Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brüx, Christian; Niefind, Karsten; Ben-David, Alon

2005-12-01

The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

Parameter analysis of a photonic crystal fiber with raised-core index profile based on effective index method

NASA Astrophysics Data System (ADS)

Seraji, Faramarz E.; Rashidi, Mahnaz; Khasheie, Vajieh

2006-08-01

Photonic crystal fibers (PCFs) with a stepped raised-core profile and one layer equally spaced holes in the cladding are analyzed. Using effective index method and considering a raised step refractive index difference between the index of the core and the effective index of the cladding, we improve the characteristic parameters such as numerical aperture and V-parameter, and reduce its bending loss to about one tenth of a conventional PCF. Implementing such a structure in PCFs may be one step forward to achieve low loss PCFs for communication applications.

SF-FDTD analysis of a predictive physical model for parallel aligned liquid crystal devices

NASA Astrophysics Data System (ADS)

Márquez, Andrés.; Francés, Jorge; Martínez, Francisco J.; Gallego, Sergi; Alvarez, Mariela L.; Calzado, Eva M.; Pascual, Inmaculada; Beléndez, Augusto

2017-08-01

Recently we demonstrated a novel and simplified model enabling to calculate the voltage dependent retardance provided by parallel aligned liquid crystal devices (PA-LCoS) for a very wide range of incidence angles and any wavelength in the visible. To our knowledge it represents the most simplified approach still showing predictive capability. Deeper insight into the physics behind the simplified model is necessary to understand if the parameters in the model are physically meaningful. Since the PA-LCoS is a black-box where we do not have information about the physical parameters of the device, we cannot perform this kind of analysis using the experimental retardance measurements. In this work we develop realistic simulations for the non-linear tilt of the liquid crystal director across the thickness of the liquid crystal layer in the PA devices. We consider these profiles to have a sine-like shape, which is a good approximation for typical ranges of applied voltage in commercial PA-LCoS microdisplays. For these simulations we develop a rigorous method based on the split-field finite difference time domain (SF-FDTD) technique which provides realistic retardance values. These values are used as the experimental measurements to which the simplified model is fitted. From this analysis we learn that the simplified model is very robust, providing unambiguous solutions when fitting its parameters. We also learn that two of the parameters in the model are physically meaningful, proving a useful reverse-engineering approach, with predictive capability, to probe into internal characteristics of the PA-LCoS device.

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Absolute configuration and crystal packing for three chiral drugs prone to spontaneous resolution: Guaifenesin, methocarbamol and mephenesin

NASA Astrophysics Data System (ADS)

Bredikhin, Alexander A.; Gubaidullin, Aidar T.; Bredikhina, Zemfira A.; Krivolapov, Dmitry B.; Pashagin, Alexander V.; Litvinov, Igor A.

2009-02-01

Popular chiral drugs, guaifenesin, methocarbamol, and mephenesin were investigated by single-crystal X-ray analysis both for enantiopure and racemic samples. The absolute configurations for all substances were established through Flack parameter method. The conglomerate-forming nature for the compounds was confirmed by equivalence of crystal characteristics of enantiopure and racemic samples. The molecular structures and crystal packing details were evaluated and compared with one another for all three investigated substances.

Optical, structural, thermal and dielectric spectroscopy characterizations of seeded melt grown 2-hydroxy biphenyl single crystal.

PubMed

Sadhasivam, S; Rajesh, Narayana Perumal

2014-09-15

Organic single crystal of 2-hydroxy biphenyl (2-HB) was grown by top seeded melt growth method. Scanning electron microscopy studies has been carried out on the surface of the grown crystals to investigate the nature of growth and defects. The crystalline perfection and lattice parameters of 2-HB has been determined by single crystal XRD analysis and it belongs to orthorhombic crystal system with space group Fdd2. The functional groups and molecular associations were confirmed by FT-IR. The optical characteristics such as cut-off and transmittance were carried out using UV-Vis-NIR spectra. Absence of absorption in the region between 320 and 1100 nm makes the grown crystal desirable to optical applications. Thermal stability of grown crystals was characterized by thermogravimetric (TGA), differential thermal analysis (DTA) and differential scanning calorimetric (DSC) analyses. Broadband dielectric studies reveals that dielectric constant of grown crystal is low. The resistivity of grown crystal was studied by impedance analysis. The second harmonic generation intensity of 3.8 mJ was studied. The grown crystal belongs to soft material studied by hardness test. Copyright © 2014 Elsevier B.V. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sathyalakshmi, R.; Bhagavannarayana, G.; Ramasamy, P.

L-(+)-Glutamic acid hydro bromide, an isomorphic salt of L-glutamic acid hydrochloride, was synthesized and the synthesis was confirmed using Fourier transform infrared analysis. Solubility of the material in water was determined. L-Glutamic acid hydro bromide crystals were grown by low temperature solution growth using the solvent evaporation technique. Single crystal X-ray diffraction studies were carried out and the cell parameters, atomic co-ordinates, bond lengths and bond angles were reported. High-resolution X-ray diffraction studies were carried out and good crystallinity for the grown crystal was observed from the diffraction curve. The grown crystals were subjected to dielectric studies. Ultraviolet-visible-near infrared spectralmore » analysis shows good optical transmission in the visible and infrared region of the grown crystals. The second harmonic generation efficiency of L-glutamic acid hydro bromide crystal was determined using the Kurtz powder test and it was found that it had efficiency comparable with that of the potassium di-hydrogen phosphate crystal.« less

Analysis of rapidly synthesized guest-filled porous complexes with synchrotron radiation: Practical guidelines for the crystalline sponge method

DOE PAGES

Ramadhar, Timothy R.; Zheng, Shao -Liang; Chen, Yu -Sheng; ...

2015-01-01

A detailed set of synthetic and crystallographic guidelines for the crystalline sponge method based upon the analysis of expediently synthesized crystal sponges using third-generation synchrotron radiation are reported. The procedure for the synthesis of the zinc-based metal–organic framework used in initial crystal sponge reports has been modified to yield competent crystals in 3 days instead of 2 weeks. These crystal sponges were tested on some small molecules, with two being unexpectedly difficult cases for analysis with in-house diffractometers in regard to data quality and proper space-group determination. These issues were easily resolved by the use of synchrotron radiation using data-collectionmore » times of less than an hour. One of these guests induced a single-crystal-to-single-crystal transformation to create a larger unit cell with over 500 non-H atoms in the asymmetric unit. This led to a non-trivial refinement scenario that afforded the best Flack x absolute stereochemical determination parameter to date for these systems. The structures did not require the use of PLATON/SQUEEZE or other solvent-masking programs, and are the highest-quality crystalline sponge systems reported to date where the results are strongly supported by the data. A set of guidelines for the entire crystallographic process were developed through these studies. In particular, the refinement guidelines include strategies to refine the host framework, locate guests and determine occupancies, discussion of the proper use of geometric and anisotropic displacement parameter restraints and constraints, and whether to perform solvent squeezing/masking. The single-crystal-to-single-crystal transformation process for the crystal sponges is also discussed. The presented general guidelines will be invaluable for researchers interested in using the crystalline sponge method at in-house diffraction or synchrotron facilities, will facilitate the collection and analysis of reliable high-quality data, and will allow construction of chemically and physically sensible models for guest structural determination.« less

Assessment of changes in crystallization properties of pressurized milk fat.

PubMed

Staniewski, Bogusław; Smoczyński, Michał; Staniewska, Katarzyna; Baranowska, Maria; Kiełczewska, Katarzyna; Zulewska, Justyna

2015-04-01

The aim of the study was to demonstrate the use of fractal image analysis as a possible tool to monitor the effect of pressurization on the crystallization pattern of anhydrous milk fat. This approach can be useful when developing new products based on milk fat. The samples were subjected to different hydrostatic pressure (100, 200, 300, and 400 MPa) and temperature (10 and 40 °C) treatments. The crystallization microphotographs were taken with a scanning electron microscope. The image analysis of scanning electron microscope photographs was done to determine a fractal dimension. Milk-fat pressurization under the applied parameters resulted in slight, but statistically significant, changes in the course of crystallization curves, related to the triacylglycerol fraction crystallizing in the lowest temperature (I exothermic effect). These changes were dependent on the value of pressure but not dependent on the temperatures applied during the process of pressurization (at either 10 or 40 °C). In turn, significant differences were observed in crystallization images of milk-fat samples subjected to this process compared with the control sample. The results of additional fractal analysis additionally demonstrated the highest degree of irregularity of the surface of the crystalline form for the nonpressurized sample and the samples pressurized at 200 and 300 MPa at 10 °C. The lowest value of fractal dimension-indicative of the least irregularity-was achieved for the fat samples pressurized at 400 MPa, 10 °C and at 100 MPa, 40 °C. The possibilities of wider application of the fractal analysis for the evaluation of effects of parameters of various technological processes on crystallization properties of milk fat require further extensive investigations. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

A view inside the nature of protein crystals

NASA Astrophysics Data System (ADS)

Oswald, R.; Pietzsch, M.; Ulrich, J.

2017-07-01

In this work a fundamental analysis of protein crystal modifications was presented to compare and confirm the components of protein crystal modifications. The result is that a protein crystal contains besides the protein, the precipitant and water. A mass spectrometer coupled to a thermogravimetry device was used to confirm the different waters (free water -the chosen buffer- and bound water) inside the crystals. Here the biggest amount of water is the free water (the buffer) with an amount of approximately 35%. The bound water (in the sense of a hydrate) has only an amount of about 1-1.5%. Furthermore, an x-ray analysis to confirm the influence range of pH value on the stability of one crystal modification for the understanding of effects on dissolution mechanism of protein crystals was investigated. The crystals of the tetragonal modification crystallized at pH 4.7, 4.85, 5.0, 5.15 and 5.3 maintain according to the x-ray measurements the same lattice parameters. The measured data are discussed.

Optical, mechanical and thermal behaviors of Nitrilotriacetic acid single crystal

NASA Astrophysics Data System (ADS)

Deepa, B.; Philominathan, P.

2017-11-01

An organic nonlinear single crystal of Nitrilotriacetic acid (NTAA) was grown for the first time by employing a simple slow evaporation technique. Single crystal X-ray diffraction (XRD) analysis reveals that the grown crystal belongs to the monoclinic system with noncentrosymmetric space group CC. Fourier transform infrared (FTIR) spectral study ascertains the presence of functional groups in NTAA. The molecular structure of the grown crystal was confirmed by Nuclear Magnetic Resonance (NMR) spectral analysis. The optical parameters such as transmittance, absorption coefficient and band gap were calculated from UV-Visible and fluorescence studies. Dielectric measurements were carried out for different frequency and temperature. The mechanical strength of the grown crystal was measured using Vickers microhardness test. The high thermal stability and the melting point of the grown crystal were also estimated using thermogravimetric (TGA) and differential thermal analyses (DTA). The confirmation of the grown crystals belonging to nonlinear optical crystals was performed by Kurtz-Perry technique and found as suitable candidate for optoelectronics applications.

Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke

2005-01-01

Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less

Study on sensing property of one-dimensional ring mirror-defect photonic crystal

NASA Astrophysics Data System (ADS)

Chen, Ying; Luo, Pei; Cao, Huiying; Zhao, Zhiyong; Zhu, Qiguang

2018-02-01

Based on the photon localization and the photonic bandgap characteristics of photonic crystals (PCs), one-dimensional (1D) ring mirror-defect photonic crystal structure is proposed. Due to the introduction of mirror structure, a defect cavity is formed in the center of the photonic crystal, and then the resonant transmission peak can be obtained in the bandgap of transmission spectrum. The transfer matrix method is used to establish the relationship model between the resonant transmission peak and the structure parameters of the photonic crystals. Using the rectangular air gate photonic crystal structure, the dynamic monitoring of the detected gas sample parameters can be achieved from the shift of the resonant transmission peak. The simulation results show that the Q-value can attain to 1739.48 and the sensitivity can attain to 1642 nm ṡ RIU-1, which demonstrates the effectiveness of the sensing structure. The structure can provide certain theoretical reference for air pollution monitoring and gas component analysis.

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis

PubMed Central

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M.; Bartlam, Mark

2016-01-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate. PMID:26919520

Purification, crystallization and X-ray crystallographic analysis of a putative exopolyphosphatase from Zymomonas mobilis.

PubMed

Zhang, Aili; Guo, Erhong; Qian, Lanfang; Tang, Nga-Yeung; Watt, Rory M; Bartlam, Mark

2016-03-01

Exopolyphosphatase (PPX) enzymes degrade inorganic polyphosphate (poly-P), which is essential for the survival of microbial cells in response to external stresses. In this study, a putative exopolyphosphatase from Zymomonas mobilis (ZmPPX) was crystallized. Crystals of the wild-type enzyme diffracted to 3.3 Å resolution and could not be optimized further. The truncation of 29 amino acids from the N-terminus resulted in crystals that diffracted to 1.8 Å resolution. The crystals belonged to space group C2, with unit-cell parameters a = 122.0, b = 47.1, c = 89.5 Å, α = γ = 90, β = 124.5°. An active-site mutant that crystallized in the same space group and with similar unit-cell parameters diffracted to 1.56 Å resolution. One molecule was identified per asymmetric unit. Analytical ultracentrifugation confirmed that ZmPPX forms a dimer in solution. It was confirmed that ZmPPX possesses exopolyphosphatase activity against a synthetic poly-P substrate.

Variation of yield loci in finite element analysis by considering texture evolution for AA5042 aluminum sheets

NASA Astrophysics Data System (ADS)

Yoon, Jonghun; Kim, Kyungjin; Yoon, Jeong Whan

2013-12-01

Yield function has various material parameters that describe how materials respond plastically in given conditions. However, a significant number of mechanical tests are required to identify the many material parameters for yield function. In this study, an effective method using crystal plasticity through a virtual experiment is introduced to develop the anisotropic yield function for AA5042. The crystal plasticity approach was used to predict the anisotropic response of the material in order to consider a number of stress or strain modes that would not otherwise be evident through mechanical testing. A rate-independent crystal plasticity model based on a smooth single crystal yield surface, which removes the innate ambiguity problem within the rate-independent model and Taylor model for polycrystalline deformation behavior were employed to predict the material's response in the balanced biaxial stress, pure shear, and plane strain states to identify the parameters for the anisotropic yield function of AA5042.

Disorder-induced losses in photonic crystal waveguides with line defects.

PubMed

Gerace, Dario; Andreani, Lucio Claudio

2004-08-15

A numerical analysis of extrinsic diffraction losses in two-dimensional photonic crystal slabs with line defects is reported. To model disorder, a Gaussian distribution of hole radii in the triangular lattice of airholes is assumed. The extrinsic losses below the light line increase quadratically with the disorder parameter, decrease slightly with increasing core thickness, and depend weakly on the hole radius. For typical values of the disorder parameter the calculated loss values of guided modes below the light line compare favorably with available experimental results.

Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

2007-09-01

A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

Analysis of intrinsic optical bistability in Tm-doped laser-related crystals

NASA Astrophysics Data System (ADS)

Noginov, M. A.; Vondrova, M.; Casimir, D.

2003-11-01

We predict and theoretically study intrinsic optical bistability (IOB) mediated by nonlinear energy transfer processes in rare-earth-doped laser-related crystals. In particular, we investigate Tm-Ho and Tm-Yb systems, in which avalanche pumping is overimposed by energy transfer up-conversion. We predict that IOB can be experimentally observed in (Tm,Yb):BaY2F8 crystals in a wide range of experimentally achievable parameters.

Crystal structure, spectral, thermal and dielectric studies of a new zinc benzoate single crystal

NASA Astrophysics Data System (ADS)

Bijini, B. R.; Prasanna, S.; Deepa, M.; Nair, C. M. K.; Rajendra Babu, K.

2012-11-01

Single crystals of zinc benzoate with a novel structure were grown in gel media. Sodium metasilicate of gel density 1.04 g/cc at pH 6 was employed to yield transparent single crystals. The crystal structure of the compound was ascertained by single crystal X-ray diffractometry. It was noted that the crystal belongs to monoclinic system with space group P21/c with unit cell parameters a = 10.669(1) Å, b = 12.995(5) Å, c = 19.119(3) Å, and β = 94.926(3)°. The crystal was seen to possess a linear polymeric structure along b-axis; with no presence of coordinated or lattice water. CHN analysis established the stoichiometric composition of the crystal. The existence of functional groups present in the single crystal system was confirmed by FT-IR studies. The thermal characteristic of the sample was analysed by TGA-DTA techniques, and the sample was found to be thermally stable up to 280 °C. The kinetic and thermodynamic parameters were also determined. UV-Vis spectroscopy corroborated the transparency of the crystal and revealed the optical band gap to be 4 eV. Dielectric studies showed decrease in the dielectric constant of the sample with increase in frequency.

X-ray diffraction analysis of LiCu2O2 crystals with additives of silver atoms

NASA Astrophysics Data System (ADS)

Sirotinkin, V. P.; Bush, A. A.; Kamentsev, K. E.; Dau, H. S.; Yakovlev, K. A.; Tishchenko, E. A.

2015-09-01

Silver-containing LiCu2O2 crystals up to 4 × 8 × 8 mm in size were grown by the crystallization of 80(1- x)CuO · 20 x AgNO3 · 20Li2CO3 (0 ≤ х ≤ 0.5) mixture melt. According to the X-ray spectral and Rietveld X-ray diffraction data, the maximum amount of silver incorporated in the LiCu2O2 structure is about 4 at % relative to the copper content. It was established that silver atoms occupy statistically crystallographic positions of lithium atoms. The incorporation of silver atoms is accompanied by a noticeable increase in parameter с of the LiCu2O2 rhombic unit cell, a slight increase in parameter а, and a slight decrease in parameter b.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

PubMed

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-05-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

Crystallization and preliminary X-ray diffraction analysis of West Nile virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

2010-05-25

West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

Growth and characterization of diammonium copper disulphate hexahydrate single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Siva Sankari, R.; Perumal, Rajesh Narayana, E-mail: r.shankarisai@gmail.com

2014-03-01

Graphical abstract: Diammonium copper disulphate hexahydrate (DACS) is one of the most promising inorganic dielectric crystals with exceptional mechanical properties. Good quality crystals of DACS were grown by using solution method in a period of 30 days. The grown crystals were subjected to single crystal X-ray diffraction analysis in order to establish their crystalline nature. Thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis were performed for the crystal. Several solid state physical parameters have been determined for the grown crystals. The dielectric constant and the dielectric loss and AC conductivity of the grown crystal were studied as a functionmore » of frequency and temperature has been calculated and plotted. - Highlights: • Diammonium copper disulphate is grown for the first time and CCDC number obtained. • Thermal analysis is done to see the stability range of the crystals. • Band gap and UV cut off wavelength of the crystal are determined to be 2.4 eV and 472.86 nm, respectively. • Dielectric constant, dielectric loss and AC conductivity are plotted as a function of applied field. - Abstract: Diammonium copper disulphate hexahydrate is one of the most promising inorganic crystals with exceptional dielectric properties. A good quality crystal was harvested in a 30-day period using solution growth method. The grown crystal was subjected to various characterization techniques like single crystal X-ray diffraction analysis, thermo gravimetric, differential thermal analysis, FTIR, and UV–vis–NIR analysis. Unit cell dimensions of the grown crystal have been identified from XRD studies. Functional groups of the title compounds have been identified from FTIR studies. Thermal stability of the samples was checked by TG/DTA studies. Band gap of the crystal was calculated. The dielectric constant and dielectric loss were studied as a function of frequency of the applied field. AC conductivity was plotted as a function of temperature.« less

Crystal growth, structural, optical, dielectric and thermal studies of an amino acid based organic NLO material: L-Phenylalanine L-phenylalaninium malonate

NASA Astrophysics Data System (ADS)

Prakash, M.; Geetha, D.; Lydia Caroline, M.; Ramesh, P. S.

2011-12-01

Good transparent single crystals of L-phenylalanine L-phenylalaninium malonate (LPPMA) have been grown successfully by slow evaporation technique from aqueous solution. Single crystal X-ray diffractometer was utilized to measure unit cell parameter and to confirm the crystal structure. The chemical structure of compound was established by FT-NMR technique. The vibrational modes of the molecules of elucidated from FTIR spectra. Its optical behaviour has been examined by UV-vis spectral analysis, which shows the absence of absorbance in the visible region. Thermal properties of the LPPMA crystal were carried out by thermo gravimetric analysis (TGA) and differential thermal analysis (DTA) techniques, which indicate that the material does not decompose before melting. The melting point of grown crystal was observed as 180 °C by melting point apparatus. The NLO property was confirmed by the powder technique of Kurtz and Perry. The dielectric behaviour of the sample was also studied for the first time.

Solid-state reaction kinetics of neodymium doped magnesium hydrogen phosphate system

NASA Astrophysics Data System (ADS)

Gupta, Rashmi; Slathia, Goldy; Bamzai, K. K.

2018-05-01

Neodymium doped magnesium hydrogen phosphate (NdMHP) crystals were grown by using gel encapsulation technique. Structural characterization of the grown crystals has been carried out by single crystal X-ray diffraction (XRD) and it revealed that NdMHP crystals crystallize in orthorhombic crystal system with space group Pbca. Kinetics of the decomposition of the grown crystals has been studied by non-isothermal analysis. The estimation of decomposition temperatures and weight loss has been made from the thermogravimetric/differential thermo analytical (TG/DTA) in conjuncture with DSC studies. The various steps involved in the thermal decomposition of the material have been analysed using Horowitz-Metzger, Coats-Redfern and Piloyan-Novikova equations for evaluating various kinetic parameters.

A facile approach towards synthesis, characterization, single crystal structure, and DFT study of 5-bromosalicylalcohol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastogi, Rupali, E-mail: rastogirupali@ymail.com; Tarannum, Nazia; Butcher, R. J.

2016-03-15

5-Bromosalicylalcohol was prepared by the interaction of NaBH{sub 4} and 5-bromosalicylaldehyde. The use of sodium borohydride makes the reaction easy, facile, economic and does not require any toxic catalyst. The compound is characterized by FTIR, {sup 1}H NMR, {sup 13}C NMR, TEM and ESI-mass spectra. Crystal structure is determined by single crystal X-ray analysis. Quantum mechanical calculations of geometries, energies and thermodynamic parameters are carried out using density functional theory (DFT/B3LYP) method with 6-311G(d,p) basis set. The optimized geometrical parameters obtained by B3LYP method show good agreement with experimental data.

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

On the morphological and chemical stability of vitamin C crystals

NASA Astrophysics Data System (ADS)

Halász, Susan; Bodor, Beáta

1993-03-01

Mass cooling crystallization of aqueous vitamin C solution was studied by applying different cooling rates, initial supersaturations and mixing intensity. The morphology of the products (size, habit and colour) well followed the changes of process parameters. Comparing a high purity (99.9%) standard with a yellow coloured heterodisperse product and a slowly grown single crystal, HPLC chromatography detected decreasing purity of the bigger single crystals, while X-ray and NMR analysis did not show any perceptible difference. It has been concluded that not the surface oxidation (chemical degredation), but rather the inclusions are the main sources of impurities within the crystals.

Crystal growth and characterization of semi organic nonlinear optical (NLO) piperazinium tetrachlorozincate monohydrate (PTCZ) single crystal

NASA Astrophysics Data System (ADS)

Karuppasamy, P.; Pandian, Muthu Senthil; Ramasamy, P.

2018-04-01

The semi-organic single crystal of piperazinium tetrachlorozincate monohydrate (PTCZ) was successfully grown by slow evaporation solution technique (SEST). The grown crystal was subjected to the single crystal XRD studies for confirming the unit cell parameters. The optical quality of the grown crystal was identified by the UV-Vis NIR spectrum analysis and the optical band gap energy was calculated. The photoconductivity study reveals that the grown crystal has positive photoconductive nature. The mechanical stability of the grown crystal was analyzed using Vickers microhardness analyzer. The third-order nonlinear optical properties such as nonlinear refractive index (n2), absorption co-efficient (β) and susceptibility (χ(3)) were studied by Z-scan technique at 640 nm using solid state laser.

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Crystallization and preliminary crystallographic analysis of calcium-binding protein-2 from Entamoeba histolytica and its complexes with strontium and the IQ1 motif of myosin V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gourinath, S., E-mail: sgourinath@mail.jnu.ac.in; Padhan, Narendra; Alam, Neelima

2005-04-01

Calcium-binding protein-2 (EhCaBP2) crystals were grown using MPD as a precipitant. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. Calcium plays a pivotal role in the pathogenesis of amoebiasis, a major disease caused by Entamoeba histolytica. Two domains with four canonical EF-hand-containing calcium-binding proteins (CaBPs) have been identified from E. histolytica. Even though they have very high sequence similarity, these bind to different target proteins in a Ca{sup 2+}-dependent manner, leading to different functional pathways. Calcium-binding protein-2 (EhCaBP2) crystals were grown usingmore » MPD as a precipitant. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 111.74, b = 68.83, c = 113.25 Å, β = 116.7°. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 69.18, b = 112.03, c = 93.42 Å, β = 92.8°. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. This complex was crystallized with MPD and ethanol as precipitating agents. These crystals belong to space group P2{sub 1}, with unit-cell parameters a = 60.5, b = 69.86, c = 86.5 Å, β = 97.9°.« less

Investigations on structural, optical, electrical, mechanical and third-order nonlinear behaviour of 3-aminopyridinium 2,4-dinitrophenolate single crystal

NASA Astrophysics Data System (ADS)

Mohanbabu, B.; Bharathikannan, R.; Siva, G.

2017-10-01

The single crystals of 3-aminopyridinium 2,4-dinitrophenolate (APDP) have been synthesized and grown by slow evaporation technique at room temperature. The crystal system was identified and lattice dimensions were measured from the single-crystal X-ray diffraction (SXRD) analysis. UV-visible absorption and transmittance spectra have been recorded in the region between 250 and 1100 nm. The different vibrational modes of the molecule were studied by Fourier transform infrared (FTIR) spectroscopic analysis. The decreasing tendency of dielectric constant with increasing frequency was analysed in dielectric study. The polarizability value calculated using Penn analysis well agrees with the value calculated using Clausius-Mossotti equation. The photoconductivity and photoluminescence behaviour were also studied on grown APDP crystal. The mechanical strength of the crystal has been studied using a Vickers' microhardness test. The stiffness constant and yield strength of the crystal were also calculated from the microhardness test. The third-order nonlinear optical parameters such as refractive index, absorption coefficient and third-order susceptibility were estimated by Z-scan studies.

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

Validation of experimental molecular crystal structures with dispersion-corrected density functional theory calculations.

PubMed

van de Streek, Jacco; Neumann, Marcus A

2010-10-01

This paper describes the validation of a dispersion-corrected density functional theory (d-DFT) method for the purpose of assessing the correctness of experimental organic crystal structures and enhancing the information content of purely experimental data. 241 experimental organic crystal structures from the August 2008 issue of Acta Cryst. Section E were energy-minimized in full, including unit-cell parameters. The differences between the experimental and the minimized crystal structures were subjected to statistical analysis. The r.m.s. Cartesian displacement excluding H atoms upon energy minimization with flexible unit-cell parameters is selected as a pertinent indicator of the correctness of a crystal structure. All 241 experimental crystal structures are reproduced very well: the average r.m.s. Cartesian displacement for the 241 crystal structures, including 16 disordered structures, is only 0.095 Å (0.084 Å for the 225 ordered structures). R.m.s. Cartesian displacements above 0.25 A either indicate incorrect experimental crystal structures or reveal interesting structural features such as exceptionally large temperature effects, incorrectly modelled disorder or symmetry breaking H atoms. After validation, the method is applied to nine examples that are known to be ambiguous or subtly incorrect.

Effect of Slag Composition on the Crystallization Kinetics of Synthetic CaO-SiO2-Al2O3-MgO Slags

NASA Astrophysics Data System (ADS)

Esfahani, Shaghayegh; Barati, Mansoor

2018-04-01

The crystallization kinetics of CaO-SiO2-Al2O3-MgO (CSAM) slags was studied with the aid of single hot thermocouple technique (SHTT). Kinetic parameters such as the Avrami exponent ( n), rate coefficient ( K), and effective activation energy of crystallization ( E A ) were obtained by kinetic analysis of data obtained from in situ observation of glassy to crystalline transformation and image analysis. Also, the dependence of nucleation and growth rates of crystalline phases were quantified as a function of time, temperature, and slag basicity. Together with the observations of crystallization front, they facilitated establishing the dominant mechanisms of crystallization. In an attempt to predict crystallization rate under non-isothermal conditions, a mathematical model was developed that employs the rate data of isothermal transformation. The model was validated by reproducing an experimental continuous cooling transformation diagram purely from isothermal data.

Estimation of kinetics parameters for the adsorption of human serum albumin onto hydroxyapatite-modified silver electrodes by piezoelectric quartz crystal impedance analysis.

PubMed

Tian, Lu; Wei, Wan-Zhi; Mao, You-An

2004-04-01

The adsorption of human serum albumin onto hydroxyapatite-modified silver electrodes has been in situ investigated by utilizing the piezoelectric quartz crystal impedance technique. The changes of equivalent circuit parameters were used to interpret the adsorption process. A kinetic model of two consecutive steps was derived to describe the process and compared with a first-order kinetic model by using residual analysis. The experimental data of frequency shift fitted to the model and kinetics parameters, k1, k2, psi1, psi2 and qr, were obtained. All fitted results were in reasonable agreement with the corresponding experimental results. Two adsorption constants (7.19 kJ mol(-1) and 22.89 kJ mol(-1)) were calculated according to the Arrhenius formula.

Q-space analysis of light scattering by ice crystals

NASA Astrophysics Data System (ADS)

Heinson, Yuli W.; Maughan, Justin B.; Ding, Jiachen; Chakrabarti, Amitabha; Yang, Ping; Sorensen, Christopher M.

2016-12-01

Q-space analysis is applied to extensive simulations of the single-scattering properties of ice crystals with various habits/shapes over a range of sizes. The analysis uncovers features common to all the shapes: a forward scattering regime with intensity quantitatively related to the Rayleigh scattering by the particle and the internal coupling parameter, followed by a Guinier regime dependent upon the particle size, a complex power law regime with incipient two dimensional diffraction effects, and, in some cases, an enhanced backscattering regime. The effects of significant absorption on the scattering profile are also studied. The overall features found for the ice crystals are similar to features in scattering from same sized spheres.

Optical and dielectric studies of KH2PO4 crystal influenced by organic ligand of citric acid and L-valine: A single crystal growth and comparative study

NASA Astrophysics Data System (ADS)

Anis, Mohd; Hakeem, D. A.; Muley, G. G.

In the present study pure, citric acid (CA) and L-valine (LV) doped potassium dihydrogen phosphate (KDP) crystals have been grown with the aim to investigate the nonlinear optical applications facilitated by UV-visible, third order nonlinear optical (TONLO) and dielectric properties. The structural parameters of grown crystals have been confirmed by single crystal X-ray diffraction analysis. The enhancement in optical transparency of KDP crystal due to addition of CA and LV has been examined within 200-900 nm by means of UV-visible spectral analysis. In addition, the transmittance data have been used to evaluate the effect of dopants on reflectance, refractive index and extinction coefficient of grown crystals in the visible region. The Z-scan analysis has been performed at 632.8 nm to identify the nature of photoinduced nonlinear refraction and nonlinear absorption in doped KDP crystals. The influence of π-bonded ligand of dopant CA and LV on TONLO susceptibility (χ3), refractive index (n2) and absorption coefficient (β) of KDP crystals has been evaluated to discuss laser assisted device applications. The decrease in dielectric constant and dielectric loss of KDP crystal due to addition of CA and LV has been explored using the temperature dependent dielectric studies.

X-ray diffraction analysis of LiCu{sub 2}O{sub 2} crystals with additives of silver atoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirotinkin, V. P., E-mail: irotinkin.vladimir@mail.ru; Bush, A. A.; Kamentsev, K. E.

2015-09-15

Silver-containing LiCu{sub 2}O{sub 2} crystals up to 4 × 8 × 8 mm in size were grown by the crystallization of 80(1-x)CuO · 20{sub x}AgNO{sub 3} · 20Li{sub 2}CO{sub 3} (0 ≤ x ≤ 0.5) mixture melt. According to the X-ray spectral and Rietveld X-ray diffraction data, the maximum amount of silver incorporated in the LiCu{sub 2}O{sub 2} structure is about 4 at % relative to the copper content. It was established that silver atoms occupy statistically crystallographic positions of lithium atoms. The incorporation of silver atoms is accompanied by a noticeable increase in parameter c of the LiCu{sub 2}O{submore » 2} rhombic unit cell, a slight increase in parameter a, and a slight decrease in parameter b.« less

Growth and spectroscopic, thermodynamic and nonlinear optical studies of L-threonine phthalate crystal

NASA Astrophysics Data System (ADS)

Theras, J. Elberin Mary; Kalaivani, D.; Jayaraman, D.; Joseph, V.

2015-10-01

L-threonine phthalate (LTP) single crystal has been grown using a solution growth technique at room temperature. Single crystal X-ray diffraction analysis reveals that LTP crystallizes in monoclinic crystal system with space group C2/c. The optical absorption studies show that the crystal is transparent in the entire visible region with a cut-off wavelength 309 nm. The optical band gap is found to be 4.05 eV. The functional groups of the synthesized compound have been identified by FTIR spectral analysis. The functional groups present in the material were also confirmed by FT-RAMAN spectroscopy. Surface morphology and the presence of various elements were studied by SEM-EDAX analysis. The thermal stability of LTP single crystal has been analyzed by TGA/DTA studies. The thermodynamic parameters such as activation energy, entropy, enthalpy and Gibbs free energy were determined for the grown material using TG data and Coats-Redfern relation. Since the grown crystal is centrosymmetric, Z-Scan studies were carried out for analyzing the third order nonlinear optical property. The nonlinear absorption coefficient, nonlinear refractive index and susceptibility have been measured using Z-Scan technique.

Angular overlap model analysis of the D 2d crystal field effect in uranium (4+) compounds

NASA Astrophysics Data System (ADS)

Gajek, Z.; Hubert, S.; Krupa, J. C.

1988-12-01

Recent interpretations of the D 2d crystal field of U 4+ in β-ThCl 4, α, β-ThBr 4, ThSiO 4 and UCl 4 are discussed in terms of the simplified one-, two- and three-parameter versions of the Angular Overlap Model which are shown to be a handy tool in a trial interpretation of the effect. The variation of the CF parameters with a small D 2 distortion of the coordination is well reproduced by the model.

Multiphysical simulation analysis of the dislocation structure in germanium single crystals

NASA Astrophysics Data System (ADS)

Podkopaev, O. I.; Artemyev, V. V.; Smirnov, A. D.; Mamedov, V. M.; Sid'ko, A. P.; Kalaev, V. V.; Kravtsova, E. D.; Shimanskii, A. F.

2016-09-01

To grow high-quality germanium crystals is one of the most important problems of growth industry. The dislocation density is an important parameter of the quality of single crystals. The dislocation densities in germanium crystals 100 mm in diameter, which have various shapes of the side surface and are grown by the Czochralski technique, are experimentally measured. The crystal growth is numerically simulated using heat-transfer and hydrodynamics models and the Alexander-Haasen dislocation model in terms of the CGSim software package. A comparison of the experimental and calculated dislocation densities shows that the dislocation model can be applied to study lattice defects in germanium crystals and to improve their quality.

Site selectivity on chalcogen atoms in superconducting La(O,F)BiSSe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Masashi, E-mail: Tanaka.Masashi@nims.go.jp; Matsushita, Yoshitaka; Fujioka, Masaya

2015-03-16

Single crystals of La(O,F)BiSSe were grown by using a CsCl flux method. Single crystal X-ray structural analysis reveals that the crystal structure is isostructural to the BiS{sub 2}- or BiSe{sub 2}-based compounds crystallizing with space group P4/nmm (lattice parameters a = 4.1110(2) Å, c = 13.6010(7) Å). However, the S atoms are selectively occupied at the apical site of the Bi-SSe pyramids in the superconducting layer. The single crystals show a superconducting transition at around 4.2 K in the magnetic susceptibility and resistivity measurements. The superconducting anisotropic parameter is determined to be 34–35 from its upper critical magnetic field. The anisotropy is in the same range withmore » that of other members of the La(O,F)BiCh{sub 2} (Ch = S, Se) family under ambient pressure.« less

Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

1999-01-01

Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

Crystallization and preliminary X-ray crystallographic analysis of carboxyl-terminal region 4 of SigR from Streptomyces coelicolor A3(2)

PubMed Central

Kim, Keon Young; Kim, Sunmin; Park, Jeong Kuk; Song, HyoJin; Park, SangYoun

2014-01-01

Full-length SigR from Streptomyces coelicolor A3(2) was overexpressed in Escherichia coli, purified and submitted to crystallization trials using either polyethylene glycol 3350 or 4000 as a precipitant. X-ray diffraction data were collected to 2.60 Å resolution under cryoconditions using synchrotron X-rays. The crystal packs in space group P43212, with unit-cell parameters a = b = 42.14, c = 102.02 Å. According to the Matthews coefficient, the crystal asymmetric unit cannot contain the full-length protein. Molecular replacement with the known structures of region 2 and region 4 as independent search models indicates that the crystal contains only the −35 element-binding carboxyl-terminal region 4 of full-length SigR. Mass-spectrometric analysis of the harvested crystal confirms this, suggesting a crystal volume per protein weight (V M) of 2.24 Å3 Da−1 and 45.1% solvent content. PMID:24915084

Expression, limited proteolysis and preliminary crystallographic analysis of IpaD, a component of the Shigella flexneri type III secretion system

PubMed Central

Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E.; Birket, Susan; Picking, William D.; Blocker, Ariel; Picking, Wendy L.; Lea, Susan M.

2006-01-01

IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P212121, with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 Å, and data were collected to 2.9 Å resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 Å resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 Å, β = 107.9°. An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit. PMID:16946465

Expression, limited proteolysis and preliminary crystallographic analysis of IpaD, a component of the Shigella flexneri type III secretion system.

PubMed

Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E; Birket, Susan; Picking, William D; Blocker, Ariel; Picking, Wendy L; Lea, Susan M

2006-09-01

IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P2(1)2(1)2(1), with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 A, and data were collected to 2.9 A resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 A resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 A, beta = 107.9 degrees . An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramadhar, Timothy R.; Zheng, Shao -Liang; Chen, Yu -Sheng

A detailed set of synthetic and crystallographic guidelines for the crystalline sponge method based upon the analysis of expediently synthesized crystal sponges using third-generation synchrotron radiation are reported. The procedure for the synthesis of the zinc-based metal–organic framework used in initial crystal sponge reports has been modified to yield competent crystals in 3 days instead of 2 weeks. These crystal sponges were tested on some small molecules, with two being unexpectedly difficult cases for analysis with in-house diffractometers in regard to data quality and proper space-group determination. These issues were easily resolved by the use of synchrotron radiation using data-collectionmore » times of less than an hour. One of these guests induced a single-crystal-to-single-crystal transformation to create a larger unit cell with over 500 non-H atoms in the asymmetric unit. This led to a non-trivial refinement scenario that afforded the best Flack x absolute stereochemical determination parameter to date for these systems. The structures did not require the use of PLATON/SQUEEZE or other solvent-masking programs, and are the highest-quality crystalline sponge systems reported to date where the results are strongly supported by the data. A set of guidelines for the entire crystallographic process were developed through these studies. In particular, the refinement guidelines include strategies to refine the host framework, locate guests and determine occupancies, discussion of the proper use of geometric and anisotropic displacement parameter restraints and constraints, and whether to perform solvent squeezing/masking. The single-crystal-to-single-crystal transformation process for the crystal sponges is also discussed. The presented general guidelines will be invaluable for researchers interested in using the crystalline sponge method at in-house diffraction or synchrotron facilities, will facilitate the collection and analysis of reliable high-quality data, and will allow construction of chemically and physically sensible models for guest structural determination.« less

Sb2Te3 and Its Superlattices: Optimization by Statistical Design.

PubMed

Behera, Jitendra K; Zhou, Xilin; Ranjan, Alok; Simpson, Robert E

2018-05-02

The objective of this work is to demonstrate the usefulness of fractional factorial design for optimizing the crystal quality of chalcogenide van der Waals (vdW) crystals. We statistically analyze the growth parameters of highly c axis oriented Sb 2 Te 3 crystals and Sb 2 Te 3 -GeTe phase change vdW heterostructured superlattices. The statistical significance of the growth parameters of temperature, pressure, power, buffer materials, and buffer layer thickness was found by fractional factorial design and response surface analysis. Temperature, pressure, power, and their second-order interactions are the major factors that significantly influence the quality of the crystals. Additionally, using tungsten rather than molybdenum as a buffer layer significantly enhances the crystal quality. Fractional factorial design minimizes the number of experiments that are necessary to find the optimal growth conditions, resulting in an order of magnitude improvement in the crystal quality. We highlight that statistical design of experiment methods, which is more commonly used in product design, should be considered more broadly by those designing and optimizing materials.

Rocking curve imaging of high quality sapphire crystals in backscattering geometry

DOE PAGES

Jafari, A.; European Synchrotron Radiation Facility; Univ. of Liege,; ...

2017-01-23

Here, we report on the characterization of high quality sapphire single crystals suitable for high-resolution X-ray optics at high energy. Investigations using rocking curve imaging reveal the crystals to be of uniformly good quality at the level of ~10 -4 in lattice parameter variations, deltad/d. But, investigations using backscattering rocking curve imaging with lattice spacing resolution of deltad/d ~ 5.10 -8 shows very diverse quality maps for all crystals. Our results highlight nearly ideal areas with edge length of 0.2-0.5 mm in most crystals, but a comparison of the back re ection peak positions shows that even neighboring ideal areasmore » exhibit a relative difference in the lattice parameters on the order of deltad/d = 10-20.10 -8; this is several times larger than the rocking curve width. Furthermore, the stress-strain analysis suggests that an extremely stringent limit on the strain at a level of ~100 kPa in the growth process is required in order to produce crystals with large areas of the quality required for X-ray optics at high energy.« less

Crystal growth and characterization of semi-organic 2-amino-5-nitropyridinium bromide (2A5NPBr) single crystals for third-order nonlinear optical (NLO) applications

NASA Astrophysics Data System (ADS)

Vediyappan, Sivasubramani; Arumugam, Raja; Pichan, Karuppasamy; Kasthuri, Ramachandran; Muthu, Senthil Pandian; Perumal, Ramasamy

2017-12-01

Semi-organic nonlinear optical (NLO) 2-amino-5-nitropyridinium bromide (2A5NPBr) single crystals have been grown by slow evaporation solution technique (SEST) with the growth period of 60 days. The single-crystal XRD analysis confirms the unit cell parameters of the grown crystal. The crystallinity of grown 2A5NPBr was analyzed by powder X-ray diffraction (PXRD) measurement. The presence of functional groups of 2A5NPBr crystal was confirmed by Fourier transform infrared (FTIR) spectrum analysis. The optical transmittance of the grown crystal was analyzed by UV-Vis-NIR analysis. It shows good transparency in the visible and NIR region and it is favorable for nonlinear optical (NLO) device applications. The chemical etching study was carried out and it reveals that the grown crystal has less dislocation density. The photoconductivity study reveals that the grown crystal possesses positive photoconductive nature. The thermal stability of the crystal has been investigated by thermogravimetric (TG) and differential thermal analysis (DTA). The dielectric constant and dielectric loss as a function of frequency were measured. The electronic polarizability (α) of 2A5NPBr molecule has been calculated theoretically by different ways such as Penn analysis, Clausius-Mossotti relation, Lorentz-Lorenz equation, optical bandgap, and coupled dipole method (CDM). The obtained values of electronic polarizability (α) are in good agreement with each other. Laser damage threshold (LDT) of 2A5NPBr crystal has been measured using Nd:YAG laser with the wavelength of 1064 nm. Third-order nonlinear optical property of the grown crystal was studied by Z-scan technique using He-Ne laser of wavelength 632.8 nm.

Crystallization and X-ray diffraction analysis of the RNA primer/promoter-binding domain of influenza A virus RNA-dependent RNA polymerase PB2

PubMed Central

Kuzuhara, Takashi; Kise, Daisuke; Yoshida, Hiroko; Horita, Takahiro; Murazaki, Yoshimi; Utsunomiya, Hiroko; Tsuge, Hideaki

2009-01-01

The C-terminal domain protein (amino-acid residues 535–759) of the PB2 subunit of the RNA-dependent RNA polymerase from the highly pathogenic influenza A virus was expressed as a soluble protein in Escherichia coli and crystallized using sodium formate as a precipitant. Data sets were collected from crystals of native and selenomethionine-substituted protein on the KEK NW12 beamline at the Photon Factory and the crystals diffracted to a maximum resolution of 2.44 Å for the SeMet-derivative crystal. The native crystals were found to belong to space group P3221, with unit-cell parameters a = b = 52.5, c = 156.3 Å. The Matthews value (V M) was 2.7 Å3 Da−1, assuming the presence of one molecule in the asymmetric unit. The SeMet-derivative crystals were found to belong to the same space group, with unit-cell parameters a = b = 52.6, c = 156.4 Å. Attempts are being made to solve the structure by multi-wavelength anomalous dispersion phasing. PMID:19194006

Growth and spectral properties of Tm:BaY2F8 crystals with different Tm3+ concentration

NASA Astrophysics Data System (ADS)

Liu, Wang; Li, Chun; Xu, Jialin; Zhou, Yao; Xie, Huishuang; Gao, Meiling; Yin, Ru; Zheng, Dongyang; Lin, Hai; Liu, Jinghe; Zeng, Fanming

2016-01-01

Tm3+:BaY2F8 (Tm:BYF) laser crystals with different doping concentrations were successfully grown by Czochralski method. The optimal growth parameters obtained are as follows: the pulling rate is 0.5 mm/h; the rotation speed is 5 rpm; the cooling rate is 10°C/h. Phase composition, absorption spectra, and fluorescence properties of crystals were studied by XRD and spectral methods. XRD analysis indicates that the crystal belongs to monoclinic system with the C2/ m space group. The lattice parameters were calculated and the anisotropy of the crystals was studied, confirming that the a axis is the best growth direction. The absorption peaks around 790 nm became larger with increase of Tm3+ concentration. The cross section of 15% Tm:BYF crystal around 791 nm is 9.47 × 10-21 cm2. The 10% Tm:BYF crystal has the strongest emission peak around 1879.6 nm with the FWHM of 79 nm and the emission cross-section of 2.13 × 10-21 cm2, which is favorable for the 1.88 μm laser output.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

PubMed Central

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-01-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260

NMR signal analysis to attribute the components to the solid/liquid phases present in mixes and ice creams.

PubMed

Mariette, François; Lucas, Tiphaine

2005-03-09

The NMR relaxation signals from complex products such as ice cream are hard to interpret because of the multiexponential behavior of the relaxation signal and the difficulty of attributing the NMR relaxation components to specific molecule fractions. An attribution of the NMR relaxation parameters is proposed, however, based on an approach that combines quantitative analysis of the spin-spin and spin-lattice relaxation times and the signal intensities with characterization of the ice cream components. We have been able to show that NMR can be used to describe the crystallized and liquid phases separately. The first component of the spin-spin and spin-lattice relaxation describes the behavior of the protons of the crystallized fat in the mix. The amount of fat crystals can then be estimated. In the case of ice cream, only the spin-lattice relaxation signal from the crystallized fraction is relevant. However, it enables the ice protons and the protons of the crystallized fat to be distinguished. The spin-lattice relaxation time can be used to describe the mobility of the protons in the different crystallized phases and also to quantify the amount of ice crystals and fat crystals in the ice cream. The NMR relaxation of the liquid phase of the mix has a biexponential behavior. A first component is attributable to the liquid fraction of the fat and to the sugars, while a second component is attributable to the aqueous phase. Overall, the study shows that despite the complexity of the NMR signal from ice cream, a number of relevant parameters can be extracted to study the influence of the formulation and of the process stages on the ice fraction, the crystallized fat fraction, and the liquid aqueous fraction.

Optical, Fluorescence with quantum analysis of hydrazine (1, 3- Dinitro Phenyl) by DFT and Ab initio approach

NASA Astrophysics Data System (ADS)

Cecily Mary Glory, D.; Sambathkumar, K.; Madivanane, R.; Velmurugan, G.; Gayathri, R.; Nithiyanantham, S.; Venkatachalapathy, M.; Rajkamal, N.

2018-07-01

Experimental and computational study of molecular structure, vibrational and UV-spectral analysis of Hydrazine (1, 3- Dinitrophenyl) (HDP) derivatives. The crystal was grown by slow cooling method and the crystalline perfection of single crystals was evaluated by high resolution X-ray diffractometry (HRXRD) using a multicrystal X-ray diffractometer. Fluorescence, FT-IR and FT-Raman spectra of HDP crystal were recorded. The assignments of the vibrational spectra have been carried out with the help of normal co-ordinate analysis (NCA) followed by scaled quantum force field methodology (SQMFF). NMR studies have confirmed respectively the crystal structure and functional groups of the grown crystal. The energy and oscillator strength calculated by Time-Dependent Density Functional Theory (TD-DFT) result complements the experimental findings. The calculated MESP, UV, HOMO-LUMO energies show that charge transfer done within the molecule. And various thermodynamic parameters are studied. Fukui determines the local reactive site of electrophilic, nucleophilic, descriptor.

Crystal growth, structural, optical, dielectric and thermal studies of an amino acid based organic NLO material: L-phenylalanine L-phenylalaninium malonate.

PubMed

Prakash, M; Geetha, D; Caroline, M Lydia; Ramesh, P S

2011-12-01

Good transparent single crystals of L-phenylalanine L-phenylalaninium malonate (LPPMA) have been grown successfully by slow evaporation technique from aqueous solution. Single crystal X-ray diffractometer was utilized to measure unit cell parameter and to confirm the crystal structure. The chemical structure of compound was established by FT-NMR technique. The vibrational modes of the molecules of elucidated from FTIR spectra. Its optical behaviour has been examined by UV-vis spectral analysis, which shows the absence of absorbance in the visible region. Thermal properties of the LPPMA crystal were carried out by thermo gravimetric analysis (TGA) and differential thermal analysis (DTA) techniques, which indicate that the material does not decompose before melting. The melting point of grown crystal was observed as 180°C by melting point apparatus. The NLO property was confirmed by the powder technique of Kurtz and Perry. The dielectric behaviour of the sample was also studied for the first time. Copyright © 2011 Elsevier B.V. All rights reserved.

