Crystallization and crystal manipulation of a steric chaperone in complex with its lipase substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pauwels, Kris, E-mail: krpauwel@vub.ac.be; Loris, Remy; Vandenbussche, Guy

2005-08-01

Crystals of the lipase of B. glumae in complex with its specific foldase were obtained in two forms. Crystallization, crystal manipulation and preliminary X-ray diffraction analysis are described. Bacterial lipases that are secreted via the type II secretion pathway require a lipase-specific foldase in order to obtain their native and biologically active conformation in the periplasmic space. The lipase–foldase complex from Burkholderia glumae (319 and 333 residues, respectively) was crystallized in two crystal forms. One crystal form belongs to space group P3{sub 1}21 (P3{sub 2}21), with unit-cell parameters a = b = 122.3, c = 98.2 Å. A procedure ismore » presented which improved the diffraction of these crystals from ∼5 to 2.95 Å. For the second crystal form, which belonged to space group C2 with unit-cell parameters a = 183.0, b = 75.7, c = 116.6 Å, X-ray data were collected to 1.85 Å.« less

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

Cloning, expression, purification, crystallization and preliminary X-ray characterization of the full-length single-stranded DNA-binding protein from the hyperthermophilic bacterium Aquifex aeolicus.

PubMed

Clarke, David J; Northey, Christopher G; Mack, Lynsey A; McNae, Iain W; Alexeev, Dmitriy; Sawyer, Lindsay; Campopiano, Dominic J

2004-11-01

Single-stranded DNA-binding (SSB) proteins stabilize single-stranded DNA, which is exposed by separation of the duplex during DNA replication, recombination and repair. The SSB protein from the hyperthermophile Aquifex aeolicus has been overexpressed in Escherichia coli, purified and characterized and crystals of the full-length protein (147 amino acids; M(r) 17 131.20) have been grown by vapour diffusion from ammonium sulfate pH 7.5 in both the absence and presence of ssDNA [dT(pT)(68)]. All crystals diffract to around 2.9 A resolution and those without bound DNA (native) belong to space group P2(1), with two tetramers in the asymmetric unit and unit-cell parameters a = 80.97, b = 73.40, c = 109.76 A, beta = 95.11 degrees . Crystals containing DNA have unit-cell parameters a = 108.65, b = 108.51, c = 113.24 A and could belong to three closely related space groups (I222, I2(1)2(1)2(1) or I4(1)) with one tetramer in the asymmetric unit. Electrospray mass spectrometry of the crystals confirmed that the protein was intact. Molecular replacement with a truncated E. coli SSB structure has revealed the position of the molecules in the unit cell and refinement of both native and DNA-bound forms is under way.

Polymorphism of Alprazolam (Xanax): a review of its crystalline phases and identification, crystallographic characterization, and crystal structure of a new polymorph (form III).

PubMed

de Armas, Héctor Novoa; Peeters, Oswald M; Van den Mooter, Guy; Blaton, Norbert

2007-05-01

A new polymorphic form of Alprazolam (Xanax), 8-chloro-1-methyl-6-phenyl-4H-[1,2,4]triazolo-[4,3-alpha][1,4]benzodiazepine, C(17)H(13)ClN(4), has been investigated by means of X-ray powder diffraction (XRPD), single crystal X-ray diffraction, and differential scanning calorimetry (DSC). This polymorphic form (form III) was obtained during DSC experiments after the exothermic recrystallization of the melt of form I. The crystal unit cell dimensions for form III were determined from diffractometer methods. The monoclinic unit cell found for this polymorph using XRPD after indexing the powder diffractogram was confirmed by the cell parameters obtained from single crystal X-ray diffractometry on a crystal isolated from the DSC pans. The single crystal unit cell parameters are: a = 28.929(9), b = 13.844(8), c = 7.361(3) angstroms, beta = 92.82(3) degrees , V = 2944(2) angstroms(3), Z = 8, space group P2(1) (No.4), Dx = 1.393 Mg/m(3). The structure obtained from single crystal X-ray diffraction was used as initial model for Rietveld refinement on the powder diffraction data of form III. The temperature phase transformations of alprazolam were also studied using high temperature XRPD. A review of the different phases available in the Powder Diffraction File (PDF) database for this drug is described bringing some clarification and corrections. (c) 2007 Wiley-Liss, Inc. and the American Pharmacists Association.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

Measurement and Interpretation of Diffuse Scattering in X-Ray Diffraction for Macromolecular Crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wall, Michael E.

X-ray diffraction from macromolecular crystals includes both sharply peaked Bragg reflections and diffuse intensity between the peaks. The information in Bragg scattering reflects the mean electron density in the unit cells of the crystal. The diffuse scattering arises from correlations in the variations of electron density that may occur from one unit cell to another, and therefore contains information about collective motions in proteins.

Crystallization and preliminary X-ray diffraction analysis of the arginine repressor of the hyperthermophile Thermotoga neapolitana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Massant, Jan, E-mail: jan.massant@vub.ac.be; Peeters, Eveline; Charlier, Daniel

2006-01-01

The arginine repressor of the hyperthermophile T. neapolitana was crystallized with and without its corepressor arginine. Both crystals diffracted to high resolution and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with similar unit-cell parameters. The arginine repressor of Thermotoga neapolitana (ArgRTnp) is a member of the family of multifunctional bacterial arginine repressors involved in the regulation of arginine metabolism. This hyperthermophilic repressor shows unique DNA-binding features that distinguish it from its homologues. ArgRTnp exists as a homotrimeric protein that assembles into hexamers at higher protein concentrations and/or in the presence of arginine. ArgRTnp was crystallized with andmore » without its corepressor arginine using the hanging-drop vapour-diffusion method. Crystals of the aporepressor diffracted to a resolution of 2.1 Å and belong to the orthorhombic P2{sub 1}2{sub 1}2{sub 1} space group, with unit-cell parameters a = 117.73, b = 134.15, c = 139.31 Å. Crystals of the repressor in the presence of its corepressor arginine diffracted to a resolution of 2.4 Å and belong to the same space group, with similar unit-cell parameters.« less

Influence of Crystal Expansion/Contraction on Zeolite Membrane Permeation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sorenson, Stephanie G; Payzant, E Andrew; Noble, Richard D

X-ray diffraction was used to measure the unit cell parameters of B-ZSM-5, SAPO-34, and NaA zeolite powders as a function of adsorbate loading at 303 K, and in one case, at elevated temperatures. Most adsorbates expanded the zeolite crystals below saturation loading at 303 K: n-hexane and SF6 in B-ZSM-5, methanol and CO2 in SAPO-34, and methanol in NaA zeolite. As the loadings increased, the crystals expanded more. Changes in the unit cell volumes of B-ZSM-5 and SAPO-34 zeolite powders correlated with changes in permeation through zeolite membranes defects. When the zeolite crystals expanded or contracted upon adsorption, the defectmore » sizes decreased or increased. In B-ZSM-5 membranes, the fluxes through defects decreased dramatically when n-hexane or SF6 adsorbed. In contrast, i-butane adsorption at 303 K contracted B-ZSM-5 crystals at low loadings and expanded them at higher loadings. Correspondingly, the flux through B-ZSM-5 membrane defects increased at low i-butane loadings and decreased at high loading because the defects increased in size at low loading and decreased at high loadings. At 398 K and 473 K, n-hexane expanded the B-ZSM-5 unit cell more as the temperature increased from 303 to 473 K. The silicalite-1 and B-ZSM-5 unit cell volumes expanded similarly upon n-hexane adsorption at 303 K; boron substitution had little effect on volume expansion.« less

Synthesis and structural study of N-isopropenylbenzimidazolone

NASA Astrophysics Data System (ADS)

Mondieig, D.; Negrier, Ph.; Leger, J. M.; Lakhrissi, L.; El Assyry, A.; Lakhrissi, B.; Essassi, E. M.; Benali, B.; Boucetta, A.

2015-05-01

The synthesis and the crystal structure of the N-isopropenylbenzimidazolone (C10H10N2O) are presented. The synthesis was performed by Meth-Cohen method by reaction of o-phenylenediamine with ethyl acetoacetate in refluxed xylene. The single crystal structure was determined at room temperature by means of X-rays diffraction. The crystal system is monoclinic, with space group C2/c and eight molecules per unit cell. The unit cell dimensions are: a = 15.978(1) Å, b = 6.100(2) Å, c = 18.222(2) Å, β = 90.16(1)° and V = 1776.0(6) Å3.

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

CGBA, Pilot Kent Rominger films HHDTC units in Spacelab

NASA Image and Video Library

1995-11-05

STS073-131-014 (20 October-5 November 1995) --- Astronaut Kent V. Rominger, STS-73 pilot, uses a camcorder to record progress in the Hand-Held Diffusion Test Cell (HHDTC) experiment. This test dealt with crystal growth by liquid-to-liquid diffusion. Four HHDTC units containing four test cells each produced protein crystals by diffusing one liquid to another. Rominger joined four other NASA astronauts and two guest researchers for 16 days of in-space United States Microgravity Laboratory 2 (USML-2) research aboard the Space Shuttle Columbia.

Crystallization and preliminary crystallographic studies of LipA, a secretory lipase/esterase from Xanthomonas oryzae pv. oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aparna, Gudlur; Chatterjee, Avradip; Jha, Gopaljee

2007-08-01

The crystallization and preliminary crystallographic studies of LipA, a lipase/esterase secreted by X. oryzae pv. oryzae during its infection of rice plants, are reported. Xanthomonas oryzae pv. oryzae is the causal agent of bacterial leaf blight, a serious disease of rice. Several enzymes that are secreted through the type II secretion system of this bacterium play an important role in the plant–microbe interaction, being important for virulence and also being able to induce potent host defence responses. One of these enzymes is a secretory lipase/esterase, LipA, which shows a very weak homology to other bacterial lipases and gives a positivemore » tributyrin plate assay. In this study, LipA was purified from the culture supernatant of an overexpressing clone of X. oryzae pv. oryzae and two types of crystals belonging to space group C2 but with two different unit-cell parameters were obtained using the hanging-drop vapour-diffusion method. Type I crystals diffract to a maximum resolution of 1.89 Å and have unit-cell parameters a = 93.1, b = 62.3, c = 66.1 Å, β = 90.8°. Type II crystals have unit-cell parameters a = 103.6, b = 54.6, c = 66.3 Å, β = 92.6° and diffract to 1.86 Å. Solvent-content analysis shows one monomer in the asymmetric unit in both the crystal forms.« less

Purification, crystallization and preliminary X-ray crystallographic analysis of rice Bowman–Birk inhibitor from Oryza sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Yi-Hung; Li, Hsin-Tai; Institute of Bioinformatics and Structural Biology, National Tsing-Hua University, Hsinchu 30013,Taiwan

2006-06-01

Rice Bowman–Birk inhibitor was expressed and crystallized. Bowman–Birk inhibitors (BBIs) are cysteine-rich proteins with inhibitory activity against proteases that are widely distributed in monocot and dicot species. The expression of rice BBI from Oryza sativa is up-regulated and induced by pathogens or insects during germination of rice seeds. The rice BBI (RBTI) of molecular weight 15 kDa has been crystallized using the hanging-drop vapour-diffusion method. According to the diffraction of rice BBI crystals at a resolution of 2.07 Å, the unit cell belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 74.37, b = 96.69, cmore » = 100.36 Å. Preliminary analysis indicates four BBI molecules in an asymmetric unit, with a solvent content of 58.29%.« less

Isolation, crystallization in the macrogravitation field, preliminary X-ray investigation of uridine phosphorylase from Escherichia coli K-12.

PubMed

Mikhailov, A M; Smirnova, E A; Tsuprun, V L; Tagunova, I V; Vainshtein, B K; Linkova, E V; Komissarov, A A; Siprashvili, Z Z; Mironov, A S

1992-03-01

Uridine phosphorylase (UPH) from Escherichia coli K-12 has been purified to near homogeneity from a strain harbouring the udp gene, encoding UPH, on a multicopy plasmid. UPH was purified to electrophoretic homogeneity with the specific activity 230 units/mg with a recovery of 80%, yielding 120 mg of enzyme from 3g cells. Crystals of enzyme suitable for X-ray diffraction analysis were obtained in a preparative ultracentrifuge. The packing of the molecules in the crystals may be described by the space group P2(1)2(1)2(1) with the unit cell constants a = 90.4; b = 128.8; c = 136.8 A. There is one molecule per asymmetric unit, Vm = 2.4. These crystals diffract to at least 2.5-2.7 A resolution. The hexameric structure of UPH was directly demonstrated by electron microscopy study and image processing.

Crystallization and preliminary crystallographic analysis of calcium-binding protein-2 from Entamoeba histolytica and its complexes with strontium and the IQ1 motif of myosin V

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gourinath, S., E-mail: sgourinath@mail.jnu.ac.in; Padhan, Narendra; Alam, Neelima

2005-04-01

Calcium-binding protein-2 (EhCaBP2) crystals were grown using MPD as a precipitant. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. Calcium plays a pivotal role in the pathogenesis of amoebiasis, a major disease caused by Entamoeba histolytica. Two domains with four canonical EF-hand-containing calcium-binding proteins (CaBPs) have been identified from E. histolytica. Even though they have very high sequence similarity, these bind to different target proteins in a Ca{sup 2+}-dependent manner, leading to different functional pathways. Calcium-binding protein-2 (EhCaBP2) crystals were grown usingmore » MPD as a precipitant. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 111.74, b = 68.83, c = 113.25 Å, β = 116.7°. EhCaBP2 also crystallized in complex with strontium (replacing calcium) at similar conditions. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 69.18, b = 112.03, c = 93.42 Å, β = 92.8°. Preliminary data for EhCaBP2 crystals in complex with an IQ motif are also reported. This complex was crystallized with MPD and ethanol as precipitating agents. These crystals belong to space group P2{sub 1}, with unit-cell parameters a = 60.5, b = 69.86, c = 86.5 Å, β = 97.9°.« less

Crystallization and X-ray diffraction analysis of the RNA primer/promoter-binding domain of influenza A virus RNA-dependent RNA polymerase PB2

PubMed Central

Kuzuhara, Takashi; Kise, Daisuke; Yoshida, Hiroko; Horita, Takahiro; Murazaki, Yoshimi; Utsunomiya, Hiroko; Tsuge, Hideaki

2009-01-01

The C-terminal domain protein (amino-acid residues 535–759) of the PB2 subunit of the RNA-dependent RNA polymerase from the highly pathogenic influenza A virus was expressed as a soluble protein in Escherichia coli and crystallized using sodium formate as a precipitant. Data sets were collected from crystals of native and selenomethionine-substituted protein on the KEK NW12 beamline at the Photon Factory and the crystals diffracted to a maximum resolution of 2.44 Å for the SeMet-derivative crystal. The native crystals were found to belong to space group P3221, with unit-cell parameters a = b = 52.5, c = 156.3 Å. The Matthews value (V M) was 2.7 Å3 Da−1, assuming the presence of one molecule in the asymmetric unit. The SeMet-derivative crystals were found to belong to the same space group, with unit-cell parameters a = b = 52.6, c = 156.4 Å. Attempts are being made to solve the structure by multi-wavelength anomalous dispersion phasing. PMID:19194006

In-house SIRAS phasing of the polyunsaturated fatty-acid isomerase from Propionibacterium acnes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liavonchanka, Alena; Hornung, Ellen; Feussner, Ivo

2006-02-01

Low iodide concentrations were sufficient to allow SAD and SIRAS phasing of cubic crystals of a novel fatty acid isomerase using Cu Kα radiation. The polyenoic fatty-acid isomerase from Propionibacterium acnes (PAI) catalyzes the double-bond isomerization of linoleic acid to conjugated linoleic acid, which is a dairy- or meat-derived fatty acid in the human diet. PAI was overproduced in Escherichia coli and purified to homogeneity as a yellow-coloured protein. The nature of the bound cofactor was analyzed by absorption and fluorescence spectroscopy. Single crystals of PAI were obtained in two crystal forms. Cubic shaped crystals belong to space group I2{submore » 1}3, with a unit-cell parameter of 160.4 Å, and plate-like crystals belong to the monoclinic space group C2, with unit-cell parameters a = 133.7, b = 60.8, c = 72.2 Å, β = 115.8°. Both crystal forms contain one molecule per asymmetric unit and diffract to a resolution of better than 2.0 Å. Initial phases were obtained by SIRAS from in-house data from a cubic crystal that was soaked with an unusually low KI concentration of 0.25 M.« less

Crystallization and preliminary X-ray diffraction studies of Seneca Valley Virus-001, a new member of the Picornaviridae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Venkataraman, Sangita; Reddy, Seshidhar P.; Loo, Jackie

2008-04-01

Seneca Valley Virus-001 of the Picornavirdae family was crystallized in the space group R3 and X-ray diffraction data was collected to a resolution of 2.3 Å. Rotation-function studies suggested the presence of two distict sets of 20 protomers that belong to two different virus particles in the crystallographic asymmetric unit. Seneca Valley Virus-001 (SVV-001) is a newly found species in the Picornaviridae family. SVV-001 is the first naturally occurring nonpathogenic picorna@@virus observed to mediate selective cytotoxicity towards tumor cells with neuroendocrine cancer features. The nonsegmented (+)ssRNA genome of SVV-001 shares closest sequence similarity to the genomes of the members ofmore » the Cardiovirus genus. However, based on the distinct characteristics of the genome organization and other biochemical properties, it has been suggested that SVV-001 represents a new genus, namely ‘Senecavirus’, in the Picornaviridae family. In order to understand the oncolytic properties of SVV-001, the native virus was crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group R3, with unit-cell parameters (in the hexagonal setting) a = b = 311.5, c = 1526.4 Å. Although the SVV crystals diffracted to better than 2.3 Å resolution, the data quality is acceptable [I/σ(I) > 2.0] to 2.6 Å resolution. The unit-cell volume and the locked rotation-function analysis suggest that six particles could be accommodated in the unit cell, with two distinct sets of one third of a particle, each containing 20 protomers, occupying the crystallographic asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of Escherichia coli glutaredoxin 2 in complex with glutathione and of a cysteine-less variant without glutathione

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sheng, Ju; Ye, Jun; Rosen, Barry P., E-mail: brosen@med.wayne.edu

2007-04-01

Glutaredoxin 2 from E. coli was cocrystallized with glutathione and data were collected to 1.60 Å. A mutant with the active-site residues Cys9 and Cys12 changed to serine was crystallized in the absence of glutathione and data were collected to 2.4 Å. Glutaredoxin 2 (Grx2) from Escherichia coli is larger in size than classical glutaredoxins. It is extremely efficient in the catalysis of reduced glutathione-dependent disulfide reduction. A complex of Grx2 with reduced glutathione (GSH) has been crystallized. Data were collected to 1.60 Å. The crystals belong to space group P3{sub 2}21, with one Grx2–GSH complex in the asymmetric unit.more » The unit-cell parameters are a = b = 50.10, c = 152.47 Å. A Grx2 mutant, C9S/C12S, which cannot form a disulfide bond with GSH was also crystallized. The crystals diffracted to 2.40 Å and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with one molecule in the asymmetric unit. The unit-cell parameters are a = 28.16, b = 78.65, c = 89.16 Å.« less

Synthesis and Structural Features of [4,4'-Diisopropoxyester-2,2'-bipyridine], [Dichloro(4,4'-diisopropoxyester-2,2'-bi-pyridine)-platinum(ii)] and Its Dichloromethane Solvated Pseudo-Polymorph: Versatile Supramolecular Interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Browning, Charles; Nesterov, Vladimir N.; Wang, Xiaoping

We report that the organic ligand 4,4'-diisopropoxyester-2,2'-bipyridine, C 18H 20N 2O 4 (1), crystallizes in the triclinic crystal system P-1 and the molecule occupies a special position in the unit cell. In the crystal, molecules form stacks with partial overlapping of the pyridine rings. The Pt(II) dichloro complex of 1 crystallizes from a mixture of ethanol/hexane and from dichloromethane to form orange and yellow crystals, respectively. The orange non-solvated crystals of the (bipyridine)(dichloro)platinum(II) complex C 18H 20N 2O 4PtCl 2 (2) crystallize in the triclinic crystal system P-1 as well with two independent molecules in the unit cell. In themore » crystal packing, molecules form two types of dimers with Pt1 ··· Pt1A and Pt2···Pt2A distances of 3.478 and 5.186 angstrom respectively. The yellow crystals, as a solvated pseudo-polymorph C 18H 20N 2O 4PtCl 2·1.5 CH 2Cl 2 (3) also crystallize in the triclinic crystal system P-1 with two independent molecules in the unit cell. In the crystal packing, molecules form Pt2 ···Pt1 ···Pt1A ···Pt2A intermolecular contacts with alternating distances 3.501 and 3.431 angstrom, respectively, forming infinite chains. Graphical Abstract The dichloro(bipyridine)platinum complex, dichloro(4,4'-diisopropoxyester-2,2'-bipyridine)platinum(II), forms single crystals as a stable non-solvated form and a solvated polymorph with dramatically different supramolecular structure and short contacts.« less

Synthesis and Structural Features of [4,4'-Diisopropoxyester-2,2'-bipyridine], [Dichloro(4,4'-diisopropoxyester-2,2'-bi-pyridine)-platinum(ii)] and Its Dichloromethane Solvated Pseudo-Polymorph: Versatile Supramolecular Interactions

DOE PAGES

Browning, Charles; Nesterov, Vladimir N.; Wang, Xiaoping; ...

2015-06-03

We report that the organic ligand 4,4'-diisopropoxyester-2,2'-bipyridine, C 18H 20N 2O 4 (1), crystallizes in the triclinic crystal system P-1 and the molecule occupies a special position in the unit cell. In the crystal, molecules form stacks with partial overlapping of the pyridine rings. The Pt(II) dichloro complex of 1 crystallizes from a mixture of ethanol/hexane and from dichloromethane to form orange and yellow crystals, respectively. The orange non-solvated crystals of the (bipyridine)(dichloro)platinum(II) complex C 18H 20N 2O 4PtCl 2 (2) crystallize in the triclinic crystal system P-1 as well with two independent molecules in the unit cell. In themore » crystal packing, molecules form two types of dimers with Pt1 ··· Pt1A and Pt2···Pt2A distances of 3.478 and 5.186 angstrom respectively. The yellow crystals, as a solvated pseudo-polymorph C 18H 20N 2O 4PtCl 2·1.5 CH 2Cl 2 (3) also crystallize in the triclinic crystal system P-1 with two independent molecules in the unit cell. In the crystal packing, molecules form Pt2 ···Pt1 ···Pt1A ···Pt2A intermolecular contacts with alternating distances 3.501 and 3.431 angstrom, respectively, forming infinite chains. Graphical Abstract The dichloro(bipyridine)platinum complex, dichloro(4,4'-diisopropoxyester-2,2'-bipyridine)platinum(II), forms single crystals as a stable non-solvated form and a solvated polymorph with dramatically different supramolecular structure and short contacts.« less

The molecular and crystal structure of dextrans: a combined electron and X-ray diffraction study. II. A low temperature, hydrated polymorph.

PubMed

Guizard, C; Chanzy, H; Sarko, A

1985-06-05

The crystal and molecular structure of a dextran hydrate has been determined through combined electron and X-ray diffraction analysis, aided by stereochemical model refinement. A total of 65 hk0 electron diffraction intensities were measured on frozen single crystals held at the temperature of liquid nitrogen, to a resolution limit of 1.6 A. The X-ray intensities were measured from powder patterns recorded from collections of the single crystals. The structure crystallizes in a monoclinic unit cell with parameters a = 25.71 A, b = 10.21 A, c (chain axis) = 7.76 A and beta = 91.3 degrees. The space group is P2(1) with b axis unique. The unit cell contains six chains and eight water molecules, with three chains of the same polarity and four water molecules constituting the asymmetric unit. Along the chain direction the asymmetric unit is a dimer residue; however, the individual glucopyranose residues are very nearly related by a molecular 2-fold screw axis. The conformation of the chain is very similar to that in the anhydrous structure, but the chain packing differs in the two structures in that the rotational positions of the chains about the helix axes (the chain setting angles) are considerably different. The chains still pack in the form of sheets that are separated by water molecules. The difference in the chain setting angles between the anhydrous and hydrate structures corresponds to the angle between like unit cell axes observed in the diffraction diagrams recorded from hybrid crystals containing both polymorphs. Despite some beam damage effects, the structure was determined to a satisfactory degree of agreement, with the residuals R''(electron diffraction) = 0.258 and R(X-ray) = 0.127.

Production, Purification and Preliminary X-ray Crystallographic Studies of Adeno-Associated Virus Serotype 9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchell, M.; Nam, H; Carter, A

2009-01-01

Adeno-associated virus (AAV) serotype 9, which is under development for gene-delivery applications, shows significantly enhanced capsid-associated transduction efficiency in muscle compared with other AAV serotypes. With the aim of characterizing the structural determinants of this property, the purification, crystallization and preliminary X-ray crystallographic analyses of the AAV9 viral capsid are reported. The crystals diffracted X-rays to 2.8 A resolution using synchrotron radiation and belonged to the trigonal space group P32, with unit-cell parameters a = b = 251.0, c = 640.0 A. There are three complete viral capsids in the crystal unit cell. The orientation and position of the asymmetricmore » unit capsid have been determined by molecular-replacement methods and structure determination is in progress.« less

Crystallization and preliminary X-ray crystallographic analysis of the heterodimeric crotoxin complex and the isolated subunits crotapotin and phospholipase A{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos, K. F.; Murakami, M. T.; Cintra, A. C. O.

2007-04-01

Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained. Crotoxin, a potent neurotoxin from the venom of the South American rattlesnake Crotalus durissus terrificus, exists as a heterodimer formed between a phospholipase A{sub 2} and a catalytically inactive acidic phospholipase A{sub 2} analogue (crotapotin). Large single crystals of the crotoxin complex and of the isolated subunits have been obtained.more » The crotoxin complex crystal belongs to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 38.2, b = 68.7, c = 84.2 Å, and diffracted to 1.75 Å resolution. The crystal of the phospholipase A{sub 2} domain belongs to the hexagonal space group P6{sub 1}22 (or its enantiomorph P6{sub 5}22), with unit-cell parameters a = b = 38.7, c = 286.7 Å, and diffracted to 2.6 Å resolution. The crotapotin crystal diffracted to 2.3 Å resolution; however, the highly diffuse diffraction pattern did not permit unambiguous assignment of the unit-cell parameters.« less

Purification, crystallization and preliminary X-ray diffraction of human S100A15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boeshans, Karen M.; Wolf, Ronald; Voscopoulos, Christopher

2006-05-01

S100 proteins are differentially expressed during epithelial cell maturation, tumorigenesis and inflammation. The novel human S100A15 protein has been cloned, expressed, purified and crystallized in two crystal forms, a triclinic and a monoclinic form, which diffract to 1.7 and 2.0 Å, respectively. Human S100A15 is a novel member of the S100 family of EF-hand calcium-binding proteins and was recently identified in psoriasis, where it is significantly upregulated in lesional skin. The protein is implicated as an effector in calcium-mediated signal transduction pathways. Although its biological function is unclear, the association of the 11.2 kDa S100A15 with psoriasis suggests that itmore » contributes to the pathogenesis of the disease and could provide a molecular target for therapy. To provide insight into the function of S100A15, the protein was crystallized to visualize its structure and to further the understanding of how the many similar calcium-binding mediator proteins in the cell distinguish their cognate target molecules. The S100A15 protein has been cloned, expressed and purified to homogeneity and produced two crystal forms. Crystals of form I are triclinic, with unit-cell parameters a = 33.5, b = 44.3, c = 44.8 Å, α = 71.2, β = 68.1, γ = 67.8° and an estimated two molecules in the asymmetric unit, and diffract to 1.7 Å resolution. Crystals of form II are monoclinic, with unit-cell parameters a = 82.1, b = 33.6, c = 52.2 Å, β = 128.2° and an estimated one molecule in the asymmetric unit, and diffract to 2.0 Å resolution. This structural analysis of the human S100A15 will further aid in the phylogenic comparison between the other members of the S100 protein family, especially the highly homologous paralog S100A7.« less

Crystallization of a 2:2 complex of granulocyte-colony stimulating factor (GCSF) with the ligand-binding region of the GCSF receptor

PubMed Central

Honjo, Eijiro; Tamada, Taro; Maeda, Yoshitake; Koshiba, Takumi; Matsukura, Yasuko; Okamoto, Tomoyuki; Ishibashi, Matsujiro; Tokunaga, Masao; Kuroki, Ryota

2005-01-01

The granulocyte-colony stimulating factor (GCSF) receptor receives signals for regulating the maturation, proliferation and differentiation of the precursor cells of neutrophilic granulocytes. The signalling complex composed of two GCSFs (GCSF, 19 kDa) and two GCSF receptors (GCSFR, 34 kDa) consisting of an Ig-like domain and a cytokine-receptor homologous (CRH) domain was crystallized. A crystal of the complex was grown in 1.0 M sodium formate and 0.1 M sodium acetate pH 4.6 and belongs to space group P41212 (or its enantiomorph P43212), with unit-cell parameters a = b = 110.1, c = 331.8 Å. Unfortunately, this crystal form did not diffract beyond 5 Å resolution. Since the heterogeneity of GCSF receptor appeared to prevent the growth of good-quality crystals, the GCSF receptor was fractionated by anion-exchange chromatography. Crystals of the GCSF–fractionated GCSF receptor complex were grown as a new crystal form in 0.2 M ammonium phosphate. This new crystal form diffracted to beyond 3.0 Å resolution and belonged to space group P3121 (or its enantiomorph P3221), with unit-cell parameters a = b = 134.8, c = 105.7 Å. PMID:16511159

Yolk-platelet crystals in three ancient bony fishes: Polypterus bichir (Polypteri), Amia calva L., and Lepisosteus osseus (L.) (Holostei).

PubMed

Lange, R H; Grodziński, Z; Kilarski, W

1982-01-01

Yolk-platelet crystals in Amia calva L., Lepisosteus osseus (L.) and Polypterus bichir have orthorhombic features with unit-cell dimensions a = 8.3 ... 8.8 nm, b = 16.4 ... 16.9 nm and c = 18.6 ... 19.8 nm as determined in electron-diffracted patterns of fixed, epoxy-resin embedded and thin-sectioned material. Electron-diffraction patterns, crystal projections and the above unit-cell data make them extremely similar to the orthorhombic yolk-platelet crystals known for amphibians and teleosts. This observation fills a gap in yolk-platelet research and supports the view that the general architecture of yolk platelets has been conserved for nearly 400 million years. It follows that the peculiar platelet architecture itself has physiological significance.

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

A combined optical, SEM and STM study of growth spirals on the polytypic cadmium iodide crystals

NASA Astrophysics Data System (ADS)

Singh, Rajendra; Samanta, S. B.; Narlikar, A. V.; Trigunayat, G. C.

2000-05-01

Some novel results of a combined sequential study of growth spirals on the basal surface of the richly polytypic CdI 2 crystals by optical microscopy, scanning electron microscopy (SEM) and scanning tunneling microscopy (STM) are presented and discussed. Under the high resolution and magnification achieved in the scanning electron microscope, the growth steps of large heights seen in the optical micrographs are found to have a large number of additional steps of smaller heights existing between any two adjacent large height growth steps. When further seen by a scanning tunneling microscope, which provides still higher resolution, sequences of unit substeps, each of height equal to the unit cell height of the underlying polytype, are revealed to exist on the surface. Several large steps also lie between the unit steps, with heights equal to an integral multiple of either the unit cell height of the underlying polytype or the thickness of a molecular sheet I-Cd-I. It is suggested that initially a giant screw dislocation may form by brittle fracture of the crystal platelet, which may gradually decompose into numerous unit dislocations during subsequent crystal growth.

Cloning, expression, purification, crystallization and preliminary X-ray studies of argininosuccinate lyase (Rv1659) from Mycobacterium tuberculosis

PubMed Central

Paul, A.; Mishra, A.; Surolia, A.; Vijayan, M.

2013-01-01

The last enzyme in the arginine-biosynthesis pathway, argininosuccinate lyase, from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized, and preliminary X-ray studies have been carried out on the crystals. The His-tagged tetrameric enzyme with a subunit molecular weight of 50.9 kDa crystallized with two tetramers in the asymmetric unit of the orthorhombic unit cell, space group P212121. Molecular-replacement calculations and self-rotation calculations confirmed the space group and the tetrameric nature of the molecule. PMID:24316845

Large three-dimensional photonic crystals based on monocrystalline liquid crystal blue phases.

PubMed

Chen, Chun-Wei; Hou, Chien-Tsung; Li, Cheng-Chang; Jau, Hung-Chang; Wang, Chun-Ta; Hong, Ching-Lang; Guo, Duan-Yi; Wang, Cheng-Yu; Chiang, Sheng-Ping; Bunning, Timothy J; Khoo, Iam-Choon; Lin, Tsung-Hsien

2017-09-28

Although there have been intense efforts to fabricate large three-dimensional photonic crystals in order to realize their full potential, the technologies developed so far are still beset with various material processing and cost issues. Conventional top-down fabrications are costly and time-consuming, whereas natural self-assembly and bottom-up fabrications often result in high defect density and limited dimensions. Here we report the fabrication of extraordinarily large monocrystalline photonic crystals by controlling the self-assembly processes which occur in unique phases of liquid crystals that exhibit three-dimensional photonic-crystalline properties called liquid-crystal blue phases. In particular, we have developed a gradient-temperature technique that enables three-dimensional photonic crystals to grow to lateral dimensions of ~1 cm (~30,000 of unit cells) and thickness of ~100 μm (~ 300 unit cells). These giant single crystals exhibit extraordinarily sharp photonic bandgaps with high reflectivity, long-range periodicity in all dimensions and well-defined lattice orientation.Conventional fabrication approaches for large-size three-dimensional photonic crystals are problematic. By properly controlling the self-assembly processes, the authors report the fabrication of monocrystalline blue phase liquid crystals that exhibit three-dimensional photonic-crystalline properties.

Crystallization and initial X-ray diffraction studies of scaffolding protein (gp7) of bacteriophage ϕ29

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badasso, Mohammed O., E-mail: badas001@umn.edu; Anderson, Dwight L.; Department of Oral Science, University of Minnesota, Minneapolis, MN 55455

2005-04-01

ϕ29 bacteriophage scaffolding protein (gp7) has been overproduced in E. coli, purified, crystallized and characterized by X-ray diffraction. Two distinct crystal forms were obtained and a diffraction data set was collected to 1.8 Å resolution. The Bacillus subtilis bacteriophage ϕ29 scaffolding protein (gp7) has been crystallized by the hanging-drop vapour-diffusion method at 293 K. Two new distinct crystal forms that both differed from a previously crystallized and solved scaffolding protein were grown under the same conditions. Form I belongs to the primitive tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 77.13, c = 37.12 Å.more » Form II crystals exhibit an orthorhombic crystal form, with space group C222 and unit-cell parameters a = 107.50, b = 107. 80, c = 37.34 Å. Complete data sets have been collected to 1.78 and 1.80 Å for forms I and II, respectively, at 100 K using Cu Kα X-rays from a rotating-anode generator. Calculation of a V{sub M} value of 2.46 Å{sup 3} Da{sup −1} for form I suggests the presence of one molecule in the asymmetric unit, corresponding to a solvent content of 50.90%, whereas form II has a V{sub M} of 4.80 Å{sup 3} Da{sup −1} with a solvent content of 48.76% and two molecules in the asymmetric unit. The structures of both crystal forms are being determined by the molecular-replacement method using the coordinates of the published crystal structure of gp7.« less

Calcium carbonate mineralization mediated by in vitro cultured mantle cells from Pinctada fucata.

PubMed

Kong, Wei; Li, Shiguo; Xiang, Liang; Xie, Liping; Zhang, Rongqing

2015-08-07

Formation of the molluscan shell is believed to be an extracellular event mediated by matrix proteins. We report calcium carbonate mineralization mediated by Pinctada fucata mantle cells. Crystals only appeared when mantle cells were present in the crystallization solution. These crystals were piled up in highly ordered units and showed the typical characteristics of biomineralization products. A thin organic framework was observed after dissolving the crystals in EDTA. Some crystals had etched surfaces with a much smoother appearance than other parts. Mantle cells were observed to be attached to some of these smooth surfaces. These results suggest that mantle cells may be directly involved in the nucleation and remodeling process of calcium carbonate mineralization. Our result demonstrate the practicability of studying the mantle cell mechanism of biomineralization and contribute to the overall understanding of the shell formation process. Copyright © 2015 Elsevier Inc. All rights reserved.

Polarization splitting phenomenon of photonic crystals constructed by two-fold rotationally symmetric unit-cells

NASA Astrophysics Data System (ADS)

Yasa, U. G.; Giden, I. H.; Turduev, M.; Kurt, H.

2017-09-01

We present an intrinsic polarization splitting characteristic of low-symmetric photonic crystals (PCs) formed by unit-cells with C 2 rotational symmetry. This behavior emerges from the polarization sensitive self-collimation effect for both transverse-magnetic (TM) and transverse-electric (TE) modes depending on the rotational orientations of the unit-cell elements. Numerical analyzes are performed in both frequency and time domains for different types of square lattice two-fold rotational symmetric PC structures. At incident wavelength of λ = 1550 nm, high polarization extinction ratios with ˜26 dB (for TE polarization) and ˜22 dB (for TM polarization) are obtained with an operating bandwidth of 59 nm. Moreover, fabrication feasibilities of the designed structure are analyzed to evaluate their robustness in terms of the unit-cell orientation: for the selected PC unit-cell composition, corresponding extinction ratios for both polarizations still remain to be over 18 dB for the unit-cell rotation interval of θ = [40°-55°]. Taking all these advantages, two-fold rotationally symmetric PCs could be considered as an essential component in photonic integrated circuits for polarization control of light.

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of L-lactate dehydrogenase and its H171C mutant from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Gao, Xiaoli

2012-08-31

L-Lactate dehydrogenase (LDH) is an important enzyme involved in the last step of glycolysis that catalyzes the reversible conversion of pyruvate to L-lactate with the simultaneous oxidation of NADH to NAD{sup +}. In this study, wild-type LDH from Bacillus subtilis (BsLDH-WT) and the H171C mutant (BsLDH-H171C) were expressed in Escherichia coli and purified to near-homogeneity. BsLDH-WT was crystallized in the presence of fructose 1,6-bisphosphate (FBP) and NAD{sup +} and the crystal diffracted to 2.38 {angstrom} resolution. The crystal belonged to space group P3, with unit-cell parameters a = b = 171.04, c = 96.27 {angstrom}. BsLDH-H171C was also crystallized asmore » the apoenzyme and in complex with NAD{sup +}, and data sets were collected to 2.20 and 2.49 {angstrom} resolution, respectively. Both BsLDH-H171C crystals belonged to space group P3, with unit-cell parameters a = b = 133.41, c = 99.34 {angstrom} and a = b = 133.43, c = 99.09 {angstrom}, respectively. Tetramers were observed in the asymmetric units of all three crystals.« less

Expression, purification, crystallization and preliminary crystallographic study of isolated modules of the mouse coactivator-associated arginine methyltransferase 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Troffer-Charlier, Nathalie; Cura, Vincent; Hassenboehler, Pierre

2007-04-01

Isolated modules of mouse coactivator-associated arginine methyltransferase 1 encompassing the protein arginine N-methyltransferase catalytic domain have been overexpressed, purified and crystallized. X-ray diffraction data have been collected and have enabled determination of the structures by multiple isomorphous replacement using anomalous scattering. Coactivator-associated arginine methyltransferase 1 (CARM1) plays a crucial role in gene expression as a coactivator of several nuclear hormone receptors and also of non-nuclear receptor systems. Its recruitment by the transcriptional machinery induces protein methylation, leading to chromatin remodelling and gene activation. CARM1{sub 28–507} and two structural states of CARM1{sub 140–480} were expressed, purified and crystallized. Crystals of CARM1{submore » 28–507} belong to space group P6{sub 2}22, with unit-cell parameters a = b = 136.0, c = 125.3 Å; they diffract to beyond 2.5 Å resolution using synchrotron radiation and contain one monomer in the asymmetric unit. The structure of CARM1{sub 28–507} was solved by multiple isomorphous replacement and anomalous scattering methods. Crystals of apo CARM1{sub 140–480} belong to space group I222, with unit-cell parameters a = 74.6, b = 99.0, c = 207.4 Å; they diffract to beyond 2.7 Å resolution and contain two monomers in the asymmetric unit. Crystals of CARM1{sub 140–480} in complex with S-adenosyl-l-homocysteine belong to space P2{sub 1}2{sub 1}2, with unit-cell parameters a = 74.6, b = 98.65, c = 206.08 Å; they diffract to beyond 2.6 Å resolution and contain four monomers in the asymmetric unit. The structures of apo and holo CARM1{sub 140–480} were solved by molecular-replacement techniques from the structure of CARM1{sub 28–507}.« less

Probing Structural Perturbation in a Bent Molecular Crystal with Synchrotron Infrared Microspectroscopy and Periodic Density Functional Theory Calculations.

PubMed

Pejov, Ljupčo; Panda, Manas K; Moriwaki, Taro; Naumov, Panče

2017-02-15

The range of unit cell orientations generated at the kink of a bent single crystal poses unsurmountable challenges with diffraction analysis and limits the insight into the molecular-scale mechanism of bending. On a plastically bent crystal of hexachlorobenzene, it is demonstrated here that spatially resolved microfocus infrared spectroscopy using synchrotron radiation can be applied in conjunction with periodic density functional theory calculations to predict spectral changes or to extract information on structural changes that occur as a consequence of bending. The approach reproduces well the observed trends, such as the wall effects, and provides estimations of the vibrational shifts, unit cell deformations, and intramolecular parameters. Generally, expansion of the lattice induces red-shift while compression induces larger blue-shift of the characteristic ν(C-C) and ν(C-Cl) modes. Uniform or non-uniform expansion or contraction of the unit cell of 0.1 Å results in shifts of several cm -1 , whereas deformation of the cell of 0.5° at the unique angle causes shifts of <0.5 cm -1 . Since this approach does not include parameters related to the actual stimulus by which the deformation has been induced, it can be generalized and applied to other mechanically, photochemically, or thermally bent crystals.

Crystallization and preliminary X-ray analysis of gene product 44 from bacteriophage Mu

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kondou, Youhei; Faculty of Pharmaceutical Sciences, Toyama Medical and Pharmaceutical University, Toyama; Kitazawa, Daisuke

2005-01-01

Bacteriophage Mu baseplate protein gene product 44 was crystallized. The crystal belongs to space group R3, with unit-cell parameters a = b = 126.6, c = 64.2 Å. Bacteriophage Mu baseplate protein gene product 44 (gp44) is an essential protein required for the assembly of viable phages. To investigate the roles of gp44 in baseplate assembly and infection, gp44 was crystallized at pH 6.0 in the presence of 20% 2-methyl-2,4-pentanediol. The crystals belong to space group R3, with unit-cell parameters a = b = 127.47, c = 63.97 Å. The crystals diffract X-rays to at least 2.1 Å resolution andmore » are stable in the X-ray beam and are therefore appropriate for structure determination. Native data have been collected to 2.1 Å resolution using a DIP6040 image-plate system at beamline BL44XU at the SPring-8 facility in Japan.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Production, purification, crystallization and preliminary X-ray analysis of adeno-associated virus serotype 8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lane, Michael Douglas; Nam, Hyun-Joo; Padron, Eric

2005-06-01

The production, purification, crystallization and preliminary X-ray crystallographic analysis of adeno-associated virus serotype 8 is reported. Adeno-associated viruses (AAVs) are actively being developed for clinical gene-therapy applications and the efficiencies of the vectors could be significantly improved by a detailed understanding of their viral capsid structures and the structural determinants of their tissue-transduction interactions. AAV8 is ∼80% identical to the more widely studied AAV2, but its liver-transduction efficiency is significantly greater than that of AAV2 and other serotypes. The production, purification, crystallization and preliminary X-ray crystallographic analysis of AAV8 viral capsids are reported. The crystals diffract X-rays to 3.0 Åmore » resolution using synchrotron radiation and belong to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = 257.5, c = 443.5 Å. The unit cell contains two viral particles, with ten capsid viral protein monomers per crystallographic asymmetric unit.« less

Crystallization of the C-terminal globular domain of avian reovirus fibre

PubMed Central

van Raaij, Mark J.; Hermo Parrado, X. Lois; Guardado Calvo, Pablo; Fox, Gavin C.; Llamas-Saiz, Antonio L.; Costas, Celina; Martínez-Costas, José; Benavente, Javier

2005-01-01

Avian reovirus fibre, a homotrimer of the σC protein, is responsible for primary host-cell attachment. Using the protease trypsin, a C-terminal σC fragment containing amino acids 156–326 has been generated which was subsequently purified and crystallized. Two different crystal forms were obtained, one grown in the absence of divalent cations and belonging to space group P6322 (unit-cell parameters a = 75.6, c = 243.1 Å) and one grown in the presence of either zinc or cadmium sulfate and belonging to space group P321 (unit-cell parameters a = 74.7, c = 74.5 Å and a = 73.1, c = 69.9 Å for the ZnII- and CdII-grown crystals, respectively). The first crystal form diffracted synchrotron radiation to 3.0 Å resolution and the second form to 2.2–2.3 Å. Its closest related structure, the C-­terminal fragment of mammalian reovirus fibre, has only 18% sequence identity and molecular-replacement attempts were unsuccessful. Therefore, a search is under way for suitable heavy-atom derivatives and attempts are being made to grow protein crystals containing selenomethionine instead of methionine. PMID:16511119

Refolding, crystallization and preliminary X-ray crystallographic studies of the β-barrel domain of BamA, a membrane protein essential for outer membrane protein biogenesis.

PubMed

Ni, Dongchun; Yang, Kun; Huang, Yihua

2014-03-01

In Gram-negative bacteria, the assembly of outer membrane proteins (OMPs) requires a five-protein β-barrel assembly machinery (BAM) complex, of which BamA is an essential and evolutionarily conserved integral outer membrane protein. Here, the refolding, crystallization and preliminary X-ray crystallographic characterization of the β-barrel domain of BamA from Escherichia coli (EcBamA) are reported. Native and selenomethionine-substituted EcBamA proteins were crystallized at 16°C and X-ray diffraction data were collected to 2.6 and 3.7 Å resolution, respectively. The native crystals belonged to space group P21212, with unit-cell parameters a = 118.492, b = 159.883, c = 56.000 Å and two molecules in one asymmetric unit; selenomethionine-substituted protein crystals belonged to space group P4322, with unit-cell parameters a = b = 163.162, c = 46.388 Å and one molecule in one asymmetric unit. Initial phases for EcBamA β-barrel domain were obtained from a SeMet SAD data set. These preliminary X-ray crystallographic studies paved the way for further structural determination of the β-barrel domain of EcBamA.

Crystallization and preliminary X-ray diffraction studies of trypsin-like proteases from the gastric fluid of the marine crab Cancer pagurus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hehemann, Jan-Hendrik; Redecke, Lars; Perbandt, Markus

2007-03-01

Two trypsins from the gastric fluid of the marine crab C. pagurus were purified and crystallized and X-ray data were collected to 0.97 and 3.2 Å resolution. The digestive fluid of the marine crab Cancer pagurus (Decapoda, Brachyura) contains highly stable proteases which display enhanced activity in aqueous mixtures of organic solvents. Three trypsins were isolated from the gastric fluid and two of them, C.p.TryII and C.p.TryIII, were purified to homogeneity by anion-exchange chromatography and crystallized by hanging-drop vapour diffusion. Diffraction data were collected at a synchrotron to 0.97 and 3.2 Å resolution, respectively. The crystal of C.p.TryII belongs tomore » the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.06, b = 62.00, c = 71.66 Å. Based on the Matthews coefficient, one protein molecule per asymmetric unit is suggested. In contrast, crystals of C.p.TryIII, which belong to the cubic space group P2{sub 1}3 with unit-cell parameters a = b = c = 215.4 Å, are assumed to contain 12 molecules per asymmetric unit.« less

Extracellular overproduction and preliminary crystallographic analysis of a family I.3 lipase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Angkawidjaja, Clement; You, Dong-Ju; Matsumura, Hiroyoshi

2007-03-01

A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. A family I.3 lipase from Pseudomonas sp. MIS38 was secreted from Escherichia coli cells to the external medium, purified and crystallized and preliminary crystallographic studies were performed. The crystal was grown at 277 K by the hanging-drop vapour-diffusion method. Native X-ray diffraction data were collected to 1.7 Å resolution using synchrotron radiation at station BL38B1, SPring-8. The crystal belongs to space group P2{sub 1}, with unit-cell parameters a = 48.79, b = 84.06,more » c = 87.04 Å. Assuming the presence of one molecule per asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.73 Å{sup 3} Da{sup −1} and the solvent content was 55%.« less

Expression, crystallization and preliminary crystallographic analysis of the extracellular IgV-like domain of the human natural killer cell inhibitory receptor p75/AIRM1.

PubMed

Dimasi, Nazzareno; Moretta, Lorenzo; Biassoni, Roberto; Mariuzza, Roy A

2003-10-01

p75/AIRM1 (Siglec-7) is a sialic acid-binding Ig-like lectin recently identified as an inhibitory receptor on natural killer cells. The expression, in vitro folding, circular-dichroism spectroscopy, crystallization and preliminary X-ray characterization of the Ig-V like domain of p75/AIRM1 are reported. X-ray data were collected from a single crystal at 100 K, with a maximum useful diffraction pattern extending to 1.45 A resolution on a synchrotron source. The crystal belongs to a primitive monoclinic space group, with unit-cell parameters a = 32.65, b = 49.72, c = 39.79 A, alpha = gamma = 90, beta = 113 degrees. The systematic absences indicate that the space group is P2(1). Assuming one molecule per asymmetric unit, V(M) (the Matthews coefficient) was calculated to be 1.879 A(3) Da(-1) and the solvent content was estimated to be 32.01%.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Crystallization and preliminary X-ray analysis of a novel halotolerant feruloyl esterase identified from a soil metagenomic library

PubMed Central

Chen, Shang-ke; Wang, Kui; Liu, Yuhuan; Hu, Xiaopeng

2012-01-01

Feruloyl esterase cleaves the ester linkage formed between ferulic acid and polysaccharides in plant cell walls and thus has wide potential industrial applications. A novel feruloyl esterase (EstF27) identified from a soil metagenomic library was crystallized and a complete data set was collected from a single cooled crystal using an in-house X-ray source. The crystal diffracted to 2.9 Å resolution and belonged to space group P212121, with unit-cell parameters a = 94.35, b = 106.19, c = 188.51 Å, α = β = γ = 90.00°. A Matthews coefficient of 2.55 Å3 Da−1, with a corresponding solvent content of 51.84%, suggested the presence of ten protein subunits in the asymmetric unit. PMID:22750860

Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Jing; Li, Ming; Chen, Jiashu

Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

Rhombohedral crystals of 2-dehydro-3-deoxygalactarate aldolase from Escherichia coli.

PubMed

Blackwell, N C; Cullis, P M; Cooper, R A; Izard, T

1999-07-01

2-Dehydro-3-deoxygalactarate (DDG) aldolase (E.C. 4.1.2.20) catalyzes the reversible aldol cleavage of DDG and 2-dehydro-3-deoxyglucarate to pyruvate and tartronic semialdehyde. Rhombohedral crystals of recombinant DDG aldolase from Escherichia coli K-12 were obtained. The crystals belong to space group R32 with unit-cell parameters a = 93 A, alpha = 85 degrees. The crystals diffract to beyond 1.8 A resolution on a Cu Kalpha rotating-anode generator. The asymmetric unit is likely to contain two molecules, corresponding to a packing density of 1.34 A3 Da-1.

A low-temperature polymorph of m-quinquephenyl.

PubMed

Gomes, Ligia R; Howie, R Alan; Low, John Nicolson; Rodrigues, Ana S M C; Santos, Luís M N B F

2012-12-01

A low-temperature polymorph of 1,1':3',1'':3'',1''':3''',1''''-quinquephenyl (m-quinquephenyl), C(30)H(22), crystallizes in the space group P2(1)/c with two molecules in the asymmetric unit. The crystal is a three-component nonmerohedral twin. A previously reported room-temperature polymorph [Rabideau, Sygula, Dhar & Fronczek (1993). Chem. Commun. pp. 1795-1797] also crystallizes with two molecules in the asymmetric unit in the space group P-1. The unit-cell volume for the low-temperature polymorph is 4120.5 (4) Å(3), almost twice that of the room-temperature polymorph which is 2102.3 (6) Å(3). The molecules in both structures adopt a U-shaped conformation with similar geometric parameters. The structural packing is similar in both compounds, with the molecules lying in layers which stack perpendicular to the longest unit-cell axis. The molecules pack alternately in the layers and in the stacked columns. In both polymorphs, the only interactions between the molecules which can stabilize the packing are very weak C-H...π interactions.

Polarization-selective transmission in stacked two-dimensional complementary plasmonic crystal slabs

NASA Astrophysics Data System (ADS)

Iwanaga, Masanobu

2010-02-01

It has been experimentally and numerically shown that transmission at near infrared wavelengths is selectively controlled by polarizations in two-dimensional complementary plasmonic crystal slabs (2D c-PlCSs) of stacked unit cell. This feature is naturally derived by taking account of Babinet's principle. Moreover, the slight structural modification of the unit cell has been found to result in a drastic change in linear optical responses of stacked 2D c-PlCSs. These results substantiate the feasibility of 2D c-PlCSs for producing efficient polarizers with subwavelength thickness.

Ultra-high-Q three-dimensional photonic crystal nano-resonators.

PubMed

Tang, Lingling; Yoshie, Tomoyuki

2007-12-10

Two nano-resonator modes are designed in a woodpile three-dimensional photonic crystal by the modulation of unit cell size along a low-loss optical waveguide. One is a dipole mode with 2.88 cubic half-wavelengths mode volume. The other is a quadrupole mode with 8.3 cubic half-wavelengths mode volume. Light is three-dimensionally confined by a complete photonic band gap so that, in the analyzed range, the quality factor exponentially increases as the increase in the number of unit cells used for confinement of light.

Purification, crystallization and preliminary X-ray analysis of a thermostable glycoside hydrolase family 43 β-xylosidase from Geobacillus thermoleovorans IT-08

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rohman, Ali; Oosterwijk, Niels van; Kralj, Slavko

2007-11-01

The β-xylosidase was crystallized using PEG 6000 as precipitant. 5% PEG 6000 yielded bipyramid-shaped tetragonal crystals diffracting to 1.55 Å resolution, and 13% PEG 6000 gave rectangular monoclinic crystals diffracting to 1.80 Å resolution. The main enzymes involved in xylan-backbone hydrolysis are endo-1,4-β-xylanase and β-xylosidase. β-Xylosidase converts the xylo-oligosaccharides produced by endo-1,4-β-xylanase into xylose monomers. The β-xylosidase from the thermophilic Geobacillus thermoleovorans IT-08, a member of glycoside hydrolase family 43, was crystallized at room temperature using the hanging-drop vapour-diffusion method. Two crystal forms were observed. Bipyramid-shaped crystals belonging to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = bmore » = 62.53, c = 277.4 Å diffracted to 1.55 Å resolution. The rectangular crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 57.94, b = 142.1, c = 153.9 Å, β = 90.5°, and diffracted to 1.80 Å resolution.« less

Validation of experimental molecular crystal structures with dispersion-corrected density functional theory calculations.

PubMed

van de Streek, Jacco; Neumann, Marcus A

2010-10-01

This paper describes the validation of a dispersion-corrected density functional theory (d-DFT) method for the purpose of assessing the correctness of experimental organic crystal structures and enhancing the information content of purely experimental data. 241 experimental organic crystal structures from the August 2008 issue of Acta Cryst. Section E were energy-minimized in full, including unit-cell parameters. The differences between the experimental and the minimized crystal structures were subjected to statistical analysis. The r.m.s. Cartesian displacement excluding H atoms upon energy minimization with flexible unit-cell parameters is selected as a pertinent indicator of the correctness of a crystal structure. All 241 experimental crystal structures are reproduced very well: the average r.m.s. Cartesian displacement for the 241 crystal structures, including 16 disordered structures, is only 0.095 Å (0.084 Å for the 225 ordered structures). R.m.s. Cartesian displacements above 0.25 A either indicate incorrect experimental crystal structures or reveal interesting structural features such as exceptionally large temperature effects, incorrectly modelled disorder or symmetry breaking H atoms. After validation, the method is applied to nine examples that are known to be ambiguous or subtly incorrect.

Four crystal forms of a Bence-Jones protein

PubMed Central

Makino, Debora L.; Henschen-Edman, Agnes H.; McPherson, Alexander

2005-01-01

Four crystal forms have been grown and characterized by X-ray diffraction of a Bence-Jones protein collected from the urine of a multiple myeloma patient more than 40 years ago. Closely related tetragonal and orthorhombic forms belonging to space groups P43212 and P212121, with unit-cell parameters a = b = 68.7, c = 182.1 and a = 67.7, b = 69.4, c = 87.3 Å, diffract to 1.5 and 1.9 Å, respectively. Two closely related trigonal forms, both belonging to space group P3121 with unit-cell parameters a = b = 154.3 Å but differing by a doubling of the c axis, one 46.9 Å and the other 94.0 Å, diffract to 2.9 and 2.6 Å resolution, respectively. The trigonal crystal of short c-axis length shows a positive indication of twinning. The trigonal crystal of longer c axis, which appeared only after eight months of incubation at room temperature, is likely to be composed of proteolytically degraded molecules and unlike the other crystal forms contains two entire Bence-Jones dimers in the asymmetric unit. This latter crystal form may shed some light on the formation of fibrils common to certain storage diseases. PMID:16508097

Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quesada, Odayme; Gurda, Brittney; Govindasamy, Lakshmanan

2007-12-01

Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids have been produced which diffract X-rays to ∼3.0 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 7 capsids diffract X-rays to ∼3.0 Å resolution. The crystals belong to the rhombohedral space group R3, with unit-cell parameters a = 252.4, c = 591.2 Å in the hexagonal setting. The diffraction data were processed and reduced to an overall completeness of 79.0% and an R{sub merge} of 12.0%. There are three viral capsids in the unit cell. The icosahedral threefold axis is coincident with the crystallographic threefold axis, resulting in one third of amore » capsid (20 monomers) per crystallographic asymmetric unit. The orientation of the viral capsid has been determined by rotation-function searches and is positioned at (0, 0, 0) by packing considerations.« less

2D-3D switchable display based on a passive polymeric lenticular lens array and electrically suppressed ferroelectric liquid crystal.

PubMed

Shi, Liangyu; Srivastava, Abhishek Kumar; Wai Tam, Alwin Ming; Chigrinov, Vladimir Grigorievich; Kwok, Hoi Sing

2017-09-01

We reveal a 2D-3D switchable lens unit that is based on a polarization-sensitive microlens array and a polarization selector unit made of an electrically suppressed helix ferroelectric liquid crystal (ESHFLC) cell. The ESHFLCs offer a high contrast ratio (∼10k∶1) between the crossed polarizers at a low applied electric field (∼1.7  V/μm) with a small switching time (<50  μs). A special driving scheme, to switch between a 2D and 3D mode, has been developed to avoid unwanted issues related to DC accumulation in the ferroelectric liquid crystal without affecting its optical quality. The proposed lens unit is characterized by low power consumption, ultrafast response, and 3D crosstalk <5%, and can therefore find application in TVs, cell phones, etc.

Crystal-Chemical Analysis Martian Minerals in Gale Crater

NASA Technical Reports Server (NTRS)

Morrison, S. M.; Downs, R. T.; Blake, D. F.; Bish, D. L.; Ming, D. W.; Morris, R. V.; Yen, A. S.; Chipera, S. J.; Treiman, A. H.; Vaniman, D. T.;

Production, purification and preliminary X-ray crystallographic studies of adeno-associated virus serotype 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Edward B.; Gurda-Whitaker, Brittney; Govindasamy, Lakshmanan

2006-12-01

Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. Crystals of baculovirus-expressed adeno-associated virus serotype 1 (AAV1) capsids have been grown in the rhombohedral space group R32 (unit-cell parameters a = 254.7 Å, α = 62.3°) and shown to diffract X-rays to at least 2.5 Å resolution. The diffraction data were subsequently processed and reduced with an overall R{sub sym} of 12.3% and a completeness of 89.0%. Based on the unit-cellmore » volume, rotation-function and translation-function results and packing considerations, there is one virus capsid (60 viral proteins) per unit cell and there are ten viral proteins per crystallographic asymmetric unit. The AAV1 capsid shares both the twofold and threefold crystallographic symmetry operators. The AAV1 data have been initially phased using a polyalanine model (based on the crystal structure of AAV4) to 4.0 Å resolution and the structure determination and refinement is in progress using tenfold noncrystallographic symmetry electron-density averaging.« less

Crystallization of the Fab from a human monoclonal antibody against gp 41 of human immunodeficiency virus type I

NASA Technical Reports Server (NTRS)

Casale, Elena; He, Xiao-Min; Snyder, Robert S.; Carter, Daniel C.; Wenisch, Elisabeth; Jungbauer, Alois; Tauer, Christa; Ruker, Florian; Righetti, Pier Giorgio

1990-01-01

A monoclonal IgG antibody directed against gp 41 from the human immunodeficiency virus (HIV-1) has been crystallized in both intact and Fab forms. Crystals of the intact antibody grow as tetragonal-like prisms too small for conventional X-ray analysis. However, the Fab portion of the antibody produces suitable platelike crystals which belong to the space group P2(1)2(1)2(1) with unit cell constants of a = 66.5 A, b = 74.3 A, and c = 105.3 A. There is one molecule of Fab in the asymmetric unit. The Fab crystals show diffraction to d-spacings less than 3.0 A.

Expression, purification and crystallization of Helicobacter pyloril-asparaginase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dhavala, Prathusha; Krasotkina, Julya; Dubreuil, Christine

2008-08-01

l-Asparaginase from H. pylori was overexpressed in E. coli, purified and crystallized. The crystals belonged to space group I222, with unit-cell parameters a = 63.6, b = 94.9, c = 100.2 Å and one molecule in the asymmetric unit. A complete data set to 1.6 Å resolution was collected using synchrotron radiation. The l-asparaginases from Escherichia coli and Erwinia chrysanthemi are effective drugs that have been used in the treatment of acute childhood lymphoblastic leukaemia for over 30 years. However, despite their therapeutic potential, they can cause serious side effects as a consequence of their intrinsic glutaminase activity, which leadsmore » to l-glutamine depletion in the blood. Consequently, new asparaginases with low glutaminase activity, fewer side effects and high activity towards l-asparagine are highly desirable as better alternatives in cancer therapy. l-Asparaginase from Helicobacter pylori was overexpressed in E. coli and purified for structural studies. The enzyme was crystallized at pH 7.0 in the presence of 16–19%(w/v) PEG 4000 and 0.1 M magnesium formate. Data were collected to 1.6 Å resolution at 100 K from a single crystal at a synchrotron-radiation source. The crystals belong to space group I222, with unit-cell parameters a = 63.6, b = 94.9, c = 100.2 Å and one molecule of l-asparaginase in the asymmetric unit. Elucidation of the crystal structure will provide insight into the active site of the enzyme and a better understanding of the structure–activity relationship in l-asparaginases.« less

Crystallization of the C-terminal domain of the addiction antidote CcdA in complex with its toxin CcdB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buts, Lieven; De Jonge, Natalie; Loris, Remy, E-mail: reloris@vub.ac.be

2005-10-01

The CcdA C-terminal domain was crystallized in complex with CcdB in two crystal forms that diffract to beyond 2.0 Å resolution. CcdA and CcdB are the antidote and toxin of the ccd addiction module of Escherichia coli plasmid F. The CcdA C-terminal domain (CcdA{sub C36}; 36 amino acids) was crystallized in complex with CcdB (dimer of 2 × 101 amino acids) in three different crystal forms, two of which diffract to high resolution. Form II belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 37.6, b = 60.5, c = 83.8 Å and diffracts to 1.8more » Å resolution. Form III belongs to space group P2{sub 1}, with unit-cell parameters a = 41.0, b = 37.9, c = 69.6 Å, β = 96.9°, and diffracts to 1.9 Å resolution.« less

Crystallization of Δ1-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

PubMed Central

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi; Tamada, Taro; Adachi, Motoyasu; Kuroki, Ryota; Shoyama, Yukihiro; Morimoto, Satoshi

2005-01-01

Δ1-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 M sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å3 Da−1 assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively. PMID:16511162

The Crystal and Molecular Structure of an Asymmetric Diacetylene Monomer, 6-(2-methyl-4-nitroanilino)-2,4-hexadiyne-1-ol

NASA Technical Reports Server (NTRS)

Vlasse, Marcus; Paley, Mark S.

1993-01-01

The crystal and molecular structure of an asymmetric diacetylene monomer has been determined from x-ray diffraction data. The crystals, obtained from an acetone/pentane solution, are orthorhombic, Fdd2 with Z = 16 in a unit cell having dimensions of a = 42.815(6) A, b = 22.224(5) A, c = 4.996(l) A. The structure was solved by direct methods and refined by least- squares techniques to an R(sub F) of 6.4% for 988 reflections and 171 variables. The diacetylene chains are disposed in the unit cell in a complex manner in order to satisfy the hydrogen- bonding, crystal packing, and symmetry requirements of the system. The solid state polymerization mechanism is discussed with respect to the geometric disposition of the diacetylene chains. These chains are far apart and incorrectly oriented with respect to each other to permit polymerization in the crystal by means of 1,4-addition, consistent with the Baughman mechanistic model.

Preparation and crystal structure of U3Fe2C5: An original uranium-iron carbide

NASA Astrophysics Data System (ADS)

Henriques, M. S.; Paixão, J. A.; Henriques, M. S. C.; Gonçalves, A. P.

2015-09-01

The U3Fe2C5 compound was prepared from the elements by arc-melting, followed by an heat-treatment in an induction furnace, at 1250 °C for 1 h and 1300 °C for 2 h. The crystal structure of this phase was determined by direct methods from single crystal X-ray diffraction data. U3Fe2C5 crystallizes in an original tetragonal crystal structure, with space group I4/mmm, a = 3.4980(3) Å and c = 19.8380(15) Å as lattice constants and two formula units per cell. This new type structure is characterized by the simultaneous presence of isolated and pairs of carbon atoms, the interatomic distances in the pairs being similar to a typical carbon-carbon double bond length found in a molecule. U3Fe2C5 is closely related to UC and UFeC2, and can be seen as build from two (distorted) UFeC2 unit cells and a UC layer.

Crystallization and halide phasing of the C-terminal domain of human KIN17

PubMed Central

le Maire, Albane; Schiltz, Marc; Braud, Sandrine; Gondry, Muriel; Charbonnier, Jean-Baptiste; Zinn-Justin, Sophie; Stura, Enrico

2006-01-01

Here, the crystallization and initial phasing of the C-terminal domain of human KIN17, a 45 kDa protein mainly expressed in response to ionizing radiation and overexpressed in certain tumour cell lines, are reported. Crystals diffracting to 1.4 Å resolution were obtained from 10% ethylene glycol, 27% PEG 6000, 500 mM LiCl and 100 mM sodium acetate pH 6.3 in space group P212121, with unit-cell parameters a = 45.75, b = 46.31, c = 60.80 Å and one molecule in the asymmetric unit. Since this domain has a basic pI, heavy-atom derivatives were obtained by soaking the crystals with negatively charged ions such as tungstate and iodine. The replacement of LiCl by KI in the cryosolution allowed the determination of phases from iodide ions to give an interpretable electron-density map. PMID:16511313

Expression, purification and crystallization of Streptococcus dysgalactiae-derived mitogen

PubMed Central

Papageorgiou, Anastassios C.; Saarinen, Susanna; Ramirez-Bartutis, Rosa; Kato, Hidehito; Uchiyama, Takehiko; Kirikae, Teruo; Miyoshi-Akiyama, Toru

2006-01-01

Superantigens are bacterial or viral toxins with potent immunostimulatory properties. Streptococcus dysgalactiae-derived mitogen, a 25 kDa protein, is a recently discovered superantigen isolated from S. dysgalactiae culture supernatant. Sequence considerations suggest that it belongs to a new superantigen family distinct from other superantigens. The protein was expressed in Escherichia coli cells and purified to homogeneity. Crystals were grown at pH 4.2–4.4 in the presence of 18–20%(w/v) PEG 3350 and 0.4 M lithium nitrate. A complete data set to 2.4 Å resolution was collected from a single crystal at liquid-nitrogen temperatures using synchrotron radiation. The crystals belong to space group P3/P31/P32, with unit-cell parameters a = b = 52.7, c = 62.4 Å, γ = 120° and one molecule in the crystallographic asymmetric unit. PMID:16511312

Crystallization and preliminary crystallographic analysis of the cellulose biosynthesis-related protein CMCax from Acetobacter xylinum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kawano, Shin; Yasutake, Yoshiaki; Tajima, Kenji

2005-02-01

The cellulose biosynthesis-related protein CMCax from A. xylinum has been purified and crystallized. The crystals of CMCax belong to the primitive hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 89.1, c = 94.2 Å.

X-ray Diffraction from Membrane Protein Nanocrystals

PubMed Central

Hunter, M.S.; DePonte, D.P.; Shapiro, D.A.; Kirian, R.A.; Wang, X.; Starodub, D.; Marchesini, S.; Weierstall, U.; Doak, R.B.; Spence, J.C.H.; Fromme, P.

2011-01-01

Membrane proteins constitute >30% of the proteins in an average cell, and yet the number of currently known structures of unique membrane proteins is <300. To develop new concepts for membrane protein structure determination, we have explored the serial nanocrystallography method, in which fully hydrated protein nanocrystals are delivered to an x-ray beam within a liquid jet at room temperature. As a model system, we have collected x-ray powder diffraction data from the integral membrane protein Photosystem I, which consists of 36 subunits and 381 cofactors. Data were collected from crystals ranging in size from 100 nm to 2 μm. The results demonstrate that there are membrane protein crystals that contain <100 unit cells (200 total molecules) and that 3D crystals of membrane proteins, which contain <200 molecules, may be suitable for structural investigation. Serial nanocrystallography overcomes the problem of x-ray damage, which is currently one of the major limitations for x-ray structure determination of small crystals. By combining serial nanocrystallography with x-ray free-electron laser sources in the future, it may be possible to produce molecular-resolution electron-density maps using membrane protein crystals that contain only a few hundred or thousand unit cells. PMID:21190672

Microfocus diffraction from different regions of a protein crystal: structural variations and unit-cell polymorphism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Michael C.; Cascio, Duilio; Yeates, Todd O.

Real macromolecular crystals can be non-ideal in a myriad of ways. This often creates challenges for structure determination, while also offering opportunities for greater insight into the crystalline state and the dynamic behavior of macromolecules. To evaluate whether different parts of a single crystal of a dynamic protein, EutL, might be informative about crystal and protein polymorphism, a microfocus X-ray synchrotron beam was used to collect a series of 18 separate data sets from non-overlapping regions of the same crystal specimen. A principal component analysis (PCA) approach was employed to compare the structure factors and unit cells across the datamore » sets, and it was found that the 18 data sets separated into two distinct groups, with largeRvalues (in the 40% range) and significant unit-cell variations between the members of the two groups. This categorization mapped the different data-set types to distinct regions of the crystal specimen. Atomic models of EutL were then refined against two different data sets obtained by separately merging data from the two distinct groups. A comparison of the two resulting models revealed minor but discernable differences in certain segments of the protein structure, and regions of higher deviation were found to correlate with regions where larger dynamic motions were predicted to occur by normal-mode molecular-dynamics simulations. The findings emphasize that large spatially dependent variations may be present across individual macromolecular crystals. This information can be uncovered by simultaneous analysis of multiple partial data sets and can be exploited to reveal new insights about protein dynamics, while also improving the accuracy of the structure-factor data ultimately obtained in X-ray diffraction experiments.« less

Expression, purification and preliminary X-ray diffraction studies of the transcriptional factor PyrR from Bacillus halodurans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arreola, Rodrigo; Vega-Miranda, Anita; Gómez-Puyou, Armando

The gene-regulation factor PyrR from B. halodurans has been crystallized in two crystal forms. Preliminary crystallographic analysis showed that the protein forms tetramers in both space groups. The PyrR transcriptional regulator is widely distributed in bacteria. This RNA-binding protein is involved in the control of genes involved in pyrimidine biosynthesis, in which uridyl and guanyl nucleotides function as effectors. Here, the crystallization and preliminary X-ray diffraction analysis of two crystal forms of Bacillus halodurans PyrR are reported. One of the forms belongs to the monoclinic space group P2{sub 1} with unit-cell parameters a = 59.7, b = 87.4, c =more » 72.1 Å, β = 104.4°, while the other form belongs to the orthorhombic space group P22{sub 1}2{sub 1} with unit-cell parameters a = 72.7, b = 95.9, c = 177.1 Å. Preliminary X-ray diffraction data analysis and molecular-replacement solution revealed the presence of four and six monomers per asymmetric unit; a crystallographic tetramer is formed in both forms.« less

Preliminary crystallographic analysis of the major capsid protein P2 of the lipid-containing bacteriophage PM2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abrescia, Nicola G. A.; Kivelä, Hanna M.; Grimes, Jonathan M.

2005-08-01

The viral capsid protein P2 of bacteriophage PM2 has been crystallized. Preliminary X-ray analysis demonstrates the position and orientation of the two trimers in the asymmetric unit. PM2 (Corticoviridae) is a dsDNA bacteriophage which contains a lipid membrane beneath its icosahedral capsid. In this respect it resembles bacteriophage PRD1 (Tectiviridae), although it is not known whether the similarity extends to the detailed molecular architecture of the virus, for instance the fold of the major coat protein P2. Structural analysis of PM2 has been initiated and virus-derived P2 has been crystallized by sitting-nanodrop vapour diffusion. Crystals of P2 have been obtainedmore » in space group P2{sub 1}2{sub 1}2, with two trimers in the asymmetric unit and unit-cell parameters a = 171.1, b = 78.7, c = 130.1 Å. The crystals diffract to 4 Å resolution at the ESRF BM14 beamline (Grenoble, France) and the orientation of the non-crystallographic threefold axes, the spatial relationship between the two trimers and the packing of the trimers within the unit cell have been determined. The trimers form tightly packed layers consistent with the crystal morphology, possibly recapitulating aspects of the arrangement of subunits in the virus.« less

Crystalline structures of particles interacting through the harmonic-repulsive pair potential

NASA Astrophysics Data System (ADS)

Levashov, V. A.

2017-09-01

The behavior of identical particles interacting through the harmonic-repulsive pair potential has been studied in 3D using molecular dynamics simulations at a number of different densities. We found that at many densities, as the temperature of the systems decreases, the particles crystallize into complex structures whose formation has not been anticipated in previous studies on the harmonic-repulsive pair potential. In particular, at certain densities, crystallization into the structure I a 3 ¯ d (space group #230) with 16 particles in the unit cell occupying Wyckoff special positions (16b) was observed. This crystal structure has not been observed previously in experiments or in computer simulations of single component atomic or soft matter systems. At another density, we observed a liquid which is rather stable against crystallization. Yet, we observed crystallization of this liquid into the monoclinic C2/c (space group #15) structure with 32 particles in the unit cell occupying four different non-special Wyckoff (8f) sites. In this structure particles located at different Wyckoff sites have different energies. From the perspective of the local atomic environment, the organization of particles in this structure resembles the structure of some columnar quasicrystals. At a different value of the density, we did not observe crystallization at all despite rather long molecular dynamics runs. At two other densities, we observed the formation of the β S n distorted diamond structures instead of the expected diamond structure. Possibly, we also observed the formation of the R 3 ¯ c hexagonal lattice with 24 particles per unit cell occupying non-equivalent positions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David

The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit.

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.

PubMed

Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.

Crystallization of Δ{sup 1}-tetrahydrocannabinolic acid (THCA) synthase from Cannabis sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoyama, Yoshinari; Takeuchi, Ayako; Taura, Futoshi

Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase from C. sativa was crystallized. The crystal diffracted to 2.7 Å resolution with sufficient quality for further structure determination. Δ{sup 1}-Tetrahydrocannabinolic acid (THCA) synthase is a novel oxidoreductase that catalyzes the biosynthesis of the psychoactive compound THCA in Cannabis sativa (Mexican strain). In order to investigate the structure–function relationship of THCA synthase, this enzyme was overproduced in insect cells, purified and finally crystallized in 0.1 M HEPES buffer pH 7.5 containing 1.4 M sodium citrate. A single crystal suitable for X-ray diffraction measurement was obtained in 0.09 M HEPES buffer pH 7.5 containing 1.26 Mmore » sodium citrate. The crystal diffracted to 2.7 Å resolution at beamline BL41XU, SPring-8. The crystal belonged to the primitive cubic space group P432, with unit-cell parameters a = b = c = 178.2 Å. The calculated Matthews coefficient was approximately 4.1 or 2.0 Å{sup 3} Da{sup −1} assuming the presence of one or two molecules of THCA synthase in the asymmetric unit, respectively.« less

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

Crystallization of the rice immune receptor RGA5A_S with the rice blast fungus effector AVR1-CO39 prepared via mixture and tandem strategies.

PubMed

Guo, Liwei; Zhang, Yikun; Ma, Mengqi; Liu, Qiang; Zhang, Yanan; Peng, Youliang; Liu, Junfeng

2018-04-01

RGA5 is a component of the Pia resistance-protein pair (RGA4/RGA5) from Oryza sativa L. japonica. It acts as an immune receptor that directly recognizes the effector AVR1-CO39 from Magnaporthe oryzae via a C-terminal non-LRR domain (RGA5A_S). The interaction between RGA5A_S and AVR1-CO39 relieves the repression of RGA4, leading to effector-independent cell death. To determine the structure of the complex of RGA5A_S and AVR1-CO39 and to understand the details of this interaction, the complex was prepared by fusing the proteins together, by mixing them in vitro or by co-expressing them in one host cell. Samples purified via the first two strategies were crystallized under two different conditions. A mixture of AVR1-CO39 and RGA5A_S (complex I) crystallized in 1.1 M ammonium tartrate dibasic, 0.1 M sodium acetate-HCl pH 4.6, while crystals of the fusion complex RGA5A_S-TEV-AVR1-CO39 (complex II) were grown in 2 M NaCl. The crystal of complex I belonged to space group P3 1 21, with unit-cell parameters a = b = 66.2, c = 108.8 Å, α = β = 90, γ = 120°. The crystals diffracted to a Bragg spacing of 2.4 Å, and one molecule each of RGA5A_S and AVR1-CO39 were present in the asymmetric unit of the initial model. The crystal of complex II belonged to space group I4, with unit-cell parameters a = b = 137.4, c = 66.2 Å, α = β = γ = 90°. The crystals diffracted to a Bragg spacing of 2.72 Å, and there were two molecules of RGA5A_S and two molecules of AVR1-CO39 in the asymmetric unit of the initial model. Further structural characterization of the interaction between RGA5A_S and AVR1-CO39 will lead to a better understanding of the mechanism underlying effector recognition by R proteins.

Expression, purification, crystallization and preliminary X-ray studies of Lactobacillus jensenii enolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.

2010-09-02

Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.

Purification, crystallization and preliminary X-ray analysis of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).

PubMed

Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A

2003-08-01

UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.

Cloning, expression, purification and preliminary X-ray crystallographic analysis of mouse protein arginine methyltransferase 7.

PubMed

Cura, Vincent; Troffer-Charlier, Nathalie; Lambert, Marie-Annick; Bonnefond, Luc; Cavarelli, Jean

2014-01-01

Protein arginine methyltransferase 7 (PRMT7) is a unique but less characterized member of the family of protein arginine methyltransferases (PRMTs) that plays a role in male germline gene imprinting. PRMT7 is the only known PRMT member that catalyzes the monomethylation but not the dimethylation of the target arginine residues and harbours two catalytic domains in tandem. PRMT7 genes from five different species were cloned and expressed in Escherichia coli and Sf21 insect cells. Four gave soluble proteins from Sf21 cells, of which two were homogeneous and one gave crystals. The mouse PRMT7 structure was solved by the single anomalous dispersion method using a crystal soaked with thimerosal that diffracted to beyond 2.1 Å resolution. The crystal belonged to space group P4(3)2(1)2, with unit-cell parameters a = b = 97.4, c = 168.1 Å and one PRMT7 monomer in the asymmetric unit. The structure of another crystal form belonging to space group I222 was solved by molecular replacement.

Cloning, expression, purification and preliminary X-­ray crystallographic analysis of mouse protein arginine methyltransferase 7

PubMed Central

Cura, Vincent; Troffer-Charlier, Nathalie; Lambert, Marie-Annick; Bonnefond, Luc; Cavarelli, Jean

2014-01-01

Protein arginine methyltransferase 7 (PRMT7) is a unique but less characterized member of the family of protein arginine methyltransferases (PRMTs) that plays a role in male germline gene imprinting. PRMT7 is the only known PRMT member that catalyzes the monomethylation but not the dimethylation of the target arginine residues and harbours two catalytic domains in tandem. PRMT7 genes from five different species were cloned and expressed in Escherichia coli and Sf21 insect cells. Four gave soluble proteins from Sf21 cells, of which two were homogeneous and one gave crystals. The mouse PRMT7 structure was solved by the single anomalous dispersion method using a crystal soaked with thimerosal that diffracted to beyond 2.1 Å resolution. The crystal belonged to space group P43212, with unit-cell parameters a = b = 97.4, c = 168.1 Å and one PRMT7 monomer in the asymmetric unit. The structure of another crystal form belonging to space group I222 was solved by molecular replacement. PMID:24419624

Isolation, purification, crystallization, and preliminary X-ray diffraction study of the crystals of HU protein from M. gallisepticum

NASA Astrophysics Data System (ADS)

Nikolaeva, A. Yu.; Timofeev, V. I.; Boiko, K. M.; Korzhenevskii, D. A.; Rakitina, T. V.; Dorovatovskii, P. V.; Lipkin, A. V.

2015-11-01

HU proteins are involved in bacterial DNA and RNA repair. Since these proteins are absent in cells of higher organisms, inhibitors of HU proteins can be used as effective and safe antibiotics. The crystallization conditions for the M. gallisepticum HU protein were found and optimized by the vapor-diffusion method. The X-ray diffraction data set was collected to 2.91 Å resolution from the crystals grown by the vapor-diffusion method on a synchrotron source. The crystals of the HU protein belong to sp. gr. P41212 and have the following unit-cell parameters: a = b = 97.94 Å, c = 77.92 Å, α = β = γ = 90°.

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

PubMed Central

Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony; Dattagupta, Jiban K.; Sen, Udayaditya

2006-01-01

A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P41, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, were found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V M value. PMID:16511326

Purification, crystallization and preliminary crystallographic study of a recombinant plant aminoaldehyde dehydrogenase from Pisum sativum

PubMed Central

Tylichová, Martina; Briozzo, Pierre; Kopečný, David; Ferrero, Julien; Moréra, Solange; Joly, Nathalie; Snégaroff, Jacques; Šebela, Marek

2008-01-01

Aminoaldehydes are products of polyamine degradation and are known to be reactive metabolites that are toxic to living cells at high concentrations. These compounds are catabolized by aminoaldehyde dehydrogenases, which are enzymes that contain a nicotinamide adenine dinucleotide coenzyme. Amino­aldehyde dehydrogenase from Pisum sativum was overexpressed in Escherichia coli, purified and crystallized using the hanging-drop method. A complete data set was collected to 2.8 Å resolution at 100 K. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 86.4, b = 216.6, c = 205.4 Å, β = 98.1°. Molecular replacement was performed and led to the identification of six dimers per asymmetric unit. PMID:18259056

Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, G.J.; Garen, C.R.; Cherney, M.M.

2009-06-03

The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

Expression, limited proteolysis and preliminary crystallographic analysis of IpaD, a component of the Shigella flexneri type III secretion system

PubMed Central

Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E.; Birket, Susan; Picking, William D.; Blocker, Ariel; Picking, Wendy L.; Lea, Susan M.

2006-01-01

IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P212121, with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 Å, and data were collected to 2.9 Å resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 Å resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 Å, β = 107.9°. An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit. PMID:16946465

Expression, limited proteolysis and preliminary crystallographic analysis of IpaD, a component of the Shigella flexneri type III secretion system.

PubMed

Johnson, Steven; Roversi, Pietro; Espina, Marianela; Deane, Janet E; Birket, Susan; Picking, William D; Blocker, Ariel; Picking, Wendy L; Lea, Susan M

2006-09-01

IpaD, the putative needle-tip protein of the Shigella flexneri type III secretion system, has been overexpressed and purified. Crystals were grown of the native protein in space group P2(1)2(1)2(1), with unit-cell parameters a = 55.9, b = 100.7, c = 112.0 A, and data were collected to 2.9 A resolution. Analysis of the native Patterson map revealed a peak at 50% of the origin on the Harker section v = 0.5, suggesting twofold non-crystallographic symmetry parallel to the b crystallographic axis. As attempts to derivatize or grow selenomethionine-labelled protein crystals failed, in-drop proteolysis was used to produce new crystal forms. A trace amount of subtilisin Carlsberg was added to IpaD before sparse-matrix screening, resulting in the production of several new crystal forms. This approach produced SeMet-labelled crystals and diffraction data were collected to 3.2 A resolution. The SeMet crystals belong to space group C2, with unit-cell parameters a = 139.4, b = 45.0, c = 99.5 A, beta = 107.9 degrees . An anomalous difference Patterson map revealed peaks on the Harker section v = 0, while the self-rotation function indicates the presence of a twofold noncrystallographic symmetry axis, which is consistent with two molecules per asymmetric unit.

Crystallization and preliminary X-ray diffraction studies of vitamin D3 hydroxylase, a novel cytochrome P450 isolated from Pseudonocardia autotrophica

PubMed Central

Yasutake, Yoshiaki; Fujii, Yoshikazu; Cheon, Woo-Kwang; Arisawa, Akira; Tamura, Tomohiro

2009-01-01

Vitamin D3 hydroxylase (Vdh) is a novel cytochrome P450 monooxygenase isolated from the actinomycete Pseudonocardia autotrophica and consisting of 403 amino-acid residues. Vdh catalyzes the activation of vitamin D3 via sequential hydroxylation reactions: these reactions involve the conversion of vitamin D3 (cholecalciferol or VD3) to 25-hydroxyvitamin D3 [25(OH)VD3] and the subsequent conversion of 25(OH)VD3 to 1α,25-dihydroxyvitamin D3 [calciferol or 1α,25(OH)2VD3]. Overexpression of recombinant Vdh was carried out using a Rhodococcus erythropolis expression system and the protein was subsequently purified and crystallized. Two different crystal forms were obtained by the hanging-drop vapour-diffusion method at 293 K using polyethylene glycol as a precipitant. The form I crystal belonged to the trigonal space group P31, with unit-cell parameters a = b = 61.7, c = 98.8 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 47.6%. The form II crystal was grown in the presence of 25(OH)VD3 and belonged to the orthorhombic system P212121, with unit-cell parameters a = 63.4, b = 65.6 c = 102.2 Å. There is one Vdh molecule in the asymmetric unit, with a solvent content of 46.7%. Native data sets were collected to resolutions of 1.75 and 3.05 Å for form I and form II crystals, respectively, using synchrotron radiation. The structure solution was obtained by the molecular-replacement method and model refinement is in progress for the form I crystal. PMID:19342783

X-ray crystallographic studies on C-phycocyanins from cyanobacteria from different habitats: marine and freshwater

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satyanarayana, L.; Suresh, C. G., E-mail: cgsuresh@ncl.res.in; Patel, Anamika

2005-09-01

The protein C-phycocyanin, involved in photosynthesis, has been purified from three cyanobacterial species: Spirulina, Phormidium and Lyngbya. These three proteins have been crystallized and characterized using X-ray crystallography. C-phycocyanins from three cyanobacterial cultures of freshwater and marine habitat, Spirulina, Phormidium and Lyngbya spp., were purified to homogeneity and crystallized using the hanging-drop vapour-diffusion method. Blue-coloured crystals in different crystal forms, monoclinic and hexagonal, were obtained for the three species. The crystals took 1–12 weeks to grow to full size using polyethylene glycols of different molecular weights as precipitants. The amino-acid sequences of these proteins show high similarity to other knownmore » C-phycocyanins from related organisms; however, the C-phycocyanins reported here showed different biochemical and biophysical properties, i.e. molecular weight, stability etc. The X-ray diffraction data were collected at resolutions of 3.0 Å for the monoclinic and 3.2 and 3.6 Å for the hexagonal forms. The unit-cell parameters corresponding to the monoclinic space group P2{sub 1} are a = 107.33, b = 115.64, c = 183.26 Å, β = 90.03° for Spirulina sp. C-phycocyanin and are similar for crystals of Phormidium and Lyngbya spp. C-phycocyanins. Crystals belonging to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 154.97, c = 40.35 Å and a = b = 151.96, c = 39.06 Å, were also obtained for the C-phycocyanins from Spirulina and Lyngbya spp., respectively. The estimated solvent content is around 50% for the monoclinic crystals of all three species assuming the presence of two hexamers per asymmetric unit. The solvent content is 66.5 and 64.1% for the hexagonal crystals of C-phycocyanin from Spirulina and Lyngbya spp. assuming the presence of one αβ monomer per asymmetric unit.« less

Purification, crystallization and preliminary X-ray analysis of phycocyanin and phycoerythrin from Porphyra yezoensis Ueda

PubMed Central

Cai, Chuner; Wu, Lian; Li, Chunxia; He, Peimin; Li, Jie; Zhou, Jiahai

2011-01-01

Porphyra yezoensis is one of the most important and widely cultured seaweeds in China. Phycobiliproteins exhibit excellent spectroscopic properties and play versatile roles in the biomedical, food, cosmetics and chemical synthetic dye industries. Here, the purification and crystallization of phycoerythrin and phycocyanin, two phycobiliproteins extracted from P. yezoensis, are described. Using a novel protocol including co-precipitation with ammonium sulfate and hydroxyapatite column chromatography, both phycobiliproteins were produced on a large scale with improved quality and yield compared with those previously reported. Native PAGE analysis indicated that phycoerythrin and phycocyanin exist as (αβ)3 heterohexamers in solution. The crystals of phycoerythrin diffracted to 2.07 Å resolution and belonged to space group R3. The unit-cell parameters referred to hexagonal axes are a = b = 187.7, c = 59.7 Å, with nine (αβ)2 heterotetramers per unit cell. The crystals of phycocyanin diffracted to 2.70 Å resolution in space group P21. Matthews coefficient analysis shows that 10–19 (αβ) heterodimers of phycocyanin in the asymmetric unit would be reasonable. A self-rotation function calculation clarified this ambiguity and indicated that 12 (αβ) heterodimers of phycocyanin are assembled in the asymmetric unit. PMID:21543866

Crystallization and preliminary crystallographic analysis of l-asparaginase from Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wikman, Linnea E. K.; Krasotkina, Julya; Kuchumova, Anastasia

2005-04-01

Er. carotovoral-asparaginase, a potential antileukaemic agent, has been crystallized. Crystals diffract to 2.6 Å using a rotating-anode source and belong to space group P2{sub 1}, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. Bacterial l-asparaginases have been used as therapeutic agents in the treatment of acute childhood lymphoblastic leukaemia for over 30 y. However, their use is limited owing to the glutaminase activity of the administered enzymes, which results in serious side effects. In contrast, l-asparaginase from Erwinia carotovora exhibits low glutaminase activity atmore » physiological concentrations of l-asparagine and l-glutamine in the blood. Recombinant Er. carotovoral-asparaginase was crystallized in the presence of l-glutamate by the hanging-drop vapour-diffusion method using 10 mg ml{sup −1} purified enzyme, 16–18%(w/v) PEG 3350 and 0.2 M NaF. X-ray diffraction data were collected to 2.6 Å at 293 K using an in-house rotating-anode generator. The crystals belong to the monoclinic P2{sub 1} space group, with unit-cell parameters a = 78.0, b = 112.3, c = 78.7 Å, β = 101.9° and a homotetramer in the crystallographic asymmetric unit. A molecular-replacement solution has been found and refinement is currently in progress. The crystal structure may provide leads towards protein-engineering efforts aimed at safer asparaginase administration in leukaemia treatment.« less

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Synechocystis sp. PCC 6803.

PubMed

Liu, Yinghui; Zhang, Yanming; Cao, Xupeng; Xue, Song

2013-11-01

Malonyl-coenzymeA:acyl-carrier protein transacylase (MCAT), which catalyzes the transfer of the malonyl group from malonyl-CoA to acyl-carrier protein (ACP), is an essential enzyme in type II fatty-acid synthesis. The enzyme MCAT from Synechocystis sp. PCC 6803 (spMCAT), the first MCAT counterpart from a cyanobacterium, was cloned, purified and crystallized in order to determine its three-dimensional crystal structure. A higher-quality crystal with better diffraction was obtained by crystallization optimization. The crystal diffracted to 1.8 Å resolution and belonged to the orthorhombic space group P2(1)2(1)2, with unit-cell parameters a = 43.22, b = 149.21, c = 40.59 Å. Matthews coefficient calculations indicated that the crystal contained one spMCAT molecule in the asymmetric unit with a Matthews coefficient of 2.18 Å(3) Da(-1) and a solvent content of 43.65%.

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin

PubMed Central

Jaimohan, S. M.; Naresh, M. D.; Arumugam, V.; Mandal, A. B.