Crystallization and preliminary X-ray analysis of pyruvate kinase from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suzuki, Kenichiro; Ito, Sohei; Shimizu-Ibuka, Akiko

2005-08-01

This report describes the crystallization and X-ray diffraction data collection of three types (wild-type, W416F/V435W and C9S/C268S) of B. stearothermophilus. Crystals of C9S/C268S belonged to space group P6{sub 2}22 and diffracted to a resolution of 2.4 Å. Pyruvate kinase (PK) from a moderate thermophile, Bacillus stearothermophilus (BstPK), is an allosteric enzyme activated by AMP and ribose 5-phosphate but not by fructose 1,6-bisphosphate (FBP). However, almost all other PKs are activated by FBP. The wild-type and W416F/V435W mutant BstPKs were crystallized by the hanging-drop vapour-diffusion method. However, they were unsuitable for structural analysis because their data sets exhibited low completeness. Amore » crystal suitable for structural analysis was obtained using C9S/C268S enzyme. The crystal belonged to space group P6{sub 2}22, with unit-cell parameters a = b = 145.97, c = 118.03 Å.« less

Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

2007-04-01

Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

Translation effects on vertical Bridgman growth and optical, mechanical and surface analysis of 2-phenylphenol single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sadhasivam, S., E-mail: sadha.phy1@gmail.com; Perumal, Rajesh Narayana

2-phenylphenol optical crystals were grown in cone ampoules using vertical Bridgman technique. Single crystal of 2-phenylphenol with 150 mm length has been grown. The inclination on the conical part of the ampoule reduces the growth defects in the 2-phenylphenol single crystal. The lattice parameters and structure studied using single crystal X-ray diffraction method. 2-phenylphenol single crystal belongs to orthorhombic space group Fdd2. The micro translation rate affects crystal growth of 2-phenylphenol crystal was studied. The translation rate dependent defects present in the crystal were investigated by transmittance, indentation and etching characterizations. The dislocation induced indentation crack lengths variations were studied. Etchmore » pits and striations observed for the selective etchants furnish significant information on growth aspects and degree of defect present in the crystal.« less

Synthesis, structural, optical and thermal studies of an organic nonlinear optical 4-aminopyridinium maleate single crystal.

PubMed

Pandi, P; Peramaiyan, G; Kumar, M Krishna; Kumar, R Mohan; Jayavel, R

2012-03-01

Synthesis and growth of a novel organic nonlinear optical (NLO) crystal of 4-aminopyridinium maleate (4APM) in larger size by the slow evaporation solution growth technique are reported. Single crystal and powder X-ray diffraction analyses reveal that 4APM crystallizes in monoclinic system with space group P2(1) with cell parameters a=8.140(4)Å, b=5.457(5)Å, c=10.926(10)Å and volume=481.4(7)Å(3). The grown crystal has been characterized by Fourier transform infrared and UV-visible spectral analyses. Thermogravimetric analysis (TGA) and differential thermal analysis (DTA) have been carried out to study its thermal properties. Dielectric measurements have been carried out to study the distribution of charges within the crystal. The mechanical strength of the crystal has been studied by using Vickers' microhardness test. The etching studies have been carried out on the grown crystal. The Kurtz and Perry powder SHG technique confirms the NLO property of the grown crystal and the SHG efficiency of 4APM was found to be 4.8 times greater than that of KDP crystal. Copyright © 2011 Elsevier B.V. All rights reserved.

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Computerized Liquid Crystal Phase Identification by Neural Networks Analysis of Polarizing Microscopy Textures

NASA Astrophysics Data System (ADS)

Karaszi, Zoltan; Konya, Andrew; Dragan, Feodor; Jakli, Antal; CPIP/LCI; CS Dept. of Kent State University Collaboration

Polarizing optical microscopy (POM) is traditionally the best-established method of studying liquid crystals, and using POM started already with Otto Lehman in 1890. An expert, who is familiar with the science of optics of anisotropic materials and typical textures of liquid crystals, can identify phases with relatively large confidence. However, for unambiguous identification usually other expensive and time-consuming experiments are needed. Replacement of the subjective and qualitative human eye-based liquid crystal texture analysis with quantitative computerized image analysis technique started only recently and were used to enhance the detection of smooth phase transitions, determine order parameter and birefringence of specific liquid crystal phases. We investigate if the computer can recognize and name the phase where the texture was taken. To judge the potential of reliable image recognition based on this procedure, we used 871 images of liquid crystal textures belonging to five main categories: Nematic, Smectic A, Smectic C, Cholesteric and Crystal, and used a Neural Network Clustering Technique included in the data mining software package in Java ``WEKA''. A neural network trained on a set of 827 LC textures classified the remaining 44 textures with 80% accuracy.

An ignored variable: solution preparation temperature in protein crystallization.

PubMed

Chen, Rui-Qing; Lu, Qin-Qin; Cheng, Qing-Di; Ao, Liang-Bo; Zhang, Chen-Yan; Hou, Hai; Liu, Yong-Ming; Li, Da-Wei; Yin, Da-Chuan

2015-01-19

Protein crystallization is affected by many parameters, among which certain parameters have not been well controlled. The temperature at which the protein and precipitant solutions are mixed (i.e., the ambient temperature during mixing) is such a parameter that is typically not well controlled and is often ignored. In this paper, we show that this temperature can influence protein crystallization. The experimental results showed that both higher and lower mixing temperatures can enhance the success of crystallization, which follows a parabolic curve with an increasing ambient temperature. This work illustrates that the crystallization solution preparation temperature is also an important parameter for protein crystallization. Uncontrolled or poorly controlled room temperature may yield poor reproducibility in protein crystallization.

Theory and simulation of buoyancy-driven convection around growing protein crystals in microgravity.

PubMed

Carotenuto, L; Cartwright, J H E; Castagnolo, D; Garcia Ruiz, J M; Otalora, F

2002-01-01

We present an order-of-magnitude analysis of the Navier-Stokes equations in a time-dependent, incompressible and Boussinesq formulation. The hypothesis employed of two different length scales allows one to determine the different flow regimes on the basis of the geometrical and thermodynamical parameters alone, without solving the Navier-Stokes equations. The order-of-magnitude analysis is then applied to the field of protein crystallization, and to the flow field around a crystal, where the driving forces are solutal buoyancy-driven convection, from density dependence on species concentration, and sedimentation caused by the different densities of the crystal and the protein solution. The main result of this paper is to provide predictions of the conditions in which a crystal is growing in a convective regime, rather than in the ideal diffusive state, even under the typical microgravity conditions of space platforms.

Crystal growth, characterization and theoretical studies of 4-aminopyridinium picrate

NASA Astrophysics Data System (ADS)

Aditya Prasad, A.; Muthu, K.; Rajasekar, M.; Meenatchi, V.; Meenakshisundaram, S. P.

2015-01-01

Single crystals of 4-aminopyridinium picrate (APP) were grown by slow evaporation of a mixed solvent system methanol-acetone (1:1, v/v) containing equimolar quantities of 4-aminopyridine and picric acid. Structure is elucidated by single crystal XRD analysis and the crystal belongs to monoclinic system with four molecules in the unit cell (space group P21/c) and the cell parameter values are, a = 8.513 Å (±0.015), b = 11.33 Å (±0.02), c = 14.33 Å (±0.03) and β = 104.15° (±0.019), V = 1340 A3 (±6) with refined R factors R1 = 0.0053 and wR2 = 0.0126. The electron density mapping is interpreted to find coordinates for each atom in the crystallized molecules. The various functional groups present in the molecule are confirmed by FT-IR analysis. UV-visible spectral analysis was used to determine the band gap energy of 4-aminopyridinium picrate. Powder X-ray diffraction pattern reveals the crystallinity of the as-grown crystal and it closely resembles the simulated XRD from the single crystal XRD analysis. Scanning electron microscopy reveals the surface morphology of the grown crystal. Optimized geometry is derived by Hartree-Fock theory calculations and the first-order molecular hyperpolarizability (β), theoretically calculated bond length, bond angles and excited state energy from theoretical UV-vis spectrum were estimated.

Synthesis, growth, structural, thermal and optical studies of pyrrolidinium-2-carboxylate-4-nitrophenol single crystals.

PubMed

Swarna Sowmya, N; Sampathkrishnan, S; Vidyalakshmi, Y; Sudhahar, S; Mohan Kumar, R

2015-06-15

Organic nonlinear optical material, pyrrolidinium-2-carboxylate-4-nitrophenol (PCN) was synthesized and single crystals were grown by slow evaporation solution growth method. Single crystal X-ray diffraction analysis confirmed the structure and lattice parameters of PCN crystals. Infrared, Raman and NMR spectral analyses were used to elucidate the functional groups present in the compound. The thermal behavior of synthesized compound was studied by thermogravimetric and differential scanning calorimetry (TG-DSC) analyses. The photoluminescence property was studied by exciting the crystal at 360 nm. The relative second harmonic generation (SHG) efficiency of grown crystal was estimated by using Nd:YAG laser with fundamental wavelength of 1,064 nm. Copyright © 2015 Elsevier B.V. All rights reserved.

Nonlinear optical and microscopic analysis of Cu2+ doped zinc thiourea chloride (ZTC) monocrystal

NASA Astrophysics Data System (ADS)

Ramteke, S. P.; Anis, Mohd; Pandian, M. S.; Kalainathan, S.; Baig, M. I.; Ramasamy, P.; Muley, G. G.

2018-02-01

Organometallic crystals offer considerable nonlinear response therefore, present article focuses on bulk growth and investigation of Cu2+ ion doped zinc thiourea chloride (ZTC) crystal to explore its technological impetus for laser assisted nonlinear optical (NLO) device applications. The Cu2+ ion doped ZTC bulk single crystal of dimension 03 × 2.4 × 0.4 cm3 has been grown from pH controlled aqueous solution by employing slow solvent evaporation technique. The structural analysis has been performed by means of single crystal X-ray diffraction technique. The doping of Cu2+ ion in ZTC crystal matrix has been confirmed by means of energy dispersive spectroscopic (EDS) technique. The origin of nonlinear optical properties in Cu2+ ion doped ZTC crystal has been studied by employing the Kurtz-Perry test and Z-scan analysis. The remarkable enhancement in second harmonic generation (SHG) efficiency of Cu2+ ion doped ZTC crystal with reference to ZTC crystal has been determined. The He-Ne laser assisted Z-scan analysis has been performed to determine the third order nonlinear optical (TONLO) nature of grown crystal. The TONLO parameters such as susceptibility, absorption coefficient, refractive index and figure of merit of Cu-ZTC crystal have been evaluated using the Z-scan transmittance data. The laser damage threshold of grown crystal to high intensity of Nd:YAG laser is found to be 706.2 MW/cm2. The hardness number, work hardening index, yield strength and elastic stiffness coefficient of grown crystal has been investigated under microhardness study. The etching study has been carried out to determine the growth likelihood, nature of etch pits and surface quality of grown crystal.

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

Crystallization of human nicotinamide phosphoribosyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

2007-05-01

Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

Carboxylic acids in crystallization of macromolecules: learning from successful crystallization experiments.

PubMed

Offermann, Lesa R; He, John Z; Mank, Nicholas J; Booth, William T; Chruszcz, Maksymilian

2014-03-01

The production of macromolecular crystals suitable for structural analysis is one of the most important and limiting steps in the structure determination process. Often, preliminary crystallization trials are performed using hundreds of empirically selected conditions. Carboxylic acids and/or their salts are one of the most popular components of these empirically derived crystallization conditions. Our findings indicate that almost 40 % of entries deposited to the Protein Data Bank (PDB) reporting crystallization conditions contain at least one carboxylic acid. In order to analyze the role of carboxylic acids in macromolecular crystallization, a large-scale analysis of the successful crystallization experiments reported to the PDB was performed. The PDB is currently the largest source of crystallization data, however it is not easily searchable. These complications are due to a combination of a free text format, which is used to capture information on the crystallization experiments, and the inconsistent naming of chemicals used in crystallization experiments. Despite these difficulties, our approach allows for the extraction of over 47,000 crystallization conditions from the PDB. Initially, the selected conditions were investigated to determine which carboxylic acids or their salts are most often present in crystallization solutions. From this group, selected sets of crystallization conditions were analyzed in detail, assessing parameters such as concentration, pH, and precipitant used. Our findings will lead to the design of new crystallization screens focused around carboxylic acids.

Synthesis, characterization, crystal structure, DNA/BSA binding ability and antibacterial activity of asymmetric europium complex based on 1,10- phenanthroline

NASA Astrophysics Data System (ADS)

Alfi, Nafiseh; Khorasani-Motlagh, Mozhgan; Rezvani, Ali Reza; Noroozifar, Meissam; Molčanov, Krešimir

2017-06-01

A heteroleptic europium coordination compound formulated as [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) (phen = 1,10-phenanthroline), has been synthesized and characterized by elemental analysis, FT-IR spectroscopy, and single-crystal X-ray diffractometer. Crystal structure analysis reveals the complex is crystallized in orthorhombic system with Pca21 space group. Electronic absorption and various emission methods for investigation of the binding system of europium(III) complex to Fish Salmon deoxyribonucleic acid (FS-DNA) and Bovamin Serum Albumin (BSA) have been explored. Furthermore, the binding constants, binding sites and the corresponding thermodynamic parameters of the interaction system based on the van't Hoff equation for FS-DNA and BSA were calculated. The thermodynamic parameters reflect the exothermic nature of emission process (ΔH°<0 and ΔS°<0). The experimental results seem to indicate that the [Eu(phen)2(OH2)2(Cl)2](Cl)(H2O) bound to FS-DNA by non-intercalative mode which the groove binding is preferable mode. Also, the complex exhibits a brilliant antimicrobial activity in vitro against standard bacterial strains.

Solid-state reaction kinetics and optical studies of cadmium doped magnesium hydrogen phosphate crystals

NASA Astrophysics Data System (ADS)

Verma, Madhu; Gupta, Rashmi; Singh, Harjinder; Bamzai, K. K.

2018-04-01

The growth of cadmium doped magnesium hydrogen phosphate was successfully carried out by using room temperature solution technique i.e., gel encapsulation technique. Grown crystals were confirmed by single crystal X-ray diffraction (XRD). The structure of the grown crystal belongs to orthorhombic crystal system and crystallizes in centrosymmetric space group. Kinetics of the decomposition of the grown crystals were studied by non-isothermal analysis. Thermo gravimetric / differential thermo analytical (TG/DTA) studies revealed that the grown crystal is stable upto 119 °C. The various steps involved in the thermal decomposition of the material have been analysed using Horowitz-Metzger, Coats-Redfern and Piloyan-Novikova equations for evaluating various kinetic parameters. The optical studies shows that the grown crystals possess wide transmittance in the visible region and significant optical band gap of 5.5ev with cut off wavelength of 260 nm.

Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

Crystal-field energy level analysis for Nd(3+) ions at the low symmetry C(1) site in [Nd(hfa)(4)(H(2)O)](N(C(2)H(5))(4)) single crystals.

PubMed

Mech, Agnieszka; Gajek, Zbigniew; Karbowiak, Mirosław; Rudowicz, Czesław

2008-09-24

Optical absorption measurements of Nd(3+) ions in single crystals of [Nd(hfa)(4)(H(2)O)](N(C(2)H(5))(4)) (hfa = hexafluoroacetyloacetonate), denoted Nd(hfa) for short, have been carried out at 4.2 and 298 K. This compound crystallizes in the monoclinic system (space group P 2(1)/n). Each Nd ion is coordinated to eight oxygen atoms that originate from the hexafluoroacetylacetonate ligands and one oxygen atom from the water molecule. A total of 85 experimental crystal-field (CF) energy levels arising from the Nd(3+) (4f(3)) electronic configuration were identified in the optical spectra and assigned. A three-step CF analysis was carried out in terms of a parametric Hamiltonian for the actual C(1) symmetry at the Nd(3+) ion sites. In the first step, a total of 27 CF parameters (CFPs) in the Wybourne notation B(kq), admissible by group theory, were determined in a preliminary fitting constrained by the angular overlap model predictions. The resulting CFP set was reduced to 24 specific independent CFPs using appropriate standardization transformations. Optimizations of the second-rank CFPs and extended scanning of the parameter space were employed in the second step to improve reliability of the CFP sets, which is rather a difficult task in the case of no site symmetry. Finally, seven free-ion parameters and 24 CFPs were freely varied, yielding an rms deviation between the calculated energy levels and the 85 observed ones of 11.1 cm(-1). Our approach also allows prediction of the energy levels of Nd(3+) ions that are hidden in the spectral range overlapping with strong ligand absorption, which is essential for understanding the inter-ionic energy transfer. The orientation of the axis system associated with the fitted CF parameters w.r.t. the crystallographic axes is established. The procedure adopted in our calculations may be considered as a general framework for analysis of CF levels of lanthanide ions at low (triclinic) symmetry sites.

Crystal-field energy level analysis for Nd3+ ions at the low symmetry C1 site in [Nd(hfa)4(H2O)](N(C2H5)4) single crystals

NASA Astrophysics Data System (ADS)

Mech, Agnieszka; Gajek, Zbigniew; Karbowiak, Mirosław; Rudowicz, Czesław

2008-09-01

Optical absorption measurements of Nd3+ ions in single crystals of [Nd(hfa)4(H2O)](N(C2H5)4) (hfa = hexafluoroacetyloacetonate), denoted Nd(hfa) for short, have been carried out at 4.2 and 298 K. This compound crystallizes in the monoclinic system (space group P 21/n). Each Nd ion is coordinated to eight oxygen atoms that originate from the hexafluoroacetylacetonate ligands and one oxygen atom from the water molecule. A total of 85 experimental crystal-field (CF) energy levels arising from the Nd3+ (4f3) electronic configuration were identified in the optical spectra and assigned. A three-step CF analysis was carried out in terms of a parametric Hamiltonian for the actual C1 symmetry at the Nd3+ ion sites. In the first step, a total of 27 CF parameters (CFPs) in the Wybourne notation Bkq, admissible by group theory, were determined in a preliminary fitting constrained by the angular overlap model predictions. The resulting CFP set was reduced to 24 specific independent CFPs using appropriate standardization transformations. Optimizations of the second-rank CFPs and extended scanning of the parameter space were employed in the second step to improve reliability of the CFP sets, which is rather a difficult task in the case of no site symmetry. Finally, seven free-ion parameters and 24 CFPs were freely varied, yielding an rms deviation between the calculated energy levels and the 85 observed ones of 11.1 cm-1. Our approach also allows prediction of the energy levels of Nd3+ ions that are hidden in the spectral range overlapping with strong ligand absorption, which is essential for understanding the inter-ionic energy transfer. The orientation of the axis system associated with the fitted CF parameters w.r.t. the crystallographic axes is established. The procedure adopted in our calculations may be considered as a general framework for analysis of CF levels of lanthanide ions at low (triclinic) symmetry sites.

Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

DOE PAGES

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

2015-08-25

Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

An ignored variable: solution preparation temperature in protein crystallization

PubMed Central

Chen, Rui-Qing; Lu, Qin-Qin; Cheng, Qing-Di; Ao, Liang-Bo; Zhang, Chen-Yan; Hou, Hai; Liu, Yong-Ming; Li, Da-Wei; Yin, Da-Chuan

2015-01-01

Protein crystallization is affected by many parameters, among which certain parameters have not been well controlled. The temperature at which the protein and precipitant solutions are mixed (i.e., the ambient temperature during mixing) is such a parameter that is typically not well controlled and is often ignored. In this paper, we show that this temperature can influence protein crystallization. The experimental results showed that both higher and lower mixing temperatures can enhance the success of crystallization, which follows a parabolic curve with an increasing ambient temperature. This work illustrates that the crystallization solution preparation temperature is also an important parameter for protein crystallization. Uncontrolled or poorly controlled room temperature may yield poor reproducibility in protein crystallization. PMID:25597864

Crystallization of Synthetic Blast Furnace Slags Pertaining to Heat Recovery

NASA Astrophysics Data System (ADS)

Esfahani, Shaghayegh

Heat recovery from blast furnace slags is often contradicted by another requirement, to generate amorphous slag for its use in cement production. As both the rate and extent of heat recovery and slag structure are determined by its cooling rate, a relation between the crystallization kinetics and the cooling conditions is highly desired. In this study, CaO-SiO2-Al2O3-MgO (CSAM) slags with different basicities were studied by Single Hot Thermocouple Technique (SHTT) during isothermal treatment and non-isothermal cooling. Their time-temperature-transformation (TTT) and continuous-cooling-transformation (CCT) diagrams were plotted and compared with each other. Furthermore, kinetic parameters such as the Avrami exponent (n), rate coefficient (K) and effective activation energy of crystallization (EA) were found by analysis of data obtained from in-situ observation of glassy to crystalline transformation and image analysis. Also, the dependence of nucleation and growth rates of crystalline phases were quantified as a function of time, temperature, and slag basicity. Together with the observations of crystallization front, they facilitated establishing the dominant mechanisms of crystallization. In addition to the experimental work, a mathematical model was developed and validated that predicts the amount of crystallization during cooling. A second mathematical model that calculates temperature history of slag during its cooling was coupled with the above model, to allow studying the effect of parameters such as the slag/air ratio and granule size on the heat recovery and glass content of slag.

Single crystal growth and characterization of pure and sodium-modified copper tartrate

NASA Astrophysics Data System (ADS)

Quasim, I.; Firdous, A.; Want, B.; Khosa, S. K.; Kotru, P. N.

2008-12-01

Single crystal growth of pure and modified copper tartrate crystals bearing composition (Cu) x(Na) yC 4H 4O 6· nH 2O (where x=1, 0.77, 0.65; y=0, 0.23, 0.35) is achieved using gel technique. The optimum conditions required for the growth of these crystals are worked out. The morphological development of these crystals is studied using optical and scanning electron microscopy. The dominant habit faces of the grown copper tartrate crystals are (0 0 1) and (1 1 1). Calculation of the cell parameters using CRYSFIRE software suggests that the pure copper tartrate crystal belongs to orthorhombic system with space group P2 1/c whereas the modified copper tartrate falls under tetragonal system with the space group P4 2/nbc. The external morphological development is shown to remain unaffected in the modified copper tartrate. The stoichiometric composition of the crystals is established by EDAX analysis, CH analysis, FTIR spectroscopy and thermoanalytical techniques. Thermal analysis of the grown crystals suggests that pure copper tartrate is thermally stable up to 42.84 °C whereas the modified copper tartrate crystals are stable only up to 33.11 and 25.11 °C. Calculation of the percentage weight loss from the thermogram supplemented by EDAX/CH analysis and FTIR spectroscopy suggest that the chemical formula of pure copper tartrate crystal is CuC 4H 4O 6·3H 2O whereas the chemical formula for the modified copper tartrate crystals is (Cu) 0.77(Na) 0.23C 4H 4O 6·3H 2O and (Cu) 0.65(Na) 0.35 C 4H 4O 6·H 2O.

Synthesis, growth and characterization of L-Phenylalaninium methanesulfonate nonlinear optical single crystal

NASA Astrophysics Data System (ADS)

Mangaiyarkarasi, K.; Ravichandran, A. T.; Anitha, K.; Manivel, A.

2018-03-01

The titled compound, L-Phenylalaninium methanesulfonate (LPA-MS) was synthesized and grown into single crystals by slow solvent evaporation solution growth technique in aqueous solution containing equimolar concentrations of L-phenylalanine and methanesulfonic acid at room temperature. The grown crystals were subjected to single crystal X-ray diffraction studies. It crystallizes in the monoclinic crystal structure with P21 space group and the unit cell parameters are a = 5.312 (10) Å, b = 8.883 (2) Å and c = 25.830 (7) Å. The functional groups of the LPA-MS crystal were confirmed with FT-IR and FT-Raman analysis. The carbon-hydrogen skeleton was confirmed with 1H NMR and 13C NMR analysis. TG-DTG and DSC studies were carried out to determine the thermal stability of the crystals. The optical transparency ranges were studied through UV-vis-spectroscopy and the crystal was found to be transparent in the visible region. The second Harmonic generation (SHG) efficiency of the grown LPA-MS crystal was measured by the Kurtz-Perry powder technique. The dipolar nature of the L-phenylalaninium methanesulfonate and the presence of the intermolecular hydrogen bonding between the molecules are the vital factors responsible for the existence of SHG activity in the crystal.

A special method for analyzing anisotropic nuclear magnetic resonance parameters: Acetonitrile in liquid crystals

NASA Astrophysics Data System (ADS)

Lounila, Juhani; Ala-Korpela, Mika; Jokisaari, Jukka

1990-12-01

A reliable analysis of the nuclear magnetic resonance (NMR) spectral parameters of partially oriented molecules requires the calculation of the effects of the correlation between the molecular vibration and rotation. However, in many cases the information content of the spectral data is not sufficient for an unambiguous determination of all the adjustable parameters involved in such an analysis. The present paper describes a special method to simplify the analysis significantly, so as to make seemingly underdetermined problems solvable. The method is applicable to the molecules which contain segments composed of one or more light bonds attached to a heavier bond. It is applied to the anisotropic couplings Dij of acetonitrile (CH3CN) oriented in various liquid crystals. The analysis leads to the following rα geometry: ∠HCH=109.22°±0.06°, rCH/rCC =0.751±0.002 and rCN/rCC =0.788±0.005. In addition, detailed information on (1) the indirect coupling anisotropies ΔJCC and 2ΔJCN, (2) the 1H and 13C chemical shift anisotropies, (3) the external torques acting on the CH bonds, and (4) the orientational order parameters of the CH3C segment of the acetonitrile molecule is obtained.

Investigation of non-uniformity and inclusions in 6LiInSe2 utilizing laser induced breakdown spectroscopy (LIBS)

NASA Astrophysics Data System (ADS)

Wiggins, Brenden; Tupitsyn, Eugene; Bhattacharya, Pijush; Rowe, Emmanuel; Lukosi, Eric; Chvala, Ondrej; Burger, Arnold; Stowe, Ashley

2013-09-01

Impurity analysis and compositional distribution studies have been conducted on a crystal of LiInSe2, a compound semiconductor which recently has been shown to respond to ionizing radiation. IR microscopy and laser induced breakdown spectroscopy (LIBS) revealed the presence of inclusions within the crystal lattice. These precipitates were revealed to be alkali and alkaline earth elemental impurities with non-uniform spatial distribution in the crystal. LIBS compositional maps correlate the presence of these impurities with visual color differences in the crystal as well as a significant shift of the band gap. Further, LIBS revealed variation in the ratio of I-III-VI2 elemental constituents throughout the crystal. Analysis of compositional variation and impurities will aid in discerning optimal synthesis and crystal growth parameters to maximize the mobility-lifetime product and charge collection efficiency in the LiInSe2 crystal. Preliminary charge trapping calculations have also been conducted with the Monte Carlo N-particle eXtended (MCNPx) package indicating preferential trapping of holes during irradiation with thermal neutrons.

Stacking fault density and bond orientational order of fcc ruthenium nanoparticles

NASA Astrophysics Data System (ADS)

Seo, Okkyun; Sakata, Osami; Kim, Jae Myung; Hiroi, Satoshi; Song, Chulho; Kumara, Loku Singgappulige Rosantha; Ohara, Koji; Dekura, Shun; Kusada, Kohei; Kobayashi, Hirokazu; Kitagawa, Hiroshi

2017-12-01

We investigated crystal structure deviations of catalytic nanoparticles (NPs) using synchrotron powder X-ray diffraction. The samples were fcc ruthenium (Ru) NPs with diameters of 2.4, 3.5, 3.9, and 5.4 nm. We analyzed average crystal structures by applying the line profile method to a stacking fault model and local crystal structures using bond orientational order (BOO) parameters. The reflection peaks shifted depending on rules that apply to each stacking fault. We evaluated the quantitative stacking faults densities for fcc Ru NPs, and the stacking fault per number of layers was 2-4, which is quite large. Our analysis shows that the fcc Ru 2.4 nm-diameter NPs have a considerably high stacking fault density. The B factor tends to increase with the increasing stacking fault density. A structural parameter that we define from the BOO parameters exhibits a significant difference from the ideal value of the fcc structure. This indicates that the fcc Ru NPs are highly disordered.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom.

PubMed

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-10-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å.

Crystallization and preliminary X-ray diffraction analysis of a novel sphingomyelinase D from Loxosceles gaucho venom

PubMed Central

Ullah, Anwar; Magalhães, Geraldo Santana; Masood, Rehana; Mariutti, Ricardo Barros; Coronado, Monika Aparecida; Murakami, Mário Tyago; Barbaro, Katia Cristina; Arni, Raghuvir Krishnaswamy

2014-01-01

Brown spider envenomation results in dermonecrosis, intravascular coagulation, haemolysis and renal failure, mainly owing to the action of sphingomyelinases D (SMases D), which catalyze the hydrolysis of sphingomyelin to produce ceramide 1-phosphate and choline or the hydrolysis of lysophosphatidylcholine to produce lysophosphatidic acid. Here, the heterologous expression, purification, crystallization and preliminary X-ray diffraction analysis of LgRec1, a novel SMase D from Loxosceles gaucho venom, are reported. The crystals belonged to space group P21212, with unit-cell parameters a = 52.98, b = 62.27, c = 84.84 Å and diffracted to a maximum resolution of 2.6 Å. PMID:25286953

Features in simulation of crystal growth using the hyperbolic PFC equation and the dependence of the numerical solution on the parameters of the computational grid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Starodumov, Ilya; Kropotin, Nikolai

2016-08-10

We investigate the three-dimensional mathematical model of crystal growth called PFC (Phase Field Crystal) in a hyperbolic modification. This model is also called the modified model PFC (originally PFC model is formulated in parabolic form) and allows to describe both slow and rapid crystallization processes on atomic length scales and on diffusive time scales. Modified PFC model is described by the differential equation in partial derivatives of the sixth order in space and second order in time. The solution of this equation is possible only by numerical methods. Previously, authors created the software package for the solution of the Phasemore » Field Crystal problem, based on the method of isogeometric analysis (IGA) and PetIGA program library. During further investigation it was found that the quality of the solution can strongly depends on the discretization parameters of a numerical method. In this report, we show the features that should be taken into account during constructing the computational grid for the numerical simulation.« less

Method for acquiring, storing and analyzing crystal images

NASA Technical Reports Server (NTRS)

Gester, Thomas E. (Inventor); Rosenblum, William M. (Inventor); Christopher, Gayle K. (Inventor); Hamrick, David T. (Inventor); Delucas, Lawrence J. (Inventor); Tillotson, Brian (Inventor)

2003-01-01

A system utilizing a digital computer for acquiring, storing and evaluating crystal images. The system includes a video camera (12) which produces a digital output signal representative of a crystal specimen positioned within its focal window (16). The digitized output from the camera (12) is then stored on data storage media (32) together with other parameters inputted by a technician and relevant to the crystal specimen. Preferably, the digitized images are stored on removable media (32) while the parameters for different crystal specimens are maintained in a database (40) with indices to the digitized optical images on the other data storage media (32). Computer software is then utilized to identify not only the presence and number of crystals and the edges of the crystal specimens from the optical image, but to also rate the crystal specimens by various parameters, such as edge straightness, polygon formation, aspect ratio, surface clarity, crystal cracks and other defects or lack thereof, and other parameters relevant to the quality of the crystals.

Single crystal growth by gel technique and characterization of lithium hydrogen tartrate

NASA Astrophysics Data System (ADS)

Ahmad, Nazir; Ahmad, M. M.; Kotru, P. N.

2015-02-01

Single crystal growth of lithium hydrogen tartrate by gel encapsulation technique is reported. Dependence of crystal count on gel density, gel pH, reactant concentration and temperature are studied and the optimum conditions for these crystals are worked out. The stoichiometric composition of the grown crystals is determined using EDAX/AES and CH analysis. The grown crystals are characterized by X-ray diffraction, FTIR and Uv-Visible spectroscopy. It is established that crystal falls under orthorhombic system and space group P222 with the cell parameters as: a=10.971 Å, b=13.125 Å and c=5.101 Å; α=90.5o, β=γ=90°. The morphology of the crystals as revealed by SEM is illustrated. Crystallite size, micro strain, dislocation density and distortion parameters are calculated from the powder XRD results of the crystal. UV-vis spectroscopy shows indirect allowed transition with an optical band gap of 4.83 eV. The crystals are also shown to have high transmittance in the entire visible region. Dependence of dielectric constant, dielectric loss and conductivity on frequency of the applied ac field is analyzed. The frequency-dependent real part of the complex ac conductivity is found to follow the universal dielectric response: σac (ω) ωs. The trend in the variation of frequency exponent with frequency corroborates the fact that correlated barrier hopping is the dominant charge-transport mechanism in the present system.

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Inverse Opal Photonic Crystals as an Optofluidic Platform for Fast Analysis of Hydrocarbon Mixtures.

PubMed

Xu, Qiwei; Mahpeykar, Seyed Milad; Burgess, Ian B; Wang, Xihua

2018-06-13

Most of the reported optofluidic devices analyze liquid by measuring its refractive index. Recently, the wettability of liquid on various substrates has also been used as a key sensing parameter in optofluidic sensors. However, the above-mentioned techniques face challenges in the analysis of the relative concentration of components in an alkane hydrocarbon mixture, as both refractive indices and wettabilities of alkane hydrocarbons are very close. Here, we propose to apply volatility of liquid as the key sensing parameter, correlate it to the optical property of liquid inside inverse opal photonic crystals, and construct powerful optofluidic sensors for alkane hydrocarbon identification and analysis. We have demonstrated that via evaporation of hydrocarbons inside the periodic structure of inverse opal photonic crystals and observation of their reflection spectra, an inverse opal film could be used as a fast-response optofluidic sensor to accurately differentiate pure hydrocarbon liquids and relative concentrations of their binary and ternary mixtures in tens of seconds. In these 3D photonic crystals, pure chemicals with different volatilities would have different evaporation rates and can be easily identified via the total drying time. For multicomponent mixtures, the same strategy is applied to determine the relative concentration of each component simply by measuring drying time under different temperatures. Using this optofluidic sensing platform, we have determined the relative concentrations of ternary hydrocarbon mixtures with the difference of only one carbon between alkane hydrocarbons, which is a big step toward detailed hydrocarbon analysis for practical use.

Solid state structural investigations of the bis(chalcone) compound with single crystal X-ray crystallography, DFT, gamma-ray spectroscopy and chemical spectroscopy methods

NASA Astrophysics Data System (ADS)

Yakalı, Gül; Biçer, Abdullah; Eke, Canel; Cin, Günseli Turgut

2018-04-01

A bis(chalcone), (2E,6E)-2,6-bis((E)-3phenylallidene)cyclohexanone, was characterized by 1H NMR, 13C NMR, FTIR, UV-Vis spectroscopy, gamma-ray spectroscopy and single crystal X- ray structural analysis. The optimized molecular structure of the compound is calculated using DFT/B3LYP with 6-31G (d,p) level. The calculated geometrical parameters are in good agreement with the experimental data obtained from our reported X-ray structure. The powder and single crystal compounds were gama-irradiated using clinical electron linear accelerator and 60Co gamma-ray source, respectively. Spectral studies (1H NMR, 13C NMR, FTIR and UV-Vis) of powder chalcone compound were also investigated before and after irradiation. Depending on the irradiation notable changes were observed in spectral features powder sample. Single crystal X-ray diffraction investigation shows that both unirradiated and irradiated single crystal samples crystallizes in a orthorhombic crystal system in the centrosymmetric space group Pbcn and exhibits an C-H..O intramolecular and intermolecular hydrogen bonds. The crystal packing is stabilised by strong intermolecular bifurcate C-H..O hydrogen bonds and π…π stacking interactions. The asymmetric unit of the title compound contains one-half of a molecule. The other half of the molecule is generated with (1-x,y,-3/2-z) symmetry operator. The molecule is almost planar due to having π conjugated system of chalcones. However, irradiated single crystal compound showed significant changes lattice parameters, crystal volume and density. According to results of gamma-ray spectroscopy, radioactive elements of powder compound which are 123Sb(n,g),124Sb,57Fe(g,p),56Mn, 55Mn(g,n), and 54Mn were determined using photoactivation analysis. However, the most intensive gamma-ray energy signals are 124Sb.

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of L-lactate dehydrogenase and its H171C mutant from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Gao, Xiaoli

2012-08-31

L-Lactate dehydrogenase (LDH) is an important enzyme involved in the last step of glycolysis that catalyzes the reversible conversion of pyruvate to L-lactate with the simultaneous oxidation of NADH to NAD{sup +}. In this study, wild-type LDH from Bacillus subtilis (BsLDH-WT) and the H171C mutant (BsLDH-H171C) were expressed in Escherichia coli and purified to near-homogeneity. BsLDH-WT was crystallized in the presence of fructose 1,6-bisphosphate (FBP) and NAD{sup +} and the crystal diffracted to 2.38 {angstrom} resolution. The crystal belonged to space group P3, with unit-cell parameters a = b = 171.04, c = 96.27 {angstrom}. BsLDH-H171C was also crystallized asmore » the apoenzyme and in complex with NAD{sup +}, and data sets were collected to 2.20 and 2.49 {angstrom} resolution, respectively. Both BsLDH-H171C crystals belonged to space group P3, with unit-cell parameters a = b = 133.41, c = 99.34 {angstrom} and a = b = 133.43, c = 99.09 {angstrom}, respectively. Tetramers were observed in the asymmetric units of all three crystals.« less

Electron crystallographic analysis of two-dimensional streptavidin crystals coordinated to metal-chelated lipid monolayers.

PubMed Central

Frey, W; Brink, J; Schief, W R; Chiu, W; Vogel, V

1998-01-01

Coordination of individual histidine residues located on a protein surface to metal-chelated lipid monolayers is a potentially general method for crystallizing proteins in two dimensions. It was shown recently by Brewster angle microscopy (BAM) that the model protein streptavidin binds via its surface histidines to Cu-DOIDA lipid monolayers, and aggregates into regularly shaped domains that have the appearance of crystals. We have used electron microscopy to confirm that the domains are indeed crystalline with lattice parameters similar to those of the same protein crystallized beneath biotinylated lipid monolayers. Although BAM demonstrates that the two-dimensional protein crystals grown via metal chelation are distinct from the biotin-bound crystals in both microscopic shape and thermodynamic behavior, the two crystal types show similar density projections and the same plane group symmetry. PMID:9591691

Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

2006-06-01

SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

Single-crystal growth, structure refinement and the properties of Bis(glycine) Strontium Chloride

NASA Astrophysics Data System (ADS)

Balaji, S. R.; Balu, T.; Rajasekaran, T. R.

2018-02-01

Single crystals of Bis (glycine) Strontium Chloride (BGSC) were grown by means of slow evaporation process by using analar grade Glycine and Strontium Chloride Hexahydrate as a parent compound from its aqueous solution at room temperature. The final chemical composition, [{{Sr}}{({{{C}}}2{{{H}}}5{{{NO}}}2)}2{{{Cl}}}2].{{{H}}}4{{{O}}}3+{{{H}}}8{{{O}}}3, formed were metallic light colorless block, about the size of 28 mm × 9 mm × 8 mm. A single-crystal x-ray diffraction study revealed an ordered superstructure with orthorhombic symmetry that could be assigned to the space group Pbcn. The structure in BGSC, revealed in the electron density distribution was analyzed by the direct methods (SHELXS-2014) and refined by least squares full matrix method (SHELXL-2014). The crystal structure, including anisotropic atomic displacement parameters for each atom and isotropic atomic displacement parameters for hydrogen atom, was refined to R1 = 0.0395, wR2 = 0.0776 using 1097 independent reflections. The FTIR spectrum of BGSC confirms the protonation of amino groups and the different molecular groups present in BGSC vibrate in different modes. Reverse Indentation Size Effect (RISE) was revealed in BGSC in the micro-hardness analysis using Vicker’s micro-hardness analysis. DTA and DSC results ruled out the possibility of structural change independent of mass change. The AFM studies shows fine nano size fiber like structure of the grown crystals.

Continuous diffraction of molecules and disordered molecular crystals

PubMed Central

Yefanov, Oleksandr M.; Ayyer, Kartik; White, Thomas A.; Barty, Anton; Morgan, Andrew; Mariani, Valerio; Oberthuer, Dominik; Pande, Kanupriya

2017-01-01

The intensities of far-field diffraction patterns of orientationally aligned molecules obey Wilson statistics, whether those molecules are in isolation (giving rise to a continuous diffraction pattern) or arranged in a crystal (giving rise to Bragg peaks). Ensembles of molecules in several orientations, but uncorrelated in position, give rise to the incoherent sum of the diffraction from those objects, modifying the statistics in a similar way as crystal twinning modifies the distribution of Bragg intensities. This situation arises in the continuous diffraction of laser-aligned molecules or translationally disordered molecular crystals. This paper develops the analysis of the intensity statistics of such continuous diffraction to obtain parameters such as scaling, beam coherence and the number of contributing independent object orientations. When measured, continuous molecular diffraction is generally weak and accompanied by a background that far exceeds the strength of the signal. Instead of just relying upon the smallest measured intensities or their mean value to guide the subtraction of the background, it is shown how all measured values can be utilized to estimate the background, noise and signal, by employing a modified ‘noisy Wilson’ distribution that explicitly includes the background. Parameters relating to the background and signal quantities can be estimated from the moments of the measured intensities. The analysis method is demonstrated on previously published continuous diffraction data measured from crystals of photosystem II [Ayyer et al. (2016 ▸), Nature, 530, 202–206]. PMID:28808434

Nucleation kinetics, crystal growth and optical studies on lithium hydrogen oxalate monohydrate single crystal

NASA Astrophysics Data System (ADS)

Chandran, Senthilkumar; Paulraj, Rajesh; Ramasamy, P.

2017-06-01

Semi-organic lithium hydrogen oxalate monohydrate non-linear optical single crystals have been grown by slow evaporation solution technique at 40 °C. The nucleation parameters such as critical radius, interfacial tension, and critical free energy change have been evaluated using the experimental data. The solubility and the nucleation curve of the crystal at different temperatures have been analyzed. The crystal has a positive temperature coefficient of solubility. The metastable zone width and induction period have been determined for the aqueous solution growth of lithium hydrogen oxalate monohydrate. The UV-vis-NIR spectrum showed this crystal has high transparency. The photoconductivity studies indicate lithium hydrogen oxalate monohydrate has positive photoconductivity behaviour. The low etch pit density observed on (0 0 1) crystal surface and the high resolution x-ray difraction analysis indicate the good quality of the grown crystals

Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

2007-08-01

The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balotra, Sahil; Newman, Janet; French, Nigel G.

2014-02-19

The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum β-lactamase conferring severe antibiotic resistance

NASA Astrophysics Data System (ADS)

Lee, J. H.; Sohn, S. G.; Jung, H. I.; An, Y. J.; Lee, S. H.

2013-07-01

OXA-17, an extended-spectrum β-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates β-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino β-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 Å resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P212121, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 Å. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

Growth, optical, thermal, mechanical and dielectric studies of sodium succinate hexahydrate (β phase) single crystal: A promising third order NLO material

NASA Astrophysics Data System (ADS)

Mageshwari, P. S. Latha; Priya, R.; Krishnan, S.; Joseph, V.; Das, S. Jerome

2016-11-01

A third order nonlinear optical (NLO)single crystals of sodium succinate hexahydrate (SSH) (β phase) has been grown by a slow evaporation growth technique using aqueous solution at ambient temperature. The lattice parameters and morphology of SSH were determined by single crystal X-ray diffraction analysis. SSH crystallizes in centrosymmetric monoclinic system with space group P 21 / c and the crystalline purity was analyzed by powder X-ray diffraction analysis. The UV-vis-NIR spectrum reveals that the crystal is transparent in the entire visible region. The recorded FT-IR spectrum verified the presence of various functional groups in the material. NMR analysis of the grown crystal confirms the structural elucidation and detects the major and minor functional groups present in the title compound. ICP-OES analysis proved the presence of sodium in SSH. TG-DTA/DSCanalysis was used to investigate the thermal stability of the material. The dielectric permittivity and dielectric loss of SSH were carried out as a function of frequency for different temperatures and the results were discussed. The mechanical stability was evaluated from Vicker's microhardness test. The third order nonlinear optical properties of SSH has been investigated employing Z-scan technique with He-Ne laser operating at 632.8 nm wavelength.

Studies on the syntheses, structural Characterization, antimicrobial of the CO-CRYSTAL 1,10-phenanthrolin-1-IUM(1,10-phenH+)-caffeine(caf)-hexafluorophosphate

NASA Astrophysics Data System (ADS)

El Hamdani, H.; El Amane, M.; Duhayon, C.

2018-03-01

Co-crystal of 1,10-phenanthrolin-1-ium-caffeine-hexafluorophosphate was synthesized, studied by FTIR, 1H, 13C NMR, DSC and X-ray structure and crystallized in the monoclinic space group C2/c. The unit cell parameters are a = 19.3761 (3), b = 17.9548 (3), c = 13.8074 (3) with β = 117.8132 (10). The final R value is 0.069 for 29,522 measured reflections. The co-crystal structure analysis indicate the 1,10-phenanthroline is protonated by one nitrogen atom and formed the 1,10-phenanthrolin-1-ium cation, which is stabilized by hydrogen bonds N+-H…Odbnd C interaction with carbonyl and imidazol ring in caffeine molecule. The intermolecular hydrogen bonds: Csbnd H...O, Csbnd H...N, Nsbnd H...O, Csbnd H...F and intramolecular hydrogen bond: C1sbnd H12...O14, together play a vital role in stabilizing the structure of co-crystal. The X-ray structural analysis confirm the assignments of the structure from infrared, 1H, 13C NMR, spectroscopic data DSC and molar conductivity analysis. The antimicrobial activity of the co-crystal was studied.

Selectivity analysis of an incoherent grating imaged in a photorefractive crystal

NASA Astrophysics Data System (ADS)

Tebaldi, Myrian; Forte, Gustavo; Bolognini, Nestor; Lasprilla A., Maria del Carmen

2018-04-01

In this work, the diffraction efficiency of a volume phase grating incoherently stored in a photorefractive BSO crystal is theoretically and experimentally analyzed. The results confirm the theoretical proposal based on the coupled wave theory adopting a new grating depth parameter associated to the write-in incoherent optical system. The selectivity behavior is governed by the exit pupil diameter of the imaging recording system that controls the depth of the tridimensional image distribution along the propagation direction. Two incoherent gratings are multiplexed in a single crystal and reconstructed without cross-talk.

Superposition model analysis of zero field splitting for Mn2+ in some host single crystals

NASA Astrophysics Data System (ADS)

Bansal, R. S.; Ahlawat, P.; Bharti, M.; Hooda, S. S.

2013-07-01

The Newman superposition model has been used to investigate the substitution of Mn2+ for Zn2+ site in ammonium tetra flurozincate dihydrate and for Co2+ site in cobalt ammonium phosphate hexahydrate and cobalt potassium phosphate hexahydrate single crystals. The calculated values of zero field splitting parameter b 2 0 at room temperature fit the experimental data with average intrinsic parameters overline{b}2 (F) = -0.0531 cm-1 for fluorine and overline{b}2 (O) = -0.0280 cm-1 for oxygen, taken t 2 = 7 for Mn2+ doped in ammonium tetra fluorozincate dihydrate single crystals. The values of overline{b}2 determined for Mn2+ doped in cobalt ammonium phosphate hexahydrate are -0.049 cm-1 for site I and -0.045 cm-1 for site II and in cobalt pottasium phosphate hexahydrate single crystals it is found to be overline{b}2 = -0.086 cm-1. We find close agreement between theoretical and experimental values of b 2 0.

Crystal surface analysis using matrix textural features classified by a probabilistic neural network

NASA Astrophysics Data System (ADS)

Sawyer, Curry R.; Quach, Viet; Nason, Donald; van den Berg, Lodewijk

1991-12-01

A system is under development in which surface quality of a growing bulk mercuric iodide crystal is monitored by video camera at regular intervals for early detection of growth irregularities. Mercuric iodide single crystals are employed in radiation detectors. A microcomputer system is used for image capture and processing. The digitized image is divided into multiple overlapping sub-images and features are extracted from each sub-image based on statistical measures of the gray tone distribution, according to the method of Haralick. Twenty parameters are derived from each sub-image and presented to a probabilistic neural network (PNN) for classification. This number of parameters was found to be optimal for the system. The PNN is a hierarchical, feed-forward network that can be rapidly reconfigured as additional training data become available. Training data is gathered by reviewing digital images of many crystals during their growth cycle and compiling two sets of images, those with and without irregularities.

Band structures in two-dimensional phononic crystals with periodic Jerusalem cross slot

NASA Astrophysics Data System (ADS)

Li, Yinggang; Chen, Tianning; Wang, Xiaopeng; Yu, Kunpeng; Song, Ruifang

2015-01-01

In this paper, a novel two-dimensional phononic crystal composed of periodic Jerusalem cross slot in air matrix with a square lattice is presented. The dispersion relations and the transmission coefficient spectra are calculated by using the finite element method based on the Bloch theorem. The formation mechanisms of the band gaps are analyzed based on the acoustic mode analysis. Numerical results show that the proposed phononic crystal structure can yield large band gaps in the low-frequency range. The formation mechanism of opening the acoustic band gaps is mainly attributed to the resonance modes of the cavities inside the Jerusalem cross slot structure. Furthermore, the effects of the geometrical parameters on the band gaps are further explored numerically. Results show that the band gaps can be modulated in an extremely large frequency range by the geometry parameters such as the slot length and width. These properties of acoustic waves in the proposed phononic crystals can potentially be applied to optimize band gaps and generate low-frequency filters and waveguides.

Crystal field analysis of the energy level structure of Cs2NaAlF6:Cr3+

NASA Astrophysics Data System (ADS)

Rudowicz, C.; Brik, M. G.; Avram, N. M.; Yeung, Y. Y.; Gnutek, P.

2006-06-01

An analysis of the energy level structure of Cr3+ ions in Cs2NaAlF6 crystal is performed using the exchange charge model (ECM) together with the crystal field analysis/microscopic spin Hamiltonian (CFA/MSH) computer package. Utilizing the crystal structure data, our approach enables modelling of the crystal field parameters (CFPs) and thus the energy level structure for Cr3+ ions at the two crystallographically inequivalent sites in Cs2NaAlF6. Using the ECM initial adjustment procedure, the CFPs are calculated in the crystallographic axis system centred at the Cr3+ ion at each site. Additionally the CFPs are also calculated using the superposition model (SPM). The ECM and SPM predicted CFP values match very well. Consideration of the symmetry aspects for the so-obtained CFP datasets reveals that the latter axis system matches the symmetry-adapted axis system related directly to the six Cr-F bonds well. Using the ECM predicted CFPs as an input for the CFA/MSH package, the complete energy level schemes are calculated for Cr3+ ions at the two sites. Comparison of the theoretical results with the experimental spectroscopic data yields satisfactory agreement. Our results confirm that the actual symmetry at both impurity sites I and II in the Cs2NaAlF6:Cr3+ system is trigonal D3d. The ECM predicted CFPs may be used as the initial (starting) parameters for simulations and fittings of the energy levels for Cr3+ ions in structurally similar hosts.

Sonication-assisted synthesis of a new cationic zinc nitrate complex with a tetradentate Schiff base ligand: Crystal structure, Hirshfeld surface analysis and investigation of different parameters influence on morphological properties.