2009-01-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemo­globins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 Å resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 Å, β = 109.35°. Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit. PMID:19851014

Purification, crystallization and preliminary X-ray diffraction studies of parakeet (Psittacula krameri) haemoglobin.

PubMed

Jaimohan, S M; Naresh, M D; Arumugam, V; Mandal, A B

2009-10-01

Birds often show efficient oxygen management in order to meet the special demands of their metabolism. However, the structural studies of avian haemoglobins (Hbs) are inadequate for complete understanding of the mechanism involved. Towards this end, purification, crystallization and preliminary X-ray diffraction studies have been carried out for parakeet Hb. Parakeet Hb was crystallized as the met form in low-salt buffered conditions after extracting haemoglobin from crude blood by microcentrifugation and purifying the sample by column chromatography. Good-quality crystals were grown from 10% PEG 3350 and a crystal diffracted to about 2.8 A resolution. Preliminary diffraction data showed that the Hb crystal belonged to the monoclinic system (space group C2), with unit-cell parameters a = 110.68, b = 64.27, c = 56.40 A, beta = 109.35 degrees . Matthews volume analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Broadband sound blocking in phononic crystals with rotationally symmetric inclusions.

PubMed

Lee, Joong Seok; Yoo, Sungmin; Ahn, Young Kwan; Kim, Yoon Young

2015-09-01

This paper investigates the feasibility of broadband sound blocking with rotationally symmetric extensible inclusions introduced in phononic crystals. By varying the size of four equally shaped inclusions gradually, the phononic crystal experiences remarkable changes in its band-stop properties, such as shifting/widening of multiple Bragg bandgaps and evolution to resonance gaps. Necessary extensions of the inclusions to block sound effectively can be determined for given incident frequencies by evaluating power transmission characteristics. By arraying finite dissimilar unit cells, the resulting phononic crystal exhibits broadband sound blocking from combinational effects of multiple Bragg scattering and local resonances even with small-numbered cells.

Crystallization and preliminary crystallographic analysis of a family 43 β-d-xylosidase from Geobacillus stearothermophilus T-6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brüx, Christian; Niefind, Karsten; Ben-David, Alon

2005-12-01

The crystallization and preliminary X-ray analysis of a β-d-xylosidase from G. stearothermophilus T-6, a family 43 glycoside hydrolase, is described. Native and catalytic inactive mutants of the enzymes were crystallized in two different space groups, orthorhombic P2{sub 1}2{sub 1}2 and tetragonal P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2), using a sensitive cryoprotocol. The latter crystal form diffracted X-rays to a resolution of 2.2 Å. β-d-Xylosidases (EC 3.2.1.37) are hemicellulases that cleave single xylose units from the nonreducing end of xylooligomers. In this study, the crystallization and preliminary X-ray analysis of a β-d-xylosidase from Geobacillus stearothermophilus T-6more » (XynB3), a family 43 glycoside hydrolase, is described. XynB3 is a 535-amino-acid protein with a calculated molecular weight of 61 891 Da. Purified recombinant native and catalytic inactive mutant proteins were crystallized and cocrystallized with xylobiose in two different space groups, P2{sub 1}2{sub 1}2 (unit-cell parameters a = 98.32, b = 99.36, c = 258.64 Å) and P4{sub 1}2{sub 1}2 (or the enantiomorphic space group P4{sub 3}2{sub 1}2; unit-cell parameters a = b = 140.15, c = 233.11 Å), depending on the detergent. Transferring crystals to cryoconditions required a very careful protocol. Orthorhombic crystals diffract to 2.5 Å and tetragonal crystals to 2.2 Å.« less

Sixty years from discovery to solution: crystal structure of bovine liver catalase form III

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foroughi, Leila M.; Kang, You-Na; Matzger, Adam J.

2012-03-27

The crystallization and structural characterization of bovine liver catalase (BLC) has been intensively studied for decades. Forms I and II of BLC have previously been fully characterized using single-crystal X-ray diffraction. Form III has previously been analyzed by electron microscopy, but owing to the thinness of this crystal form an X-ray crystal structure had not been determined. Here, the crystal structure of form III of BLC is presented in space group P212121, with unit-cell parameters a = 68.7, b = 173.7, c = 186.3 {angstrom}. The asymmetric unit is composed of the biological tetramer, which is packed in a tetrahedronmore » motif with three other BLC tetramers. This higher resolution structure has allowed an assessment of the previously published electron-microscopy studies.« less

Purification, crystallization and preliminary X-ray diffraction analysis of water-soluble chlorophyll-binding protein from Chenopodium album

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuki, Takayuki; Ohshima, Shigeru; Uchida, Akira, E-mail: auchida@biomol.sci.toho-u.ac.jp

2007-09-01

A water-soluble chlorophyll-binding protein with photoconvertibility from C. album was extracted, purified and crystallized in a darkroom. The crystal diffracted to around 2.0 Å resolution. A water-soluble chlorophyll-binding protein (WSCP) with photoconvertibility from Chenopodium album was extracted, purified and crystallized in a darkroom. Green crystals suitable for data collection appeared in about 10 d. A native data set was collected to 2.0 Å resolution at 100 K. The space group of the crystal was determined to be orthorhombic I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 48.13, b = 60.59, c = 107.21 Å. Preliminary analysis ofmore » the X-ray data indicated that there is one molecule per asymmetric unit.« less

Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

PubMed

Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

1993-12-20

gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

Crystallization and preliminary X-ray data of the FadA adhesin from Fusobacterium nucleatum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nithianantham, Stanley; Xu, Minghua; Wu, Nan

2006-12-01

The FadA adhesin from F. nucleatum, which is involved in bacterial attachment and invasion of human oral epithelial cells, has been crystallized in space group P6{sub 1} or P6{sub 5}, and X-ray data have been collected to 1.9 Å resolution. Fusobacterium nucleatum is a Gram-negative anaerobe prevalent in the oral cavity that is associated with periodontal disease, preterm birth and infections in other parts of the human body. The bacteria attach to and invade epithelial and endothelial cells in the gum tissue and elsewhere via a 13.7 kDa adhesin protein FadA (Fusobacterium adhesin A). FadA exists in two forms: themore » intact form (pre-FadA), consisting of 129 amino acids, and the mature form (mFadA), which lacks an 18-residue signal sequence. Both forms have been expressed in Escherichia coli and purified. mFadA has been crystallized. The crystals belong to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 59.3, c = 125.7 Å and one molecule per asymmetric unit. The crystals exhibit an unusually high solvent content of 74%. Synchrotron X-ray data have been collected to 1.9 Å. The crystals are suitable for X-ray structure determination. The crystal structure of FadA may provide a basis for the development of therapeutic agents to combat periodontal disease and other infections associated with F. nucleatum.« less

Structure of Bacillus halmapalus α-amylase crystallized with and without the substrate analogue acarbose and maltose

PubMed Central

Lyhne-Iversen, Louise; Hobley, Timothy J.; Kaasgaard, Svend G.; Harris, Pernille

2006-01-01

Recombinant Bacillus halmapalus α-amylase (BHA) was studied in two different crystal forms. The first crystal form was obtained by crystallization of BHA at room temperature in the presence of acarbose and maltose; data were collected at cryogenic temperature to a resolution of 1.9 Å. It was found that the crystal belonged to space group P212121, with unit-cell parameters a = 47.0, b = 73.5, c = 151.1 Å. A maltose molecule was observed and found to bind to BHA and previous reports of the binding of a nonasaccharide were confirmed. The second crystal form was obtained by pH-induced crystallization of BHA in a MES–HEPES–boric acid buffer (MHB buffer) at 303 K; the solubility of BHA in MHB has a retrograde temperature dependency and crystallization of BHA was only possible by raising the temperature to at least 298 K. Data were collected at cryogenic temperature to a resolution of 2.0 Å. The crystal belonged to space group P212121, with unit-cell parameters a = 38.6, b = 59.0, c = 209.8 Å. The structure was solved using molecular replacement. The maltose-binding site is described and the two structures are compared. No significant changes were seen in the structure upon binding of the substrates. PMID:16946462

Crystallographic analysis of ground and space thermostable T1 lipase crystal obtained via counter diffusion method approach.

PubMed

Mohamad Aris, Sayangku Nor Ariati; Thean Chor, Adam Leow; Mohamad Ali, Mohd Shukuri; Basri, Mahiran; Salleh, Abu Bakar; Raja Abd Rahman, Raja Noor Zaliha

2014-01-01

Three-dimensional structure of thermostable lipase is much sought after nowadays as it is important for industrial application mainly found in the food, detergent, and pharmaceutical sectors. Crystallization utilizing the counter diffusion method in space was performed with the aim to obtain high resolution diffracting crystals with better internal order to improve the accuracy of the structure. Thermostable T1 lipase enzyme has been crystallized in laboratory on earth and also under microgravity condition aboard Progress spacecraft to the ISS in collaboration with JAXA (Japanese Aerospace Exploration Agency). This study is conducted with the aims of improving crystal packing and structure resolution. The diffraction data set for ground grown crystal was collected to 1.3 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.40 Å, b = 80.95 Å, and c = 99.81 Å, whereas the diffraction data set for space grown crystal was collected to 1.1 Å resolution and belonged to monoclinic C2 space group with unit cell parameters a = 117.31 Å, b = 80.85 Å, and c = 99.81 Å. The major difference between the two crystal growth systems is the lack of convection and sedimentation in microgravity environment resulted in the growth of much higher quality crystals of T1 lipase.

Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Crystallization and preliminary X-ray diffraction analysis of two extracytoplasmic solute receptors of the DctP family from Bordetella pertussis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rucktooa, Prakash; Huvent, Isabelle; IFR 142, Institut Pasteur de Lille, 1 Rue du Professeur Calmette, BP 245, 59021 Lille CEDEX

2006-10-01

Sample preparation, crystallization and preliminary X-ray analysis are reported for two B. pertussis extracytoplasmic solute receptors. DctP6 and DctP7 are two Bordetella pertussis proteins which belong to the extracytoplasmic solute receptors (ESR) superfamily. ESRs are involved in the transport of substrates from the periplasm to the cytosol of Gram-negative bacteria. DctP6 and DctP7 have been crystallized and diffraction data were collected using a synchrotron-radiation source. DctP6 crystallized in space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = 108.39, b = 108.39, c = 63.09 Å, while selenomethionyl-derivatized DctP7 crystallized in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parametersmore » a = 64.87, b = 149.83, c = 170.65 Å. The three-dimensional structure of DctP7 will be determined by single-wavelength anomalous diffraction, while the DctP6 structure will be solved by molecular-replacement methods.« less

Growth and microtopographic study of CuInSe{sub 2} single crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chauhan, Sanjaysinh M.; Chaki, Sunil, E-mail: sunilchaki@yahoo.co.in; Deshpande, M. P.

2016-05-23

The CuInSe{sub 2} single crystals were grown by chemical vapour transport (CVT) technique using iodine as transporting agent. The elemental composition of the as-grown CuInSe{sub 2} single crystals was determined by energy dispersive analysis of X-ray (EDAX). The unit cell crystal structure and lattice parameters were determined by X-ray diffraction (XRD) technique. The surface microtopographic study of the as-grown CuInSe{sub 2} single crystals surfaces were done to study the defects, growth mechanism, etc. of the CVT grown crystals.

Internal protein motions in molecular-dynamics simulations of Bragg and diffuse X-ray scattering.

PubMed

Wall, Michael E

2018-03-01

Molecular-dynamics (MD) simulations of Bragg and diffuse X-ray scattering provide a means of obtaining experimentally validated models of protein conformational ensembles. This paper shows that compared with a single periodic unit-cell model, the accuracy of simulating diffuse scattering is increased when the crystal is modeled as a periodic supercell consisting of a 2 × 2 × 2 layout of eight unit cells. The MD simulations capture the general dependence of correlations on the separation of atoms. There is substantial agreement between the simulated Bragg reflections and the crystal structure; there are local deviations, however, indicating both the limitation of using a single structure to model disordered regions of the protein and local deviations of the average structure away from the crystal structure. Although it was anticipated that a simulation of longer duration might be required to achieve maximal agreement of the diffuse scattering calculation with the data using the supercell model, only a microsecond is required, the same as for the unit cell. Rigid protein motions only account for a minority fraction of the variation in atom positions from the simulation. The results indicate that protein crystal dynamics may be dominated by internal motions rather than packing interactions, and that MD simulations can be combined with Bragg and diffuse X-ray scattering to model the protein conformational ensemble.

Internal protein motions in molecular-dynamics simulations of Bragg and diffuse X-ray scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wall, Michael E.

Molecular-dynamics (MD) simulations of Bragg and diffuse X-ray scattering provide a means of obtaining experimentally validated models of protein conformational ensembles. This paper shows that compared with a single periodic unit-cell model, the accuracy of simulating diffuse scattering is increased when the crystal is modeled as a periodic supercell consisting of a 2 × 2 × 2 layout of eight unit cells. The MD simulations capture the general dependence of correlations on the separation of atoms. There is substantial agreement between the simulated Bragg reflections and the crystal structure; there are local deviations, however, indicating both the limitation of using a single structuremore » to model disordered regions of the protein and local deviations of the average structure away from the crystal structure. Although it was anticipated that a simulation of longer duration might be required to achieve maximal agreement of the diffuse scattering calculation with the data using the supercell model, only a microsecond is required, the same as for the unit cell. Rigid protein motions only account for a minority fraction of the variation in atom positions from the simulation. The results indicate that protein crystal dynamics may be dominated by internal motions rather than packing interactions, and that MD simulations can be combined with Bragg and diffuse X-ray scattering to model the protein conformational ensemble.« less

Internal protein motions in molecular-dynamics simulations of Bragg and diffuse X-ray scattering

DOE PAGES

Wall, Michael E.

2018-01-25

Molecular-dynamics (MD) simulations of Bragg and diffuse X-ray scattering provide a means of obtaining experimentally validated models of protein conformational ensembles. This paper shows that compared with a single periodic unit-cell model, the accuracy of simulating diffuse scattering is increased when the crystal is modeled as a periodic supercell consisting of a 2 × 2 × 2 layout of eight unit cells. The MD simulations capture the general dependence of correlations on the separation of atoms. There is substantial agreement between the simulated Bragg reflections and the crystal structure; there are local deviations, however, indicating both the limitation of using a single structuremore » to model disordered regions of the protein and local deviations of the average structure away from the crystal structure. Although it was anticipated that a simulation of longer duration might be required to achieve maximal agreement of the diffuse scattering calculation with the data using the supercell model, only a microsecond is required, the same as for the unit cell. Rigid protein motions only account for a minority fraction of the variation in atom positions from the simulation. The results indicate that protein crystal dynamics may be dominated by internal motions rather than packing interactions, and that MD simulations can be combined with Bragg and diffuse X-ray scattering to model the protein conformational ensemble.« less

Crystallization and preliminary X-ray diffraction analysis of hemextin A: a unique anticoagulant protein from Hemachatus haemachatus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Yajnavalka; Kumar, Sundramurthy; Jobichen, Chacko

2007-08-01

Crystals of hemextin A, a three-finger toxin isolated and purified from African Ringhals cobra (H. haemachatus), are orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å, and diffract to 1.5 Å resolution. Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapour-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1more » M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 Å and two molecules in the asymmetric unit. They diffracted to 1.5 Å resolution at beamline X25 at BNL.« less

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

PubMed Central

Nango, Eriko; Kumasaka, Takashi; Sato, Takao; Tanaka, Nobuo; Kakinuma, Katsumi; Eguchi, Tadashi

2005-01-01

A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P21, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V M) of 2.89 Å3 Da−1 and a solvent constant of 57.4% by volume. PMID:16511136

Purification, crystallization, and preliminary X-ray diffraction study of purine nucleoside phosphorylase from E. coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A., E-mail: inna@ns.crys.ras.ru; Timofeev, V. I., E-mail: espiov@ibch.ru; Zhukhlistova, N. E., E-mail: tostars@mail.ru

2015-07-15

Crystals of E. coli purine nucleoside phosphorylase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 0.99 Å resolution. The crystals belong to sp. gr. P2{sub 1} and have the following unit-cell parameters: a = 74.1 Å, b = 110.2 Å, c = 88.2 Å, α = γ = 90°, β = 111.08°. The crystal contains six subunits of the enzyme comprising a hexamer per asymmetric unit. The hexamermore » is the biological active form of E. coli. purine nucleoside phosphorylase.« less

Expression, purification and preliminary X-ray analysis of the C-terminal domain of an arginine repressor protein from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, George J.; Garen, Craig R.; Cherney, Maia M.

2007-11-01

The C-terminal portion of the arginine repressor protein from M. tuberculosis H37Rv has been crystallized. The complete transcriptional factor regulates arginine biosynthesis by binding operator DNA when arginine is bound at the C-terminal domain. The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 Å. The crystals belong to space group P1 and themore » Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of six molecules per unit cell.« less

Crystal structure and crystal chemistry of melanovanadite, a natural vanadium bronze.

USGS Publications Warehouse

Konnert, J.A.; Evans, H.T.

1987-01-01

The crystal structure of melanovanadite from Minas Ragra, Peru, has been determined in space group P1. The triclinic unit cell (non-standard) has a 6.360(2), b 18.090(9), c 6.276(2) A, alpha 110.18(4)o, beta 101.62(3)o, gamma 82.86(4)o. A subcell with b' = b/2 was found by crystal-structure analysis to contain CaV4O10.5H2O. The subcell has a layer structure in which the vanadate sheet consists of corner-shared tetrahedral VO4 and double square-pyramidal V2O8 groups, similar to that previously found in synthetic CsV2O5. Refinement of the full structure (R = 0.056) showed that the Ca atom, which half-occupies a general position in the subcell, is 90% ordered at one of these sites in the whole unit cell. Bond length-bond strength estimates indicate that the tetrahedra contain V5+, and the square pyramids, V4+.-J.A.Z.

Band Gap Optimization Design of Photonic Crystals Material

NASA Astrophysics Data System (ADS)

Yu, Y.; Yu, B.; Gao, X.

2017-12-01

The photonic crystal has a fundamental characteristic - photonic band gap, which can prevent light to spread in the crystals. This paper studies the width variation of band gaps of two-dimension square lattice photonic crystals by changing the geometrical shape of the unit cells’ inner medium column. Using the finite element method, we conduct numerical experiments on MATLAB 2012a and COMSOL 3.5. By shortening the radius in vertical axis and rotating the medium column, we design a new unit cell, with a 0.3*3.85e-7 vertical radius and a 15 degree deviation to the horizontal axis. The new cell has a gap 1.51 percent wider than the circle medium structure in TE gap and creates a 0.0124 wide TM gap. Besides, the experiment shows the first TM gap is partially overlapped by the second TE gap in gap pictures. This is helpful to format the absolute photonic band gaps and provides favorable theoretical basis for designing photonic communication material.

Crystallization and preliminary crystallographic analysis of the transpeptidase domain of penicillin-binding protein 2B from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamada, Mototsugu, E-mail: mototsugu-yamada@meiji.co.jp; Watanabe, Takashi; Baba, Nobuyoshi

The selenomethionyl-substituted transpeptidase domain of penicillin-binding protein (PBP) 2B from S. pneumoniae was isolated from a limited proteolysis digest of the soluble form of recombinant PBP 2B and then crystallized. MAD data were collected to 2.4 Å resolution. Penicillin-binding protein (PBP) 2B from Streptococcus pneumoniae catalyzes the cross-linking of peptidoglycan precursors that occurs during bacterial cell-wall biosynthesis. A selenomethionyl (SeMet) substituted PBP 2B transpeptidase domain was isolated from a limited proteolysis digest of a soluble form of recombinant PBP 2B and then crystallized. The crystals belonged to space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 86.39,more » c = 143.27 Å. Diffraction data were collected to 2.4 Å resolution using the BL32B2 beamline at SPring-8. The asymmetric unit contains one protein molecule and 63.7% solvent.« less

Expression and crystallographic studies of the Arabidopsis thaliana GDP-D-mannose pyrophosphorylase VTC1.

PubMed

Zhao, Shun; Liu, Lin

2016-10-01

GDP-D-mannose pyrophosphorylase catalyzes the production of GDP-D-mannose, an intermediate product in the plant ascorbic acid (AsA) biosynthetic pathway. This enzyme is a key regulatory target in AsA biosynthesis and is encoded by VITAMIN C DEFECTIVE 1 (VTC1) in the Arabidopsis thaliana genome. Here, recombinant VTC1 was expressed, purified and crystallized. Diffraction data were obtained from VTC1 crystals grown in the absence and presence of substrate using X-rays. The ligand-free VTC1 crystal diffracted X-rays to 3.3 Å resolution and belonged to space group R32, with unit-cell parameters a = b = 183.6, c = 368.5 Å, α = β = 90, γ = 120°; the crystal of VTC1 in the presence of substrate diffracted X-rays to 1.75 Å resolution and belonged to space group P2 1 , with unit-cell parameters a = 70.8, b = 83.9, c = 74.5 Å, α = γ = 90.0, β = 114.9°.

Crystallization and preliminary X-ray diffraction studies of polyketide synthase-1 (PKS-1) from Cannabis sativa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taguchi, Chiho; Quantum Beam Science Directorate, Japan Atomic Energy Agency; Taura, Futoshi

Polyketide synthase-1 from C. sativa has been crystallized. The crystal diffracted to 1.55 Å resolution with sufficient quality for further structure determination. Polyketide synthase-1 (PKS-1) is a novel type III polyketide synthase that catalyzes the biosynthesis of hexanoyl triacetic acid lactone in Cannabis sativa (Mexican strain). PKS-1 was overproduced in Escherichia coli, purified and finally crystallized in two different space groups. The crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M calcium acetate and 20%(w/v) polyethylene glycol 3350 diffracted to 1.65 Å resolution and belonged to space group P1, with unit-cell parameters a = 54.3, b =more » 59.3, c = 62.6 Å, α = 69, β = 81, γ = 80°. Another crystal obtained in 0.1 M HEPES buffer pH 7.5 containing 0.2 M sodium chloride and 20%(w/v) polyethylene glycol 3350 diffracted to 1.55 Å resolution and belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 54.3, b = 110, c = 130 Å. These data will enable us to determine the crystal structure of PKS-1.« less

Ternary gradient metal-organic frameworks.

PubMed

Liu, Chong; Rosi, Nathaniel L

2017-09-08

Gradient MOFs contain directional gradients of either structure or functionality. We have successfully prepared two ternary gradient MOFs based on bMOF-100 analogues, namely bMOF-100/102/106 and bMOF-110/100/102, via cascade ligand exchange reactions. The cubic unit cell parameter discrepancy within an individual ternary gradient MOF crystal is as large as ∼1 nm, demonstrating the impressive compatibility and flexibility of the component MOF materials. Because of the presence of a continuum of unit cells, the pore diameters within individual crystals also change in a gradient fashion from ∼2.5 nm to ∼3.0 nm for bMOF-100/102/106, and from ∼2.2 nm to ∼2.7 nm for bMOF-110/100/102, indicating significant porosity gradients. Like previously reported binary gradient MOFs, the composition of the ternary gradient MOFs can be easily controlled by adjusting the reaction conditions. Finally, X-ray diffraction and microspectrophotometry were used to analyse fractured gradient MOF crystals by comparing unit cell parameters and absorbance spectra at different locations, thus revealing the profile of heterogeneity (i.e. gradient distribution of properties) and further confirming the formation of ternary gradient MOFs.

Application of London-type dispersion corrections to the solid-state density functional theory simulation of the terahertz spectra of crystalline pharmaceuticals.

PubMed

King, Matthew D; Buchanan, William D; Korter, Timothy M

2011-03-14

The effects of applying an empirical dispersion correction to solid-state density functional theory methods were evaluated in the simulation of the crystal structure and low-frequency (10 to 90 cm(-1)) terahertz spectrum of the non-steroidal anti-inflammatory drug, naproxen. The naproxen molecular crystal is bound largely by weak London force interactions, as well as by more prominent interactions such as hydrogen bonding, and thus serves as a good model for the assessment of the pair-wise dispersion correction term in systems influenced by intermolecular interactions of various strengths. Modifications to the dispersion parameters were tested in both fully optimized unit cell dimensions and those determined by X-ray crystallography, with subsequent simulations of the THz spectrum being performed. Use of the unmodified PBE density functional leads to an unrealistic expansion of the unit cell volume and the poor representation of the THz spectrum. Inclusion of a modified dispersion correction enabled a high-quality simulation of the THz spectrum and crystal structure of naproxen to be achieved without the need for artificially constraining the unit cell dimensions.

Preliminary X-ray characterization of a novel type of anchoring cohesin from the cellulosome of Ruminococcus flavefaciens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alber, Orly; Noach, Ilit; Lamed, Raphael

2008-02-01

The cloning, expression, purification, crystallization and preliminary X-ray characterization of a novel class of cohesin module (type III) from the R. flavefaciens ScaE anchoring scaffoldin are described. Ruminococcus flavefaciens is an anaerobic bacterium that resides in the gastrointestinal tract of ruminants. It produces a highly organized multi-enzyme cellulosome complex that plays a key role in the degradation of plant cell walls. ScaE is one of the critical structural components of its cellulosome that serves to anchor the complex to the cell wall. The seleno-l-methionine-labelled derivative of the ScaE cohesin module has been cloned, expressed, purified and crystallized. The crystals belongmore » to space group C2, with unit-cell parameters a = 155.6, b = 69.3, c = 93.0 Å, β = 123.4°, and contain four molecules in the asymmetric unit. Diffraction data were phased to 1.95 Å using the anomalous signal from the Se atoms.« less

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

Modeling a photoinduced planar-to-homeotropic anchoring transition triggered by surface azobenzene units in a nematic liquid crystal

NASA Astrophysics Data System (ADS)

Oswald, Patrick; Ignés-Mullol, Jordi

2017-09-01

The performance of light-controlled liquid crystal anchoring surfaces depends on the nature of the photosensitive moieties and on the concentration of spacer units. Here, we study the kinetics of photosensitive liquid crystal cells that incorporate an azobenzene-based self-assembled monolayer. We characterize the photoinduced homeotropic-to-planar transition and the subsequent reverse relaxation in terms of the underlying isomerization of the photosensitive layer. We show that the response time can be precisely adjusted by tuning the lateral packing of azobenzene units by means of inert spacer molecules. Using simple kinetic assumptions and a well-known model for the energetics of liquid crystal anchoring we are able to capture the details of the optical microscopy experimental observations. Our analysis provides fitted values for all the relevant material parameters, including the zenithal and the azimuthal anchoring strength.

Crystallization and X-ray analysis of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nango, Eriko; Kumasaka, Takashi, E-mail: tkumasak@bio.titech.ac.jp; Sato, Takao

2005-07-01

The crystallization of 2-deoxy-scyllo-inosose synthase, the key enzyme in the biosynthesis of 2-deoxystreptamine-containing aminoglycoside antibiotics, is reported. A recombinant 2-deoxy-scyllo-inosose synthase from Bacillus circulans has been crystallized at 277 K using PEG 4000 as precipitant. The diffraction pattern of the crystal extends to 2.30 Å resolution at 100 K using synchrotron radiation at the Photon Factory. The crystals are monoclinic and belong to space group P2{sub 1}, with unit-cell parameters a = 80.5, b = 70.4, c = 83.0 Å, β = 117.8°. The presence of two molecules per asymmetric unit gives a crystal volume per protein weight (V{sub M})more » of 2.89 Å{sup 3} Da{sup −1} and a solvent constant of 57.4% by volume.« less

Characterization of molecular associations involving L-ornithine and α-ketoglutaric acid: crystal structure of L-ornithinium α-ketoglutarate.

PubMed

Allouchi, H; Céolin, R; Berthon, L; Tombret, F; Rietveld, I B

2014-07-01

The crystal structure of L-ornithinium α-ketoglutarate (C5H13N2O2, C5H5O5) has been solved by direct methods using single crystal X-ray diffraction data. It crystallizes in the monoclinic system, space group P21, unit cell parameters a=15.4326(3), b=5.2015(1), c=16.2067(3) Å and β=91.986(1)°, containing two independent pairs of molecular ions in the asymmetric unit. An extensive hydrogen-bond network and electrostatic charges due to proton transfer provide an important part of the cohesive energy of the crystal. The conformational versatility of L-ornithine and α-ketoglutaric acid is illustrated by the present results and crystal structures available from the Cambridge Structural Database. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

The purification, crystallization and preliminary structural characterization of FAD-dependent monooxygenase PhzS, a phenazine-modifying enzyme from Pseudomonas aeruginosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gohain, Neelakshi; Thomashow, Linda S.; USDA Agricultural Research Service, Root Disease and Biological Control Research Unit, Pullman, Washington 99164-6430

2006-10-01

PhzS, an FAD-dependent monooxygenase that catalyzes a reaction involved in the biosynthesis of the virulence factor pyocyanin in P. aeruginosa, was cloned, overexpressed and crystallized. Data collection from native and seleno-l-methionine-labelled crystals is reported. The blue chloroform-soluble bacterial metabolite pyocyanin (1-hydroxy-5-methyl-phenazine) contributes to the survival and virulence of Pseudomonas aeruginosa, an important Gram-negative opportunistic pathogen of humans and animals. Little is known about the two enzymes, designated PhzM and PhzS, that function in the synthesis of pyocyanin from phenazine-1-carboxylic acid. In this study, the FAD-dependent monooxygenase PhzS was purified and crystallized from lithium sulfate/ammonium sulfate/sodium citrate pH 5.5. Native crystalsmore » belong to space group C2, with unit-cell parameters a = 144.2, b = 96.2, c = 71.7 Å, α = γ = 90, β = 110.5°. They contain two monomers of PhzS in the asymmetric unit and diffract to a resolution of 2.4 Å. Seleno-l-methionine-labelled PhzS also crystallizes in space group C2, but the unit-cell parameters change to a = 70.6, b = 76.2, c = 80.2 Å, α = γ = 90, β = 110.5° and the diffraction limit is 2.7 Å.« less

Crystallization and preliminary crystallographic analysis of an Enterococcus faecalis repressor protein, CylR2, involved in regulating cytolysin production through quorum-sensing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ni, Shuisong; McAteer, Kathleen; Bussiere, Dirksen E.

2004-06-01

CylR2 is one of the two regulatory proteins associated with the quorum-sensing-dependent synthesis of cytolysin for the common pathogen Enterococcus faecalis. The protein was expressed with a C-terminal 6-histidine tag and purified to homogeneity with a cobalt affinity column followed by another size exclusion column. Both native and SeMet proteins were crystallized. A complete X-ray diffraction data set from the native crystal was collected to 2.3 resolution. The crystal was tetragonal, belonging to space group P41/43, with unit-cell dimensions a=b=66.2 , c=40.9 and a=b=g=90. The asymmetric unit contained two molecules of CylR2.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Cloning, expression, purification, crystallization and preliminary X-ray crystallographic study of DHNA synthetase from Geobacillus kaustophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaujia, Shankar Prasad; Ranjani, Chellamuthu Vasuki; Jeyakanthan, Jeyaraman

2007-02-01

DHNA synthetase from G. kaustophilus has been cloned, expressed, purified and crystallized. The aerobic Gram-positive bacterium Geobacillus kaustophilus is a bacillus species that was isolated from deep-sea sediment from the Mariana Trench. 1,4-Dihydroxy-2-naphthoate (DHNA) synthetase plays a vital role in the biosynthesis of menaquinone (vitamin K{sub 2}) in this bacterium. DHNA synthetase from Geobacillus kaustophilus was crystallized in the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 77.01, b = 130.66, c = 131.69 Å. The crystal diffracted to a resolution of 2.2 Å. Preliminary studies and molecular-replacement calculations reveal the presence of three monomers in the asymmetricmore » unit.« less

Growth and characterization of pure and glycine doped cadmium thiourea sulphate (GCTS) crystals

NASA Astrophysics Data System (ADS)

Lawrence, M.; Thomas Joseph Prakash, J.

2012-06-01

The pure and glycine doped cadmium thiourea sulphate (GCTS) single crystals were grown successfully by slow evaporation method at room temperature. The concentration of dopant in the mother solution was 1 mol%. There is a change in unit cell. The Fourier transform infrared spectroscopy study confirms the incorporation of glycine into CTS crystal. The doped crystals are optically better and more transparent than the pure ones. The dopant increases the hardness value of the material. The grown crystals were also subjected to thermal and NLO studies.

Crystal Model Kits for Use in the General Chemistry Laboratory.

ERIC Educational Resources Information Center

Kildahl, Nicholas J.; And Others

1986-01-01

Dynamic crystal model kits are described. Laboratory experiments in which students use these kits to build models have been extremely successful in providing them with an understanding of the three-dimensional structures of the common cubic unit cells as well as hexagonal and cubic closest-packing of spheres. (JN)

Crystallization and preliminary X-ray diffraction study of phosphopantetheine adenylyltransferase from M. tuberculosis crystallizing in space group P3{sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, V. I., E-mail: tostars@mail.ru; Chupova, L. A.; Esipov, R. S.

Crystals of M. tuberculosis phosphopantetheine adenylyltransferase were grown in microgravity by the capillary counter-diffusion method through a gel layer. The X-ray diffraction data set suitable for the determination of the three-dimensional structure at atomic resolution was collected from one crystal at the Spring-8 synchrotron facility to 2.00-Å resolution. The crystals belong to sp. gr. P3{sub 2} and have the following unit-cell parameters: a = b = 106.47 Å, c = 71.32 Å, α = γ = 90°, β = 120°. The structure was solved by the molecular-replacement method. There are six subunits of the enzyme comprising a hexamer per asymmetricmore » unit. The hexamer is a biologically active form of phosphopantetheine adenylyltransferase from M. tuberculosis.« less

Crystallization and preliminary X-ray diffraction studies of θ-toxin (perfringolysin O), a pore-forming cytolysin of Clostridium perfringens

NASA Astrophysics Data System (ADS)

Sugahara, Mitsuaki; Sekino-Suzuki, Naoko; Ohno-Iwashita, Yoshiko; Miki, Kunio

1996-10-01

θ-Toxin (perfringolysin O), a cholesterol-binding, pore-forming cytolysin of Clostridium perfringens type A was crystallized by the vapor diffusion procedure using polyethyleneglycol 4000 and sodium chloride as precipitants in 2-(cyclohexylamino)ethanesulfonic acid (CHES) buffer at pH 9.5. The diffraction patterns of precession photographs indicated that the crystals belong to the orthorhombic system and the space group C222 1 with unit-cell dimensions of a = 47.7 Å, b = 182.0 Å and c = 175.8 Å. Assuming that the asymmetric unit contains one or two molecules (Mw 52 700), the Vm value is calculated as 3.6 or 1.8 Å 3/dalton, respectively. The crystals diffract X-rays to at least 3 Å resolution and are suitable for high resolution X-ray crystal structure determination.

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.

PubMed

Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B

1994-05-13

Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.

Crystallization and preliminary X-ray analysis of the Man(α1-2)Man-specific lectin from Bowringia mildbraedii in complex with its carbohydrate ligand

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garcia-Pino, Abel; Loris, Remy; Wyns, Lode

2005-10-01

The lectin from the Nigerian legume B. mildbraedii was crystallized in complex with Man(α1-2)Man and data were collected to a resolution of 1.90 Å using synchrotron radiation. The lectin from Bowringia mildbraedii seeds crystallizes in the presence of the disaccharide Man(α1-2)Man. The best crystals grow at 293 K within four weeks after a pre-incubation at 277 K to induce nucleation. A complete data set was collected to a resolution of 1.90 Å using synchrotron radiation. The crystals belong to space group I222, with unit-cell parameters a = 66.06, b = 86.35, c = 91.76 Å, and contain one lectin monomermore » in the asymmetric unit.« less

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

Crystallization and preliminary X-ray crystallographic analysis of the extracellular domain of LePRK2 from Lycopersicon esculentum.

PubMed

Xu, Anbi; Huang, Laiqiang

2014-02-01

The tomato (Lycopersicon esculentum) pollen-specific receptor kinase 2 (LePRK2) is a member of the large receptor-like kinase (RLK) family and is expressed specifically in mature pollen and pollen tubes in L. esculentum. Like other RLKs, LePRK2 contains a characteristic N-terminal leucine-rich repeat (LRR) extracellular domain, the primary function of which is in protein-protein interactions. The LePRK2 LRR is likely to bind candidate ligands from the external environment, leading to a signal transduction cascade required for successful pollination. LePRK2-LRR was purified using an insect-cell secretion expression system and was crystallized using the vapour-diffusion method. The crystals diffracted to a resolution of 2.50 Å and belonged to space group I4(1)22, with unit-cell parameters a = b = 93.94, c = 134.44 Å and one molecule per asymmetric unit.

Unified structure theory of icosahedral quasicrystals: Evidence from neutron powder diffraction patterns that AlCrFeMnSi, AlCuLiMg, and TiNiFeSi icosahedral quasicrystals are twins of cubic crystals containing about 820 or 1012 atoms in a primitive unit cube

PubMed Central

Pauling, Linus

1988-01-01

A unified structure theory of icosahedral quasicrystals, combining the twinned-cubic-crystal theory and the Penrose-tiling-six-dimensional-projection theory, is described. Values of the primitive-cubic lattice constant for several quasicrystals are evaluated from x-ray and neutron diffraction data. The fact that the low-angle diffraction maxima can be indexed with cubic unit cells provides additional support for the twinned-cubic-crystal theory of icosahedral quasicrystals. PMID:16593990

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

A flexible optically re-writable color liquid crystal display

NASA Astrophysics Data System (ADS)

Zhang, Yihong; Sun, Jiatong; Liu, Yang; Shang, Jianhua; Liu, Hao; Liu, Huashan; Gong, Xiaohui; Chigrinov, Vladimir; Kowk, Hoi Sing

2018-03-01

It is very difficult to make a liquid crystal display (LCD) that is flexible. However, for an optically re-writable LCD (ORWLCD), only the spacers and the substrates need to be flexible because the driving unit and the display unit are separate and there are no electronics in the display part of ORWLCD. In this paper, three flexible-spacer methods are proposed to achieve this goal. A cholesteric liquid crystal colored mirror with a polarizer behind it is used as the colored reflective backboard of an ORWLCD. Polyethersulfone substrates and flexible spacers are used to make the optically re-writable cell insensitive to mechanical force.

X-ray diffraction measurement of cosolvent accessible volume in rhombohedral insulin crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soares, Alexei S.; Caspar, Donald L. D.

We report x-ray crystallographic measurement of the number of solvent electrons in the unit cell of a protein crystal equilibrated with aqueous solutions of different densities provides information about preferential hydration in the crystalline state. Room temperature and cryo-cooled rhombohedral insulin crystals were equilibrated with 1.2 M trehalose to study the effect of lowered water activity. The native and trehalose soaked crystals were isomorphous and had similar structures. Including all the low resolution data, the amplitudes of the structure factors were put on an absolute scale (in units of electrons per asymmetric unit) by constraining the integrated number of electronsmore » inside the envelope of the calculated protein density map to equal the number deduced from the atomic model. This procedure defines the value of F(0 0 0), the amplitude at the origin of the Fourier transform, which is equal to the total number of electrons in the asymmetric unit (i.e. protein plus solvent). Comparison of the F(0 0 0) values for three isomorphous pairs of room temperature insulin crystals, three with trehalose and three without trehalose, indicates that 75 ± 12 electrons per asymmetric unit were added to the crystal solvent when soaked in 1.2 M trehalose. If all the water in the crystal were available as solvent for the trehalose, 304 electrons would have been added. Thus, the co-solvent accessible volume is one quarter of the total water in the crystal. Finally, determination of the total number of electrons in a protein crystal is an essential first step for mapping the average density distribution of the disordered solvent.« less

X-ray diffraction measurement of cosolvent accessible volume in rhombohedral insulin crystals

DOE PAGES

Soares, Alexei S.; Caspar, Donald L. D.

2017-08-31

We report x-ray crystallographic measurement of the number of solvent electrons in the unit cell of a protein crystal equilibrated with aqueous solutions of different densities provides information about preferential hydration in the crystalline state. Room temperature and cryo-cooled rhombohedral insulin crystals were equilibrated with 1.2 M trehalose to study the effect of lowered water activity. The native and trehalose soaked crystals were isomorphous and had similar structures. Including all the low resolution data, the amplitudes of the structure factors were put on an absolute scale (in units of electrons per asymmetric unit) by constraining the integrated number of electronsmore » inside the envelope of the calculated protein density map to equal the number deduced from the atomic model. This procedure defines the value of F(0 0 0), the amplitude at the origin of the Fourier transform, which is equal to the total number of electrons in the asymmetric unit (i.e. protein plus solvent). Comparison of the F(0 0 0) values for three isomorphous pairs of room temperature insulin crystals, three with trehalose and three without trehalose, indicates that 75 ± 12 electrons per asymmetric unit were added to the crystal solvent when soaked in 1.2 M trehalose. If all the water in the crystal were available as solvent for the trehalose, 304 electrons would have been added. Thus, the co-solvent accessible volume is one quarter of the total water in the crystal. Finally, determination of the total number of electrons in a protein crystal is an essential first step for mapping the average density distribution of the disordered solvent.« less

3D-Printing Crystallographic Unit Cells for Learning Materials Science and Engineering

ERIC Educational Resources Information Center

Rodenbough, Philip P.; Vanti, William B.; Chan, Siu-Wai

2015-01-01

Introductory materials science and engineering courses universally include the study of crystal structure and unit cells, which are by their nature highly visual 3D concepts. Traditionally, such topics are explored with 2D drawings or perhaps a limited set of difficult-to-construct 3D models. The rise of 3D printing, coupled with the wealth of…

Crystallization and preliminary X-ray diffraction analysis of restriction endonuclease EcoRII

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Meehan, E.; Pusey, M. L.; Chen, L.

1999-01-01

Crystals of the restriction endonuclease EcoRII have been obtained by the vapor-diffusion technique in the presence of ammonium sulfate or polyethylene glycol. The best crystals were grown with ammonium sulfate as a precipitant. Crystals with dimensions of up to 0.6 x 0. 6 x 0.6 mm have been observed. The crystals diffract to about 4.0 A resolution at a cryo-temperature of 100 K using a rotating-anode X-ray source and a Rigaku R-AXIS IV imaging-plate detector. The space group has been determined to be either I23 or I2(1)3, with unit-cell parameters a = b = c = 160.3 A, alpha = beta = gamma = 90 degrees. The crystal asymmetric unit contains two protein molecules, and self-rotation function analysis shows a pseudo-twofold symmetry relating the two monomers. Attempts to improve the resolution of crystal diffraction and to search for heavy-atom derivatives are under way.

Crystallization and preliminary X-ray crystallographic analysis of carboxyl-terminal region 4 of SigR from Streptomyces coelicolor A3(2)

PubMed Central

Kim, Keon Young; Kim, Sunmin; Park, Jeong Kuk; Song, HyoJin; Park, SangYoun

2014-01-01

Full-length SigR from Streptomyces coelicolor A3(2) was overexpressed in Escherichia coli, purified and submitted to crystallization trials using either polyethylene glycol 3350 or 4000 as a precipitant. X-ray diffraction data were collected to 2.60 Å resolution under cryoconditions using synchrotron X-rays. The crystal packs in space group P43212, with unit-cell parameters a = b = 42.14, c = 102.02 Å. According to the Matthews coefficient, the crystal asymmetric unit cannot contain the full-length protein. Molecular replacement with the known structures of region 2 and region 4 as independent search models indicates that the crystal contains only the −35 element-binding carboxyl-terminal region 4 of full-length SigR. Mass-spectrometric analysis of the harvested crystal confirms this, suggesting a crystal volume per protein weight (V M) of 2.24 Å3 Da−1 and 45.1% solvent content. PMID:24915084

Monoclinic deformation of calcite crystals at ambient conditions

NASA Astrophysics Data System (ADS)

Przeniosło, R.; Fabrykiewicz, P.; Sosnowska, I.

2016-09-01

High resolution synchrotron radiation powder diffraction shows that the average crystal structure of calcite at ambient conditions is described with the trigonal space group R 3 bar c but there is a systematic hkl-dependent Bragg peak broadening. A modelling of this anisotropic peak broadening with the microstrain model from Stephens (1999) [15] is presented. The observed lattice parameters' correlations can be described by assuming a monoclinic-type deformation of calcite crystallites. A quantitative model of this monoclinic deformation observed at ambient conditions is described with the space group C 2 / c . The monoclinic unit cell suggested at ambient conditions is related with the monoclinic unit cell reported in calcite at high pressure (Merrill and Bassett (1975) [10]).

Towards predictive molecular dynamics simulations of DNA: electrostatics and solution/crystal environments

NASA Astrophysics Data System (ADS)

Babin, Volodymr; Baucom, Jason; Darden, Thomas; Sagui, Celeste

2006-03-01

We have investigated to what extend molecular dynamics (MD) simulatons can reproduce DNA sequence-specific features, given different electrostatic descriptions and different cell environments. For this purpose, we have carried out multiple unrestrained MD simulations of the duplex d(CCAACGTTGG)2. With respect to the electrostatic descriptions, two different force fields were studied: a traditional description based on atomic point charges and a polarizable force field. With respect to the cell environment, the difference between crystal and solution environments is emphasized, as well as the structural importance of divalent ions. By imposing the correct experimental unit cell environment, an initial configuration with two ideal B-DNA duplexes in the unit cell is shown to converge to the crystallographic structure. To the best of our knowledge, this provides the first example of a multiple nanosecond MD trajectory that shows and ideal structure converging to an experimental one, with a significant decay of the RMSD.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer.

PubMed

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-05-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq-RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq-RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 A, while the type 2 Hfq-RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 A. Diffraction data were collected to a resolution of 2.20 A from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis.

Crystallization and preliminary crystallographic analysis of d-alanine-d-alanine ligase from Streptococcus mutans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen

2007-09-01

A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous proteinmore » was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.« less

Crystallization and preliminary X-ray analysis of the isomerase domain of glucosamine-6-phosphate synthase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Olchowy, Jaroslaw; Jedrzejczak, Robert; Milewski, Slawomir

2005-11-01

The isomerase domain of glucosamine-6-phosphate synthase from C. albicans has been crystallized and X-ray diffraction data have been collected. Preliminary analysis of the data reveals the oligomeric structure of the eukaryotic synthase to be a ‘dimer’ of prokaryotic-like dimers. Glucosamine-6-phosphate synthase (EC 2.6.1.16) catalyses the first and practically irreversible step in the hexosamine metabolism pathway, the end product of which, uridine 5′-diphospho-N-acetyl d-glucosamine, is an essential substrate for assembly of the cell wall. The isomerase domain, consisting of residues 346–712 (42 kDa), of glucosamine-6-phosphate synthase from Candida albicans has been crystallized. X-ray analysis revealed that the crystals belonged to spacemore » group I4, with unit-cell parameters a = b = 149, c = 103 Å. Diffraction data were collected to 3.8 Å. Preliminary results from molecular replacement using the homologous bacterial monomer reveal that the asymmetric unit contains two monomers that resemble a bacterial dimer. The crystal lattice consists of pairs of such symmetry-related dimers forming elongated tetramers.« less

Snynthesis and magnetization of BaLn2O4 (Ln = lanthanide)

NASA Astrophysics Data System (ADS)

Lundberg, Matthew

The BaLn2O4 family has been synthesized successfully as single crystals by the flux-growth method. The phases crystallize in the CaV2O4 structure prototype in space group Pnma (# 62). The structure has been studied using single-crystal x-ray diffraction, and stoichiometry confirmed with EDS, and the unit cell parameters and atomic positions have been determined for the whole lanthanide series (with the exception of the Lu compound). The effects of the lanthanide ionic radius on the atomic positions in the unit cell has been studied in terms of fractional atomic coordinates, bond lengths and angles, and bond valence sums. Magnetic measurements have been performed on the series with the exception of the La, Eu, and Lu members in the form of susceptibility versus temperature. The crystals all show signs of geometric antiferromagnetic frustration with the Neel temperatures significantly below the temperature predicted by the Weiss constant. Additionally some members of the family, namely BaCe2O4, BaNd2O4, BaPr 2O4, BaSm2O4, BaTb2O 4, and BaYb2O4 show significant crystal field splitting, that causes deviation from Currie-Weiss behavior.

Crystallization and X-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase.

PubMed

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; Stojanoff, Vivian; Rodríguez-Sanoja, Romina; Rudiño-Piñera, Enrique; Sánchez, Sergio

2015-09-01

Labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg(2+) (LrdC-Mg(2+)) and in complex with inorganic pyrophosphate (PPi) (LrdC-Mg(2+)-PPi). Crystals of native LrdC-Mg(2+) diffracted to 2.50 Å resolution and belonged to the trigonal space group P3221, with unit-cell parameters a = b = 107.1, c = 89.2 Å. Crystals of the LrdC-Mg(2+)-PPi complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3221. Crystals of the LrdC-Mg(2+)-PPi complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P21, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.

Crystallization of the Nonameric Small Terminase Subunit of Bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingolani

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

Crystallization of the Nonameric Small Terminase Subunit of bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingoloni

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

High-pressure crystal structure of elastically isotropic CaTiO3 perovskite under hydrostatic and non-hydrostatic conditions.

PubMed

Zhao, Jing; Ross, Nancy L; Wang, Di; Angel, Ross J

2011-11-16

The structural evolution of orthorhombic CaTiO3 perovskite has been studied using high-pressure single-crystal x-ray diffraction under hydrostatic conditions up to 8.1 GPa and under a non-hydrostatic stress field formed in a diamond anvil cell (DAC) up to 4.7 GPa. Under hydrostatic conditions, the TiO6 octahedra become more tilted and distorted with increasing pressure, similar to other 2:4 perovskites. Under non-hydrostatic conditions, the experiments do not show any apparent difference in the internal structural variation from hydrostatic conditions and no additional tilts and distortions in the TiO6 octahedra are observed, even though the lattice itself becomes distorted due to the non-hydrostatic stress. The similarity between the hydrostatic and non-hydrostatic cases can be ascribed to the fact that CaTiO3 perovskite is nearly elastically isotropic and, as a consequence, its deviatoric unit-cell volume strain produced by the non-hydrostatic stress is very small; in other words, the additional octahedral tilts relevant to the extra unit-cell volume associated with the deviatoric unit-cell volume strain may be totally neglected. This study further addresses the role that three factors--the elastic properties, the crystal orientation and the pressure medium--have on the structural evolution of an orthorhombic perovskite loaded in a DAC under non-hydrostatic conditions. The influence of these factors can be clearly visualized by plotting the three-dimensional distribution of the deviatoric unit-cell volume strain in relation to the cylindrical axis of the DAC and indicates that, if the elasticity of a perovskite is nearly isotropic as it is for CaTiO3, the other two factors become relatively insignificant.

New multicell model for describing the atomic structure of La{sub 3}Ga{sub 5}SiO{sub 14} piezoelectric crystal: Unit cells of different compositions in the same single crystal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dudka, A. P., E-mail: dudka@ns.crys.ras.ru

2017-03-15

Accurate X-ray diffraction study of langasite (La{sub 3}Ga{sub 5}SiO{sub 14}) single crystal has been performed using the data obtained on a diffractometer equipped with a CCD area detector at 295 and 90.5 K. Within the known La{sub 3}Ga{sub 5}SiO{sub 14} model, Ga and Si cations jointly occupy the 2d site. A new model of a “multicell” consisting of two different unit cells is proposed. Gallium atoms occupy the 2d site in one of these cells, and silicon atoms occupy this site in the other cell; all other atoms correspondingly coordinate these cations. This structure implements various physical properties exhibited bymore » langasite family crystals. The conclusions are based on processing four data sets obtained with a high resolution (sin θ/λ ≤ 1.35 Å{sup –1}), the results reproduced in repeated experiments, and the high relative precision of the study (sp. gr. P321, Z = 1; at 295 K, a = 8.1652(6) Å, c = 5.0958(5) Å, R/wR = 0.68/0.68%, 3927 independent reflections; at 90.5 K, a = 8.1559(4) Å, c = 5.0913(6) Å, R/wR = 0.92/0.93%, 3928 reflections).« less

HicAB toxin-antitoxin complex from Escherichia coli: expression and crystallization.

PubMed

Yang, Jingsi; Xu, Bingshuang; Gao, Zengqiang; Zhou, Ke; Liu, Peng; Dong, Yuhui; Zhang, Jianjun; Liu, Quansheng

2017-09-01

Toxin-antitoxin (TA) systems are widespread in both bacteria and archaea, where they enable cells to adapt to environmental cues. TA systems play crucial roles in various cellular processes, such as programmed cell death, cell growth, persistence and virulence. Here, two distinct forms of the type II toxin-antitoxin complex HicAB were identified and characterized in Escherichia coli K-12, and both were successfully overexpressed and purified. The two proposed forms, HicAB L and HicAB S , differed in the presence or absence of a seven-amino-acid segment at the N-terminus in the antitoxin HicB. The short form HicAB S readily crystallized under the conditions 0.1 M Tris-HCl pH 8.0, 20%(w/v) PEG 6000, 0.2 M ammonium sulfate. The HicAB S crystal diffracted and data were collected to 2.5 Å resolution. The crystal belonged to space group I222 or I2 1 2 1 2 1 , with unit-cell parameters a = 67.04, b = 66.31, c = 120.78 Å. Matthews coefficient calculation suggested the presence of two molecules each of HicA and HicB S in the asymmetric unit, with a solvent content of 55.28% and a Matthews coefficient (V M ) of 2.75 Å 3  Da -1 .

CFA-2 and CFA-3 (Coordination Framework Augsburg University-2 and -3); novel MOFs assembled from trinuclear Cu(I)/Ag(I) secondary building units and 3,3',5,5'-tetraphenyl-bipyrazolate ligands.

PubMed

Grzywa, Maciej; Geßner, Christof; Denysenko, Dmytro; Bredenkötter, Björn; Gschwind, Fabienne; Fromm, Katharina M; Nitek, Wojciech; Klemm, Elias; Volkmer, Dirk

2013-05-21

The syntheses of H2-phbpz, [Cu2(phbpz)]·2DEF·MeOH (CFA-2) and [Ag2(phbpz)] (CFA-3) (H2-phbpz = 3,3',5,5'-tetraphenyl-1H,1'H-4,4'-bipyrazole) compounds and their crystal structures are described. The Cu(I) containing metal-organic framework CFA-2 crystallizes in the tetragonal crystal system, within space group I4(1)/a (no. 88) and the following unit cell parameters: a = 30.835(14), c = 29.306(7) Å, V = 27 865(19) Å(3). CFA-2 features a flexible 3-D three-connected two-fold interpenetrated porous structure constructed of triangular Cu(I) subunits. Upon exposure to different kinds of liquids (MeOH, EtOH, DMF, DEF) CFA-2 shows pronounced breathing effects. CFA-3 crystallizes in the monoclinic crystal system, within space group P2(1)/c (no. 14) and the following unit cell parameters: a = 16.3399(3), b = 32.7506(4), c = 16.2624(3) Å, β = 107.382(2)°, V = 8305.3(2) Å(3). In contrast to the former compound, CFA-3 features a layered 2-D three-connected structure constructed from triangular Ag(i) subunits. Both compounds are characterized by elemental and thermogravimetric analyses, single crystal structure analysis and X-ray powder diffraction, FTIR- and fluorescence spectroscopy. Preliminary results on oxygen activation in CFA-2 are presented and potential improvements in terms of framework robustness and catalytic efficiency are discussed.

Shape optimization of solid-air porous phononic crystal slabs with widest full 3D bandgap for in-plane acoustic waves

NASA Astrophysics Data System (ADS)

D'Alessandro, Luca; Bahr, Bichoy; Daniel, Luca; Weinstein, Dana; Ardito, Raffaele

2017-09-01

The use of Phononic Crystals (PnCs) as smart materials in structures and microstructures is growing due to their tunable dynamical properties and to the wide range of possible applications. PnCs are periodic structures that exhibit elastic wave scattering for a certain band of frequencies (called bandgap), depending on the geometric and material properties of the fundamental unit cell of the crystal. PnCs slabs can be represented by plane-extruded structures composed of a single material with periodic perforations. Such a configuration is very interesting, especially in Micro Electro-Mechanical Systems industry, due to the easy fabrication procedure. A lot of topologies can be found in the literature for PnCs with square-symmetric unit cell that exhibit complete 2D bandgaps; however, due to the application demand, it is desirable to find the best topologies in order to guarantee full bandgaps referred to in-plane wave propagation in the complete 3D structure. In this work, by means of a novel and fast implementation of the Bidirectional Evolutionary Structural Optimization technique, shape optimization is conducted on the hole shape obtaining several topologies, also with non-square-symmetric unit cell, endowed with complete 3D full bandgaps for in-plane waves. Model order reduction technique is adopted to reduce the computational time in the wave dispersion analysis. The 3D features of the PnC unit cell endowed with the widest full bandgap are then completely analyzed, paying attention to engineering design issues.

Crystallization and preliminary crystallographic study of the yeast Malassezia sympodialis allergen Mala s 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vilhelmsson, Monica, E-mail: monica.vilhelmsson@medks.ki.se; Center for Infectious Medicine, Department of Medicine, Karolinska University Hospital, Huddinge, Stockholm; Hallberg, B. Martin

2006-02-01

Crystals of the M. sympodialis allergen Mala s 1 have been obtained using the hanging-drop vapour-diffusion method. A diffraction data set has been collected from native crystals to 1.35 Å resolution. The opportunistic yeast Malassezia sympodialis can act as an allergen and elicit specific IgE- and T-cell reactivity in patients with atopic eczema. The first identified major allergen from M. sympodialis, Mala s 1, is present on the cell surface of the yeast. Recombinant Mala s 1 was expressed in Escherichia coli, purified and refolded in a soluble form. Crystals of Mala s 1 were obtained in 25% PEG 8K,more » 0.2 M (NH{sub 4}){sub 2}SO{sub 4}. Crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 44.4, b = 163.7, c = 50.6 Å, and diffract to 1.35 Å resolution.« less

Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

PubMed Central

Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

2009-01-01

2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Overexpression, crystallization and preliminary X-ray crystallographic analysis of the phosphotriesterase from Mycobacterium tuberculosis.

PubMed

Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin

2013-01-01

Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C222(1), with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data.

Overexpression, crystallization and preliminary X-ray crystallographic analysis of the phosphotriesterase from Mycobacterium tuberculosis

PubMed Central

Zhang, Liang; Chen, Ruyi; Dong, Zhe; Li, Xin

2013-01-01

Organophosphates (OPs) are extremely toxic compounds that are used as insecticides or even as chemical warfare agents. Phosphotriesterases (PHPs) are responsible for the detoxification of OPs by catalysing their degradation. Almost 100 PHP structures have been solved to date, yet the crystal structure of the phosphotriesterase from Mycobacterium tuberculosis (mPHP) remains unavailable. This study reports the first crystallization of mPHP. The crystal belonged to space group C2221, with unit-cell parameters a = 68.03, b = 149.60, c = 74.23 Å, α = β = γ = 90°. An analytical ultracentrifugation experiment suggested that mPHP exists as a dimer in solution, even though one molecule is calculated to be present in the asymmetric unit according to the structural data. PMID:23295488

Purification, partial characterization, crystallization and preliminary X-ray diffraction of a novel cardiotoxin-like basic protein from Naja naja atra (South Anhui) venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rong, Hui; Li, Yan; Lou, Xiao-hua

2007-02-01

A novel cardiotoxin-like basic protein from Naja naja atra was crystallized and diffraction data were collected to 2.35 Å resolution. A novel cardiotoxin-like basic protein was isolated from the venom of the Chinese cobra (Naja naja atra) from the south of Anhui in China. The protein inhibits the expression of vascular endothelial growth factor and basic fibroblast growth factor in human lung cancer cell line H1299 and induces the haemolysis of rabbit erythrocytes under low-lecithin conditions. After a two-step chromatographic purification, the resultant 7 kDa protein was crystallized by the hanging-drop vapour-diffusion method at room temperature. A complete data setmore » was collected to 2.35 Å resolution using an in-house X-ray diffraction system. The crystal belongs to space group P4{sub 1}2{sub 1}2, with unit-cell parameters a = b = 43.2, c = 147.9 Å. There are two molecules in the crystallographic asymmetric unit.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marana, S. R.; Cançado, F. C.; Valério, A. A.

The digestive lysozymes 1 and 2 from M. domestica were crystallized by vapour diffusion. The crystallographic data were processed to a maximum resolution of 1.9 Å in both cases. Lysozymes are mostly known for their defensive role against bacteria, but in several animals lysozymes have a digestive function. Here, the initial crystallographic characterization of two digestive lysozymes from Musca domestica are presented. The proteins were crystallized using the sitting-drop vapour-diffusion method in the presence of ammonium sulfate or PEG/2-propanol as the precipitant. X-ray diffraction data were collected to a maximum resolution of 1.9 Å using synchrotron radiation. The lysozyme 1more » and 2 crystals belong to the monoclinic space group P2{sub 1} (unit-cell parameters a = 36.52, b = 79.44, c = 45.20 Å, β = 102.97°) and the orthorhombic space group P2{sub 1}2{sub 1}2 (unit-cell parameters a = 73.90, b = 96.40, c = 33.27 Å), respectively. The crystal structures were solved by molecular replacement and structure refinement is in progress.« less

High-level expression, purification, crystallization and preliminary X-ray crystallographic studies of the receptor binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Gao, Xiaoli; Qin, Lin

2010-12-01

Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and can cause neuroparalytic disease botulism. Due to the limitations of production and manipulation of holoenzymes, expressing non-toxic heavy chain receptor binding domains (HCR) has become a common strategy for vaccine and antibody development. Meanwhile, large quantities and highly purified soluble proteins are required for research areas such as antibody maturation and structural biology. We present high level expression and purification of the BoNT serotype D HCR in E. coli using a codon-optimized cDNA. By varying expression conditions, especially at low temperature, the protein was expressed at a high level withmore » high solubility. About 150-200 mg protein was purified to >90% purity from 1 L cell culture. The recombinant D_HCR was crystallized and the crystals diffracted to 1.65 Å resolution. The crystals belong to space group P212121 with unit cell dimensions a = 60.8 Å, b = 89.7 Å, c = 93.9 Å. Preliminary crystallographic data analysis revealed one molecule in asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of a putative feruloyl esterase from Talaromyces cellulolyticus

PubMed Central

Watanabe, Masahiro; Ishikawa, Kazuhiko

2014-01-01

Feruloyl esterase (FAE; EC 3.1.1.73) catalyzes the cleavage of the ester bond between ferulic acid and polysaccharides in plant cell walls, and thus holds significant potential for the industrial utilization of biomass saccharification. A feruloyl esterase was identified from the genome database of Talaromyces cellulolyticus (formerly known as Acremonium cellulolyticus). The gene consists of the catalytic domain and a carbohydrate-binding module connected through a serine/threonine-rich linker region. The recombinant enzyme was prepared, purified and crystallized at 293 K using 0.1 M imidazole pH 8.0, 0.2 M calcium acetate, 14% PEG 8000 as the precipitant. The crystal diffracted to 2.6 Å resolution and the crystal system is primitive orthorhombic, with unit-cell parameters a = 90.9, b = 123.4, c = 135.4 Å. Four molecules are assumed to be present per asymmetric unit, corresponding to a Matthews coefficient of 2.50 Å3 Da−1 and a solvent content of 50.88%(v/v). PMID:25484222

Crystallization and preliminary X-ray crystallographic analysis of a putative feruloyl esterase from Talaromyces cellulolyticus.

PubMed

Watanabe, Masahiro; Ishikawa, Kazuhiko

2014-12-01

Feruloyl esterase (FAE; EC 3.1.1.73) catalyzes the cleavage of the ester bond between ferulic acid and polysaccharides in plant cell walls, and thus holds significant potential for the industrial utilization of biomass saccharification. A feruloyl esterase was identified from the genome database of Talaromyces cellulolyticus (formerly known as Acremonium cellulolyticus). The gene consists of the catalytic domain and a carbohydrate-binding module connected through a serine/threonine-rich linker region. The recombinant enzyme was prepared, purified and crystallized at 293 K using 0.1 M imidazole pH 8.0, 0.2 M calcium acetate, 14% PEG 8000 as the precipitant. The crystal diffracted to 2.6 Å resolution and the crystal system is primitive orthorhombic, with unit-cell parameters a = 90.9, b = 123.4, c = 135.4 Å. Four molecules are assumed to be present per asymmetric unit, corresponding to a Matthews coefficient of 2.50 Å(3) Da(-1) and a solvent content of 50.88%(v/v).

Use of a miniature diamond-anvil cell in high-pressure single-crystal neutron Laue diffraction

PubMed Central

Binns, Jack; Kamenev, Konstantin V.; McIntyre, Garry J.; Moggach, Stephen A.; Parsons, Simon

2016-01-01

The first high-pressure neutron diffraction study in a miniature diamond-anvil cell of a single crystal of size typical for X-ray diffraction is reported. This is made possible by modern Laue diffraction using a large solid-angle image-plate detector. An unexpected finding is that even reflections whose diffracted beams pass through the cell body are reliably observed, albeit with some attenuation. The cell body does limit the range of usable incident angles, but the crystallographic completeness for a high-symmetry unit cell is only slightly less than for a data collection without the cell. Data collections for two sizes of hexamine single crystals, with and without the pressure cell, and at 300 and 150 K, show that sample size and temperature are the most important factors that influence data quality. Despite the smaller crystal size and dominant parasitic scattering from the diamond-anvil cell, the data collected allow a full anisotropic refinement of hexamine with bond lengths and angles that agree with literature data within experimental error. This technique is shown to be suitable for low-symmetry crystals, and in these cases the transmission of diffracted beams through the cell body results in much higher completeness values than are possible with X-rays. The way is now open for joint X-ray and neutron studies on the same sample under identical conditions. PMID:27158503

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

PubMed

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-08-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

PubMed Central

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-01-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

2006-09-01

The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

PubMed Central

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

2013-01-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Purification, crystallization and preliminary X-ray structural studies of a 7.2 kDa cytotoxin isolated from the venom of Daboia russelli russelli of the Viperidae family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roy Choudhury, Subhasree; Gomes, Aparna; Gomes, Antony

2006-03-01

A cytotoxin from Indian Russell’s viper (D. russelli russelli) venom having multifunctional activity has been crystallized in space group P4{sub 1}. Larger crystals diffracted to 1.5 Å but were found to be twinned; preliminary data were therefore collected (2.93 Å) from a smaller crystal. A cytotoxin (MW 7.2 kDa) from Indian Russell’s viper (Daboia russelli russelli) venom possessing antiproliferative activity, cardiotoxicity, neurotoxicity and myotoxicity has been purified, characterized and crystallized. The crystals belong to the tetragonal space group P4{sub 1}, with unit-cell parameters a = b = 47.94, c = 50.2 Å. Larger crystals, which diffracted to 1.5 Å, weremore » found to be twinned; diffraction data were therefore collected to 2.93 Å resolution using a smaller crystal. Molecular-replacement calculations identified two molecules of the protein in the asymmetric unit, which is in accordance with the calculated V{sub M} value.« less

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

Crystallization of SHARPIN using an automated two-dimensional grid screen for optimization.

PubMed

Stieglitz, Benjamin; Rittinger, Katrin; Haire, Lesley F

2012-07-01

An N-terminal fragment of human SHARPIN was recombinantly expressed in Escherichia coli, purified and crystallized. Crystals suitable for X-ray diffraction were obtained by a one-step optimization of seed dilution and protein concentration using a two-dimensional grid screen. The crystals belonged to the primitive tetragonal space group P4(3)2(1)2, with unit-cell parameters a = b = 61.55, c = 222.81 Å. Complete data sets were collected from native and selenomethionine-substituted protein crystals at 100 K to 2.6 and 2.0 Å resolution, respectively.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

PubMed

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-03-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

Crystallization and preliminary X-ray analysis of a family 19 glycosyl hydrolase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huet, Joëlle, E-mail: jhuet@ulb.ac.be; Azarkan, Mohamed; Looze, Yvan

2008-05-01

A chitinase isolated from the latex of the tropical species Carica papaya has been crystallized. The addition of N-acetyl-d-glucosamine to the crystallization solution has improved the diffraction quality resolution of the crystal to 1.8 Å resolution. A chitinase isolated from the latex of the tropical species Carica papaya has been purified to homogeneity and crystallized. This enzyme belongs to glycosyl hydrolase family 19 and exhibits exceptional resistance to proteolysis. The initially observed crystals, which diffracted to a resolution of 2.0 Å, were improved through modification of the crystallization protocol. Well ordered crystals were subsequently obtained using N-acetyl-d-glucosamine, the monomer resultingmore » from the hydrolysis of chitin, as an additive to the crystallization solution. Here, the characterization of a chitinase crystal that belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 69.08, b = 44.79, c = 76.73 Å, β = 95.33° and two molecules per asymmetric unit, is reported. Diffraction data were collected to a resolution of 1.8 Å. Structure refinement is currently in progress.« less

Expression, purification, crystallization and preliminary X-ray analysis of the Met244Ala variant of catalase–peroxidase (KatG) from the haloarchaeon Haloarcula marismortui

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ten-i, Tomomi; Kumasaka, Takashi; Higuchi, Wataru

2007-11-01

The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. The covalent modification of the side chains of Trp95, Tyr218 and Met244 within the active site of Haloarcula marismortui catalase–peroxidase (KatG) appears to be common to all KatGs and has been demonstrated to be particularly significant formore » its bifunctionality [Smulevich et al. (2006 ▶), J. Inorg. Biochem.100, 568–585; Jakopitsch, Kolarich et al. (2003 ▶), FEBS Lett.552, 135–140; Jakopitsch, Auer et al. (2003 ▶), J. Biol. Chem.278, 20185–20191; Jakopitsch et al. (2004 ▶), J. Biol. Chem.279, 46082–46095; Regelsberger et al. (2001 ▶), Biochem. Soc. Trans.29, 99–105; Ghiladi, Knudsen et al. (2005 ▶), J. Biol. Chem.280, 22651–22663; Ghiladi, Medzihradzky et al. (2005 ▶), Biochemistry, 44, 15093–15105]. The Met244Ala variant of the H. marismortui KatG enzyme was expressed in haloarchaeal host cells and purified to homogeneity. The variant showed a complete loss of catalase activity, whereas the peroxidase activity of this mutant was highly enhanced owing to an increase in its affinity for the peroxidatic substrate. The variant was crystallized using the hanging-drop vapour-diffusion method with ammonium sulfate and NaCl as precipitants. The reddish-brown rod-shaped crystals obtained belong to the monoclinic space group C2, with unit-cell parameters a = 315.24, b = 81.04, c = 74.77 Å, β = 99.81°. A crystal frozen using lithium sulfate as the cryoprotectant diffracted to beyond 2.0 Å resolution. Preliminary X-ray analysis suggests the presence of a dimer in the asymmetric unit.« less

Crystallization and preliminary X-ray crystallographic analysis of the tRNA-specific adenosine deaminase from Streptococcus pyogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ku, Min-Je; Lee, Won-Ho; Biotechnology and Genetic Engineering, Korea University, Seoul 136-701

2005-04-01

The tRNA-specific adenosine deaminase from the pathogenic bacteria S. pyogenes has been overexpressed and crystallized. The tRNA-specific adenosine deaminase from the pathogenic bacteria Streptococcus pyogenes (spTAD) has been overexpressed in Escherichia coli and crystallized in the presence of Zn{sup 2+} ion at 295 K using ammonium sulfate as a precipitant. Flash-cooled crystals of spTAD diffracted to 2.0 Å using 30%(v/v) glycerol as a cryoprotectant. X-ray diffraction data have been collected to 2.0 Å using synchrotron radiation. The crystal belongs to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 81.042, c = 81.270 Å. Themore » asymmetric unit contains one subunit of spTAD, with a corresponding crystal volume per protein weight (V{sub M}) of 3.3 Å{sup 3} Da{sup −1} and a solvent content of 62.7%.« less

A Polymer Visualization System with Accurate Heating and Cooling Control and High-Speed Imaging

PubMed Central

Wong, Anson; Guo, Yanting; Park, Chul B.; Zhou, Nan Q.

2015-01-01

A visualization system to observe crystal and bubble formation in polymers under high temperature and pressure has been developed. Using this system, polymer can be subjected to a programmable thermal treatment to simulate the process in high pressure differential scanning calorimetry (HPDSC). With a high-temperature/high-pressure view-cell unit, this system enables in situ observation of crystal formation in semi-crystalline polymers to complement thermal analyses with HPDSC. The high-speed recording capability of the camera not only allows detailed recording of crystal formation, it also enables in situ capture of plastic foaming processes with a high temporal resolution. To demonstrate the system’s capability, crystal formation and foaming processes of polypropylene/carbon dioxide systems were examined. It was observed that crystals nucleated and grew into spherulites, and they grew at faster rates as temperature decreased. This observation agrees with the crystallinity measurement obtained with the HPDSC. Cell nucleation first occurred at crystals’ boundaries due to CO2 exclusion from crystal growth fronts. Subsequently, cells were nucleated around the existing ones due to tensile stresses generated in the constrained amorphous regions between networks of crystals. PMID:25915031

Expression, purification and crystallization of a dye-decolourizing peroxidase from Dictyostelium discoideum.

PubMed

Rai, Amrita; Fedorov, Roman; Manstein, Dietmar J

2014-02-01

Dye-decolourizing peroxidases are haem-containing peroxidases with broad substrate specificity. Using H2O2 as an electron acceptor, they efficiently decolourize various dyes that are of industrial and environmental relevance, such as anthraquninone- and azo-based dyes. In this study, the dye-decolourizing peroxidase DdDyP from Dictyostelium discoideum was overexpressed in Escherichia coli strain Rosetta(DE3)pLysS, purified and crystallized using the vapour-diffusion method. A native crystal diffracted to 1.65 Å resolution and belonged to space group P4(1)2(1)2, with unit-cell parameters a = b = 141.03, c = 95.56 Å, α = β = γ = 90°. The asymmetric unit contains two molecules.

Expression, crystallization and preliminary crystallographic data analysis of PigF, an O-­methyltransferase from the prodigiosin-synthetic pathway in Serratia

PubMed Central

Liu, Shaowei; Ran, Tingting; Shen, Xiang; Xu, Langlai; Wang, Weiwu; Xu, Dongqing

2012-01-01

Prodigiosin, which is a member of the prodiginines, is a red linear tripyrrole compound. A gene cluster for the biosynthesis of prodigiosin has been identified in Serratia and most genes in the cluster have been functionally assigned. A bifurcated biosynthetic pathway for prodigiosin has previously been determined. The last step in the biosynthetic pathway of 4-methoxy-2,2′-bipyrrole-5-­carbaldehyde (MBC) is catalyzed by PigF, which transfers a methyl group to 4-­hydroxy-2,2′-bipyrrole-5-carbaldehyde (HBC) to form the terminal product MBC, but its catalytic mechanism is not known. To elucidate its mechanism, recombinant PigF was purified and crystallized. The crystals belonged to space group P21, with unit-cell parameters a = 69.4, b = 52.4, c = 279.2 Å, β = 96.8°. The native crystals may contain six molecules in the asymmetric unit, with a V M of 2.17 Å3 Da−1 and a solvent content of 43.43%. A full data set was collected at 2.6 Å resolution using synchrotron radiation on beamline BL17U of Shanghai Synchrotron Radiation Facility (SSRF), People’s Republic of China. Molecular replacement was unsuccessful. To solve the structure of PigF by experimental phasing, selenomethionine-derivativized protein crystals were prepared from a condition with 0.01 M spermidine as an additive. One crystal diffracted to 1.9 Å resolution and a full data set was collected on beamline BL17U at SSRF. The crystal belonged to space group P21, with unit-cell parameters a = 69.0, b = 52.9, c = 93.4 Å, β = 97.3°. Heavy-atom substructure determination and phasing by SAD clearly showed that the crystal contains two molecules in the asymmetric unit, with a V M of 2.19 Å3 Da−1 and a solvent content of 43.82%. PMID:22869117

Crystals of Human Serum Albumin for Use in Genetic Engineering and Rational Drug Design

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1994-01-01

This invention pertains to crystals of serum albumin and processes for growing them. The purpose of the invention is to provide crystals of serum albumin which can be studied to determine binding sites for drugs. Form 2 crystals grow in the monoclinic space P2(sub 1), and possesses the following unit cell constraints: a = 58.9 +/- 7, b = 88.3 +/- 7, c = 60.7 +/- 7, Beta = 101.0 +/- 2 degrees. One advantage of the invention is that it will allow rational drug design

Crystal growth and characterization of semi organic nonlinear optical (NLO) piperazinium tetrachlorozincate monohydrate (PTCZ) single crystal

NASA Astrophysics Data System (ADS)

Karuppasamy, P.; Pandian, Muthu Senthil; Ramasamy, P.

2018-04-01

The semi-organic single crystal of piperazinium tetrachlorozincate monohydrate (PTCZ) was successfully grown by slow evaporation solution technique (SEST). The grown crystal was subjected to the single crystal XRD studies for confirming the unit cell parameters. The optical quality of the grown crystal was identified by the UV-Vis NIR spectrum analysis and the optical band gap energy was calculated. The photoconductivity study reveals that the grown crystal has positive photoconductive nature. The mechanical stability of the grown crystal was analyzed using Vickers microhardness analyzer. The third-order nonlinear optical properties such as nonlinear refractive index (n2), absorption co-efficient (β) and susceptibility (χ(3)) were studied by Z-scan technique at 640 nm using solid state laser.

Favoured local structures in liquids and solids: a 3D lattice model.

PubMed

Ronceray, Pierre; Harrowell, Peter

2015-05-07

We investigate the connection between the geometry of Favoured Local Structures (FLS) in liquids and the associated liquid and solid properties. We introduce a lattice spin model - the FLS model on a face-centered cubic lattice - where this geometry can be arbitrarily chosen among a discrete set of 115 possible FLS. We find crystalline groundstates for all choices of a single FLS. Sampling all possible FLS's, we identify the following trends: (i) low symmetry FLS's produce larger crystal unit cells but not necessarily higher energy groundstates, (ii) chiral FLS's exhibit peculiarly poor packing properties, (iii) accumulation of FLS's in supercooled liquids is linked to large crystal unit cells, and (iv) low symmetry FLS's tend to find metastable structures on cooling.

Crystal structure and phase transitions of sodium potassium niobate perovskites

NASA Astrophysics Data System (ADS)

Tellier, J.; Malic, B.; Dkhil, B.; Jenko, D.; Cilensek, J.; Kosec, M.

2009-02-01

This paper presents the crystal structure and the phase transitions of K xNa 1- xNbO 3 (0.4 ≤ x ≤ 0.6). X-ray diffraction measurements were used to follow the change of the unit-cell parameters and the symmetry in the temperature range 100-800 K. At room temperature all the compositions exhibited a monoclinic metric of the unit cell with a small monoclinic distortion (90.32° ≤ β ≤ 90.34°). No major change of symmetry was evidenced in the investigated compositional range, which should be characteristic of the morphotropic phase-boundary region. With increasing temperature, the samples underwent first-order monoclinic-tetragonal and tetragonal-cubic transitions. Only the potassium-rich phases were rhombohedral at 100 K.

Crystallization and identification of the glycosylated moieties of two isoforms of the main allergen Hev b 2 and preliminary X-ray analysis of two polymorphs of isoform II

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fuentes-Silva, D.; Mendoza-Hernández, G.; Stojanoff, V.

2007-09-01

Crystallization of important glycoenzymes involved in IgE-mediated latex allergy. Latex from Hevea brasiliensis contains several allergenic proteins that are involved in type I allergy. One of them is Hev b 2, which is a β-1,3-glucanase enzyme that exists in different isoforms with variable glycosylation content. Two glucanase isoforms were isolated from trees of the GV-42 clone by gel filtration, affinity and ion-exchange chromatography. Isoform I had a carbohydrate content of about 20%, with N-linked N-acetyl-glucosamine, N-acetyl-galactosamine, fucose and galactose residues as the main sugars, while isoform II showed 6% carbohydrate content constisting of N-acetyl-glucosamine, fucose, mannose and xylose. Both isoformsmore » were crystallized by the hanging-drop vapour-diffusion method. Isoform I crystals were grown using 0.2 M trisodium citrate dihydrate, 0.1 M Na HEPES pH 7.5 and 20%(v/v) 2-propanol, but these crystals were not appropriate for data collection. Isoform II crystals were obtained under two conditions and X-ray diffraction data were collected from both. In the first condition (0.2 M trisodium citrate, 0.1 M sodium cacodylate pH 6.5, 30% 2-propanol), crystals belonging to the tetragonal space group P4{sub 1} with unit-cell parameters a = b = 150.17, c = 77.41 Å were obtained. In the second condition [0.2 M ammonium acetate, 0.1 M trisodium citrate dihydrate pH 5.6, 30%(w/v) polyethylene glycol 4000] the isoform II crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 85.08, b = 89.67, c = 101.80 Å, β = 113.6°. Preliminary analysis suggests that there are four molecules of isoform II in both asymmetric units.« less

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4.

PubMed

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-08-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P2(1), with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed.

Purification, crystallization and preliminary X-ray analysis of the IgV domain of human nectin-4

PubMed Central

Xu, Xiang; Zhang, Xiaoai; Lu, Guangwen; Cai, Yongping

2012-01-01

Nectin-4 belongs to a family of immunoglobulin-like cell adhesion molecules and is highly expressed in cancer cells. Recently, nectin-4 was found to be a receptor of measles virus and the IgV domain sustains strong binding to measles virus H protein. In this study, the successful expression and purification of human nectin-4 V domain (nectin-4v) is reported. The purified protein was crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.8 Å resolution and belonged to space group P21, with unit-cell parameters a = 33.1, b = 51.7, c = 56.9 Å, β = 94.7°. Preliminary analysis of the diffraction data was also performed. PMID:22869128

Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

2008-04-01

A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

Expression, purification, crystallization, and preliminary X-ray crystallographic analysis of OXA-17, an extended-spectrum β-lactamase conferring severe antibiotic resistance

NASA Astrophysics Data System (ADS)

Lee, J. H.; Sohn, S. G.; Jung, H. I.; An, Y. J.; Lee, S. H.

2013-07-01

OXA-17, an extended-spectrum β-lactamase (ESBL) conferring severe antibiotic resistance, hydrolytically inactivates β-lactam antibiotics, inducing a lack of eradication of pathogenic bacteria by oxyimino β-lactams and not helping hospital infection control. Thus, the enzyme is a potential target for developing antimicrobial agents against pathogens producing ESBLs. OXA-17 was purified and crystallized at 298 K. X-ray diffraction data from OXA-17 crystal have been collected to 1.85 Å resolution using synchrotron radiation. The crystal of OXA-17 belongs to space group P212121, with unit-cell parameters a = 48.37, b = 101.12, and c = 126.07 Å. Analysis of the packing density shows that the asymmetric unit probably contains two molecules with a solvent content of 54.6%.

Crystallization of mitochondrial rhodoquinol-fumarate reductase from the parasitic nematode Ascaris suum with the specific inhibitor flutolanil

PubMed Central

Osanai, Arihiro; Harada, Shigeharu; Sakamoto, Kimitoshi; Shimizu, Hironari; Inaoka, Daniel Ken; Kita, Kiyoshi

2009-01-01

In adult Ascaris suum (roundworm) mitochondrial membrane-bound complex II acts as a rhodoquinol-fumarate reductase, which is the reverse reaction to that of mammalian complex II (succinate-ubiquinone reductase). The adult A. suum rhodoquinol-fumarate reductase was crystallized in the presence of octaethyleneglycol monododecyl ether and n-dodecyl-β-d-maltopyranoside in a 3:2 weight ratio. The crystals belonged to the orthorhombic space group P212121, with unit-cell parameters a = 123.75, b = 129.08, c = 221.12 Å, and diffracted to 2.8 Å resolution using synchrotron radiation. The presence of two molecules in the asymmetric unit (120 kDa × 2) gives a crystal volume per protein mass (V M) of 3.6 Å3 Da−1. PMID:19724139

Expression, Purification, Crystallization of Two Major Envelope Proteins from White Spot Syndrome Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Hew, C.

2007-01-01

White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less

Crystallization and preliminary X-ray diffraction studies of delta-toxin from Clostridium perfringens.

PubMed

Huyet, Jessica; Gilbert, Maryse; Popoff, Michel R; Basak, Ajit

2011-03-01

Clostridium perfringens is a Gram-positive anaerobic bacterium that is responsible for a wide range of diseases in humans and both wild and domesticated animals, including birds. C. perfringens is notable for its ability to produce a plethora of toxins, e.g. phospholipases C (alpha-toxin), pore-forming toxins (epsilon-toxin, beta-toxin and enterotoxin) and binary toxins (iota-toxin). Based on alpha-, beta-, epsilon- and iota-toxin production, the bacterium is classified into five different toxinotypes (A-E). Delta-toxin, which is a 32.6 kDa protein with 290 amino acids, is one of three haemolysins released by type C and possibly by type B strains of C. perfringens. This toxin is immunogenic and lytic to erythrocytes from the even-toed ungulates sheep, goats and pigs, and is cytotoxic to other cell types such as rabbit macrophages, human monocytes and blood platelets from goats, rabbits, guinea pigs and humans. The recombinant delta-toxin has been cloned, expressed, purified and crystallized in two different crystal forms by the hanging-drop vapour-diffusion method. Of these two different crystal forms, only the form II crystal diffracted to atomic resolution (dmin=2.4 Å), while the form I crystal diffracted to only 15 Å resolution. The form II crystals belonged to space group P2(1)2(1)2, with one molecule in the crystallographic asymmetric unit and unit-cell parameters a=49.66, b=58.48, c=112.93 Å.

Polymorphism and Modulation of Para-Substituted l-Phenylalanine.

PubMed

Sögütoglu, Leyla-Cann; Lutz, Martin; Meekes, Hugo; de Gelder, René; Vlieg, Elias

2017-12-06

The crystal structure of para -methyl-l-phenylalanine at 230 K resembles that of the para-fluorinated analogue from the literature but is commensurately modulated with seven molecules in the asymmetric unit ( Z ' = 7). At 100 K, the superstructure loses its modulation, leading to a unit cell with Z ' = 1, with clear disorder in the phenyl ring orientations. The methyl-substituent in para -methyl-l-phenylalanine has, in contrast to fluorine, no polar interactions with protons of neighboring molecules, which might allow for the well-defined modulation of the crystal structure at 230 K.

Synthesis, characterization and computational studies of 3-{(E)-[(2-hydroxyphenyl)imino]methyl}benzene-1,2-diol and molecular structure of its zwitterionic form

NASA Astrophysics Data System (ADS)

Ezeorah, Julius Chigozie; Ossai, Valentine; Obasi, Lawrence Nnamdi; Elzagheid, Mohamed I.; Rhyman, Lydia; Lutter, Michael; Jurkschat, Klaus; Dege, Necmi; Ramasami, Ponnadurai

2018-01-01

The Schiff base 3-{(E)-[(2-hydroxyphenyl)imino]methyl}benzene-1,2-diol was synthesized by the condensation of 2,3-dihydroxybenzaldehyde and 2-aminophenol in water at room temperature. The crystal was grown using two solvents (dry methanol and 60% methanol). The compound was characterized using elemental microanalysis, IR, NMR, UV spectroscopies and single-crystal X-ray diffraction crystallography. The X-ray structure reveals that the Schiff base crystallizes as a methanol solvate in dry methanol with triclinic crystal system, space group P-1 and Z = 2 in the unit cell and as a non-methanol solvate in 60% methanol with triclinic crystal system, space group P-1 and Z = 4 in the unit cell. The compound showed absorption bands at 272, 389, 473 and 602 nm in DMSO. These bands were assigned as π → π ∗, n → π∗ and n-σ∗ transitions. The 473 and 602 nm bands in DMSO reveal that the compound exists in tautomeric forms. The presence of N-H, C-O and Cdbnd N stretching vibrations in the IR spectrum indicates that the compound is zwitterionic in the solid state. This study was supplemented using density functional theory method.

Expression, crystallization and preliminary crystallographic analysis of RNA-binding protein Hfq (YmaH) from Bacillus subtilis in complex with an RNA aptamer

PubMed Central

Baba, Seiki; Someya, Tatsuhiko; Kawai, Gota; Nakamura, Kouji; Kumasaka, Takashi

2010-01-01

The Hfq protein is a hexameric RNA-binding protein which regulates gene expression by binding to RNA under the influence of diverse environmental stresses. Its ring structure binds various types of RNA, including mRNA and sRNA. RNA-bound structures of Hfq from Escherichia coli and Staphylococcus aureus have been revealed to have poly(A) RNA at the distal site and U-rich RNA at the proximal site, respectively. Here, crystals of a complex of the Bacillus subtilis Hfq protein with an A/G-repeat 7-mer RNA (Hfq–RNA) that were prepared using the hanging-drop vapour-diffusion technique are reported. The type 1 Hfq–RNA crystals belonged to space group I422, with unit-cell parameters a = b = 123.70, c = 119.13 Å, while the type 2 Hfq–RNA crystals belonged to space group F222, with unit-cell parameters a = 91.92, b = 92.50, c = 114.92 Å. Diffraction data were collected to a resolution of 2.20 Å from both crystal forms. The hexameric structure of the Hfq protein was clearly shown by self-rotation analysis. PMID:20445260

Crystallization and preliminary X-ray analysis of alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yamasaki, Masayuki; Ogura, Kohei; Moriwaki, Satoko

The crystallization and preliminary characterization of the family PL-7 alginate lyases A1-II and A1-II′ from Sphingomonas sp. A1 are presented. Alginate lyases depolymerize alginate, a heteropolysaccharide consisting of α-l-guluronate and β-d-mannuronate, through a β-elimination reaction. The alginate lyases A1-II (25 kDa) and A1-II′ (25 kDa) from Sphingomonas sp. A1, which belong to polysaccharide lyase family PL-7, exhibit 68% homology in primary structure but have different substrate specificities. To determine clearly the structural basis for substrate recognition in the depolymerization mechanism by alginate lyases, both proteins were crystallized at 293 K using the vapour-diffusion method. A crystal of A1-II belonged tomore » space group P2{sub 1} and diffracted to 2.2 Å resolution, with unit-cell parameters a = 51.3, b = 30.1, c = 101.6 Å, β = 100.2°, while a crystal of A1-II′ belonged to space group P2{sub 1}2{sub 1}2{sub 1} and diffracted to 1.0 Å resolution, with unit-cell parameters a = 34.6, b = 68.5, c = 80.3 Å.« less

Crystallization and preliminary X-ray diffraction studies of two thermostable α-galactosidases from glycoside hydrolase family 36

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foucault, M.; Watzlawick, H.; Mattes, R.

2006-02-01

The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution, respectively. α-Galactosidases from thermophilic organisms have gained interest owing to their applications in the sugar industry. The α-galactosidases AgaA, AgaB and AgaA A355E mutant from Geobacillus stearothermophilus have been overexpressed in Escherichia coli. Crystals of AgaB and AgaA A355E have been obtained by the vapour-diffusion method and synchrotron data have been collected to 2.0 and 2.8 Å resolution,more » respectively. Crystals of AgaB belong to space group I222 or I2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 87.5, b = 113.3, c = 161.6 Å. Crystals of AgaA A355E belong to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 150.1, c = 233.2 Å.« less

Negative refraction imaging of acoustic metamaterial lens in the supersonic range

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Jianning; Wen, Tingdun; Key Laboratory of Electronic Testing Technology, North University of China, Taiyuan 030051

2014-05-15

Acoustic metamaterials with negative refraction index is the most promising method to overcome the diffraction limit of acoustic imaging to achieve ultrahigh resolution. In this paper, we use localized resonant phononic crystal as the unit cell to construct the acoustic negative refraction lens. Based on the vibration model of the phononic crystal, negative quality parameters of the lens are obtained while excited near the system resonance frequency. Simulation results show that negative refraction of the acoustic lens can be achieved when a sound wave transmiting through the phononic crystal plate. The patterns of the imaging field agree well with thatmore » of the incident wave, while the dispersion is very weak. The unit cell size in the simulation is 0.0005 m and the wavelength of the sound source is 0.02 m, from which we show that acoustic signal can be manipulated through structures with dimensions much smaller than the wavelength of incident wave.« less

Crystalline Hybrid Polyphenylene Macromolecules from Octaalkynylsilsesquioxanes, Crystal Structures, and a Potential Route to 3-D Graphenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roll, Mark F.; Kampf, Jeffrey W.; Laine, Richard M.

2011-05-10

We report here the Diels–Alder reaction of octa(diphenylacetylene)silsesquioxane [DPA₈OS] with tetraphenylcyclopentadienone or tetra(p-tolyl)cyclopentadienone to form octa(hexaphenylbenzene)octasilsesquioxane, (Ph₆C₆)₈OS, or octa(tetratolyldiphenylbenzene)octasilsesquioxane, (p-Tolyl₄Ph₂C₆)₈OS. Likewise, tetra(p-tolyl)cyclopentadienone reacts with octa(p-tolylethynylphenyl)OS to form octa(pentatolylphenylbenzene)octasilsesquioxane (p-Tolyl₅PhC₆)₈OS. These compounds, with molecular weights of 4685–5245 Da, were isolated and characterized using a variety of analytical methods. The crystal structure of DPA₈OS offers a 3 nm³ unit cell with Z = 1. The crystal structure of (Ph₆C₆)₈OS was determined to have a triclinic unit cell of 11 nm³ with Z = 1. The latter structure is believed to be the largest discrete molecular structure reported with 330 carbons. Efforts tomore » dehydrogenatively cyclize (Scholl reaction) the hexaarylbenzene groups to form 3-D octgraphene compounds are described.« less

Comparative crystallization and preliminary X-ray diffraction studies of locked nucleic acid and RNA stems of a tenascin C-binding aptamer

PubMed Central

Förster, Charlotte; Brauer, Arnd B. E.; Brode, Svenja; Schmidt, Kathrin S.; Perbandt, Markus; Meyer, Arne; Rypniewski, Wojciech; Betzel, Christian; Kurreck, Jens; Fürste, Jens P.; Erdmann, Volker A.