PubMed

Mousavi, S A; Montazerozohori, M; Masoudiasl, A; Mahmoudi, G; White, J M

2018-09-01

A nanostructured cationic zinc nitrate complex with a formula of [ZnLNO 3 ]NO 3 (where L = (N 2 E,N 2' E)-N 1 ,N 1' -(ethane-1,2-diyl)bis(N 2 -((E)-3-phenylallylidene)ethane-1,2-diamine)) was prepared by sonochemical process and characterized by single crystal X-ray crystallography, scanning electron microscopy (SEM), FT-IR and NMR spectroscopy and X-ray powder diffraction (XRPD). The X-ray analysis demonstrates the formation of a cationic complex that metal center is five-coordinated by four nitrogen atom from Schiff base ligand and one oxygen atom from nitrate group. The crystal packing analysis demonstrates the essential role of the nitrate groups in the organization of supramolecular structure. The morphology and size of ultrasound-assisted synthesized zinc nitrate complex have been investigated using scanning electron microscopy (SEM) by changing parameters such as the concentration of initial reactants, the sonication power and reaction temperature. In addition the calcination of zinc nitrate complex in air atmosphere led to production of zinc oxide nanoparticles. Copyright © 2018. Published by Elsevier B.V.

Correlation of EMR and optical spectroscopy data for Cr3+ and Mn2+ ions doped into yttrium aluminum borate YAl3(BO3)4 crystal - Extracting low symmetry aspects

NASA Astrophysics Data System (ADS)

Rudowicz, Czesław; Gnutek, Paweł; Açıkgöz, Muhammed

2015-08-01

In this study, the crystal field analysis for Cr3+ and Mn2+ ions doped into yttrium aluminum borate YAl3(BO3)4, for short YAB, crystal has been carried out to complement earlier study of the zero-field splitting (ZFS) parameters (ZFSPs). This analysis utilizes data on the distortion models obtained from analysis of the ZFSPs obtained experimentally by EMR for Cr3+ and Mn2+ ions at the Y3+ and Al3+ sites in YAB. This approach enables to verify and enhance reliability of the ZFSP modeling based on superposition model (SPM) analysis and the distortion models predicted previously. Subsequently, modeling of the crystal field parameters (CFPs) based on SPM analysis is carried out for Cr3+ and Mn2+ ions located at possible cation sites in YAB. The SPM predicted CFP values serve as input for the Crystal Field Analysis (CFA) package to calculate the CF energy levels. The predicted physical ZFS of the ground spin state, i.e. the 4A2 state for Cr3+ ion and the 6S state Mn2+ ions, enable calculation of the theoretical ZFSP values, D and D & (a-F), respectively, using the microscopic spin Hamiltonian (MSH) module in the CFA package. In this way, data on the distortions around the Cr3+ centers in YAB (and to a certain extent also for Mn2+ centers) obtained using the ZFSP data from EMR measurements may be correlated with data on the CF energy levels measured by optical spectroscopy. This modeling approach uncovers certain incompatibilities in the existing data for Cr3+:YAB, which call for reanalysis of the previous assignments of the energy levels observed in optical spectra and more accurate experimental data.

Crystallization and crystallographic studies of kallistatin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

2015-08-25

The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina.

PubMed

Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim

2005-06-01

Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Ab Initio Crystal Field for Lanthanides.

PubMed

Ungur, Liviu; Chibotaru, Liviu F

2017-03-13

An ab initio methodology for the first-principle derivation of crystal-field (CF) parameters for lanthanides is described. The methodology is applied to the analysis of CF parameters in [Tb(Pc) 2 ] - (Pc=phthalocyanine) and Dy 4 K 2 ([Dy 4 K 2 O(OtBu) 12 ]) complexes, and compared with often used approximate and model descriptions. It is found that the application of geometry symmetrization, and the use of electrostatic point-charge and phenomenological CF models, lead to unacceptably large deviations from predictions based on ab initio calculations for experimental geometry. It is shown how the predictions of standard CASSCF (Complete Active Space Self-Consistent Field) calculations (with 4f orbitals in the active space) can be systematically improved by including effects of dynamical electronic correlation (CASPT2 step) and by admixing electronic configurations of the 5d shell. This is exemplified for the well-studied Er-trensal complex (H 3 trensal=2,2',2"-tris(salicylideneimido)trimethylamine). The electrostatic contributions to CF parameters in this complex, calculated with true charge distributions in the ligands, yield less than half of the total CF splitting, thus pointing to the dominant role of covalent effects. This analysis allows the conclusion that ab initio crystal field is an essential tool for the decent description of lanthanides. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

NMR spectrum analysis for CrAs at ambient pressure

NASA Astrophysics Data System (ADS)

Kotegawa, H.; Nakahara, S.; Matsushima, K.; Tou, H.; Matsuoka, E.; Sugawara, H.; Harima, H.

2018-05-01

We report NMR spectrum analysis for CrAs, which was recently reported to be superconducting under pressure. The NMR spectrum obtained by the powdered single crystals shows a typical powder pattern reproduced by the electric field gradient (EFG) parameters and isotropic Knight shift, indicating anisotropy of Knight shift is not remarkable in CrAs. For the oriented sample, the spectrum can be understood by considering that the crystals are aligned for H ∥ b . The temperature dependence of Knight shift was successfully obtained from NMR spectrum with large nuclear quadrupole interaction.

The role of updraft velocity in temporal variability of cloud hydrometeor number

NASA Astrophysics Data System (ADS)

Sullivan, Sylvia; Nenes, Athanasios; Lee, Dong Min; Oreopoulos, Lazaros

2016-04-01

Significant effort has been dedicated to incorporating direct aerosol-cloud links, through parameterization of liquid droplet activation and ice crystal nucleation, within climate models. This significant accomplishment has generated the need for understanding which parameters affecting hydrometer formation drives its variability in coupled climate simulations, as it provides the basis for optimal parameter estimation as well as robust comparison with data, and other models. Sensitivity analysis alone does not address this issue, given that the importance of each parameter for hydrometer formation depends on its variance and sensitivity. To address the above issue, we develop and use a series of attribution metrics defined with adjoint sensitivities to attribute the temporal variability in droplet and crystal number to important aerosol and dynamical parameters. This attribution analysis is done both for the NASA Global Modeling and Assimilation Office Goddard Earth Observing System Model, Version 5 and the National Center for Atmospheric Research Community Atmosphere Model Version 5.1. Within the GEOS simulation, up to 48% of temporal variability in output ice crystal number and 61% in droplet number can be attributed to input updraft velocity fluctuations, while for the CAM simulation, they explain as much as 89% of the ice crystal number variability. This above results suggest that vertical velocity in both model frameworks is seen to be a very important (or dominant) driver of hydrometer variability. Yet, observations of vertical velocity are seldomly available (or used) to evaluate the vertical velocities in simulations; this strikingly contrasts the amount and quality of data available for aerosol-related parameters. Consequentially, there is a strong need for retrievals or measurements of vertical velocity for addressing this important knowledge gap that requires a significant investment and effort by the atmospheric community. The attribution metrics as a tool of understanding for hydrometer variability can be instrumental for understanding the source of differences between models used for aerosol-cloud-climate interaction studies.

Zr 2Ir 6B with an eightfold superstructure of the cubic perovskite-like boride ZrIr 3B 0.5: Synthesis, crystal structure and bonding analysis

NASA Astrophysics Data System (ADS)

Hermus, Martin; Fokwa, Boniface P. T.

2010-04-01

Single phase powder samples and single crystals of Zr 2Ir 6B were successfully synthesized by arc-melting the elements in a water-cooled copper crucible under an argon atmosphere. Superstructure reflections were observed both on powder and on single crystal diffraction data, leading to an eightfold superstructure of ZrIr 3B x phase. The new phase, which has a metallic luster, crystallizes in space group Fm3¯m (no. 225) with the lattice parameters a=7.9903(4) Å, V=510.14(4) Å 3. Its crystal structure was refined on the basis of powder as well as single crystal data. The single crystal refinement converged to R1=0.0239 and w R2=0.0624 for all 88 unique reflections and 6 parameters. Zr 2Ir 6B is isotypic to Ti 2Rh 6B and its structure can be described as a defect double perovskite, A2BB' O6, where the A site is occupied by zirconium, the B site by boron, the O site by iridium but the B' site is vacant, leading to the formation of empty and boron-filled octahedral Ir 6 clusters. According to the result of tight-binding electronic structure calculations, Ir-B and Ir-Zr interactions are mainly responsible for the structural stability of the phase. According to COHP bonding analysis, the strongest bonding occurs for the Ir-B contacts, and the Ir-Ir bonding within the empty clusters is two times stronger than that in the BIr 6 octahedra.

Production, purification, crystallization and preliminary X-ray analysis of adeno-associated virus serotype 8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric

2005-06-01

The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

PubMed

Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

2013-11-01

Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

PubMed Central

Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

2009-01-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

PubMed

Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

2009-10-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Hydrothermal Synthesis, Crystal Structure, and Photoluminescent Properties of Li[UO2(CH3COO)3]3[Co(H2O)6

NASA Astrophysics Data System (ADS)

AlDamen, Murad A.; Juwhari, Hassan K.; Al-zuheiri, Aya M.; Alnazer, Louy A.

2017-12-01

Single crystal of Li[UO2(CH3COO)3]3[Co(H2O)6] was prepared and found to crystallize in the monoclinic crystal system in the sp. gr. C2/ c, with Z = 2, and unit cell parameters a = 22.1857(15) Å, b = 13.6477(8) Å, c = 15.6921(10) Å, β = 117.842(9)°, V = 4201.3(4) Å3. The crystal was characterized by X-ray diffraction, Fourier transform infrared spectroscopy, and differential scanning calorimetry. The single crystal X-ray diffraction analysis revealed that the crystal has a lamellar structure in which a cobalt hydrate is sandwiched within the Li[UO2(CH3COO)3]3 2- chains. Furthermore, the room temperature photoluminescence spectrum of the complex was investigated in the solid state.

Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

2006-10-01

Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

Synthesis, structural, spectroscopic and optical studies of charge transfer complex salts.

PubMed

Manikandan, Maruthappan; Mahalingam, Thaiyan; Hayakawa, Yasuhiro; Ravi, Ganesan

2013-01-15

New charge transfer molecular complex adducts of picric acid (C6H3N3O7) with triethylamine (C6H15N) and dimethylformamide (HCON(CH3)2) were synthesized successfully for the first time. Chemical composition and stoichiometry of the synthesized complex salts were verified by CHN elemental analysis. Solubility of the complex salts have been determined by gravimetric method and single crystals of two new salts were grown by low temperature solution growth technique. Crystal system, crystalline nature and cell parameters of the grown crystals were determined by single crystal X-ray diffraction (SXRD) and powder X-ray diffraction (PXRD) analyses. The formations of the charge-transfer complex, functional groups and the modes of vibrations have been confirmed by Fourier transform infrared (FTIR) spectroscopy. In order to know the linear and nonlinear optical suitability for device fabrication, UV-Vis (UV) spectral analysis and relative second harmonic generation (SHG) efficiency test were performed for the grown crystals. Copyright © 2012 Elsevier B.V. All rights reserved.

Synthesis, structural, spectroscopic and optical studies of charge transfer complex salts

NASA Astrophysics Data System (ADS)

Manikandan, Maruthappan; Mahalingam, Thaiyan; Hayakawa, Yasuhiro; Ravi, Ganesan

2013-01-01

New charge transfer molecular complex adducts of picric acid (C6H3N3O7) with triethylamine (C6H15N) and dimethylformamide (HCON(CH3)2) were synthesized successfully for the first time. Chemical composition and stoichiometry of the synthesized complex salts were verified by CHN elemental analysis. Solubility of the complex salts have been determined by gravimetric method and single crystals of two new salts were grown by low temperature solution growth technique. Crystal system, crystalline nature and cell parameters of the grown crystals were determined by single crystal X-ray diffraction (SXRD) and powder X-ray diffraction (PXRD) analyses. The formations of the charge-transfer complex, functional groups and the modes of vibrations have been confirmed by Fourier transform infrared (FTIR) spectroscopy. In order to know the linear and nonlinear optical suitability for device fabrication, UV-Vis (UV) spectral analysis and relative second harmonic generation (SHG) efficiency test were performed for the grown crystals.

Cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from Thalictrum flavum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pasquo, Alessandra; Bonamore, Alessandra; Franceschini, Stefano

The cloning, expression, crystallization and preliminary X-ray data analysis of norcoclaurine synthase from T. flavum, a protein which catalyzes the first committed step in the biosynthesis of benzylisoquinoline alkaloids, are reported. Norcoclaurine synthase (NCS) catalyzes the condensation of 3,4-dihydroxyphenylethylamine (dopamine) and 4-hydroxyphenylacetaldehyde (4-HPAA) as the first committed step in the biosynthesis of benzylisoquinoline alkaloids in plants. The protein was cloned, expressed and purified. Crystals were obtained at 294 K by the hanging-drop vapour-diffusion method using ammonium sulfate and sodium chloride as precipitant agents and diffract to better than 3.0 Å resolution using a synchrotron-radiation source. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 86.31, c = 118.36 Å. A selenomethionine derivative was overexpressed, purified and crystallized in the same space group. A complete MAD data set was collected at 2.7 Å resolution. The model is under construction.« less

Monte Carlo analysis of neutron diffuse scattering data

NASA Astrophysics Data System (ADS)

Goossens, D. J.; Heerdegen, A. P.; Welberry, T. R.; Gutmann, M. J.

2006-11-01

This paper presents a discussion of a technique developed for the analysis of neutron diffuse scattering data. The technique involves processing the data into reciprocal space sections and modelling the diffuse scattering in these sections. A Monte Carlo modelling approach is used in which the crystal energy is a function of interatomic distances between molecules and torsional rotations within molecules. The parameters of the model are the spring constants governing the interactions, as they determine the correlations which evolve when the model crystal structure is relaxed at finite temperature. When the model crystal has reached equilibrium its diffraction pattern is calculated and a χ2 goodness-of-fit test between observed and calculated data slices is performed. This allows a least-squares refinement of the fit parameters and so automated refinement can proceed. The first application of this methodology to neutron, rather than X-ray, data is outlined. The sample studied was deuterated benzil, d-benzil, C14D10O2, for which data was collected using time-of-flight Laue diffraction on SXD at ISIS.

Synthesis, Crystal Structure, and Topology-Symmetry Analysis of a New Modification of NaIn[IO3]4

NASA Astrophysics Data System (ADS)

Belokoneva, E. L.; Karamysheva, A. S.; Dimitrova, O. V.; Volkov, A. S.

2018-01-01

Crystals of new iodate NaIn[IO3]4 were prepared by the hydrothermal synthesis. The unit cell parameters are a = 7.2672(2) Å, b = 15.2572(6) Å, c = 15.0208(6) Å, β = 101.517(3)°, sp. gr. P21/ c. The formula was determined during the structure determination and refinement of a twinned crystal based on a set of reflections from the atomic planes of the major individual. The refinement with anisotropic displacement parameters was performed for both twin components to the final R factor of 0.050. The In and Na atoms are in octahedral coordination formed by oxygen atoms. The oxygen octahedra are arranged into columns by sharing edges, and the columns are connected by isolated umbrella-like [IO3]- groups to form layers. The new structure is most similar to the isoformular iodate NaIn[IO3]4, which crystallizes in the same sp. gr. P21/ c and is structurally similar, but has a twice smaller unit cell and is characterized by another direction of the monoclinic axis. The structural similarity and difference between the two phases were studied by topologysymmetry analysis. The formation of these phases is related to different combinations of identical one-dimensional infinite chains of octahedra.

Effects of low molecular sugars on the retrogradation of tapioca starch gels during storage

PubMed Central

Li, Rongfang; Kang, Huaibin; Luo, Denglin; Fan, Jinling; Zhu, Wenxue; Liu, Xinfang; Tong, Qunyi

2017-01-01

The effects of low molecular sugars (sucrose, glucose and trehalose) on the retrogradation of tapioca starch (TS) gels stored at 4°C for different periods were examined with different methods. Decrease in melting enthalpy (ΔHmelt) were obtained through differential scanning calorimetry analysis. Analysis of decrease in crystallization rate constant (k) and increase in semi-crystallization time (τ1/2) results obtained from retrogradation kinetics indicated that low molecular sugars could retard the retrogradation of TS gels and further revealed trehalose as the best inhibitor among the sugars used in this study. Fourier transform infrared (FTIR) analysis indicated that the intensity ratio of 1047 to 1022 cm−1 was increased with the addition of sugars in the order of trehalose > sucrose > glucose. Decrease in hardness parameters and increase in springiness parameters obtained from texture profile analysis (TPA) analysis also indicated that low molecular sugars could retard the retrogradation of TS gels. The results of FTIR and TPA showed a consistent sugar effect on starch retrogradation with those of DSC and retrogradation kinetics analysis. PMID:29284007

Effects of low molecular sugars on the retrogradation of tapioca starch gels during storage.

PubMed

Zhang, Xiaoyu; Li, Rongfang; Kang, Huaibin; Luo, Denglin; Fan, Jinling; Zhu, Wenxue; Liu, Xinfang; Tong, Qunyi

2017-01-01

The effects of low molecular sugars (sucrose, glucose and trehalose) on the retrogradation of tapioca starch (TS) gels stored at 4°C for different periods were examined with different methods. Decrease in melting enthalpy (ΔHmelt) were obtained through differential scanning calorimetry analysis. Analysis of decrease in crystallization rate constant (k) and increase in semi-crystallization time (τ1/2) results obtained from retrogradation kinetics indicated that low molecular sugars could retard the retrogradation of TS gels and further revealed trehalose as the best inhibitor among the sugars used in this study. Fourier transform infrared (FTIR) analysis indicated that the intensity ratio of 1047 to 1022 cm-1 was increased with the addition of sugars in the order of trehalose > sucrose > glucose. Decrease in hardness parameters and increase in springiness parameters obtained from texture profile analysis (TPA) analysis also indicated that low molecular sugars could retard the retrogradation of TS gels. The results of FTIR and TPA showed a consistent sugar effect on starch retrogradation with those of DSC and retrogradation kinetics analysis.

Synthesis, growth, structural characterization, Hirshfeld analysis and nonlinear optical studies of a methyl substituted chalcone

NASA Astrophysics Data System (ADS)

Prabhu, Shobha R.; Jayarama, A.; Chandrasekharan, K.; Upadhyaya, V.; Ng, Seik Weng

2017-05-01

A new chalcone compound (2E)-3-(3-methylphenyl)-1-(4-nitrophenyl)prop-2-en-1-one (3MPNP) with molecular formula C16H13NO3 has been synthesized and crystallized by slow solvent evaporation technique. The Fourier transform infrared, Fourier transform Raman and nuclear magnetic resonance techniques were used for structural characterization. UV-visible absorption studies were carried out to study the transparency of the crystal in the visible region. Differential scanning calorimetry study shows thermal stability of crystals up to temperature 122 °C. Single crystal X-ray diffraction and powder X-ray diffraction techniques were used to study crystal structure and cell parameters. The Hirshfeld surface and 2-D fingerprint analysis were performed to study the nature of interactions and their quantitative contributions towards the crystal packing. The third order non-linear optical properties have been studied using single beam Z-scan technique and the results show that the material is a potential candidate for optical device applications such as optical limiters and optical switches.

Synthesis and physicochemical properties of bis(L-asparaginato) zinc(II): A promising new semiorganic crystal with high laser damage threshold for shorter wavelength generation

NASA Astrophysics Data System (ADS)

Subhashini, R.; Arjunan, S.

2018-05-01

An exceedingly apparent nonlinear semiorganic optical crystals of bis(L-asparaginato)zinc(II) [BLAZ], was synthesized by a traditional slow evaporation solution growth technique. The cell parameters were estimated from single crystal X-ray diffraction analysis. Spectroscopic study substantiates the presence of functional groups. The UV spectrum shows the sustenance of wide transparency window and several optical constants, such as extinction coefficient (K), refractive index, optical conductivity and electric susceptibility with real and imaginary parts of dielectric constant were calculated using the transmittance data. The fluorescence emission spectrum of the crystal pronounces red emission. The laser induced surface damage threshold of the crystal was measured using Nd:YAG laser. The output intensity of second harmonic generation was estimated using the Kurtz and Perry powder method. The hardness stability was investigated by Vickers microhardness test. The decomposition and thermal stability of the compound were scrutinized by TGA-DSC studies. Dielectric studies were carried out to anatomize the electrical properties of the crystal. SEM analysis reveals the existence of minute crystallites on the growth surface.

Influence of NiO on the crystallization kinetics of near stoichiometric cordierite glasses nucleated with TiO2

NASA Astrophysics Data System (ADS)

Goel, Ashutosh; Shaaban, Essam R.; Ribeiro, Manuel J.; Melo, Francisco C. L.; Ferreira, José M. F.

2007-09-01

This work presents the effect of NiO on the thermal behavior and the crystallization kinetics of glasses lying near the stoichiometric cordierite composition nucleated with TiO2. Three glasses with NiO content varying between 1 and 5 mol% have been synthesized in Pt crucibles. Activation energies for structural relaxation and viscous flow have been calculated using the data obtained from differential thermal analysis (DTA). Kinetic fragility of the glasses along with other thermal parameters has been calculated. Non-isothermal crystallization kinetic studies have been employed to study the mechanism of crystallization in all three glasses. The crystallization sequence in the glasses has been followed by x-ray diffraction analysis of the heat treated glass samples in the temperature range of 800-1200 °C. μ-cordierite has been observed to be the first crystalline phase in all the glass samples after heat treatment at 850 °C, while NiO plays an important role in determining the crystallization sequence at higher temperatures, leading to the formation of α-cordierite.

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Crystallization and preliminary X-ray diffraction analysis of ω-amino acid:pyruvate transaminase from Chromobacterium violaceum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sayer, Christopher; Isupov, Michail N.; Littlechild, Jennifer A., E-mail: j.a.littlechild@exeter.ac.uk

2007-02-01

An ω-amino acid:pyruvate transaminase from C. violaceum has been purified and crystallized in two crystal forms. The structure has been solved using molecular replacement. The enzyme ω-transaminase catalyses the conversion of chiral ω-amines to ketones. The recombinant enzyme from Chromobacterium violaceum has been purified to homogeneity. The enzyme was crystallized from PEG 4000 using the microbatch method. Data were collected to 1.7 Å resolution from a crystal belonging to the triclinic space group P1, with unit-cell parameters a = 58.9, b = 61.9, c = 63.9 Å, α = 71.9, β = 87.0, γ = 74.6°. Data were also collectedmore » to 1.95 Å from a second triclinic crystal form. The structure has been solved using the molecular-replacement method.« less

Crystal-Chemical Analysis of Soil at Rocknest, Gale Crater

NASA Technical Reports Server (NTRS)

Morrison, S. M.; Downs, R. T.; Blake, D. F.; Bish, D. L.; Ming, D. W.; Morris, R. V.; Yen, A. S.; Chipera, S. J.; Treiman, A. H.; Vaniman, D. T.;

Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

2006-06-01

Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo

2006-05-01

The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2{sub 1} and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, bmore » = 108.3, c = 149.5 Å, β = 91.5°.« less

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

2008-08-01

Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Crystallization and preliminary X-ray crystallographic analysis of Escherichia coli glutaredoxin 2 in complex with glutathione and of a cysteine-less variant without glutathione

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, Ju; Ye, Jun; Rosen, Barry P., E-mail: brosen@med.wayne.edu

2007-04-01

Glutaredoxin 2 from E. coli was cocrystallized with glutathione and data were collected to 1.60 Å. A mutant with the active-site residues Cys9 and Cys12 changed to serine was crystallized in the absence of glutathione and data were collected to 2.4 Å. Glutaredoxin 2 (Grx2) from Escherichia coli is larger in size than classical glutaredoxins. It is extremely efficient in the catalysis of reduced glutathione-dependent disulfide reduction. A complex of Grx2 with reduced glutathione (GSH) has been crystallized. Data were collected to 1.60 Å. The crystals belong to space group P3{sub 2}21, with one Grx2–GSH complex in the asymmetric unit.more » The unit-cell parameters are a = b = 50.10, c = 152.47 Å. A Grx2 mutant, C9S/C12S, which cannot form a disulfide bond with GSH was also crystallized. The crystals diffracted to 2.40 Å and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with one molecule in the asymmetric unit. The unit-cell parameters are a = 28.16, b = 78.65, c = 89.16 Å.« less

Crystal structure, vibrational, spectral investigation, quantum chemical DFT calculations and thermal behavior of Diethyl [hydroxy (phenyl) methyl] phosphonate

NASA Astrophysics Data System (ADS)

Ouksel, Louiza; Chafaa, Salah; Bourzami, Riadh; Hamdouni, Noudjoud; Sebais, Miloud; Chafai, Nadjib

2017-09-01

Single Diethyl [hydroxy (phenyl) methyl] phosphonate (DHPMP) crystal with chemical formula C11H17O4P, was synthesized via the base-catalyzed Pudovik reaction and Lewis acid as catalyst. The results of SXRD analyzes indicate that this compound crystallizes into a mono-clinic system with space group P21/n symmetry and Z = 4. The crystal structure parameters are a = 9.293 Å, b = 8.103 Å, c = 17.542 Å, β = 95.329° and V = 1315.2 Å3, the structure displays one inter-molecular O-H⋯O hydrogen bonding. The UV-Visible absorption spectrum shows that the crystal exhibits a good optical transmission in the visible domain, and strong absorption in middle ultraviolet one. The vibrational frequencies of various functional groups present in DHPMP crystal have been deduced from FT-IR and FT-Raman spectra and then compared with theoretical values performed with DFT (B3LYP) method using 6-31G (p, d) basis sets. Chemical and thermodynamic parameters such as: ionization potential (I), electron affinity (A), hardness (σ), softness (η), electronegativity (χ) and electrophilicity index (ω), are also calculated using the same theoretical method. The thermal decomposition behavior of DHPMP, studied by using thermogravimetric analysis (TDG), shows a thermal stability until to 125 °C.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ramadhar, Timothy R.; Zheng, Shao-Liang; Chen, Yu-Sheng

This report describes complete practical guidelines and insights for the crystalline sponge method, which have been derived through the first use of synchrotron radiation on these systems, and includes a procedure for faster synthesis of the sponges. These guidelines will be applicable to crystal sponge data collected at synchrotrons or in-house facilities, and will allow researchers to obtain reliable high-quality data and construct chemically and physically sensible models for guest structural determination. A detailed set of synthetic and crystallographic guidelines for the crystalline sponge method based upon the analysis of expediently synthesized crystal sponges using third-generation synchrotron radiation are reported.more » The procedure for the synthesis of the zinc-based metal–organic framework used in initial crystal sponge reports has been modified to yield competent crystals in 3 days instead of 2 weeks. These crystal sponges were tested on some small molecules, with two being unexpectedly difficult cases for analysis with in-house diffractometers in regard to data quality and proper space-group determination. These issues were easily resolved by the use of synchrotron radiation using data-collection times of less than an hour. One of these guests induced a single-crystal-to-single-crystal transformation to create a larger unit cell with over 500 non-H atoms in the asymmetric unit. This led to a non-trivial refinement scenario that afforded the best Flack x absolute stereochemical determination parameter to date for these systems. The structures did not require the use of PLATON/SQUEEZE or other solvent-masking programs, and are the highest-quality crystalline sponge systems reported to date where the results are strongly supported by the data. A set of guidelines for the entire crystallographic process were developed through these studies. In particular, the refinement guidelines include strategies to refine the host framework, locate guests and determine occupancies, discussion of the proper use of geometric and anisotropic displacement parameter restraints and constraints, and whether to perform solvent squeezing/masking. The single-crystal-to-single-crystal transformation process for the crystal sponges is also discussed. The presented general guidelines will be invaluable for researchers interested in using the crystalline sponge method at in-house diffraction or synchrotron facilities, will facilitate the collection and analysis of reliable high-quality data, and will allow construction of chemically and physically sensible models for guest structural determination.« less

Growth, spectral, thermal, dielectric, mechanical, linear and nonlinear optical, birefringence, laser damage threshold studies of semi-organic crystal: dibrucinium sulfate heptahydrate.

PubMed

Krishnan, P; Gayathri, K; Bhagavannarayana, G; Jayaramakrishnan, V; Gunasekaran, S; Anbalagan, G

2013-08-01

Dibrucinium sulfate heptahydrate (DBSH), a semi-organic nonlinear optical material, has been synthesized and single crystals were grown from water-ethanol solution at room temperature up to dimensions of 10×7×2 mm(3). The unit cell parameters were determined from single crystal and powder X-ray diffraction studies. The structural perfection of the grown crystal has been analyzed by high-resolution X-ray diffraction (HRXRD) study. FTIR and Raman studies were performed to identify the functional groups present in the title compound. The activation energy (E), entropy (ΔS), enthalpy (ΔH) and Gibbs free energy (ΔG), of the thermal decomposition reaction have been derived from thermo gravimetric (TGA) and differential thermal (DTA) analysis curves, using Coats-Redfern method. The variation of dielectric properties of the grown crystal with respect to frequency has been investigated at different temperatures. Microhardness measurements revealed the mechanical strength of grown crystal. The optical parameters, the optical band gap E(g) and width of localized states Eu were determined using the transmittance data in the spectral range 200-800 nm. The relative second harmonic efficiency of the compound is found to be 1.4 times greater than that of KDP. Birefringence and Laser damage threshold studies were carried out for the grown crystal. Copyright © 2013 Elsevier B.V. All rights reserved.

Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

PubMed

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

2015-09-01

Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

Tools for magnetostructural correlations for the 3d8(3A2 state) ions at orthorhombic sites: Comparative study with applications to Ni2+ ions in Y2BaNiO5 and Nd2BaNiO5

NASA Astrophysics Data System (ADS)

Gnutek, P.; Açıkgöz, M.; Rudowicz, C.

2015-01-01

Three approaches are employed to study magnetostructural correlations for the 3d8(3A2 state) ions at orthorhombic sites in crystals: (i) the higher-order perturbation theory (PT) of the microscopic spin Hamiltonian (MSH) parameters, (ii) the crystal field (CF) analysis (CFA) within all 3d8 states combined with the superposition model (SPM) calculations of CF parameters, and (iii) the second-order PT of MSH parameters. A comparative study is carried out to assess the merit of each modeling approach. These approaches enable predictions of the orthorhombic zero-field splitting parameters (ZFSPs) for the 3d8 ions at orthorhombic sites. Hence, correlation of the magnetic and spectroscopic properties with the structural ones may be considered. The approach (i) and (iii) take into account only the spin-orbit coupling (SOC) and a limited set of low lying states. Analysis of the expressions used in the approach (i) reveals discrepancies concerning: the sign of the SOC parameter, the cubic crystal field parameter Dq, the energy levels sequence, and numerical errors, which diminish its reliability. The distinction between the first- and second-kind orthorhombic symmetry is also elucidated. The approaches (i)-(iii) are applied for Ni2+ (S=1) ions in the Haldane gap systems Y2BaNiO5 and Nd2BaNiO5. The contributions to the ZFSPs due to the spin-spin and spin-other-orbit interactions considered using the approach (ii) are found nearly insignificant as compared with the dominant SOC ones. The results indicate that the approach (i)-corrected and (iii) may be employed only as an approximation. The approach (ii) together with the SPM/CFP modeling appear to be preferable and more reliable tools to study magnetostructural correlations and thus spectroscopic and magnetic properties of the 3d8(3A2 state) ions at orthorhombic sites in crystals.

Kinetic transition in the order-disorder transformation at a solid/liquid interface

NASA Astrophysics Data System (ADS)

Galenko, P. K.; Nizovtseva, I. G.; Reuther, K.; Rettenmayr, M.

2018-01-01

Phase-field analysis for the kinetic transition in an ordered crystal structure growing from an undercooled liquid is carried out. The results are interpreted on the basis of analytical and numerical solutions of equations describing the dynamics of the phase field, the long-range order parameter as well as the atomic diffusion within the crystal/liquid interface and in the bulk crystal. As an example, the growth of a binary A50B50 crystal is described, and critical undercoolings at characteristic changes of growth velocity and the long-range order parameter are defined. For rapidly growing crystals, analogies and qualitative differences are found in comparison with known non-equilibrium effects, particularly solute trapping and disorder trapping. The results and model predictions are compared qualitatively with results of the theory of kinetic phase transitions (Chernov 1968 Sov. Phys. JETP 26, 1182-1190) and with experimental data obtained for rapid dendritic solidification of congruently melting alloy with order-disorder transition (Hartmann et al. 2009 Europhys. Lett. 87, 40007 (doi:10.1209/0295-5075/87/40007)). This article is part of the theme issue `From atomistic interfaces to dendritic patterns'.

Effects of Borax on the Reduction of Pre-oxidized Panzhihua Ilmenite

NASA Astrophysics Data System (ADS)

Guo, Yufeng; Zheng, Fuqiang; Jiang, Tao; Chen, Feng; Wang, Shuai; Qiu, Guanzhou

2018-01-01

The effects of borax (sodium borate) on the enhancement reduction of pre-oxidized Panzhihua ilmenite were investigated. The effects of borax on the mineral phase transformation, microstructures, crystal cell parameter, melting point and Mg distribution were studied to reveal the mechanism of enhancement reduction. Under the constant reduction conditions, the borax could reduce the reduction activation energy of pre-oxidized ilmenite. The reduction kinetics analysis indicated that the reduction rate was controlled by interfacial chemical reaction. The reduction activation energy of the pre-oxidized ilmenite with 4% borax was 80.263 kJ/mol, which was 28.585 kJ/mol less than that of the pre-oxidized ilmenite without borax. Borax could eliminate the migration of Mg into the reduced particle center. The crystal cell parameter of the reduced product was increased by adding borax. Borax could improve the growth of dendritic crystals in the pre-oxidized ilmenite.

Crucial role of molecular planarity on the second order nonlinear optical property of pyridine based chalcone single crystals

NASA Astrophysics Data System (ADS)

Menezes, Anthoni Praveen; Jayarama, A.; Ng, Seik Weng

2015-05-01

An efficient nonlinear optical material 2E-3-(4-bromophenyl)-1-(pyridin-3-yl) prop-2-en-1-one (BPP) was synthesized and single crystals were grown using slow evaporation solution growth technique at room temperature. Grown crystal had prismatic morphology and its structure was confirmed by various spectroscopic studies, elemental analysis, and single crystal X-ray diffraction (XRD) technique. The single crystal XRD of the crystal showed that BPP crystallizes in monoclinic system with noncentrosymmetric space group P21 and the cell parameters are a = 5.6428(7) Å, b = 3.8637(6) Å, c = 26.411(2) Å, β = 97.568(11) deg and v = 575.82(12) Å3. The UV-Visible spectrum reveals that the crystal is optically transparent and has high optical energy band gap of 3.1 eV. The powder second harmonic generation efficiency (SHG) of BPP is 6.8 times that of KDP. From thermal analysis it is found that the crystal melts at 139 °C and decomposes at 264 °C. High optical transparency down to blue region, higher powder SHG efficiency and better thermal stability than that of urea makes this chalcone derivative a promising candidate for SHG applications. Furthermore, effect of molecular planarity on SHG efficiency and role of pyridine ring adjacent to carbonyl group in forming noncentrosymmetric crystal systems of chalcone family is also discussed.

Effect of amino acid doping on the growth and ferroelectric properties of triglycine sulphate single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raghavan, C.M.; Sankar, R.; Mohan Kumar, R.

2008-02-05

Effect of amino acids (L-leucine and isoleucine) doping on the growth aspects and ferroelectric properties of triglycine sulphate crystals has been studied. Pure and doped crystals were grown from aqueous solution by low temperature solution growth technique. The cell parameter values were found to significantly vary for doped crystals. Fourier transform infrared analysis confirmed the presence of functional groups in the grown crystal. Morphology study reveals that amino acid doping induces faster growth rate along b-direction leading to a wide b-plane and hence suitable for pyroelectric detector applications. Ferroelectric domain structure has been studied by atomic force microscopy and hysteresismore » measurements reveal an increase of coercive field due to the formation of single domain pattern.« less

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

PubMed Central

Nango, Eriko; Kumasaka, Takashi; Sato, Takao; Tanaka, Nobuo; Kakinuma, Katsumi; Eguchi, Tadashi

2005-01-01

A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P21, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V M) of 2.89 Å3 Da−1 and a solvent constant of 57.4% by volume. PMID:16511136

Effect of L-aspartic acid on the growth, structure and spectral studies of Zinc (tris) Thiourea Sulphate (ZTS) single crystals

NASA Astrophysics Data System (ADS)

Samuel, Bincy Susan; Krishnamurthy, R.; Rajasekaran, R.

2014-11-01

Single crystals of pure and L-aspartic acid doped Zinc (Tris) Thiourea Sulphate (ZTS) were grown from aqueous solution by solution growth method. The cell parameters and structure of the grown crystals were determined by X-ray diffraction studies. The presence of functional group in the compound has been confirmed by FTIR and FT-Raman analysis. The optical transparency range has been studied through UV-Vis spectroscopy. TGA/DTA studies show thermal stability of the grown crystals. Microhardness study reveals that the hardness number (Hv) increases with load for pure and doped ZTS crystals. Dielectric studies have been carried out and the results are discussed. The second harmonic generation was confirmed for L-aspartic acid doped ZTS which is greater than pure ZTS.

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Charge-Transfer Analysis of 2p3d Resonant Inelastic X-ray Scattering of Cobalt Sulfide and Halides

PubMed Central

2017-01-01

We show that with 2p3d resonant inelastic X-ray scattering (RIXS) we can accurately determine the charge-transfer parameters of CoF2, CoCl2, CoBr2, and CoS. The 160 meV resolution RIXS results are compared with charge-transfer multiplet calculations. The improved resolution and the direct observation of the crystal field and charge-transfer excitations allow the determination of more accurate parameters than could be derived from X-ray absorption and X-ray photoemission, both limited in resolution by their lifetime broadening. We derive the crystal field and charge-transfer parameters of the Co2+ ions, which provides the nature of the ground state of the Co2+ ions with respect to symmetry and hybridization. In addition, the increased spectral resolution allows the more accurate determination of the atomic Slater integrals. The results show that the crystal field energy decreases with increasing ligand covalency. The L2 edge RIXS spectra show that the intensity of the (Coster–Kronig induced) nonresonant X-ray emission is a measure of ligand covalency. PMID:29170686

Understanding the importance of the temperature dependence of viscosity on the crystallization dynamics in the Ge2Sb2Te5 phase-change material

NASA Astrophysics Data System (ADS)

Aladool, A.; Aziz, M. M.; Wright, C. D.

2017-06-01

The crystallization dynamics in the phase-change material Ge2Sb2Te5 is modelled using the more detailed Master equation method over a wide range of heating rates commensurate with published ultrafast calorimetry experiments. Through the attachment and detachment of monomers, the Master rate equation naturally traces nucleation and growth of crystallites with temperature history to calculate the transient distribution of cluster sizes in the material. Both the attachment and detachment rates in this theory are strong functions of viscosity, and thus, the value of viscosity and its dependence on temperature significantly affect the crystallization process. In this paper, we use the physically realistic Mauro-Yue-Ellison-Gupta-Allan viscosity model in the Master equation approach to study the role of the viscosity model parameters on the crystallization dynamics in Ge2Sb2Te5 under ramped annealing conditions with heating rates up to 4 × 104 K/s. Furthermore, due to the relatively low computational cost of the Master equation method compared to atomistic level computations, an iterative numerical approach was developed to fit theoretical Kissinger plots simulated with the Master equation system to experimental Kissinger plots from ultrafast calorimetry measurements at increasing heating rates. This provided a more rigorous method (incorporating both nucleation and growth processes) to extract the viscosity model parameters from the analysis of experimental data. The simulations and analysis revealed the strong coupling between the glass transition temperature and fragility index in the viscosity and crystallization models and highlighted the role of the dependence of the glass transition temperature on the heating rate for the accurate estimation of the fragility index of phase-change materials from the analysis of experimental measurements.

Crystallization and preliminary X-ray crystallographic analysis of agkicetin-C from Deinagkistrodon acutus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Gufeng; Departments of Molecular and Cell Biology, School of Life Sciences, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026; Huang, Qingqiu

2005-01-01

The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. Crystals of agkicetin-C suitable for structure determination were obtained from 1.8 M ammonium sulfate, 40 mM MES pH 6.5 with 2%(v/v) PEG 400. Interestingly, low buffer concentrations of MES seem to be necessary for crystal growth. The crystals of agkicetin-C belong tomore » space group C2, with unit-cell parameters a = 177.5, b = 97.7, c = 106.8 Å, β = 118.5°, and diffract to 2.4 Å resolution. Solution of the phase problem by the molecular-replacement method shows that there are four agkicetin-C molecules in the asymmetric unit, with a V{sub M} value of 3.4 Å{sup 3} Da{sup −1}, which corresponds to a high solvent content of approximately 64%. Self-rotation function calculations show a single well defined non-crystallographic twofold axis with features that may represent additional elements of non-crystallographic symmetry.« less

Developments in the Implementation of Acoustic Droplet Ejection for Protein Crystallography.

PubMed

Wu, Ping; Noland, Cameron; Ultsch, Mark; Edwards, Bonnie; Harris, David; Mayer, Robert; Harris, Seth F

2016-02-01

Acoustic droplet ejection (ADE) enables crystallization experiments at the low-nanoliter scale, resulting in rapid vapor diffusion equilibration dynamics and efficient reagent usage in the empirical discovery of structure-enabling protein crystallization conditions. We extend our validation of this technology applied to the diverse physicochemical property space of aqueous crystallization reagents where dynamic fluid analysis coupled to ADE aids in accurate and precise dispensations. Addition of crystallization seed stocks, chemical additives, or small-molecule ligands effectively modulates crystallization, and we here provide examples in optimization of crystal morphology and diffraction quality by the acoustic delivery of ultra-small volumes of these cofactors. Additional applications are discussed, including set up of in situ proteolysis and alternate geometries of crystallization that leverage the small scale afforded by acoustic delivery. Finally, we describe parameters of a system of automation in which the acoustic liquid handler is integrated with a robotic arm, plate centrifuge, peeler, sealer, and stacks, which allows unattended high-throughput crystallization experimentation. © 2015 Society for Laboratory Automation and Screening.

Growth and characterization of Melaminium bis (trichloroacetate) dihydrate

NASA Astrophysics Data System (ADS)

Kanagathara, N.; Renganathan, N. G.; Marchewka, M. K.; Sivakumar, N.; Gayathri, K.; Krishnan, P.; Gunasekaran, S.; Anbalagan, G.

2013-01-01

Single crystals of melaminium bis (trichloroacetate) dihydrate have been grown successfully by slow evaporation solution growth technique at room temperature. Single crystal X-ray diffraction analysis reveals that the compound crystallizes in monoclinic system with non -centrosymmetric space group C2 with lattice parameters a = 17.70 Å, b = 8.44 Å, c = 6.09 Å, α = 90°, β = 100.24°, γ = 90° and V = 900 (Å)3. The UV-Vis transmittance spectrum shows that the crystal has a good optical transmittance in the entire visible region with lower cutoff wavelength of 351 nm. The vibrational frequencies of various functional groups present in the crystal have been derived from FI-IR, FT-Raman and Confocal Raman analyses. The chemical structure of the compound was established by 1H and 13C NMR spectrum. TGA-DTA analysis reveals that the materials have good thermal stability and the melting point of the crystal is found to be 195 °C. The dielectric response of the crystals was studied in the frequency range 50 Hz to 5 MHz at different temperatures and the results are discussed. Etching studies show the growth pattern of the crystals. The second harmonic generation efficiency was measured in comparison with KDP by employing powder Kurtz method.

Quantitative analysis of crystalline pharmaceuticals in tablets by pattern-fitting procedure using X-ray diffraction pattern.

PubMed

Takehira, Rieko; Momose, Yasunori; Yamamura, Shigeo

2010-10-15

A pattern-fitting procedure using an X-ray diffraction pattern was applied to the quantitative analysis of binary system of crystalline pharmaceuticals in tablets. Orthorhombic crystals of isoniazid (INH) and mannitol (MAN) were used for the analysis. Tablets were prepared under various compression pressures using a direct compression method with various compositions of INH and MAN. Assuming that X-ray diffraction pattern of INH-MAN system consists of diffraction intensities from respective crystals, observed diffraction intensities were fitted to analytic expression based on X-ray diffraction theory and separated into two intensities from INH and MAN crystals by a nonlinear least-squares procedure. After separation, the contents of INH were determined by using the optimized normalization constants for INH and MAN. The correction parameter including all the factors that are beyond experimental control was required for quantitative analysis without calibration curve. The pattern-fitting procedure made it possible to determine crystalline phases in the range of 10-90% (w/w) of the INH contents. Further, certain characteristics of the crystals in the tablets, such as the preferred orientation, size of crystallite, and lattice disorder were determined simultaneously. This method can be adopted to analyze compounds whose crystal structures are known. It is a potentially powerful tool for the quantitative phase analysis and characterization of crystals in tablets and powders using X-ray diffraction patterns. Copyright 2010 Elsevier B.V. All rights reserved.

Crystallization and identification of the glycosylated moieties of two isoforms of the main allergen Hev b 2 and preliminary X-ray analysis of two polymorphs of isoform II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.

2007-09-01

Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less

Combining 27Al Solid-State NMR and First-Principles Simulations To Explore Crystal Structure in Disordered Aluminum Oxynitride.

PubMed

Tu, Bingtian; Liu, Xin; Wang, Hao; Wang, Weimin; Zhai, Pengcheng; Fu, Zhengyi

2016-12-19

The nuclear magnetic resonance (NMR) technique gives insight into the local information in a crystal structure, while Rietveld refinement of powder X-ray diffraction (PXRD) sketches out the framework of a crystal lattice. In this work, first-principles calculations were combined with the solid-state NMR technique and Rietveld refinement to explore the crystal structure of a disordered aluminum oxynitride (γ-alon). The theoretical NMR parameters (chemical shift, δ iso , quadrupolar coupling constants, C Q , and asymmetry parameter, η) of Al 22.5 O 28.5 N 3.5 , predicted by the gauge-including projector augmented wave (GIPAW) algorithm, were used to facilitate the analytical investigation of the 27 Al magic-angle spinning (MAS) NMR spectra of the as-prepared sample, whose formula was confirmed to be Al 2.811 O 3.565 N 0.435 by quantitative analysis. The experimental δ iso , C Q , and η of 27 Al showed a small discrepancy compared with theoretical models. The ratio of aluminum located at the 8a to 16d sites was calculated to be 0.531 from the relative integration of peaks in the 27 Al NMR spectra. The occupancies of aluminum at the 8a and 16d positions were determined through NMR investigations to be 0.9755 and 0.9178, respectively, and were used in the Rietveld refinement to obtain the lattice parameter and anion parameter of Al 2.811 O 3.565 N 0.435 . The results from 27 Al NMR investigations and PXRD structural refinement complemented each other. This work provides a powerful and accessible strategy to precisely understand the crystal structure of novel oxynitride materials with multiple disorder.

Synthesis, growth, structural and optical studies of organic nonlinear optical material--piperazine-1,4-diium bis 2,4,6-trinitrophenolate.

PubMed

Suguna, S; Anbuselvi, D; Jayaraman, D; Nagaraja, K S; Jeyaraj, B

2014-11-11

Piperazine-1,4-diium bis 2,4,6-trinitrophenolate is one of the useful organic materials with nonlinear optical (NLO) and pharmaceutical applications. The material was grown by slow evaporation solution growth method at room temperature. The crystal system and lattice parameters were identified by single crystal XRD analysis. The grown material crystallizes in monoclinic system with P21/n space group. The main functional groups NH2, NO2, CN, CC, and phenolic 'O' atom were identified using FTIR analysis. The protons and carbons of grown crystal with various chemical environments were studied by 1H and 13C NMR spectroscopy to confirm the molecular structure. The optical properties of the crystal were studied by UV-vis-NIR spectroscopy and the transmission 100% range starts from 532 nm onwards. The optical band gap was measured as 2.63 eV from the plot of (αhν)2 versus hν. The thermal stability was detected at 304.1°C using TG-DTA analysis. The dielectric studies of the sample were carried out at different temperatures in the frequency range from 50 Hz to 5 MHz to establish the dielectric nature of the crystal. Photoconductivity measurements were carried out on the grown crystal. The Second Harmonic Generation (SHG) of the crystal was tested to confirm the nonlinear optical property. Copyright © 2014 Elsevier B.V. All rights reserved.

Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

2005-11-01

The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

Investigation of selected structural parameters in Fe 95Si 5 amorphous alloy during crystallization process

NASA Astrophysics Data System (ADS)

Fronczyk, Adam

2007-04-01

In this study, we report on a crystallization behavior of the Fe 95Si 5 metallic glasses using a differential scanning cabrimetry (DSC), and X-ray diffraction. The paper presents the results of experimental investigation of Fe 95Si 5 amorphous alloy, subjected to the crystallizing process by the isothermal annealing. The objective of the experiment was to determine changes in the structural parameters during crystallization process of the examined alloy. Crystalline diameter and the lattice constant of the crystallizing phase were used as parameters to evaluate structural changes in material.

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nango, Eriko; Kumasaka, Takashi, E-mail: tkumasak@bio.titech.ac.jp; Sato, Takao

2005-07-01

The crystallization of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics, is reported. A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P2{sub 1}, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V{sub M})more » of 2.89 Å{sup 3} Da{sup −1} and a solvent constant of 57.4% by volume.« less

Crystal growth, thermal and optical studies of semiorganic nonlinear optical material: L-lysine hydrochloride dihydrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalaiselvi, D.; Mohan Kumar, R.; Jayavel, R.

2008-07-01

Single crystals of L-lysine hydrochloride dihydrate (LLHCD), a nonlinear optical material, have been grown by slow cooling technique from its aqueous solution. LLHCD was found to be highly soluble in water. The grown crystals have been subjected to single crystal X-ray diffraction to confirm the structure and to estimate the lattice parameters. The vibrational structure of the molecule is elucidated from FTIR spectra. Thermal analysis revealed the thermal stability of the grown crystals. The optical transmittance spectrum shows that the material possesses good optical transparency in the entire visible region with a UV cut-off wavelength at 228 nm. The mechanicalmore » properties of the grown crystal have been studied using Vicker's microhardness test. The laser damage threshold of 52.25 MW/cm{sup 2} has been measured by irradiating Q-switched Nd:YAG laser (1064 nm)« less

Adsorption of gentian violet dyes in aqueous solution on microporous AlPOs molecular sieves synthesized by ionothermal method

NASA Astrophysics Data System (ADS)

Fortas, W.; Djelad, A.; Hasnaoui, M. A.; Sassi, M.; Bengueddach, A.

2018-02-01

In this work, AlPO-34, like-chabazite (CHA) zeolite, was ionothermally prepared using the ionic liquid (IL), 1-ethyl-3-methylimidazolium chloride [EMIMCl], as solvent. The solids obtained were characterized by x-ray powder diffraction (XRD), scanning electron microscopy (SEM), infrared spectroscopy (FTIR), thermal analysis (TG) and nitrogen adsorption/desorption at 77.3 K. The results show that the ionic liquid is occluded in the AlPO-34 framework and consequently it acts also as a structure-directing agent. The variation of chemical composition led to AlPO-34 materials with different crystal sizes and morphologies. The well crystallized AlPO-34 material was used as adsorbent for Crystal Violet (CV) dye removal from aqueous solutions. The effect of adsorption parameters such as pH and initial concentration were investigated. It was found that adsorption dyes is favorable at pH = 6. The adsorption isotherm data follow the Langmuir equation in which parameters are calculated. The selected AlPO-34 sample exhibited a high crystal violet dye removal of 46.08 mg g-1 at pH = 6.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Remarkable features in lattice-parameter ratios of crystals. II. Monoclinic and triclinic crystals.