2006-01-01

The pharmacokinetic properties of an aptamer against the tumour-marker protein tenascin-C have recently been successfully improved by the introduction of locked nucleic acids (LNAs) into the terminal stem of the aptamer. Since it is believed that this post-SELEX optimization is likely to provide a more general route to enhance the in vitro and in vivo stability of aptamers, elucidation of the structural basis of this improvement was embarked upon. Here, the crystallographic and X-ray diffraction data of the isolated aptamer stem encompassed in a six-base-pair duplex both with and without the LNA modification are presented. The obtained all-LNA crystals belong to space group P41212 or P43212, with unit-cell parameters a = b = 52.80, c = 62.83 Å; the all-RNA crystals belong to space group R32, with unit-cell parameters a = b = 45.21, c = 186.97 Å, γ = 120.00°. PMID:16820689

Softening non-metallic crystals by inhomogeneous elasticity.

PubMed

Howie, P R; Thompson, R P; Korte-Kerzel, S; Clegg, W J

2017-09-14

High temperature structural materials must be resistant to cracking and oxidation. However, most oxidation resistant materials are brittle and a significant reduction in their yield stress is required if they are to be resistant to cracking. It is shown, using density functional theory, that if a crystal's unit cell elastically deforms in an inhomogeneous manner, the yield stress is greatly reduced, consistent with observations in layered compounds, such as Ti 3 SiC 2 , Nb 2 Co 7 , W 2 B 5 , Ta 2 C and Ta 4 C 3 . The mechanism by which elastic inhomogeneity reduces the yield stress is explained and the effect demonstrated in a complex metallic alloy, even though the electronegativity differences within the unit cell are less than in the layered compounds. Substantial changes appear possible, suggesting this is a first step in developing a simple way of controlling plastic flow in non-metallic crystals, enabling materials with a greater oxidation resistance and hence a higher temperature capability to be used.

Structural features of single crystals of LuB{sub 12} upon a transition to the cage-glass phase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bolotina, N. B., E-mail: nb-bolotina@mail.ru; Verin, I. A.; Shitsevalova, N. Yu.

2016-03-15

The unit-cell parameters of dodecaboride LuB{sub 12}, which undergoes a transition to the cage-glass phase, have been determined for the first time in the temperature range of 50–75 K by X-ray diffraction, and the single-crystal structure of this compound is established at 50 K. Nonlinear changes in the unit-cell parameters correspond to anomalies in the physical properties near the glass-transition temperature T* ~ 50–70 K. This compound has cubic symmetry at room temperature, and it is reduced to tetragonal symmetry at lower temperatures. Based on the X-ray diffraction data and relying on the physical properties of the crystals, the structuremore » model, in which a small part (~15%) of Lu atoms are displaced from the 2a sites at the centers of the B{sub 24} cuboctahedra to the 16n sites of sp. gr. I4/mmm, seems preferable.« less

High-voltage solar-cell chip

NASA Technical Reports Server (NTRS)

Kapoor, V. J.; Valco, G. J.; Skebe, G. G.; Evans, J. C., Jr.

1985-01-01

Integrated circuit technology has been successfully applied to the design and fabrication of 0.5 x 0.5-cm planar multijunction solar-cell chips. Each of these solar cells consisted of six voltage-generating unit cells monolithically connected in series and fabricated on a 75-micron-thick, p-type, single crystal, silicon substrate. A contact photolithic process employing five photomask levels together with a standard microelectronics batch-processing technique were used to construct the solar-cell chip. The open-circuit voltage increased rapidly with increasing illumination up to 5 AM1 suns where it began to saturate at the sum of the individual unit-cell voltages at a maximum of 3.0 V. A short-circuit current density per unit cell of 240 mA/sq cm was observed at 10 AM1 suns.

Unidirectional Wave Propagation in Low-Symmetric Colloidal Photonic-Crystal Heterostructures.

PubMed

Yannopapas, Vassilios

2015-03-19

We show theoretically that photonic crystals consisting of colloidal spheres exhibit unidirectional wave propagation and one-way frequency band gaps without breaking time-reversal symmetry via, e.g., the application of an external magnetic field or the use of nonlinear materials. Namely, photonic crystals with low symmetry such as the monoclinic crystal type considered here as well as with unit cells formed by the heterostructure of different photonic crystals show significant unidirectional electromagnetic response. In particular, we show that the use of scatterers with low refractive-index contrast favors the formation of unidirectional frequency gaps which is the optimal route for achieving unidirectional wave propagation.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

PubMed Central

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-01-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

2007-08-01

The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

New Techniques in Characterization of Ferroelectric Materials

NASA Technical Reports Server (NTRS)

Sehirlioglu, Alp

2008-01-01

Two new techniques have been developed to characterize Pb(Mg1/3Nb2/3)O3-PbTiO3 (PMN-PT) based ferroelectric single crystals: (i) electro-thermal imaging, and (ii) single crystal x-ray diffraction in the transmission mode. (i) Electro-thermal imaging is a remote sensing technique that can detect the polarization direction and poling state of a whole crystal slice. This imaging technique utilizes an IR camera to determine the field induced temperature change and does not require any special or destructive sample preparation. In the resulting images it is possible to distinguish regions of 180 deg domains. This powerful technique can be used remotely during poling to determine the poling state of the crystal to avoid over-poling that can result in inferior properties and/or cracking of the crystals. Electro-thermal imaging produced the first direct observations of polarization rotation. Under bipolar field, the domains near the corners were the first to switch direction. As the field increased above the coercive field, domains at the center part of the crystals switched direction. (ii) X-ray diffraction in the transmission mode has long been used in structure determination of organic crystals and proteins; however, it is not used much to characterize inorganic systems. 0.7Pb(Mg1/3Nb2/3)O3-0.3PbTiO3 single crystals were examined by this XRD technique for the first time, and a never-before-seen super-lattice was revealed with a doubling of the unit cell in all three directions, giving a cell volume eight times that of a traditional perovskite unit cell. The significance of the super-lattice peaks increased with poling, indicating a structural contribution to ordering. Lack of such observations by electron diffraction in the transmission electron microscope examinations suggests the presence of a bulk effect.

Expression, purification, crystallization and preliminary X-ray diffraction analysis of an essential lipoprotein implicated in cell-wall biosynthesis in Mycobacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marland, Zara; Beddoe, Travis; Zaker-Tabrizi, Leyla

2005-12-01

A lipoprotein implicated in mycobacterial cell-wall biosynthesis, LpqW, was expressed in E. coli. Crystals were obtained that diffracted to 2.4 Å resolution. Mycobacterium tuberculosis is a renewed cause of devastation in the developing world. Critical to the success of this re-emerging pathogen is its unusual waxy cell wall, which is rich in rare components including lipoarabinomannan (LAM) and its precursors, the phosphatidylinositol mannosides (PIMs). Balanced synthesis of these related glycolipids is intrinsic to both cell-wall integrity and virulence in M. tuberculosis and presents a promising, albeit poorly defined, therapeutic target. Here, the expression, purification and crystallization of an essential 600-amino-acidmore » lipoprotein, LpqW, implicated in this process are reported. Crystals of LpqW were grown using 20–24%(w/v) PEG 4000, 8–16%(v/v) 2-propanol, 100 mM sodium citrate pH 5.5 and 10 mM DTT. A complete data set was collected at 2.4 Å using synchrotron radiation on a crystal belonging to space group C222, with unit-cell parameters a = 188.57, b = 312.04, c = 104.15 Å. Structure determination is under way.« less

Crystallization and preliminary X-ray analysis of neoagarobiose hydrolase from Saccharophagus degradans 2-40

PubMed Central

Lee, Saeyoung; Lee, Jonas Yun; Ha, Sung Chul; Jung, Jina; Shin, Dong Hae; Kim, Kyoung Heon; Choi, In-Geol

2009-01-01

Many agarolytic bacteria degrade agar polysaccharide into the disaccharide unit neoagarobiose [O-3,6-anhydro-α-l-galactopyranosyl-(1→3)-d-galactose] using various β-agarases. Neoagarobiose hydrolase is an enzyme that acts on the α-­1,3 linkage in neoagarobiose to yield d-galactose and 3,6-anhydro-l-galactose. This activity is essential in both the metabolism of agar by agarolytic bacteria and the production of fermentable sugars from agar biomass for bioenergy production. Neoagarobiose hydrolase from the marine bacterium Saccharophagus degradans 2-40 was overexpressed in Escherichia coli and crystallized in the monoclinic space group C2, with unit-cell parameters a = 129.83, b = 76.81, c = 90.11 Å, β = 101.86°. The crystals diffracted to 1.98 Å resolution and possibly contains two molecules in the asymmetric unit. PMID:20054134

Crystallization and preliminary X-ray crystallographic analysis of YfcM: an important factor for EF-P hydroxylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kobayashi, Kan; RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198; Suzuki, Takehiro

2014-08-27

E. coli YfcM was expressed, purified and crystallized. Crystals of YfcM were obtained by the in situ proteolysis crystallization method. Using these crystals, an X-ray diffraction data set was collected at 1.45 Å resolution. Elongation factor P (EF-P) plays an essential role in the translation of polyproline-containing proteins in bacteria. It becomes functional by the post-translational modification of its highly conserved lysine residue. It is first β-lysylated by PoxA and then hydroxylated by YfcM. In this work, the YfcM protein from Escherichia coli was overexpressed, purified and crystallized. The crystal of YfcM was obtained by the in situ proteolysis crystallizationmore » method and diffracted X-rays to 1.45 Å resolution. It belonged to space group C2, with unit-cell parameters a = 124.4, b = 37.0, c = 37.6 Å, β = 101.2°. The calculated Matthews coefficient (V{sub M}) of the crystal was 1.91 Å{sup 3} Da{sup −1}, indicating that one YfcM molecule is present in the asymmetric unit with a solvent content of 35.7%.« less

Growth and characterization of metal halide perovskite crystals: Benzyltributyl ammonium tetrachloro manganate(II) monohydrate

NASA Astrophysics Data System (ADS)

Dhandapani, M.; Sugandhi, K.; Nithya, S.; Muthuraja, P.; Balachandar, S.; Aranganayagam, K. R.

2018-05-01

The perovskite type organic-inorganic hybrid benzyltributyl ammoniumtetrachloro manganate (II) monohydrates (BTBA-Mn) are synthesized and the single crystals are grown by slow evaporation solution growth technique. The structure of the grown crystals are confirmed by using X-ray diffraction (XRD), unit cell parameter analysis, Fourier transform Infrared (FTIR), elemental analysis and 13C-NMR spectral studies. Thermogravimetry (TG), differential thermal analysis (DTA) and differential scanning colorimetric (DSC) analysis were carried out to understand thermal stability and occurrence of phase transition.

Cloning, expression, and crystallization of Cpn60 proteins from Thermococcus litoralis.

PubMed

Osipiuk, J; Sriram, M; Mai, X; Adams, M W; Joachimiak, A

2000-01-01

Two genes of the extreme thermophilic archaeon Thermococcus litoralis homologous to those that code for Cpn60 chaperonins were cloned and expressed in Escherichia coli. Each of the Cpn60 subunits as well as the entire Cpn60 complex crystallize in a variety of morphological forms. The best crystals diffract to 3.6 A resolution at room temperature and belong to the space group 1422 with unit cell parameters a = b = 193.5 A, c = 204.2 A.

Purification, crystallization and preliminary X-ray studies of human augmenter of liver regeneration.

PubMed

Ji, Chao-Neng; Cai, Zai-Long; Cao, Gen-Tao; Yin, Gang; Jiao, Bing-Hua; Jiang, Tao; Shu, Guang; Mao, Ji-Fang; Xie, Yi; Mao, Yu-Min

2002-12-01

Human augmenter of liver regeneration has been expressed in Escherichia coli, purified and crystallized. The crystals belong to space group C222, with unit-cell parameters a=51.7 A, b=78.8 A, c=63.7 A. Diffraction data were collected to 2.80 A with a completeness of 99.9% (99.9% for the last shell), a R(sym) value of 0.092(0.236) and an I/sigma(I) value of 6.2(2.7).

Crystallization and preliminary crystallographic analysis of a surface antigen glycoprotein, SAG19, from Eimeria tenella

PubMed Central

Ramly, Nur Zazarina; Rouzheinikov, Sergey N.; Sedelnikova, Svetlana E.; Baker, Patrick J.; Chow, Yock-Ping; Wan, Kiew-Lian; Nathan, Sheila; Rice, David W.

2013-01-01

Coccidiosis in chickens is caused by the apicomplexan parasite Eimeria tenella and is thought to involve a role for a superfamily of more than 20 cysteine-rich surface antigen glycoproteins (SAGs) in host–parasite interactions. A representative member of the family, SAG19, has been overexpressed in Escherichia coli, purified and crystallized by the hanging-drop method of vapour diffusion using ammonium sulfate as the precipitant. Crystals of SAG19 diffracted to beyond 1.50 Å resolution and belonged to space group I4, with unit-cell parameters a = b = 108.2, c = 37.5 Å. Calculation of possible values of V M suggests that there is a single molecule in the asymmetric unit. PMID:24316835

Overexpression, crystallization and preliminary X-­ray crystallographic analysis of the RNA polymerase domain of primase from Streptococcus mutans strain UA159

PubMed Central

Im, Dong-Won; Kim, Tae-O; Jung, Ha Yun; Oh, Ji Eun; Lee, Se Jin; Heo, Yong-Seok

2012-01-01

Primase is the enzyme that synthesizes RNA primers on single-stranded DNA during normal DNA replication. In this study, the catalytic core domain of primase from Streptococcus mutans UA159 was overexpressed in Escherichia coli, purified and crystallized. Diffraction data were collected to 1.60 Å resolution using a synchrotron-radiation source. The crystal belonged to space group P41 or P43, with unit-cell parameters a = b = 52.63, c = 110.31 Å. The asymmetric unit is likely to contain one molecule, with a corresponding V M of 1.77 Å3 Da−1 and a solvent content of 30.7%. PMID:22232183

Expression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae pseudopilin EpsH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raghunathan, Kannan; Vago, Frank S.; Ball, Terry

2010-01-12

EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

PubMed Central

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny; Willassen, Nils Peder

2006-01-01

Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P21, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, β = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit. PMID:16511268

Structure and properties of fullerene molecular crystals with linear-scaling van der Waals density functional theory

NASA Astrophysics Data System (ADS)

Mostofi, Arash; Andrinopoulos, Lampros; Hine, Nicholas

2014-03-01

Fullerene molecular crystals are of technological promise for their use in heterojunction photovoltaic cells. An improved theoretical understanding of their structure and properties would be a step towards the rational design of new devices. Simulations based on density-functional theory (DFT) are invaluable for developing such insight, but standard semi-local functionals do not capture the important inter-molecular van der Waals (vdW) interactions in fullerene crystals. Furthermore the computational cost associated with the large unit cells needed are at the limit or beyond the capabilities of traditional DFT methods. In this work we overcome these limitations by using our implementation of a number of vdW-DFs in the ONETEP linear-scaling DFT code to study the structural properties of C60 molecular crystals. Powder neutron diffraction shows that the low-temperature Pa-3 phase is orientationally ordered with individual C60 units rotated around the [111] direction. We fully explore the energy landscape associated with the rotation angle and find two stable structures that are energetically very close, one of which corresponds to the experimentally observed structure. We further consider the effect of orientational disorder in very large supercells of thousands of atoms.

Crystal-Chemical Correlations in Chromites from Kimberlitic and Non-Kimberlitic Sources.

NASA Astrophysics Data System (ADS)

Freckelton, C. N.; Flemming, R. L.

2009-05-01

This study explores the utility of micro X-ray diffraction (μXRD) as a tool for diamond exploration, as a compliment to current industry-standard techniques such as electron probe microanalysis (EPMA). Here we examine chromite. As one of the first phases to crystallize in mantle rocks, it is a useful indicator of upper mantle magmatic conditions in rocks that have been sampled by kimberlites. In addition, chromite does not alter easily from chemical and physical weathering processes. As such, chromite is a useful kimberlite indicator mineral in diamond exploration. We present correlations between crystal structure (unit cell) and chemical composition of chromite, (Fe,Mg)[Cr, Al]2O4, using correlated μXRD and EPMA data for 133 chromites from a three source locations: Two kimberlite sources and one non-kimberlitic source from an Archean granite/greenstone terrain. Quantitative analysis was performed using Electron Probe Microanalysis (EPMA) at Mineral Services, South Africa, prior to the loan of the samples. Randomly-oriented chromite grains, approximately 500 μm in diameter, were analyzed as previously mounted for EPMA. Micro X-ray-diffraction was performed using a Bruker D8-Discover Diffractometer, with θ-θ geometry, with CuKα radiation, operating at 40 kV and 40 mA, with nominal beam diameter of 500 μm. The data were collected in omega scan mode. Two dimensional General Area Detector Diffraction System (GADDS) images were collected for 20 minutes per image, and integrated to produce one-dimensional plots of intensity versus 2θ, for subsequent unit cell refinement using CELREF. Although all samples in this study were considered to be 'chromite', a plot of Cr/(Cr+Al) versus Fe2+/(Fe2++Mg) shows extensive substitution among four dominant members: chromite (FeCr2O4), magnesio-chromite (MgCr2O4), spinel (MgAl2O4), and hercynite (FeAl2O4), where Mg and Fe2+ substitute for one another on the tetrahedral site, and Cr and Al substitute for one another on the octahedral site. Our data are widely variable as compared to the field occupied by chromite inclusions in diamonds (high Cr and Mg (˜60 wt %) and very low Ti (˜0.40 wt %). Plots of the unit cell parameter, ao, versus composition demonstrate a decrease in unit cell size with increasing Al content (and corresponding decrease in Cr content), consistent with a smaller cation radius for Al versus Cr (Al=0.675 Å and Cr=0.905 Å). The trend in unit cell size is unlikely to be effected by Mg-Fe substitution because of the very small difference in their tetrahedral cation radii (Fe2+=0.835 Å and Mg=0.86 Å). Initial plots of composition versus unit cell parameter were clearly able to distinguish a difference between unit cell of kimberlitic chromites and non-kimberlitic chromites. The significantly higher Cr content in kimberlitic chromites (radius=0.905 Å), and correspondingly higher Al content in non-kimberlitic chromites (radius=0.675 Å), results in a striking bimodal distribution in unit cell parameter, ao, where kimberlitic chromites have a larger unit cell (> 8.3 Å) than non-kimberlitic chromites (< 8.3 Å). This preliminary data provides a useful starting point for screening minerals from naturally relevant chromite solid solutions using their corresponding unit cell parameters. Future work will examine which site substitutions (octahedral versus tetrahedral) are affecting the unit cell as well as the effect of cation order-disorder on unit cell parameters.

High temperature hydrothermal synthesis of rare-earth titanates: synthesis and structure of RE5Ti4O15(OH) (RE = La, Er), Sm3TiO5(OH)3, RE5Ti2O11(OH) (RE = Tm-Lu) and Ce2Ti4O11.

PubMed

Fulle, Kyle; Sanjeewa, Liurukara D; McMillen, Colin D; Kolis, Joseph W

2018-05-15

Reactions of rare-earth oxides with TiO2 were performed in high temperature (650-700 °C) hydrothermal fluids. Two different mineralizer fluids were examined, 20 M KOH and 30 M CsF, and their respective products analyzed. When concentrated KOH fluids were used, single crystals of a variety of new OH- containing species were isolated and structurally characterized: RE5Ti4O15(OH) (RE = La, Er) I, Sm3TiO5(OH)3II and RE5Ti2O11(OH) (RE = Tm-Lu) III. La5Ti4O15(OH) I crystallizes in the orthorhombic space group Pnnm with unit cell dimensions of a = 30.5152(12) Å, b = 5.5832(2) Å, c = 7.7590(3) Å and V = 1321.92(9) Å3, Z = 4. Sm3TiO5(OH)3II crystallizes in the monoclinic space group P21/m with unit cell parameters of a = 5.6066(2) Å, b = 10.4622(4) Å, c = 6.1258(2) Å and β = 104.7390(10)°, V = 347.50(2) Å3, Z = 2. Lu5Ti2O11(OH) III crystallizes in the monoclinic space group C2/m with unit cell dimensions of a = 12.1252(9) Å, b = 5.8243(4) Å, c = 7.0407(5) Å, β = 106.939(3)° and V = 475.65(6) Å3, Z = 2. When concentrated fluoride solutions are used, mostly RE2Ti2O7 type compounds were isolated in either cubic or monoclinic phases. In the case of cerium, Ce2Ti4O11IV was isolated that crystallizes in the monoclinic space group C2/c with unit cell parameters of a = 13.6875(7) Å, b = 5.0955(3) Å, c = 12.8592(7) Å, β = 108.964(2)° and V = 848.18(8) Å3, Z = 4. The synthesis, structural characterization, and supporting characterization are reported for all compounds. The work highlights the complementary nature of hydroxide and fluoride fluids in studying the reactivity of refractory oxides.

Clay Mineral Crystal Structure Tied to Composition

NASA Image and Video Library

2016-12-13

This diagram illustrates how the dimensions of clay minerals' crystal structure are affected by which ions are present in the composition of the mineral. Different clay minerals were identified this way at two sites in Mars' Gale Crater: "Murray Buttes" and "Yellowknife Bay." In otherwise identical clay minerals, a composition that includes aluminum and ferric iron ions (red dots) results in slightly smaller crystalline unit cells than one that instead includes magnesium and ferrous iron ions (green dots). Ferric iron is more highly oxidized than ferrous iron. Crystalline cell units are the basic repeating building blocks that define minerals. X-ray diffraction analysis, a capability of the Chemistry and Mineralogy (CheMin) instrument on NASA's Curiosity Mars rover, identifies minerals from their crystalline structure. http://photojournal.jpl.nasa.gov/catalog/PIA21148

Crystal-Chemical Analysis of Soil at Rocknest, Gale Crater

NASA Technical Reports Server (NTRS)

Morrison, S. M.; Downs, R. T.; Blake, D. F.; Bish, D. L.; Ming, D. W.; Morris, R. V.; Yen, A. S.; Chipera, S. J.; Treiman, A. H.; Vaniman, D. T.;

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

Overexpression, purification and crystallization of a choline-binding protein CbpI from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paterson, Neil G., E-mail: neison@chem.gla.ac.uk; Riboldi-Tunicliffe, Alan; Mitchell, Timothy J.

2006-07-01

The choline-binding protein CbpI from S. pneumoniae has been purified and crystallized and diffraction data have been collected to 3.5 Å resolution. The choline-binding protein CbpI from Streptococcus pneumoniae is a 23.4 kDa protein with no known function. The protein has been successfully purified initially using Ni–NTA chromatography and to homogeneity using Q-Sepharose ion-exchange resin as an affinity column. CbpI was crystallized using PEG 3350 as a precipitant and X-ray crystallographic analysis showed that the crystals belonged to the tetragonal space group P4, with unit-cell parameters a = b = 83.31, c = 80.29 Å, α = β = γmore » = 90°. The crystal contains two molecules in the asymmetric unit with a solvent content of 55.7% (V{sub M} = 2.77 Å{sup 3} Da{sup −1}) and shows a diffraction limit of 3.5 Å.« less

Crystallization and preliminary X-ray diffraction analysis of Leishmania major dihydroorotate dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordeiro, Artur T.; Feliciano, Patricia R.; Nonato, M. Cristina, E-mail: cristy@fcfrp.usp.br

2006-10-01

Dihydroorotate dehydrogenase from L. major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitant agent. A complete data set from a native crystal has been collected to 2.0 Å resolution using an in-house rotating-anode generator. Dihydroorotate dehydrogenases (DHODHs) are flavin-containing enzymes that catalyze the oxidation of l-dihydroorotate to orotate, the fourth step in the de novo pyrimidine nucleotide synthesis pathway. In this study, DHODH from Leishmania major has been crystallized by the vapour-diffusion technique using lithium sulfate as the precipitating agent. The crystals belong to space group P6{sub 1}, with unit-cell parameters a = 143.7, cmore » = 69.8 Å. X-ray diffraction data were collected to 2.0 Å resolution using an in-house rotating-anode generator. Analysis of the solvent content and the self-rotation function indicate the presence of two molecules in the asymmetric unit. The structure has been solved by the molecular-replacement technique.« less

Purification, crystallization and preliminary X-ray diffraction analysis of royal palm tree (Roystonea regia) peroxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, Leandra; Nascimento, Alessandro S.; Zamorano, Laura S.

2007-09-01

The purification, crystallization, X-ray diffraction data acquisition and molecular-replacement results of royal palm tree (R. regia) peroxidase are described. Royal palm tree peroxidase (RPTP), which was isolated from Roystonea regia leaves, has an unusually high stability that makes it a promising candidate for diverse applications in industry and analytical chemistry [Caramyshev et al. (2005 ▶), Biomacromolecules, 6, 1360–1366]. Here, the purification and crystallization of this plant peroxidase and its X-ray diffraction data collection are described. RPTP crystals were obtained by the hanging-drop vapour-diffusion method and diffraction data were collected to a resolution of 2.8 Å. The crystals belong to themore » trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 116.83, c = 92.24 Å, and contain one protein molecule per asymmetric unit. The V{sub M} value and solvent content are 4.07 Å{sup 3} Da{sup −1} and 69.8%, respectively.« less

Purification, crystallization and preliminary X-ray analysis of the BseCI DNA methyltransferase from Bacillus stearothermophilus in complex with its cognate DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kapetaniou, Evangelia G.; Kotsifaki, Dina; Providaki, Mary

2007-01-01

The DNA methyltransferase M.BseCI from B. stearothermophilus was crystallized as a complex with its cognate DNA. Crystals belong to space group P6 and diffract to 2.5 Å resolution at a synchrotron source. The DNA methyltransferase M.BseCI from Bacillus stearothermophilus (EC 2.1.1.72), a 579-amino-acid enzyme, methylates the N6 atom of the 3′ adenine in the sequence 5′-ATCGAT-3′. M.BseCI was crystallized in complex with its cognate DNA. The crystals were found to belong to the hexagonal space group P6, with unit-cell parameters a = b = 87.0, c = 156.1 Å, β = 120.0° and one molecule in the asymmetric unit. Twomore » complete data sets were collected at wavelengths of 1.1 and 2.0 Å to 2.5 and 2.8 Å resolution, respectively, using synchrotron radiation at 100 K.« less

Crystallization, X-ray diffraction analysis and preliminary structure determination of the polygalacturonase PehA from Agrobacterium vitis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vordtriede, Paul B.; Yoder, Marilyn D., E-mail: yoderm@umkc.edu

2008-07-01

The acidic polygalacturonase PehA from A. vitis has been crystallized. A molecular-replacement solution indicated a right-handed parallel β-helix fold. Polygalacturonases are pectate-degrading enzymes that belong to glycoside hydrolase family 28 and hydrolyze the α-1,4 glycosidic bond between neighboring galacturonasyl residues of the homogalacturonan substrate. The acidic polygalacturonase PehA from Agrobacterium vitis was overexpressed in Escherichia coli, where it accumulated in the periplasmic fraction. It was purified to homogeneity via a two-step chromatography procedure and crystallized using the hanging-drop vapour-diffusion technique. PehA crystals belonged to space group P2{sub 1}, with unit-cell parameters a = 52.387, b = 62.738, c = 149.165more » Å, β = 89.98°. Crystals diffracted to 1.59 Å resolution and contained two molecules per asymmetric unit. An initial structure determination by molecular replacement indicated a right-handed parallel β-helix fold.« less

Crystallization and preliminary X-ray crystallographic analysis of the GluR0 ligand-binding core from Nostoc punctiforme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jun Hyuck; Park, Soo Jeong; Rho, Seong-Hwan

2005-11-01

The GluR0 ligand-binding core from N. punctiforme was expressed, purified and crystallized in the presence of l-glutamate. A diffraction data set was collected to a resolution of 2.1 Å. GluR0 from Nostoc punctiforme (NpGluR0) is a bacterial homologue of the ionotropic glutamate receptor. The ligand-binding core of NpGluR0 was crystallized at 294 K using the hanging-drop vapour-diffusion method. The l-glutamate-complexed crystal belongs to space group C222{sub 1}, with unit-cell parameters a = 78.0, b = 145.1, c = 132.1 Å. The crystals contain three subunits in the asymmetric unit, with a V{sub M} value of 2.49 Å{sup 3} Da{sup −1}.more » The diffraction limit of the l-glutamate complex data set was 2.1 Å using synchrotron X-ray radiation at beamline BL-4A of the Pohang Accelerator Laboratory (Pohang, Korea)« less

Cloning, purification, crystallization and preliminary crystallographic analysis of a penicillin-binding protein homologue from Pyrococcus abyssi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delfosse, Vanessa; Hugonnet, Jean-Emmanuel; Sougakoff, Wladimir

The crystallization of a hypothetical penicillin-binding protein from the archaeon P. abyssi in space group C2 by hanging-drop vapour diffusion is reported. The genome of the hyperthermophilic archaeon Pyrococcus abyssi contains a gene (pab0087) encoding a penicillin-binding protein (PBP) homologue. This sequence consists of 447 residues and shows significant sequence similarity to low-molecular-weight PBPs and class C β-lactamases. The Pab0087 protein was overexpressed, purified and crystallized. Diffraction data from two different crystal forms were collected to 2.7 and 2.0 Å resolution. Both crystals belong to space group C2, with unit-cell parameters a = 160.59, b = 135.74, c = 113.02more » Å, β = 117.36° and a = 166.97, b = 131.25, c = 189.39 Å, β = 113.81°, respectively. The asymmetric unit contains four and eight molecules, respectively, with fourfold non-crystallographic symmetry.« less

Expression, purification and crystallization of the C-terminal LRR domain of Streptococcus pyogenes protein 0843.

PubMed

Haikarainen, Teemu; Loimaranta, Vuokko; Prieto-Lopez, Carlos; Battula, Pradeep; Finne, Jukka; Papageorgiou, Anastassios C

2013-05-01

Streptococcus pyogenes protein 0843 (Spy0843) is a recently identified protein with a potential adhesin function. Sequence analysis has shown that Spy0843 contains two leucine-rich repeat (LRR) domains that mediate interactions with the gp340 receptor. Here, the C-terminal LRR domain was overexpressed in Escherichia coli, purified and crystallized in the presence of 1.7-1.8 M ammonium sulfate pH 7.4 as precipitant. Data were collected from a single crystal to 1.59 Å resolution at 100 K at a synchrotron-radiation source. The crystal was found to belong to space group I41, with unit-cell parameters a = b = 121.4, c = 51.5 Å and one molecule in the asymmetric unit. Elucidation of the crystal structure will provide insights into the interactions of Spy0843 with the gp340 receptor and a better understanding of the role of Spy0843 in streptococcal infections.

Expression, purification and crystallization of the C-terminal LRR domain of Streptococcus pyogenes protein 0843

PubMed Central

Haikarainen, Teemu; Loimaranta, Vuokko; Prieto-Lopez, Carlos; Battula, Pradeep; Finne, Jukka; Papageorgiou, Anastassios C.

2013-01-01

Streptococcus pyogenes protein 0843 (Spy0843) is a recently identified protein with a potential adhesin function. Sequence analysis has shown that Spy0843 contains two leucine-rich repeat (LRR) domains that mediate interactions with the gp340 receptor. Here, the C-terminal LRR domain was overexpressed in Escherichia coli, purified and crystallized in the presence of 1.7–1.8 M ammonium sulfate pH 7.4 as precipitant. Data were collected from a single crystal to 1.59 Å resolution at 100 K at a synchrotron-radiation source. The crystal was found to belong to space group I41, with unit-cell parameters a = b = 121.4, c = 51.5 Å and one molecule in the asymmetric unit. Elucidation of the crystal structure will provide insights into the interactions of Spy0843 with the gp340 receptor and a better understanding of the role of Spy0843 in streptococcal infections. PMID:23695577

Crystallization and preliminary crystallographic investigation of a low-pH native insulin monomer with flexible behaviour.

PubMed

Zhang, Youshang; Whittingham, Jean L; Turkenburg, Johan P; Dodson, Eleanor J; Brange, Jens; Dodson, G Guy

2002-01-01

Insulin naturally aggregates as dimers and hexamers, whose structures have been extensively analysed by X-ray crystallography. Structural determination of the physiologically relevant insulin monomer, however, is an unusual challenge owing to the difficulty in finding solution conditions in which the concentration of insulin is high enough for crystallization yet the molecule remains monomeric. By utilizing solution conditions known to inhibit insulin assembly, namely 20% acetic acid, crystals of insulin in the monomeric state have been obtained. The crystals are strongly diffracting and a data set extending to 1.6 A has recently been collected. The crystals nominally belong to the space group I422, with unit-cell parameters a = b = 57.80, c = 54.61 A, giving rise to one molecule in the asymmetric unit. Preliminary electron-density maps show that whilst most of the insulin monomer is well ordered and similar in conformation to other insulin structures, parts of the B-chain C-terminus main chain adopt more than one conformation.

Crystallization and preliminary X-ray analysis of the atrial natriuretic peptide (ANP) receptor extracellular domain complex with ANP: use of ammonium sulfate as the cryosalt.

PubMed

Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S

2003-10-01

Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

PubMed Central

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-01-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

PubMed

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-10-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

Crystallization and preliminary X-ray characterization of the eukaryotic replication terminator Reb1-Ter DNA complex.

PubMed

Jaiswal, Rahul; Singh, Samarendra K; Bastia, Deepak; Escalante, Carlos R

2015-04-01

The Reb1 protein from Schizosaccharomyces pombe is a member of a family of proteins that control programmed replication termination and/or transcription termination in eukaryotic cells. These events occur at naturally occurring replication fork barriers (RFBs), where Reb1 binds to termination (Ter) DNA sites and coordinates the polar arrest of replication forks and transcription approaching in opposite directions. The Reb1 DNA-binding and replication-termination domain was expressed in Escherichia coli, purified and crystallized in complex with a 26-mer DNA Ter site. Batch crystallization under oil was required to produce crystals of good quality for data collection. Crystals grew in space group P2₁, with unit-cell parameters a = 68.9, b = 162.9, c = 71.1 Å, β = 94.7°. The crystals diffracted to a resolution of 3.0 Å. The crystals were mosaic and required two or three cycles of annealing. This study is the first to yield structural information about this important family of proteins and will provide insights into the mechanism of replication and transcription termination.

Crystallization and preliminary X-ray diffraction analysis of a cold-adapted catalase from Vibrio salmonicida

DOE Office of Scientific and Technical Information (OSTI.GOV)

Riise, Ellen Kristin; Lorentzen, Marit Sjo; Helland, Ronny

2006-01-01

Monoclinic (P2{sub 1}) crystals of a His-tagged form of V. salmonicida catalase without cofactor diffract X-rays to 1.96 Å. Catalase (EC 1.11.1.6) catalyses the breakdown of hydrogen peroxide to water and molecular oxygen. Recombinant Vibrio salmonicida catalase (VSC) possesses typical cold-adapted features, with higher catalytic efficiency, lower thermal stability and a lower temperature optimum than its mesophilic counterpart from Proteus mirabilis. Crystals of VSC were produced by the hanging-drop vapour-diffusion method using ammonium sulfate as precipitant. The crystals belong to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 98.15, b = 217.76, c = 99.28 Å, βmore » = 110.48°. Data were collected to 1.96 Å and a molecular-replacement solution was found with eight molecules in the asymmetric unit.« less

Superoxide reductase from the syphilis spirochete Treponema pallidum: crystallization and structure determination using soft X-rays

DOE Office of Scientific and Technical Information (OSTI.GOV)

Santos-Silva, Teresa; Trincão, José; Carvalho, Ana L.

2005-11-01

Superoxide reductase is a non-haem iron-containing protein involved in resistance to oxidative stress. The oxidized form of the protein has been crystallized and its three-dimensional structure solved. A highly redundant X-ray diffraction data set was collected on a rotating-anode generator using Cu Kα X-ray radiation. Four Fe atoms were located in the asymmetric unit corresponding to four protein molecules arranged as a dimer of homodimers. Superoxide reductase is a 14 kDa metalloprotein containing a catalytic non-haem iron centre [Fe(His){sub 4}Cys]. It is involved in defence mechanisms against oxygen toxicity, scavenging superoxide radicals from the cell. The oxidized form of Treponemamore » pallidum superoxide reductase was crystallized in the presence of polyethylene glycol and magnesium chloride. Two crystal forms were obtained depending on the oxidizing agents used after purification: crystals grown in the presence of K{sub 3}Fe(CN){sub 6} belonged to space group P2{sub 1} (unit-cell parameters a = 60.3, b = 59.9, c = 64.8 Å, β = 106.9°) and diffracted beyond 1.60 Å resolution, while crystals grown in the presence of Na{sub 2}IrCl{sub 6} belonged to space group C2 (a = 119.4, b = 60.1, c = 65.6 Å, β = 104.9°) and diffracted beyond 1.55 Å. A highly redundant X-ray diffraction data set from the C2 crystal form collected on a copper rotating-anode generator (λ = 1.542 Å) clearly defined the positions of the four Fe atoms present in the asymmetric unit by SAD methods. A MAD experiment at the iron absorption edge confirmed the positions of the previously determined iron sites and provided better phases for model building and refinement. Molecular replacement using the P2{sub 1} data set was successful using a preliminary trace as a search model. A similar arrangement of the four protein molecules could be observed.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez-Rodríguez, Sergio; Ultrastructure Laboratory, Vrije Universiteit Brussel, 1050 Brussels; González-Ramírez, Luis Antonio

Crystals of an active-site mutated hydantoin racemase from S. meliloti have been obtained in the presence and absence of d,l-5-isopropyl-hydantoin and characterized by X-ray diffraction. A recombinant active-site mutant of hydantoin racemase (C76A) from Sinorhizobium meliloti CECT 4114 (SmeHyuA) has been crystallized in the presence and absence of the substrate d,l-5-isopropyl hydantoin. Crystals of the SmeHyuA mutant suitable for data collection and structure determination were grown using the counter-diffusion method. X-ray data were collected to resolutions of 2.17 and 1.85 Å for the free and bound enzymes, respectively. Both crystals belong to space group R3 and contain two molecules ofmore » SmeHyuA per asymmetric unit. The crystals of the free and complexed SmeHyuA have unit-cell parameters a = b = 85.43, c = 152.37 Å and a = b = 85.69, c = 154.38 Å, crystal volumes per protein weight (V{sub M}) of 1.94 and 1.98 Å{sup 3} Da{sup −1} and solvent contents of 36.7 and 37.9%, respectively.« less

Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

DiMattia, Michael; Govindasamy, Lakshmanan; Levy, Hazel C.

2005-10-01

The production, purification, crystallization and preliminary crystallographic analysis of empty adeno-associated virus serotype 5 capsids are reported. Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Å resolution using synchrotron radiation and belong to the orthorhombicmore » space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c = 629.7 Å. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

Crystallization and preliminary X-ray analysis of a novel Kunitz-type kallikrein inhibitor from Bauhinia bauhinioides

PubMed Central

Navarro, Marcos Vicente de A. S.; Vierira, Débora F.; Nagem, Ronaldo A. P.; de Araújo, Ana Paula U.; Oliva, Maria Luiza V.; Garratt, Richard C.

2005-01-01

A Kunitz-type protease inhibitor (BbKI) found in Bauhinia bauhinioides seeds has been overexpressed in Escherichia coli and crystallized at 293 K using PEG 4000 as the precipitant. X-ray diffraction data have been collected to 1.87 Å resolution using an in-house X-ray generator. The crystals of the recombinant protein (rBbKI) belong to the orthorhombic space group P212121, with unit-cell parameters a = 46.70, b = 64.14, c = 59.24 Å. Calculation of the Matthews coefficient suggests the presence of one monomer of rBbKI in the asymmetric unit, with a corresponding solvent content of 51% (V M = 2.5 Å3 Da−1). Iodinated crystals were prepared and a derivative data set was also collected at 2.1 Å resolution. Crystals soaked for a few seconds in a cryogenic solution containing 0.5 M NaI were found to be reasonably isomorphous to the native crystals. Furthermore, the presence of iodide anions could be confirmed in the NaI-derivatized crystal. Data sets from native and derivative crystals are being evaluated for use in crystal structure determination by means of the SIRAS (single isomorphous replacement with anomalous scattering) method. PMID:16511193

Crystallization and x-ray diffraction analysis of a putative bacterial class I labdane-related diterpene synthase [Crysallization and preliminary x-ray diffraction analysis of a bacterial class I labdane-related diterpene synthase

DOE PAGES

Serrano-Posada, Hugo; Centeno-Leija, Sara; Rojas-Trejo, Sonia; ...

2015-08-25

Here, labdane-related diterpenoids are natural products with potential pharmaceutical applications that are rarely found in bacteria. Here, a putative class I labdane-related diterpene synthase (LrdC) identified by genome mining in a streptomycete was successfully crystallized using the microbatch method. Crystals of the LrdC enzyme were obtained in a holo form with its natural cofactor Mg 2+ (LrdC-Mg 2+) and in complex with inorganic pyrophosphate (PP i) (LrdC-Mg 2+–PP i). Crystals of native LrdC-Mg 2+ diffracted to 2.50 Å resolution and belonged to the trigonal space group P3 221, with unit-cell parameters a = b = 107.1, c = 89.2 Å.more » Crystals of the LrdC-Mg 2+–PP i complex grown in the same conditions as the native enzyme with PEG 8000 diffracted to 2.36 Å resolution and also belonged to the trigonal space group P3 221. Crystals of the LrdC-Mg 2+–PP i complex grown in a second crystallization condition with PEG 3350 diffracted to 2.57 Å resolution and belonged to the monoclinic space group P2 1, with unit-cell parameters a = 49.9, b = 104.1, c = 66.5 Å, β = 111.4°. The structure was determined by the single-wavelength anomalous dispersion (SAD) technique using the osmium signal from a potassium hexachloroosmate (IV) derivative.« less

Crystallization, optimization and preliminary X-ray characterization of a metal-dependent PI-PLC from Streptomyces antibioticus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Michael R.; Selby, Thomas L.

2012-10-30

A recombinant metal-dependent phosphatidylinositol-specific phospholipase C (PI-PLC) fromStreptomyces antibioticushas been crystallized by the hanging-drop method with and without heavy metals. The native crystals belonged to the orthorhombic space groupP222, with unit-cell parametersa= 41.26,b= 51.86,c = 154.78 Å. The X-ray diffraction results showed significant differences in the crystal quality of samples soaked with heavy atoms. Additionally, drop pinning, which increases the surface area of the drops, was also used to improve crystal growth and quality. The combination of heavy-metal soaks and drop pinning was found to be critical for producing high-quality crystals that diffracted to 1.23 Å resolution.

Purification, crystallization and preliminary X-ray diffraction analysis of the kinase domain of human tousled-like kinase 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garrote, Ana M.; Redondo, Pilar; Montoya, Guillermo, E-mail: gmontoya@cnio.es

2014-02-19

The C-terminal kinase domain of TLK2 (a human tousled-like kinase) has been cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. Tousled-like kinases (TLKs) are an evolutionarily conserved family of serine/threonine protein kinases involved in chromatin dynamics, including DNA replication and repair, transcription and chromosome segregation. The two members of the family reported in humans, namely TLK1 and TLK2, localize to the cell nucleus and are capable of forming homo- ormore » hetero-oligomers by themselves. To characterize the role of TLK2, its C-terminal kinase domain was cloned and overexpressed in Escherichia coli followed by purification to homogeneity. Crystallization experiments in the presence of ATP-γ-S yielded crystals suitable for X-ray diffraction analysis belonging to two different space groups: tetragonal I4{sub 1}22 and cubic P2{sub 1}3. The latter produced the best diffracting crystal (3.4 Å resolution using synchrotron radiation), with unit-cell parameters a = b = c = 126.05 Å, α = β = γ = 90°. The asymmetric unit contained one protein molecule, with a Matthews coefficient of 4.59 Å{sup 3} Da{sup −1} and a solvent content of 73.23%.« less

Zak phase induced multiband waveguide by two-dimensional photonic crystals.

PubMed

Yang, Yuting; Xu, Tao; Xu, Yun Fei; Hang, Zhi Hong

2017-08-15

Interface states in photonic crystals provide efficient approaches to control the flow of light. Photonic Zak phase determines the bulk band properties of photonic crystals, and, by assembling two photonic crystals with different bulk band properties together, deterministic interface states can be realized. By translating each unit cell of a photonic crystal by half the lattice constant, another photonic crystal with identical common gaps but a different Zak phase at each photonic band can be created. By assembling these two photonic crystals together, multiband waveguide can thus be easily created and then experimentally characterized. Our experimental results have good agreement with numerical simulations, and the propagation properties of these measured interface states indicate that this new type of interface state will be a good candidate for future applications of optical communications.

Expression, purification and crystallization of two major envelope proteins from white spot syndrome virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang, Xuhua; Hew, Choy Leong, E-mail: dbshewcl@nus.edu.sg

2007-07-01

The crystallization of the N-terminal transmembrane region-truncated VP26 and VP28 of white spot syndrome virus is described. White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapour-diffusion method. Crystals ofmore » SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 M sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 Å resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 Å. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 Å, and diffracts to 2.0 Å resolution.« less

Crystal structure, conformational analysis, and molecular dynamics of tetra-0-methyl-(+)-catechin

Treesearch

Frank R. Fronczek; Richard W. Hemingway; G. Wayne McGraw; Jan P. Steynberg; Carin A. Helfer; Wayne L. Mattice

1993-01-01

The structure of tetra-O-methyl-(+)-catechin has been determined in the crystalline state. Two independent molecules, denoted structure A and structure B, exist in the unit cell. Crystals are triclinic, space group P1, a=4.8125(2) Ǻ, b=12.9148(8) Ǻ, c=13.8862(11) Ǻ, α=86.962(6)°, β=89.120(5)°, γ=...

Production of extreme-purity aluminum and silicon by fractional crystallization processing

NASA Astrophysics Data System (ADS)

Dawless, R. K.; Troup, R. L.; Meier, D. L.; Rohatgi, A.

1988-06-01

Large scale fractional crystallization is used commercially at Alcoa to produce extreme purity aluminum (99.999+% Al). The primary market is sputtering targets used to make interconnects for integrated circuits. For some applications the impurities uranium and thorium are reduced to less than 1 ppbw to avoid "soft errors" associated with α particle emission. The crystallization process achieves segregation coefficients which are close to theoretical at normal yields, and this, coupled with the scale of the units, allows practical production of this material. The silicon purification process involves crystallization of Si from molten aluminum alloys containing about 30% silicon. The crystallites from this process are further treated to remove residual Al and an extreme purity ingot is obtained. This material is considered suitable for single crystal or ribbon type photovoltaic cells and for certain IC applications, including highly doped substrates used for epitaxial growth. In production of both extreme purity Al and Si, impurities are rejected to the remaining melt as the crystals form and some separation is achieved by draining this downgraded melt from the unit. Purification of this downgrade by crystallization has also been demonstrated for both systems and is important for achieving high recoveries.

Crystallization of human nicotinamide phosphoribosyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takahashi, Ryo; Nakamura, Shota; Yoshida, Takuya

2007-05-01

Human nicotinamide phosphoribosyltransferase has been crystallized using microseeding methods and X-ray diffraction data have been collected at 2.0 Å resolution. In the NAD biosynthetic pathway, nicotinamide phosphoribosyltransferase (NMPRTase; EC 2.4.2.12) plays an important role in catalyzing the synthesis of nicotinamide mononucleotide from nicotinamide and 5′-phosphoribosyl-1′-pyrophosphate. Because the diffraction pattern of the initally obtained crystals was not suitable for structure analysis, the crystal quality was improved by successive use of the microseeding technique. The resultant crystals diffracted to 2.0 Å resolution. These crystals belonged to space group P21, with unit-cell parameters a = 60.56, b = 106.40, c = 82.78 Å.more » Here, the crystallization of human NMPRTase is reported in the free form; the crystals should be useful for inhibitor-soaking experiments on the enzyme.« less

Six new complexes constructed from silver(I) and 2-(dinitromethylene)-1,3-diazacyclopentane (DNDZ): Synthesis, crystal structure and properties

NASA Astrophysics Data System (ADS)

Feng, Zhicun; Zhang, Hang; Xu, Kangzhen; Song, Jirong; Zhao, Fengqi

2018-04-01

Six different energetic silver complexes of 2-(dinitromethylene)-1,3-diazacyclopentane (DNDZ), Ag(DNDZ) (1), [Ag2(H2O)(DNDZ)]n (2), Ag(NH3)DNDZ (3), Ag(CH3NH2)(DNDZ) (4), Ag(C2H5NH2)(DNDZ) (5) and Ag(C3H7NH2)(DNDZ) (6), were first synthesized and structurally characterized. Complexes 2, 3, 5 and 6 were characterized by the single crystal X-ray diffraction analysis. Complexes 2, 5 and 6 crystallize in the monoclinic crystal system with space group P21/n containing four molecules per unit cell, but the crystal of complex 3 is triclinic with space group P-1 containing two molecules in each unit cell. Complexes 2 and 3 possess Ag⋯Ag interaction and corresponding central symmetric structure, but complexes 5 and 6 do not. Thermal behaviors of complexes 1-6 were determined and analyzed. The order of thermal stability for the six complexes is 4 > 3 >1 > 2 >5 > 6. Impact sensitivities for complexes 1-6 are >12 J, > 4 J, > 13 J, > 16 J, > 8 J and >7 J respectively, which corresponds well to the results of thermal stability for the six complexes except for complex 2. Moreover, natural bond orbital (NBO) analysis was used to investigate the bonding and hybridization of complex 3.

Crystal structures, in-silico study and anti-microbial potential of synthetic monocarbonyl curcuminoids

NASA Astrophysics Data System (ADS)

Ud Din, Zia; Serrano, N. F. G.; Ademi, Kastriot; Sousa, C. P.; Deflon, Victor Marcelo; Maia, Pedro Ivo da Silva; Rodrigues-Filho, Edson

2017-09-01

In this work the screening of 20 unsymmetrical chalcone and curcuminoids analogues in regard of their antimicrobial properties was conducted. Electron donating groups in the aromatic rings in the chalcone and curcuminoid derivatives produced higher antimicrobial effect. Compounds 1, 9 and 15 exhibited good activity against Escherichia coli and Staphylococcus aureus. These compounds were further evaluated against nine micro-organisms of pathological interest. Pharmmaper was used for target fishing of compounds against important bacterial targets. Molecular Docking helped to verify the results of these compounds against the selected bacterial target D-alanyl-D-alanine carboxypeptidase (PDB ID: 1PW1). The crystal structure of ligand and docked conformers in the active site of 1PW1 were analyzed. As a result structure-activity relationships are proposed. Structures of compounds 14 and 16 were obtained through single crystals X-ray diffraction studies. Compound 14 crystallizes in monoclinic space group P21/c with unit cell dimensions a = 13.1293(3) Å, b = 17.5364(4) Å, c = 15.1433(3) Å, β = 95.6440(10), V = 3469.70(13) Å3 and Z = 8. Compound 16 crystallizes in triclinic space group Pī with unit cell dimensions a = 6.8226(4) Å, b = 7.2256(4) Å, c = 18.1235(12) Å, β = 87.322(4), V = 850.57(9) Å3 and Z = 2.

Purification, crystallization and preliminary X-ray diffraction analysis of the Escherichia coli common pilus chaperone EcpB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Garnett, James A.; Diallo, Mamou; Matthews, Steve J., E-mail: s.j.matthews@imperial.ac.uk

In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher pathway that plays a major role in both early biofilm formation and host-cell adhesion. Initial attempts at crystallizing the chaperone EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. This is the first time that this refolding strategy has been used to purify CU chaperones. Pili are key cell-surface components that allow the attachment of bacteria to both biological andmore » abiotic solid surfaces, whilst also mediating interactions between themselves. In Escherichia coli, the common pilus (Ecp) belongs to an alternative chaperone–usher (CU) pathway that plays a major role in both early biofilm formation and host-cell adhesion. The chaperone EcpB is involved in the biogenesis of the filament, which is composed of EcpA and EcpD. Initial attempts at crystallizing EcpB using natively purified protein from the bacterial periplasm were not successful; however, after the isolation of EcpB under denaturing conditions and subsequent refolding, crystals were obtained at pH 8.0 using the sitting-drop method of vapour diffusion. Diffraction data have been processed to 2.4 Å resolution. These crystals belonged to the trigonal space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 62.65, c = 121.14 Å and one monomer in the asymmetric unit. Molecular replacement was unsuccessful, but selenomethionine-substituted protein and heavy-atom derivatives are being prepared for phasing. The three-dimensional structure of EcpB will provide invaluable information on the subtle mechanistic differences in biogenesis between the alternative and classical CU pathways. Furthermore, this is the first time that this refolding strategy has been used to purify CU chaperones, and it could be implemented in similar systems where it has not been possible to obtain highly ordered crystals.« less

Combinatorial compatibility as habit-controlling factor in lysozyme crystallization I. Monomeric and tetrameric F faces derived graph-theoretically

NASA Astrophysics Data System (ADS)

Strom, C. S.; Bennema, P.

1997-03-01

A series of two articles discusses possible morphological evidence for oligomerization of growth units in the crystallization of tetragonal lysozyme, based on a rigorous graph-theoretic derivation of the F faces. In the first study (Part I), the growth layers are derived as valid networks satisfying the conditions of F slices in the context of the PBC theory using the graph-theoretic method implemented in program FFACE [C.S. Strom, Z. Krist. 172 (1985) 11]. The analysis is performed in monomeric and alternative tetrameric and octameric formulations of the unit cell, assuming tetramer formation according to the strongest bonds. F (flat) slices with thickness Rdhkl ( {1}/{2} < R ≤ 1 ) are predicted theoretically in the forms 1 1 0, 0 1 1, 1 1 1. The relevant energies are established in the broken bond model. The relation between possible oligomeric specifications of the unit cell and combinatorially feasible F slice compositions in these orientations is explored.

Gene silencing pathway RNA-dependent RNA polymerase of Neurospora crassa: yeast expression and crystallization of selenomethionated QDE-1 protein.

PubMed

Laurila, Minni R L; Salgado, Paula S; Makeyev, Eugene V; Nettelship, Joanne; Stuart, David I; Grimes, Jonathan M; Bamford, Dennis H

2005-01-01

The RNA-dependent RNA polymerase, QDE-1, is a component of the RNA silencing pathway in Neurospora crassa. The enzymatically active carboxy-terminal fragment QDE-1 DeltaN has been expressed in Saccharomyces cerevisiae in the presence and absence of selenomethionine (SeMet). The level of SeMet incorporation was estimated by mass spectrometry to be approximately 98%. Both native and SeMet proteins were crystallized in space group P2(1) with unit cell parameters a=101.2, b=122.5, c=114.4A, beta=108.9 degrees , and 2 molecules per asymmetric unit. The native and SeMet crystals diffract to 2.3 and 3.2A, respectively, the latter are suitable for MAD structure determination.

Crystallization and preliminary crystallographic study of 3 alpha, 20 beta-hydroxysteroid dehydrogenase from Streptomyces hydrogenans.

PubMed

Fitzgerald, P M; Duax, W L; Punzi, J S; Orr, J C

1984-05-15

3 alpha, 20 beta-Hydroxysteroid dehydrogenase, an NADH-dependent oxidoreductase isolated from Streptomyces hydrogenans , is a tetramer containing four subunits each of Mr 25,000. The enzyme has been crystallized by the vapor diffusion technique using either phosphate or borate buffered ammonium sulfate (pH between 6.0 and 8.7) as the precipitant. The crystals are hexagonal bipyramids ; they have the symmetry of space group P6(4)22 (or P6(2)22), with unit cell dimensions a = 127.3 A, c = 112.2 A. Volume and density considerations imply that the crystallographic asymmetric unit contains two monomers, and therefore that the tetramer possesses a 2-fold axis of symmetry that is coincident with a crystallographic 2-fold symmetry element.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osiry, H.; Cano, A.; Reguera, L.

The pentacyanonitrosylferrate complex anion, [Fe(CN){sub 5}NO]{sup 2−}, forms an insoluble solid with Hg(I) ion, of formula unit Hg{sub 2}[Fe(CN){sub 5}NO]·2H{sub 2}O, whose crystal structure and related properties are unknown. This contribution reports the preparation of that compound by the precipitation method and its structural study from X-ray powder patterns complemented with spectroscopic information from IR, Raman, and UV–vis techniques. The crystal structure was solved ab initio and then refined using the Rietveld method. The solid crystallizes with a triclinic unit cell, in the P−1 space group, with cell parameters a=10.1202(12), b=10.1000(13), c=7.4704(11) Å; α=110.664(10), β=110.114(10), γ=104.724(8) °. Within the unitmore » cell, two formula units are accommodated (Z=2). It adopts a layered structure related with the coordination of the equatorial CN groups at their N end to the Hg atoms while the axial CN ligand remains unlinked. Within the layers neighboring Hg{sub 2}[Fe(CN){sub 5}NO] building units remain linked through four relatively strong Hg–Hg interactions, with an interatomic distance of 2.549(3) Å. The charge donation from the equatorial CN groups through their 5σ orbitals results into an increase for the electron density on the Hg atoms, which strengths the Hg–Hg bond. In the Raman spectrum, that metal–metal bond is detected as a stretching vibration band at 167 cm{sup −1}. The available free volume between neighboring layers accommodates two water molecules, which are stabilized within the framework through hydrogen bonds with the N end of the unlinked axial CN group. The removal of these weakly bonded water molecules results in structural disorder for the material 3D framework. - Graphical abstract: Assembling of Hg{sub 2}[Fe(CN){sub 5}NO] units through Hg–Hg interactions. - Highlights: • Homometallic Hg–Hg interactions in metal nitroprusside. • 2D structure supported on metal–metal interactions. • Crystal structure and related properties for mercury (I) nitroprusside. • IR and UV–vis spectral features for mercury (I) nitroprusside.« less

Strain-based control of crystal anisotropy for perovskite oxides on semiconductor-based material

DOEpatents

McKee, Rodney Allen; Walker, Frederick Joseph

2000-01-01

A crystalline structure and a semiconductor device includes a substrate of a semiconductor-based material and a thin film of an anisotropic crystalline material epitaxially arranged upon the surface of the substrate so that the thin film couples to the underlying substrate and so that the geometries of substantially all of the unit cells of the thin film are arranged in a predisposed orientation relative to the substrate surface. The predisposition of the geometries of the unit cells of the thin film is responsible for a predisposed orientation of a directional-dependent quality, such as the dipole moment, of the unit cells. The predisposed orientation of the unit cell geometries are influenced by either a stressed or strained condition of the lattice at the interface between the thin film material and the substrate surface.

A portable liquid crystal-based polarized light system for the detection of organophosphorus nerve gas.

PubMed

He, Feng Jie; Liu, Hui Long; Chen, Long Cong; Xiong, Xing Liang

2018-03-01

Liquid crystal (LC)-based sensors have the advantageous properties of being fast, sensitive, and label-free, the results of which can be accessed directly only through the naked eye. However, the inherent disadvantages possessed by LC sensors, such as relying heavily on polarizing microscopes and the difficulty to quantify, have limited the possibility of field applications. Herein, we have addressed these issues by constructing a portable polarized detection system with constant temperature control. This system is mainly composed of four parts: the LC cell, the optics unit, the automatic temperature control unit, and the image processing unit. The LC cell was based on the ordering transitions of LCs in the presence of analytes. The optics unit based on the imaging principle of LCs was designed to substitute the polarizing microscope for the real-time observation. The image processing unit is expected to quantify the concentration of analytes. The results have shown that the presented system can detect dimethyl methyl phosphonate (a stimulant for organophosphorus nerve gas) within 25 s, and the limit of detection is about 10 ppb. In all, our portable system has potential in field applications.

A portable liquid crystal-based polarized light system for the detection of organophosphorus nerve gas

NASA Astrophysics Data System (ADS)

He, Feng Jie; Liu, Hui Long; Chen, Long Cong; Xiong, Xing Liang

2018-03-01

Liquid crystal (LC)-based sensors have the advantageous properties of being fast, sensitive, and label-free, the results of which can be accessed directly only through the naked eye. However, the inherent disadvantages possessed by LC sensors, such as relying heavily on polarizing microscopes and the difficulty to quantify, have limited the possibility of field applications. Herein, we have addressed these issues by constructing a portable polarized detection system with constant temperature control. This system is mainly composed of four parts: the LC cell, the optics unit, the automatic temperature control unit, and the image processing unit. The LC cell was based on the ordering transitions of LCs in the presence of analytes. The optics unit based on the imaging principle of LCs was designed to substitute the polarizing microscope for the real-time observation. The image processing unit is expected to quantify the concentration of analytes. The results have shown that the presented system can detect dimethyl methyl phosphonate (a stimulant for organophosphorus nerve gas) within 25 s, and the limit of detection is about 10 ppb. In all, our portable system has potential in field applications.

Purification, crystallization and preliminary crystallographic analysis of Streptococcus pyogenes laminin-binding protein Lbp

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linke, Christian, E-mail: clin180@ec.auckland.ac.nz; Caradoc-Davies, Tom T.; Australian Synchrotron, Clayton, Victoria 3168

2008-02-01

The S. pyogenes laminin-binding protein Lbp, which is essential for adhesion to human laminin, has been expressed, purified and crystallized. The laminin-binding protein Lbp (Spy2007) from Streptococcus pyogenes (a group A streptococcus) mediates adhesion to the human basal lamina glycoprotein laminin. Accordingly, Lbp is essential in in vitro models of cell adhesion and invasion. However, the molecular and structural basis of laminin binding by bacteria remains unknown. Therefore, the lbp gene has been cloned for recombinant expression in Escherichia coli. Lbp has been purified and crystallized from 30%(w/v) PEG 1500 by the sitting-drop vapour-diffusion method. The crystals belonged to themore » monoclinic space group P2{sub 1}, with unit-cell parameters a = 42.62, b = 92.16, c = 70.61 Å, β = 106.27°, and diffracted to 2.5 Å resolution.« less

Crystallization and preliminary X-ray crystallographic analysis of the variable domain of Scl2.3, a streptococcal collagen-like protein from invasive M3-type Streptococcus pyogenes.

PubMed

Squeglia, Flavia; Bachert, Beth; Romano, Maria; Lukomski, Slawomir; Berisio, Rita

2013-09-01

Streptococcal collagen-like proteins (Scls) are widely expressed by the well recognized human pathogen Streptococcus pyogenes. These surface proteins contain a signature central collagen-like region and an amino-terminal globular domain, termed the variable domain, which is protruded away from the cell surface by the collagen-like domain. Despite their recognized importance in bacterial pathogenicity, no structural information is presently available on proteins of the Scl class. The variable domain of Scl2 from invasive M3-type S. pyogenes has successfully been crystallized using vapour-diffusion methods. The crystals diffracted to 1.5 Å resolution and belonged to space group H32, with unit-cell parameters a = 44.23, b = 44.23, c = 227.83 Å. The crystal structure was solved by single-wavelength anomalous dispersion using anomalous signal from a europium chloride derivative.|

Oxidation/reduction studies on Zr yU 1-yO 2+x and delineation of a new orthorhombic phase in U-Zr-O system

NASA Astrophysics Data System (ADS)

Sali, S. K.; Kulkarni, N. K.; Krishnan, K.; Achary, S. N.; Tyagi, A. K.

2008-08-01

In this communication, we report the oxidation and reduction behavior of fluorite type solid solutions in U-Zr-O. The maximum solubility of ZrO 2 in UO 2 lattice could be achieved with a mild oxidizing followed by reducing conditions. The role of valency state of U is more dominating in controlling the unit cell parameters than the incorporated interstitial oxygen in the fluorite lattice. The controlled oxidation studies on U-Zr-O solid solutions led to the delineation of a new distorted fluorite lattice at the U:Zr=2:1 composition. The detailed crystal structure analysis of this ordered composition Zr 0.33U 0.67O 2.33 (ZrU 2O 7) has been carried from the powder XRD data. This phase crystallizes in an orthorhombically distorted fluorite type lattice with unit cell parameters: a=5.1678(2), b=5.4848(2), c=5.5557(2) Å and V=157.47(1) Å 3 (Space group: Cmcm, No. 63). The metal ions have distorted cubical polyhedra with anion similar to the fluorite structure. The excess anions are occupied in the interstitial (empty cubes) of the fluorite unit cell. The crystal structure and chemical analyses suggest approximately equal fractions of U 4+ and U 6+ in this compound. The details of the thermal stability as well as kinetics of formation and oxidation of ZrU 2O 7 are also studied using thermogravimetry.

Searching the Cambridge Structural Database for polymorphs.

PubMed

van de Streek, Jacco; Motherwell, Sam

2005-10-01

In order to identify all pairs of polymorphs in the Cambridge Structural Database (CSD), a method was devised to automatically compare two crystal structures. The comparison is based on simulated powder diffraction patterns, but with special provisions to deal with differences in unit-cell volumes caused by temperature or pressure. Among the 325,000 crystal structures in the Cambridge Structural Database, 35,000 pairs of crystal structures of the same chemical compound were identified and compared. A total of 7300 pairs of polymorphs were identified, of which 154 previously were unknown.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

Ca4As3 – a new binary calcium arsenide

PubMed Central

Hoffmann, Andrea V.; Hlukhyy, Viktor; Fässler, Thomas F.

2015-01-01

The crystal structure of the binary compound tetra­calcium triarsenide, Ca4As3, was investigated by single-crystal X-ray diffraction. Ca4As3 crystallizes in the Ba4P3 structure type and is thus a homologue of isotypic Sr4As3. The unit cell contains 32 Ca2+ cations, 16 As3− isolated anions and four centrosymmetric [As2]4– dumbbells. The As atoms in each of the dumbbells are connected by a single bond, thus this calcium arsenide is a Zintl phase. PMID:26870427

Expression, purification, crystallization and preliminary X-ray crystallographic data from TktA, a transketolase from the lactic acid bacterium Lactobacillus salivarius

PubMed Central

Horsham, Matt; Saxby, Harriet; Blake, James; Isaacs, Neil W.; Mitchell, Tim J.; Riboldi-Tunnicliffe, Alan

2010-01-01

The enzyme transketolase from the lactic acid bacterium Lactobacillus salivarius (subsp. salivarius UCC118) has been recombinantly expressed and purified using an Escherichia coli expression system. Purified transketolase from L. salivarius has been crystallized using the vapour-diffusion technique. The crystals belonged to the trigonal space group P3221, with unit-cell parameters a = b = 75.43, c = 184.11 Å, and showed diffraction to 2.3 Å resolution. PMID:20693662

Crystallization and preliminary X-ray diffraction analysis of the amidase domain of allophanate hydrolase from Pseudomonas sp. strain ADP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balotra, Sahil; Newman, Janet; French, Nigel G.

2014-02-19

The amidase domain of the allophanate hydrolase AtzF from Pseudomonas sp. strain ADP has been crystallized and preliminary X-ray diffraction data have been collected. The allophanate hydrolase from Pseudomonas sp. strain ADP was expressed and purified, and a tryptic digest fragment was subsequently identified, expressed and purified. This 50 kDa construct retained amidase activity and was crystallized. The crystals diffracted to 2.5 Å resolution and adopted space group P2{sub 1}, with unit-cell parameters a = 82.4, b = 179.2, c = 112.6 Å, β = 106.6°.

DNA-guided nanoparticle assemblies

DOEpatents

Gang, Oleg; Nykypanchuk, Dmytro; Maye, Mathew; van der Lelie, Daniel

2013-07-16

In some embodiments, DNA-capped nanoparticles are used to define a degree of crystalline order in assemblies thereof. In some embodiments, thermodynamically reversible and stable body-centered cubic (bcc) structures, with particles occupying <.about.10% of the unit cell, are formed. Designs and pathways amenable to the crystallization of particle assemblies are identified. In some embodiments, a plasmonic crystal is provided. In some aspects, a method for controlling the properties of particle assemblages is provided. In some embodiments a catalyst is formed from nanoparticles linked by nucleic acid sequences and forming an open crystal structure with catalytically active agents attached to the crystal on its surface or in interstices.

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum.

PubMed

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier; Bernier-Villamor, Laura; Sevilla, Francisca; Lázaro, Juan José

2006-07-01

A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 angstroms from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 angstroms, alpha = 102.90, beta = 104.40, gamma = 99.07 degrees, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Logsdon, Naomi J.; Allen, Christopher E.; Rajashankar, Kanagalaghatta R.

2012-02-08

Interleukin-20 (IL-20) is an IL-10-family cytokine that regulates innate and adaptive immunity in skin and other tissues. In addition to protecting the host from various external pathogens, dysregulated IL-20 signaling has been shown to contribute to the pathogenesis of human psoriasis. IL-20 signals through two cell-surface receptor heterodimers, IL-20R1-IL-20R2 and IL-22R1-IL-20R2. In this report, crystals of the IL-20-IL-20R1-IL-20R2 ternary complex have been grown from polyethylene glycol solutions. The crystals belonged to space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = 111, c = 135 {angstrom}, and diffracted X-rays to 3 {angstrom} resolution. The crystallographic asymmetricmore » unit contains one IL-20-IL-20R1-IL-20R2 complex, corresponding to a solvent content of approximately 54%.« less

CFA-13 - a bifunctional perfluorinated metal-organic framework featuring active Cu(i) and Cu(ii) sites.

PubMed

Fritzsche, J; Denysenko, D; Grzywa, M; Volkmer, D

2017-11-07

The synthesis and crystal structure of the mixed-valent perfluorinated metal-organic framework (Me 2 NH 2 )[CFA-13] (Coordination Framework Augsburg University-13), (Me 2 NH 2 )[CuCu(tfpc) 4 ] (H 2 -tfpc = 3,5-bis(trifluoromethyl)-1H-pyrazole-4-carboxylic acid) is described. The copper-containing MOF crystallizes in the monoclinic crystal system within the space group P2 1 /n (no. 14) and the unit cell parameters are as follows: a = 22.3887(19), b = 13.6888(8), c = 21.1804(13) Å, β = 90.495(3)°, V = 6491.0(8) Å 3 . (Me 2 NH 2 )[CFA-13] features a porous 3-D structure constructed from two types of secondary building units (SBUs). Besides novel trinuclear [Cu(pz) 4 ] - coordination units, the network also exhibits Cu(ii) paddle-wheel SBUs. (Me 2 NH 2 )[CFA-13] is fully characterized by single crystal X-ray diffraction, thermogravimetric analysis, variable temperature powder X-ray diffraction, IR spectroscopy, photoluminescence, gas sorption measurements and pulse chemisorption experiments. M[CFA-13] (M = K + , Cs + ) frameworks were prepared by postsynthetic exchange of interchannel dimethylammonium cations. Moreover, it was shown that CO molecules can be selectively bound at Cu(i) sites of [Cu(pz) 4 ] - units, whereas Cu(ii) paddle-wheel units bind selectively NH 3 molecules.

Human 17β-hydroxysteroid dehydrogenase-ligand complexes: crystals of different space groups with various cations and combined seeding and co-crystallization

NASA Astrophysics Data System (ADS)

Zhu, D.-W.; Han, Q.; Qiu, W.; Campbell, R. L.; Xie, B.-X.; Azzi, A.; Lin, S.-X.

1999-01-01

Human estrogenic 17β-hydroxysteroid dehydrogenase (17β-HSD1) is responsible for the synthesis of active estrogens that stimulate the proliferation of breast cancer cells. The enzyme has been crystallized using a Mg 2+/PEG (3500)/β-octyl glucoside system [Zhu et al., J. Mol. Biol. 234 (1993) 242]. The space group of these crystals is C2. Here we report that cations can affect 17β-HSD1 crystallization significantly. In the presence of Mn 2+ instead of Mg 2+, crystals have been obtained in the same space group with similar unit cell dimensions. In the presence of Li + and Na + instead of Mg 2+, the space group has been changed to P2 12 12 1. A whole data set for a crystal of 17ß-HSD1 complex with progesterone grown in the presence of Li + has been collected to 1.95 Å resolution with a synchrotron source. The cell dimensions are a=41.91 Å, b=108.21 Å, c=117.00 Å. The structure has been preliminarily determined by molecular replacement, yielding important information on crystal packing in the presence of different cations. In order to further understand the structure-function relationship of 17β-HSD1, enzyme complexes with several ligands have been crystallized. As the steroids have very low aqueous solubility, we used a combined method of seeding and co-crystallization to obtain crystals of 17β-HSD1 complexed with various ligands. This method provides ideal conditions for growing complex crystals, with ligands such as 20α-hydroxysteroid progesterone, testosterone and 17β-methyl-estradiol-NADP +. Several complex structures have been determined with reliable electronic density of the bound ligands.

Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China

2012-06-22

Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less

Cloning, purification, crystallization and preliminary crystallographic analysis of SecA from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meining, Winfried, E-mail: wim@csb.ki.se; Scheuring, Johannes; Fischer, Markus

2006-06-01

SecA ATPase from E. faecalis has been cloned, overexpressed, purified and crystallized. Crystals belong to space group C2 and diffract to 2.4 Å resolution. The gene coding for SecA from Enterococcus faecalis was cloned and overexpressed in Escherichia coli. In this protein, the lysine at position 6 was replaced by an asparagine in order to reduce sensitivity towards proteases. The modified protein was purified and crystallized. Crystals diffracting to 2.4 Å resolution were obtained using the vapour-diffusion technique. The crystals belong to the monoclinic space group C2, with unit-cell parameters a = 203.4, b = 49.8, c = 100.8 Å,more » α = γ = 90.0, β = 119.1°. A selenomethionine derivative was prepared and is currently being tested in crystallization trials.« less

Preliminary X-ray data analysis of crystalline hibiscus chlorotic ringspot virus

PubMed Central

Cheng, Ao; Speir, Jeffrey A.; Yuan, Y. Adam; Johnson, John E.; Wong, Sek-Man

2009-01-01

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 Å resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 Å. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV. PMID:19478438

Preliminary X-ray Data Analysis of Crystalline Hibiscus Chlorotic Ringspot Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, A.; Speir, J; Yuan, Y

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3Synchrotron .2 Amore » resolution and allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 . Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.« less

Indexing amyloid peptide diffraction from serial femtosecond crystallography: new algorithms for sparse patterns

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brewster, Aaron S.; Sawaya, Michael R.; University of California, Los Angeles, CA 90095-1570

2015-02-01

Special methods are required to interpret sparse diffraction patterns collected from peptide crystals at X-ray free-electron lasers. Bragg spots can be indexed from composite-image powder rings, with crystal orientations then deduced from a very limited number of spot positions. Still diffraction patterns from peptide nanocrystals with small unit cells are challenging to index using conventional methods owing to the limited number of spots and the lack of crystal orientation information for individual images. New indexing algorithms have been developed as part of the Computational Crystallography Toolbox (cctbx) to overcome these challenges. Accurate unit-cell information derived from an aggregate data setmore » from thousands of diffraction patterns can be used to determine a crystal orientation matrix for individual images with as few as five reflections. These algorithms are potentially applicable not only to amyloid peptides but also to any set of diffraction patterns with sparse properties, such as low-resolution virus structures or high-throughput screening of still images captured by raster-scanning at synchrotron sources. As a proof of concept for this technique, successful integration of X-ray free-electron laser (XFEL) data to 2.5 Å resolution for the amyloid segment GNNQQNY from the Sup35 yeast prion is presented.« less

Synthesis, Crystal Structure, and Topology-Symmetry Analysis of a New Modification of NaIn[IO3]4

NASA Astrophysics Data System (ADS)

Belokoneva, E. L.; Karamysheva, A. S.; Dimitrova, O. V.; Volkov, A. S.

2018-01-01

Crystals of new iodate NaIn[IO3]4 were prepared by the hydrothermal synthesis. The unit cell parameters are a = 7.2672(2) Å, b = 15.2572(6) Å, c = 15.0208(6) Å, β = 101.517(3)°, sp. gr. P21/ c. The formula was determined during the structure determination and refinement of a twinned crystal based on a set of reflections from the atomic planes of the major individual. The refinement with anisotropic displacement parameters was performed for both twin components to the final R factor of 0.050. The In and Na atoms are in octahedral coordination formed by oxygen atoms. The oxygen octahedra are arranged into columns by sharing edges, and the columns are connected by isolated umbrella-like [IO3]- groups to form layers. The new structure is most similar to the isoformular iodate NaIn[IO3]4, which crystallizes in the same sp. gr. P21/ c and is structurally similar, but has a twice smaller unit cell and is characterized by another direction of the monoclinic axis. The structural similarity and difference between the two phases were studied by topologysymmetry analysis. The formation of these phases is related to different combinations of identical one-dimensional infinite chains of octahedra.

Crystal structure and phase transition in (NH4)3WO2F5: from dynamic to static orientational disorder.

PubMed

Udovenko, Anatoly; Laptash, Natalia

2015-08-01

Single crystals of tungsten double salt (NH4)3WO2F5 = (NH4)3[WO2F4]F have been synthesized by solid-state reaction or from fluoride solution and its crystal structures at 296 and 193 K were determined by X-ray diffraction. At room temperature, the crystal structure of the compound is dynamically disordered with the ligand atoms statistically distributed on two positions (6e and 24m) of the Pm3m unit cell [a = 6.0298 (1) Å], and the tungsten atom dynamically disordered on 12 orientations forming a spatial cuboctahedron [W12] that enables the real geometry of cis-WO2F4 octahedron to be determined with two short W-O distances. On cooling, the compound undergoes a first-order phase transition with the symmetry change Pm3m → Pa3 and a doubling of the unit-cell parameter [a = 11.9635 (7) Å]. The ligand F(O) atoms statistically occupy two general 24d sites and form W1X6 and W2X6 octahedra, in which the O and F atoms are not crystallographically different that means a static orientational disorder of (NH4)3WO2F5.

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier, E-mail: fjljara@ugr.es; Bernier-Villamor, Laura

2006-07-01

The isolation, purification, crystallization and molecular-replacement solution of mitochondrial type II peroxiredoxin from P. sativum is reported. A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 Å from a single crystal flash-cooledmore » at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 Å, α = 102.90, β = 104.40, γ = 99.07°, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.« less

Low temperature structural transformation in T[Ni(CN){sub 4}].xpyz with x=1,2; T=Mn,Co,Ni,Zn,Cd; pyz=pyrazine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rodriguez-Hernandez, J.; Instituto de Ciencia y Tecnologia de Materiales, Universidad de La Habana; Lemus-Santana, A.A.

2010-01-15

The materials under study are pillared solids T[Ni(CN){sub 4}].xpyz with one and two (x=1,2) pyrazine (pyz) molecules and where T=Mn, Co, Ni, Zn, Cd. Stimulated by their structural features and potential role as prototype of porous solids for hydrogen storage, the structural stability under cryogenic conditions for this series of pillared solids was studied. At low temperature, in the 100-200 K range, the occurrence of a reversible structural transformation was found. For T=Mn, Co, Zn, Cd, with x=2, the structural transformation was observed to occur around 185 K, and the low temperature phase crystallizes with a monoclinic unit cell (spacemore » group Pc). This structure change results from certain charge redistribution on cooling within the involved ligands. For T=Ni with x=1, both the low and high temperature phases crystallize with unit cells of tetragonal symmetry, within the same space group but with a different unit cell volume. In this case the structure change is observed around 120 K. Above that temperature the rotational states for the pyrazine molecule are thermally excited and all the pyrazine molecules in the structure become equivalent. Under this condition the material structure is described using a smaller structural unit. The structural study using X-ray powder diffraction data was complemented with calorimetric and Raman spectroscopy measurements. For the low temperature phases the crystal structures were solved from Patterson methods and then refined using the Rietveld method. - Graphical abstract: Low temperature ordered structure for pyrazine in T[Ni(CN){sub 4}].pyz.« less

On the Use of Dynamical Diffraction Theory To Refine Crystal Structure from Electron Diffraction Data: Application to KLa5O5(VO4)2, a Material with Promising Luminescent Properties.

PubMed

Colmont, Marie; Palatinus, Lukas; Huvé, Marielle; Kabbour, Houria; Saitzek, Sébastien; Djelal, Nora; Roussel, Pascal

2016-03-07

A new lanthanum oxide, KLa5O5(VO4)2, was synthesized using a flux growth technique that involved solid-state reaction under an air atmosphere at 900 °C. The crystal structure was solved and refined using an innovative approach recently established and based on three-dimensional (3D) electron diffraction data, using precession of the electron beam and then validated against Rietveld refinement and denisty functional theory (DFT) calculations. It crystallizes in a monoclinic unit cell with space group C2/m and has unit cell parameters of a = 20.2282(14) Å, b = 5.8639(4) Å, c = 12.6060(9) Å, and β = 117.64(1)°. Its structure is built on Cresnel-like two-dimensional (2D) units (La5O5) of 4*3 (OLa4) tetrahedra, which run parallel to (001) plane, being surrounded by isolated VO4 tetrahedra. Four isolated vanadate groups create channels that host K(+) ions. Substitution of K(+) cations by another alkali metal is possible, going from lithium to rubidium. Li substitution led to a similar phase with a primitive monoclinic unit cell. A complementary selected area electron diffraction (SAED) study highlighted diffuse streaks associated with stacking faults observed on high-resolution electron microscopy (HREM) images of the lithium compound. Finally, preliminary catalytic tests for ethanol oxidation are reported, as well as luminescence evidence. This paper also describes how solid-state chemists can take advantages of recent progresses in electron crystallography, assisted by DFT calculations and powder X-ray diffraction (PXRD) refinements, to propose new structural types with potential applications to the physicist community.

Growth and characterization of Cadmium Thiosemicarbazide Bromide crystals for antibacterial and nonlinear optical applications

NASA Astrophysics Data System (ADS)

Thomas Joseph Prakash, J.; Martin Sam Gnanaraj, J.

2015-01-01

Semiorganic nonlinear optical crystals of Cadmium Thiosemicarbazide Bromide was grown by slow evaporation solution growth technique. The unit cell parameters were estimated by subjecting the crystals to single crystal X-ray diffraction. The grown crystals were subjected to Powder X-ray diffraction for analyzing the crystalline nature of the sample. FTIR studies reveal the functional groups and the optical characters were analyzed by UV-Vis spectral studies. Mechanical stability of the sample was assessed by Vicker's micro hardness test. The presence of surface dislocations was identified by chemical etching technique. Antibacterial study was carried out against ACDP declared harmful pathogens. SHG efficiency of CTSB crystal was tested using Nd: YAG laser and it was found to be ∼1.8 times that of potassium dihydrogen phosphate.

Biochemical, spectroscopic and X-ray structural analysis of deuterated multicopper oxidase CueO prepared from a new expression construct for neutron crystallography.

PubMed

Akter, Mahfuza; Inoue, Chika; Komori, Hirofumi; Matsuda, Nana; Sakurai, Takeshi; Kataoka, Kunishige; Higuchi, Yoshiki; Shibata, Naoki

2016-10-01

Multicopper oxidases oxidize various phenolic and nonphenolic compounds by using molecular oxygen as an electron acceptor to produce water. A multicopper oxidase protein, CueO, from Escherichia coli is involved in copper homeostasis in the bacterial cell. Although X-ray crystallographic studies have been conducted, the reduction mechanism of oxygen and the proton-transfer pathway remain unclear owing to the difficulty in identifying H atoms from X-ray diffraction data alone. To elucidate the reaction mechanism using neutron crystallography, a preparation system for obtaining large, high-quality single crystals of deuterated CueO was developed. Tiny crystals were obtained from the deuterated CueO initially prepared from the original construct. The X-ray crystal structure of the deuterated CueO showed that the protein contained an incompletely truncated signal sequence at the N-terminus, which resulted in the heterogeneity of the protein sample for crystallization. Here, a new CueO expression system that had an HRV3C cleavage site just after the signal sequence was constructed. Deuterated CueO from the new construct was expressed in cells cultured in deuterated algae-extract medium and the signal sequence was completely eliminated by HRV3C protease. The deuteration level of the purified protein was estimated by MALDI-TOF mass spectrometry to be at least 83.2% compared with nondeuterated protein. Nondeuterated CueO crystallized in space group P2 1 , with unit-cell parameters a = 49.51, b = 88.79, c = 53.95 Å, β = 94.24°, and deuterated CueO crystallized in space group P2 1 2 1 2 1 , with unit-cell parameters a = 49.91, b = 106.92, c = 262.89 Å. The crystallographic parameters for the crystals of the new construct were different from those previously reported for nondeuterated crystals. The nondeuterated and deuterated CueO from the new construct had similar UV-Vis spectra, enzymatic activities and overall structure and geometry of the ligands of the Cu atoms in the active site to those of previously reported CueO structures. These results indicate that the CueO protein prepared using the new construct is suitable for further neutron diffraction studies.

Production, Purification, Crystallization and Preliminary X-ray Structural Studies of Adeno-Associated Virus Serotype 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

DiMattia,M.; Govindasamy, L.; Levy, H.

2005-01-01

Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

X-ray diffraction and infrared spectroscopy of N,N-dimethylformamide and dimethyl sulfoxide solvatomorphs of betulonic acid.

PubMed

Boryczka, Stanisław; Jastrzebska, Maria; Bębenek, Ewa; Kusz, Joachim; Zubko, Maciej; Kadela, Monika; Michalik, Ewa

2012-12-01

X-ray diffraction and infrared spectroscopy measurements for the N,N-dimethylformamide (DMF) and dimethyl sulfoxide (DMSO) solvatomorphs of betulonic acid (BA) were investigated. BA [3-oxolup-20(29)-en-28-oic acid, C(30)H(46)O(3)] exhibits a wide spectrum of biological activities and is considered to be a promising natural agent for the treatment of various cancer diseases. BA as a noncrystalline substance was obtained by oxidation of betulin. Crystal structures and the spectral data allowed analysis of hydrogen bonding (H-bonding), molecular conformation, and crystal packing differences in the solvatomorphs. Crystals of BA solvates were grown from the DMF-acetone (1:10, v/v) and DMSO-water (9:1, v/v) solutions. BA-DMF (1:1) solvate crystallizes in the monoclinic P2(1) space group, Z = 2. The unit cell parameters are as follows: cell lengths a = 13.2458(5) Å, b = 6.6501(2) Å, c = 17.9766(7) Å, and β = 110.513(4)°. BA-DMSO (1:1) solvate crystallizes in the orthorhombic P2(1)2(1)2(1) (Z = 4) space group with the following unit cell parameters: a = 6.6484(4) Å, b = 13.3279(8) Å, and c = 32.6821(19) Å. Conformational analysis of the six-membered rings, cyclopentane ring, and isopropenyl group showed differences in comparison with other betulin derivatives examined earlier. For both solvates, the intermolecular packing arrangement was governed mainly by H-bonds. The shortest H-bonds with D···A distances of 2.604 and 2.657 Å, and almost linear DH···A connection occurred between OH of carboxylic group of BA and oxygen atoms from O=C and O=S groups of DMF and DMSO, respectively. Copyright © 2012 Wiley Periodicals, Inc.

Applications of thermal-gradients method for the optimization of α-amylase crystallization conditions based on dynamic and static light scattering data

NASA Astrophysics Data System (ADS)

Delboni, L. F.; Iulek, J.; Burger, R.; da Silva, A. C. R.; Moreno, A.

2002-02-01

The expression, purification, crystallization, and characterization by X-ray diffraction of α-amylase are described here. Dynamic and static light scattering methods with a temperature controller was used to optimize the crystallization conditions of α-amylase from Bacillus stearothermophilus an important enzyme in many fields of industrial activity. After applying thermal gradients for growing crystals, X-ray cryo-crystallographic methods were employed for the data collection. Crystals grown by these thermal-gradients diffracted up to a maximum resolution of 3.8 Å, which allowed the determination of the unit cell constants as follows: a=61.7 Å, b=86.7 Å, c=92.2 Å and space group C222 (or C222 1).

Crystallization and crystallographic studies of kallistatin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

2015-08-25

The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina.

PubMed

Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim

2005-06-01

Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.

Overexpression, purification, crystallization and preliminary structural studies of catabolic ornithine transcarbamylase from Lactobacillus hilgardii

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rivas, Blanca de las; Rodríguez, Héctor; Angulo, Iván

2007-07-01

The catabolic ornithine transcarbamylase (cOTC) from L. hilgardii has been overexpressed in E. coli, purified and crystallized under two different experimental conditions. The structure has been solved by the molecular-replacement method using the atomic coordinates of catabolic ornithine transcarbamylase from P. aeruginosa as the search model. The catabolic ornithine transcarbamylase (cOTC; EC 2.1.3.3) from the lactic acid bacteria Lactobacillus hilgardii is a key protein involved in the degradation of arginine during malolactic fermentation. cOTC containing an N-terminal His{sub 6} tag has been overexpressed in Escherichia coli, purified and crystallized under two different experimental conditions using the hanging-drop vapour-diffusion method. Crystalsmore » obtained from a solution containing 8%(w/v) PEG 4000, 75 mM sodium acetate pH 4.6 belong to the trigonal space group P321 and have unit-cell parameters a = b = 157.04, c = 79.28 Å. Conversely, crystals grown in 20%(v/v) 2-methyl-2,4-pentanediol, 7.5%(w/v) PEG 4000, 100 mM HEPES pH 7.8 belong to the monoclinic space group C2 and have unit-cell parameters a = 80.06, b = 148.90, c = 91.67 Å, β = 100.25°. Diffraction data were collected in-house to 3.00 and 2.91 Å resolution for trigonal and monoclinic crystals, respectively. The estimated Matthews coefficient for the crystal forms were 2.36 and 2.24 Å{sup 3} Da{sup −1}, respectively, corresponding to 48% and 45% solvent content. In both cases, the results are consistent with the presence of three protein subunits in the asymmetric unit. The structure of cOTC has been determined by the molecular-replacement method using the atomic coordinates of cOTC from Pseudomonas aeruginosa (PDB code) as the search model.« less

Crystallization of Spätzle, a cystine-knot protein involved in embryonic development and innate immunity in Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoffmann, Anita; Neumann, Piotr; Schierhorn, Angelika

2008-08-01

Crystallization of the cystine-knot protein Spätzle occurred following serendipitous limited degradation of the pro-Spätzle propeptide during the crystallization experiment. The Spätzle protein is involved in both the definition of the dorsal–ventral axis during embryonic development and in the adult innate immune response. The disulfide-linked dimeric cystine-knot protein has been expressed as a proprotein in inclusion bodies in Escherichia coli and refolded in vitro by rapid dilution. Initial orthorhombic crystals that diffracted to 7 Å resolution were obtained after three months by the sitting-drop vapour-diffusion method. Optimization of the crystallization conditions resulted in orthorhombic crystals (space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 53.0, b = 59.2, c = 62.5 Å) that diffracted to 2.8 Å resolution in-house. The small volume of the asymmetric unit indicated that it was not possible for the crystals to contain the complete pro-Spätzle dimer. Mass spectrometry, N-terminal sequencing and Western-blot analysis revealed that the crystals contained the C-terminal disulfide-linked cystine-knot dimer. Comparison of various crystallization experiments indicated that degradation of the N-terminal prodomain was dependent on the buffer conditions.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gavira, José A.; Jesus, Walleska de; Camara-Artigas, Ana

The haemoglobin II from the clam L. pectinata has been crystallized using counter-diffusion in single capillary in the presence of agarose to improve crystal quality. Initial phases have been obtained by molecular replacement. Haemoglobin II is one of three haemoglobins present in the cytoplasm of the Lucina pectinata mollusc that inhabits the Caribbean coast. Using HBII purified from its natural source, crystallization screening was performed using the counter-diffusion method with capillaries of 0.2 mm inner diameter. Crystals of HbII suitable for data collection and structure determination were grown in the presence of agarose at 0.1%(w/v) in order to improve theirmore » quality. The crystals belong to the tetragonal space group P4{sub 2}2{sub 1}2, with unit-cell parameters a = b = 73.92, c = 152.35 Å, and diffracted X-rays to a resolution of better than 2.0 Å. The asymmetric unit is a homodimer with a corresponding Matthews coefficient (V{sub M}) of 3.15 Å{sup 3} Da{sup −1} and a solvent content of 61% by volume.« less

Overexpression, crystallization and preliminary X-ray crystallographic analysis of erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa.

PubMed

Ha, Jun Yong; Lee, Ji Hyun; Kim, Kyoung Hoon; Kim, Do Jin; Lee, Hyung Ho; Kim, Hye-Kyung; Yoon, Hye-Jin; Suh, Se Won

2006-02-01

The enzyme erythronate-4-phosphate dehydrogenase catalyses the conversion of erythronate-4-phosphate to 3-hydroxy-4-phospho-hydroxy-alpha-ketobutyrate. It belongs to the D-isomer-specific 2-hydroxyacid dehydrogenase family. It is essential for de novo biosynthesis of vitamin B6 (pyridoxine). Erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa, a homodimeric enzyme consisting of two identical 380-residue subunits, has been overexpressed in Escherichia coli with a C-terminal purification tag and crystallized at 297 K using 0.7 M ammonium dihydrogen phosphate, 0.4 M ammonium tartrate, 0.1 M sodium citrate pH 5.6 and 10 mM cupric chloride. X-ray diffraction data were collected to 2.20 A from a crystal grown in the presence of NADH. The crystals belong to the orthorhombic space group P2(1)2(1)2(1), with unit-cell parameters a = 84.77, b = 101.28, c = 142.58 A. A dimeric molecule is present in the asymmetric unit, giving a crystal volume per protein weight (VM) of 3.64 A3 Da(-1) and a solvent content of 66%.