PubMed

de Gelder, R; Janner, A

2005-06-01

The frequency distributions of monoclinic crystals as a function of the lattice-parameter ratios resemble the corresponding ones of orthorhombic crystals: an exponential component, with more or less pronounced sharp peaks, with in general the most important peak at the ratio value 1. In addition, the distribution as a function of the monoclinic angle beta has a sharp peak at 90 degrees and decreases sensibly at larger angles. Similar behavior is observed for the three triclinic angular parameters alpha, beta and gamma, with characteristic differences between the organic and metal-organic, bio-macromolecular and inorganic crystals, respectively. The general behavior observed for the hexagonal, tetragonal, orthorhombic, monoclinic and triclinic crystals {in the first part of this series [de Gelder & Janner (2005). Acta Cryst. B61, 287-295] and in the present case} is summarized and commented. The data involved represent 366 800 crystals, with lattice parameters taken from the Cambridge Structural Database, CSD (294 400 entries), the Protein Data Bank, PDB (18 800 entries), and the Inorganic Crystal Structure Database, ICSD (53 600 entries). A new general structural principle is suggested.

Antimicrobial activity and second harmonic studies on organic non-centrosymmetric pure and doped ninhydrin single crystals

NASA Astrophysics Data System (ADS)

Prasanyaa, T.; Jayaramakrishnan, V.; Haris, M.

2013-03-01

In this paper, we report the successful growth of pure, Cu2+ ions and Cd2+ ions doped on ninhydrin single crystals by slow solvent evaporation technique. The presence of Cu2+ and Cd2+ ions in the specimen of ninhydrin single crystal has been determined by atomic absorption spectroscopy. The powder X-ray diffraction analysis was done to calculate the lattice parameters of the pure and doped crystals. The percentage of transmittance of the crystal was recorded using the UV-Vis Spectrophotometer. Thermal behaviors of the grown crystals have been examined by the thermal gravimetric/differential thermal analysis. The hardness of the grown crystals was assessed and the results show the minor variation in the hardness value for the pure and doped ninhydrin samples. The value of the work hardening coefficient n was found to be 2.0, 1.0 and 1.06 for pure, copper and cadmium doped ninhydrin crystals respectively. The second harmonic generation efficiency of Cd2+ and Cu2+ doped ninhydrin is 8.3 and 6.3 times greater than well known nonlinear crystal of potassium dihydrogen phosphate respectively. The antibacterial and antifungal activities of the title compound were performed by disk diffusion method against the standard bacteria Escherichia coli, Xanthomonas oryzae and against the fungus Aspergillis niger and Aspergillus flavus.

Growth and characterization of an organic single crystal: 2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide

NASA Astrophysics Data System (ADS)

Senthil, K.; Kalainathan, S.; Ruban Kumar, A.

Optically transparent crystal of the organic salt DEASI (2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide) has been synthesized by using knoevenagel condensation reaction method. The synthesized material has been purified by successfully recrystallization process. Single crystals of DEASI have been grown by slow evaporation technique at room temperature. The solubility of the title material has been determined at different temperature in acetonitrile/methanol mixture. The cell parameters and crystallinity of the title crystal were determined by single crystal XRD. The powder diffraction was carried out to study the reflection plane of the grown crystal and diffraction peaks were indexed. The presence of different functional groups in the crystal was confirmed by Fourier transform infrared (FTIR) analysis. 1H NMR spectrum was recorded to confirm the presence of hydrogen nuclei in the synthesized material. The optical property of the title crystal was studied by UV-Vis-NIR spectroscopic analysis. The melting point and thermal property of DEASI were studied using TGA/DSC technique. The Vicker’s hardness (Hv) was carried out to know the category. The dielectric constant and dielectric loss of the compound decreases with an increase in frequencies. Chemical etching studies showed that the DEASI grows in the two dimensional growth mechanisms. The Kurtz-Perry powder second harmonic generation (SHG) test has done for title crystal.

Antimicrobial activity and second harmonic studies on organic non-centrosymmetric pure and doped ninhydrin single crystals.

PubMed

Prasanyaa, T; Jayaramakrishnan, V; Haris, M

2013-03-01

In this paper, we report the successful growth of pure, Cu(2+) ions and Cd(2+) ions doped on ninhydrin single crystals by slow solvent evaporation technique. The presence of Cu(2+) and Cd(2+) ions in the specimen of ninhydrin single crystal has been determined by atomic absorption spectroscopy. The powder X-ray diffraction analysis was done to calculate the lattice parameters of the pure and doped crystals. The percentage of transmittance of the crystal was recorded using the UV-Vis Spectrophotometer. Thermal behaviors of the grown crystals have been examined by the thermal gravimetric/differential thermal analysis. The hardness of the grown crystals was assessed and the results show the minor variation in the hardness value for the pure and doped ninhydrin samples. The value of the work hardening coefficient n was found to be 2.0, 1.0 and 1.06 for pure, copper and cadmium doped ninhydrin crystals respectively. The second harmonic generation efficiency of Cd(2+) and Cu(2+) doped ninhydrin is 8.3 and 6.3 times greater than well known nonlinear crystal of potassium dihydrogen phosphate respectively. The antibacterial and antifungal activities of the title compound were performed by disk diffusion method against the standard bacteria Escherichia coli, Xanthomonas oryzae and against the fungus Aspergillis niger and Aspergillus flavus. Copyright © 2012 Elsevier B.V. All rights reserved.

Growth and characterization of an organic single crystal: 2-[2-(4-diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide.

PubMed

Senthil, K; Kalainathan, S; Ruban Kumar, A

2014-05-05

Optically transparent crystal of the organic salt DEASI (2-[2-(4-Diethylamino-phenyl)-vinyl]-1-methyl-pyridinium iodide) has been synthesized by using knoevenagel condensation reaction method. The synthesized material has been purified by successfully recrystallization process. Single crystals of DEASI have been grown by slow evaporation technique at room temperature. The solubility of the title material has been determined at different temperature in acetonitrile/methanol mixture. The cell parameters and crystallinity of the title crystal were determined by single crystal XRD. The powder diffraction was carried out to study the reflection plane of the grown crystal and diffraction peaks were indexed. The presence of different functional groups in the crystal was confirmed by Fourier transform infrared (FTIR) analysis. (1)H NMR spectrum was recorded to confirm the presence of hydrogen nuclei in the synthesized material. The optical property of the title crystal was studied by UV-Vis-NIR spectroscopic analysis. The melting point and thermal property of DEASI were studied using TGA/DSC technique. The Vicker's hardness (Hv) was carried out to know the category. The dielectric constant and dielectric loss of the compound decreases with an increase in frequencies. Chemical etching studies showed that the DEASI grows in the two dimensional growth mechanisms. The Kurtz-Perry powder second harmonic generation (SHG) test has done for title crystal. Copyright © 2014 Elsevier B.V. All rights reserved.

Ultra compact spectrometer apparatus and method using photonic crystals

NASA Technical Reports Server (NTRS)

Ting, David Z. (Inventor); Hill, Cory J. (Inventor); Bandara, Sumith V. (Inventor); Gunapala, Sarath D. (Inventor)

2009-01-01

The present invention is directed to methods of photonic crystal formation, and to methods and apparatus for using such photonic crystals, particularly in conjunction with detector arrays. Photonic crystal parameters and detector array parameters are compared to optimize the selection and orientation of a photonic crystal shape. A photonic crystal is operatively positioned relative to a plurality of light sensors. The light sensors can be separated by a pitch distance and positioned within one half of the pitch distance of an exit surface of the photonic crystals.

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan).

PubMed

Balasubramanian, Anuradha; Ponnuraj, Karthe

2008-07-01

Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 A resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 A.

Structure of a new crystal form of human Hsp70 ATPase domain.

PubMed

Osipiuk, J; Walsh, M A; Freeman, B C; Morimoto, R I; Joachimiak, A

1999-05-01

Hsp70 proteins are highly conserved proteins induced by heat shock and other stress conditions. An ATP-binding domain of human Hsp70 protein has been crystallized in two major morphological forms at pH 7.0 in the presence of PEG 8000 and CaCl2. Both crystal forms belong to the orthorhombic space group P212121, but show no resemblance in unit-cell parameters. Analysis of the crystal structures for both forms shows a 1-2 A shift of one of the subdomains of the protein. This conformational change could reflect a 'natural' flexibility of the protein which might be relevant to ATP binding and may facilitate the interaction of other proteins with Hsp70 protein.

Ultrasound assisted crystallization of mefenamic acid: Effect of operating parameters and comparison with conventional approach.

PubMed

Iyer, Sneha R; Gogate, Parag R

2017-01-01

The current work investigates the application of low intensity ultrasonic irradiation for improving the cooling crystallization of Mefenamic Acid for the first time. The crystal shape and size has been analyzed with the help of optical microscope and image analysis software respectively. The effect of ultrasonic irradiation on crystal size, particle size distribution (PSD) and yield has been investigated, also establishing the comparison with conventional approach. It has been observed that application of ultrasound not only enhances the yield but also reduces the induction time for crystallization as compared to conventional cooling crystallization technique. In the presence of ultrasound, the maximum yield was obtained at optimum conditions of power dissipation of 30W and ultrasonic irradiation time of 10min. The yield was further improved by application of ultrasound in cycles where the formed crystals are allowed to grow in the absence of ultrasonic irradiation. It was also observed that the desired crystal morphology was obtained for the ultrasound assisted crystallization. The conventionally obtained needle shaped crystals transformed into plate shaped crystals for the ultrasound assisted crystallization. The particle size distribution was analyzed using statistical means on the basis of skewness and kurtosis values. It was observed that the skewness and excess kurtosis value for ultrasound assisted crystallization was significantly lower as compared to the conventional approach. XRD analysis also revealed better crystal properties for the processed mefenamic acid using ultrasound assisted approach. The overall process intensification benefits of mefenamic acid crystallization using the ultrasound assisted approach were reduced particle size, increase in the yield and uniform PSD coupled with desired morphology. Copyright © 2016 Elsevier B.V. All rights reserved.

Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

PubMed

Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

2013-08-01

Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

PubMed

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-08-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

PubMed Central

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-01-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

Crystallization and preliminary X-ray analysis of the Man(α1-2)Man-specific lectin from Bowringia mildbraedii in complex with its carbohydrate ligand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Pino, Abel; Loris, Remy; Wyns, Lode

2005-10-01

The lectin from the Nigerian legume B. mildbraedii was crystallized in complex with Man(α1-2)Man and data were collected to a resolution of 1.90 Å using synchrotron radiation. The lectin from Bowringia mildbraedii seeds crystallizes in the presence of the disaccharide Man(α1-2)Man. The best crystals grow at 293 K within four weeks after a pre-incubation at 277 K to induce nucleation. A complete data set was collected to a resolution of 1.90 Å using synchrotron radiation. The crystals belong to space group I222, with unit-cell parameters a = 66.06, b = 86.35, c = 91.76 Å, and contain one lectin monomermore » in the asymmetric unit.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patel, Piyush, E-mail: piyush-patel130@yahoo.com; Vyas, S. M., E-mail: s-m-vyas-gu@hotmail.com; Patel, Vimal

The III-VI compound semiconductors is important for the fabrication of ionizing radiation detectors, solid-state electrodes, and photosensitive heterostructures, solar cell and ionic batteries. In this paper, In{sub 2}Se{sub 2.7} Sb{sub 0.3} single crystals were grown by the Bridgman method with temperature gradient of 60 °C/cm and the growth velocity 0.5cm/hr. The as-grown crystals were examined under the optical microscope for surface study, a various growth features observed on top free surface of the single crystal which is predominant of layers growth mechanism. The lattice parameters of as-grown crystal was determined by the XRD analysis. A Vickers’ projection microscope were usedmore » for the study of microhardness on the as-cleaved, cold-worked and annealed samples of the crystals, the results were discussed, and reported in detail.« less

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

Improved reproducibility of unit-cell parameters in macromolecular cryocrystallography by limiting dehydration during crystal mounting.

PubMed

Farley, Christopher; Burks, Geoffry; Siegert, Thomas; Juers, Douglas H

2014-08-01

In macromolecular cryocrystallography unit-cell parameters can have low reproducibility, limiting the effectiveness of combining data sets from multiple crystals and inhibiting the development of defined repeatable cooling protocols. Here, potential sources of unit-cell variation are investigated and crystal dehydration during loop-mounting is found to be an important factor. The amount of water lost by the unit cell depends on the crystal size, the loop size, the ambient relative humidity and the transfer distance to the cooling medium. To limit water loss during crystal mounting, a threefold strategy has been implemented. Firstly, crystal manipulations are performed in a humid environment similar to the humidity of the crystal-growth or soaking solution. Secondly, the looped crystal is transferred to a vial containing a small amount of the crystal soaking solution. Upon loop transfer, the vial is sealed, which allows transport of the crystal at its equilibrated humidity. Thirdly, the crystal loop is directly mounted from the vial into the cold gas stream. This strategy minimizes the exposure of the crystal to relatively low humidity ambient air, improves the reproducibility of low-temperature unit-cell parameters and offers some new approaches to crystal handling and cryoprotection.

Improved reproducibility of unit-cell parameters in macromolecular cryocrystallography by limiting dehydration during crystal mounting

PubMed Central

Farley, Christopher; Burks, Geoffry; Siegert, Thomas; Juers, Douglas H.

2014-01-01

In macromolecular cryocrystallography unit-cell parameters can have low reproducibility, limiting the effectiveness of combining data sets from multiple crystals and inhibiting the development of defined repeatable cooling protocols. Here, potential sources of unit-cell variation are investigated and crystal dehydration during loop-mounting is found to be an important factor. The amount of water lost by the unit cell depends on the crystal size, the loop size, the ambient relative humidity and the transfer distance to the cooling medium. To limit water loss during crystal mounting, a threefold strategy has been implemented. Firstly, crystal manipulations are performed in a humid environment similar to the humidity of the crystal-growth or soaking solution. Secondly, the looped crystal is transferred to a vial containing a small amount of the crystal soaking solution. Upon loop transfer, the vial is sealed, which allows transport of the crystal at its equilibrated humidity. Thirdly, the crystal loop is directly mounted from the vial into the cold gas stream. This strategy minimizes the exposure of the crystal to relatively low humidity ambient air, improves the reproducibility of low-temperature unit-cell parameters and offers some new approaches to crystal handling and cryoprotection. PMID:25084331

One pot synthesis of two Mn(II) perchlorate complexes with s-triazine NNN-pincer ligand; molecular structure, Hirshfeld analysis and DFT studies

NASA Astrophysics Data System (ADS)

Soliman, Saied M.; El-Faham, Ayman

2018-07-01

Self assembly of Mn(II) perchlorate and bis(pyrazolo)-s-triazine pincer ligand (L) in methanol-water mixture afforded the homoleptic [MnL2](ClO4)2 complex (1) as plate colorless crystals. Following the crystallization process till the near dryness of the solution, we noted few needle like crystals of the heteroleptic [MnL(H2O)3](ClO4)2·H2O complex (2). Their molecular and supramolecular structures were analyzed using single crystal structure combined with Hirshfeld analysis. The packing of complexes 1 and 2 is dominated by weak Csbnd H⋯O and strong Osbnd H⋯O hydrogen bonds, respectively, as well as anion-π stacking interactions. Using Hirshfeld analysis, the percentages of the O⋯H intermolecular contacts are 32.7% and 36.8% for 1 and 2, respectively. The Mnsbnd N distances correlated well with the atoms in molecules (AIM) topological parameters. The amount of electron density transferred from the ligand units to the manganese centre are nearly the same (0.9 e) in both complexes.

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu

2006-12-01

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less

Electrostatic properties of the pyrimethamine-2,4-dihydroxybenzoic acid cocrystal in methanol studied using transferred electron-density parameters.

PubMed

Faroque, Muhammad Umer; Noureen, Sajida; Ahmed, Maqsood; Tahir, Muhammad Nawaz

2018-01-01

The crystal structure of the cocrystal salt form of the antimalarial drug pyrimethamine with 2,4-dihydroxybenzoic acid in methanol [systematic name: 2,4-diamino-5-(4-chlorophenyl)-6-ethylpyrimidin-1-ium 2,4-dihydroxybenzoate methanol monosolvate, C 12 H 14 ClN 4 + ·C 7 H 5 O 4 - ·CH 3 OH] has been studied using X-ray diffraction data collected at room temperature. The crystal structure was refined using the classical Independent Atom Model (IAM) and the Multipolar Atom Model by transferring electron-density parameters from the ELMAM2 database. The Cl atom was refined anharmonically. The results of both refinement methods have been compared. The intermolecular interactions have been characterized on the basis of Hirshfeld surface analysis and topological analysis using Bader's theory of Atoms in Molecules. The results show that the molecular assembly is built primarily on the basis of charge transfer between 2,4-dihydroxybenzoic acid and pyrimethamine, which results in strong intermolecular hydrogen bonds. This fact is further validated by the calculation of the electrostatic potential based on transferred electron-density parameters.

Investigation on the growth and characterization of 4-aminobenzophenone single crystal by the vertical dynamic gradient freeze technique

NASA Astrophysics Data System (ADS)

Prabhakaran, SP.; Ramesh Babu, R.; Sukumar, M.; Bhagavannarayana, G.; Ramamurthi, K.

2014-03-01

Growth of bulk single crystal of 4-Aminobenzophenone (4-ABP) from the vertical dynamic gradient freeze (VDGF) setup designed with eight zone furnace was investigated. The experimental parameters for the growth of 4-ABP single crystal with respect to the design of VDGF setup are discussed. The eight zones were used to generate multiple temperature gradients over the furnace, and video imaging system helped to capture the real time growth and solid-liquid interface. 4-ABP single crystal with the size of 18 mm diameter and 40 mm length was grown from this investigation. Structural and optical quality of grown crystal was examined by high resolution X-ray diffraction and UV-visible spectral analysis, respectively and the blue emission was also confirmed from the photoluminescence spectrum. Microhardness number of the crystal was estimated at different loads using Vicker's microhardness tester. The size and quality of single crystal grown from the present investigation are compared with the vertical Bridgman grown 4-ABP.

Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

2006-10-01

Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

Overexpression, crystallization and preliminary X-ray crystallographic analysis of β-N-acetylglucosaminidase from Thermotoga maritima encoded by the Tm0809 gene.

PubMed

Lee, Hyung Ho; Jung, Sang Taek

2013-02-01

β-N-acetylglucosaminidase (NagA) protein hs a chitin-degrading activity and chitin is one of the most abundant polymers in nature. NagA contains a family 3 glycoside (GH3)-type N-terminal domain and a unique C-terminal domain. The structurally uncharacterized C-terminal domain of NagA may be involved in substrate specificity. To provide a structural basis for the substrate specificity of NagA, structural analysis of NagA from Thermotoga maritima encoded by the Tm0809 gene was initiated. NagA from T. maritima has been overexpressed in Escherichia coli and crystallized at 296 K using ammonium sulfate as a precipitant. Crystals of T. maritima NagA diffracted to 3.80 Å resolution and belonged to the monoclinic space group C2, with unit-cell parameters a = 231.15, b = 133.62, c = 140.88 Å, β = 89.97°. The crystallization of selenomethionyl-substituted protein is in progress to solve the crystal structure of T. maritima NagA.

Growth, spectral and optical characterization of a novel nonlinear optical organic material: D-Alanine DL-Mandelic acid single crystal

NASA Astrophysics Data System (ADS)

Jayaprakash, P.; Mohamed, M. Peer; Caroline, M. Lydia

2017-04-01

An organic nonlinear optical single crystal, D-alanine DL-mandelic acid was synthesized and successfully grown by slow evaporation solution growth technique at ambient temperature using solvent of aqueous solution. The unit cell parameters were assessed from single crystal X-ray diffraction analysis. The presence of diverse functional groups and vibrational modes were identified using Fourier Transform Infra Red and Fourier Transform Raman spectral analyses. The chemical structure of grown crystal has been identified by Nuclear Magnetic Resonance spectroscopic study. Ultraviolet-visible spectral analysis reveal that the crystal has lower cut-off wavelength down to 259 nm, is a key factor to exhibit second harmonic generation signal. The electronic optical band gap and Urbach energy is calculated as 5.31 eV and 0.2425 eV respectively from the UV absorption profile. The diverse optical properties such as, extinction coefficient, reflectance, linear refractive index, optical conductivity was calculated using UV-visible data. The relative second harmonic efficiency of the compound is found to be 0.81 times greater than that of KH2PO4 (KDP). The thermal stability of the grown crystal was studied by thermogravimetric analysis and differential thermal analysis techniques. The luminescence spectrum exhibited two peaks (520 nm, 564 nm) due to the donation of protons from carboxylic acid to amino group. The Vickers microhardness test was carried out employing one of the as-grown hard crystal and there by hardness number (Hv), Meyer's index (n), yield strength (σy), elastic stiffness constant (C11) and Knoop hardness number (HK) were assessed. The dielectric behaviour of the as-grown crystal was analyzed for different temperatures (313 K, 333 K, 353 K, and 373 K) at different frequencies.

Modeling local structure using crystal field and spin Hamiltonian parameters: the tetragonal FeK3+-OI2- defect center in KTaO3 crystal

NASA Astrophysics Data System (ADS)

Gnutek, P.; Y Yang, Z.; Rudowicz, C.

2009-11-01

The local structure and the spin Hamiltonian (SH) parameters, including the zero-field-splitting (ZFS) parameters D and (a+2F/3), and the Zeeman g factors g_{\\parallel } and g_{\\perp } , are theoretically investigated for the FeK3+-OI2- center in KTaO3 crystal. The microscopic SH (MSH) parameters are modeled within the framework of the crystal field (CF) theory employing the CF analysis (CFA) package, which also incorporates the MSH modules. Our approach takes into account the spin-orbit interaction as well as the spin-spin and spin-other-orbit interactions omitted in previous studies. The superposition model (SPM) calculations are carried out to provide input CF parameters for the CFA/MSH package. The combined SPM-CFA/MSH approach is used to consider various structural models for the FeK3+-OI2- defect center in KTaO3. This modeling reveals that the off-center displacement of the Fe3+ ions, Δ1(Fe3+), combined with an inward relaxation of the nearest oxygen ligands, Δ2(O2-), and the existence of the interstitial oxygen OI2- give rise to a strong tetragonal crystal field. This finding may explain the large ZFS experimentally observed for the FeK3+-OI2- center in KTaO3. Matching the theoretical MSH predictions with the available structural data as well as electron magnetic resonance (EMR) and optical spectroscopy data enables predicting reasonable ranges of values of Δ1(Fe3+) and Δ2(O2-) as well as the possible location of OI2- ligands around Fe3+ ions in KTaO3. The defect structure model obtained using the SPM-CFA/MSH approach reproduces very well the ranges of the experimental SH parameters D, g_{\\parallel } and g_{\\perp } and importantly yields not only the correct magnitude of D but also the sign, unlike previous studies. More reliable predictions may be achieved when experimental data on (a+2F/3) and/or crystal field energy levels become available. Comparison of our results with those arising from alternative models existing in the literature indicates considerable advantages of our method and presumably higher reliability of our predictions.

Investigations of the possibility of determination of thermal parameters of Si and SiGe samples based on the Photo Thermal Radiometry technique

NASA Astrophysics Data System (ADS)

Chrobak, Ł.; Maliński, M.

2018-03-01

This paper presents results of investigations of the possibility of determination of thermal parameters (thermal conductivity, thermal diffusivity) of silicon and silicon germanium crystals from the frequency characteristics of the Photo Thermal Radiometry (PTR) signal. The theoretical analysis of the influence of the mentioned parameters on the PTR signal has been presented and discussed. The values of the thermal and recombination parameters have been extracted from the fittings of the theoretical to experimental data. The presented approach uses the reference Si sample whose thermal and recombination parameters are known.

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

PubMed

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-03-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

Crystal-Chemical Analysis Martian Minerals in Gale Crater

NASA Technical Reports Server (NTRS)

Morrison, S. M.; Downs, R. T.; Blake, D. F.; Bish, D. L.; Ming, D. W.; Morris, R. V.; Yen, A. S.; Chipera, S. J.; Treiman, A. H.; Vaniman, D. T.;

Crystallization and preliminary X-ray analysis of alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko

The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less

Kinetics of phase transformation in glass forming systems

NASA Technical Reports Server (NTRS)

Ray, Chandra S.

1994-01-01

The objectives of this research were to (1) develop computer models for realistic simulations of nucleation and crystal growth in glasses, which would also have the flexibility to accomodate the different variables related to sample characteristics and experimental conditions, and (2) design and perform nucleation and crystallization experiments using calorimetric measurements, such as differential scanning calorimetry (DSC) and differential thermal analysis (DTA) to verify these models. The variables related to sample characteristics mentioned in (1) above include size of the glass particles, nucleating agents, and the relative concentration of the surface and internal nuclei. A change in any of these variables changes the mode of the transformation (crystallization) kinetics. A variation in experimental conditions includes isothermal and nonisothermal DSC/DTA measurements. This research would lead to develop improved, more realistic methods for analysis of the DSC/DTA peak profiles to determine the kinetic parameters for nucleation and crystal growth as well as to assess the relative merits and demerits of the thermoanalytical models presently used to study the phase transformation in glasses.

Control of DNA-Functionalized Nanoparticle Assembly

NASA Astrophysics Data System (ADS)

Olvera de La Cruz, Monica

Directed crystallization of a large variety of nanoparticles, including proteins, via DNA hybridization kinetics has led to unique materials with a broad range of crystal symmetries. The nanoparticles are functionalized with DNA chains that link neighboring functionalized units. The shape of the nanoparticle, the DNA length, the sequence of the hybridizing DNA linker and the grafting density determine the crystal symmetries and lattice spacing. By carefully selecting these parameters one can, in principle, achieve all the symmetries found for both atomic and colloidal crystals of asymmetric shapes as well as new symmetries, and drive transitions between them. A scale-accurate coarse-grained model with explicit DNA chains provides the design parameters, including degree of hybridization, to achieve specific crystal structures. The model also provides surface energy values to determine the shape of defect-free single crystals with macroscopic anisotropic properties, as well as the parameters to develop colloidal models that reproduce both the shape of single crystals and their growth kinetics.

Modeling Cr-to-Tm and Cr-to-Tm-to-Ho energy transfer in YAG crystals

NASA Technical Reports Server (NTRS)

Swetits, John J.

1991-01-01

A systematic analysis of energy transfer processes in crystals of YAG doped with varying concentrations of Cr and Tm is described. Both spectral measurements and measurements of the temporal response to pulsed excitation are used to give independent determinations of the microscopic interaction parameter for Cr to Tm transfer. The different factors in influencing the temperature dependence of the Cr to Tm transfer are discussed. The dependence of the Tm cross-relaxation rate on Tm concentration is determined.

The Determination of Birefringence Dispersion in Nematic Liquid Crystals by Using the S-Transform

NASA Astrophysics Data System (ADS)

Coşkun, E.; Özder, S.; Kocahan, Ö.; Köysal, O.

2007-04-01

Transmittance spectra of 5CB and ZLI-6000 coded nematic liquid crystals were acquired in the 12600-22200 cm-1 region at room temperature. The S-transform was applied to analyze the transmittance signal. Dispersion curves of the birefringence were obtained for 5CB and ZLI-6000 by this analysis and data were fitted to the Cauchy formula whereby the dispersion parameters were extracted. Results are found to be in favorable accordance with the published values.

Host Materials for Transition-Metal Ions

DTIC Science & Technology

1989-09-01

Spectra of 3d Transition Elements in KMgF3 Crystal, Soy. Phys. Solid State 19 (1977), 340. 21. H . Onuki , F. Sugawara, M. Hirano, and Y. Yamaguchi...on Cs2SnBr 6 .... h ............. 84 13.2 Crystal-Field Components, Anm, for Sn (Oh) Site .............. 814 13.3 Experimental Parameters...A.M VSg Kleef, Y. N. .3oshi, and R. P. Srivastava, Analysis of’ Cd V: I.--4Ida-id’ 5p Transitions, Physica 114IC (1982), 105. 15. H . Benschop, Y. N

Progressive freezing and sweating in a test unit

NASA Astrophysics Data System (ADS)

Ulrich, J.; Özoğuz, Y.

1990-01-01

Crystallization from melts is applied in several fields like waste water treatment, fruit juice or liquid food concentration and purification of organic chemicals. Investigations to improve the understanding, the performance and the control of the process have been carried out. The experimental unit used a vertical tube with a falling film on the outside. With an specially designed measuring technique process controlling parameters have been studied. The results demonstrate the dependency of those parameters upon each other and indicate the way to control the process by controlling the dominant parameter. This is the growth rate of the crystal coat. A further purification of the crystal layer can be achieved by introducing the procedure of sweating, which is a controlled partial melting of the crystal coat. Here again process parameters have been varied and results are presented. The strong effect upon the final purity of the product by an efficient executed sweating which is effectively tuned on the crystallization procedure should save crystallization steps, energy and time.

Comparison in Schemes for Simulating Depositional Growth of Ice Crystal between Theoretical and Laboratory Data

NASA Astrophysics Data System (ADS)

Zhai, Guoqing; Li, Xiaofan

2015-04-01

The Bergeron-Findeisen process has been simulated using the parameterization scheme for the depositional growth of ice crystal with the temperature-dependent theoretically predicted parameters in the past decades. Recently, Westbrook and Heymsfield (2011) calculated these parameters using the laboratory data from Takahashi and Fukuta (1988) and Takahashi et al. (1991) and found significant differences between the two parameter sets. There are two schemes that parameterize the depositional growth of ice crystal: Hsie et al. (1980), Krueger et al. (1995) and Zeng et al. (2008). In this study, we conducted three pairs of sensitivity experiments using three parameterization schemes and the two parameter sets. The pre-summer torrential rainfall event is chosen as the simulated rainfall case in this study. The analysis of root-mean-squared difference and correlation coefficient between the simulation and observation of surface rain rate shows that the experiment with the Krueger scheme and the Takahashi laboratory-derived parameters produces the best rain-rate simulation. The mean simulated rain rates are higher than the mean observational rain rate. The calculations of 5-day and model domain mean rain rates reveal that the three schemes with Takahashi laboratory-derived parameters tend to reduce the mean rain rate. The Krueger scheme together with the Takahashi laboratory-derived parameters generate the closest mean rain rate to the mean observational rain rate. The decrease in the mean rain rate caused by the Takahashi laboratory-derived parameters in the experiment with the Krueger scheme is associated with the reductions in the mean net condensation and the mean hydrometeor loss. These reductions correspond to the suppressed mean infrared radiative cooling due to the enhanced cloud ice and snow in the upper troposphere.

Crystallization of carbonate hydroxyapatite in the presence of strontium ranelate

NASA Astrophysics Data System (ADS)

Izmailov, R. R.; Golovanova, O. A.

2015-11-01

The influence of strontium ranelate on the crystallization of carbonate hydroxyapatite from a prototype of synovial fluid of humans has been investigated. The synthesis products are studied by IR Fourier spectroscopy, X-ray diffraction, and differential thermal analysis. The amount of strontium in the samples is determined by atomic emission analysis. The sizes of crystallites in the synthesized phases are calculated from the Selyakov-Scherrer formula; the lattice parameters are also determined. The phases obtained are found to be species of calcium-deficient strontium-containing carbonate hydroxyapatite of mixed A and B types. Schemes of chemical reactions occurring during heat treatment are proposed.

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

Numerical study on characteristic of two-dimensional metal/dielectric photonic crystals

NASA Astrophysics Data System (ADS)

Zong, Yi-Xin; Xia, Jian-Bai; Wu, Hai-Bin

2017-04-01

An improved plan-wave expansion method is adopted to theoretically study the photonic band diagrams of two-dimensional (2D) metal/dielectric photonic crystals. Based on the photonic band structures, the dependence of flat bands and photonic bandgaps on two parameters (dielectric constant and filling factor) are investigated for two types of 2D metal/dielectric (M/D) photonic crystals, hole and cylinder photonic crystals. The simulation results show that band structures are affected greatly by these two parameters. Flat bands and bandgaps can be easily obtained by tuning these parameters and the bandgap width may reach to the maximum at certain parameters. It is worth noting that the hole-type photonic crystals show more bandgaps than the corresponding cylinder ones, and the frequency ranges of bandgaps also depend strongly on these parameters. Besides, the photonic crystals containing metallic medium can obtain more modulation of photonic bands, band gaps, and large effective refractive index, etc. than the dielectric/dielectric ones. According to the numerical results, the needs of optical devices for flat bands and bandgaps can be met by selecting the suitable geometry and material parameters. Project supported by the National Basic Research Program of China (Grant No. 2011CB922200) and the National Natural Science Foundation of China (Grant No. 605210010).

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

PubMed Central

Balasubramanian, Anuradha; Ponnuraj, Karthe

2008-01-01

Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å. PMID:18607103

Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

PubMed Central

Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

2009-01-01

2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

Monolayer Colloidal Crystals by Modified Air-Water Interface Self-Assembly Approach

PubMed Central

Ye, Xin; Huang, Jin; Zeng, Yong; Sun, Lai-Xi; Geng, Feng; Liu, Hong-Jie; Wang, Feng-Rui; Jiang, Xiao-Dong; Wu, Wei-Dong; Zheng, Wan-Guo

2017-01-01

Hexagonally ordered arrays of polystyrene (PS) microspheres were prepared by a modified air-water self-assembly method. A detailed analysis of the air-water interface self-assembly process was conducted. Several parameters affect the quality of the monolayer colloidal crystals, i.e., the colloidal microsphere concentration on the latex, the surfactant concentration, the polystyrene microsphere diameter, the microsphere polydispersity, and the degree of sphericity of polystyrene microspheres. An abrupt change in surface tension was used to improve the quality of the monolayer colloidal crystal. Three typical microstructures, i.e., a cone, a pillar, and a binary structure were prepared by reactive-ion etching using a high-quality colloidal crystal mask. This study provides insight into the production of microsphere templates with flexible structures for large-area patterned materials. PMID:28946664

Overexpression, crystallization and preliminary X-ray crystallographic analysis of the phosphotriesterase from Mycobacterium tuberculosis.

PubMed

Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin

2013-01-01

Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C222(1), with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data.

Overexpression, crystallization and preliminary X-ray crystallographic analysis of the phosphotriesterase from Mycobacterium tuberculosis

PubMed Central

Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin

2013-01-01

Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C2221, with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data. PMID:23295488

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Tackling both the player and the ball: lessons from crystallographic studies on the N-utilization substance B (NusB) from Mycobacterium tuberculosis

NASA Astrophysics Data System (ADS)

Haire, L. F.; Gopal, B.

2001-11-01

The N-utilization substance B (NusB) from Mycobacterium tuberculosis is an important element in a complex assembly of other proteins and ribonucleic acid effecting transcription antitermination in this organism. The cloning and overexpression of the protein in E. coli, followed by the purification, crystallization, and use of selenomethionine samples to obtain phase information by anomalous dispersion techniques, allows us to investigate the fine interplay of sample engineering and modification of crystallization parameters leading to successful structure determination. Knowledge of the crystal structure and the surface properties of the protein allows an analysis of the packing of the NusB dimers in the crystal lattice. This exercise, albeit post facto, helps to demonstrate how biophysical and functional information could help 'rationalize' the course of obtaining protein crystals suitable for structural studies.

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.

PubMed

Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.

Influence of doping on thermal diffusivity of single crystals used in photonics: measurements based on thermal wave methods.

PubMed

Bodzenta, Jerzy; Kaźmierczak-Bałata, Anna; Wokulska, Krystyna B; Kucytowski, Jacek; Łukasiewicz, Tadeusz; Hofman, Władysław

2009-03-01

Three crystals used in solid-state lasers, namely, yttrium aluminum garnet (YAG), yttrium orthovanadate (YVO(4)), and gadolinium calcium oxoborate (GdCOB), were investigated to determine the influence of dopants on their thermal diffusivity. The thermal diffusivity was measured by thermal wave method with a signal detection based on mirage effect. The YAG crystals were doped with Yb or V, the YVO(4) with Nd or Ca and Tm, and the GdCOB crystals contained Nd or Yb. In all cases, the doping caused a decrease in thermal diffusivity. The analysis of complementary measurements of ultrasound velocity changes caused by dopants leads to the conclusion that impurities create phonon scattering centers. This additional scattering reduces the phonon mean free path and accordingly results in the decrease of the thermal diffusivity of the crystal. The influence of doping on lattice parameters was investigated, additionally.

Crystal-chemical characteristics of nontronites from bottom sediments of Pacific ocean

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palchik, N. A., E-mail: nadezhda@igm.nsc.ru; Moroz, T. N.; Grigorieva, T. N.

A crystal-chemical analysis of the nontronite samples formed in deep-water sediments of the underwater Juan-de-Fuca ridge in the Pacific ocean has been performed using powder X-ray diffraction, IR spectroscopy, and Mössbauer spectroscopy. A comparison with the previously investigated nontronites from different regions of the Sea of Okhotsk showed that the structural features of these formations are due to the difference in the physicochemical parameters of their crystallization. The values of the basal interplanar spacing d{sub 001} (within 11–13 Å) in the samples analyzed are determined by the degree of hydration and cation filling of the interlayer space, while the differencesmore » in the IR spectra are due to isomorphic substitutions in the structure. The character of cation distribution and the nature and concentration of stacking faults in nontronite structures are determined. The differences in the composition, structure, and properties of nontronites of different origin are confirmed by theoretical calculations of their structural parameters.« less

Spectroscopic studies and crystal-field analyses of Am{sup 3+}: LiYF{sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cavellec, R.; Hubert, S.; Simoni, E.

1997-03-01

Fluorescence and laser selective excitation spectroscopy have been used to investigate the electronic energy level structure of the actinide Am{sup 3+} (5{line_integral}{sup 6}) in LiYF{sub 4}. From the analysis of the fluorescence in the visible and infrared spectra obtained at 10K, 29 crystal-field levels have been assigned in the D{sub 2d} approximation. Zeeman splitting observation permits one to index some doubly degenerated {Gamma}{sub 5} levels. The phenomenological crystal-field parameters have been calculated in the D{sub 2d} approximation. A least-square adjustment yields a mean error of 38 cm{sup {minus}1} with the following values (in cm{sup {minus}1}) of the B{sub q}{sup k}more » parameters: B{sub O}{sup 2} = 473, B{sub 0}{sup 4} = -1776, B{sub 4}{sup 4}=2253, B{sub 0}{sup 6} = 80, and B{sub 4}{sup 6} = -2222.« less

The active site of hen egg-white lysozyme: flexibility and chemical bonding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Held, Jeanette, E-mail: jeanette.netzel@uni-bayreuth.de; Smaalen, Sander van

Chemical bonding at the active site of lysozyme is analyzed on the basis of a multipole model employing transferable multipole parameters from a database. Large B factors at low temperatures reflect frozen-in disorder, but therefore prevent a meaningful free refinement of multipole parameters. Chemical bonding at the active site of hen egg-white lysozyme (HEWL) is analyzed on the basis of Bader’s quantum theory of atoms in molecules [QTAIM; Bader (1994 ▶), Atoms in Molecules: A Quantum Theory. Oxford University Press] applied to electron-density maps derived from a multipole model. The observation is made that the atomic displacement parameters (ADPs) ofmore » HEWL at a temperature of 100 K are larger than ADPs in crystals of small biological molecules at 298 K. This feature shows that the ADPs in the cold crystals of HEWL reflect frozen-in disorder rather than thermal vibrations of the atoms. Directly generalizing the results of multipole studies on small-molecule crystals, the important consequence for electron-density analysis of protein crystals is that multipole parameters cannot be independently varied in a meaningful way in structure refinements. Instead, a multipole model for HEWL has been developed by refinement of atomic coordinates and ADPs against the X-ray diffraction data of Wang and coworkers [Wang et al. (2007), Acta Cryst. D63, 1254–1268], while multipole parameters were fixed to the values for transferable multipole parameters from the ELMAM2 database [Domagala et al. (2012), Acta Cryst. A68, 337–351] . Static and dynamic electron densities based on this multipole model are presented. Analysis of their topological properties according to the QTAIM shows that the covalent bonds possess similar properties to the covalent bonds of small molecules. Hydrogen bonds of intermediate strength are identified for the Glu35 and Asp52 residues, which are considered to be essential parts of the active site of HEWL. Furthermore, a series of weak C—H⋯O hydrogen bonds are identified by means of the existence of bond critical points (BCPs) in the multipole electron density. It is proposed that these weak interactions might be important for defining the tertiary structure and activity of HEWL. The deprotonated state of Glu35 prevents a distinction between the Phillips and Koshland mechanisms.« less

Formulation of dynamical theory of X-ray diffraction for perfect crystals in the Laue case using the Riemann surface.

PubMed

Saka, Takashi

2016-05-01

The dynamical theory for perfect crystals in the Laue case was reformulated using the Riemann surface, as used in complex analysis. In the two-beam approximation, each branch of the dispersion surface is specified by one sheet of the Riemann surface. The characteristic features of the dispersion surface are analytically revealed using four parameters, which are the real and imaginary parts of two quantities specifying the degree of departure from the exact Bragg condition and the reflection strength. By representing these parameters on complex planes, these characteristics can be graphically depicted on the Riemann surface. In the conventional case, the absorption is small and the real part of the reflection strength is large, so the formulation is the same as the traditional analysis. However, when the real part of the reflection strength is small or zero, the two branches of the dispersion surface cross, and the dispersion relationship becomes similar to that of the Bragg case. This is because the geometrical relationships among the parameters are similar in both cases. The present analytical method is generally applicable, irrespective of the magnitudes of the parameters. Furthermore, the present method analytically revealed many characteristic features of the dispersion surface and will be quite instructive for further numerical calculations of rocking curves.

Review of aragonite and calcite crystal morphogenesis in thermal spring systems

NASA Astrophysics Data System (ADS)

Jones, Brian

2017-06-01

Aragonite and calcite crystals are the fundamental building blocks of calcareous thermal spring deposits. The diverse array of crystal morphologies found in these deposits, which includes monocrystals, mesocrystals, skeletal crystals, dendrites, and spherulites, are commonly precipitated under far-from-equilibrium conditions. Such crystals form through both abiotic and biotic processes. Many crystals develop through non-classical crystal growth models that involve the arrangement of nanocrystals in a precisely controlled crystallographic register. Calcite crystal morphogenesis has commonly been linked to a ;driving force;, which is a conceptual measure of the distance of the growth conditions from equilibrium conditions. Essentially, this scheme indicates that increasing levels of supersaturation and various other parameters that produce a progressive change from monocrystals and mesocrystals to skeletal crystals to crystallographic and non-crystallographic dendrites, to dumbbells, to spherulites. Despite the vast amount of information available from laboratory experiments and natural spring systems, the precise factors that control the driving force are open to debate. The fact that calcite crystal morphogenesis is still poorly understood is largely a reflection of the complexity of the factors that influence aragonite and calcite precipitation. Available information indicates that variations in calcite crystal morphogenesis can be attributed to physical and chemical parameters of the parent water, the presence of impurities, the addition of organic or inorganic additives to the water, the rate of crystal growth, and/or the presence of microbes and their associated biofilms. The problems in trying to relate crystal morphogenesis to specific environmental parameters arise because it is generally impossible to disentangle the controlling factor(s) from the vast array of potential parameters that may act alone or in unison with each other.

Luminescence and radiation resistance of undoped NaI crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shiran, N., E-mail: shiran@isc.kharkov.com; Boiaryntseva, I.; Gektin, A.

2014-11-15

Highlights: • The performance of NaI scintillators depends on luminescence properties. • A criterion of crystals’ purity level is radiation colorability at room temperature. • The traces of the most dangerous impurities were detected. • Crucial role in efficiency of pure NaI scintillator play the crystal perfection. - Abstract: Undoped NaI single crystal is an excellent scintillator at low temperature. However, scintillation parameters of different quality crystals vary in a wide range, significantly exceeding measurement error. Experimental data demonstrate the features of luminescence, radiation induced coloration, and afterglow dependence on the quality of nominally pure crystals. It is found thatmore » defects level that allows to elucidate artefacts introduced by traces of harmful impurities corresponds to 3 × 10{sup 15} cm{sup −3} that significantly overhead accuracy of chemical and absorption analysis. It is shown that special raw material treatment before and during the single crystal growth allows to reach NaI purity level that avoids impurities influence to the basic luminescence data.« less

Synthesis, crystal growth, structural and physicochemical studies of novel binary organic complex: 4-chloroaniline-3-hydroxy-4-methoxybenzaldehyde

NASA Astrophysics Data System (ADS)

Sharma, K. P.; Reddi, R. S. B.; Bhattacharya, S.; Rai, R. N.

2012-06-01

The solid-state reaction, which is solvent free and green synthesis, has been adopted to explore the novel compound. The phase diagram of 4-chloroaniline (CA) and 3-hydroxy-4-methoxybenzaldehyde (HMB) system shows the formation of a novel 1:1 molecular complex, and two eutectics on either sides of complex. Thermochemical studies of complex and eutectics have been carried out for various properties such as heat of fusion, entropy of fusion, Jackson's parameters, interfacial energy and excess thermodynamic functions. The formation of molecular complex was also studied by IR, NMR, elemental analysis and UV-Vis absorption spectra. The single crystal of molecular complex was grown and its XRD study confirms the formation of complex and identifies the crystal structure and atomic packing of crystal of complex. Transmission spectra of grown crystal of the complex show 70% transmittance efficiency with cut off wavelength 412 nm. The band gap and refractive index of the crystal of complex have also been studied.

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701

2005-04-01

The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

2007-08-01

The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Investigation of the Surface Stress in SiC and Diamond Nanocrystals by In-situ High Pressure Powder Diffraction Technique

NASA Technical Reports Server (NTRS)

Palosz, B.; Stelmakh, S.; Grzanka, E.; Gierlotka, S.; Zhao, Y.; Palosz, W.

2003-01-01

The real atomic structure of nanocrystals determines key properties of the materials. For such materials the serious experimental problem lies in obtaining sufficiently accurate measurements of the structural parameters of the crystals, since very small crystals constitute rather a two-phase than a uniform crystallographic phase system. As a result, elastic properties of nanograins may be expected to reflect a dual nature of their structure, with a corresponding set of different elastic property parameters. We studied those properties by in-situ high-pressure powder diffraction technique. For nanocrystalline, even one-phase materials such measurements are particularly difficult to make since determination of the lattice parameters of very small crystals presents a challenge due to inherent limitations of standard elaboration of powder diffractograms. In this investigation we used our methodology of the structural analysis, the 'apparent lattice parameter' (alp) concept. The methodology allowed us to avoid the traps (if applied to nanocrystals) of standard powder diffraction evaluation techniques. The experiments were performed for nanocrystalline Sic and GaN powders using synchrotron sources. We applied both hydrostatic and isostatic pressures in the range of up to 40 GPa. Elastic properties of the samples were examined based on the measurements of a change of the lattice parameters with pressure. The results show a dual nature of the mechanical properties (compressibilities) of the materials, indicating a complex, core-shell structure of the grains.

Multiscale Analysis of Structurally-Graded Microstructures Using Molecular Dynamics, Discrete Dislocation Dynamics and Continuum Crystal Plasticity

NASA Technical Reports Server (NTRS)

Saether, Erik; Hochhalter, Jacob D.; Glaessgen, Edward H.; Mishin, Yuri

2014-01-01

A multiscale modeling methodology is developed for structurally-graded material microstructures. Molecular dynamic (MD) simulations are performed at the nanoscale to determine fundamental failure mechanisms and quantify material constitutive parameters. These parameters are used to calibrate material processes at the mesoscale using discrete dislocation dynamics (DD). Different grain boundary interactions with dislocations are analyzed using DD to predict grain-size dependent stress-strain behavior. These relationships are mapped into crystal plasticity (CP) parameters to develop a computationally efficient finite element-based DD/CP model for continuum-level simulations and complete the multiscale analysis by predicting the behavior of macroscopic physical specimens. The present analysis is focused on simulating the behavior of a graded microstructure in which grain sizes are on the order of nanometers in the exterior region and transition to larger, multi-micron size in the interior domain. This microstructural configuration has been shown to offer improved mechanical properties over homogeneous coarse-grained materials by increasing yield stress while maintaining ductility. Various mesoscopic polycrystal models of structurally-graded microstructures are generated, analyzed and used as a benchmark for comparison between multiscale DD/CP model and DD predictions. A final series of simulations utilize the DD/CP analysis method exclusively to study macroscopic models that cannot be analyzed by MD or DD methods alone due to the model size.

Crystal growth, structural, optical, thermal, mechanical, laser damage threshold and electrical properties of triphenylphosphine oxide 4-nitrophenol (TP4N) single crystals for nonlinear optical applications

NASA Astrophysics Data System (ADS)

Karuppasamy, P.; Senthil Pandian, Muthu; Ramasamy, P.; Verma, Sunil

2018-05-01

The optically good quality single crystals of triphenylphosphine oxide 4-nitrophenol (TP4N) with maximum dimension of 15 × 10 × 5 mm3 were grown by slow evaporation solution technique (SEST) at room temperature. The cell dimensions of the grown TP4N crystal were confirmed by single crystal X-ray diffraction (SXRD) and the crystalline purity was confirmed and planes were indexed by powder X-ray diffraction (PXRD) analysis. Functional groups of TP4N crystal were confirmed by Fourier transform infrared (FTIR) spectral analysis. The optical transmittance of the grown crystal was determined by the UV-Vis NIR spectral analysis and it has good optical transparency in the entire visible region. The band tail (Urbach) energy of the grown crystal was analyzed and it appears to be minimum, which indicates that the TP4N has good crystallinity. The position of valence band (Ev) and conduction band (Ec) of the TP4N have been determined from the electron affinity energy (EA) and the ionization energy (EI) of its elements and using the optical band gap. The thermal behaviour of the grown crystal was investigated by thermogravimetric and differential thermal analysis (TG-DTA). Vickers microhardness analysis was carried out to identify the mechanical stability of the grown crystal and their indentation size effect (ISE) was explained by the Meyer's law (ML), Hays-Kendall's (HK) approach, proportional specimen resistance (PSR) model, modified PSR model (MPSR), elastic/plastic deformation (EPD) model and indentation induced cracking (IIC) model. Chemical etching study was carried out to find the etch pit density (EPD) of the grown crystal. Laser damage threshold (LDT) value was measured by using Nd:YAG laser (1064 nm). The dielectric permittivity (ε՛) and dielectric loss (tan δ) as a function of frequency was measured. The electronic polarizability (α) of the TP4N crystal was calculated. It is well matched to the value which was calculated from Clausius-Mossotti relation, Lorentz-Lorentz equation, optical band gap and coupled dipole method (CDM). The Z-scan technique was carried out using solid state laser (640 nm) to analyze the nonlinear optical properties of the TP4N crystal. It exhibits the self-defocusing and saturable absorbance effect during analysis of closed and open aperture respectively. The nonlinear optical parameters such as refractive index (n2), absorption coefficient (β) and the third order nonlinear optical susceptibility (χ(3)) were analyzed.

Understanding the glass-forming ability of active pharmaceutical ingredients for designing supersaturating dosage forms.

PubMed

Kawakami, Kohsaku; Usui, Toshinori; Hattori, Mitsunari

2012-09-01

Amorphous solid dispersions have great potential for enhancing oral absorption of poorly soluble drugs. Crystallization behavior during storage and after exposure to aqueous media must be examined in detail for designing stable and effective amorphous formulations, and it is significantly affected by the intrinsic properties of an amorphous drug. Many attempts have been made to correlate various thermodynamic parameters of pharmaceutical glasses with their crystallization behavior; however, variations in model drugs that could be used for such investigation has been limited because the amorphous characteristics of drugs possessing a high crystallization tendency are difficult to evaluate. In this study, high-speed differential scanning calorimetry, which could inhibit their crystallization using high cooling rates up to 2000°C/s, was employed for assessing such drugs. The thermodynamic parameters of the glasses, including glass transition temperature (T(g)) and fragility, were obtained to show that their crystallization tendency cannot be explained simply by the parameters, although there have been general thought that fragility may be correlated with crystallization tendency. Also investigated was correlation between the thermodynamic parameters and crystallization tendency upon contact with water, which influences in vivo efficacy of amorphous formulations. T(g) was correlated well with the crystallization tendency upon contact with water. Copyright © 2012 Wiley Periodicals, Inc.

A hybrid phononic crystal for roof application.

PubMed

Wan, Qingmian; Shao, Rong

2017-11-01

Phononic crystal is a type of acoustic material, and the study of phononic crystals has attracted great attention from national research institutions. Meanwhile, noise reduction in the low-frequency range has always encountered difficulties and troubles in the engineering field. In order to obtain a unique and effective low-frequency noise reduction method, in this paper a low frequency noise attenuation system based on phononic crystal structure is proposed and demonstrated. The finite element simulation of the band gap is consistent with the final test results. The effects of structure parameters on the band gaps were studied by changing the structure parameters and the band gaps can be controlled by suitably tuning structure parameters. The structure and results provide a good support for phononic crystal structures engineering application.

Electron paramagnetic resonance studies of slowly tumbling vanadyl spin probes in nematic liquid crystals

NASA Technical Reports Server (NTRS)

Bruno, G. V.; Harrington, J. K.; Eastman, M. P.

1978-01-01

An analysis of EPR line shapes by the method of Polnaszek, Bruno, and Freed is made for slowly tumbling vanadyl spin probes in viscous nematic liquid crystals. The use of typical vanadyl complexes as spin probes for nematic liquid crystals is shown to simplify the theoretical analysis and the subsequent interpretation. Rotational correlation times tau and orientational ordering parameters S sub Z where slow tumbling effects are expected to be observed in vanadyl EPR spectra are indicated in a plot. Analysis of the inertial effects on the probe reorientation, which are induced by slowly fluctuating torque components of the local solvent structure, yield quantitative values for tau and S sub Z. The weakly ordered probe VOAA is in the slow tumbling region and displays these inertial effects throughout the nematic range of BEPC and Phase V. VOAA exhibits different reorientation behavior near the isotropic-nematic transition temperature than that displayed far below this transition temperature.

Single crystal growth and characterization of kagomé-lattice shandites Co3Sn2-xInxS2

NASA Astrophysics Data System (ADS)

Kassem, Mohamed A.; Tabata, Yoshikazu; Waki, Takeshi; Nakamura, Hiroyuki

2015-09-01

Single crystals of the shandite-type half metallic ferromagnet Co3Sn2S2, and its In-substituted compounds, Co3Sn2-xInxS2 (0

Process development and characterization of centrosymmetric semiorganic nonlinear optical crystal: 4-dimethylaminopyridine potassium chloride

NASA Astrophysics Data System (ADS)

Johnson, J.; Srineevasan, R.; Sivavishnu, D.

2018-06-01

Centrosymmetric semiorganic crystal 4-dimethylaminopyridine potassium chloride (4-DMAPKC) has been grown successfully by using slow evaporation solution growth technique. Powder x-ray diffraction shows the 4-DMAPKC crystal has good crystalline nature. Single crystal XRD shows that the grown 4-DMAPKC is cubic crystal system with cell parameters a = 3.09 Å, b = 3.09 Å, c = 3.09 Å. Investigation has been carried out to assign the Vibrational frequencies of the grown crystal by FTIR spectral studies. UVsbnd Visible NIR optical absorption spectral studies in the range of 200-1100 nm shows low absorption in UVsbnd Visible region with lower cutoff wave length at 261 nm and optical band gap energy was found as Eg = 5.52 eV. Optically transmittance spectral shows 4-DMAPKC crystal is very good transparency in UV-Visible NIR region. Thermogravimetry and differential thermal (TG-DTA) analysis were carried out. Dielectric studies of as grown crystal sample exhibit low dielectric constant and loss at higher frequencies and attests the nonlinear optical activity. Micro hardness studies of as grown crystal were discussed. Second harmonic generation (SHG) efficiency of the 4-DMAPKC is 0.69 times as that of KDP.

Liquid crystals of carbon nanotubes and graphene.

PubMed

Zakri, Cécile; Blanc, Christophe; Grelet, Eric; Zamora-Ledezma, Camilo; Puech, Nicolas; Anglaret, Eric; Poulin, Philippe

2013-04-13

Liquid crystal ordering is an opportunity to develop novel materials and applications with spontaneously aligned nanotubes or graphene particles. Nevertheless, achieving high orientational order parameter and large monodomains remains a challenge. In addition, our restricted knowledge of the structure of the currently available materials is a limitation for fundamental studies and future applications. This paper presents recent methodologies that have been developed to achieve large monodomains of nematic liquid crystals. These allow quantification and increase of their order parameters. Nematic ordering provides an efficient way to prepare conductive films that exhibit anisotropic properties. In particular, it is shown how the electrical conductivity anisotropy increases with the order parameter of the nematic liquid crystal. The order parameter can be tuned by controlling the length and entanglement of the nanotubes. In the second part of the paper, recent results on graphene liquid crystals are reported. The possibility to obtain water-based liquid crystals stabilized by surfactant molecules is demonstrated. Structural and thermodynamic characterizations provide indirect but statistical information on the dimensions of the graphene flakes. From a general point of view, this work presents experimental approaches to optimize the use of nanocarbons as liquid crystals and provides new methodologies for the still challenging characterization of such materials.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

PubMed Central

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-01-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Subburaman, P.; Austin, B.P.; Shaw, G.X.

2010-11-03

Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

Growth of ruby crystals by the heat exchanger method, phase 1: NSF small business innovation research

NASA Astrophysics Data System (ADS)

Schmid, F.; Khattak, C. P.

1980-03-01

Conditions for the growth of large, uniformly doped laser crystals by the heat exchanger method are explored. Determination of the melt point, selection of crucible material and establishment of furnace operating parameters are discussed. The melt point of ruby was found to be 2040 plus or minus 10 C. Molybdenum crucibles can be used to contain ruby in vacuum as well as under argon atmospheres at desired superheat temperatures over extended periods required for crystal growth. Thermodynamic analysis was conducted and vapor pressures of volatile species calculated. Experimentally, volatilization of chromium oxides was suppressed by using welded covers on crucibles and operating under an argon pressure in the furnace.

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

PubMed Central

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2005-01-01

This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

Synthesis, spectral characterization, and single crystal structure studies of (2-nitro-ethene-1,1-diyl)-bis-((4-isopropyl-benzyl)sulfane)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sakthikumar, L., E-mail: lsakthisbk@gmail.com; Mahalakshmy, R.; Bhargavi, G.

2015-12-15

The title compound (2-nitro-ethene-1,1-diyl)-bis-(4-isopropylbenzyl)sulfane) (5), was synthesised using a two step process. The structure of the product (5) was established by UV, FT-IR, {sup 1}H NMR, {sup 13}C NMR, C,H,N analysis, LC-MS and single crystal X-ray diffraction analysis. The single crystal of the title compound (5) was crystallized in Monoclinic with the space group of P21/c. The crystal exhibit the following unit cell parameters a = 12.8165(18), b = 6.1878(6), c = 27.082(4) Å, β = 90.705(17)°, V = 2147.6(5) A{sup 3}, Z = 4, D{sub x} = 1.242 Mg/m{sup 3} and the molecular formula of C{sub 22}H{sub 27}N{sub 1}O{submore » 2}S{sub 2} was found. The final R value was 0.0776. The crystal structure is stabilized by an interesting intramolecular push and pull five membered electrocyclic interaction between the O1–N1–C2–C1–S1- and via the intermolecular H-bonding interaction between C2–H2···O2.« less

Study of the specific features of single-crystal boron microstructure

NASA Astrophysics Data System (ADS)

Blagov, A. E.; Vasil'ev, A. L.; Dmitriev, V. P.; Ivanova, A. G.; Kulikov, A. G.; Marchenkov, N. V.; Popov, P. A.; Presnyakov, M. Yu.; Prosekov, P. A.; Pisarevskii, Yu. V.; Targonskii, A. V.; Chernaya, T. S.; Chernyshov, D. Yu.

2017-09-01

A complex study of the structure of β-boron single crystal grown by the floating-zone method, with sizes significantly exceeding the analogs known in the literature, has been performed. The study includes X-ray diffraction analysis and X-ray diffractometry (measurement of pole figures and rocking curves), performed on both laboratory and synchrotron sources; atomic-resolution scanning transmission electron microscopy with spherical aberration correction; and energy-dispersive microanalysis. X-ray diffraction analysis using synchrotron radiation has been used to refine the β-boron structure and find impurity Si atoms. The relative variations in the unit-cell parameters a and c for the crystal bulk are found to be δ a/ a ≈ 0.4 and δ c/ c ≈ 0.1%. X-ray diffractometry has revealed that the single-crystal growth axis coincides with the [2\\bar 2013] crystallographic axis and makes an angle of 21.12° with the [0001] threefold axis. Electron microscopy data have confirmed that the sample under study is a β-boron crystal, which may contain 0.3-0.4 at % Si as an impurity. Planar defects (stacking faults and dislocations) are found. The results of additional measurements of the temperature dependence of the thermal conductivity of the crystal in the range of 50-300 K are indicative of its high structural quality.

Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walanj, Rupa; Young, Paul; Baker, Heather M.

2005-04-01

APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

Lidar inelastic multiple-scattering parameters of cirrus particle ensembles determined with geometrical-optics crystal phase functions.

PubMed

Reichardt, J; Hess, M; Macke, A

2000-04-20

Multiple-scattering correction factors for cirrus particle extinction coefficients measured with Raman and high spectral resolution lidars are calculated with a radiative-transfer model. Cirrus particle-ensemble phase functions are computed from single-crystal phase functions derived in a geometrical-optics approximation. Seven crystal types are considered. In cirrus clouds with height-independent particle extinction coefficients the general pattern of the multiple-scattering parameters has a steep onset at cloud base with values of 0.5-0.7 followed by a gradual and monotonic decrease to 0.1-0.2 at cloud top. The larger the scattering particles are, the more gradual is the rate of decrease. Multiple-scattering parameters of complex crystals and of imperfect hexagonal columns and plates can be well approximated by those of projected-area equivalent ice spheres, whereas perfect hexagonal crystals show values as much as 70% higher than those of spheres. The dependencies of the multiple-scattering parameters on cirrus particle spectrum, base height, and geometric depth and on the lidar parameters laser wavelength and receiver field of view, are discussed, and a set of multiple-scattering parameter profiles for the correction of extinction measurements in homogeneous cirrus is provided.

X-ray diffraction and infrared spectroscopy of N,N-dimethylformamide and dimethyl sulfoxide solvatomorphs of betulonic acid.

PubMed

Boryczka, Stanisław; Jastrzebska, Maria; Bębenek, Ewa; Kusz, Joachim; Zubko, Maciej; Kadela, Monika; Michalik, Ewa

2012-12-01

X-ray diffraction and infrared spectroscopy measurements for the N,N-dimethylformamide (DMF) and dimethyl sulfoxide (DMSO) solvatomorphs of betulonic acid (BA) were investigated. BA [3-oxolup-20(29)-en-28-oic acid, C(30)H(46)O(3)] exhibits a wide spectrum of biological activities and is considered to be a promising natural agent for the treatment of various cancer diseases. BA as a noncrystalline substance was obtained by oxidation of betulin. Crystal structures and the spectral data allowed analysis of hydrogen bonding (H-bonding), molecular conformation, and crystal packing differences in the solvatomorphs. Crystals of BA solvates were grown from the DMF-acetone (1:10, v/v) and DMSO-water (9:1, v/v) solutions. BA-DMF (1:1) solvate crystallizes in the monoclinic P2(1) space group, Z = 2. The unit cell parameters are as follows: cell lengths a = 13.2458(5) Å, b = 6.6501(2) Å, c = 17.9766(7) Å, and β = 110.513(4)°. BA-DMSO (1:1) solvate crystallizes in the orthorhombic P2(1)2(1)2(1) (Z = 4) space group with the following unit cell parameters: a = 6.6484(4) Å, b = 13.3279(8) Å, and c = 32.6821(19) Å. Conformational analysis of the six-membered rings, cyclopentane ring, and isopropenyl group showed differences in comparison with other betulin derivatives examined earlier. For both solvates, the intermolecular packing arrangement was governed mainly by H-bonds. The shortest H-bonds with D···A distances of 2.604 and 2.657 Å, and almost linear DH···A connection occurred between OH of carboxylic group of BA and oxygen atoms from O=C and O=S groups of DMF and DMSO, respectively. Copyright © 2012 Wiley Periodicals, Inc.

Crystallization and preliminary X-ray analysis of recombinant human acid beta-glucocerebrosidase, a treatment for Gaucher's disease

NASA Technical Reports Server (NTRS)

Roeber, Dana; Achari, Aniruddha; Manavalan, Partha; Edmunds, Tim; Scott, David L.

2003-01-01

Acid beta-glucocerebrosidase (N-acylsphingosyl-1-O-beta-D-glucoside:glucohydrolase) is a lysosomal glycoprotein that catalyzes the hydrolysis of the glycolipid glucocerebroside to glucose and ceramide. Inadequate levels of this enzyme underly the pathophysiology of Gaucher's disease. Cerezyme (Genzyme Corporation, Cambridge, MA, USA) is a partially deglycosylated form of recombinant human acid beta-glucocerebrosidase that is used in the treatment of Gaucher patients. Although acid beta-glucocerebrosidase belongs to a large family of glycosidases, relatively little is known regarding its structural biology. Here, the crystallization and the initial diffraction analysis of Cerezyme are reported. The crystals are C-centered orthorhombic, with unit-cell parameters a = 285.0, b = 110.2, c = 91.7 A. A 99.9% complete data set has been collected to 2.75 A with an R(sym) of 8.8%.

Crystallization and Preliminary X-ray analysis of Human Recombinant Acid beta-glucocerebrosidase, a treatment for Gaucher's Disease

NASA Technical Reports Server (NTRS)

Roeber, Dana F.; Achari, Aniruddha; Manavalan, Partha; Edmunds, Tim; Scott, David L.; Curreri, Peter A. (Technical Monitor)

2002-01-01

Acid beta-glucocerebrosidase (N-acylsphingosyl - O - beta-D - glucoside:glucohydrolase) is a lysosomal glycoprotein that catalyzes the hydrolysis of the glycolipid glucocerebroside to glucose and ceramide. Inadequate levels of this enzyme underly the pathophysiology of Gaucher's disease. Cerezyme(R) (Genzyme Corporation, Cambridge, MA) is a partially deglycosylated form of recombinant human acid beta-glucocerebrosidase that is commercially available for the treatment of Gaucher patients. Although acid beta-glucocerebrosidase belongs to a large family of glycosidases, relatively little is known regarding its structural biology. We report the crystallization and the initial diffraction analysis of Cerezyme(R). The crystals are C-centered orthorhombic, with unit-cell parameters of a = 285.0 A, b = 110.2 A, and c = 91.7 A. A 99.9 A complete data set has been collected to 2.75 A with an R(sub sym) of 8.8 %.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

A novel coordination polymer of Ni(II) based on 1,3,5-benzenetricarboxylic acid synthesis, characterization, crystal structure, thermal study, and luminescent properties

NASA Astrophysics Data System (ADS)

Saheli, Sania; Rezvani, Alireza

2017-01-01

A new metal-organic framework (MOF) formulated as [Ni(H2btc)(OH)(H2O)2] (1) (H3btc = 1,3,5-benzenetricarboxylic acid) was synthesized using the hydrothermal technique. The complex 1 was characterized by elemental analysis, infrared spectroscopy, and powder X-ray diffraction in addition to single crystal X-ray diffraction. X-ray crystal structural analysis displayed that the compound belonged to the monoclinic space group P21/n with cell parameters a = 6.8658(14) Å, b = 18.849(4) Å, c = 8.5608(17) Å. In the title complex, ligand is linked to metal centers through two μ-oxo bridges and forming a 2D layer which is led to form an interesting geometry. The thermal stability and fluorescence property of 1 have also been investigated.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

Synthesis and crystal structure of an oxovanadium(IV) complex with a pyrazolone ligand and its use as a heterogeneous catalyst for the oxidation of styrene under mild conditions.

PubMed

Parihar, Sanjay; Pathan, Soyeb; Jadeja, R N; Patel, Anjali; Gupta, Vivek K

2012-01-16

1-Phenyl-3-methyl-4-touloyl-5-pyrazolone (ligand) was synthesized and used to prepare an oxovanadium(IV) complex. The complex was characterized by single-crystal X-ray analysis and various spectroscopic techniques. The single-crystal X-ray analysis of the complex shows that the ligands are coordinated in a syn configuration to each other and create a distorted octahedral environment around the metal ion. A heterogeneous catalyst comprising an oxovanadium(IV) complex and hydrous zirconia was synthesized, characterized by various physicochemical techniques, and successfully used for the solvent-free oxidation of styrene. The influence of the reaction parameters (percent loading, molar ratio of the substrate to H(2)O(2), amount of catalyst, and reaction time) was studied. The catalyst was reused three times without any significant loss in the catalytic activity.

Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

2008-04-01

A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.

2007-10-01

S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of selenomethionine-labelled progesterone 5β-reductase from Digitalis lanata Ehrh

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egerer-Sieber, Claudia; Herl, Vanessa; Müller-Uri, Frieder

2006-03-01

Progesterone 5β-reductase is the first stereospecific enzyme in the pathway for the synthesis of cardenolides. To elucidate the structural mechanism of this reaction, we crystallized the selenomethionine-labelled enzyme from D. lanata and report the preliminary analysis of a MAD data set collected from these crystals. Progesterone 5β-reductase (5β-POR) catalyzes the reduction of progesterone to 5β-pregnane-3,20-dione and is the first stereospecific enzyme in the putative biosynthetic pathway of Digitalis cardenolides. Selenomethionine-derivatized 5β-POR from D. lanata was successfully overproduced and crystallized. The crystals belong to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 71.73, c = 186.64 Å. A MADmore » data set collected at 2.7 Å resolution allowed the identification of six out of eight possible Se-atom positions. A first inspection of the MAD-phased electron-density map shows that 5β-POR is a Rossmann-type reductase and the quality of the map is such that it is anticipated that a complete atomic model of 5β-POR will readily be built.« less

A Simple Inexpensive Bridgman-Stockbarger Crystal Growth System for Organic Materials

NASA Technical Reports Server (NTRS)

Choi, J.; Aggarwal, M. D.; Wang, W. S.; Metzl, R.; Bhat, K.; Penn, Benjamin G.; Frazier, Donald O.

1996-01-01

Direct observation of solid-liquid interface is important for the directional solidification to determine the desired interface shape by controlling the growth parameters. To grow good quality single crystals of novel organic nonlinear optical materials, a simple inexpensive Bridgman-Stockbarger (BS) crystal growth system has been designed and fabricated. Two immiscible liquids have been utilized to create two zones for this crystal growth system. Bulk single crystals of benzil derivative and n-salicylidene-aniline have been successfully grown in this system. The optimum lowering rate has been found to be 0.1 mm/h for the flat interface. Results on the crystal growth and other parameters of the grown crystals are presented.

Crystallite size strain analysis of nanocrystalline La0.7Sr0.3MnO3 perovskite by Williamson-Hall plot method

NASA Astrophysics Data System (ADS)

Kumar, Dinesh; Verma, Narendra Kumar; Singh, Chandra Bhal; Singh, Akhilesh Kumar

2018-04-01

The nanocrystalline Sr-doped LaMnO3 (La0.7Sr0.3MnO3 = LSMO) perovskite manganites having different crystallite size were synthesized using the nitrate-glycine auto-combustion method. The phase purity of the manganites was checked by X-ray diffraction (XRD) measurement. The XRD patterns of the sample reveal that La0.7S0.3MnO3 crystallizes into rhombohedral crystal structure with space group R-3c. The size-dependence of structural lattice parameters have been investigated with the help of Rietveld refinement. The structural parameters increase as a function of crystallite size. The crystallite-size and internal strain as a function of crystallite-size have been calculated using Williamson-Hall plot.

Optimal design of similariton fiber lasers without gain-bandwidth limitation.

PubMed

Li, Xingliang; Zhang, Shumin; Yang, Zhenjun

2017-07-24

We have numerically investigated broadband high-energy similariton fiber lasers, demonstrated that the self-similar evolution of pulses can locate in a segment of photonic crystal fiber without gain-bandwidth limitation. The effects of various parameters, including the cavity length, the spectral filter bandwidth, the pump power, the length of the photonic crystal fiber and the output coupling ratio have also been studied in detail. Using the optimal parameters, a single pulse with spectral width of 186.6 nm, pulse energy of 23.8 nJ, dechirped pulse duration of 22.5 fs and dechirped pulse peak power of 1.26 MW was obtained. We believe that this detailed analysis of the behaviour of pulses in the similariton regime may have major implications in the development of broadband high-energy fiber lasers.

Calculation of Optical Parameters of Liquid Crystals

NASA Astrophysics Data System (ADS)

Kumar, A.

2007-12-01

Validation of a modified four-parameter model describing temperature effect on liquid crystal refractive indices is being reported in the present article. This model is based upon the Vuks equation. Experimental data of ordinary and extraordinary refractive indices for two liquid crystal samples MLC-9200-000 and MLC-6608 are used to validate the above-mentioned theoretical model. Using these experimental data, birefringence, order parameter, normalized polarizabilities, and the temperature gradient of refractive indices are determined. Two methods: directly using birefringence measurements and using Haller's extrapolation procedure are adopted for the determination of order parameter. Both approches of order parameter calculation are compared. The temperature dependences of all these parameters are discussed. A close agreement between theory and experiment is obtained.

Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

2014-02-19

The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

Investigation of the multiplet features of SrTiO 3 in X-ray absorption spectra based on configuration interaction calculations

DOE PAGES

Wu, M.; Xin, Houlin L.; Wang, J. O.; ...

2018-04-24

Synchrotron-based L 2,3-edge absorption spectra show strong sensitivities to the local electronic structure and chemical environment. However, detailed physical information cannot be extracted easily without computational aids. Here in this study using the experimental Ti L 2,3-edges absorption spectrum of SrTiO 3as a fingerprint and considering full multiplet effects, calculations yield different energy parameters characterizing local ground state properties. The peak splitting and intensity ratios of the L 3 and L 2 set of peaks are carefully analyzed quantitatively, giving rise to a small hybridization energy around 1.2 eV, and the different hybridization energy values reported in the literature aremore » further addressed. Finally, absorption spectra with different linearly polarized photons under various tetragonal crystal fields are investigated, revealing a non-linear orbital–lattice interaction, and a theoretical guidance for material engineering of SrTiO 3-based thin films and heterostructures is offered. Finally, detailed analysis of spectrum shifts with different tetragonal crystal fields suggests that the e g crystal field splitting is a necessary parameter for a thorough analysis of the spectra, even though it is not relevant for the ground state properties.« less

Investigation of the multiplet features of SrTiO 3 in X-ray absorption spectra based on configuration interaction calculations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, M.; Xin, Houlin L.; Wang, J. O.

Synchrotron-based L 2,3-edge absorption spectra show strong sensitivities to the local electronic structure and chemical environment. However, detailed physical information cannot be extracted easily without computational aids. Here in this study using the experimental Ti L 2,3-edges absorption spectrum of SrTiO 3as a fingerprint and considering full multiplet effects, calculations yield different energy parameters characterizing local ground state properties. The peak splitting and intensity ratios of the L 3 and L 2 set of peaks are carefully analyzed quantitatively, giving rise to a small hybridization energy around 1.2 eV, and the different hybridization energy values reported in the literature aremore » further addressed. Finally, absorption spectra with different linearly polarized photons under various tetragonal crystal fields are investigated, revealing a non-linear orbital–lattice interaction, and a theoretical guidance for material engineering of SrTiO 3-based thin films and heterostructures is offered. Finally, detailed analysis of spectrum shifts with different tetragonal crystal fields suggests that the e g crystal field splitting is a necessary parameter for a thorough analysis of the spectra, even though it is not relevant for the ground state properties.« less

Maximizing Macromolecule Crystal Size for Neutron Diffraction Experiments

NASA Technical Reports Server (NTRS)

Judge, R. A.; Kephart, R.; Leardi, R.; Myles, D. A.; Snell, E. H.; vanderWoerd, M.; Curreri, Peter A. (Technical Monitor)

2002-01-01

A challenge in neutron diffraction experiments is growing large (greater than 1 cu mm) macromolecule crystals. In taking up this challenge we have used statistical experiment design techniques to quickly identify crystallization conditions under which the largest crystals grow. These techniques provide the maximum information for minimal experimental effort, allowing optimal screening of crystallization variables in a simple experimental matrix, using the minimum amount of sample. Analysis of the results quickly tells the investigator what conditions are the most important for the crystallization. These can then be used to maximize the crystallization results in terms of reducing crystal numbers and providing large crystals of suitable habit. We have used these techniques to grow large crystals of Glucose isomerase. Glucose isomerase is an industrial enzyme used extensively in the food industry for the conversion of glucose to fructose. The aim of this study is the elucidation of the enzymatic mechanism at the molecular level. The accurate determination of hydrogen positions, which is critical for this, is a requirement that neutron diffraction is uniquely suited for. Preliminary neutron diffraction experiments with these crystals conducted at the Institute Laue-Langevin (Grenoble, France) reveal diffraction to beyond 2.5 angstrom. Macromolecular crystal growth is a process involving many parameters, and statistical experimental design is naturally suited to this field. These techniques are sample independent and provide an experimental strategy to maximize crystal volume and habit for neutron diffraction studies.

Long wavelength optical mode frequencies and the Anderson-Gruneisen parameter for alkali halide crystals

NASA Astrophysics Data System (ADS)

Gupta, A. P.; Shanker, Jai

1980-02-01

The relation between long wavelength optical mode frequencies and the Anderson-Gruneisen parameter δ for alkali halides studied by Madan suffers from a mathematical error which is rectified in the present communication. A theoretical analysis of δ is presented adopting six potential functions for the short range repulsion energy. Values of δ and γTO calculated from the Varshni-Shukla potential are found in closest agreement with experimental data.

Crystallization and preliminary X-ray crystallographic analysis of the cysteine protease inhibitor clitocypin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Galeša, Katja; Brzin, Jože; Sabotič, Jerica

2006-01-01

Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. Clitocypin is a cysteine protease inhibitor from the mushroom Clitocybe nebularis. The protein has been purified from natural sources and crystallized in a variety of non-isomorphous forms belonging to monoclinic and triclinic space groups. A diffraction data set to 1.55 Å resolution was obtained from a crystal belonging to space group P2, with unit-cell parameters a = 38.326, b = 33.597, c = 55.568 Å, βmore » = 104°. An inability to achieve isomorphism forced the use of MAD and SAD phasing methods. Phasing is in progress.« less

Crystallization and preliminary X-ray analysis of the atrial natriuretic peptide (ANP) receptor extracellular domain complex with ANP: use of ammonium sulfate as the cryosalt.

PubMed

Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S

2003-10-01

Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

PubMed Central

Kondou, Youhei; Kitazawa, Daisuke; Takeda, Shigeki; Yamashita, Eiki; Mizuguchi, Mineyuki; Kawano, Keiichi; Tsukihara, Tomitake

2005-01-01

Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-­rays to at least 2.1 Å resolution and are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan. PMID:16508104

Crystallization and preliminary X-ray analysis of a novel halotolerant feruloyl esterase identified from a soil metagenomic library

PubMed Central

Chen, Shang-ke; Wang, Kui; Liu, Yuhuan; Hu, Xiaopeng

2012-01-01

Feruloyl esterase cleaves the ester linkage formed between ferulic acid and polysaccharides in plant cell walls and thus has wide potential industrial applications. A novel feruloyl esterase (EstF27) identified from a soil metagenomic library was crystallized and a complete data set was collected from a single cooled crystal using an in-house X-ray source. The crystal diffracted to 2.9 Å resolution and belonged to space group P212121, with unit-cell parameters a = 94.35, b = 106.19, c = 188.51 Å, α = β = γ = 90.00°. A Matthews coefficient of 2.55 Å3 Da−1, with a corresponding solvent content of 51.84%, suggested the presence of ten protein subunits in the asymmetric unit. PMID:22750860

Purification, crystallization and preliminary X-ray analysis of the regulatory subunit of aspartate kinase from Thermus thermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Ayako; Tomita, Takeo; Kuzuyama, Tomohisa

2007-02-01

To elucidate the mechanism of regulation of aspartate kinase, the regulatory subunit (the β subunit of T. thermophilus aspartate kinase) was crystallized in the presence of the inhibitor threonine. Aspartate kinase (AK) from Thermus thermophilus, which catalyzes the first step of threonine and methionine biosynthesis, is regulated via feedback inhibition by the end product threonine. To elucidate the mechanism of regulation of AK, the regulatory subunit (the β subunit of T. thermophilus AK) was crystallized in the presence of the inhibitor threonine. Diffraction data were collected to 2.15 Å at a synchrotron source. The crystal belongs to the cubic spacemore » group P4{sub 3}32 or P4{sub 1}32, with unit-cell parameters a = b = c = 141.8 Å.« less

Mechanical Characterization of Partially Crystallized Sphere Packings

NASA Astrophysics Data System (ADS)

Hanifpour, M.; Francois, N.; Vaez Allaei, S. M.; Senden, T.; Saadatfar, M.

2014-10-01

We study grain-scale mechanical and geometrical features of partially crystallized packings of frictional spheres, produced experimentally by a vibrational protocol. By combining x-ray computed tomography, 3D image analysis, and discrete element method simulations, we have access to the 3D structure of internal forces. We investigate how the network of mechanical contacts and intergranular forces change when the packing structure evolves from amorphous to near perfect crystalline arrangements. We compare the behavior of the geometrical neighbors (quasicontracts) of a grain to the evolution of the mechanical contacts. The mechanical coordination number Zm is a key parameter characterizing the crystallization onset. The high fluctuation level of Zm and of the force distribution in highly crystallized packings reveals that a geometrically ordered structure still possesses a highly random mechanical backbone similar to that of amorphous packings.

Time-evolution of grain size distributions in random nucleation and growth crystallization processes

NASA Astrophysics Data System (ADS)

Teran, Anthony V.; Bill, Andreas; Bergmann, Ralf B.

2010-02-01

We study the time dependence of the grain size distribution N(r,t) during crystallization of a d -dimensional solid. A partial differential equation, including a source term for nuclei and a growth law for grains, is solved analytically for any dimension d . We discuss solutions obtained for processes described by the Kolmogorov-Avrami-Mehl-Johnson model for random nucleation and growth (RNG). Nucleation and growth are set on the same footing, which leads to a time-dependent decay of both effective rates. We analyze in detail how model parameters, the dimensionality of the crystallization process, and time influence the shape of the distribution. The calculations show that the dynamics of the effective nucleation and effective growth rates play an essential role in determining the final form of the distribution obtained at full crystallization. We demonstrate that for one class of nucleation and growth rates, the distribution evolves in time into the logarithmic-normal (lognormal) form discussed earlier by Bergmann and Bill [J. Cryst. Growth 310, 3135 (2008)]. We also obtain an analytical expression for the finite maximal grain size at all times. The theory allows for the description of a variety of RNG crystallization processes in thin films and bulk materials. Expressions useful for experimental data analysis are presented for the grain size distribution and the moments in terms of fundamental and measurable parameters of the model.

Synthesis, crystal structure refinement, and nonlinear-optical properties of CaB{sub 3}O{sub 5}(OH): Comparative crystal chemistry of calcium triborates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamnova, N. A., E-mail: aks.crys@gmail.com; Aksenov, S. M.; Stefanovich, S. Yu.

Calcium triborate CaB{sub 3}O5(OH) obtained by hydrothermal synthesis in the Ca(OH){sub 2}–H{sub 3}BO{sub 3}–Na{sub 2}CO{sub 3}–KCl system is studied by single-crystal X-ray diffraction. The parameters of the orthorhombic unit cell are as follows: a = 13.490(1), b = 6.9576(3), and c = 4.3930(2) Å; V = 412.32(3) Å{sup 3} and space group Pna2{sub 1}. The structure is refined in the anisotropic approximation of the atomic displacement parameters to R = 4.28% using 972 vertical bar F vertical bar > 4σ(F). It is confirmed that the crystal structure of Ca triborate CaB{sub 3}O{sub 5}(OH) is identical to that described earlier. Themore » hydrogen atom is localized. An SHG signal stronger than that of the quartz standard is registered. The phase transition of calcium triborate into calciborite is found on heating. The comparative crystal-chemical analysis of a series of borates with the general chemical formula 2CaO · 3B{sub 2}O{sub 3} · nH{sub 2}O (n = 0–13) with the constant CaO: B{sub 2}O{sub 3}= 2: 3 ratio and variable content of water is performed.« less

Characterization of Strain Due to Nitrogen Doping Concentration Variations in Heavy Doped 4H-SiC

NASA Astrophysics Data System (ADS)

Yang, Yu; Guo, Jianqiu; Raghothamachar, Balaji; Chan, Xiaojun; Kim, Taejin; Dudley, Michael

2018-02-01

Highly doped 4H-SiC will show a significant lattice parameter difference with respect to the undoped material. We have applied the recently developed monochromatic contour mapping technique for 4H-SiC crystals to a 4H-SiC wafer crystal characterized by nitrogen doping concentration variation across the whole sample surface using a synchrotron monochromatic x-ray beam. Strain maps of 0008 and - 2203 planes were derived by deconvoluting the lattice parameter variations from the lattice tilt. Analysis reveals markedly different strain values within and out of the basal plane indicating the strain induced by nitrogen doping is anisotropic in the 4H-SiC hexagonal crystal structure. The highest strain calculated along growth direction [0001] and along [1-100] on the closed packed basal plane is up to - 4 × 10-4 and - 2.7 × 10-3, respectively. Using an anisotropic elasticity model by separating the whole bulk crystal into numerous identical rectangular prism units, the measured strain was related to the doping concentration and the calculated highest nitrogen level inside wafer crystal was determined to be 1.5 × 1020 cm-3. This is in agreement with observation of double Shockley stacking faults in the highly doped region that are predicted to nucleate at nitrogen levels above 2 × 1019 cm-3.

Additive Manufacturing of Single-Crystal Superalloy CMSX-4 Through Scanning Laser Epitaxy: Computational Modeling, Experimental Process Development, and Process Parameter Optimization

NASA Astrophysics Data System (ADS)

Basak, Amrita; Acharya, Ranadip; Das, Suman

2016-08-01

This paper focuses on additive manufacturing (AM) of single-crystal (SX) nickel-based superalloy CMSX-4 through scanning laser epitaxy (SLE). SLE, a powder bed fusion-based AM process was explored for the purpose of producing crack-free, dense deposits of CMSX-4 on top of similar chemistry investment-cast substrates. Optical microscopy and scanning electron microscopy (SEM) investigations revealed the presence of dendritic microstructures that consisted of fine γ' precipitates within the γ matrix in the deposit region. Computational fluid dynamics (CFD)-based process modeling, statistical design of experiments (DoE), and microstructural characterization techniques were combined to produce metallurgically bonded single-crystal deposits of more than 500 μm height in a single pass along the entire length of the substrate. A customized quantitative metallography based image analysis technique was employed for automatic extraction of various deposit quality metrics from the digital cross-sectional micrographs. The processing parameters were varied, and optimal processing windows were identified to obtain good quality deposits. The results reported here represent one of the few successes obtained in producing single-crystal epitaxial deposits through a powder bed fusion-based metal AM process and thus demonstrate the potential of SLE to repair and manufacture single-crystal hot section components of gas turbine systems from nickel-based superalloy powders.

Effect of process parameters and crystal orientation on 3D anisotropic stress during CZ and FZ growth of silicon

NASA Astrophysics Data System (ADS)

Drikis, Ivars; Plate, Matiss; Sennikovs, Juris; Virbulis, Janis

2017-09-01

Simulations of 3D anisotropic stress are carried out in <100> and <111> oriented Si crystals grown by FZ and CZ processes for different diameters, growth rates and process stages. Temperature dependent elastic constants and thermal expansion coefficients are used in the FE simulations. The von Mises stress at the triple point line is 5-11% higher in <111> crystals compared to <100> crystals. The process parameters have a larger effect on the von Mises stress than the crystal orientation. Generally, the <111> crystal has a higher azimuthal variation of stress along the triple point line ( 8%) than the <100> crystal ( 2%). The presence of a crystal ridge increases the stress beside the ridge and decreases it on the ridge compared with the round crystal.

Growth, structural, spectral, mechanical, thermal and dielectric characterization of phosphoric acid admixtured L-alanine (PLA) single crystals.

PubMed

Rose, A S J Lucia; Selvarajan, P; Perumal, S

2011-10-15

Phosphoric acid admixtured L-alanine (PLA) single crystals were grown successfully by solution method with slow evaporation technique at room temperature. Crystals of size 18 mm×12 mm×8 mm have been obtained in 28 days. The grown crystals were colorless and transparent. The solubility of the grown samples has been found out at various temperatures. The lattice parameters of the grown crystals were determined by X-ray diffraction technique. The reflection planes of the sample were confirmed by the powder X-ray diffraction study and diffraction peaks were indexed. Fourier transform infrared (FTIR) studies were used to confirm the presence of various functional groups in the crystals. UV-visible transmittance spectrum was recorded to study the optical transparency of grown crystal. The nonlinear optical (NLO) property of the grown crystal was confirmed by Kurtz-Perry powder technique and a study of its second harmonic generation efficiency in comparison with potassium dihydrogen phosphate (KDP) has been made. The mechanical strength of the crystal was estimated by Vickers hardness test. The grown crystals were subjected to thermo gravimetric and differential thermal analysis (TG/DTA). The dielectric behavior of the sample was also studied. Copyright © 2011 Elsevier B.V. All rights reserved.

X-ray crystal spectrometer upgrade for ITER-like wall experiments at JETa)

NASA Astrophysics Data System (ADS)

Shumack, A. E.; Rzadkiewicz, J.; Chernyshova, M.; Jakubowska, K.; Scholz, M.; Byszuk, A.; Cieszewski, R.; Czarski, T.; Dominik, W.; Karpinski, L.; Kasprowicz, G.; Pozniak, K.; Wojenski, A.; Zabolotny, W.; Conway, N. J.; Dalley, S.; Figueiredo, J.; Nakano, T.; Tyrrell, S.; Zastrow, K.-D.; Zoita, V.

2014-11-01

The high resolution X-Ray crystal spectrometer at the JET tokamak has been upgraded with the main goal of measuring the tungsten impurity concentration. This is important for understanding impurity accumulation in the plasma after installation of the JET ITER-like wall (main chamber: Be, divertor: W). This contribution provides details of the upgraded spectrometer with a focus on the aspects important for spectral analysis and plasma parameter calculation. In particular, we describe the determination of the spectrometer sensitivity: important for impurity concentration determination.

X-ray crystal spectrometer upgrade for ITER-like wall experiments at JET.

PubMed

Shumack, A E; Rzadkiewicz, J; Chernyshova, M; Jakubowska, K; Scholz, M; Byszuk, A; Cieszewski, R; Czarski, T; Dominik, W; Karpinski, L; Kasprowicz, G; Pozniak, K; Wojenski, A; Zabolotny, W; Conway, N J; Dalley, S; Figueiredo, J; Nakano, T; Tyrrell, S; Zastrow, K-D; Zoita, V

2014-11-01

The high resolution X-Ray crystal spectrometer at the JET tokamak has been upgraded with the main goal of measuring the tungsten impurity concentration. This is important for understanding impurity accumulation in the plasma after installation of the JET ITER-like wall (main chamber: Be, divertor: W). This contribution provides details of the upgraded spectrometer with a focus on the aspects important for spectral analysis and plasma parameter calculation. In particular, we describe the determination of the spectrometer sensitivity: important for impurity concentration determination.

Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

2014-08-27

E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

Phosphate recovery through struvite-family crystals precipitated in the presence of citric acid: mineralogical phase and morphology evaluation.

PubMed

Perwitasari, D S; Edahwati, L; Sutiyono, S; Muryanto, S; Jamari, J; Bayuseno, A P

2017-11-01

Precipitation strategy of struvite-family crystals is presented in this paper to recover phosphate and potassium from a synthetic wastewater in the presence of citric acid at elevated temperature. The crystal-forming solutions were prepared from crystals of MgCl 2 and NH 4 H 2 PO 4 with a molar ratio of 1:1:1 for Mg +2 , [Formula: see text], and [Formula: see text], and the citric acid (C 6 H 8 O 7 ) was prepared (1.00 and 20.00 ppm) from citric acid crystals. The Rietveld analysis of X-ray powder diffraction pattern confirmed a mixed product of struvite, struvite-(K), and newberyite crystallized at 30°C in the absence of citric acid. In the presence of citric acid at 30° and 40°C, an abundance of struvite and struvite-(K) were observed. A minute impurity of sylvite and potassium peroxide was unexpectedly found in certain precipitates. The crystal solids have irregular flake-shaped morphology, as shown by scanning electron microscopy micrograph. All parameters (citric acid, temperature, pH, Mg/P, and N/P) were deliberately arranged to control struvite-family crystals precipitation.

The effect of UV exposure and heat treatment on crystallization behavior of photosensitive glasses

NASA Astrophysics Data System (ADS)

Kıbrıslı, Orhan; Ersundu, Ali Erçin

2018-05-01

In this study, photosensitive glasses in the Na2O-ZnO-Al2O3-SiO2 system with photosensitizing agents (cerium, silver, tin, antimony) and halogenides (NaF and KBr) were synthesized through a conventional melt-quenching technique. The crystallization mechanism was investigated for solely heat-treated and UV-exposed + heat-treated samples using differential thermal analysis (DTA), X-ray diffraction (XRD), energy-dispersive X-ray spectroscopy (EDS) and scanning electron microscopy (SEM) techniques to understand the effect of UV exposure on crystallization behavior of photosensitive glasses. Accordingly, non-isothermal DTA measurements were performed at different heating rates to determine crystallization peak, T p, and onset, T c, temperatures. For solely heat-treated samples, the kinetic parameters such as the Avrami constant, n, and morphology index, m, were calculated as 1 from the Ozawa method indicating surface crystallization and the value of crystallization activation energy was calculated as 944 kJ/mol using modified Kissinger method. On the contrary, bulk crystallization was found to be predominant for UV exposed + heat-treated samples revealing that UV exposure is the primary cause of bulk crystallization in photosensitive glasses.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohrbaugh, Wayne Joseph

Results are reported from an investigation of correlations between molecular structural parameters of selected organophosphorus insecticides and their corresponding toxic effectiveness. The crystal and molecular structures of azinphos-methyl, emidithion, and tetrachlorvinphos were determined via three-dimensional x-ray analysis. Acetylcholinesterase (AChE) in nerve cells was identified as the target for organophosphorus insecticides.

Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.

2005-10-01

The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

Hydrothermal synthesis, crystal structures, and enantioselective adsorption property of bis(L-histidinato)nickel(II) monohydrate

NASA Astrophysics Data System (ADS)

Ramos, Christian Paul L.; Conato, Marlon T.

2018-05-01

Despite the numerous researches in metal-organic frameworks (MOFs), there are only few reports on biologically important amino acids, histidine in particular, on its use as bridging ligand in the construction of open-framework architectures. In this work, hydrothermal synthesis was used to prepare a compound based on Ni2+ and histidine. The coordination assembly of imidazole side chain of histidine with divalent nickel ions in aqueous condition yielded purple prismatic solids. Single crystal X-ray diffraction (XRD) analysis of the product revealed structure for Ni(C6H8N3O2)2 • H2O that has a monoclinic (C2) structure with lattice parameters, a = 29.41, b = 8.27, c = 6.31 Å, β = 90.01 ˚. Circular dichroism - optical rotatory dispersion (CD-ORD), Powder X-ray diffraction (PXRD) and Fourier transform - infrared spectroscopy (FT-IR) analyses are conducted to further characterize the crystals. Enantioselective adsorption analysis using racemic mixture of 2-butanol confirmed bis(L-histidinato)nickel(II) monohydrate MOF crystal's enantioselective property preferentially favoring the adsorption of (S)-2-butanol isomer.

Expression, purification, crystallization and preliminary crystallographic analysis of MxiH, a subunit of the Shigella flexneri type III secretion system needle

PubMed Central

Deane, Janet E.; Cordes, Frank S.; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D.; Picking, Wendy L.; Lea, Susan M.; Blocker, Ariel

2006-01-01

A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiHCΔ5 and diffraction data were collected to 1.9 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 Å, β = 96.5°. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 Å3 Da−1 for two molecules per asymmetric unit, corresponding to a solvent content of 33%. PMID:16511329

Expression, purification, crystallization and preliminary crystallographic analysis of MxiH, a subunit of the Shigella flexneri type III secretion system needle.

PubMed

Deane, Janet E; Cordes, Frank S; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D; Picking, Wendy L; Lea, Susan M; Blocker, Ariel

2006-03-01

A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiH(CDelta5) and diffraction data were collected to 1.9 A resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 A, beta = 96.5 degrees. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 A3 Da(-1) for two molecules per asymmetric unit, corresponding to a solvent content of 33%.

Purification, crystallization and preliminary X-ray analysis of native and selenomethionine class I tagatose-1,6-bisphosphate aldolase from Streptococcus pyogenes.

PubMed

Liotard, Brigitte; Sygusch, Jurgen

2004-03-01

Tagatose-1,6-bisphosphate aldolase (EC 4.1.2.40) is situated at the branching of the tagatose-6-phosphate and Embden-Meyerhof-Parnas (glycolysis) metabolic pathways, where it catalyzes the reversible cleavage of tagatose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The recombinant protein from Streptococcus pyogenes was overexpressed in Escherichia coli in its native and selenomethionine-derivative forms and purified using ion-exchange and hydrophobic interaction chromatography. Orthorhombic crystals suitable for structural analysis were obtained by the hanging-drop vapour-diffusion method for both isoforms. The crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.7, b = 108.1, c = 238.7 A for the native form and a = 64.1, b = 108.3, c = 239.8 A for the selenomethionine derivative. The asymmetric unit contains four protomers, corresponding to a crystal volume per protein weight (V(M)) of 2.8 A(3) Da(-1) and a solvent content of 56% by volume.

Experimental and numerical analysis of penetration/removal response of endodontic instrument made of single crystal Cu-based SMA: comparison with NiTi SMA instruments

NASA Astrophysics Data System (ADS)

Vincent, M.; Xolin, P.; Gevrey, A.-M.; Thiebaud, F.; Engels-Deutsch, M.; Ben Zineb, T.

2017-04-01

This paper presents an experimental and numerical study showing that single crystal shape memory alloy (SMA) Cu-based endodontic instruments can lead to equivalent mechanical performances compared to NiTi-based instruments besides their interesting biological properties. Following a previous finite element analysis (FEA) of single crystal CuAlBe endodontic instruments (Vincent et al 2015 J. Mater. Eng. Perform. 24 4128-39), prototypes with the determined geometrical parameters were machined and experimentally characterized in continuous rotation during a penetration/removal (P/R) protocol in artificial canals. The obtained mechanical responses were compared to responses of NiTi endodontic files in the same conditions. In addition, FEA was conducted and compared with the experimental results to validate the adopted modeling and to evaluate the local quantities inside the instrument as the stress state and the distribution of volume fraction of martensite. The obtained results highlight that single crystal CuAlBe SMA prototypes show equivalent mechanical responses to its NiTi homologous prototypes in the same P/R experimental conditions.

The influence of cooling parameters on the speed of continuous steel casting

NASA Astrophysics Data System (ADS)

Tirian, G. O.; Gheorghiu, C. A.; Hepuţ, T.; Chioncel, C. P.

2018-01-01

This paper analyzes the cooling parameters of the continuous casting speed. In the researches carried out we aimed to establish some correlation equations between the parameters characterizing the continuous casting process, the temperature of the steel at the entrance to the crystallizer, the superheating of the steel and the flow of the cooling water in the crystallizer and different zones of the secondary cooling. Parallel to these parameters were also the values for the casting speed. The research was made for the casting of round ϕ270mm semi-finished steel products. The steel was developed in an electric EBT furnace with a capacity of 100t, treated in L.F. (Ladle - Furnace) and VD (Vacuum-Degassing) and poured in a 5-wire continuous casting plant. The obtained data was processed in MATLAB using three types of correlation equations. The obtained results are presented both in the analytical and graphical form, each correlation being analyzed from the technological point of view, indicating the optimal values for the independent parameters monitored. In the analysis we present a comparison between the results obtained after the three types of equations for each correlation.

cm-scale variations of crystal orientation fabric in cold Alpine ice core from Colle Gnifetti

NASA Astrophysics Data System (ADS)

Kerch, Johanna; Weikusat, Ilka; Eisen, Olaf; Wagenbach, Dietmar; Erhardt, Tobias

2015-04-01

Analysis of the microstructural parameters of ice has been an important part of ice core analyses so far mainly in polar cores in order to obtain information about physical processes (e.g. deformation, recrystallisation) on the micro- and macro-scale within an ice body. More recently the influence of impurities and climatic conditions during snow accumulation on these processes has come into focus. A deeper understanding of how palaeoclimate proxies interact with physical properties of the ice matrix bears relevance for palaeoclimatic interpretations, improved geophysical measurement techniques and the furthering of ice dynamical modeling. Variations in microstructural parameters e.g. crystal orientation fabric or grain size can be observed on a scale of hundreds and tens of metres but also on a centimetre scale. The underlying processes are not necessarily the same on all scales. Especially for the short-scale variations many questions remain unanswered. We present results from a study that aims to investigate following hypotheses: 1. Variations in grain size and fabric, i.e. strong changes of the orientation of ice crystals with respect to the vertical, occur on a centimetre scale and can be observed in all depths of an ice core. 2. Palaeoclimate proxies like dust and impurities have an impact on the microstructural processes and thus are inducing the observed short-scale variations in grain size and fabric. 3. The interaction of proxies with the ice matrix leads to depth intervals that show correlating behaviour as well as ranges with anticorrelation between microstructural parameters and palaeoclimatic proxies. The respective processes need to be identified. Fabric Analyser measurements were conducted on more than 80 samples (total of 8 m) from different depth ranges of a cold Alpine ice core (72 m length) drilled in 2013 at Colle Gnifetti, Switzerland/Italy. Results were obtained by automatic image processing, providing estimates for grain size distributions and crystal orientation fabric, and comparison with data from continuous flow analysis of chemical impurities. A microstructural characterisation of the analysed core is presented with emphasis on the observed variations in crystal orientation fabric. The relevance of these results for palaeoclimate reconstruction and geophysical applications in ice are discussed.