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Expression, purification and crystallization of a lyssavirus matrix (M) protein

PubMed Central

Assenberg, René; Delmas, Olivier; Graham, Stephen C.; Verma, Anil; Berrow, Nick; Stuart, David I.; Owens, Raymond J.; Bourhy, Hervé; Grimes, Jonathan M.

2008-01-01

The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number of factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6122 or P6522, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress. PMID:18391421

DOE Office of Scientific and Technical Information (OSTI.GOV)

Malet, Hélène; Dalle, Karen; Brémond, Nicolas

The SARS-CoV macro domain was expressed, purified and crystallized. Selenomethionine-labelled crystals diffracted to 1.8 Å resolution. Macro domains or X domains are found as modules of multidomain proteins, but can also constitute a protein on their own. Recently, biochemical and structural studies of cellular macro domains have been performed, showing that they are active as ADP-ribose-1′′-phosphatases. Macro domains are also present in a number of positive-stranded RNA viruses, but their precise function in viral replication is still unknown. The major human pathogen severe acute respiratory syndrome coronavirus (SARS-CoV) encodes 16 non-structural proteins (nsps), one of which (nsp3) encompasses a macromore » domain. The SARS-CoV nsp3 gene region corresponding to amino acids 182–355 has been cloned, expressed in Escherichia coli, purified and crystallized. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 37.5, b = 55.6, c = 108.9 Å, β = 91.4°, and the asymmetric unit contains either two or three molecules. Both native and selenomethionine-labelled crystals diffract to 1.8 Å.« less

Expression, purification and preliminary X-ray characterization of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Omi, Rie; Department of Chemistry, Graduate School of Science, Osaka City University, Sumiyoshi-ku, Osaka 558-8585; Jitsumori, Keiji

A recombinant form of dl-2-haloacid dehalogenase from Methylobacterium sp. CPA1 has been expressed in E. coli, purified and crystallized. The crystal belongs to space group P6{sub 3}. Diffraction data have been collected to 1.75 Å resolution. dl-2-Haloacid dehalogenase from Methylobacterium sp. CPA1 (dl-DEX Mb) is a unique enzyme that catalyzes the dehalogenation reaction without the formation of an ester intermediate. A recombinant form of dl-DEX Mb has been expressed in Escherichia coli, purified and crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the hexagonal space group P6{sub 3}, with unit-cell parameters a = b = 186.2, c =more » 114.4 Å. The crystals are likely to contain between four and eight monomers in the asymmetric unit, with a V{sub M} value of 4.20–2.10 Å{sup 3} Da{sup −1}. A self-rotation function revealed peaks on the χ = 180° section. X-ray data have been collected to 1.75 Å resolution.« less

Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

Crystallization and X-ray diffraction analysis of an l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii and a d-xylonate dehydratase from Caulobacter crescentus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahman, Mohammad Mubinur; Andberg, Martina; Koivula, Anu

l-Arabinonate dehydratase and d-xylonate dehydratase from the IlvD/EDD family were crystallized by the vapour-diffusion method. Diffraction data sets were collected to resolutions of 2.40 and 2.66 Å from crystals of l-arabinonate dehydratase and d-xylonate dehydratase, respectively. l-Arabinonate dehydratase (EC 4.2.1.25) and d-xylonate dehydratase (EC 4.2.1.82) are two enzymes that are involved in a nonphosphorylative oxidation pathway of pentose sugars. l-Arabinonate dehydratase converts l-arabinonate into 2-dehydro-3-deoxy-l-arabinonate, and d-xylonate dehydratase catalyzes the dehydration of d-xylonate to 2-dehydro-3-deoxy-d-xylonate. l-Arabinonate and d-xylonate dehydratases belong to the IlvD/EDD family, together with 6-phosphogluconate dehydratases and dihydroxyacid dehydratases. No crystal structure of any l-arabinonate or d-xylonate dehydratasemore » is available in the PDB. In this study, recombinant l-arabinonate dehydratase from Rhizobium leguminosarum bv. trifolii (RlArDHT) and d-xylonate dehydratase from Caulobacter crescentus (CcXyDHT) were heterologously expressed in Escherichia coli and purified by the use of affinity chromatography followed by gel-filtration chromatography. The purified proteins were crystallized using the hanging-drop vapour-diffusion method at 293 K. Crystals of RlArDHT that diffracted to 2.40 Å resolution were obtained using sodium formate as a precipitating agent. They belonged to space group P2{sub 1}, with unit-cell parameters a = 106.07, b = 208.61, c = 147.09 Å, β = 90.43°. Eight RlArDHT molecules (two tetramers) in the asymmetric unit give a V{sub M} value of 3.2 Å{sup 3} Da{sup −1} and a solvent content of 62%. Crystals of CcXyDHT that diffracted to 2.66 Å resolution were obtained using sodium formate and polyethylene glycol 3350. They belonged to space group C2, with unit-cell parameters a = 270.42, b = 236.13, c = 65.17 Å, β = 97.38°. Four CcXyDHT molecules (a tetramer) in the asymmetric unit give a V{sub M} value of 4.0 Å{sup 3} Da{sup −1} and a solvent content of 69%.« less

Cloning, expression, purification and preliminary crystallographic characterization of a shikimate dehydrogenase from Corynebacterium glutamicum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schoepe, Jan, E-mail: jschoepe@smail.uni-koeln.de; Niefind, Karsten; Chatterjee, Shivani

2006-07-01

The crystallization and preliminary X-ray characterization of a shikimate dehydrogenase from C. glutamicum is presented. The shikimate dehydrogenase from Corynebacterium glutamicum has been cloned into an Escherichia coli expression vector, overexpressed and purified. Native crystals were obtained by the vapour-diffusion technique using 2-methyl-2,4-pentanediol as a precipitant. The crystals belong to the centred monoclinic space group C2, with unit-cell parameters a = 118.77, b = 63.17, c = 35.67 Å, β = 92.26° (at 100 K), and diffract to 1.64 Å on a synchrotron X-ray source. The asymmetric unit is likely to contain one molecule, corresponding to a packing density ofmore » 2.08 Å{sup 3} Da{sup −1} and a solvent content of about 41%.« less

Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee,Y.; Kumar, S.; Jobichen, C.

2007-01-01

Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

Production, crystallization and preliminary crystallographic analysis of Allochromatium vinosum thiosulfate dehydrogenase TsdA, an unusual acidophilic c-type cytochrome

PubMed Central

Brito, José A.; Gutierres, André; Denkmann, Kevin; Dahl, Christiane; Archer, Margarida

2014-01-01

The ability to perform the very simple oxidation of two molecules of thiosulfate to tetrathionate is widespread among prokaryotes. Despite the prevalent occurrence of tetrathionate formation and its well documented significance within the sulfur cycle, little is known about the enzymes that catalyze the oxidative condensation of two thiosulfate anions. To fill this gap, the thiosulfate dehydrogenase (TsdA) enzyme from the purple sulfur bacterium Allochromatium vinosum was recombinantly expressed in Escherichia coli, purified and crystallized, and a crystallographic data set was collected. The crystals belonged to the monoclinic space group C2, with unit-cell parameters a = 79.2, b = 69.9, c = 57.9 Å, β = 129.3°, contained one monomer per asymmetric unit and diffracted to a resolution of 1.98 Å. PMID:25286955

Crystallization and preliminary crystallographic studies of Hyp-1, a St John’s wort protein implicated in the biosynthesis of hypericin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandes, Humberto; Konieczna, Malgorzata; Kolodziejczyk, Robert

2008-05-01

The Hyp-1 protein suggested to be a phenolic oxidative-coupling enzyme involved in the biosynthesis of hypericin, a medicinally important natural compound found in St John’s wort (H. perforatum), has been expressed, purified and prepared in single-crystal form. According to a debated hypothesis, the biosynthesis from emodin of the medicinally important natural compound hypericin is catalyzed in St John’s wort (Hypericum perforatum) by the phenolic oxidative-coupling protein Hyp-1. Recombinant St John’s wort Hyp-1 has been overexpressed in Escherichia coli and obtained in single-crystal form. The crystals belong to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters amore » = 37.5, b = 76.7, c = 119.8 Å, contain two protein molecules in the asymmetric unit and diffract X-rays to 1.73 Å resolution.« less

Crystallization and preliminary X-ray analysis of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1

PubMed Central

Taketa, Midori; Nakagawa, Hanae; Habukawa, Mao; Osuka, Hisao; Kihira, Kiyohito; Komori, Hirofumi; Shibata, Naoki; Ishii, Masaharu; Igarashi, Yasuo; Nishihara, Hirofumi; Yoon, Ki-Seok; Ogo, Seiji; Shomura, Yasuhito; Higuchi, Yoshiki

2015-01-01

NAD+-reducing [NiFe] hydrogenases catalyze the oxidoreduction of dihydrogen concomitant with the interconversion of NAD+ and NADH. Here, the isolation, purification and crystallization of the NAD+-reducing [NiFe] hydrogenase from Hydrogenophilus thermoluteolus TH-1 are reported. Crystals of the NAD+-reducing [NiFe] hydrogenase were obtained within one week from a solution containing polyethylene glycol using the sitting-drop vapour-diffusion method and micro-seeding. The crystal diffracted to 2.58 Å resolution and belonged to space group C2, with unit-cell parameters a = 131.43, b = 189.71, c = 124.59 Å, β = 109.42°. Assuming the presence of two NAD+-reducing [NiFe] hydrogenase molecules in the asymmetric unit, V M was calculated to be 2.2 Å3  Da−1, which corresponds to a solvent content of 43%. Initial phases were determined by the single-wavelength anomalous dispersion method using the anomalous signal from the Fe atoms. PMID:25615977

Purification, crystallization and preliminary X-ray diffraction analysis of a soluble variant of the monoglyceride lipase Yju3p from the yeast Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rengachari, Srinivasan; Aschauer, Philipp; Sturm, Christian

A soluble variant of the monoglyceride lipase Yju3p was successfully expressed, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. The protein Yju3p is the orthologue of monoglyceride lipases in the yeast Saccharomyces cerevisiae. A soluble variant of this lipase termed s-Yju3p (38.3 kDa) was generated and purified to homogeneity by affinity and size-exclusion chromatography. s-Yju3p was crystallized in a vapour-diffusion setup at 293 K and a complete data set was collected to 2.4 Å resolution. The crystal form was orthorhombic (space group P2{sub 1}2{sub 1}2{sub 1}), with unit-cell parameters a = 77.2, b = 108.6, c =more » 167.7 Å. The asymmetric unit contained four molecules with a solvent content of 46.4%.« less

Purification, crystallization and preliminary diffraction studies of an ectromelia virus glutaredoxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bacik, John-Paul; Brigley, Angela M.; Channon, Lisa D.

2005-06-01

Ectromelia virus glutaredoxin has been crystallized in the presence of the reducing agent DTT. A diffraction data set has been collected and processed to 1.8 Å resolution. Ectromelia, vaccinia, smallpox and other closely related viruses of the orthopoxvirus genus encode a glutaredoxin gene that is not present in poxviruses outside of this genus. The vaccinia glutaredoxin O2L has been implicated as the reducing agent for ribonucleotide reductase and may thus play an important role in viral deoxyribonucleotide synthesis. As part of an effort to understand nucleotide metabolism by poxviruses, EVM053, the O2L ortholog of the ectromelia virus, has been crystallized.more » EVM053 crystallizes in space group C222{sub 1}, with unit-cell parameters a = 61.98, b = 67.57, c = 108.55 Å. Diffraction data have been processed to 1.8 Å resolution and a self-rotation function indicates that there are two molecules per asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of porcine acylaminoacyl peptidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wright, Helena; Kiss, András L.; Szeltner, Zoltán

2005-10-01

Acylaminoacyl peptidase from porcine liver has been crystallized. Data were collected to 3.4 Å from native crystals and a search for heavy-atom derivatives is in progress. Acylaminoacyl peptidase (also known as acylamino-acid-releasing enzyme or acylpeptide hydrolase; EC 3.4.19.1) is an unusual member of the prolyl oligopeptidase family catalysing the hydrolysis of an N-acylated peptide to an acylamino acid and a peptide with a free N-terminus. Acylaminoacyl peptidase purified from porcine liver has been crystallized in mother liquor containing 0.1 M Tris–HCl pH 7.0, 10%(w/v) polyethylene glycol 8000, 50 mM MgCl{sub 2} and 1%(w/v) CHAPS using the hanging-drop vapour-diffusion technique. Amore » full data set to 3.4 Å resolution was collected at ESRF beamline ID14-4 and space group C222 was assigned, with unit-cell parameters a = 84.8, b = 421.1, c = 212.0 Å and four molecules in the asymmetric unit.« less

High-level Expression Purification Crystallization and Preliminary X-ray Crystallographic Studies of the Receptor Binding Domain of botulinum neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; X Gao; G Buchko

2011-12-31

Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

High-level expression, purification, crystallization and preliminary X-ray crystallographic studies of the receptor-binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Y.; Robinson, H.; Gao, X.

2010-12-01

Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

Crystallization and preliminary X-ray diffraction analysis of FabG from Yersinia pestis.

PubMed

Nanson, Jeffrey David; Forwood, Jade Kenneth

2014-01-01

The type II fatty-acid biosynthesis pathway of bacteria provides enormous potential for antibacterial drug development owing to the structural differences between this and the type I fatty-acid biosynthesis system found in mammals. β-Ketoacyl-ACP reductase (FabG) is responsible for the reduction of the β-ketoacyl group linked to acyl carrier protein (ACP), and is essential for the formation of fatty acids and bacterial survival. Here, the cloning, expression, purification, crystallization and diffraction of FabG from Yersinia pestis (ypFabG), the highly virulent causative agent of plague, are reported. Recombinant FabG was expressed, purified to homogeneity and crystallized via the hanging-drop vapour-diffusion technique. Diffraction data were collected at the Australian Synchrotron to 2.30 Å resolution. The crystal displayed P2(1)2(1)2(1) symmetry, with unit-cell parameters a = 68.22, b = 98.68, c = 169.84 Å, and four ypFabG molecules in the asymmetric unit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marçal, D.; Rego, A. T.; Fogg, M. J.

1,3-Propanediol dehydrogenase from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data have been collected to 2.7 Å resolution. 1,3-Propanediol dehydrogenase (1,3-PD-DH), encoded by the dhaT gene, is a key enzyme in the dissimilation process for converting glycerol to 1,3-propanediol in the human pathogen Klebsiella pneumoniae. Single colourless crystals were obtained from a recombinant preparation of 1,3-propanediol dehydrogenase overexpressed in Escherichia coli. The crystals belong to space group P2{sub 1}, with unit-cell parameters a = 91.9, b = 226.6, c = 232.6 Å, β = 92.9°. The crystals probably contain two decamers in the asymmetric unit,more » with a V{sub M} value of 3.07 Å{sup 3} Da{sup −1} and an estimated solvent content of 59%. Diffraction data were collected to 2.7 Å resolution using synchrotron radiation at the ID14-4 beamline of the European Synchrotron Radiation Facility.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pang, Xiaoyun; Xu, Feng, E-mail: xuf@xtal.tsinghua.edu.cn; Bell, Stephen G.

The cytochrome P450 enzyme CYP203A1 from Rhodopseudomonas palustris binds a wide range of highly substituted aromatic compounds and may play an important role in the astonishing metabolic diversity of this organism. Crystals of CYP203A1 that diffract to 2.0 Å resolution have been obtained. Cytochrome P450 enzymes constitute a large family of haemoproteins that catalyze the monooxygenation of a great variety of endogenous and exogenous organic compounds. Cytochrome P450 203A1 (CYP203A1, RPA1009) from the metabolically versatile organism Rhodopseudomonas palustris binds a broad range of substrates, in particular substituted aromatic compounds. Crystals of CYP203A1 suitable for X-ray crystallography have been obtained andmore » diffraction data were collected in-house to 2.0 Å resolution from a single crystal. The crystals belong to space group P222, with unit-cell parameters a = 40.1, b = 95.1, c = 99.0 Å, α = β = γ = 90°. There is one protein molecule per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction studies of NP24-I, an isoform of a thaumatin-like protein from ripe tomato fruits

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Raka; Chakrabarti, Chandana, E-mail: chandana.chakrabarti@saha.ac.in

2005-08-01

A thaumatin-like antifungal protein, NP24-I, has been isolated from ripe tomato fruits. It was crystallized by the vapour-diffusion method and data were collected to 2.45 Å. The structure was solved by molecular replacement. NP24 is a 24 kDa (207-amino-acid) antifungal thaumatin-like protein (TLP) found in tomato fruits. An isoform of the protein, NP24-I, is reported to play a possible role in ripening of the fruit in addition to its antifungal properties. The protein has been isolated and purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the tetragonal space group P4{sub 3}, with unit-cell parameters a =more » b = 61.01, c = 62.90 Å and one molecule per asymmetric unit. X-ray diffraction data were processed to a resolution of 2.45 Å and the structure was solved by molecular replacement.« less

Purification, crystallization and preliminary crystallographic study of an IDS-epimerase from Agrobacterium tumefaciens BY6

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bäuerle, Bettina; Sandalova, Tatyana; Schneider, Gunter

2006-08-01

This is the first report of the crystallization of an IDS-epimerase from A. tumefaciens BY6 and its l-selenomethionine derivative. The initial degradation of all stereoisomers of the complexing agent iminodisuccinate (IDS) is enabled by an epimerase in the bacterial strain Agrobacterium tumefaciens BY6. This protein was produced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method. Crystals of IDS-epimerase were obtained under several conditions. The best diffracting crystals were grown in 22% PEG 3350, 0.2 M (NH{sub 4}){sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 7.2 at 293 K. These crystals belong to the monoclinic space groupmore » P2{sub 1}, with unit-cell parameters a = 55.4, b = 104.2, c = 78.6 Å, β = 103.3°, and diffracted to 1.7 Å resolution. They contain two protein molecules per asymmetric unit. In order to solve the structure using the MAD phasing method, crystals of the l-selenomethionine-substituted epimerase were grown in the presence of 20% PEG 3350, 0.2 M Na{sub 2}SO{sub 4} and 0.1 M bis-Tris propane pH 8.5.« less

Structure of Toxoplasma gondii fructose-1,6-bisphosphate aldolase.

PubMed

Boucher, Lauren E; Bosch, Jürgen

2014-09-01

The apicomplexan parasite Toxoplasma gondii must invade host cells to continue its lifecycle. It invades different cell types using an actomyosin motor that is connected to extracellular adhesins via the bridging protein fructose-1,6-bisphosphate aldolase. During invasion, aldolase serves in the role of a structural bridging protein, as opposed to its normal enzymatic role in the glycolysis pathway. Crystal structures of the homologous Plasmodium falciparum fructose-1,6-bisphosphate aldolase have been described previously. Here, T. gondii fructose-1,6-bisphosphate aldolase has been crystallized in space group P22121, with the biologically relevant tetramer in the asymmetric unit, and the structure has been determined via molecular replacement to a resolution of 2.0 Å. An analysis of the quality of the model and of the differences between the four chains in the asymmetric unit and a comparison between the T. gondii and P. falciparum aldolase structures is presented.

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens.

PubMed

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-09-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å.

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Expression, purification, crystallization and preliminary X-ray analysis of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from Helicobacter pylori

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elliott, Paul R.; Mohammad, Shabaz; Melrose, Helen J.

2008-08-01

Glyceraldehyde-3-phosphate dehydrogenase B from H. pylori has been cloned, expressed, purified and crystallized in the presence of NAD. Crystals of GAPDHB diffracted to 2.8 Å resolution and belonged to space group P6{sub 5}22, with unit-cell parameters a = b = 166.1, c = 253.1 Å. Helicobacter pylori is a dangerous human pathogen that resides in the upper gastrointestinal tract. Little is known about its metabolism and with the onset of antibiotic resistance new treatments are required. In this study, the expression, purification, crystallization and preliminary X-ray diffraction of an NAD-dependent glyceraldehyde-3-phosphate dehydrogenase from H. pylori are reported.

Band structures in fractal grading porous phononic crystals

NASA Astrophysics Data System (ADS)

Wang, Kai; Liu, Ying; Liang, Tianshu; Wang, Bin

2018-05-01

In this paper, a new grading porous structure is introduced based on a Sierpinski triangle routine, and wave propagation in this fractal grading porous phononic crystal is investigated. The influences of fractal hierarchy and porosity on the band structures in fractal graidng porous phononic crystals are clarified. Vibration modes of unit cell at absolute band gap edges are given to manifest formation mechanism of absolute band gaps. The results show that absolute band gaps are easy to form in fractal structures comparatively to the normal ones with the same porosity. Structures with higher fractal hierarchies benefit multiple wider absolute band gaps. This work provides useful guidance in design of fractal porous phononic crystals.

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Hydrothermal Synthesis, Crystal Structure, and Photoluminescent Properties of Li[UO2(CH3COO)3]3[Co(H2O)6

NASA Astrophysics Data System (ADS)

AlDamen, Murad A.; Juwhari, Hassan K.; Al-zuheiri, Aya M.; Alnazer, Louy A.

2017-12-01

Single crystal of Li[UO2(CH3COO)3]3[Co(H2O)6] was prepared and found to crystallize in the monoclinic crystal system in the sp. gr. C2/ c, with Z = 2, and unit cell parameters a = 22.1857(15) Å, b = 13.6477(8) Å, c = 15.6921(10) Å, β = 117.842(9)°, V = 4201.3(4) Å3. The crystal was characterized by X-ray diffraction, Fourier transform infrared spectroscopy, and differential scanning calorimetry. The single crystal X-ray diffraction analysis revealed that the crystal has a lamellar structure in which a cobalt hydrate is sandwiched within the Li[UO2(CH3COO)3]3 2- chains. Furthermore, the room temperature photoluminescence spectrum of the complex was investigated in the solid state.

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Crystallization and preliminary X-ray diffraction analysis of ω-amino acid:pyruvate transaminase from Chromobacterium violaceum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sayer, Christopher; Isupov, Michail N.; Littlechild, Jennifer A., E-mail: j.a.littlechild@exeter.ac.uk

2007-02-01

An ω-amino acid:pyruvate transaminase from C. violaceum has been purified and crystallized in two crystal forms. The structure has been solved using molecular replacement. The enzyme ω-transaminase catalyses the conversion of chiral ω-amines to ketones. The recombinant enzyme from Chromobacterium violaceum has been purified to homogeneity. The enzyme was crystallized from PEG 4000 using the microbatch method. Data were collected to 1.7 Å resolution from a crystal belonging to the triclinic space group P1, with unit-cell parameters a = 58.9, b = 61.9, c = 63.9 Å, α = 71.9, β = 87.0, γ = 74.6°. Data were also collectedmore » to 1.95 Å from a second triclinic crystal form. The structure has been solved using the molecular-replacement method.« less

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

Standard Reference Material (SRM 1990) for Single Crystal Diffractometer Alignment

USGS Publications Warehouse

Wong-Ng, W.; Siegrist, T.; DeTitta, G.T.; Finger, L.W.; Evans, H.T.; Gabe, E.J.; Enright, G.D.; Armstrong, J.T.; Levenson, M.; Cook, L.P.; Hubbard, C.R.

2001-01-01

An international project was successfully completed which involved two major undertakings: (1) a round-robin to demonstrate the viability of the selected standard and (2) the certification of the lattice parameters of the SRM 1990, a Standard Reference Material?? for single crystal diffractometer alignment. This SRM is a set of ???3500 units of Cr-doped Al2O3, or ruby spheres [(0 420.011 mole fraction % Cr (expanded uncertainty)]. The round-robin consisted of determination of lattice parameters of a pair of crystals' the ruby sphere as a standard, and a zeolite reference to serve as an unknown. Fifty pairs of crystals were dispatched from Hauptman-Woodward Medical Research Institute to volunteers in x-ray laboratories world-wide. A total of 45 sets of data was received from 32 laboratories. The mean unit cell parameters of the ruby spheres was found to be a=4.7608 A?? ?? 0.0062 A??, and c=12.9979 A?? ?? 0.020 A?? (95 % intervals of the laboratory means). The source of errors of outlier data was identified. The SRM project involved the certification of lattice parameters using four well-aligned single crystal diffractometers at (Bell Laboratories) Lucent Technologies and at NRC of Canada (39 ruby spheres), the quantification of the Cr content using a combined microprobe and SEM/EDS technique, and the evaluation of the mosaicity of the ruby spheres using a double-crystal spectrometry method. A confirmation of the lattice parameters was also conducted using a Guinier-Ha??gg camera. Systematic corrections of thermal expansion and refraction corrections were applied. These rubies_ are rhombohedral, with space group R3c. The certified mean unit cell parameters are a=4.76080 ?? 0.00029 A??, and c=12 99568 A?? ?? 0.00087 A?? (expanded uncertainty). These certified lattice parameters fall well within the results of those obtained from the international round-robin study. The Guinier-Ha??gg transmission measurements on five samples of powdered rubies (a=4.7610 A?? ?? 0.0013 A??, and c=12.9954 A?? ?? 0.0034 A??) agreed well with the values obtained from the single crystal spheres.

Standard Reference Material (SRM 1990) For Single Crystal Diffractometer Alignment

PubMed Central

Wong-Ng, W.; Siegrist, T.; DeTitta, G. T.; Finger, L. W.; Evans, H. T.; Gabe, E. J.; Enright, G. D.; Armstrong, J. T.; Levenson, M.; Cook, L. P.; Hubbard, C. R.

2001-01-01

An international project was successfully completed which involved two major undertakings: (1) a round-robin to demonstrate the viability of the selected standard and (2) the certification of the lattice parameters of the SRM 1990, a Standard Reference Material® for single crystal diffractometer alignment. This SRM is a set of ≈3500 units of Cr-doped Al2O3, or ruby spheres [(0.420.011 mole fraction % Cr (expanded uncertainty)]. The round-robin consisted of determination of lattice parameters of a pair of crystals: the ruby sphere as a standard, and a zeolite reference to serve as an unknown. Fifty pairs of crystals were dispatched from Hauptman-Woodward Medical Research Institute to volunteers in x-ray laboratories world-wide. A total of 45 sets of data was received from 32 laboratories. The mean unit cell parameters of the ruby spheres was found to be a=4.7608 ű0.0062 Å, and c=12.9979 ű0.020 Å (95 % intervals of the laboratory means). The source of errors of outlier data was identified. The SRM project involved the certification of lattice parameters using four well-aligned single crystal diffractometers at (Bell Laboratories) Lucent Technologies and at NRC of Canada (39 ruby spheres), the quantification of the Cr content using a combined microprobe and SEM/EDS technique, and the evaluation of the mosaicity of the ruby spheres using a double-crystal spectrometry method. A confirmation of the lattice parameters was also conducted using a Guinier-Hägg camera. Systematic corrections of thermal expansion and refraction corrections were applied. These rubies– are rhombohedral, with space group R3¯c. The certified mean unit cell parameters are a=4.76080±0.00029 Å, and c=12.99568 ű0.00087 Å (expanded uncertainty). These certified lattice parameters fall well within the results of those obtained from the international round-robin study. The Guinier-Hägg transmission measurements on five samples of powdered rubies (a=4.7610 ű0.0013 Å, and c = 12.9954 ű0.0034 Å) agreed well with the values obtained from the single crystal spheres. PMID:27500067

[Expression, crystallization and crystallographic study of the 1st IgV domain of human CD96].

PubMed

Jiang, Wenjing; Zhang, Shuijun; Yan, Jinghua; Guo, Ning

2013-05-01

CD96 (Tactile) is an adhesion receptor expressed mainly on activated T cells, NK cells. As a family member of the immunoglobulin-like cell receptor, CD96 consists of three immunoglobulin-like domains (V1, V2/C and C) in the extracellular region. Recent studies have shown that the 1st IgV domain of CD96 (CD96V1) plays an essential role in cell adhesion and NK cell-mediated killing. In this study, the 1st IgV domain of human CD96 (hCD96V1) was cloned and expressed in Escherichia coli (BL21). The soluble protein was obtained by refolding of the hCD96V1 inclusion bodies. From analytical ultracentrifugation, we could predict that CD96 V1 maily exists as dimer with approximate molecular weight of 26.9 kDa. The protein was then successfully crystallized using the sitting-drop vapour-diffusion method. The crystals diffracted to 1.9 angstrom resolution and belonged to space group P21, with unit-cell parameters a = 35.1, b = 69.5, c = 49.6A, alpha=gamma=90 degrees, beta=105.4 degrees.

Structure and transport in organic semiconductor thin films

NASA Astrophysics Data System (ADS)

Vos, Sandra Elizabeth Fritz

Organic Semiconductors represent an exciting area of research due to their potential application in cheap and flexible electronics. In spite of the abundant interest in organic electronics the electronic transport mechanism remains poorly understood. Understanding the connection between molecular structure, crystal packing, intermolecular interactions and electronic delocalization is an important aspect of improving the transport properties of organics in thin film transistors (TFTs). In an organic thin film transistor, charge carrier transport is believed to occur within the first few monolayers of the organic material adjacent to the dielectric. It is therefore critical to understand the initial stages of film growth and molecular structure in these first few layers and relate this structure to electronic transport properties. The structure of organic films at the interface with an amorphous silicon dioxide ( a-SiO2) dielectric and how structure relates to transport in a TFT is the focus of this thesis. Pentacene films on a-SiO2 were extensively characterized with specular and in-plane X-ray diffraction, and CuKalpha1, and synchrotron radiation. The first layer of pentacene molecules adjacent to the a-SiO2 crystallized in a rectangular unit cell with the long axis of the molecules perpendicular to the substrate surface. Subsequent layers of pentacene crystallized in a slightly oblique in-plane unit cell that evolved as thickness was increased. The rectangular monolayer phase of pentacene did not persist when subsequent layers were deposited. Specular diffraction with Synchrotron radiation of a 160 A pentacene film (˜ 10 layers) revealed growth initiation of a bulk-like phase and persistence of the thin-film phase. Pentacene molecules were more tilted in the bulk-like phase and the in-plane unit cell was slightly more oblique. Pentacene grains began to grow randomly oriented with respect to the substrate surface (out-of-plane) in films near 650 A in thickness. The single crystal bulk phase of pentacene was observed from specular diffraction (CuKalpha1) of a 2.5 mum film. These results suggest that the thickness of pentacene films on a-SiO2 is an important aspect in the comparison of crystal structure and electronic transport.

Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina, Rafael; González, Ana; Moscoso, Miriam

2007-09-01

The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

The galactoside 2-α-L-fucosyltransferase FUT1 from Arabidopsis thaliana: crystallization and experimental MAD phasing.

PubMed

Rocha, Joana; Cicéron, Félix; Lerouxel, Olivier; Breton, Christelle; de Sanctis, Daniele

2016-07-01

The plant cell wall is a complex network of polysaccharides made up of cellulose, hemicelluloses and pectins. Xyloglucan (XyG), which is the main hemicellulosic component of dicotyledonous plants, has attracted much attention for its role in plant development and for its many industrial applications. The XyG-specific fucosyltransferase (FUT1) adds a fucose residue from GDP-fucose to the 2-O position of the terminal galactosyl residues on XyG side chains. Recombinant FUT1 from Arabidopsis thaliana was crystallized in two different crystal forms, with the best diffracting crystals (up to 1.95 Å resolution) belonging to the monoclinic space group P21, with unit-cell parameters a = 87.6, b = 84.5, c = 150.3 Å, β = 96.3°. Ab initio phases were determined using a two-wavelength anomalous dispersion experiment on a tantalum bromide-derivatized crystal with data collected at the rising and descending inflection points of the Ta white line. An interpretable electron-density map was obtained after elaborate density modification. Model completion and structural analysis are currently under way.

Single-Crystal Growth of Cl-Doped n-Type SnS Using SnCl2 Self-Flux.

PubMed

Iguchi, Yuki; Inoue, Kazutoshi; Sugiyama, Taiki; Yanagi, Hiroshi

2018-06-05

SnS is a promising photovoltaic semiconductor owing to its suitable band gap energy and high optical absorption coefficient for highly efficient thin film solar cells. The most significant carnage is demonstration of n-type SnS. In this study, Cl-doped n-type single crystals were grown using SnCl 2 self-flux method. The obtained crystal was lamellar, with length and width of a few millimeters and thickness ranging between 28 and 39 μm. X-ray diffraction measurements revealed the single crystals had an orthorhombic unit cell. Since the ionic radii of S 2- and Cl - are similar, Cl doping did not result in substantial change in lattice parameter. All the elements were homogeneously distributed on a cleaved surface; the Sn/(S + Cl) ratio was 1.00. The crystal was an n-type degenerate semiconductor with a carrier concentration of ∼3 × 10 17 cm -3 . Hall mobility at 300 K was 252 cm 2 V -1 s -1 and reached 363 cm 2 V -1 s -1 at 142 K.

Crystal growth, structure and morphology of hydrocortisone methanol solvate

NASA Astrophysics Data System (ADS)

Chen, Jianxin; Wang, Jiangkang; Zhang, Ying; Wu, Hong; Chen, Wei; Guo, Zhichao

2004-04-01

Hydrocortisone (HC), an important grucocorticoid, was crystallized from methanol solvent in the form of its methanol solvate. Its crystal structure belongs to orthorhombic, space group P2 12 12 1, with the unit cell parameters a=7.712(3) Å, b=14.392(5) Å, c=18.408(6) Å, Z=4. The methanol takes part in intermolecular hydrogen bonding, so if we change the solvent, the crystal habit of HC maybe different. The long parallelepiped morphology was also predicted by Cerius 2TM simulation program. The influence of intermolecular interaction was taken into account in the attachment energy model. The morphology calculation performed on the potential energy minimized model using a generic DREIDING 2.21 force field and developed minimization protocol with derived partial charges fits the experimental crystal shape well.

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

Crystallization and preliminary X-ray diffraction analysis of the small laccase from Streptomyces coelicolor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Skálová, Tereza, E-mail: skalova@imc.cas.cz; Dohnálek, Jan; Institute of Physics, Academy of Sciences of the Czech Republic, Cukrovarnicka 10, 162 53 Praha 6

2007-12-01

The expression, purification and crystallization of the small laccase from S. coelicolor are reported. Diffraction data were collected to 3 Å resolution. The small bacterial laccase from the actinobacterium Streptomyces coelicolor which lacks the second of the three domains of the laccases structurally characterized to date was crystallized. This multi-copper phenol oxidase crystallizes in a primitive tetragonal lattice, with unit-cell parameters a = b = 179.8, c = 175.3 Å. The crystals belong to either space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2. The self-rotation function shows the presence of a noncrystallographic threefold axis in the structure. Phases willmore » be determined from the anomalous signal of the natively present copper ions.« less

Purification, crystallization and preliminary crystallographic studies of plant S-adenosyl-l-homocysteine hydrolase (Lupinus luteus)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Department of Crystallography, Faculty of Chemistry, A. Mickiewicz University, Poznan; Bujacz, Grzegorz

2008-07-01

Single crystals of recombinant S-adenosyl-l-homocysteine hydrolase from L. luteus in complex with adenosine diffract X-rays to 1.17 Å resolution at 100 K. The crystals are tetragonal, space group P4{sub 3}2{sub 1}2, and contain one copy of the dimeric enzyme in the asymmetric unit. By degrading S-adenosyl-l-homocysteine, which is a byproduct of S-adenosyl-l-methionine-dependent methylation reactions, S-adenosyl-l-homocysteine hydrolase (SAHase) acts as a regulator of cellular methylation processes. S-Adenosyl-l-homocysteine hydrolase from the leguminose plant yellow lupin (Lupinus luteus), LlSAHase, which is composed of 485 amino acids and has a molecular weight of 55 kDa, has been cloned, expressed in Escherichia coli and purified.more » Crystals of LlSAHase in complex with adenosine were obtained by the hanging-drop vapour-diffusion method using 20%(w/v) PEG 4000 and 10%(v/v) 2-propanol as precipitants in 0.1 M Tris–HCl buffer pH 8.0. The crystals were tetragonal, space group P4{sub 3}2{sub 1}2, with unit-cell parameters a = 122.4, c = 126.5 Å and contained two protein molecules in the asymmetric unit, corresponding to the functional dimeric form of the enzyme. Atomic resolution (1.17 Å) X-ray diffraction data have been collected using synchrotron radiation.« less

Topology-Scaling Identification of Layered Solids and Stable Exfoliated 2D Materials.

PubMed

Ashton, Michael; Paul, Joshua; Sinnott, Susan B; Hennig, Richard G

2017-03-10

The Materials Project crystal structure database has been searched for materials possessing layered motifs in their crystal structures using a topology-scaling algorithm. The algorithm identifies and measures the sizes of bonded atomic clusters in a structure's unit cell, and determines their scaling with cell size. The search yielded 826 stable layered materials that are considered as candidates for the formation of two-dimensional monolayers via exfoliation. Density-functional theory was used to calculate the exfoliation energy of each material and 680 monolayers emerge with exfoliation energies below those of already-existent two-dimensional materials. The crystal structures of these two-dimensional materials provide templates for future theoretical searches of stable two-dimensional materials. The optimized structures and other calculated data for all 826 monolayers are provided at our database (https://materialsweb.org).

Cloning, purification, crystallization and preliminary X-ray crystallographic analysis of MCAT from Staphylococcus aureus.

PubMed

Hong, Seung Kon; Kim, Kook Han; Kim, Eunice EunKyeong

2010-01-01

Malonyl-CoA:acyl-carrier protein transacylase (MCAT), encoded by the fabd gene, is a key enzyme in type II fatty-acid biosynthesis. It is responsible for transferring the malonyl group from malonyl-CoA to the holo acyl-carrier protein (ACP). Since the type II system differs from the type I system that mammals use, it has received enormous attention as a possible antibiotic target. In particular, only a single isoform of MCAT has been reported and a continuous coupled enzyme assay has been developed. MCAT from Staphylococcus aureus was overexpressed in Escherichia coli and the protein was purified and crystallized. Diffraction data were collected to 1.2 A resolution. The crystals belonged to space group P2(1), with unit-cell parameters a = 41.608, b = 86.717, c = 43.163 A, alpha = gamma = 90, beta = 106.330 degrees . The asymmetric unit contains one SaMCAT molecule.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aravind, Penmatsa; Rajini, Bheemreddy; Sharma, Yogendra

The crystallization and preliminary X-ray diffraction analysis of AIM1g1, a βγ-crystallin domain of absent in melanoma (AIM1) protein from H. sapiens, is reported. AIM1g1 is a single βγ-crystallin domain from the protein absent in melanoma 1 (AIM1), which appears to play a role in the suppression of melanomas. This domain is known to bind calcium and its structure would help in identifying calcium-coordinating sites in vertebrate crystallins, which have hitherto been believed to have lost this ability during evolution. Crystallization of this domain was performed by the hanging-drop vapour-diffusion method. Crystals diffracted to a maximum resolution of 1.86 Å andmore » were found to belong to space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 54.98, c = 59.73 Å. Solvent-content analysis indicated the presence of one monomer per asymmetric unit.« less

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

Recombinant expression, purification, crystallization and preliminary X-ray diffraction analysis of the C-terminal DUF490(963-1138) domain of TamB from Escherichia coli.

PubMed

Josts, Inokentijs; Grinter, Rhys; Kelly, Sharon M; Mosbahi, Khedidja; Roszak, Aleksander; Cogdell, Richard; Smith, Brian O; Byron, Olwyn; Walker, Daniel

2014-09-01

TamB is a recently described inner membrane protein that, together with its partner protein TamA, is required for the efficient secretion of a subset of autotransporter proteins in Gram-negative bacteria. In this study, the C-terminal DUF490963-1138 domain of TamB was overexpressed in Escherichia coli K-12, purified and crystallized using the sitting-drop vapour-diffusion method. The crystals belonged to the primitive trigonal space group P3121, with unit-cell parameters a = b = 57.34, c = 220.74 Å, and diffracted to 2.1 Å resolution. Preliminary secondary-structure and X-ray diffraction analyses are reported. Two molecules are predicted to be present in the asymmetric unit. Experimental phasing using selenomethionine-labelled protein will be undertaken in the future.

Crystallization and preliminary X-ray analysis of the NADPH-dependent 3-quinuclidinone reductase from Rhodotorula rubra

PubMed Central

Takeshita, Daijiro; Kataoka, Michihiko; Miyakawa, Takuya; Miyazono, Ken-ichi; Uzura, Atsuko; Nagata, Koji; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

(R)-3-Quinuclidinol is a useful compound that is applicable to the synthesis of various pharmaceuticals. The NADPH-dependent carbonyl reductase 3-­quinuclidinone reductase from Rhodotorula rubra catalyzes the stereospecific reduction of 3-quinuclidinone to (R)-3-quinuclidinol and is expected to be utilized in industrial production of this alcohol. 3-Quinuclidinone reductase from R. rubra was expressed in Escherichia coli and purified using Ni-affinity and ion-exchange column chromatography. Crystals of the protein were obtained by the sitting-drop vapour-diffusion method using PEG 8000 as the precipitant. The crystals belonged to space group P41212, with unit-cell parameters a = b = 91.3, c = 265.4 Å, and diffracted X-rays to 2.2 Å resolution. The asymmetric unit contained four molecules of the protein and the solvent content was 48.4%. PMID:19478454

Crystallization and preliminary X-ray data analysis of β-alanine synthase from Drosophila melanogaster

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lundgren, Stina; Andersen, Birgit; Piškur, Jure

2007-10-01

β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine. Crystals of the recombinant enzyme from D. melanogaster belong to space group C2. Diffraction data to 3.3 Å resolution were collected and analyzed. β-Alanine synthase catalyzes the last step in the reductive degradation pathway for uracil and thymine, which represents the main clearance route for the widely used anticancer drug 5-fluorouracil. Crystals of the recombinant enzyme from Drosophila melanogaster, which is closely related to the human enzyme, were obtained by the hanging-drop vapour-diffusion method. They diffracted to 3.3 Å at a synchrotron-radiation source, belong tomore » space group C2 (unit-cell parameters a = 278.9, b = 95.0, c = 199.3 Å, β = 125.8°) and contain 8–10 molecules per asymmetric unit.« less

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1

PubMed Central

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-01-01

The hyperthermophilic archaeal Rieske-type [2Fe–2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe–2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-­terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 Å resolution and belonged to the tetragonal space group P43212, with unit-cell parameters a = 60.72, c = 83.31 Å. The asymmetric unit contains one protein molecule. PMID:20606288

Crystallization and preliminary X-ray diffraction studies of hyperthermophilic archaeal Rieske-type ferredoxin (ARF) from Sulfolobus solfataricus P1.

PubMed

Kounosu, Asako; Hasegawa, Kazuya; Iwasaki, Toshio; Kumasaka, Takashi

2010-07-01

The hyperthermophilic archaeal Rieske-type [2Fe-2S] ferredoxin (ARF) from Sulfolobus solfataricus P1 contains a low-potential Rieske-type [2Fe-2S] cluster that has served as a tractable model for ligand-substitution studies on this protein family. Recombinant ARF harbouring a pET30a vector-derived N-terminal extension region plus a hexahistidine tag has been heterologously overproduced in Escherichia coli, purified and crystallized by the hanging-drop vapour-diffusion method using 0.05 M sodium acetate, 0.05 M HEPES, 2 M ammonium sulfate pH 5.5. The crystals diffracted to 1.85 A resolution and belonged to the tetragonal space group P4(3)2(1)2, with unit-cell parameters a = 60.72, c = 83.31 A. The asymmetric unit contains one protein molecule.

Solid solutions of gadolinium doped zinc oxide nanorods by combined microwave-ultrasonic irradiation assisted crystallization

NASA Astrophysics Data System (ADS)

Kiani, Armin; Dastafkan, Kamran; Obeydavi, Ali; Rahimi, Mohammad

2017-12-01

Nanocrystalline solid solutions consisting of un-doped and gadolinium doped zinc oxide nanorods were fabricated by a modified sol-gel process utilizing combined ultrasonic-microwave irradiations. Polyvinylpyrrolidone, diethylene glycol, and triethylenetetramine respectively as capping, structure directing, and complexing agents were used under ultrasound dynamic aging and microwave heating to obtain crystalline nanorods. Crystalline phase monitoring, lattice parameters and variation, morphology and shape, elemental analysis, functional groups, reducibility, and the oxidation state of emerged species were examined by PXRD, FESEM, TEM, EDX, FTIR, micro Raman, H2-TPR, and EPR techniques. Results have verified that irradiation mechanism of gelation and crystallization reduces the reaction time, augments the crystal quality, and formation of hexagonal close pack structure of Wurtzite morphology. Besides, dissolution of gadolinium within host lattice involves lattice deformation, unit cell distortion, and angular position variation. Structure related shape and growth along with compositional purity were observed through microscopic and spectroscopic surveys. Furthermore, TPR and EPR studies elucidated more detailed behavior upon exposure to the exerted irradiations and subsequent air-annealing including the formed oxidation states and electron trapping centers, presence of gadolinium, zinc, and oxygen disarrays and defects, as well as alteration in the host unit cell via gadolinium addition.

Purification, crystallization and preliminary crystallographic study of haemoglobin from camel (Camelus dromedarius): a high oxygen-affinity lowland species.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-08-01

Haemoglobin is a prototypical allosteric protein that is mainly involved in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs in an intrinsically coordinated manner to maintain the viability of cells. Haemoglobin from Camelus dromedarius provides an interesting case study of adaptation to life in deserts at extremely high temperatures. An ambition to unravel the integrated structural and functional aspects of the casual survival of this animal at high temperatures led us to specifically work on this problem. The present work reports the preliminary crystallographic study of camel haemoglobin. Camel blood was collected and the haemoglobin was purified by anion-exchange chromatography and crystallized using the hanging-drop vapour-diffusion method under buffered high salt concentration using PEG 3350 as a precipitant. Intensity data were collected using a MAR 345 dtb image-plate detector system. Camel haemoglobin crystallized in the monoclinic space group P2(1), with one whole biological molecule (alpha(2)beta(2)) in the asymmetric unit and unit-cell parameters a = 52.759, b = 116.782, c = 52.807 A, beta = 120.07 degrees .

On the edge of periodicity: Unconventional magnetism of Gd 117Co 56.4Sn 114.3

DOE PAGES

Liu, J.; Mudryk, Yaroslav; Ryan, D. H.; ...