Preliminary crystallographic analysis of the major capsid protein P2 of the lipid-containing bacteriophage PM2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.

2005-08-01

The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less

Mathematical modeling and fuzzy availability analysis for serial processes in the crystallization system of a sugar plant

NASA Astrophysics Data System (ADS)

Aggarwal, Anil Kr.; Kumar, Sanjeev; Singh, Vikram

2017-03-01

The binary states, i.e., success or failed state assumptions used in conventional reliability are inappropriate for reliability analysis of complex industrial systems due to lack of sufficient probabilistic information. For large complex systems, the uncertainty of each individual parameter enhances the uncertainty of the system reliability. In this paper, the concept of fuzzy reliability has been used for reliability analysis of the system, and the effect of coverage factor, failure and repair rates of subsystems on fuzzy availability for fault-tolerant crystallization system of sugar plant is analyzed. Mathematical modeling of the system is carried out using the mnemonic rule to derive Chapman-Kolmogorov differential equations. These governing differential equations are solved with Runge-Kutta fourth-order method.

Growth and characterization of struvite-Na crystals

NASA Astrophysics Data System (ADS)

Chauhan, Chetan K.; Joshi, Mihirkumar J.

2014-09-01

Sodium magnesium phosphate heptahydrate [NaMgPO4·7H2O], also known as struvite-Na, is the sodium analog to struvite. Among phosphate containing bio-minerals, struvite has attracted considerable attention, because of its common occurrence in a wide variety of environments. Struvite and family crystals were found as urinary calculi in humans and animals. Struvite-Na crystals were grown by a single diffusion gel growth technique in a silica hydro gel medium. Struvite-Na crystals with different morphologies having transparent to translucent diaphaneity were grown with different growth parameters. The phenomenon of Liesegang rings was also observed with some particular growth parameters. The powder XRD study confirmed the structural similarity of the grown struvite-Na crystals with struvite and found that struvite-Na crystallized in the orthorhombic Pmn21 space group with unit cell parameters such as a= 6.893 Å, b=6.124 Å, c=11.150 Å, and α=β=γ=90°. FT-IR spectra of struvite-Na crystals revealed the presence of functional groups. The TGA, DTA and DSC were carried out simultaneously. The kinetic and thermodynamic parameters of dehydration/decomposition process were calculated. The variation of dielectric constant with frequency of applied field was studied in the range from 400 Hz to 100 kHz.

Single‐dose pharmacokinetics of co‐crystal of tramadol–celecoxib: Results of a four‐way randomized open‐label phase I clinical trial in healthy subjects

PubMed Central

Lahjou, Mounia; Vaqué, Anna; Sust, Mariano; Encabo, Mercedes; Soler, Lluis; Sans, Artur; Sicard, Eric; Gascón, Neus; Encina, Gregorio; Plata‐Salamán, Carlos

2017-01-01

Aims Co‐crystal of tramadol–celecoxib (CTC) is a novel co‐crystal molecule containing two active pharmaceutical ingredients under development by Esteve (E‐58425) and Mundipharma Research (MR308). This Phase I study compared single‐dose pharmacokinetics (PK) of CTC with those of the individual reference products [immediate‐release (IR) tramadol and celecoxib] alone and in open combination. Methods Healthy adults aged 18–55 years were orally administered four treatments under fasted conditions (separated by 7‐day wash‐out period): 200 mg IR CTC (equivalent to 88 mg tramadol and 112 mg celecoxib; Treatment 1); 100 mg IR tramadol (Treatment 2); 100 mg celecoxib (Treatment 3); and 100 mg IR tramadol and 100 mg celecoxib (Treatment 4). Treatment sequence was assigned using computer‐generated randomization. PK parameters were calculated using noncompartmental analysis with parameters for CTC adjusted according to reference product dose (100 mg). Results Thirty‐six subjects (28 male, mean age 36 years) participated. Tramadol PK parameters for Treatments‐1, –2 and –4, respectively, were 263, 346 and 349 ng ml–1 (mean maximum plasma concentration); 3039, 2979 and 3119 ng h ml–1 (mean cumulative area under the plasma concentration–time curve); and 2.7, 1.8 and 1.8 h (median time to maximum plasma concentration). For Treatments 1, 3 and 4, the respective celecoxib PK parameters were 313, 449 and 284 ng ml–1; 2183, 3093 and 2856 ng h ml–1; and 1.5, 2.3 and 3.0 h. No unexpected adverse events were reported. Conclusion PK parameters of each API in CTC were modified by co‐crystallization compared with marketed formulations of tramadol, celecoxib, and their open combination. PMID:28810061

Single-dose pharmacokinetics of co-crystal of tramadol-celecoxib: Results of a four-way randomized open-label phase I clinical trial in healthy subjects.

PubMed

Videla, Sebastián; Lahjou, Mounia; Vaqué, Anna; Sust, Mariano; Encabo, Mercedes; Soler, Lluis; Sans, Artur; Sicard, Eric; Gascón, Neus; Encina, Gregorio; Plata-Salamán, Carlos

2017-12-01

Co-crystal of tramadol-celecoxib (CTC) is a novel co-crystal molecule containing two active pharmaceutical ingredients under development by Esteve (E-58425) and Mundipharma Research (MR308). This Phase I study compared single-dose pharmacokinetics (PK) of CTC with those of the individual reference products [immediate-release (IR) tramadol and celecoxib] alone and in open combination. Healthy adults aged 18-55 years were orally administered four treatments under fasted conditions (separated by 7-day wash-out period): 200 mg IR CTC (equivalent to 88 mg tramadol and 112 mg celecoxib; Treatment 1); 100 mg IR tramadol (Treatment 2); 100 mg celecoxib (Treatment 3); and 100 mg IR tramadol and 100 mg celecoxib (Treatment 4). Treatment sequence was assigned using computer-generated randomization. PK parameters were calculated using noncompartmental analysis with parameters for CTC adjusted according to reference product dose (100 mg). Thirty-six subjects (28 male, mean age 36 years) participated. Tramadol PK parameters for Treatments-1, -2 and -4, respectively, were 263, 346 and 349 ng ml -1 (mean maximum plasma concentration); 3039, 2979 and 3119 ng h ml -1 (mean cumulative area under the plasma concentration-time curve); and 2.7, 1.8 and 1.8 h (median time to maximum plasma concentration). For Treatments 1, 3 and 4, the respective celecoxib PK parameters were 313, 449 and 284 ng ml -1 ; 2183, 3093 and 2856 ng h ml -1 ; and 1.5, 2.3 and 3.0 h. No unexpected adverse events were reported. PK parameters of each API in CTC were modified by co-crystallization compared with marketed formulations of tramadol, celecoxib, and their open combination. © 2017 The Authors. British Journal of Clinical Pharmacology published by John Wiley & Sons Ltd on behalf of British Pharmacological Society.

Crystallization of the Nonameric Small Terminase Subunit of Bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingolani

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

Crystallization of the Nonameric Small Terminase Subunit of bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingoloni

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

The diagram of phase-field crystal structures: an influence of model parameters in a two-mode approximation

NASA Astrophysics Data System (ADS)

Ankudinov, V.; Galenko, P. K.

2017-04-01

Effect of phase-field crystal model (PFC-model) parameters on the structure diagram is analyzed. The PFC-model is taken in a two-mode approximation and the construction of structure diagram follows from the free energy minimization and Maxwell thermodynamic rule. The diagram of structure’s coexistence for three dimensional crystal structures [Body-Centered-Cubic (BCC), Face-Centered-Cubic (FCC) and homogeneous structures] are constructed. An influence of the model parameters, including the stability parameters, are discussed. A question about the structure diagram construction using the two-mode PFC-model with the application to real materials is established.

Effects of scandium substitution on the crystal structure and luminescence properties of LuBO{sub 3}: Ce{sup 3+}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Yuntao, E-mail: caswyt@hotmail.com; Ren, Guohao, E-mail: rgh@mail.sic.ac.cn; Ding, Dongzhou

2012-10-15

The calcite phase of LuBO{sub 3} and ScBO{sub 3} polycrystalline powders were synthesized by solid state reaction method, and the Lu{sub 1-x}Sc{sub x}BO{sub 3}:Ce (x=0.2, 0.5, 0.7) single crystals were grown by the Czochralski method. A large composition deviation between the initial polycrystalline powders and final single crystal was confirmed by electron probe micro-analysis. Raman spectroscopy revealed that moderate lattice disorder was induced by scandium substitution. However, based on the single crystal X-ray study, we finally concluded that the crystal structure of lutetium scandium orthoborate still crystallized in the rhombohedral system belonging to R3{sup -}c. Furthermore, the relationship between themore » energies of the five 5d levels of Ce{sup 3+} and the crystalline environment was revealed. The total redshift, total crystal field splitting, and centroid shift of Lu{sub 1-x}Sc{sub x}BO{sub 3}:Ce{sup 3+} were calculated based on their VUV excitation spectra. The variations trend of these observed spectroscopic parameters was in accordance with the predicted ones. - Graphical abstract: The crystal structure of Lu{sub 1-x}Sc{sub x}BO{sub 3}:Ce is rhombohedral system with R3{sup -}c space group. The relationship between the energies of the five Ce{sup 3+} 5d levels and the crystalline environment is established. Highlights: Black-Right-Pointing-Pointer Moderate lattice disorder is induced by scandium doping. Black-Right-Pointing-Pointer The crystal structure of Lu{sub 1-x}Sc{sub x}BO{sub 3}:Ce is rhombohedral system with R3{sup -}c space group. Black-Right-Pointing-Pointer Relationship between energies of Ce{sup 3+} 5d levels and crystalline environment is established. Black-Right-Pointing-Pointer The spectroscopic parameters are experimentally and theoretically calculated.« less

Optical properties of Sulfur doped InP single crystals

NASA Astrophysics Data System (ADS)

El-Nahass, M. M.; Youssef, S. B.; Ali, H. A. M.

2014-05-01

Optical properties of InP:S single crystals were investigated using spectrophotometric measurements in the spectral range of 200-2500 nm. The absorption coefficient and refractive index were calculated. It was found that InP:S crystals exhibit allowed and forbidden direct transitions with energy gaps of 1.578 and 1.528 eV, respectively. Analysis of the refractive index in the normal dispersion region was discussed in terms of the single oscillator model. Some optical dispersion parameters namely: the dispersion energy (Ed), single oscillator energy (Eo), high frequency dielectric constant (ɛ∞), and lattice dielectric constant (ɛL) were determined. The volume and the surface energy loss functions (VELF & SELF) were estimated. Also, the real and imaginary parts of the complex conductivity were calculated.

Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

PubMed Central

Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

2013-01-01

Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

Overexpression, crystallization and preliminary X-­ray crystallographic analysis of the RNA polymerase domain of primase from Streptococcus mutans strain UA159

PubMed Central

Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok

2012-01-01

Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P41 or P43, with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å3 Da−1 and a solvent content of 30.7%. PMID:22232183

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

PubMed Central

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2006-01-01

Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

Expression, purification, crystallization and preliminary X-ray diffraction analysis of Bifidobacterium adolescentis xylose isomerase

PubMed Central

dos Reis, Caio Vinicius; Bernardes, Amanda; Polikarpov, Igor

2013-01-01

Xylose isomerase (EC 5.3.1.5) is a key enzyme in xylose metabolism which is industrially important for the transformation of glucose and xylose into fructose and xylulose, respectively. The Bifidobacterium adolescentis xylA gene (NC_008618.1) encoding xylose isomerase (XI) was cloned and the enzyme was overexpressed in Escherichia coli. Purified recombinant XI was crystallized using the sitting-drop vapour-diffusion method with polyethylene glycol 3350 as the precipitating agent. A complete native data set was collected to 1.7 Å resolution using a synchrotron-radiation source. The crystals belonged to the orthorhombic space group P21212, with unit-cell parameters a = 88.78, b = 123.98, c = 78.63 Å. PMID:23695585

Shape Evolution of Detached Bridgman Crystals Grown in Microgravity

NASA Technical Reports Server (NTRS)

Volz, M. P.; Mazuruk, K.

2015-01-01

Detached (or dewetted) Bridgman crystal growth defines that process in which a gap exists between a growing crystal and the crucible wall. In microgravity, the parameters that influence the existence of a stable gap are the growth angle of the solidifying crystal, the contact angle between the melt and the crucible wall, and the pressure difference across the meniscus. During actual crystal growth, the initial crystal radius will not have the precise value required for stable detached growth. Beginning with a crystal diameter that differs from stable conditions, numerical calculations are used to analyze the transient crystal growth process. Depending on the initial conditions and growth parameters, the crystal shape will either evolve towards attachment at the crucible wall, towards a stable gap width, or inwards towards eventual collapse of the meniscus. Dynamic growth stability is observed only when the sum of the growth and contact angles exceeds 180 degrees.

Effects of Ultrasonic Parameters on the Crystallization Behavior of Virgin Coconut Oil.

PubMed

Wu, Linhe; Cao, Jun; Bai, Xinpeng; Chen, Haiming; Zhang, Yuxiang; Wu, Qian

2016-12-01

Crystallization behavior of virgin coconut oil (VCO) in the absence and presence of ultrasonic treatment under a temperature gradient field was investigated. The effects of ultrasonic parameters on the crystallization behavior of VCO were studied by differential scanning calorimetry, ultraviolet/visible spectrophotometry and polarized light microscopy. The thermal effect of the ultrasonic treatment was also increased at higher power levels. Therefore, the optimal power level was determined at approximately 36 W. Induction time reduced evidently and the crystallization rate was accelerated under ultrasonic treatment at crystallization temperature (T c ) above 15°C. However, no significant difference in induction time was noted at 13°C. The result of morphological studies showed that the growth mechanism of crystals was significantly changed. Meanwhile, smaller and uniform crystals were produced by the ultrasonic treatment. This study shows a novel technique to accelerate the crystallization rate and alter the growth mechanism of VCO crystals.

Study of single crystals of metal solid solutions

NASA Technical Reports Server (NTRS)

Doty, J. P.; Reising, J. A.

1973-01-01

The growth of single crystals of relatively high melting point metals such as silver, copper, gold, and their alloys was investigated. The purpose was to develop background information necessary to support a space flight experiment and to generate ground based data for comparison. The ground based data, when compared to the data from space grown crystals, are intended to identify any effects which zero-gravity might have on the basic process of single crystal growth of these metals. The ultimate purposes of the complete investigation are to: (1) determine specific metals and alloys to be investigated; (2) grow single metal crystals in a terrestrial laboratory; (3) determine crystal characteristics, properties, and growth parameters that will be effected by zero-gravity; (4) evaluate terrestrially grown crystals; (5) grow single metal crystals in a space laboratory such as Skylab; (6) evaluate the space grown crystals; (7) compare for zero-gravity effects of crystal characteristics, properties, and parameters; and (8) make a recommendation as to production of these crystals as a routine space manufacturing proceses.

Study of linear optical parameters of sodium sulphide nano-particles added ADP crystals

NASA Astrophysics Data System (ADS)

Kochuparampil, A. P.; Joshi, J. H.; Dixit, K. P.; Jethva, H. O.; Joshi, M. J.

2017-05-01

Ammonium Dihydrogen Phosphate (ADP) is one of the nonlinear optical crystals. It is having various applications like optical mixing, electro-optical modulator, harmonic generators, etc. Chalcogenide compounds are poorly soluble in water and difficult to add in the water soluble ADP crystals. The solubility of Chalcogenide compounds can be increased by synthesizing the nano-structured samples with suitable capping agent. In the present study sodium sulphide was added in to ADP to modify its linear optical parameters. Sodium sulphide nano particles were synthesized by co-precipitation technique using Ethylene diamine as capping agent followed by microwave irradiation. The powder XRD confirmed the nano-structured nature of sodium sulphide nano particles. The solubility of nanoparticles of sodium sulphide increased significantly in water compared to the bulk. Pure and Na2S added ADP crystals were grown by slow solvent evaporation method at room temperature. The presence of sodium in ADP was confirmed by AAS. The UV-Vis spectra were recorded for all crystals. Various optical parameters like, transmittance, energy band gap, extinction coefficient, refractive index, optical conductivity, etc. were evaluated. The electronic polarizibility of pure and doped crystals calculated from energy band gap. The effect of doping concentration was found on various parameters.

Uncertainty, Sensitivity Analysis, and Causal Identification in the Arctic using a Perturbed Parameter Ensemble of the HiLAT Climate Model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunke, Elizabeth Clare; Urrego Blanco, Jorge Rolando; Urban, Nathan Mark

Coupled climate models have a large number of input parameters that can affect output uncertainty. We conducted a sensitivity analysis of sea ice proper:es and Arc:c related climate variables to 5 parameters in the HiLAT climate model: air-ocean turbulent exchange parameter (C), conversion of water vapor to clouds (cldfrc_rhminl) and of ice crystals to snow (micro_mg_dcs), snow thermal conduc:vity (ksno), and maximum snow grain size (rsnw_mlt). We used an elementary effect (EE) approach to rank their importance for output uncertainty. EE is an extension of one-at-a-time sensitivity analyses, but it is more efficient in sampling multi-dimensional parameter spaces. We lookedmore » for emerging relationships among climate variables across the model ensemble, and used causal discovery algorithms to establish potential pathways for those relationships.« less

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.

2006-07-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γmore » = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.« less

Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of bacterioferritin A from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Vibha; Gupta, Rakesh K.; Ram Lal Anand College, University of Delhi, Benito Juarez Road, New Delhi 110021

2008-05-01

The cloning, purification and crystallization of a bacterioferritin from M. tuberculosis together with preliminary X-ray characterization of its crystals are reported. Bacterioferritins (Bfrs) comprise a subfamily of the ferritin superfamily of proteins that play an important role in bacterial iron storage and homeostasis. Bacterioferritins differ from ferritins in that they have additional noncovalently bound haem groups. To assess the physiological role of this subfamily of ferritins, a greater understanding of the structural details of bacterioferritins from various sources is required. The gene encoding bacterioferritin A (BfrA) from Mycobacterium tuberculosis was cloned and expressed in Escherichia coli. The recombinant protein productmore » was purified by affinity chromatography on a Strep-Tactin column and crystallized with sodium chloride as a precipitant at pH 8.0 using the vapour-diffusion technique. The crystals diffracted to 2.1 Å resolution and belonged to space group P4{sub 2}, with unit-cell parameters a = 123.0, b = 123.0, c = 174.6 Å.« less

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Purification, crystallization and preliminary X-ray analysis of the BseCI DNA methyltransferase from Bacillus stearothermophilus in complex with its cognate DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary

2007-01-01

The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less

Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

2008-07-01

The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

Expression, purification and crystallization of the C-terminal LRR domain of Streptococcus pyogenes protein 0843.

PubMed

Haikarainen, Teemu; Loimaranta, Vuokko; Prieto-Lopez, Carlos; Battula, Pradeep; Finne, Jukka; Papageorgiou, Anastassios C

2013-05-01

Streptococcus pyogenes protein 0843 (Spy0843) is a recently identified protein with a potential adhesin function. Sequence analysis has shown that Spy0843 contains two leucine-rich repeat (LRR) domains that mediate interactions with the gp340 receptor. Here, the C-terminal LRR domain was overexpressed in Escherichia coli, purified and crystallized in the presence of 1.7-1.8 M ammonium sulfate pH 7.4 as precipitant. Data were collected from a single crystal to 1.59 Å resolution at 100 K at a synchrotron-radiation source. The crystal was found to belong to space group I41, with unit-cell parameters a = b = 121.4, c = 51.5 Å and one molecule in the asymmetric unit. Elucidation of the crystal structure will provide insights into the interactions of Spy0843 with the gp340 receptor and a better understanding of the role of Spy0843 in streptococcal infections.

Expression, purification and crystallization of the C-terminal LRR domain of Streptococcus pyogenes protein 0843

PubMed Central

Haikarainen, Teemu; Loimaranta, Vuokko; Prieto-Lopez, Carlos; Battula, Pradeep; Finne, Jukka; Papageorgiou, Anastassios C.

2013-01-01

Streptococcus pyogenes protein 0843 (Spy0843) is a recently identified protein with a potential adhesin function. Sequence analysis has shown that Spy0843 contains two leucine-rich repeat (LRR) domains that mediate interactions with the gp340 receptor. Here, the C-terminal LRR domain was overexpressed in Escherichia coli, purified and crystallized in the presence of 1.7–1.8 M ammonium sulfate pH 7.4 as precipitant. Data were collected from a single crystal to 1.59 Å resolution at 100 K at a synchrotron-radiation source. The crystal was found to belong to space group I41, with unit-cell parameters a = b = 121.4, c = 51.5 Å and one molecule in the asymmetric unit. Elucidation of the crystal structure will provide insights into the interactions of Spy0843 with the gp340 receptor and a better understanding of the role of Spy0843 in streptococcal infections. PMID:23695577

X-ray diffraction, spectroscopic and mechanical studies on potential organic NLO materials of metaNitroaniline and N-3-Nitrophenyl Acetamide single crystals

NASA Astrophysics Data System (ADS)

Senthil, S.; Madhavan, J.

2015-02-01

In the present paper, attempts were made to grow good quality metaNitroaniline (mNA) and N-3-Nitrophenyl (3-NAA) single crystals. The lattice parameter values from the Powder X-ray diffraction pattern confirms that mNA belongs to orthorhombic crystal system with the unit cell parameter values of a = 6.501 Å, b = 19.330 Å and c = 5.082 Å with space group Pbc21. Similarly the powder XRD data indicates that 3-NAA crystal retained its monoclinic structure with lattice parameter values a = 9.762 Å, b =13.287 Å, c =13.226 Å, and β = 102.99°. Investigation has been carried out to assign the vibrational frequencies of the grown crystals by Fourier Transform infrared spectroscopy technique. The SHG efficiency of mNA and 3NAA was determined by Kurtz and Perry powder technique. The Optical absorption study confirms the suitability of the crystals for device applications. The mechanical properties of the grown crystals have been studied using Vickers microhardness tester.

Structural versus electrical properties of an organic-inorganic hybrid material based on sulfate

NASA Astrophysics Data System (ADS)

Ben Rached, Asma; Guionneau, Philippe; Lebraud, Eric; Mhiri, Tahar; Elaoud, Zakaria

2017-01-01

A new organo-sulfate compound is obtained by slow evaporation at room temperature and is characterized by powder and single-crystal X-ray diffraction (XRD) at variable temperatures. The benzylammonium monohydrogenosulfate of formula C6H5CH2NH3+. HSO4-, denoted (BAS), crystallizes in the monoclinic system P21/c space group with the following parameters at room temperature: a=5.623(5)Å, b=20.239(5) Å, c=8.188(5)Å, β=94.104(5)°. The crystal structure consists of infinite parallel two-dimensional planes built by HSO4- anions and C6H5CH2NH3+ cations interconnected by strong O-H….. O and N-H….. O hydrogen bonds. A phase transition is detected at 350 K by differential scanning calorimetry (DSC) and confirmed by powder XRD. Conductivity measurements using the impedance spectroscopy technique allow to determine the conductivity relaxation parameters associated with the H+ conduction from an analysis of the M"/M"max spectrum measured in a wide temperature range. Transport properties of this material appear to be due to an H+ ion hopping mechanism.

Quantifying the origin of metallic glass formation

NASA Astrophysics Data System (ADS)

Johnson, W. L.; Na, J. H.; Demetriou, M. D.

2016-01-01

The waiting time to form a crystal in a unit volume of homogeneous undercooled liquid exhibits a pronounced minimum τX* at a `nose temperature' T* located between the glass transition temperature Tg, and the crystal melting temperature, TL. Turnbull argued that τX* should increase rapidly with the dimensionless ratio trg=Tg/TL. Angell introduced a dimensionless `fragility parameter', m, to characterize the fall of atomic mobility with temperature above Tg. Both trg and m are widely thought to play a significant role in determining τX*. Here we survey and assess reported data for TL, Tg, trg, m and τX* for a broad range of metallic glasses with widely varying τX*. By analysing this database, we derive a simple empirical expression for τX*(trg, m) that depends exponentially on trg and m, and two fitting parameters. A statistical analysis shows that knowledge of trg and m alone is therefore sufficient to predict τX* within estimated experimental errors. Surprisingly, the liquid/crystal interfacial free energy does not appear in this expression for τX*.

Crystallization and preliminary X-ray analysis of a novel Kunitz-type kallikrein inhibitor from Bauhinia bauhinioides

PubMed Central

Navarro, Marcos Vicente de A. S.; Vierira, Débora F.; Nagem, Ronaldo A. P.; de Araújo, Ana Paula U.; Oliva, Maria Luiza V.; Garratt, Richard C.

2005-01-01

A Kunitz-type protease inhibitor (BbKI) found in Bauhinia bauhinioides seeds has been overexpressed in Escherichia coli and crystallized at 293 K using PEG 4000 as the precipitant. X-ray diffraction data have been collected to 1.87 Å resolution using an in-house X-ray generator. The crystals of the recombinant protein (rBbKI) belong to the orthorhombic space group P212121, with unit-cell parameters a = 46.70, b = 64.14, c = 59.24 Å. Calculation of the Matthews coefficient suggests the presence of one monomer of rBbKI in the asymmetric unit, with a corresponding solvent content of 51% (V M = 2.5 Å3 Da−1). Iodinated crystals were prepared and a derivative data set was also collected at 2.1 Å resolution. Crystals soaked for a few seconds in a cryogenic solution containing 0.5 M NaI were found to be reasonably isomorphous to the native crystals. Furthermore, the presence of iodide anions could be confirmed in the NaI-derivatized crystal. Data sets from native and derivative crystals are being evaluated for use in crystal structure determination by means of the SIRAS (single isomorphous replacement with anomalous scattering) method. PMID:16511193

Probing Structural Perturbation in a Bent Molecular Crystal with Synchrotron Infrared Microspectroscopy and Periodic Density Functional Theory Calculations.

PubMed

Pejov, Ljupčo; Panda, Manas K; Moriwaki, Taro; Naumov, Panče

2017-02-15

The range of unit cell orientations generated at the kink of a bent single crystal poses unsurmountable challenges with diffraction analysis and limits the insight into the molecular-scale mechanism of bending. On a plastically bent crystal of hexachlorobenzene, it is demonstrated here that spatially resolved microfocus infrared spectroscopy using synchrotron radiation can be applied in conjunction with periodic density functional theory calculations to predict spectral changes or to extract information on structural changes that occur as a consequence of bending. The approach reproduces well the observed trends, such as the wall effects, and provides estimations of the vibrational shifts, unit cell deformations, and intramolecular parameters. Generally, expansion of the lattice induces red-shift while compression induces larger blue-shift of the characteristic ν(C-C) and ν(C-Cl) modes. Uniform or non-uniform expansion or contraction of the unit cell of 0.1 Å results in shifts of several cm -1 , whereas deformation of the cell of 0.5° at the unique angle causes shifts of <0.5 cm -1 . Since this approach does not include parameters related to the actual stimulus by which the deformation has been induced, it can be generalized and applied to other mechanically, photochemically, or thermally bent crystals.

Role of Er3+ concentration in high-resolution spectra of BaY2 F8 single crystals

NASA Astrophysics Data System (ADS)

Baraldi, A.; Capelletti, R.; Mazzera, M.; Ponzoni, A.; Amoretti, G.; Magnani, N.; Toncelli, A.; Tonelli, M.

2005-08-01

Fourier transform absorption spectroscopy with a resolution as fine as 0.02cm-1 was applied to Er3+ -doped monoclinic BaY2F8 laser crystals in a wide wave number range (500-24000cm-1) and in the temperature range 9-300 K. The careful analysis of the complex narrow line spectra induced by Er3+ allowed us to determine with high accuracy the crystal field splitting of the fundamental I15/24 and of the excited I13/24 , I11/24 , I9/24 , F9/24 , S3/24 , H11/22 , F7/24 , F5/24 , and F3/24 manifolds. On the basis of the experimental data, the crystal-field parameters were determined and Newman’s superposition model was applied: in this way a slight displacement of Er3+ with respect to the Y3+ position was foreseen. The Judd-Ofelt parameters were evaluated: the lifetime values deduced from them were compared to the experimental ones and discussed. The effects caused by increasing Er3+ concentrations (0.5%, 2%, 12%, and 20% atomic fraction) were studied in detail. The new lines, the line broadening, and the line-shape changes were explained in terms of Er3+-Er3+ interaction.

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

2005-04-01

Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

CFA-2 and CFA-3 (Coordination Framework Augsburg University-2 and -3); novel MOFs assembled from trinuclear Cu(I)/Ag(I) secondary building units and 3,3',5,5'-tetraphenyl-bipyrazolate ligands.

PubMed

Grzywa, Maciej; Geßner, Christof; Denysenko, Dmytro; Bredenkötter, Björn; Gschwind, Fabienne; Fromm, Katharina M; Nitek, Wojciech; Klemm, Elias; Volkmer, Dirk

2013-05-21

The syntheses of H2-phbpz, [Cu2(phbpz)]·2DEF·MeOH (CFA-2) and [Ag2(phbpz)] (CFA-3) (H2-phbpz = 3,3',5,5'-tetraphenyl-1H,1'H-4,4'-bipyrazole) compounds and their crystal structures are described. The Cu(I) containing metal-organic framework CFA-2 crystallizes in the tetragonal crystal system, within space group I4(1)/a (no. 88) and the following unit cell parameters: a = 30.835(14), c = 29.306(7) Å, V = 27 865(19) Å(3). CFA-2 features a flexible 3-D three-connected two-fold interpenetrated porous structure constructed of triangular Cu(I) subunits. Upon exposure to different kinds of liquids (MeOH, EtOH, DMF, DEF) CFA-2 shows pronounced breathing effects. CFA-3 crystallizes in the monoclinic crystal system, within space group P2(1)/c (no. 14) and the following unit cell parameters: a = 16.3399(3), b = 32.7506(4), c = 16.2624(3) Å, β = 107.382(2)°, V = 8305.3(2) Å(3). In contrast to the former compound, CFA-3 features a layered 2-D three-connected structure constructed from triangular Ag(i) subunits. Both compounds are characterized by elemental and thermogravimetric analyses, single crystal structure analysis and X-ray powder diffraction, FTIR- and fluorescence spectroscopy. Preliminary results on oxygen activation in CFA-2 are presented and potential improvements in terms of framework robustness and catalytic efficiency are discussed.

Research on subsurface defects of potassium dihydrogen phosphate crystals fabricated by single point diamond turning technique

NASA Astrophysics Data System (ADS)

Tie, Guipeng; Dai, Yifan; Guan, Chaoliang; Chen, Shaoshan; Song, Bing

2013-03-01

Potassium dihydrogen phosphate (KDP) crystals, which are widely used in high-power laser systems, are required to be free of defects on fabricated subsurfaces. The depth of subsurface defects (SSD) of KDP crystals is significantly influenced by the parameters used in the single point diamond turning technique. In this paper, based on the deliquescent magnetorheological finishing technique, the SSD of KDP crystals is observed and the depths under various cutting parameters are detected and discussed. The results indicate that no SSD is generated under small parameters and with the increase of cutting parameters, SSD appears and the depth rises almost linearly. Although the ascending trends of SSD depths caused by cutting depth and feed rate are much alike, the two parameters make different contributions. Taking the same material removal efficiency as a criterion, a large cutting depth generates shallower SSD depth than a large feed rate. Based on the experiment results, an optimized cutting procedure is obtained to generate defect-free surfaces.

Investigation on the growth, spectral, lifetime, mechanical analysis and third-order nonlinear optical studies of L-methionine admixtured D-mandelic acid single crystal: A promising material for nonlinear optical applications

NASA Astrophysics Data System (ADS)

Jayaprakash, P.; Sangeetha, P.; Kumari, C. Rathika Thaya; Caroline, M. Lydia

2017-08-01

A nonlinear optical bulk single crystal of L-methionine admixtured D-mandelic acid (LMDMA) has been grown by slow solvent evaporation technique using water as solvent at ambient temperature. The crystallized LMDMA single crystal subjected to single crystal X-ray diffraction study confirmed monoclinic system with the acentric space group P21. The FTIR analysis gives information about the modes of vibration in the various functional groups present in LMDMA. The UV-visible spectral analysis assessed the optical quality and linear optical properties such as extinction coefficient, reflectance, refractive index and from which optical conductivity and electric susceptibility were also evaluated. The frequency doubling efficiency was observed using Kurtz Perry powder technique. A multiple shot laser was utilized to evaluate the laser damage threshold energy of the crystal. Discrete thermodynamic properties were carried out by TG-DTA studies. The hardness, Meyer's index, yield strength, elastic stiffness constant, Knoop hardness, fracture toughness and brittleness index were analyzed using Vickers microhardness tester. Layer growth pattern and the surface defect were examined by chemical etching studies using optical microscope. Fluorescence emission spectrum was recorded and lifetime was also studied. The electric field response of crystal was investigated from the dielectric studies at various temperatures at different frequencies. The third-order nonlinear optical response in LMDMA has been investigated using Z-scan technique with He-Ne laser at 632.8 nm and nonlinear parameters such as refractive index (n2), absorption coefficient (β) and susceptibility (χ3) investigated extensively for they are in optical phase conjucation, high-speed optical switches and optical dielectric devices.

Strain Analysis of Stretched Tourmaline Crystals Using ImageJ, Microsoft Excel and PowerPoint

NASA Astrophysics Data System (ADS)

Bosbyshell, H.

2012-12-01

This poster describes an undergraduate structural geology lab exercise utilizing the Mohr's circle diagram for finite strain, constructed using measurements obtained from stretched tourmaline crystals. A small building housing HVAC equipment at the south end of West Chester University's Recitation Hall (itself made of serpentinite) is constructed of early-Cambrian Chickies Quartzite. Stretched tourmaline crystals, with segments joined by fibrous quartz, are visible on many surfaces (presumably originally bedding). While the original orientation of any stone is unknown, these rocks provide an opportunity for a short field exercise during a two-hour lab period and a great base for conducting strain analysis. It is always fun to ask how many in the class have ever noticed the tourmaline (few have). Students take photos using their cell phones or cameras. Since strain is a ratio the absolute size of the tourmaline crystals is immaterial. Nonetheless, this is a good opportunity to remind students of the importance of including a scale in their photographs. The photos are opened in ImageJ and the line tool is used to determine the original and final lengths of selected crystals. Students calculate strain parameters using Microsoft Excel. Then, we use Adobe Illustrator or the drafting capabilities of Microsoft PowerPoint 2010 to follow Ramsay and Huber's techniques using a Mohr's circle construction to determine the finite strain ellipse. If a stretching direction can be estimated, elongation of two crystals is all that is required to determine the strain ratio. If no stretching direction is apparent, three crystals are required for a more complicated analysis that allows for determination of the stretching direction, as well as the strain ratio.

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

Structural, thermal and optical characterization of an organic NLO material--benzaldehyde thiosemicarbazone monohydrate single crystals.

PubMed

Santhakumari, R; Ramamurthi, K

2011-02-01

Single crystals of the organic NLO material, benzaldehyde thiosemicarbazone (BTSC) monohydrate, were grown by slow evaporation method. Solubility of BTSC monohydrate was determined in ethanol at different temperatures. The grown crystals were characterized by single crystal X-ray diffraction analysis to determine the cell parameters and by FT-IR technique to study the presence of the functional groups. Thermogravimetric and differential thermal analyses reveal the thermal stability of the crystal. UV-vis-NIR spectrum shows excellent transmission in the region of 200-1100 nm. Theoretical calculations were carried out to determine the linear optical constants such as extinction coefficient and refractive index. Further the optical nonlinearities of BTSC have been investigated by Z-scan technique with He-Ne laser radiation of wavelength 632.8 nm. Mechanical properties of the grown crystal were studied using Vickers microhardness tester. Second harmonic generation efficiency of the powdered BTSC monohydrate was tested using Nd:YAG laser and it is found to be ∼5.3 times that of potassium dihydrogen orthophosphate. Copyright © 2010 Elsevier B.V. All rights reserved.

Growth, structural, thermal, dielectric and nonlinear optical properties of potassium hexachloro cadmate (IV) a novel single crystal

NASA Astrophysics Data System (ADS)

Umarani, P.; Jagannathan, K.

2018-02-01

The Potassium hexachloro cadmate (IV) (PHC) single crystal was grown from the aqueous of the solution by a controlled evaporation method. Single crystal XRD solved the structure. FTIR is used to identify the functional groups of grown crystal. The UV-Vis-NIR spectrometer was used to find out the UV cut off region and to calculate the optical band gap of the Potassium hexachloro cadmate (IV) single crystal. The EDAX spectrum has been used to identify the compounds present in title compound. The TG-DTA profile shows the thermal stability of the grown crystal of Potassium hexachloro cadmate (IV). The Vicker's hardness measurement was used to calculate the material hardness of the title compound. The dielectric loss and constant varied with frequencies and activation energy is also calculated. The solid state parameters like plasma energy, Penn gap, Fermi energy, electronic polarizability using Penn analysis and Clausius-Mossotti equation were also calculated for the title compound. The Z-scan technique is used to calculate the third order nonlinear susceptibility of a real and imaginary part.

Detecting ordered small molecule drug aggregates in live macrophages: a multi-parameter microscope image data acquisition and analysis strategy

PubMed Central

Rzeczycki, Phillip; Yoon, Gi Sang; Keswani, Rahul K.; Sud, Sudha; Stringer, Kathleen A.; Rosania, Gus R.

2017-01-01

Following prolonged administration, certain orally bioavailable but poorly soluble small molecule drugs are prone to precipitate out and form crystal-like drug inclusions (CLDIs) within the cells of living organisms. In this research, we present a quantitative multi-parameter imaging platform for measuring the fluorescence and polarization diattenuation signals of cells harboring intracellular CLDIs. To validate the imaging system, the FDA-approved drug clofazimine (CFZ) was used as a model compound. Our results demonstrated that a quantitative multi-parameter microscopy image analysis platform can be used to study drug sequestering macrophages, and to detect the formation of ordered molecular aggregates formed by poorly soluble small molecule drugs in animals. PMID:28270989

Detecting ordered small molecule drug aggregates in live macrophages: a multi-parameter microscope image data acquisition and analysis strategy.

PubMed

Rzeczycki, Phillip; Yoon, Gi Sang; Keswani, Rahul K; Sud, Sudha; Stringer, Kathleen A; Rosania, Gus R

2017-02-01

Following prolonged administration, certain orally bioavailable but poorly soluble small molecule drugs are prone to precipitate out and form crystal-like drug inclusions (CLDIs) within the cells of living organisms. In this research, we present a quantitative multi-parameter imaging platform for measuring the fluorescence and polarization diattenuation signals of cells harboring intracellular CLDIs. To validate the imaging system, the FDA-approved drug clofazimine (CFZ) was used as a model compound. Our results demonstrated that a quantitative multi-parameter microscopy image analysis platform can be used to study drug sequestering macrophages, and to detect the formation of ordered molecular aggregates formed by poorly soluble small molecule drugs in animals.

Characterization of monoclinic crystals in tablets by pattern-fitting procedure using X-ray powder diffraction data.

PubMed

Yamamura, Shigeo; Momose, Yasunori

2003-06-18

The purpose of this study is to characterize the monoclinic crystals in tablets by using X-ray powder diffraction data and to evaluate the deformation feature of crystals during compression. The monoclinic crystals of acetaminophen and benzoic acid were used as the samples. The observed X-ray diffraction intensities were fitted to the analytic expression, and the fitting parameters, such as the lattice parameters, the peak-width parameters, the preferred orientation parameter and peak asymmetric parameter were optimized by a non-linear least-squares procedure. The Gauss and March distribution functions were used to correct the preferred orientation of crystallites in the tablet. The March function performed better in correcting the modification of diffraction intensity by preferred orientation of crystallites, suggesting that the crystallites in the tablets had fiber texture with axial orientation. Although a broadening of diffraction peaks was observed in acetaminophen tablets with an increase of compression pressure, little broadening was observed in the benzoic tablets. These results suggest that "acetaminophen is a material consolidating by fragmentation of crystalline particles and benzoic acid is a material consolidating by plastic deformation then occurred rearrangement of molecules during compression". A pattern-fitting procedure is the superior method for characterizing the crystalline drugs of monoclinic crystals in the tablets, as well as orthorhombic isoniazid and mannitol crystals reported in the previous paper.

Crystallization and preliminary X-ray diffraction analysis of P30, the transmembrane domain of pertactin, an autotransporter from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Yanshi; Black, Isobel; Roszak, Aleksander W.

2007-07-01

P30, the transmembrane C-terminal domain of pertactin from B. pertussis has been crystallized after refolding in vitro. Preliminary X-ray crystallographic data are reported. P30, the 32 kDa transmembrane C-terminal domain of pertactin from Bordetella pertussis, is supposed to form a β-barrel inserted into the outer membrane for the translocation of the passenger domain. P30 was cloned and expressed in inclusion bodies in Escherichia coli. After refolding and purification, the protein was crystallized using the sitting-drop vapour-diffusion method at 292 K. The crystals diffract to a resolution limit of 3.5 Å using synchrotron radiation and belong to the hexagonal space groupmore » P6{sub 1}22, with unit-cell parameters a = b = 123.27, c = 134.43 Å.« less

Preparation, crystallization and preliminary X-ray analysis of the methionine synthase (MetE) from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Tian-Min; Zhang, Xiao-Yan; Li, Lan-Fen

2006-10-01

Methionine synthase (MetE) from S. mutans was expressed, purified and crystallized. Diffraction data have been collected to 2.2 Å resolution. The Streptococcus mutans metE gene encodes methionine synthase (MetE), which catalyzes the direct transfer of a methyl group from methyltetrahydrofolate to homocysteine in the last step of methionine synthesis. metE was cloned into pET28a and the gene product was expressed at high levels in the Escherichia coli strain BL21 (DE3). MetE was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.2 Å resolution.more » The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 52.85, b = 99.48, c = 77.88 Å, β = 94.55°.« less

Preliminary X-ray crystallographic analysis of SMU.573, a putative sugar kinase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Yan-Feng; Li, Lan-Fen; Yang, Cheng

2008-01-01

SMU.573 from S. mutans was expressed in E. coli and crystallized. The crystals belong to space group I4 and 2.5 Å resolution diffraction data were collected at an in-house chromium radiation source. SMU.573 from Streptococcus mutans is a structurally and functionally uncharacterized protein that was selected for structural biology studies. Native and SeMet-labelled proteins were expressed with an N-His tag in Escherichia coli BL21 (DE3) and purified by Ni{sup 2+}-chelating and size-exclusion chromatography. Crystals of the SeMet-labelled protein were obtained by the hanging-drop vapour-diffusion method and a 2.5 Å resolution diffraction data set was collected using an in-house chromium radiationmore » source. The crystals belong to space group I4, with unit-cell parameters a = b = 96.53, c = 56.26 Å, α = β = γ = 90°.« less

Purification, crystallization and preliminary crystallographic analysis of Est25: a ketoprofen-specific hormone-sensitive lipase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, SeungBum; Joo, Sangbum; Yoon, Hyun C.

2007-07-01

Est25, a ketoprofen-specific hormone-sensitive lipase from a metagenomic library, was crystallized and diffraction data were collected to 1.49 Å resolution. Ketoprofen, a nonsteroidal anti-inflammatory drug, inhibits the synthesis of prostaglandin. A novel hydrolase (Est25) with high ketoprofen specificity has previously been identified using a metagenomic library from environmental samples. Recombinant Est25 protein with a histidine tag at the N-terminus was expressed in Escherichia coli and purified in a homogenous form. Est25 was crystallized from 2.4 M sodium malonate pH 7.0 and X-ray diffraction data were collected to 1.49 Å using synchrotron radiation. The crystals belong to the monoclinic space groupmore » C2, with unit-cell parameters a = 197.8, b = 95.2, c = 99.4 Å, β = 97.1°.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis

PubMed Central

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-01-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase σ factor SigB. In order to elucidate the structural–functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 Å resolution with an R merge of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 Å, α = 98.8, β = 90.0, γ = 108.4°. PMID:19923733

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Modeling a photoinduced planar-to-homeotropic anchoring transition triggered by surface azobenzene units in a nematic liquid crystal

NASA Astrophysics Data System (ADS)

Oswald, Patrick; Ignés-Mullol, Jordi

2017-09-01

The performance of light-controlled liquid crystal anchoring surfaces depends on the nature of the photosensitive moieties and on the concentration of spacer units. Here, we study the kinetics of photosensitive liquid crystal cells that incorporate an azobenzene-based self-assembled monolayer. We characterize the photoinduced homeotropic-to-planar transition and the subsequent reverse relaxation in terms of the underlying isomerization of the photosensitive layer. We show that the response time can be precisely adjusted by tuning the lateral packing of azobenzene units by means of inert spacer molecules. Using simple kinetic assumptions and a well-known model for the energetics of liquid crystal anchoring we are able to capture the details of the optical microscopy experimental observations. Our analysis provides fitted values for all the relevant material parameters, including the zenithal and the azimuthal anchoring strength.

Controlled vapor crystal growth of N a4I r3O8 : A three-dimensional quantum spin liquid candidate

NASA Astrophysics Data System (ADS)

Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.; Ren, Yang; Chen, Yu-Sheng; Dally, Rebecca; Wilson, Stephen D.; Islam, Zahirul; Mitchell, J. F.

2018-04-01

We report the successful bulk single-crystal growth of the hyperkagome lattice iridate N a4I r3O8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q =(1 /3 ,1 /3 ,1 /3 ) based on the cubic substructure with cell parameter a =8.986 (1 )Å . This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ions at the notionally disordered Na sites as a plausible origin for the observed superlattice.

Crystallization and preliminary crystallographic analysis of an acridone-producing novel multifunctional type III polyketide synthase from Huperzia serrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Hiroyuki; Kondo, Shin; Kato, Ryohei

2007-07-01

An acridone-producing novel type III polyketide synthase from H. serrata has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.0 Å. Polyketide synthase 1 (PKS1) from Huperzia serrata is a plant-specific type III polyketide synthase that shows an unusually versatile catalytic potential, producing various aromatic tetraketides, including chalcones, benzophenones, phlorogulucinols and acridones. Recombinant H. serrata PKS1 expressed in Escherichia coli was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 73.3, b = 85.0, c = 137.7 Å, α =more » β = γ = 90.0°. Diffraction data were collected to 2.0 Å resolution using synchrotron radiation at BL24XU of SPring-8.« less

Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

2008-02-01

The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

Crystallization and preliminary X-ray crystallographic analysis of the variable domain of Scl2.3, a streptococcal collagen-like protein from invasive M3-type Streptococcus pyogenes.

PubMed

Squeglia, Flavia; Bachert, Beth; Romano, Maria; Lukomski, Slawomir; Berisio, Rita

2013-09-01

Streptococcal collagen-like proteins (Scls) are widely expressed by the well recognized human pathogen Streptococcus pyogenes. These surface proteins contain a signature central collagen-like region and an amino-terminal globular domain, termed the variable domain, which is protruded away from the cell surface by the collagen-like domain. Despite their recognized importance in bacterial pathogenicity, no structural information is presently available on proteins of the Scl class. The variable domain of Scl2 from invasive M3-type S. pyogenes has successfully been crystallized using vapour-diffusion methods. The crystals diffracted to 1.5 Å resolution and belonged to space group H32, with unit-cell parameters a = 44.23, b = 44.23, c = 227.83 Å. The crystal structure was solved by single-wavelength anomalous dispersion using anomalous signal from a europium chloride derivative.|

Expression, purification, crystallization, data collection and preliminary biochemical characterization of methicillin-resistant Staphylococcus aureus Sar2028, an aspartate/tyrosine/phenylalanine pyridoxal-5′-phosphate-dependent aminotransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seetharamappa, Jaldappagari; Department of Chemistry, Karnatak University, Pavate Nagar, Dharwad 580 003, Karnataka State; Oke, Muse

2007-05-01

As part of work on S. aureus, the crystallization of Sar2028, a protein that is upregulated in MRSA, is reported. Sar2028, an aspartate/tyrosine/phenylalanine pyridoxal-5′-phosphate-dependent aminotransferase with a molecular weight of 48 168 Da, was overexpressed in methicillin-resistant Staphylococcus aureus compared with a methicillin-sensitive strain. The protein was expressed in Escherichia coli, purified and crystallized. The protein crystallized in a primitive orthorhombic Laue group with unit-cell parameters a = 83.6, b = 91.3, c = 106.0 Å, α = β = γ = 90°. Analysis of the systematic absences along the three principal axes indicated the space group to be P2{submore » 1}2{sub 1}2{sub 1}. A complete data set was collected to 2.5 Å resolution.« less

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto.

PubMed

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-12-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27,724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a=74.3, b=49.9, c=56.3 Å, β=95.2°. Diffraction images were processed to a resolution of 1.74 Å with an Rmerge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase.

Purification, crystallization and preliminary X-ray diffraction experiment of nattokinase from Bacillus subtilis natto

PubMed Central

Yanagisawa, Yasuhide; Chatake, Toshiyuki; Chiba-Kamoshida, Kaori; Naito, Sawa; Ohsugi, Tadanori; Sumi, Hiroyuki; Yasuda, Ichiro; Morimoto, Yukio

2010-01-01

Nattokinase is a single polypeptide chain composed of 275 amino acids (molecular weight 27 724) which displays strong fibrinolytic activity. Moreover, it can activate other fibrinolytic enzymes such as pro-urokinase and tissue plasminogen activator. In the present study, native nattokinase from Bacillus subtilis natto was purified using gel-filtration chromatography and crystallized to give needle-like crystals which could be used for X-ray diffraction experiments. The crystals belonged to space group C2, with unit-cell parameters a = 74.3, b = 49.9, c = 56.3 Å, β = 95.2°. Diffraction images were processed to a resolution of 1.74 Å with an R merge of 5.2% (15.3% in the highest resolution shell) and a completeness of 69.8% (30.0% in the highest resolution shell). This study reports the first X-ray diffraction analysis of nattokinase. PMID:21139221

Controlled vapor crystal growth of N a 4 I r 3 O 8 : A three-dimensional quantum spin liquid candidate

DOE PAGES

Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.; ...

2018-04-24

In this work, we report the successful bulk single-crystal growth of the hyperkagome lattice iridate Na 4Ir 3O 8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q=(1/3,1/3,1/3) based on the cubic substructure with cell parameter a=8.986(1)Å. This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ionsmore » at the notionally disordered Na sites as a plausible origin for the observed superlattice.« less

Controlled vapor crystal growth of N a 4 I r 3 O 8 : A three-dimensional quantum spin liquid candidate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Hong; Zhang, Junjie; Stoumpos, Constantinos C.

In this work, we report the successful bulk single-crystal growth of the hyperkagome lattice iridate Na 4Ir 3O 8 (Na438) by vapor transport using a sealed aluminum oxide tube as a container. Crystals were characterized by magnetization, x-ray diffraction, and energy-dispersive x-ray measurements, confirming their identity and properties. Single-crystal x-ray diffraction experiments revealed superlattice peaks indexed on a propagation vector q=(1/3,1/3,1/3) based on the cubic substructure with cell parameter a=8.986(1)Å. This superlattice is three-dimensional and fully coherent. Polarization analysis rules out spin and/or orbital order as the underlying origin of the modulation and points to long-range ordering of Na ionsmore » at the notionally disordered Na sites as a plausible origin for the observed superlattice.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

PubMed Central

Rodamilans, Bernardo; Montoya, Guillermo

2007-01-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

PubMed

Rodamilans, Bernardo; Montoya, Guillermo

2007-04-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

Crystallization of the Membrane-Associated Annexin B1: Roles of Additive Screen, Dynamic Light Scattering, and Bioactivity Assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, F.; Xu, Y; Azzi, A

2010-01-01

Annexin B1 (AnxB1) is a calcium-dependent phospholipid binding protein from Taenia solium cysticercus and has been reported to possess anticoagulant activity, to inhibit phospholipase A{sub 2}, and to regulate membrane transport. Native AnxB1 and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. The results of dynamic light scattering analysis showed that Hepes buffer combined with low concentration salts (NaCl or CaCl{sub 2}) was beneficial for preventing aggregation and for AnxB1 stabilization in the storage. After the additive screen, crystals have been yielded in the presence of guanidine hydrochloride (Gn-HCl). We determined that a low concentration of Gn-HClmore » significantly delayed clotting time and increased anticoagulant activity. Analysis of the crystal showed that in the presence of Gn-HCl, AnxB1 crystallizes in orthorhombic space group, which is modified from the cubic space group for crystals grown in the absence of Gn-HCl. A high quality data set (at 1.9 {angstrom}) has been collected successfully for crystals of L-selenomethionine labeled protein in the presence of Gn-HCl, to solve the structure with the single anomalous dispersion method (SAD). The unit cell parameters are a = 102.35 {angstrom}, b = 103.59 {angstrom}, c = 114.60 {angstrom}, {alpha} = {beta} = {gamma} = 90.00{sup o}.« less

EPR, optical and modeling of Mn(2+) doped sarcosinium oxalate monohydrate.

PubMed

Kripal, Ram; Singh, Manju

2015-01-25

Electron paramagnetic resonance (EPR) study of Mn(2+) ions doped in sarcosinium oxalate monohydrate (SOM) single crystal is done at liquid nitrogen temperature (LNT). EPR spectrum shows a bunch of five fine structure lines and further they split into six hyperfine components. Only one interstitial site was observed. With the help of EPR spectra the spin Hamiltonian parameters including zero field splitting (ZFS) parameters are evaluated. The optical absorption study at room temperature is also done in the wavelength range 195-1100 nm. From this study cubic crystal field splitting parameter, Dq=730 cm(-1) and Racah inter-electronic repulsion parameters B=792 cm(-1), C=2278 cm(-1) are determined. ZFS parameters D and E are also calculated using crystal field parameters from superposition model and microscopic spin Hamiltonian theory. The calculated ZFS parameter values are in good match with the experimental values obtained by EPR. Copyright © 2014 Elsevier B.V. All rights reserved.

Theoretical studies of the dependence of EPR parameters on local structure for the tetragonal Er(3+) centres in YVO4 and ScVO4.

PubMed

Chai, Rui-Peng; Hao, Dan-Hui; Kuang, Xiao-Yu; Liang, Liang

2015-11-05

The dependences of the EPR parameters on the local distortion parameters Δθ and ΔR as well as the crystal-field parameters have been studied by diagonalizing the 364×364 complete energy matrices for a tetragonal Er(3+) centre in the YVO4 and ScVO4 crystals. The results show that the local distortion angle Δθ and the fourth-order crystal-field parameter Ā4 are most sensitive to the EPR g-factors g// and g⊥, whereas the local distortion length ΔR and the second-order parameter Ā2 are less sensitive to the g-factors. Furthermore, we found that the abnormal EPR g-factors for the Er(3+) ion in the ScVO4 may be ascribed to the stronger nephelauxetic effect and covalent bonding effect, as a result of an expanded local distortion for the Er(3+) centre in the ScVO4 crystal. Simultaneously, the contributions of the J-J mixing effects from the terms of excited states to the EPR parameters have been evaluated quantitatively. Copyright © 2015 Elsevier B.V. All rights reserved.

Analysis of X-Ray Line Spectra from a Transient Plasma Under Solar Flare Conditions - Part Three - Diagnostics for Measuring Electron Temperature and Density

NASA Astrophysics Data System (ADS)

Sylwester, J.; Mewe, R.; Schrijver, J.

1980-06-01

In this paper, the third in a series dealing with plasmas out of equilibrium we present quantitative methods of analysis of non-stationary flare plasma parameters. The method is designed to be used for the interpretation of the SMM XRP Bent Crystal Spectrometer spectra. Our analysis is based on measurements of 11 specific lines in the 1.77-3.3 Å range. Using the proposed method we are able to derive information about temperature, density, emission measure, and other related parameters of the flare plasma. It is shown that the measurements, to be made by XRP can give detailed information on these parameters and their time evolution. The method is then tested on some artificial flares, and proves to be useful and accurate.

Crystallization tendency of active pharmaceutical ingredients following rapid solvent evaporation--classification and comparison with crystallization tendency from undercooled melts.

PubMed

Van Eerdenbrugh, Bernard; Baird, Jared A; Taylor, Lynne S

2010-09-01

In this study, the crystallization behavior of a variety of compounds was studied following rapid solvent evaporation using spin coating. Initial screening to determine model compound suitability was performed using a structurally diverse set of 51 compounds in three different solvent systems [dichloromethane (DCM), a 1:1 (w/w) dichloromethane/ethanol mixture (MIX), and ethanol (EtOH)]. Of this starting set of 153 drug-solvent combinations, 93 (40 compounds) were selected for further evaluation based on solubility, chemical solution stability, and processability criteria. These systems were spin coated and their crystallization was monitored using polarized light microscopy (7 days, dry conditions). The crystallization behavior of the samples could be classified as rapid (Class I: 39 cases), intermediate (Class II: 23 cases), or slow (Class III: 31 cases). The solvent system employed influenced the classification outcome for only four of the compounds. The various compounds showed very diverse crystallization behavior. Upon comparison of classification results with those of a previous study, where cooling from the melt was used as a preparation technique, a good similarity was found whereby 68% of the cases were identically classified. Multivariate analysis was performed using a set of relevant physicochemical compound characteristics. It was found that a number of these parameters tended to differ between the different classes. These could be further interpreted in terms of the nature of the crystallization process. Additional multivariate analysis on the separate classes of compounds indicated some potential in predicting the crystallization tendency of a given compound.

The Effect of Roughness Model on Scattering Properties of Ice Crystals.

NASA Technical Reports Server (NTRS)

Geogdzhayev, Igor V.; Van Diedenhoven, Bastiaan

2016-01-01

We compare stochastic models of microscale surface roughness assuming uniform and Weibull distributions of crystal facet tilt angles to calculate scattering by roughened hexagonal ice crystals using the geometric optics (GO) approximation. Both distributions are determined by similar roughness parameters, while the Weibull model depends on the additional shape parameter. Calculations were performed for two visible wavelengths (864 nm and 410 nm) for roughness values between 0.2 and 0.7 and Weibull shape parameters between 0 and 1.0 for crystals with aspect ratios of 0.21, 1 and 4.8. For this range of parameters we find that, for a given roughness level, varying the Weibull shape parameter can change the asymmetry parameter by up to about 0.05. The largest effect of the shape parameter variation on the phase function is found in the backscattering region, while the degree of linear polarization is most affected at the side-scattering angles. For high roughness, scattering properties calculated using the uniform and Weibull models are in relatively close agreement for a given roughness parameter, especially when a Weibull shape parameter of 0.75 is used. For smaller roughness values, a shape parameter close to unity provides a better agreement. Notable differences are observed in the phase function over the scattering angle range from 5deg to 20deg, where the uniform roughness model produces a plateau while the Weibull model does not.

Thermal deformation of cryogenically cooled silicon crystals under intense X-ray beams: measurement and finite-element predictions of the surface shape

PubMed Central

Zhang, Lin; Sánchez del Río, Manuel; Monaco, Giulio; Detlefs, Carsten; Roth, Thomas; Chumakov, Aleksandr I.; Glatzel, Pieter

2013-01-01

X-ray crystal monochromators exposed to white-beam X-rays in third-generation synchrotron light sources are subject to thermal deformations that must be minimized using an adequate cooling system. A new approach was used to measure the crystal shape profile and slope of several cryogenically cooled (liquid nitrogen) silicon monochromators as a function of beam power in situ and under heat load. The method utilizes multiple angular scans across the Bragg peak (rocking curve) at various vertical positions of a narrow-gap slit downstream from the monochromator. When increasing the beam power, the surface of the liquid-nitrogen-cooled silicon crystal deforms from a concave shape at low heat load to a convex shape at high heat load, passing through an approximately flat shape at intermediate heat load. Finite-element analysis is used to calculate the crystal thermal deformations. The simulated crystal profiles and slopes are in excellent agreement with experiments. The parameters used in simulations, such as material properties, absorbed power distribution on the crystal and cooling boundary conditions, are described in detail as they are fundamental for obtaining accurate results. PMID:23765298

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.

The gene encoding a putative siderophore-interacting protein from the marine bacterium S. frigidimarina was successfully cloned, followed by expression and purification of the gene product. Optimized crystals diffracted to 1.35 Å resolution and preliminary crystallographic analysis is promising with respect to structure determination and increased insight into the poorly understood molecular mechanisms underlying iron acquisition. Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI-RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this proteinmore » are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing.« less

A combined experimental and in silico characterization to highlight additional structural features and properties of a potentially new drug

NASA Astrophysics Data System (ADS)

Bastos, Isadora T. S.; Costa, Fanny N.; Silva, Tiago F.; Barreiro, Eliezer J.; Lima, Lídia M.; Braz, Delson; Lombardo, Giuseppe M.; Punzo, Francesco; Ferreira, Fabio F.; Barroso, Regina C.

2017-10-01

LASSBio-1755 is a new cycloalkyl-N-acylhydrazone parent compound designed for the development of derivatives with antinociceptive and anti-inflammatory activities. Although single crystal X-ray diffraction has been considered as the golden standard in structure determination, we successfully used X-ray powder diffraction data in the structural determination of new synthesized compounds, in order to overcome the bottle-neck due to the difficulties experienced in harvesting good quality single crystals of the compounds. We therefore unequivocally assigned the relative configuration (E) to the imine double bond and a s-cis conformation of the amide function of the N-acylhydrazone compound. These features are confirmed by a computational analysis performed on the basis of molecular dynamics calculations, which are extended not only to the structural characteristics but also to the analysis of the anisotropic atomic displacement parameters, a further information - missed in a typical powder diffraction analysis. The so inferred data were used to perform additional cycles of refinement and eventually generate a new cif file with additional physical information. Furthermore, crystal morphology prediction was performed, which is in agreement with the experimental images acquired by scanning electron microscopy, thus providing useful information on possible alternative paths for better crystallization strategies.

Hydrogen bonding interactions and supramolecular assemblies in 2-amino guanidinium 4-methyl benzene sulphonate crystal structure: Hirshfeld surfaces and computational calculations

NASA Astrophysics Data System (ADS)

Muthuraja, P.; Joselin Beaula, T.; Balachandar, S.; Bena Jothy, V.; Dhandapani, M.

2017-10-01

2-aminoguanidinium 4-methyl benzene sulphonate (AGMS), an organic compound with big assembly of hydrogen bonding interactions was crystallized at room temperature. The structure of the compound was confirmed by FT-IR, NMR and single crystal X-ray diffraction analysis. Numerous hydrogen bonded interactions were found to form supramolecular assemblies in the molecular structure. Fingerprint plots of Hirshfeld surface analysis spells out the interactions in various directions. The molecular structure of AGMS was optimised by HF, MP2 and DFT (B3LYP and CAM-B3LYP) methods at 6-311G (d,p) basis set and the geometrical parameters were compared. Electrostatic potential calculations of the reactants and product confirm the transfer of proton. Optical properties of AGMS were ascertained by UV-Vis absorbance and reflectance spectra. The band gap of AGMS is found to be 2.689 eV. Due to numerous hydrogen bonds, the crystal is thermally stable up to 200 °C. Hyperconjugative interactions which are responsible for the second hyperpolarizabilities were accounted by NBO analysis. Static and frequency dependent optical properties were calculated at HF and DFT methods. The hyperpolarizabilities of AGMS increase rapidly at frequencies 0.0428 and 0.08 a.u. compared to static one. The compound exhibits violet and blue emission.

Purification, crystallization and preliminary X-ray analysis of phycocyanin and phycoerythrin from Porphyra yezoensis Ueda

PubMed Central

Cai, Chuner; Wu, Lian; Li, Chunxia; He, Peimin; Li, Jie; Zhou, Jiahai

2011-01-01

Porphyra yezoensis is one of the most important and widely cultured seaweeds in China. Phycobiliproteins exhibit excellent spectroscopic properties and play versatile roles in the biomedical, food, cosmetics and chemical synthetic dye industries. Here, the purification and crystallization of phycoerythrin and phycocyanin, two phycobiliproteins extracted from P. yezoensis, are described. Using a novel protocol including co-precipitation with ammonium sulfate and hydroxyapatite column chromatography, both phycobiliproteins were produced on a large scale with improved quality and yield compared with those previously reported. Native PAGE analysis indicated that phycoerythrin and phycocyanin exist as (αβ)3 heterohexamers in solution. The crystals of phycoerythrin diffracted to 2.07 Å resolution and belonged to space group R3. The unit-cell parameters referred to hexagonal axes are a = b = 187.7, c = 59.7 Å, with nine (αβ)2 heterotetramers per unit cell. The crystals of phycocyanin diffracted to 2.70 Å resolution in space group P21. Matthews coefficient analysis shows that 10–19 (αβ) heterodimers of phycocyanin in the asymmetric unit would be reasonable. A self-rotation function calculation clarified this ambiguity and indicated that 12 (αβ) heterodimers of phycocyanin are assembled in the asymmetric unit. PMID:21543866

Theoretical research of the spin-Hamiltonian parameters for two rhombic W5+ centers in KTiOPO4 (KTP) crystal through a two-mechanism model

NASA Astrophysics Data System (ADS)

Mei, Yang; Chen, Bo-Wei; Wei, Chen-Fu; Zheng, Wen-Chen

2016-09-01

The high-order perturbation formulas based on the two-mechanism model are employed to calculate the spin-Hamiltonian parameters (g factors gi and hyperfine structure constants Ai, where i=x, y, z) for two approximately rhombic W5+ centers in KTiOPO4 (KTP) crystal. In the model, both the widely-applied crystal-field (CF) mechanism concerning the interactions of CF excited states with the ground state and the generally-neglected charge-transfer (CT) mechanism concerning the interactions of CT excited states with the ground state are included. The calculated results agree with the experimental values, and the signs of constants Ai are suggested. The calculations indicate that (i) for the high valence state dn ions in crystals, the contributions to spin-Hamiltonian parameters should take into account both the CF and CT mechanisms and (ii) the large g-shifts |Δgi | (=|gi-ge |, where ge≈ 2.0023) for W5+ centers in crystals are due to the large spin-orbit parameter of free W5+ ion.

Neutron diffraction measurements and micromechanical modelling of temperature-dependent variations in TATB lattice parameters

DOE PAGES

Yeager, John D.; Luscher, Darby J.; Vogel, Sven C.; ...

2016-02-02

Triaminotrinitrobenzene (TATB) is a highly anisotropic molecular crystal used in several plastic-bonded explosive (PBX) formulations. TATB-based explosives exhibit irreversible volume expansion (“ratchet growth”) when thermally cycled. A theoretical understanding of the relationship between anisotropy of the crystal, crystal orientation distribution (texture) of polycrystalline aggregates, and the intergranular interactions leading to this irreversible growth is necessary to accurately develop physics-based predictive models for TATB-based PBXs under various thermal environments. In this work, TATB lattice parameters were measured using neutron diffraction during thermal cycling of loose powder and a pressed pellet. The measured lattice parameters help clarify conflicting reports in the literaturemore » as these new results are more consistent with one set of previous results than another. The lattice parameters of pressed TATB were also measured as a function of temperature, showing some differences from the powder. This data is used along with anisotropic single-crystal stiffness moduli reported in the literature to model the nominal stresses associated with intergranular constraints during thermal expansion. The texture of both specimens were characterized and the pressed pellet exhibits preferential orientation of (001) poles along the pressing direction, whereas no preferred orientation was found for the loose powder. Lastly, thermal strains for single-crystal TATB computed from lattice parameter data for the powder is input to a self-consistent micromechanical model, which predicts the lattice parameters of the constrained TATB crystals within the pellet. The agreement of these model results with the diffraction data obtained from the pellet is discussed along with future directions of research.« less

Theoretical and experimental studies of the molecular orbital bonding coefficients for Cu{sup 2+} ion in cesium hydrogen oxalate single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalfaoğlu, Emel, E-mail: emelkalfaoglu@mynet.com; Karabulut, Bünyamin

2016-03-25

Electron paramagnetic resonance (EPR) and optical absorption spectra of Cu{sup 2+} ions in cesium hydrogen oxalate single crystals have been investigated at room temperature. The spin-Hamiltonian parameters (g and A), have been determined. Crystalline field around the Cu{sup 2+} ion is almost axially symmetric. The results show a single paramagnetic site which confirms the triclinic crystal symmetry. Molecular orbital bonding coefficients are studied from the EPR and optical data. Theoretical octahedral field parameter and the tetragonal field parameters have been evaluated from the superposition model. Using these parameters, various bonding parameters are analyzed and the nature of bonding in themore » complex is discussed. The theoretical results are supported by experimental results.« less

Complex structures of different CaFe2As2 samples

PubMed Central

Saparov, Bayrammurad; Cantoni, Claudia; Pan, Minghu; Hogan, Thomas C.; II, William Ratcliff; Wilson, Stephen D.; Fritsch, Katharina; Gaulin, Bruce D.; Sefat, Athena S.

2014-01-01

The interplay between magnetism and crystal structures in three CaFe2As2 samples is studied. For the nonmagnetic quenched crystals, different crystalline domains with varying lattice parameters are found, and three phases (orthorhombic, tetragonal, and collapsed tetragonal) coexist between TS = 95 K and 45 K. Annealing of the quenched crystals at 350°C leads to a strain relief through a large (~1.3%) expansion of the c-parameter and a small (~0.2%) contraction of the a-parameter, and to local ~0.2 Å displacements at the atomic-level. This annealing procedure results in the most homogeneous crystals for which the antiferromagnetic and orthorhombic phase transitions occur at TN/TS = 168(1) K. In the 700°C-annealed crystal, an intermediate strain regime takes place, with tetragonal and orthorhombic structural phases coexisting between 80 to 120 K. The origin of such strong shifts in the transition temperatures are tied to structural parameters. Importantly, with annealing, an increase in the Fe-As length leads to more localized Fe electrons and higher local magnetic moments on Fe ions. Synergistic contribution of other structural parameters, including a decrease in the Fe-Fe distance, and a dramatic increase of the c-parameter, which enhances the Fermi surface nesting in CaFe2As2, are also discussed. PMID:24844399

REVIEW: Optics of globular photonic crystals

NASA Astrophysics Data System (ADS)

Gorelik, V. S.

2007-05-01

The results of experimental and theoretical studies of the optical properties of globular photonic crystals - new physical objects having a crystal structure with the lattice period exceeding considerably the atomic size, are presented. As globular photonic crystals, artificial opal matrices consisting of close-packed silica globules of diameter ~200 nm were used. The reflection spectra of these objects characterising the parameters of photonic bands existing in these crystals in the visible spectral region are presented. The idealised models of the energy band structure of photonic crystals investigated in the review give analytic dispersion dependences for the group velocity and the effective photon mass in a globular photonic crystal. The characteristics of secondary emission excited in globular photonic crystals by monochromatic and broadband radiation are presented. The results of investigations of single-photon-excited delayed scattering of light observed in globular photonic crystals exposed to cw UV radiation and radiation from a repetitively pulsed copper vapour laser are presented. The possibilities of using globular photonic crystals as active media for lasing in different spectral regions are considered. It is proposed to use globular photonic crystals as sensitive sensors in optoelectronic devices for molecular analysis of organic and inorganic materials by the modern methods of laser spectroscopy. The results of experimental studies of spontaneous and stimulated globular scattering of light are discussed. The conditions for observing resonance and two-photon-excited delayed scattering of light are found. The possibility of accumulation and localisation of the laser radiation energy inside a globular photonic crystal is reported.

Biochemical, spectroscopic and X-ray structural analysis of deuterated multicopper oxidase CueO prepared from a new expression construct for neutron crystallography.

PubMed

Akter, Mahfuza; Inoue, Chika; Komori, Hirofumi; Matsuda, Nana; Sakurai, Takeshi; Kataoka, Kunishige; Higuchi, Yoshiki; Shibata, Naoki

2016-10-01

Multicopper oxidases oxidize various phenolic and nonphenolic compounds by using molecular oxygen as an electron acceptor to produce water. A multicopper oxidase protein, CueO, from Escherichia coli is involved in copper homeostasis in the bacterial cell. Although X-ray crystallographic studies have been conducted, the reduction mechanism of oxygen and the proton-transfer pathway remain unclear owing to the difficulty in identifying H atoms from X-ray diffraction data alone. To elucidate the reaction mechanism using neutron crystallography, a preparation system for obtaining large, high-quality single crystals of deuterated CueO was developed. Tiny crystals were obtained from the deuterated CueO initially prepared from the original construct. The X-ray crystal structure of the deuterated CueO showed that the protein contained an incompletely truncated signal sequence at the N-terminus, which resulted in the heterogeneity of the protein sample for crystallization. Here, a new CueO expression system that had an HRV3C cleavage site just after the signal sequence was constructed. Deuterated CueO from the new construct was expressed in cells cultured in deuterated algae-extract medium and the signal sequence was completely eliminated by HRV3C protease. The deuteration level of the purified protein was estimated by MALDI-TOF mass spectrometry to be at least 83.2% compared with nondeuterated protein. Nondeuterated CueO crystallized in space group P2 1 , with unit-cell parameters a = 49.51, b = 88.79, c = 53.95 Å, β = 94.24°, and deuterated CueO crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 49.91, b = 106.92, c = 262.89 Å. The crystallographic parameters for the crystals of the new construct were different from those previously reported for nondeuterated crystals. The nondeuterated and deuterated CueO from the new construct had similar UV-Vis spectra, enzymatic activities and overall structure and geometry of the ligands of the Cu atoms in the active site to those of previously reported CueO structures. These results indicate that the CueO protein prepared using the new construct is suitable for further neutron diffraction studies.

A novel conformation of gel grown biologically active cadmium nicotinate

NASA Astrophysics Data System (ADS)

Nair, Lekshmi P.; Bijini, B. R.; Divya, R.; Nair, Prabitha B.; Eapen, S. M.; Dileep Kumar, B. S.; Nishanth Kumar, S.; Nair, C. M. K.; Deepa, M.; Rajendra Babu, K.

2017-11-01

The elimination of toxic heavy metals by the formation of stable co-ordination compounds with biologically active ligands is applicable in drug designing. A new crystalline complex of cadmium with nicotinic acid is grown at ambient temperature using the single gel diffusion method in which the crystal structure is different from those already reported. Single crystal x-ray diffraction reveals the identity of crystal structure belonging to monoclinic system, P21/c space group with cell dimensions a = 17.220 (2) Å, b = 10.2480 (2) Å, c = 7.229(9) Å, β = 91.829(4)°. Powder x-ray diffraction analysis confirmed the crystallinity of the sample. The unidentate mode of co-ordination between the metal atom and the carboxylate group is supported by the Fourier Transform Infra Red spectral data. Thermal analysis ensures the thermal stability of the complex. Kinetic and thermodynamic parameters are also calculated. The stoichiometry of the complex is confirmed by the elemental analysis. The UV-visible spectral analysis shows the wide transparency window of the complex in the visible region. The band gap of the complex is found to be 3.92 eV. The complex shows excellent antibacterial and antifungal activity.

Theoretical crystal chemistry of M{sub x}(TO{sub 4}){sub y} sulfates and selenates: Topological analysis and classification of suprapolyhedral invariants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ilyushin, G. D.; Blatov, V. A.

2006-05-15

A geometric topological analysis of orthotetrahedral phases M{sub x}(TO{sub 4}){sub y} (T = S or Se) is performed for 46 sulfates and 17 selenates with the TOPOS 3.2 software package. The values of coordination sequences {l_brace}N{sub k}{r_brace} of T atoms are used as classification parameters of topologically different MTO nets. The crystal structures are analyzed within 12 coordination spheres of T sites and assigned to 26 topological types. It is established that only 7 types are common for the structures of sulfates and selenates, 16 types include only sulfates, and 3 types include only selenates. The average values of themore » bond lengths are determined: = 1.48(2) A and = 1.63(2) A. The hierarchical ordering of the crystal structure is performed using the concept of a polyhedral microensemble of the structure.« less

Synthesis and characterization of tetraacetonitrilolithiumhexafluorophosphate crystal

NASA Astrophysics Data System (ADS)

Li, Xuecong; Li, Xuanli; Zhang, Zhiye; Yang, Lin; Zhong, Benhe; Wang, Xinlong

2015-08-01

Tetraacetonitrilolithiumhexafluorophosphate (Li(CH3CN)4PF6) crystal is an important intermediate in the preparation of high purity lithium hexafluorophosphate electrolyte via a simple transformation method. In this study, the crystal parameters were determined by X-ray powder diffraction analysis, which showed that it belongs to the triclinic system with space group P1. FTIR spectral studies identified the characteristic absorption bands of Ctbnd N and PF6- in the synthesized complex. Chemical analysis, gas chromatography, and ICP-AES results showed that the elementary ratio of Li:P:F: CH3CN in the complex is approximately: 1:1:6:4. Furthermore, the geometric optimization structure of Li(CH3CN)4PF6 was obtained using GAUSSIAN 09 program on a B3LYP/6-31+G(d, p) level. In this structure, two acetonitrile ligands bind strongly with the Li+ ion, whereas the other two are weakly-coordinated with lithium. The results of solid-state 13C-, 31P-, and 19F-NMR spectra confirmed that this configuration is reasonable.

Synthesis, structure, spectral characterization and thermal analysis of the tetraaquabis (isothiocyanato-κN) cobalt (II)-bis(caffeine)-tetrahydrate complex

NASA Astrophysics Data System (ADS)

EL Hamdani, H.; EL Amane, M.; Duhayon, C.

2018-04-01

The complex 2(C8H10N4O2).[Co(H2O)4(NCS)2].4H2O was prepared in the water-ethanol solution at room temperature and characterized by the single crystal X-ray diffraction analysis, 1H, 13C NMR, TGA/DTA and IR spectroscopy. This complex was crystallized in the monoclinic system (P 21/c). The unit cell parameters are a = 10.65854 (19) A°, b = 8.16642 (14) A°, c = 18.0595 (3) A° with β = 96.4701° (15). The cobalt (II) cation is coordinated by four oxygen atoms of the water molecules and two nitrogen in isothiocyanato a trans octahedral geometry, stabilized by hydrogen bonds with caffeine molecule and free water molecule, The intermolecular hydrogen bonds: Osbnd H⋯N, Osbnd H⋯O, Csbnd H⋯S, π···π interactions are together playing a vital role in the stabilization of the crystal packing.

Crystallization and preliminary X-ray crystallographic analysis of BxlA, an intracellular beta-D-xylosidase from Streptomyces thermoviolaceus OPC-520.

PubMed

Morioka, Hideaki; Miki, Yasuhiro; Saito, Kei; Tomoo, Koji; Ishida, Toshimasa; Hasegawa, Tomokazu; Yamano, Akihito; Takada, Chiaki; Miyamoto, Katsushiro; Tsujibo, Hiroshi

2010-07-01

BxlA from Streptomyces thermoviolaceus OPC-520, together with the extracellular BxlE and the integral membrane proteins BxlF and BxlG, constitutes a xylanolytic system that participates in the intracellular transport of xylan-degradation products and the production of xylose. To elucidate the mechanism of the hydrolytic degradation of xylooligosaccharides to xylose at the atomic level, X-ray structural analysis of BxlA was attempted. The recombinant BxlA protein (molecular weight 82 kDa) was crystallized by the hanging-drop vapour-diffusion method at 289 K. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 142.2, b = 129.5, c = 101.4 A, beta = 119.8 degrees , and contained two molecules per asymmetric unit (V(M) = 2.47 A(3) Da(-1)). Diffraction data were collected to a resolution to 2.50 A and provided a data set with an overall R(merge) of 8.3%.

Cloning, expression, purification, crystallization and X-ray crystallographic analysis of recombinant human C1ORF123 protein.

PubMed

Rahaman, Siti Nurulnabila A; Mat Yusop, Jastina; Mohamed-Hussein, Zeti-Azura; Ho, Kok Lian; Teh, Aik-Hong; Waterman, Jitka; Ng, Chyan Leong

2016-03-01

C1ORF123 is a human hypothetical protein found in open reading frame 123 of chromosome 1. The protein belongs to the DUF866 protein family comprising eukaryote-conserved proteins with unknown function. Recent proteomic and bioinformatic analyses identified the presence of C1ORF123 in brain, frontal cortex and synapses, as well as its involvement in endocrine function and polycystic ovary syndrome (PCOS), indicating the importance of its biological role. In order to provide a better understanding of the biological function of the human C1ORF123 protein, the characterization and analysis of recombinant C1ORF123 (rC1ORF123), including overexpression and purification, verification by mass spectrometry and a Western blot using anti-C1ORF123 antibodies, crystallization and X-ray diffraction analysis of the protein crystals, are reported here. The rC1ORF123 protein was crystallized by the hanging-drop vapor-diffusion method with a reservoir solution comprised of 20% PEG 3350, 0.2 M magnesium chloride hexahydrate, 0.1 M sodium citrate pH 6.5. The crystals diffracted to 1.9 Å resolution and belonged to an orthorhombic space group with unit-cell parameters a = 59.32, b = 65.35, c = 95.05 Å. The calculated Matthews coefficient (VM) value of 2.27 Å(3) Da(-1) suggests that there are two molecules per asymmetric unit, with an estimated solvent content of 45.7%.

Optimization of crystallization conditions for biological macromolecules.

PubMed

McPherson, Alexander; Cudney, Bob

2014-11-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success.

Optimization of crystallization conditions for biological macromolecules

PubMed Central

McPherson, Alexander; Cudney, Bob

2014-01-01

For the successful X-ray structure determination of macromolecules, it is first necessary to identify, usually by matrix screening, conditions that yield some sort of crystals. Initial crystals are frequently microcrystals or clusters, and often have unfavorable morphologies or yield poor diffraction intensities. It is therefore generally necessary to improve upon these initial conditions in order to obtain better crystals of sufficient quality for X-ray data collection. Even when the initial samples are suitable, often marginally, refinement of conditions is recommended in order to obtain the highest quality crystals that can be grown. The quality of an X-ray structure determination is directly correlated with the size and the perfection of the crystalline samples; thus, refinement of conditions should always be a primary component of crystal growth. The improvement process is referred to as optimization, and it entails sequential, incremental changes in the chemical parameters that influence crystallization, such as pH, ionic strength and precipitant concentration, as well as physical parameters such as temperature, sample volume and overall methodology. It also includes the application of some unique procedures and approaches, and the addition of novel components such as detergents, ligands or other small molecules that may enhance nucleation or crystal development. Here, an attempt is made to provide guidance on how optimization might best be applied to crystal-growth problems, and what parameters and factors might most profitably be explored to accelerate and achieve success. PMID:25372810

Purification, crystallization and preliminary X-ray analysis of uracil-DNA glycosylase from Sulfolobus tokodaii strain 7

PubMed Central

Kawai, Akito; Higuchi, Shigesada; Tsunoda, Masaru; Nakamura, Kazuo T.; Miyamoto, Shuichi

2012-01-01

Uracil-DNA glycosylase (UDG) specifically removes uracil from DNA by catalyzing hydrolysis of the N-glycosidic bond, thereby initiating the base-excision repair pathway. Although a number of UDG structures have been determined, the structure of archaeal UDG remains unknown. In this study, a deletion mutant of UDG isolated from Sulfolobus tokodaii strain 7 (stoUDGΔ) and stoUDGΔ complexed with uracil were crystallized and analyzed by X-ray crystallography. The crystals were found to belong to the orthorhombic space group P212121, with unit-cell parameters a = 52.2, b = 52.3, c = 74.7 Å and a = 52.1, b = 52.2, c = 74.1 Å for apo stoUDGΔ and stoUDGΔ complexed with uracil, respectively. PMID:22949205

Understanding microstrain anisotropy in yttrium oxide synthesized by sol-gel route

NASA Astrophysics Data System (ADS)

Murugesan, S.; Thirumurugesan, R.; Parameswaran, P.

2018-04-01

Yttrium oxide was synthesized by wet chemical route and calcined at various temperatures. On x-ray diffraction analysis of the material using Williamson-Hall analysis followed by Rietveld analysis indicates that the powder exists in nano crystallite size with lattice strain. The spherical harmonics analysis model of microstrain indicates the presence of strain anisotropy. The change in crystal structure lattice parameter, atomic coordinates of Y, O in yttria and the bond length analysis of the calcined powder reveals the presence of oxygen vacancies in the system.

Process for Encapsulating Protein Crystals

NASA Technical Reports Server (NTRS)

Morrison, Dennis R.; Mosier, Benjamin

2003-01-01

A process for growing protein crystals encapsulated within membranes has been invented. This process begins with the encapsulation of a nearly saturated aqueous protein solution inside semipermeable membranes to form microcapsules. The encapsulation is effected by use of special formulations of a dissolved protein and a surfactant in an aqueous first liquid phase, which is placed into contact with a second, immiscible liquid phase that contains one or more polymers that are insoluble in the first phase. The second phase becomes formed into the semipermeable membranes that surround microglobules of the first phase, thereby forming the microcapsules. Once formed, the microcapsules are then dehydrated osmotically by exposure to a concentrated salt or polymer solution. The dehydration forms supersaturated solutions inside the microcapsules, thereby enabling nucleation and growth of protein crystals inside the microcapsules. By suitable formulation of the polymer or salt solution and of other physical and chemical parameters, one can control the rate of transport of water out of the microcapsules through the membranes and thereby create physicochemical conditions that favor the growth, within each microcapsule, of one or a few large crystals suitable for analysis by x-ray diffraction. The membrane polymer can be formulated to consist of low-molecular-weight molecules that do not interfere with the x-ray diffraction analysis of the encapsulated crystals. During dehydration, an electrostatic field can be applied to exert additional control over the rate of dehydration. This protein-crystal-encapsulation process is expected to constitute the basis of protein-growth experiments to be performed on the space shuttle and the International Space Station. As envisioned, the experiments would involve the exposure of immiscible liquids to each other in sequences of steps under microgravitational conditions. The experiments are expected to contribute to knowledge of the precise conditions under which protein crystals form. By enhancing the ability to grow crystals suitable for x-ray diffraction analysis, this knowledge can be expected to benefit not only the space program but also medicine and the pharmaceutical industry.

Temperature dependence of local structural changes around transition metal centers Cr3+ and Mn2+ in RAl3(BO3)4 crystals studied by EMR

NASA Astrophysics Data System (ADS)

Açıkgöz, Muhammed; Rudowicz, Czesław; Gnutek, Paweł

2017-11-01

Theoretical investigations are carried out to determine the temperature dependence of the local structural parameters of Cr3+ and Mn2+ ions doped into RAl3(BO3)4 (RAB, R = Y, Eu, Tm) crystals. The zero-field splitting (ZFS) parameters (ZFSPs) obtained from the spin Hamiltonian (SH) analysis of EMR (EPR) spectra serve for fine-tuning the theoretically predicted ZFSPs obtained using the semi-empirical superposition model (SPM). The SPM analysis enables to determine the local structure changes around Cr3+ and Mn2+ centers in RAB crystals and explain the observed temperature dependence of the ZFSPs. The local monoclinic C2 site symmetry of all Al sites in YAB necessitates consideration of one non-zero monoclinic ZFSP (in the Stevens notation, b21) for Cr3+ ions. However, the experimental second-rank ZFSPs (D =b20 , E = 1 / 3b22) were expressed in a nominal principal axis system. To provide additional insight into low symmetry aspects, the distortions (ligand's distances ΔRi and angular distortions Δθi) have been varied while preserving monoclinic site symmetry, in such way as to obtain the calculated values (D, E) close to the experimental ones, while keeping b21 close to zero. This procedure yields good matching of the calculated ZFSPs and the experimental ones, and enables determination of the corresponding local distortions. The present results may be useful in future studies aimed at technological applications of the Huntite-type borates with the formula RM3(BO3)4. The model parameters determined here may be utilized for ZFSP calculations for Cr3+ and Mn2+ ions at octahedral sites in single-molecule magnets and single-chain magnets.

PURY: a database of geometric restraints of hetero compounds for refinement in complexes with macromolecular structures.

PubMed

Andrejasic, Miha; Praaenikar, Jure; Turk, Dusan

2008-11-01

The number and variety of macromolecular structures in complex with ;hetero' ligands is growing. The need for rapid delivery of correct geometric parameters for their refinement, which is often crucial for understanding the biological relevance of the structure, is growing correspondingly. The current standard for describing protein structures is the Engh-Huber parameter set. It is an expert data set resulting from selection and analysis of the crystal structures gathered in the Cambridge Structural Database (CSD). Clearly, such a manual approach cannot be applied to the vast and ever-growing number of chemical compounds. Therefore, a database, named PURY, of geometric parameters of chemical compounds has been developed, together with a server that accesses it. PURY is a compilation of the whole CSD. It contains lists of atom classes and bonds connecting them, as well as angle, chirality, planarity and conformation parameters. The current compilation is based on CSD 5.28 and contains 1978 atom classes and 32,702 bonding, 237,068 angle, 201,860 dihedral and 64,193 improper geometric restraints. Analysis has confirmed that the restraints from the PURY database are suitable for use in macromolecular crystal structure refinement and should be of value to the crystallographic community. The database can be accessed through the web server http://pury.ijs.si/, which creates topology and parameter files from deposited coordinates in suitable forms for the refinement programs MAIN, CNS and REFMAC. In the near future, the server will move to the CSD website http://pury.ccdc.cam.ac.uk/.

Synthesis, pharmacology, crystal properties, and quantitative solvation studies from a drug transport perspective for three new 1,2,4-thiadiazoles.

PubMed

Perlovich, German L; Volkova, Tatyana V; Proshin, Alexey N; Sergeev, Dmitriy Yu; Bui, Cong Trinh; Petrova, Ludmila N; Bachurin, Sergey O

2010-09-01

A novel 1,2,4-thiadiazoles were synthesized. Crystal structures of these compounds were solved by X-ray diffraction experiments and comparative analysis of molecular conformational states, packing architecture, and hydrogen bonds networks were carried out. Thermodynamic aspects of sublimation processes of studied compounds were determined using temperature dependencies of vapor pressure. Thermophysical characteristics of the molecular crystals were obtained and compared with the sublimation and structural parameters. Solubility and solvation processes of 1,2,4-thiadiazoles in buffer, n-hexane and n-octanol were studied within the wide range of temperature intervals and thermodynamic functions were calculated. Specific and nonspecific interactions of molecules resolved in crystals and solvents were estimated and compared. Distribution processes of compounds in buffer/n-octanol and buffer/n-hexane systems (describing different types of membranes) were investigated. Analysis of transfer processes of studied molecules from the buffer to n-octanol/n-hexane phases was carried out by the diagram method with evaluation of the enthalpic and entropic terms. This approach allows us to design drug molecules with optimal passive transport properties. Calcium-blocking properties of the substances were evaluated.

Investigation on synthesis, growth and characterization of CdIn2S2Se2 single crystal grown by vertical Bridgman method

NASA Astrophysics Data System (ADS)

Vijayakumar, P.; Ramasamy, P.

2017-06-01

CdIn2S2Se2 polycrystalline material has been synthesized by melt oscillation method. Vertical Bridgman method was used to grow a good quality CdIn2S2Se2 single crystal. The crystalline phase and growth orientation were confirmed by powder X-ray diffraction pattern and unit cell parameters were determined by single crystal X-ray diffraction analysis. The structural uniformity of CdIn2S2Se2 was studied using Raman scattering spectroscopy at room temperature. The stoichiometric composition variation along the CdIn2S2Se2 was measured using energy dispersive spectrometry. The transmission spectra of CdIn2S2Se2 single crystal gave 42% transmission in the NIR region. Thermal property of CdIn2S2Se2 has been studied using differential thermal analysis. Thermal diffusivity, specific heat capacity and thermal conductivity were also measured. Electrical property was measured using Hall Effect measurement and it confirms the n-type semiconducting nature. The hardness behavior has been measured using Vickers micro hardness measurement and the indentation size effect has been observed.

Growth and structural analysis of ammonium nickel cobalt sulfate hexahydrate crystals

NASA Astrophysics Data System (ADS)

de Oliveira, Michelle; Ghosh, Santunu; Pacheco, Tiago S.; Perpétuo, Genivaldo J.; Franco, Carlos J.

2017-10-01

We have obtained a set of crystals of the empirical formula (NH4)2Ni x Co(1-x)(SO4)2 · 6H2O with the different concentrations of Ni and Co, by employing the growth from the solution technique. We have chosen the monocrystal (NH4)2Ni0.3Co0.7(SO4)2 · 6H2O for the structural analysis. The structure was resolved by x-ray diffraction method and refined by the full-matrix least-squares method with the help of SHELXS software. This crystal belongs to a monoclinic space group P21/c with crystal parameters, a  =  6.2455 (2) Å, b  =  12.5065 (3) Å, c  =  9.2303 (2) Å, α  =  γ  =  90°, β  =  106.995 (3)°, V  =  689.49 (3) Å3, Z  =  2. We have shown the configuration of the unit cell of the above monocrystal, along with that we have also reported the length, angles between the bonds and the geometry of the hydrogen bonds of the monocrystal.

Single crystal growth of spin-ladder compound La8Cu7O19 by the travelling-solvent floating zone method

NASA Astrophysics Data System (ADS)

Mohan, A.; Singh, S.; Partzsch, S.; Zwiebler, M.; Geck, J.; Wurmehl, S.; Büchner, B.; Hess, C.

2016-08-01

Large single crystals of La8Cu7O19 have been grown using the travelling-solvent floating zone method. A rather high oxygen pressure of 9 bar in the growth chamber and a slow growth speed of 0.5 mm/h were among the most important parameters in stabilizing the growth of this incongruently melting compound. Interestingly, a novel growth scenario has been witnessed. The crystal structure of the grown La8Cu7O19 crystal has been analyzed using single crystal diffractometry to extract important structural parameters of this compound. We find that La8Cu7O19 crystallizes in a monoclinic structure with space group C 2 / c and has the lattice parameters a ≈ 13.83 Å, b ≈ 3.75 Å, c ≈ 34.59 Å, and β ≈ 99.33 °, in good agreement with the data obtained on polycrystalline samples in the literature. The magnetization shows a highly anisotropic behavior, and an anomaly at T ≈103 K.

Advanced protein crystal growth programmatic sensitivity study

NASA Technical Reports Server (NTRS)

1992-01-01

The purpose of this study is to define the costs of various APCG (Advanced Protein Crystal Growth) program options and to determine the parameters which, if changed, impact the costs and goals of the programs and to what extent. This was accomplished by developing and evaluating several alternate programmatic scenarios for the microgravity Advanced Protein Crystal Growth program transitioning from the present shuttle activity to the man tended Space Station to the permanently manned Space Station. These scenarios include selected variations in such sensitivity parameters as development and operational costs, schedules, technology issues, and crystal growth methods. This final report provides information that will aid in planning the Advanced Protein Crystal Growth Program.

Features of changes in electrophysical properties of silicon under the influence of thermal treatment

NASA Astrophysics Data System (ADS)

Gaidar, G. P.; Baranskii, P. I.

2018-06-01

The influence of the annealing temperatures and cooling rates of n-silicon crystals, grown by the Czochralski method and doped with phosphorus impurity, on their electric and thermoelectric properties was studied. In the region of predominantly impurity scattering a more essential dependence of the charge carrier mobility on the cooling conditions of crystals was established in comparison with the dependence on the annealing temperature. The analysis of the measurement results of tensoresistance and tenso-thermo-emf was carried out, on the basis of which the dependence of the anisotropy parameter of drag thermo-emf on the cooling rate was obtained. The feature of the anisotropy parameter of thermo-emf M in the form of its maximal deviation from the linear dependence M = M(lg(υcl)) was revealed in the region of cooling rates from 8 to 15 K/min.

Thermal Decomposition Study on CuInSe2 Single Crystals

NASA Astrophysics Data System (ADS)

Chauhan, Sanjaysinh M.; Chaki, Sunil H.; Deshpande, M. P.; Malek, Tasmira J.; Tailor, J. P.

2018-01-01

The thermal analysis of the chemical vapor transport (CVT)-grown CuInSe2 single crystals was carried out by recording the thermogravimetric, differential thermogravimetric and differential thermal analysis curves. All the three thermo-curves were recorded simultaneously by thermal analyzer in the temperature range of ambient to 1080 K in inert nitrogen atmosphere. The thermo-curves were recorded for four heating rates of 5 K \\cdot min^{-1}, 10 K \\cdot min^{-1}, 15 K \\cdot min^{-1} and 20 K \\cdot min^{-1}. The TG curve analysis showed negligible mass loss in the temperature range of ambient to 600 K, stating the sample material to be thermally stable in this temperature range. Above 601 K to the temperature of 1080 K, the sample showed continuous mass loss. The DTG curves showed two peaks in the temperature range of 601 K to 1080 K. The corresponding DTA showed initial minor exothermic nature followed by endothermic nature up to nearly 750 K and above it showed exothermic nature. The initial exothermic nature is due to absorbed water converting to water vapor, whereas the endothermic nature states the absorption of heat by the sample up to nearly 950 K. Above nearly 950 K the exothermic nature is due to the decomposition of sample material. The absorption of heat in the endothermic region is substantiated by corresponding weight loss in TG. The thermal kinetic parameters of the CVT-grown CuInSe2 single crystals were determined employing the non-mechanistic Kissinger relation. The determined kinetic parameters support the observations of the thermo-curves.

Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

2008-08-01

Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

Synthesis, crystal structure, vibrational spectroscopy and photoluminescence of new hybrid compound containing chlorate anions of stanate (II)

NASA Astrophysics Data System (ADS)

Lassoued, Mohamed Saber; Abdelbaky, Mohammed S. M.; Lassoued, Abdelmajid; Meroño, Rafael Mendoza; Gadri, Abdellatif; Ammar, Salah; Ben Salah, Abdelhamid; García-Granda, Santiago

2017-08-01

The present work aimed at studying a new organic-inorganic bis (4-amino quinolinium) hexachloro stanate (II) dihydrate compound. It was prepared and characterized by single crystal X-ray diffraction, X-ray powder, Hirshfeld surface, Spectroscopy measurement, thermal study and photoluminescence properties. It was found to crystallize in the monoclinic system (P21/c space group) with the following lattice parameters: a = 7.2558(6) Å, b = 13.4876(5) Å, c = 17.2107(13) Å, β = 102.028 (12)°. Its crystal structure was determined and refined down to an R value of 0.06 and a wR value of 0.087. The structure consisted of two different alternating organic-inorganic layers. The crystal packing was stabilized by Nsbnd H⋯Cl and Osbnd H⋯Cl hydrogen bonds and π-π interactions. Hirshfeld surface analysis was used to investigate intermolecular interactions, as well 2D finger plots were conducted to reveal the contribution of these interactions in the crystal structure quantitatively. The X-ray powder is in agreement with the X-ray structure. Scanning electronic microscopy (SEM) was carried out. Furthermore, the room temperature Infra Red (IR) spectrum of the title compound was analyzed on the basis of data found in the literature. Solid state 13C NMR spectrum shows ten signals, confirming the solid state structure determined by X-ray diffraction. Thermal analysis shows two anomalies at 380 and 610 °C. The optical properties of the crystal were studied using optical absorption UV-visible and photoluminescence (PL) spectroscopy, which were investigated at room temperature.

Material Recycling and Waste Minimization by Freeze Crystallization. Phase 1

DTIC Science & Technology

1995-05-01

or centrifuge for recovery. DESIGN PARAMETERS - Crystallizer Gives direct scale-up information. - Eutectic Salt Separation Gives direct scale-up...because of sfer rates and crystal kinetics, differences in crystallizer construction. - Eutectic Salt Separation No ability in this system. - Wash Columns

Electronegativity, charge transfer, crystal field strength, and the point charge model revisited.

PubMed

Tanner, Peter A; Ning, Lixin

2013-02-21

Although the optical spectra of LnCl(6)(3-) systems are complex, only two crystal field parameters, B(40) and B(60), are required to model the J-multiplet crystal field splittings in octahedral symmetry. It is found that these parameters exhibit R(-5) and R(-7) dependence, respectively, upon the ionic radius Ln(3+)(VI), but not upon the Ln-Cl distance. More generally, the crystal field strengths of LnX(6) systems (X = Br, Cl, F, O) exhibit linear relationships with ligand electronegativity, charge transfer energy, and fractional ionic character of the Ln-X bond.

Active Control of Interface Shape During the Crystal Growth of Lead Bromide

NASA Technical Reports Server (NTRS)

Duval, W. M. B.; Batur, C.; Singh, N. B.

2003-01-01

A thermal model for predicting and designing the furnace temperature profile was developed and used for the crystal growth of lead bromide. The model gives the ampoule temperature as a function of the furnace temperature, thermal conductivity, heat transfer coefficients, and ampoule dimensions as variable parameters. Crystal interface curvature was derived from the model and it was compared with the predicted curvature for a particular furnace temperature and growth parameters. Large crystals of lead bromide were grown and it was observed that interface shape was in agreement with the shape predicted by this model.

Time-varying phononic crystals

NASA Astrophysics Data System (ADS)

Wright, Derek Warren

The primary objective of this thesis was to gain a deeper understanding of acoustic wave propagation in phononic crystals, particularly those that include materials whose properties can be varied periodically in time. This research was accomplished in three ways. First, a 2D phononic crystal was designed, created, and characterized. Its properties closely matched those determined through simulation. The crystal demonstrated band gaps, dispersion, and negative refraction. It served as a means of elucidating the practicalities of phononic crystal design and construction and as a physical verification of their more interesting properties. Next, the transmission matrix method for analyzing 1D phononic crystals was extended to include the effects of time-varying material parameters. The method was then used to provide a closed-form solution for the case of periodically time-varying material parameters. Some intriguing results from the use of the extended method include dramatically altered transmission properties and parametric amplification. New insights can be gained from the governing equations and have helped to identify the conditions that lead to parametric amplification in these structures. Finally, 2D multiple scattering theory was modified to analyze scatterers with time-varying material parameters. It is shown to be highly compatible with existing multiple scattering theories. It allows the total scattered field from a 2D time-varying phononic crystal to be determined. It was shown that time-varying material parameters significantly affect the phononic crystal transmission spectrum, and this was used to switch an incident monochromatic wave. Parametric amplification can occur under certain circumstances, and this effect was investigated using the closed-form solutions provided by the new 1D method. The complexity of the extended methods grows logarithmically as opposed linearly with existing methods, resulting in superior computational complexity for large numbers of scatterers. Also, since both extended methods provide analytic solutions, they may give further insights into the factors that govern the behaviour of time-varying phononic crystals. These extended methods may now be used to design an active phononic crystal that could demonstrate new or enhanced properties.

Is it Possible to have the Similar Unit Cell in Crystals of Different form from the same Macromolecule? (A Case Study of Ribosome Crystals)

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Rose, M. Franklin (Technical Monitor)

2000-01-01

Three different types of ribosome crystals were grown by the vapor diffusion technique in hanging drops as described in (1,2). The ribosome is a large asymmetric RNA-protein complex (2.3 million Da), which is protein syntheses machinery of the cell. In this poster we would like to discuss the features of ribosome crystallization. Ribosomes were purified from the thermophilic bacteria Thermus thermophilus by centrifugation (3). Three types of crystals (needle, flat tetragonal and tetragonal-like pyramid) can be grown from the same solution; furthermore, in the same drop using 10-15% 2-methyl-2,4- pentanediol as a precipitant. The crystals appeared in 5-48 hours. The crystals were stable and can co-exist in solution over long period of time. The kinetics of appearance of different crystal forms was different: first the needle crystals were grown, then the tetragonal, and finally the tetragonal pyramids. Later studies of the process of ribosome crystal growth depending on supersaturation showed that low supersaturation results in the appearance of tetragonal plates or tetragonal-like pyramids. An electron microscopy study, together with computer modeling, has shown that crystals of different forms have a high probability of having the same unit cell parameters. According to these experiments the following conclusion can be dranvn: the level of supersaturation of the macromolecule in a crystallizing solution is one of the major factors for forming three-dimensional crystals convenient for X-rays diffraction analysis. From the same macromolecule solution, crystals of different forms can be grown at approximately the same conditions by varying the concentration of macromolecule in the solution. Ion-macromolecule and water-macromolecule interactions, apparently, play the main role in the formation of the unit cell of the crystals.

Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

2007-11-01

The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

Thermoluminescence kinetic features of Lithium Iodide (LiI) single crystal grown by vertical Bridgman technique

NASA Astrophysics Data System (ADS)

Daniel, D. Joseph; Kim, H. J.; Kim, Sunghwan; Khan, Sajid

2017-08-01

Single crystal of pure Lithium Iodide (LiI) has been grown from melt by using the vertical Bridgman technique. Thermoluminescence (TL) Measurements were carried out at 1 K/s following X-ray irradiation. The TL glow curve consists of a dominant peak at (peak-maximum Tm) 393 K and one low temperature peak of weaker intensity at 343 K. The order of kinetics (b), activation energy (E), and the frequency factor (S) for a prominent TL glow peak observed around 393 K for LiI crystals are reported for the first time. The peak shape analysis of the glow peak indicates the kinetics to be of the first order. The value of E is calculated using various standard methods such as initial rise (IR), whole glow peak (WGP), peak shape (PS), computerized glow curve deconvolution (CGCD) and Variable Heating rate (VHR) methods. An average value of 1.06 eV is obtained in this case. In order to validate the obtained parameters, numerically integrated TL glow curve has been generated using experimentally determined kinetic parameters. The effective atomic number (Zeff) for this material was determined and found to be 52. X-ray induced emission spectra of pure LiI single crystal are studied at room temperature and it is found that the sample exhibit sharp emission at 457 nm and broad emission at 650 nm.

ThMn12-type phases for magnets with low rare-earth content: Crystal-field analysis of the full magnetization process.

PubMed

Tereshina, I S; Kostyuchenko, N V; Tereshina-Chitrova, E A; Skourski, Y; Doerr, M; Pelevin, I A; Zvezdin, A K; Paukov, M; Havela, L; Drulis, H

2018-02-26

Rare-earth (R)-iron alloys are a backbone of permanent magnets. Recent increase in price of rare earths has pushed the industry to seek ways to reduce the R-content in the hard magnetic materials. For this reason strong magnets with the ThMn 12  type of structure came into focus. Functional properties of R(Fe,T) 12 (T-element stabilizes the structure) compounds or their interstitially modified derivatives, R(Fe,T) 12 -X (X is an atom of hydrogen or nitrogen) are determined by the crystal-electric-field (CEF) and exchange interaction (EI) parameters. We have calculated the parameters using high-field magnetization data. We choose the ferrimagnetic Tm-containing compounds, which are most sensitive to magnetic field and demonstrate that TmFe 11 Ti-H reaches the ferromagnetic state in the magnetic field of 52 T. Knowledge of exact CEF and EI parameters and their variation in the compounds modified by the interstitial atoms is a cornerstone of the quest for hard magnetic materials with low rare-earth content.

Standard Reference Material (SRM 1990) for Single Crystal Diffractometer Alignment

USGS Publications Warehouse

Wong-Ng, W.; Siegrist, T.; DeTitta, G.T.; Finger, L.W.; Evans, H.T.; Gabe, E.J.; Enright, G.D.; Armstrong, J.T.; Levenson, M.; Cook, L.P.; Hubbard, C.R.

2001-01-01

An international project was successfully completed which involved two major undertakings: (1) a round-robin to demonstrate the viability of the selected standard and (2) the certification of the lattice parameters of the SRM 1990, a Standard Reference Material?? for single crystal diffractometer alignment. This SRM is a set of ???3500 units of Cr-doped Al2O3, or ruby spheres [(0 420.011 mole fraction % Cr (expanded uncertainty)]. The round-robin consisted of determination of lattice parameters of a pair of crystals' the ruby sphere as a standard, and a zeolite reference to serve as an unknown. Fifty pairs of crystals were dispatched from Hauptman-Woodward Medical Research Institute to volunteers in x-ray laboratories world-wide. A total of 45 sets of data was received from 32 laboratories. The mean unit cell parameters of the ruby spheres was found to be a=4.7608 A?? ?? 0.0062 A??, and c=12.9979 A?? ?? 0.020 A?? (95 % intervals of the laboratory means). The source of errors of outlier data was identified. The SRM project involved the certification of lattice parameters using four well-aligned single crystal diffractometers at (Bell Laboratories) Lucent Technologies and at NRC of Canada (39 ruby spheres), the quantification of the Cr content using a combined microprobe and SEM/EDS technique, and the evaluation of the mosaicity of the ruby spheres using a double-crystal spectrometry method. A confirmation of the lattice parameters was also conducted using a Guinier-Ha??gg camera. Systematic corrections of thermal expansion and refraction corrections were applied. These rubies_ are rhombohedral, with space group R3c. The certified mean unit cell parameters are a=4.76080 ?? 0.00029 A??, and c=12 99568 A?? ?? 0.00087 A?? (expanded uncertainty). These certified lattice parameters fall well within the results of those obtained from the international round-robin study. The Guinier-Ha??gg transmission measurements on five samples of powdered rubies (a=4.7610 A?? ?? 0.0013 A??, and c=12.9954 A?? ?? 0.0034 A??) agreed well with the values obtained from the single crystal spheres.

Standard Reference Material (SRM 1990) For Single Crystal Diffractometer Alignment

PubMed Central

Wong-Ng, W.; Siegrist, T.; DeTitta, G. T.; Finger, L. W.; Evans, H. T.; Gabe, E. J.; Enright, G. D.; Armstrong, J. T.; Levenson, M.; Cook, L. P.; Hubbard, C. R.

2001-01-01

An international project was successfully completed which involved two major undertakings: (1) a round-robin to demonstrate the viability of the selected standard and (2) the certification of the lattice parameters of the SRM 1990, a Standard Reference Material® for single crystal diffractometer alignment. This SRM is a set of ≈3500 units of Cr-doped Al2O3, or ruby spheres [(0.420.011 mole fraction % Cr (expanded uncertainty)]. The round-robin consisted of determination of lattice parameters of a pair of crystals: the ruby sphere as a standard, and a zeolite reference to serve as an unknown. Fifty pairs of crystals were dispatched from Hauptman-Woodward Medical Research Institute to volunteers in x-ray laboratories world-wide. A total of 45 sets of data was received from 32 laboratories. The mean unit cell parameters of the ruby spheres was found to be a=4.7608 ű0.0062 Å, and c=12.9979 ű0.020 Å (95 % intervals of the laboratory means). The source of errors of outlier data was identified. The SRM project involved the certification of lattice parameters using four well-aligned single crystal diffractometers at (Bell Laboratories) Lucent Technologies and at NRC of Canada (39 ruby spheres), the quantification of the Cr content using a combined microprobe and SEM/EDS technique, and the evaluation of the mosaicity of the ruby spheres using a double-crystal spectrometry method. A confirmation of the lattice parameters was also conducted using a Guinier-Hägg camera. Systematic corrections of thermal expansion and refraction corrections were applied. These rubies– are rhombohedral, with space group R3¯c. The certified mean unit cell parameters are a=4.76080±0.00029 Å, and c=12.99568 ű0.00087 Å (expanded uncertainty). These certified lattice parameters fall well within the results of those obtained from the international round-robin study. The Guinier-Hägg transmission measurements on five samples of powdered rubies (a=4.7610 ű0.0013 Å, and c = 12.9954 ű0.0034 Å) agreed well with the values obtained from the single crystal spheres. PMID:27500067

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

Low carrier semiconductor like behavior in Lu3Ir4Ge13 single crystal

NASA Astrophysics Data System (ADS)

Kumar, Anil; Matteppanavar, Shidaling; Thamizhavel, A.; Ramakrishnan, S.

2018-04-01

Single crystal of Lu3Ir4Ge13 crystallizing in the Yb3Rh4Sn13-type cubic crystal structure has been grown by Czochralski method in a tetra-arc furnace. In this paper we report on the crystal structure, magnetic and transport properties of Lu3Ir4Ge13. The analysis of the powder x-ray diffraction (XRD) studies revealed that Lu3Ir4Ge13 crystallizes in a cubic structure with the space group Pm-3n, no. 223. The lattice parameter was obtained from the Rietveld refinement of the room temperature XRD data which amounts to 8.904 (3) Å with low R factors. The temperature dependence of the resistivity exhibited semiconductor like behavior till 1.8 K, with a broad hump around 15 - 62 K. This hump was observed in both warming and cooling cycle with a very small hysteresis, it may be due to the existence of structural transition from high - low symmetry. The temperature dependent magnetization data shows the diamagnetic behavior with an anomaly around 70 K, which is well supported by the derivative of resistivity data.

Overexpression, crystallization and preliminary X-ray crystallographic analysis of erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa.

PubMed

Ha, Jun Yong; Lee, Ji Hyun; Kim, Kyoung Hoon; Kim, Do Jin; Lee, Hyung Ho; Kim, Hye-Kyung; Yoon, Hye-Jin; Suh, Se Won

2006-02-01

The enzyme erythronate-4-phosphate dehydrogenase catalyses the conversion of erythronate-4-phosphate to 3-hydroxy-4-phospho-hydroxy-alpha-ketobutyrate. It belongs to the D-isomer-specific 2-hydroxyacid dehydrogenase family. It is essential for de novo biosynthesis of vitamin B6 (pyridoxine). Erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa, a homodimeric enzyme consisting of two identical 380-residue subunits, has been overexpressed in Escherichia coli with a C-terminal purification tag and crystallized at 297 K using 0.7 M ammonium dihydrogen phosphate, 0.4 M ammonium tartrate, 0.1 M sodium citrate pH 5.6 and 10 mM cupric chloride. X-ray diffraction data were collected to 2.20 A from a crystal grown in the presence of NADH. The crystals belong to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 84.77, b = 101.28, c = 142.58 A. A dimeric molecule is present in the asymmetric unit, giving a crystal volume per protein weight (VM) of 3.64 A3 Da(-1) and a solvent content of 66%.

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Expression, purification and crystallization of a lyssavirus matrix (M) protein

PubMed Central

Assenberg, René; Delmas, Olivier; Graham, Stephen C.; Verma, Anil; Berrow, Nick; Stuart, David I.; Owens, Raymond J.; Bourhy, Hervé; Grimes, Jonathan M.

2008-01-01

The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number of factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6122 or P6522, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress. PMID:18391421

Crystallization and preliminary X-ray analysis of a novel thermoalkalophilic poly(3-hydroxybutyrate) depolymerase (PhaZ7) from Paucimonas lemoignei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapetaniou, Evangelia G.; Braaz, Reinhard; Jendrossek, Dieter

2005-05-01

A novel thermoalkalophilic depolymerase, PhaZ7, from P. lemoignei was crystallized by the microdialysis technique. Crystals belong to space group C2 and diffract to 2.75 Å resolution at a synchrotron source. Polyhydroxyalkanoates (PHA) are biodegradable polyesters that have attracted commercial and academic interest as environmentally friendly materials. A number of enzymes are able to degrade polyhydroxyalkanoates to water-soluble products. PhaZ7 poly(3-hydroxybutyrate) (PHB) depolymerase (EC 3.1.1.75), a 342-amino-acid hydrolase from the PHA-degrading bacterium Paucimonas lemoignei, has been found to possess substrate specificity for amorphous PHA. PhaZ7 was crystallized by the microdialysis method. Thin rod-like crystals were grown in low ionic strength solutionmore » and found to belong to the monoclinic space group C2, with unit-cell parameters a = 225.8, b = 46.5, c = 171.3, β = 128.9°. A complete data set was collected to 2.75 Å resolution at 100 K using synchrotron radiation.« less

Investigation of crystalline morphology in poly (ether ether ketone) using dielectric relaxation spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalika, D.S.; Krishnaswamy, R.K.

1993-12-31

The relaxation behavior of poly (ether ether ketone) [PEEK] has been investigated using dielectric relaxation spectroscopy; the glass-rubber ({alpha}) relaxation and a sub-glass ({beta}) relaxation were examined for the amorphous material and both cold-crystallized and melt-crystallized specimens. Analysis of the data using the Cole-Cole modification of the Debye equation allowed determination of the dielectric relaxation strength and relaxation broadening parameter for both transitions as a function of material crystallization history. The crystallized specimens displayed a positive offset in isochronal loss temperature for both the {alpha} and {beta} relaxations, with the {alpha} relaxation broadened significantly. The measured dipolar response was interpretedmore » using a three-phase morphological model encompassing a crystalline phase, a mobile amorphous phase, and a rigid amorphous phase. Determination of phase fractions based on dipolar mobilization across the glass-rubber relaxation revealed a finite rigid amorphous phase fraction for both the cold-crystallized specimens which was relatively insensitive to thermal history and degree of crystallinity (W{sub RAP}40.20).« less

Intangible pointlike tracers for liquid-crystal-based microsensors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brasselet, Etienne; Juodkazis, Saulius

2010-12-15

We propose an optical detection technique for liquid-crystal-based sensors that is based on polarization-resolved tracking of optical singularities and does not rely on standard observation of light-intensity changes caused by modifications of the liquid crystal orientational ordering. It uses a natural two-dimensional network of polarization singularities embedded in the transverse cross section of a probe beam that passes through a liquid crystal sample, in our case, a nematic droplet held in laser tweezers. The identification and spatial evolution of such a topological fingerprint is retrieved from subwavelength polarization-resolved imaging, and the mechanical constraint exerted on the molecular ordering by themore » trapping beam itself is chosen as the control parameter. By restricting our analysis to one type of point singularity, C points, which correspond to location in space where the polarization azimuth is undefined, we show that polarization singularities appear as intangible pointlike tracers for liquid-crystal-based three-dimensional microsensors. The method has a superresolution potential and can be used to visualize changes at the nanoscale.« less

Work-hardening behaviour of Mg single crystals oriented for basal slip

NASA Astrophysics Data System (ADS)

Bhattacharya, B.; Niewczas, M.

2011-06-01

Work-hardening behaviour of Mg single crystals oriented for basal slip was studied by means of tensile tests carried out at 4, 78 and 295 K. The crystals show critical resolved shear stress values (CRSS) for a {0001} ? basal slip system in the range 1-1.5 MPa. The samples exhibit two-stage work hardening characteristics consisting of a long easy glide stage and a stage of rapid hardening terminated by failure. The onset of the plastic flow up to the point of fracture is accompanied by a low work-hardening rate in the range 5 × 10-5-5 × 10-4 µ, corresponding to the hardening rate in Stage I of copper single crystals. The analysis of thermally activated glide parameters suggests that forest interactions are rate-controlling processes. The very low value of the activation distance found at 4 K, ∼0.047 b, is attributed to zero-point energy effects. The failure of crystals occurs well before their hardening capacity is exhausted by mechanisms which are characteristic of deformation temperature.

The galactoside 2-α-L-fucosyltransferase FUT1 from Arabidopsis thaliana: crystallization and experimental MAD phasing.

PubMed

Rocha, Joana; Cicéron, Félix; Lerouxel, Olivier; Breton, Christelle; de Sanctis, Daniele

2016-07-01

The plant cell wall is a complex network of polysaccharides made up of cellulose, hemicelluloses and pectins. Xyloglucan (XyG), which is the main hemicellulosic component of dicotyledonous plants, has attracted much attention for its role in plant development and for its many industrial applications. The XyG-specific fucosyltransferase (FUT1) adds a fucose residue from GDP-fucose to the 2-O position of the terminal galactosyl residues on XyG side chains. Recombinant FUT1 from Arabidopsis thaliana was crystallized in two different crystal forms, with the best diffracting crystals (up to 1.95 Å resolution) belonging to the monoclinic space group P21, with unit-cell parameters a = 87.6, b = 84.5, c = 150.3 Å, β = 96.3°. Ab initio phases were determined using a two-wavelength anomalous dispersion experiment on a tantalum bromide-derivatized crystal with data collected at the rising and descending inflection points of the Ta white line. An interpretable electron-density map was obtained after elaborate density modification. Model completion and structural analysis are currently under way.

Analysis of spin-Hamiltonian and molecular orbital coefficients of Cu2+ doped C8H11KO8 single crystal through EPR technique

NASA Astrophysics Data System (ADS)

Juliet sheela, K.; Krishnan, S. Radha; Shanmugam, V. M.; Subramanian, P.

2018-04-01

Electron paramagnetic resonance (EPR) studies have been investigated at X-band microwave frequency on Cu2+ ion incorporated into the single crystal of potassium succinate-succinic acid (KSSA) at room temperature. The angular variation of the EPR spectra has shown two magnetically in-equivalent Cu2+ sites in the KSSA single crystal system. The spin Hamiltonian parameters g and A are determined which reveals that the site I and site II occupied in rhombic and axial local field symmetry around the impurity ion. Among the two paramagnetic impurity ions, sites one occupies at substituitional position in the place of monovalent cation (K+) in the crystal whereas the other enters in its lattice interstitially by the correlation of EPR and crystal structure data. From the calculated principle values gxx, gyy, gzz and Axx, Ayy, Azz of both the sites, the admixture coefficients and molecular orbital coefficients were evaluated which gives the information of ground state wave function and types of bonding of impurity ions with the ligands.

Crystallization and preliminary crystallographic analysis of poly(3-hydroxybutyrate) depolymerase from Bacillus thuringiensis.

PubMed

Wang, Yung Lin; Lin, Yi Ting; Chen, Chia Lin; Shaw, Gwo Chyuan; Liaw, Shwu Huey

2014-10-01

Poly[(R)-3-hydroxybutyrate] (PHB) is a microbial biopolymer that has been commercialized as biodegradable plastics. The key enzyme for the degradation is PHB depolymerase (PhaZ). A new intracellular PhaZ from Bacillus thuringiensis (BtPhaZ) has been screened for potential applications in polymer biodegradation. Recombinant BtPhaZ was crystallized using 25% polyethylene glycol 3350, 0.2 M ammonium acetate, 0.1 M bis-tris pH 6.5 at 288 K. The crystals belonged to space group P1, with unit-cell parameters a = 42.97, b = 83.23, c = 85.50 Å, α = 73.45, β = 82.83, γ = 83.49°. An X-ray diffraction data set was collected to 1.42 Å resolution with an Rmerge of 6.4%. Unexpectedly, a molecular-replacement solution was obtained using the crystal structure of Streptomyces lividans chloroperoxidase as a template, which shares 24% sequence identity to BtPhaZ. This is the first crystal structure of an intracellular poly(3-hydroxybutyrate) depolymerase.

Crystal structure, vibrational and DFT simulation studies of melaminium dihydrogen phosphite monohydrate

NASA Astrophysics Data System (ADS)

Arjunan, V.; Kalaivani, M.; Marchewka, M. K.; Mohan, S.

2013-08-01

The crystal structure investigations of melamine with phosphorous acid, namely melaminium dihydrogenphosphite monohydrate (C3N6H7·H2PO3·H2O) have been investigated by means of single crystal X-ray diffraction method. The title compound crystallizes in monoclinic crystal system, and the space group is P21/c with a = 10.069 Å, b = 21.592 Å, c = 12.409 Å and Z = 12. The vibrational assignments and analysis of melaminium dihydrogen phosphite monohydrate have also been performed by FTIR, FT-Raman and far-infrared spectral studies. The quantum chemical simulations were performed with DFT (B3LYP) method using 6-31G**, cc-pVTZ, and 6-311++G** basis sets to determine the energy, structural, thermodynamic parameters and vibrational frequencies of melaminium dihydrogen phosphite monohydrate. The hydrogen atom from phosphorous acid was transferred to the melamine molecule giving the singly protonated melaminium cation. The ability of ions to form spontaneous three-dimensional structure through weak Osbnd H···O and Nsbnd H···O hydrogen bonds shows notable vibrational effects.

Effect of Multiple Alloying Elements on the Glass-Forming Ability, Thermal Stability, and Crystallization Behavior of Zr-Based Alloys

NASA Astrophysics Data System (ADS)

Bazlov, A. I.; Tsarkov, A. A.; Ketov, S. V.; Suryanarayana, C.; Louzguine-Luzgin, D. V.

2018-02-01

Effect of multiple alloying elements on the glass-forming ability, thermal stability, and crystallization behavior of Zr-based glass-forming alloys were studied in the present work. We investigated the effect of complete or partial substitution of Ti and Ni with similar early and late transition metals, respectively, on the glass-forming ability and crystallization behavior of the Zr50Ti10Cu20Ni10Al10 alloy. Poor correlation was observed between different parameters indicating the glass-forming ability and the critical size of the obtained glassy samples. Importance of the width of the crystallization interval is emphasized. The kinetics of primary crystallization, i.e., the rate of nucleation and rate of growth of the nuclei of primary crystals is very different from that of the eutectic alloys. Thus, it is difficult to estimate the glass-forming ability only on the basis of the empirical parameters not taking into account the crystallization behavior and the crystallization interval.

Synthesis, characterization, AIM and NBO analysis of HMX/DMI cocrystal explosive

NASA Astrophysics Data System (ADS)

Lin, He; Zhu, Shun-Guan; Li, Hong-Zhen; Peng, Xin-Hua

2013-09-01

1,3,5,7-Tetranitro-1,3,5,7-tetrazacyclooctane (HMX)/1,3-dimethyl-2-imidazolidinone (DMI) cocrystal explosive was synthesized and characterized by using X-ray single crystal diffraction. HMX/DMI cocrystal crystallizes in the monoclinic system (space group Cm), with cell parameters a = 7.231(2)Å, b = 14.739(2)Å, c = 7.552(1)Å, β = 96.66°. In addition, density functional theory, involving binding energy, natural bond orbital (NBO) analysis, atoms in molecule (AIM) analysis, band structure, and density of states, was adopted to investigate intermolecular interactions for the formation of HMX/DMI cocrystal. The results show that hydrogen bondings between methylene groups of HMX molecules and O atoms of DMI molecules are the main intermolecular interactions. This research provides the basis for further design of cocrystal explosives, which are composed of HMX and energetic materials.

Synthesis, crystal structures, computational studies and antimicrobial activity of new designed bis((5-aryl-1,3,4-oxadiazol-2-yl)thio)alkanes

NASA Astrophysics Data System (ADS)

Ahmed, Muhammad Naeem; Sadiq, Beenish; Al-Masoudi, Najim A.; Yasin, Khawaja Ansar; Hameed, Shahid; Mahmood, Tariq; Ayub, Khurshid; Tahir, Muhammad Nawaz

2018-03-01

A new series of bis((5-aryl-1,3,4-oxadiazol-2-yl)thio)alkanes 4-14 have been synthesized via nucleophilic substitution reaction of dihaloalkanes with respective 1,3,4-oxadiazole-2-thiols 3a-f, and characterized by spectroscopic techniques. The structures of 4 and 12 were unambiguously confirmed by single-crystal X-ray diffraction analysis. Density functional theory calculations at B3LYP/6-31 + G(d) level of theory were performed for comparison of X-ray geometric parameters, molecular electrostatic potential (MEP) and frontier molecular orbital analyses of synthesized compounds. MEP analysis revealed that these compounds are nucleophilic in nature. Frontier molecular orbitals (FMOs) analysis of 4-14 was performed for evaluation of kinetic stability. All synthesized compounds were screened in vitro for antimicrobial activity against three bacterial and three fungal strains and showed promising results.

Thermal analysis of Bridgman-Stockbarger growth. [mercury cadmium telluride single crystals

NASA Technical Reports Server (NTRS)

Knopf, F. W.

1979-01-01

A thermal analysis of a cylindrical HgCdTe sample in a Bridgman-Stockbarger crystal growth configuration was conducted with emphasis on the thermal profile, interface shape and position, and the thermal gradients at the liquid-solid interface. Alloys of HgTe and CdTe with compositions approximating 20 percent CdTe, 80 percent HgTe were used. This composition results in a bandgap suited for the detection of 10.6 micron CO2 radiation. The sensitivity of the sample thermal characteristics to important growth parameters, such as thermal diffusivities, thermal conductivities, furnace temperature profile, ampoule dimensions, and growth velocity was assessed. Numerical techniques and associated computational models necessary to analyze the heat transfer process within the sample and the Bridgman-Stockbarger boundary conditions were developed. This thermal analysis mode was programmed in FORTRAN V, and is currently operational on the MSFC Univac 1100 system.

Use of a torsional pendulum as a high-pressure gage and determination of viscosity of helium gas at high pressures

NASA Technical Reports Server (NTRS)

Maisel, J. E.; Webeler, R. W. H.; Grimes, H. H.

1973-01-01

Three torsional crystal parameters were examined for suitability in sensing pressure in gases up to 131 million newtons per square meter. The best parameters were found to be the change in crystal decrement at resonance and the change in crystal electrical resistance at resonance. The change in crystal resonant frequency did not appear to be a reliable pressure measuring parameter. Pure argon and pure helium gases were studied for use as working fluids. Helium functioned better over a wider pressure range. Calibration of the gage also provided a measure of the viscosity-density product of the gas as a function of pressure. These data, together with known extrapolated density data, permitted the determination of the viscosity of helium to 131 million N/square meter.

X-ray diffraction, vibrational and quantum chemical investigations of 2-methyl-4-nitroanilinium trichloroacetate trichloroacetic acid

NASA Astrophysics Data System (ADS)

Arjunan, V.; Marchewka, Mariusz K.; Pietraszko, A.; Kalaivani, M.

2012-11-01

The structural investigations of the molecular complex of 2-methyl-4-nitroaniline with trichloroacetic acid, namely 2-methyl-4-nitroanilinium trichloroacetate trichloroacetic acid (C11H10Cl6N2O6) have been performed by means of single crystal and powder X-ray diffraction method. The complex was formed with accompanying proton transfer from trichloroacetic acid molecule to 2-methyl-4-nitroaniline. The studied crystal is built up of singly protonated 2-methyl-4-nitroanilinium cations, trichloroacetate anions and neutral trichloroacetic acid molecules. The crystals are monoclinic, space group P21/c, with a = 14.947 Å, b = 6.432 Å, c = 19.609 Å and Z = 4. The vibrational assignments and analysis of 2-methyl-4-nitroanilinium trichloroacetate trichloroacetic acid have also been performed by FTIR, FT-Raman and far-infrared spectral studies. More support on the experimental findings were added from the quantum chemical studies performed with DFT (B3LYP) method using 6-31G**, cc-pVDZ, 6-31G and 6-31++G basis sets. The structural parameters, energies, thermodynamic parameters and the NBO charges of 2M4NATCA were also determined by the DFT methods.

Single crystal EPR, optical absorption and superposition model study of Cr3+ doped ammonium dihydrogen phosphate.

PubMed

Kripal, Ram; Pandey, Sangita

2010-06-01

The electron paramagnetic resonance (EPR) studies are carried out on Cr(3+) ion doped ammonium dihydrogen phosphate (ADP) single crystals at room temperature. Four magnetically inequivalent sites for chromium are observed. No hyperfine structure is obtained. The crystal-field and spin Hamiltonian parameters are calculated from the resonance lines obtained at different angular rotations. The zero field and spin Hamiltonian parameters of Cr(3+) ion in ADP are calculated as: |D|=(257+/-2) x 10(-4) cm(-1), |E|=(79+/-2) x 10(-4) cm(-1), g=1.9724+/-0.0002 for site I; |D|=(257+/-2) x 10(-4) cm(-1), |E|=(77+/-2) x 10(-4) cm(-1), g=1.9727+/-0.0002 for site II; |D|=(259+/-2) x 10(-4) cm(-1), |E|=(78+/-2) x 10(-4) cm(-1), g=1.9733+/-0.0002 for site III; |D|=(259+/-2) x 10(-4) cm(-1), |E|=(77+/-2) x 10(-4) cm(-1), g=1.973+/-0.0002 for site IV, respectively. The site symmetry of Cr(3+) doped single crystal is discussed on the basis of EPR data. The Cr(3+) ion enters the lattice substitutionally replacing the NH(4)(+) sites. The optical absorption spectra are recorded in 195-925 nm wavelength range at room temperature. The energy values of different orbital levels are determined. On the basis of EPR and optical data, the nature of bonding in the crystal is discussed. The calculated values of Racah interelectronic repulsion parameters (B and C), cubic crystal-field splitting parameter (D(q)) and nephelauxetic parameters (h and k) are: B=640, C=3070, D(q)=2067 cm(-1), h=1.44 and k=0.21, respectively. ZFS parameters are also determined using B(kq) parameters from superposition model. Copyright 2010 Elsevier B.V. All rights reserved.

Synthesis, growth, structural, optical, spectral, thermal and mechanical studies of 4-methoxy 4-nitrostilbene (MONS): a new organic nonlinear optical single crystal.

PubMed

Dinakaran, Paul M; Bhagavannarayana, G; Kalainathan, S

2012-11-01

4-Methoxy 4-nitrostilbene (MONS), a new organic nonlinear optical material has been synthesized. Based on the solubility data good quality single crystal with dimensions up to 38×11×3 mm(3) has been grown by slow evaporation method using ethyl methyl ketone (MEK) as a solvent. Powder XRD confirms the crystalline property and also the diffraction planes have been indexed. The lattice parameters for the grown MONS crystals were determined by using single crystal X-ray diffraction analysis and it reveals that the crystal lattice system is triclinic. The crystalline perfection of the grown crystals has been analysed by high resolution X-ray diffraction (HRXRD) rocking curve measurements. Fourier transform infrared (FTIR) spectrum for powdered MONS sample confirms the functional groups present in the grown crystal. The UV-vis absorption spectrum has been recorded in the range of 190-1100 nm and the cut off wavelength 499 nm has been determined. The optical constants of MONS have been determined through UV-vis-NIR spectroscopy. The MONS crystals were further subjected to other characterizations. i.e., (1)H NMR, TG/DTA, photoluminescence and microhardness test. The Kurtz and Perry powder technique confirms the NLO property of the grown crystal and the SHG efficiency of MONS was found to be 1.55× greater than that of KDP crystal. Copyright © 2012 Elsevier B.V. All rights reserved.

In situ 3D topographic and shape analysis by synchrotron radiation X-ray microtomography for crystal form identification in polymorphic mixtures

PubMed Central

Yin, Xian-Zhen; Xiao, Ti-Qiao; Nangia, Ashwini; Yang, Shuo; Lu, Xiao-Long; Li, Hai-Yan; Shao, Qun; He, You; York, Peter; Zhang, Ji-Wen

2016-01-01

Polymorphism denotes the existence of more than one crystal structure of a substance, and great practical and theoretical interest for the chemical and pharmaceutical industries. In many cases, it is challenging to produce a pure crystal form and establish a sensitive detection method for the identification of crystal form in a mixture of polymorphs. In this study, an accurate and sensitive method based on synchrotron radiation X-ray computed microtomography (SR-μCT) was devised to identify the polymorphs of clopidogrel bisulphate (CLP). After 3D reconstruction, crystal particles were extracted and dozens of structural parameters were calculated. Whilst, the particle shapes of the two crystal forms were all irregular, the surface of CLP II was found to be rougher than CLP I. In order to classify the crystal form based on the quantitative morphological property of particles, Volume Bias Percentage based on Surface Smoothing (VBP) was defined and a new method based on VBP was successfully developed, with a total matching rate of 99.91% for 4544 particles and a lowest detectable limit of 1%. More important for the mixtures in solid pharmaceutical formulations, the interference of excipients can be avoided, a feature cannot achieved by other available analytical methods. PMID:27097672

Purification, crystallization and preliminary X-ray diffraction analysis of the carbohydrate-binding region of the Streptococcus gordonii adhesin GspB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.

2012-07-11

The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} formore » crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.« less

Cloning, expression, purification, crystallization and X-ray crystallographic analysis of CofB, the minor pilin subunit of CFA/III from human enterotoxigenic Escherichia coli.

PubMed

Kawahara, Kazuki; Oki, Hiroya; Fukakusa, Shunsuke; Maruno, Takahiro; Kobayashi, Yuji; Motooka, Daisuke; Taniguchi, Tooru; Honda, Takeshi; Iida, Tetsuya; Nakamura, Shota; Ohkubo, Tadayasu

2015-06-01

Colonization factor antigen III (CFA/III) is one of the virulence factors of human enterotoxigenic Escherichia coli (ETEC) that forms the long, thin, proteinaceous fibres of type IV pili through assembly of its major and minor subunits CofA and CofB, respectively. The crystal structure of CofA has recently been reported; however, the lack of structural information for CofB, the largest among the known type IV pilin subunits, hampers a comprehensive understanding of CFA/III pili. In this study, constructs of wild-type CofB with an N-terminal truncation and the corresponding SeMet derivative were cloned, expressed, purified and crystallized. The crystals belonged to the rhombohedral space group R32, with unit-cell parameters a = b = 103.97, c = 364.57 Å for the wild-type construct and a = b = 103.47, c = 362.08 Å for the SeMet-derivatized form. Although the diffraction quality of these crystals was initially very poor, dehydration of the crystals substantially improved the resolution limit from ∼ 4.0 to ∼ 2.0 Å. The initial phase was solved by the single-wavelength anomalous dispersion (SAD) method using a dehydrated SeMet CofB crystal, which resulted in an interpretable electron-density map.

Influence of precipitating agents on thermodynamic parameters of protein crystallization solutions.

PubMed

Stavros, Philemon; Saridakis, Emmanuel; Nounesis, George

2016-09-01

X-ray crystallography is the most powerful method for determining three-dimensional structures of proteins to (near-)atomic resolution, but protein crystallization is a poorly explained and often intractable phenomenon. Differential Scanning Calorimetry was used to measure the thermodynamic parameters (ΔG, ΔH, ΔS) of temperature-driven unfolding of two globular proteins, lysozyme, and ribonuclease A, in various salt solutions. The mixtures were categorized into those that were conducive to crystallization of the protein and those that were not. It was found that even fairly low salt concentrations had very large effects on thermodynamic parameters. High concentrations of salts conducive to crystallization stabilized the native folded forms of proteins, whereas high concentrations of salts that did not crystallize them tended to destabilize them. Considering the ΔH and TΔS contributions to the ΔG of unfolding separately, high concentrations of crystallizing salts were found to enthalpically stabilize and entropically destabilize the protein, and vice-versa for the noncrystallizing salts. These observations suggest an explanation, in terms of protein stability and entropy of hydration, of why some salts are good crystallization agents for a given protein and others are not. This in turn provides theoretical insight into the process of protein crystallization, suggesting ways of predicting and controlling it. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 642-652, 2016. © 2016 Wiley Periodicals, Inc.

Preliminary X-ray crystallographic analysis of glutathione transferase zeta 1 (GSTZ1a-1a)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boone, Christopher D.; Zhong, Guo; Smeltz, Marci

2014-01-21

Crystals of glutathione transferase zeta 1 were grown and shown to diffract X-rays to 3.1 Å resolution. They belonged to space group P1, with unit-cell parameters a = 42.0, b = 49.6, c = 54.6 Å, α = 82.9, β = 69.9, γ = 73.4°.

Preliminary X-ray analysis of twinned crystals of the Q88Y25_Lacpl esterase from Lactobacillus plantarum WCFS1

PubMed Central

Álvarez, Yanaisis; Esteban-Torres, María; Acebrón, Iván; de las Rivas, Blanca; Muñoz, Rosario; Martínez-Ripoll, Martín; Mancheño, José M.

2011-01-01

Q88Y25_Lacpl is an esterase produced by the lactic acid bacterium Lactobacillus plantarum WCFS1 that shows amino-acid sequence similarity to carboxyl­esterases from the hormone-sensitive lipase family, in particular the AFEST esterase from the archaeon Archaeoglobus fulgidus and the hyperthermophilic esterase EstEI isolated from a metagenomic library. N-­terminally His6-tagged Q88Y25_Lacpl has been overexpressed in Escherichia coli BL21 (DE3) cells, purified and crystallized at 291 K using the hanging-drop vapour-diffusion method. Mass spectrometry was used to determine the purity and homogeneity of the enzyme. Crystals of His6-tagged Q88Y25_Lacpl were prepared in a solution containing 2.8 M sodium acetate trihydrate pH 7.0. X-ray diffraction data were collected to 2.24 Å resolution on beamline ID29 at the ESRF. The apparent crystal point group was 422; however, initial global analysis of the intensity statistics (data processed with high symmetry in space group I422) and subsequent tests on data processed with low symmetry (space group I4) showed that the crystals were almost perfectly merohedrally twinned. Most probably, the true space group is I4, with unit-cell parameters a = 169.05, b = 169.05, c = 183.62 Å. PMID:22102251

Crystallization, X-ray diffraction analysis and phasing of 17β-hydroxysteroid dehydrogenase from the fungus Cochliobolus lunatus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cassetta, Alberto, E-mail: alberto.cassetta@ic.cnr.it; Büdefeld, Tomaž; Lanišnik Rižner, Tea

2005-12-01

The expression, purification and crystallization of 17β-hydroxysteroid dehydrogenase from the filamentous fungus C. lunatus and its Y167F mutant, both in the apo form, are described. X-ray diffraction analysis and phasing by Patterson-search techniques are reported. 17β-Hydroxysteroid dehydrogenase from the filamentous fungus Cochliobolus lunatus (17β-HSDcl) is an NADP(H)-dependent enzyme that preferentially catalyses the oxidoreduction of oestrogens and androgens. The enzyme belongs to the short-chain dehydrogenase/reductase superfamily and is the only fungal hydroxysteroid dehydrogenase known to date. 17β-HSDcl has recently been characterized and cloned and has been the subject of several functional studies. Although several hypotheses on the physiological role of 17β-HSDclmore » in fungal metabolism have been formulated, its function is still unclear. An X-ray crystallographic study has been undertaken and the optimal conditions for crystallization of 17β-HSDcl (apo form) were established, resulting in well shaped crystals that diffracted to 1.7 Å resolution. The space group was identified as I4{sub 1}22, with unit-cell parameters a = b = 67.14, c = 266.77 Å. Phasing was successfully performed by Patterson search techniques. A catalytic inactive mutant Tyr167Phe was also engineered, expressed, purified and crystallized for functional and structural studies.« less

Thermoelectric properties of nanocrystalline Sb2Te3 thin films: experimental evaluation and first-principles calculation, addressing effect of crystal grain size.

PubMed

Morikawa, Satoshi; Inamoto, Takuya; Takashiri, Masayuki

2018-02-16

The effect of crystal grain size on the thermoelectric properties of nanocrystalline antimony telluride (Sb 2 Te 3 ) thin films was investigated by experiments and first-principles studies using a developed relaxation time approximation. The Sb 2 Te 3 thin films were deposited on glass substrates using radio-frequency magnetron sputtering. To change the crystal grain size of the Sb 2 Te 3 thin films, thermal annealing was performed at different temperatures. The crystal grain size, lattice parameter, and crystal orientation of the thin films were estimated using XRD patterns. The carrier concentration and in-plane thermoelectric properties of the thin films were measured at room temperature. A theoretical analysis was performed using a first-principles study based on density functional theory. The electronic band structures of Sb 2 Te 3 were calculated using different lattice parameters, and the thermoelectric properties were predicted based on the semi-classical Boltzmann transport equation in the relaxation time approximation. In particular, we introduced the effect of carrier scattering at the grain boundaries into the relaxation time approximation by estimating the group velocities from the electronic band structures. Finally, the experimentally measured thermoelectric properties were compared with those obtained by calculation. As a result, the calculated thermoelectric properties were found to be in good agreement with the experimental results. Therefore, we can conclude that introducing the effect of carrier scattering at the grain boundaries into the relaxation time approximation contributes to enhance the accuracy of a first-principles calculation relating to nanocrystalline materials.

Thermoelectric properties of nanocrystalline Sb2Te3 thin films: experimental evaluation and first-principles calculation, addressing effect of crystal grain size

NASA Astrophysics Data System (ADS)

Morikawa, Satoshi; Inamoto, Takuya; Takashiri, Masayuki

2018-02-01

The effect of crystal grain size on the thermoelectric properties of nanocrystalline antimony telluride (Sb2Te3) thin films was investigated by experiments and first-principles studies using a developed relaxation time approximation. The Sb2Te3 thin films were deposited on glass substrates using radio-frequency magnetron sputtering. To change the crystal grain size of the Sb2Te3 thin films, thermal annealing was performed at different temperatures. The crystal grain size, lattice parameter, and crystal orientation of the thin films were estimated using XRD patterns. The carrier concentration and in-plane thermoelectric properties of the thin films were measured at room temperature. A theoretical analysis was performed using a first-principles study based on density functional theory. The electronic band structures of Sb2Te3 were calculated using different lattice parameters, and the thermoelectric properties were predicted based on the semi-classical Boltzmann transport equation in the relaxation time approximation. In particular, we introduced the effect of carrier scattering at the grain boundaries into the relaxation time approximation by estimating the group velocities from the electronic band structures. Finally, the experimentally measured thermoelectric properties were compared with those obtained by calculation. As a result, the calculated thermoelectric properties were found to be in good agreement with the experimental results. Therefore, we can conclude that introducing the effect of carrier scattering at the grain boundaries into the relaxation time approximation contributes to enhance the accuracy of a first-principles calculation relating to nanocrystalline materials.

Intrinsically incompatible crystal (ligand) field parameter sets for transition ions at orthorhombic and lower symmetry sites in crystals and their implications

NASA Astrophysics Data System (ADS)

Rudowicz, C.; Gnutek, P.

2010-01-01

Central quantities in spectroscopy and magnetism of transition ions in crystals are crystal (ligand) field parameters (CFPs). For orthorhombic, monoclinic, and triclinic site symmetry CF analysis is prone to misinterpretations due to large number of CFPs and existence of correlated sets of alternative CFPs. In this review, we elucidate the intrinsic features of orthorhombic and lower symmetry CFPs and their implications. The alternative CFP sets, which yield identical energy levels, belong to different regions of CF parameter space and hence are intrinsically incompatible. Only their ‘images’ representing CFP sets expressed in the same region of CF parameter space may be directly compared. Implications of these features for fitting procedures and meaning of fitted CFPs are categorized into negative: pitfalls and positive: blessings. As a case study, the CFP sets for Tm 3+ ions in KLu(WO 4) 2 are analysed and shown to be intrinsically incompatible. Inadvertent, so meaningless, comparisons of incompatible CFP sets result in various pitfalls, e.g., controversial claims about the values of CFPs obtained by other researchers as well as incorrect structural conclusions or faulty systematics of CF parameters across rare-earth ion series based on relative magnitudes of incompatible CFPs. Such pitfalls bear on interpretation of, e.g., optical spectroscopy, inelastic neutron scattering, and magnetic susceptibility data. An extensive survey of pertinent literature was carried out to assess recognition of compatibility problems. Great portion of available orthorhombic and lower symmetry CFP sets are found intrinsically incompatible, yet these problems and their implications appear barely recognized. The considerable extent and consequences of pitfalls revealed by our survey call for concerted remedial actions of researchers. A general approach based on the rhombicity ratio standardization may solve compatibility problems. Wider utilization of alternative CFP sets in the multiple correlated fitting techniques may improve reliability ( blessing) of fitted CFPs. This review may be of interest to a broad range of researchers from condensed matter physicists to physical chemists working on, e.g., high temperature superconductors, luminescent, optoelectronic, laser, and magnetic materials.

Bayes-Turchin analysis of x-ray absorption data above the Fe L{sub 2,3}-edges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rossner, H. H.; Schmitz, D.; Imperia, P.

2006-10-01

Extended x-ray absorption fine structure (EXAFS) data and magnetic EXAFS (MEXAFS) data were measured at two temperatures (180 and 296 K) in the energy region of the overlapping L-edges of bcc Fe grown on a V(110) crystal surface. In combination with a Bayes-Turchin data analysis procedure these measurements enable the exploration of local crystallographic and magnetic structures. The analysis determined the atomic-like background together with the EXAFS parameters which consisted of ten shell radii, the Debye-Waller parameters, separated into structural and vibrational components, and the third cumulant of the first scattering path. The vibrational components for 97 different scattering pathsmore » were determined by a two parameter force-field model using a priori values adjusted to Born-von Karman parameters of inelastic neutron scattering data. The investigations of the system Fe/V(110) demonstrate that the simultaneous fitting of atomic background parameters and EXAFS parameters can be performed reliably. Using the L{sub 2}- and L{sub 3}-components extracted from the EXAFS analysis and the rigid-band model, the MEXAFS oscillations can only be described when the sign of the exchange energy is changed compared to the predictions of the Hedin Lundquist exchange and correlation functional.« less

Crystallization of beef heart cytochrome c oxidase

NASA Astrophysics Data System (ADS)

Yoshikawa, Shinya; Shinzawa, Kyoko; Tsukihara, Tomitake; Abe, Toshio; Caughey, Winslow S.

1991-03-01

The three-dimensional structure of cytochrome c oxidase, a complex (multimetal, multisubunit) membrane protein is critical to elucidation of the mechanism of the enzymic reactions and their control. Our recent developments in the crystallization of the enzyme isolated from beef hearts are presented. The crystals appeared more readily at higher protein concentration, lower ionic strength, higher detergent concentration (Brij-35) and lower temperature. Large crystals were obtained by changing one of these parameters to the crystallization point as slowly as possible, keeping the other parameters constant. Increasing the detergent concentration was the most successful method, producing green crystals of the resting oxidized form as hexagonal bipyramids with typical dimensions of 0.6 mm. The usual procedures for crystallization of water soluble proteins, such as increasing ionic strength by vapor diffusion, were not applicable for this enzyme. Crystals of the resting oxidized enzyme belong to a space group of P6 2 or P6 4 with cell dimensions, a = b = 208.7 Å and c = 282.3 Å. The Patterson function shows that the crystal exhibited a non-crystallographic two-fold axis parallel to the c-axis in the asymmetric unit.

Effect of real-world sounds on protein crystallization.

PubMed

Zhang, Chen-Yan; Liu, Yue; Tian, Xu-Hua; Liu, Wen-Jing; Li, Xiao-Yu; Yang, Li-Xue; Jiang, Han-Jun; Han, Chong; Chen, Ke-An; Yin, Da-Chuan

2018-06-01

Protein crystallization is sensitive to the environment, while audible sound, as a physical and environmental factor during the entire process, is always ignored. We have previously reported that protein crystallization can be affected by a computer-generated monotonous sound with fixed frequency and amplitude. However, real-world sounds are not so simple but are complicated by parameters (frequency, amplitude, timbre, etc.) that vary over time. In this work, from three sound categories (music, speech, and environmental sound), we selected 26 different sounds and evaluated their effects on protein crystallization. The correlation between the sound parameters and the crystallization success rate was studied mathematically. The results showed that the real-world sounds, similar to the artificial monotonous sounds, could not only affect protein crystallization, but also improve crystal quality. Crystallization was dependent not only on the frequency, amplitude, volume, irradiation time, and overall energy of the sounds but also on their spectral characteristics. Based on these results, we suggest that intentionally applying environmental sound may be a simple and useful tool to promote protein crystallization. Copyright © 2018. Published by Elsevier B.V.

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of a resuscitation-promoting factor from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruggiero, Alessia; Tizzano, Barbara; Geerlof, Arie

2007-10-01

The first crystallization of a resuscitation-promoting factor has been performed. Multiwavelength anomalous dispersion experiments have been carried out to obtain experimental phases using data at 2.9 Å resolution from a selenomethionine derivative. The resuscitation-promoting factor RpfB, the most complex of the five resuscitation-promoting factors produced by M. tuberculosis, is devoted to bacterial reactivation from the dormant state. RpfB consists of 362 residues predicted to form five domains. An RpfB fragment containing the protein catalytic domain and a G5 domain has been successfully crystallized using vapour-diffusion methods. This is the first crystallographic study of a resuscitation-promoting factor. Crystals of this proteinmore » belong to space group I422, with unit-cell parameters a = 97.63, b = 97.63, c = 114.87 Å. Diffraction data have also been collected from a selenomethionine derivative at 2.9 Å resolution. Model building using the phases derived from the multiwavelength anomalous dispersion experiment is in progress.« less

Purification, crystallization and preliminary X-ray analysis of the glucosamine-6-phosphate N-acetyltransferase from human liver

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Juan; Zhou, Yan-Feng; Li, Lan-Fen

2006-11-01

Glucosamine-6-phosphate N-acetyltransferase from human liver was expressed, purified and crystallized. Diffraction data have been collected to 2.6 Å resolution. Glucosamine-6-phosphate N-acetyltransferase from human liver, which catalyzes the transfer of an acetyl group from acetyl coenzyme A (AcCoA) to the primary amine of d-glucosamine 6-phosphate to form N-acetyl-d-glucosamine 6-phosphate, was expressed in a soluble form from Escherichia coli strain BL21 (DE3). The protein was purified to homogeneity using Ni{sup 2+}-chelating chromatography followed by size-exclusion chromatography. Crystals of the protein were obtained by the hanging-drop vapour-diffusion method and diffracted to 2.6 Å resolution. The crystals belonged to space group P4{sub 1}2{sub 1}2more » or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 50.08, c = 142.88 Å.« less