2017-08-04

Magnetization measurements reveal the onset of magnetic ordering at T C = 65 K followed by three additional magnetic anomalies at T 1 = 47 K, T 2 = 28 K, and T 3 = 11 K in Gd 117Co 56.4Sn 114.3 – a compound with a giant cubic unit cell that crystallizes in the Dy 117Co 56Sn 112 structure type with space group Fm3¯m and lattice parameter a = 30.186 Å. The magnetic ordering temperature increases with applied magnetic field; however, the analysis of magnetic data indicates that antiferromagnetic interactions also play a role in the ground state. ACmore » magnetic susceptibility confirms multiple magnetic anomalies and shows minor frequency dependence. The local magnetic ordering below 60 K is supported by the Mössbauer spectroscopy. A single broad anomaly is detected at T 3 in the heat capacity; we suggest that magnetic domains form below this temperature. Furthermore, these data highlight unique features of magnetism in this and, potentially, other rare-earth intermetallics crystallizing with giant unit-cells where the exchange correlation lengths are much shorter when compared to the periodicity of the crystal lattice.« less

3-D phononic crystals with ultra-wide band gaps

PubMed Central

Lu, Yan; Yang, Yang; Guest, James K.; Srivastava, Ankit

2017-01-01

In this paper gradient based topology optimization (TO) is used to discover 3-D phononic structures that exhibit ultra-wide normalized all-angle all-mode band gaps. The challenging computational task of repeated 3-D phononic band-structure evaluations is accomplished by a combination of a fast mixed variational eigenvalue solver and distributed Graphic Processing Unit (GPU) parallel computations. The TO algorithm utilizes the material distribution-based approach and a gradient-based optimizer. The design sensitivity for the mixed variational eigenvalue problem is derived using the adjoint method and is implemented through highly efficient vectorization techniques. We present optimized results for two-material simple cubic (SC), body centered cubic (BCC), and face centered cubic (FCC) crystal structures and show that in each of these cases different initial designs converge to single inclusion network topologies within their corresponding primitive cells. The optimized results show that large phononic stop bands for bulk wave propagation can be achieved at lower than close packed spherical configurations leading to lighter unit cells. For tungsten carbide - epoxy crystals we identify all angle all mode normalized stop bands exceeding 100%, which is larger than what is possible with only spherical inclusions. PMID:28233812

3-D phononic crystals with ultra-wide band gaps.

PubMed

Lu, Yan; Yang, Yang; Guest, James K; Srivastava, Ankit

2017-02-24

In this paper gradient based topology optimization (TO) is used to discover 3-D phononic structures that exhibit ultra-wide normalized all-angle all-mode band gaps. The challenging computational task of repeated 3-D phononic band-structure evaluations is accomplished by a combination of a fast mixed variational eigenvalue solver and distributed Graphic Processing Unit (GPU) parallel computations. The TO algorithm utilizes the material distribution-based approach and a gradient-based optimizer. The design sensitivity for the mixed variational eigenvalue problem is derived using the adjoint method and is implemented through highly efficient vectorization techniques. We present optimized results for two-material simple cubic (SC), body centered cubic (BCC), and face centered cubic (FCC) crystal structures and show that in each of these cases different initial designs converge to single inclusion network topologies within their corresponding primitive cells. The optimized results show that large phononic stop bands for bulk wave propagation can be achieved at lower than close packed spherical configurations leading to lighter unit cells. For tungsten carbide - epoxy crystals we identify all angle all mode normalized stop bands exceeding 100%, which is larger than what is possible with only spherical inclusions.

Single crystal X-ray diffraction, spectroscopic and mass spectrometric studies of furanocoumarin peucedanin.

PubMed

Bartnik, Magdalena; Arczewska, Marta; Hoser, Anna A; Mroczek, Tomasz; Kamiński, Daniel M; Głowniak, Kazimierz; Gagoś, Mariusz; Woźniak, Krzysztof

2014-01-01

The structure of peucedanin, isolated from Peucedanum tauricum Bieb. (Apiaceae), has been established using single crystal X-ray diffraction. This furanocoumarin isolated from the light petroleum extract of P. tauricum fruits was characterized by high resolution EI-MS, sATR-FTIR and 2D NMR spectroscopic techniques. The EI-MS showed the typical fragmentation pattern of methoxyfuranocoumarins. Extensive 1D (1H and 13C) as well as 2D NMR data enabled complete assignment of the carbon atoms in the peucedanin molecule. The FTIR data confirms intermolecular hydrogen bonding between peucedanin molecules in polar solvents. Peucedanin crystallises in the R-3 space group from the trigonal system with one molecule in the asymmetric part of the unit cell. The crystal lattice of peucedanin consists of the molecules arranged in separate columns. They are related by two fold screw axes and centres of symmetry. Interestingly, peucedanin columns form two channels per unit cell with a diameter of 7.5angstrom going through the crystal lattice in the Z-direction. These channels are filled with disordered water molecules, which are surrounded by hydrophobic methyl groups and are located exactly at the centres of the channels. The peucedanin molecules are stacked in a single column with the opposite orientation of the neighbouring molecules. These results could be interesting in further application of this molecule, for example in biological tests of its activity.

Origin of Quantum Criticality in Yb-Al-Au Approximant Crystal and Quasicrystal

NASA Astrophysics Data System (ADS)

Watanabe, Shinji; Miyake, Kazumasa

2016-06-01

To get insight into the mechanism of emergence of unconventional quantum criticality observed in quasicrystal Yb15Al34Au51, the approximant crystal Yb14Al35Au51 is analyzed theoretically. By constructing a minimal model for the approximant crystal, the heavy quasiparticle band is shown to emerge near the Fermi level because of strong correlation of 4f electrons at Yb. We find that charge-transfer mode between 4f electron at Yb on the 3rd shell and 3p electron at Al on the 4th shell in Tsai-type cluster is considerably enhanced with almost flat momentum dependence. The mode-coupling theory shows that magnetic as well as valence susceptibility exhibits χ ˜ T-0.5 for zero-field limit and is expressed as a single scaling function of the ratio of temperature to magnetic field T/B over four decades even in the approximant crystal when some condition is satisfied by varying parameters, e.g., by applying pressure. The key origin is clarified to be due to strong locality of the critical Yb-valence fluctuation and small Brillouin zone reflecting the large unit cell, giving rise to the extremely-small characteristic energy scale. This also gives a natural explanation for the quantum criticality in the quasicrystal corresponding to the infinite limit of the unit-cell size.

Cloning, expression, purification, crystallization and preliminary X-ray crystallographic analysis of the mannose 6-phosphate isomerase from Salmonella typhimurium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gowda, Giri; Sagurthi, Someswar Rao; Savithri, H. S.

2008-02-01

The cloning, expression, purification, crystallization and preliminary X-ray crystallographic studies of mannose 6-phosphate isomerase from S. typhimurium are reported. Mannose 6-phosphate isomerase (MPI; EC 5.3.1.8) catalyzes the reversible isomerization of d-mannose 6-phosphate (M6P) and d-fructose 6-phosphate (F6P). In the eukaryotes and prokaryotes investigated to date, the enzyme has been reported to play a crucial role in d-mannose metabolism and supply of the activated mannose donor guanosine diphosphate d-mannose (GDP-d-mannose). In the present study, MPI was cloned from Salmonella typhimurium, overexpressed in Escherichia coli and purified using Ni–NTA affinity column chromatography. Purified MPI crystallized in space group P2{sub 1}2{sub 1}2{sub 1},more » with unit-cell parameters a = 36.03, b = 92.2, c = 111.01 Å. A data set extending to 1.66 Å resolution was collected with 98.8% completeness using an image-plate detector system mounted on a rotating-anode X-ray generator. The asymmetric unit of the crystal cell was compatible with the presence of a monomer of MPI. A preliminary structure solution of the enzyme has been obtained by molecular replacement using Candida albicans MPI as the phasing model and the program Phaser. Further refinement and model building are in progress.« less

Cloning, overexpression, crystallization and preliminary X-ray crystallographic analysis of a slow-processing mutant of penicillin G acylase from Kluyvera citrophila.

PubMed

Varshney, Nishant Kumar; Ramasamy, Sureshkumar; Brannigan, James A; Wilkinson, Anthony J; Suresh, C G

2013-08-01

Kluyvera citrophila penicillin G acylase (KcPGA) has recently attracted increased attention relative to the well studied and commonly used Escherichia coli PGA (EcPGA) because KcPGA is more resilient to harsh conditions and is easier to immobilize for the industrial hydrolysis of natural penicillins to generate the 6-aminopenicillin (6-APA) nucleus, which is the starting material for semi-synthetic antibiotic production. Like other penicillin acylases, KcPGA is synthesized as a single-chain inactive pro-PGA, which upon autocatalytic processing becomes an active heterodimer of α and β chains. Here, the cloning of the pac gene encoding KcPGA and the preparation of a slow-processing mutant precursor are reported. The purification, crystallization and preliminary X-ray analysis of crystals of this precursor protein are described. The protein crystallized in two different space groups, P1, with unit-cell parameters a = 54.0, b = 124.6, c = 135.1 Å, α = 104.1, β = 101.4, γ = 96.5°, and C2, with unit-cell parameters a = 265.1, b = 54.0, c = 249.2 Å, β = 104.4°, using the sitting-drop vapour-diffusion method. Diffraction data were collected at 100 K and the phases were determined using the molecular-replacement method. The initial maps revealed electron density for the spacer peptide.

Structure elucidation of 3-[1-(6-methoxy-2-naphtyl)ethyl]-6-(2,4-dichlorophenyl)-7H-1,2,4-triazolo[3,4-b]-1,3,4-thiadiazine, C 23H 18Cl 2N 4OS from synchrotron X-ray powder diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gündoğdu, Gülsüm; Aytaç, Sevim Peri; Müller, Melanie

The 3-[1-(6-methoxy-2-naphtyl)ethyl]-6-(2,4-dichlorophenyl)-7H-1,2,4-triazolo[3,4-b]-1,3,4-thiadiazine, C 23H 18Cl 2N 4OS compound was synthesized, as a member of the family of novel potential anticancer agents. The structure of the title compound was characterized by IR, 1H-NMR, mass spectroscopy, and elemental analysis, previously. In this study, the crystal structure of this compound has been determined from synchrotron X-ray powder diffraction data. The crystal structure was solved by simulated annealing and the final structure was achieved by Rietveld refinement method using soft restrains on all interatomic bond lengths and angles. This compound crystallizes in space groupP21,Z= 2, with the unit-cell parametersa= 15.55645(11) Å,b= 8.61693(6) Å,c= 8.56702(6)more » Å,β= 104.3270(4)°, andV= 1112.68(1) Å 3. In the crystal structure, strong C-H∙∙∙πand weak intermolecular hydrogen-bonding interactions link the molecules into a three-dimensional network. The molecules are in a head-to-head arrangement in the unit cell.« less

Structural incorporation of MgCl2 into ice VII at room temperature

NASA Astrophysics Data System (ADS)

Watanabe, Mao; Komatsu, Kazuki; Noritake, Fumiya; Kagi, Hiroyuki

2017-05-01

Raman spectra and X-ray diffraction patterns were obtained from 1:100 and 1:200 \\text{MgCl}2:\\text{H}2\\text{O} solutions (in molar ratio) at pressures up to 6 GPa using diamond anvil cells (DACs) and compared with those of pure water. The O-H stretching band from ice VII crystallized from the 1:200 solution was approximately 10 cm-1 higher than that of pure ice VII. The phase boundaries between ice VII and VIII crystallized from the MgCl2 solutions at 4 GPa were 2 K lower than those of pure ice VII and VIII. These observations indicate that ice VII incorporates MgCl2 into its structure. The unit cell volumes of ice VII crystallized from pure water and the two solutions coincided with each other within the experimental error, and salt incorporation was not detectable from the cell volume. Possible configurations of ion substitution and excess volume of ice VIII were simulated on the basis of density functional theory (DFT) calculations.

Using Latex Balls and Acrylic Resin Plates to Investigate the Stacking Arrangement and Packing Efficiency of Metal Crystals

ERIC Educational Resources Information Center

Ohashi, Atsushi

2015-01-01

A high-school third-year or undergraduate first-semester general chemistry laboratory experiment introducing simple-cubic, face-centered cubic, body-centered cubic, and hexagonal closest packing unit cells is presented. Latex balls and acrylic resin plates are employed to make each atomic arrangement. The volume of the vacant space in each cell is…

Use of the Primitive Unit Cell in Understanding Subtle Features of the Cubic Closest-Packed Structure

ERIC Educational Resources Information Center

Hawkins, John A.; Rittenhouse, Jeffrey L.; Soper, Linda M.; Rittenhouse, Robert C.

2008-01-01

One of the most important crystal structures adopted by metals is characterized by the "abcabc"...stacking of close-packed layers. This structure is commonly referred to in textbooks as the cubic close-packed (ccp) or face-centered cubic (fcc) structure, since the entire lattice can be generated by replication of a face-centered cubic unit cell…

Measuring Solvent Content of Macromolecular Crystals Using Fluorescence Recovery after Photobleaching

NASA Astrophysics Data System (ADS)

Siewny, Matthew; Kmetko, Jan

2010-10-01

We work out a novel protocol for measuring the solvent content (the fraction of crystal volume occupied by solvent) in biological crystals by the technique of fluorescence recovery after photobleaching (FRAP). Crystals of proteins with widely varying known solvent content (lysozyme, thaumatin, catalase, and ferritin) were grown in their native solution doped with sodium fluorescein dye and hydroxylamine (to prevent dye from binding to amine groups of the proteins.) The crystals were irradiated by a broadband, high intensity light through knife slits, leaving a rectangular area of bleached dye within the crystals. Measuring the flow of dye out of the bleached area allowed us to construct a curve relating the diffusion coefficient of dye to the channel size within the crystals, by solving the diffusion equation analytically. This curve may be used to measure the solvent content of any biological crystal in its native solution and help determine the number of proteins in the crystallographic asymmetric unit cell in x-ray structure solving procedures.

Solubility prediction of naphthalene in carbon dioxide from crystal microstructure

NASA Astrophysics Data System (ADS)

Sang, Jiarong; Jin, Junsu; Mi, Jianguo

2018-03-01

Crystals dissolved in solvents are ubiquitous in both natural and artificial systems. Due to the complicated structures and asymmetric interactions between the crystal and solvent, it is difficult to interpret the dissolution mechanism and predict solubility using traditional theories and models. Here we use the classical density functional theory (DFT) to describe the crystal dissolution behavior. As an example, naphthalene dissolved in carbon dioxide (CO2) is considered within the DFT framework. The unit cell dimensions and microstructure of crystalline naphthalene are determined by minimizing the free-energy of the crystal. According to the microstructure, the solubilities of naphthalene in CO2 are predicted based on the equality of naphthalene's chemical potential in crystal and solution phases, and the interfacial structures and free-energies between different crystal planes and solution are determined to investigate the dissolution mechanism at the molecular level. The theoretical predictions are in general agreement with the available experimental data, implying that the present model is quantitatively reliable in describing crystal dissolution.

Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin.

PubMed

Albillos, Silvia M; Jin, Tengchuan; Howard, Andrew; Zhang, Yuzhu; Kothary, Mahendra H; Fu, Tong-Jen

2008-07-09

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond ( Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0 A and belong to the tetragonal space group P4(1)22, with unit cell parameters of a = b = 150.912 A, c = 165.248 A. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.

Complex assembly, crystallization and preliminary X-ray crystallographic studies of rhesus macaque MHC Mamu-A*01 complexed with an immunodominant SIV-Gag nonapeptide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chu, Fuliang; Graduate School, Chinese Academy of Sciences, Beijing; Lou, Zhiyong

2005-06-01

Crystallization of the first rhesus macaque MHC class I complex. Simian immunodeficiency virus (SIV) infection in rhesus macaques has been used as the best model for the study of human immunodeficiency virus (HIV) infection in humans, especially in the cytotoxic T-lymphocyte (CTL) response. However, the structure of rhesus macaque (or any other monkey model) major histocompatibility complex class I (MHC I) presenting a specific peptide (the ligand for CTL) has not yet been elucidated. Here, using in vitro refolding, the preparation of the complex of the rhesus macaque MHC I allele (Mamu-A*01) with human β{sub 2}m and an immunodominant peptide,more » CTPYDINQM (Gag-CM9), derived from SIV Gag protein is reported. The complex (45 kDa) was crystallized; the crystal belongs to space group I422, with unit-cell parameters a = b = 183.8, c = 155.2 Å. The crystal contains two molecules in the asymmetric unit and diffracts X-rays to 2.8 Å resolution. The structure is being solved by molecular replacement and this is the first attempt to determined the crystal structure of a peptide–nonhuman primate MHC complex.« less

Crystallization and preliminary X-ray crystallographic analysis of agkicetin-C from Deinagkistrodon acutus venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Gufeng; Departments of Molecular and Cell Biology, School of Life Sciences, University of Science and Technology of China, 96 Jinzhai Road, Hefei, Anhui 230026; Huang, Qingqiu

2005-01-01

The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. The crystallization and preliminary crystallographic analysis of agkicetin-C, a well known platelet glycoprotein Ib (GPIb) antagonist from the venom of Deinagkistrodon acutus found in Anhui Province, China is reported. Crystals of agkicetin-C suitable for structure determination were obtained from 1.8 M ammonium sulfate, 40 mM MES pH 6.5 with 2%(v/v) PEG 400. Interestingly, low buffer concentrations of MES seem to be necessary for crystal growth. The crystals of agkicetin-C belong tomore » space group C2, with unit-cell parameters a = 177.5, b = 97.7, c = 106.8 Å, β = 118.5°, and diffract to 2.4 Å resolution. Solution of the phase problem by the molecular-replacement method shows that there are four agkicetin-C molecules in the asymmetric unit, with a V{sub M} value of 3.4 Å{sup 3} Da{sup −1}, which corresponds to a high solvent content of approximately 64%. Self-rotation function calculations show a single well defined non-crystallographic twofold axis with features that may represent additional elements of non-crystallographic symmetry.« less

Purification, crystallization and preliminary X-ray analysis of Enterococcus faecium aminoglycoside-2′′-phosphotransferase-Ib [APH(2′′)-Ib

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walanj, Rupa; Young, Paul; Baker, Heather M.

2005-04-01

APH(2′′)-Ib is an enzyme responsible for high-level gentamicin resistance in E. faecium isolates. Native crystals of this enzyme have been prepared and preliminary X-ray diffraction experiments have been undertaken. Bacterial resistance to the aminoglycoside antibiotics is primarily the result of deactivation of the drugs. Three families of enzymes are responsible for this activity, with one such family being the aminoglycoside phosphotransferases (APHs). The gene encoding one of these enzymes, APH(2′′)-Ib, has been cloned and the protein (comprising 299 amino-acid residues) expressed in Escherichia coli, purified and crystallized in the presence of 16%(w/v) PEG 3350 and gentamicin. The crystals belong tomore » the monoclinic space group P2{sub 1}, with approximate unit-cell parameters a = 79.7, b = 58.8, c = 81.4 Å, β = 98.4°, and preliminary X-ray diffraction analysis is consistent with the presence of two molecules in the asymmetric unit. Synchrotron diffraction data to approximately 2.65 Å resolution were collected from a native APH(2′′)-Ib crystal at beamline BL9-2 at SSRL (Stanford, CA, USA). Selenium-substituted crystals have also been produced and structure determination is proceeding.« less

Extending the applicability of the Goldschmidt tolerance factor to arbitrary ionic compounds

PubMed Central

Sato, Toyoto; Takagi, Shigeyuki; Deledda, Stefano; Hauback, Bjørn C.; Orimo, Shin-ichi

2016-01-01

Crystal structure determination is essential for characterizing materials and their properties, and can be facilitated by various tools and indicators. For instance, the Goldschmidt tolerance factor (T) for perovskite compounds is acknowledged for evaluating crystal structures in terms of the ionic packing. However, its applicability is limited to perovskite compounds. Here, we report on extending the applicability of T to ionic compounds with arbitrary ionic arrangements and compositions. By focussing on the occupancy of constituent spherical ions in the crystal structure, we define the ionic filling fraction (IFF), which is obtained from the volumes of crystal structure and constituent ions. Ionic compounds, including perovskites, are arranged linearly by the IFF, providing consistent results with T. The linearity guides towards finding suitable unit cell and composition, thus tackling the main obstacle for determining new crystal structures. We demonstrate the utility of the IFF by solving the structure of three hydrides with new crystal structures. PMID:27032978

Extending the applicability of the Goldschmidt tolerance factor to arbitrary ionic compounds.

PubMed

Sato, Toyoto; Takagi, Shigeyuki; Deledda, Stefano; Hauback, Bjørn C; Orimo, Shin-ichi

2016-04-01

Crystal structure determination is essential for characterizing materials and their properties, and can be facilitated by various tools and indicators. For instance, the Goldschmidt tolerance factor (T) for perovskite compounds is acknowledged for evaluating crystal structures in terms of the ionic packing. However, its applicability is limited to perovskite compounds. Here, we report on extending the applicability of T to ionic compounds with arbitrary ionic arrangements and compositions. By focussing on the occupancy of constituent spherical ions in the crystal structure, we define the ionic filling fraction (IFF), which is obtained from the volumes of crystal structure and constituent ions. Ionic compounds, including perovskites, are arranged linearly by the IFF, providing consistent results with T. The linearity guides towards finding suitable unit cell and composition, thus tackling the main obstacle for determining new crystal structures. We demonstrate the utility of the IFF by solving the structure of three hydrides with new crystal structures.

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Finite element method analysis of band gap and transmission of two-dimensional metallic photonic crystals at terahertz frequencies.

PubMed

Degirmenci, Elif; Landais, Pascal

2013-10-20

Photonic band gap and transmission characteristics of 2D metallic photonic crystals at THz frequencies have been investigated using finite element method (FEM). Photonic crystals composed of metallic rods in air, in square and triangular lattice arrangements, are considered for transverse electric and transverse magnetic polarizations. The modes and band gap characteristics of metallic photonic crystal structure are investigated by solving the eigenvalue problem over a unit cell of the lattice using periodic boundary conditions. A photonic band gap diagram of dielectric photonic crystal in square lattice array is also considered and compared with well-known plane wave expansion results verifying our FEM approach. The photonic band gap designs for both dielectric and metallic photonic crystals are consistent with previous studies obtained by different methods. Perfect match is obtained between photonic band gap diagrams and transmission spectra of corresponding lattice structure.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martínez-Rodríguez, Sergio; González-Ramírez, Luis Antonio; Clemente-Jiménez, Josefa María

The dihydropyrimidinase from S. meliloti CECT4114, with activity towards both hydantoin and dihydrouracil substrates, was crystallized, and diffraction data were collected to 1.85 Å resolution. Dihydropyrimidinases are involved in the reductive pathway of pyrimidine degradation, catalysing the hydrolysis of 5,6-dihydrouracil and 5,6-dihydrothymine to the corresponding N-carbamoyl β-amino acids. This enzyme has often been referred to as hydantoinase owing to its industrial application in the production of optically pure amino acids starting from racemic mixtures of 5-monosubstituted hydantoins. Recombinant dihydropyrimidinase from Sinorhizobium meliloti CECT4114 (SmelDhp) has been expressed, purified and crystallized. Crystallization was performed using the counter-diffusion method with capillaries ofmore » 0.3 mm inner diameter. Crystals of SmelDhp suitable for data collection and structure determination were grown in the presence of agarose at 0.1%(w/v) in order to ensure mass transport controlled by diffusion. X-ray data were collected to a resolution of 1.85 Å. The crystal belongs to the orthorhombic space group C222{sub 1}, with unit-cell parameters a = 124.89, b = 126.28, c = 196.10 Å and two molecules in the asymmetric unit. A molecular-replacement solution has been determined and refinement is in progress.« less

Crystallization and X-ray diffraction analysis of salicylate synthase, a chorismate-utilizing enyme involved in siderophore biosynthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Parsons, James F., E-mail: parsonsj@umbi.umd.edu; Shi, Katherine; Calabrese, Kelly

2006-03-01

Salicylate synthase, which catalyzes the first step in the synthesis of the siderophore yersiniabactin, has been crystallized. Diffraction data have been collected to 2.5 Å. Bacteria have evolved elaborate schemes that help them thrive in environments where free iron is severely limited. Siderophores such as yersiniabactin are small iron-scavenging molecules that are deployed by bacteria during iron starvation. Several studies have linked siderophore production and virulence. Yersiniabactin, produced by several Enterobacteriaceae, is derived from the key metabolic intermediate chorismic acid via its conversion to salicylate by salicylate synthase. Crystals of salicylate synthase from the uropathogen Escherichia coli CFT073 have beenmore » grown by vapour diffusion using polyethylene glycol as the precipitant. The monoclinic (P2{sub 1}) crystals diffract to 2.5 Å. The unit-cell parameters are a = 57.27, b = 164.07, c = 59.04 Å, β = 108.8°. The solvent content of the crystals is 54% and there are two molecules of the 434-amino-acid protein in the asymmetric unit. It is anticipated that the structure will reveal key details about the reaction mechanism and the evolution of salicylate synthase.« less

Isolation, crystallization and preliminary crystallographic analysis of Salmonella typhimurium uridine phosphorylase crystallized with 2,2′-anhydrouridine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timofeev, Vladimir I.; Lashkov, Alexander A.; Gabdoulkhakov, Azat G.

2007-10-01

S. typhimurium uridine phosphorylase has been isolated and crystallized in the presence of ligand. Uridine phosphorylase (UPh; EC 2.4.2.3) is a member of the pyrimidine nucleoside phosphorylase family of enzymes which catalyzes the phosphorolytic cleavage of the C—N glycoside bond of uridine, with the formation of ribose 1-phosphate and uracil. This enzyme has been shown to be important in the activation and catabolism of fluoropyrimidines. Modulation of its enzymatic activity may affect the therapeutic efficacy of chemotherapeutic agents. The structural investigation of the bacterial uridine phosphorylases, both unliganded and complexed with substrate/product analogues and inhibitors, may help in understanding themore » catalytic mechanism of the phosphorolytic cleavage of uridine. Salmonella typhimurium uridine phosphorylase has been crystallized with 2,2′-anhydrouridine. X-ray diffraction data were collected to 2.15 Å. Preliminary analysis of the diffraction data indicates that the crystal belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 88.52, b = 123.98, c = 133.52 Å. The solvent content is 45.51%, assuming the presence of one hexamer molecule per asymmetric unit.« less

Overexpression, crystallization and preliminary X-­ray crystallographic analysis of erythronate-4-phosphate dehydrogenase from Pseudomonas aeruginosa

PubMed Central

Ha, Jun Yong; Lee, Ji Hyun; Kim, Kyoung Hoon; Kim, Do Jin; Lee, Hyung Ho; Kim, Hye-Kyung; Yoon, Hye-Jin; Suh, Se Won

2006-01-01

The enzyme erythronate-4-phosphate dehydrogenase catalyses the conversion of erythronate-4-phosphate to 3-hydroxy-4-phospho-hydroxy-α-ketobutyrate. It belongs to the d-isomer-specific 2-hydroxyacid dehydrogenase family. It is essential for de novo biosynthesis of vitamin B6 (pyridoxine). Erythronate-4-­phosphate dehydrogenase from Pseudomonas aeruginosa, a homodimeric enzyme consisting of two identical 380-residue subunits, has been overexpressed in Escherichia coli with a C-terminal purification tag and crystallized at 297 K using 0.7 M ammonium dihydrogen phosphate, 0.4 M ammonium tartrate, 0.1 M sodium citrate pH 5.6 and 10 mM cupric chloride. X-ray diffraction data were collected to 2.20 Å from a crystal grown in the presence of NADH. The crystals belong to the orthorhombic space group P212121, with unit-cell parameters a = 84.77, b = 101.28, c = 142.58 Å. A dimeric molecule is present in the asymmetric unit, giving a crystal volume per protein weight (V M) of 3.64 Å3 Da−1 and a solvent content of 66%. PMID:16511285

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assenberg, René; Delmas, Olivier; Graham, Stephen C.

The expression, purification and crystallization of the full-length matrix protein from three lyssaviruses is described. The matrix (M) proteins of lyssaviruses (family Rhabdoviridae) are crucial to viral morphogenesis as well as in modulating replication and transcription of the viral genome. To date, no high-resolution structural information has been obtained for full-length rhabdovirus M. Here, the cloning, expression and purification of the matrix proteins from three lyssaviruses, Lagos bat virus (LAG), Mokola virus and Thailand dog virus, are described. Crystals have been obtained for the full-length M protein from Lagos bat virus (LAG M). Successful crystallization depended on a number ofmore » factors, in particular the addition of an N-terminal SUMO fusion tag to increase protein solubility. Diffraction data have been recorded from crystals of native and selenomethionine-labelled LAG M to 2.75 and 3.0 Å resolution, respectively. Preliminary analysis indicates that these crystals belong to space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 56.9–57.2, c = 187.9–188.6 Å, consistent with the presence of one molecule per asymmetric unit, and structure determination is currently in progress.« less

Overexpression, crystallization and preliminary X-ray crystallographic analysis of phosphopantetheine adenylyltransferase from Enterococcus faecalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Ji Yong; Lee, Hyung Ho; Yoon, Hye Jin

2006-11-01

Phosphopantetheine adenylyltransferase from En. faecalis was crystallized and X-ray diffraction data were collected to 2.70 Å resolution. Phosphopantetheine adenylyltransferase, an essential enzyme in the coenzyme A biosynthetic pathway, catalyzes the reversible transfer of an adenylyl group from ATP to 4′-phosphopantetheine, yielding 3′-dephospho-CoA and pyrophosphate. Enterococcus faecalis PPAT has been overexpressed in Escherichia coli as a fusion with a C-terminal purification tag and crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium HEPES pH 7.5, 0.8 M sodium dihydrogen phosphate and 0.8 M potassium dihydrogen phosphate. X-ray diffraction data were collected to 2.70 Å at 100 K.more » The crystals belong to the primitive tetragonal space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 160.81, c = 225.68 Å. Four copies of the hexameric molecule are likely to be present in the asymmetric unit, giving a crystal volume per protein weight (V{sub M}) of 3.08 Å{sup 3} Da{sup −1} and a solvent content of 60.1%.« less

CFA-4 - a fluorinated metal-organic framework with exchangeable interchannel cations.

PubMed

Fritzsche, J; Grzywa, M; Denysenko, D; Bon, V; Senkovska, I; Kaskel, S; Volkmer, D

2017-05-23

The syntheses and crystal structures of the fluorinated linker 1,4-bis(3,5-bis(trifluoromethyl)-1H-pyrazole-4-yl)benzene (H 2 -tfpb; 1) and the novel metal-organic framework family M[CFA-4] (Coordination Framework Augsburg University-4), M[Cu 5 (tfpb) 3 ] (M = Cu(i), K, Cs, Ca(0.5)), are described. The ligand 1 is fully characterized by single crystal X-ray diffraction, photoluminescence-, NMR-, IR spectroscopy, and mass spectrometry. The copper(i)-containing MOF crystallizes in the hexagonal crystal system within the chiral space group P6 3 22 (no. 182) and the unit cell parameters are as follows: a = 23.630(5) Å, c = 41.390(5) Å, V = 20 015(6) Å 3 . M[CFA-4] features a porous 3-D structure constructed from pentanuclear copper(i) secondary building units {Cu(pz) 6 } - (pz = pyrazolate). Cu(I)[CFA-4] is fully characterized by synchrotron single crystal X-ray diffraction, thermogravimetric analysis, variable temperature powder X-ray diffraction, IR spectroscopy, photoluminescence and gas sorption measurements. Moreover, thermal stability and gas sorption properties of K[CFA-4] and Cu(I)[CFA-4] are compared.

The purification, crystallization and preliminary diffraction of a glycerophosphodiesterase from Enterobacter aerogenes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Colin J.; Carr, Paul D.; Kim, Hye-Kyung

2006-07-01

The metallo-glycerophosphodiesterase from E. aerogenes (GpdQ) has been cloned, expressed in E. coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme and subsequent optimization of these conditions led to crystals. The metallo-glycerophosphodiesterase from Enterobacter aerogenes (GpdQ) has been cloned, expressed in Escherichia coli and purified. Initial screening of crystallization conditions for this enzyme resulted in the identification of needles from one condition in a sodium malonate grid screen. Removal of the metals from the enzyme andmore » subsequent optimization of these conditions led to crystals that diffracted to 2.9 Å and belonged to space group P2{sub 1}3, with unit-cell parameter a = 164.1 Å. Self-rotation function analysis and V{sub M} calculations indicated that the asymmetric unit contains two copies of the monomeric enzyme, corresponding to a solvent content of 79%. It is intended to determine the structure of this protein utilizing SAD phasing from transition metals or molecular replacement.« less

Synthesis and structure of U(VI), Np(VI), and Pu(VI) propionates

NASA Astrophysics Data System (ADS)

Serezhkin, V. N.; Grigor'ev, M. S.; Abdul'myanov, A. R.; Fedoseev, A. M.; Serezhkina, L. B.

2015-11-01

Crystals of [ AnO2(C2H5COO)2(H2O)2], where An = U (I), Np (II), or Pu (III), have been synthesized and studied by X-ray diffraction at 100 K. Compounds I-III are isostructural and crystallize in the monoclinic system, sp. gr. C2/ c, Z = 4, with the following unit-cell parameters: a = 7.4677(2), 7.4740(1), 7.512(2) Å, b = 14.2384(4), 14.1681(3), 14.182(4) Å, c = 10.5977(3), 10.5875(2), 10.607(3) Å, β = 92.384(1)°, 92.476(1)°, 92.668(17)°. Crystals I-III are composed of the mononuclear complexes [ AnO2(C2H5COO)2(H2O)2] as the main structural units belonging to the crystal-chemical group AB 01 2 M 1 2 ( A= AnO2+ 2, B 01 = C2H5COO-, M 1 = H2O). The crystal-chemical analysis of the structures of compounds of the composition UO2 L 2 · nH2O, where L is the carboxylate ion, is performed.

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan).

PubMed

Balasubramanian, Anuradha; Ponnuraj, Karthe

2008-07-01

Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 A resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 A.

Expression, purification, crystallization and X-ray diffraction studies of the molecular chaperone prefoldin from Homo sapiens

PubMed Central

Aikawa, Yoshiki; Kida, Hiroshi; Nishitani, Yuichi; Miki, Kunio

2015-01-01

Proper protein folding is an essential process for all organisms. Prefoldin (PFD) is a molecular chaperone that assists protein folding by delivering non-native proteins to group II chaperonin. A heterohexamer of eukaryotic PFD has been shown to specifically recognize and deliver non-native actin and tubulin to chaperonin-containing TCP-1 (CCT), but the mechanism of specific recognition is still unclear. To determine its crystal structure, recombinant human PFD was reconstituted, purified and crystallized. X-ray diffraction data were collected to 4.7 Å resolution. The crystals belonged to space group P21212, with unit-cell parameters a = 123.2, b = 152.4, c = 105.9 Å. PMID:26323306

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sippel, K.; Boehlein, S; Sakai, Y

Mycoplasma genitalium is a human pathogen that is associated with nongonococcal urethritis in men and cervicitis in women. The cloning, expression, purification and crystallization of the protein MG289 from M. genitalium strain G37 are reported here. Crystals of MG289 diffracted X-rays to 2.8 {angstrom} resolution. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.7, b = 90.9, c = 176.1 {angstrom}. The diffraction data after processing had an overall R{sub merge} of 8.7%. The crystal structure of Cypl, the ortholog of MG289 from M. hyorhinis, has recently been determined, providing amore » reasonable phasing model; molecular replacement is currently under way.« less

Structure of a new crystal form of human Hsp70 ATPase domain.

PubMed

Osipiuk, J; Walsh, M A; Freeman, B C; Morimoto, R I; Joachimiak, A

1999-05-01

Hsp70 proteins are highly conserved proteins induced by heat shock and other stress conditions. An ATP-binding domain of human Hsp70 protein has been crystallized in two major morphological forms at pH 7.0 in the presence of PEG 8000 and CaCl2. Both crystal forms belong to the orthorhombic space group P212121, but show no resemblance in unit-cell parameters. Analysis of the crystal structures for both forms shows a 1-2 A shift of one of the subdomains of the protein. This conformational change could reflect a 'natural' flexibility of the protein which might be relevant to ATP binding and may facilitate the interaction of other proteins with Hsp70 protein.

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE PAGES

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.; ...

2017-03-29

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

Preliminary neutron diffraction analysis of challenging human manganese superoxide dismutase crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azadmanesh, Jahaun; Trickel, Scott R.; Weiss, Kevin L.

Superoxide dismutases (SODs) are enzymes that protect against oxidative stress by dismutation of superoxide into oxygen and hydrogen peroxide through cyclic reduction and oxidation of the active-site metal. The complete enzymatic mechanisms of SODs are unknown since data on the positions of hydrogen are limited. Here, we present, methods for large crystal growth and neutron data collection of human manganese SOD (MnSOD) using perdeuteration and the MaNDi beamline at Oak Ridge National Laboratory. Furthermore, The crystal from which the human MnSOD data set was obtained is the crystal with the largest unit-cell edge (240 Å) from which data have beenmore » collectedvianeutron diffraction to sufficient resolution (2.30 Å) where hydrogen positions can be observed.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Altenfeld, Anika; Wohlgemuth, Sabine; Wehenkel, Annemarie

The 800 kDa complex of the human Rod, Zwilch and ZW10 proteins (the RZZ complex) was reconstituted in insect cells, purified, crystallized and subjected to preliminary X-ray diffraction analysis. The spindle-assembly checkpoint (SAC) monitors kinetochore–microtubule attachment during mitosis. In metazoans, the three-subunit Rod–Zwilch–ZW10 (RZZ) complex is a crucial SAC component that interacts with additional SAC-activating and SAC-silencing components, including the Mad1–Mad2 complex and cytoplasmic dynein. The RZZ complex contains two copies of each subunit and has a predicted molecular mass of ∼800 kDa. Given the low abundance of the RZZ complex in natural sources, its recombinant reconstitution was attempted bymore » co-expression of its subunits in insect cells. The RZZ complex was purified to homogeneity and subjected to systematic crystallization attempts. Initial crystals containing the entire RZZ complex were obtained using the sitting-drop method and were subjected to optimization to improve the diffraction resolution limit. The crystals belonged to space group P3{sub 1} (No. 144) or P3{sub 2} (No. 145), with unit-cell parameters a = b = 215.45, c = 458.7 Å, α = β = 90.0, γ = 120.0°.« less

Crystal growth, characterization and theoretical studies of 4-aminopyridinium picrate

NASA Astrophysics Data System (ADS)

Aditya Prasad, A.; Muthu, K.; Rajasekar, M.; Meenatchi, V.; Meenakshisundaram, S. P.

2015-01-01

Single crystals of 4-aminopyridinium picrate (APP) were grown by slow evaporation of a mixed solvent system methanol-acetone (1:1, v/v) containing equimolar quantities of 4-aminopyridine and picric acid. Structure is elucidated by single crystal XRD analysis and the crystal belongs to monoclinic system with four molecules in the unit cell (space group P21/c) and the cell parameter values are, a = 8.513 Å (±0.015), b = 11.33 Å (±0.02), c = 14.33 Å (±0.03) and β = 104.15° (±0.019), V = 1340 A3 (±6) with refined R factors R1 = 0.0053 and wR2 = 0.0126. The electron density mapping is interpreted to find coordinates for each atom in the crystallized molecules. The various functional groups present in the molecule are confirmed by FT-IR analysis. UV-visible spectral analysis was used to determine the band gap energy of 4-aminopyridinium picrate. Powder X-ray diffraction pattern reveals the crystallinity of the as-grown crystal and it closely resembles the simulated XRD from the single crystal XRD analysis. Scanning electron microscopy reveals the surface morphology of the grown crystal. Optimized geometry is derived by Hartree-Fock theory calculations and the first-order molecular hyperpolarizability (β), theoretically calculated bond length, bond angles and excited state energy from theoretical UV-vis spectrum were estimated.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gati, Cornelius; Oberthuer, Dominik; Yefanov, Oleksandr

To understand how molecules function in biological systems, new methods are required to obtain atomic resolution structures from biological material under physiological conditions. Intense femtosecond-duration pulses from X-ray free-electron lasers (XFELs) can outrun most damage processes, vastly increasing the tolerable dose before the specimen is destroyed. This in turn allows structure determination from crystals much smaller and more radiation sensitive than previously considered possible, allowing data collection from room temperature structures and avoiding structural changes due to cooling. Regardless, high-resolution structures obtained from XFEL data mostly use crystals far larger than 1 μm3 in volume, whereas the X-ray beam ismore » often attenuated to protect the detector from damage caused by intense Bragg spots. Here, we describe the 2 Å resolution structure of native nanocrystalline granulovirus occlusion bodies (OBs) that are less than 0.016 μm3 in volume using the full power of the Linac Coherent Light Source (LCLS) and a dose up to 1.3 GGy per crystal. The crystalline shell of granulovirus OBs consists, on average, of about 9,000 unit cells, representing the smallest protein crystals to yield a high-resolution structure by X-ray crystallography to date. The XFEL structure shows little to no evidence of radiation damage and is more complete than a model determined using synchrotron data from recombinantly produced, much larger, cryocooled granulovirus granulin microcrystals. Furthermore, our measurements suggest that it should be possible, under ideal experimental conditions, to obtain data from protein crystals with only 100 unit cells in volume using currently available XFELs and suggest that single-molecule imaging of individual biomolecules could almost be within reach.« less

Synthesis and studies on structural, optical and nonlinear optical properties of novel organic inter-molecular compounds: 4-chloro-3-nitroaniline-3-hydroxy benzaldehyde and urea-4-dimethylaminopyridine

NASA Astrophysics Data System (ADS)

Pandey, Priyanka; Rai, R. N.

2018-05-01

Two novel organic inter-molecular compounds (IMCs), (3-(4-chloro-3-nitrophenylimino) methyl) phenol) (CNMP) and urea ̶ 4-dimethylaminopyridine complex (UDMAP), have been synthesized by solid state reaction. These two IMCs were identified by phase diagram study of CNA-HB and U-DMAP systems. The single crystals of newly obtained IMCs were grown by slow solvent evaporation technique at room temperature. Both the IMCs were further studied for their thermal, spectral, single crystal XRD for their atomic packing in molecule, crystallinity, optical and nonlinear optical behaviour. In both the cases, melting point of inter-molecular compounds was found to be higher than that of their parent components, CNMP was found to be thermally stable up to 158 °C while UDMAP was stable up to 144 °C, which indicate their extra stability than their parents. The single crystal XRD studies confirmed that CNMP has crystallized in orthorhombic unit cell with non-centrosymmetric space group P212121 while UDMAP has crystallized in monoclinic unit cell with centrosymmetric space group C2/c. The absorption spectrum of CNMP was found to be in between the absorption of parents, while broadening of peak and red shift was observed in UDMAP as compared to the parents. Second order nonlinear optical property of CNMP and UDMAP was studied using Kurtz Perry powder technique and intense green light emission was observed with CNMP on excitation with 1064 nm of Nd:YAG laser while no emission was observed with UDMAP.

Peptide crystal simulations reveal hidden dynamics

PubMed Central

Janowski, Pawel A.; Cerutti, David S.; Holton, James; Case, David A.

2013-01-01

Molecular dynamics simulations of biomolecular crystals at atomic resolution have the potential to recover information on dynamics and heterogeneity hidden in the X-ray diffraction data. We present here 9.6 microseconds of dynamics in a small helical peptide crystal with 36 independent copies of the unit cell. The average simulation structure agrees with experiment to within 0.28 Å backbone and 0.42 Å all-atom rmsd; a model refined against the average simulation density agrees with the experimental structure to within 0.20 Å backbone and 0.33 Å all-atom rmsd. The R-factor between the experimental structure factors and those derived from this unrestrained simulation is 23% to 1.0 Å resolution. The B-factors for most heavy atoms agree well with experiment (Pearson correlation of 0.90), but B-factors obtained by refinement against the average simulation density underestimate the coordinate fluctuations in the underlying simulation where the simulation samples alternate conformations. A dynamic flow of water molecules through channels within the crystal lattice is observed, yet the average water density is in remarkable agreement with experiment. A minor population of unit cells is characterized by reduced water content, 310 helical propensity and a gauche(−) side-chain rotamer for one of the valine residues. Careful examination of the experimental data suggests that transitions of the helices are a simulation artifact, although there is indeed evidence for alternate valine conformers and variable water content. This study highlights the potential for crystal simulations to detect dynamics and heterogeneity in experimental diffraction data, as well as to validate computational chemistry methods. PMID:23631449

Crystal structure, thermochromic and magnetic properties of organic-inorganic hybrid compound: (C7H7N2S)2CuCl4

NASA Astrophysics Data System (ADS)

Vishwakarma, Ashok K.; Kumari, Reema; Ghalsasi, Prasanna S.; Arulsamy, Navamoney

2017-08-01

The synthesis, thermal analysis, crystal structure and magnetic properties of (2-aminobenzothiazolium)2CuCl4, organic-inorganic hybrid compound, have been described. The compound crystallizes in the monoclinic space group P21/c with two formula units in a unit cell of dimensions a = 6.9522(4) Å, b = 9.6979(4) Å, c = 13.9633(6) Å, β = 97.849(3)° and volume 930.83(8) Å3 at 150(2) K. The structure consists of isolated nearly square planer [CuC14]2- units, with somewhat longer than normal Cusbnd Cl bond lengths [Cusbnd Cl (average) = 2.2711 Å]. The magnetic measurements of (2-aminobenzothiazolium)2CuCl4 using SQUID magnetometer show paramagnetic nature of the compound. Thermal measurements (TG-DTA and DSC) on this compound showed reversible phase transition at 83 °C. This transition is accompanied by the reversible change in colour of the prismatic crystal from green to dark brown, thermochromic behaviour. Temperature dependent EPR measurements on powdered sample ascertain change in coordination sphere around Cu(II) with shift in g|| = 2.150 and g⊥ = 2.071 at room temperature, typical of square planar, to g|| = 2.201 and g⊥ = 2.182 at 170 °C, typical of distorted tetrahedral geometry.

The Pythagorean Theorem and the Solid State

ERIC Educational Resources Information Center

Kelly, Brenda S.; Splittgerber, Allan G.

2005-01-01

Packing efficiency and crystal density can be calculated from basic geometric principles employing the Pythagorean theorem, if the unit-cell structure is known. The procedures illustrated have applicability in courses such as general chemistry, intermediate and advanced inorganic, materials science, and solid-state physics.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ovchinnikova, E. N.; Rogalev, A.; Wilhelm, F.

The local electronic structure of copper ions in a copper metaborate CuB{sub 2}O{sub 4} crystal is studied on the ESRF synchrotron using X-ray absorption polarization-dependent spectroscopy. The X-ray natural circular dichroism near the K absorption edge of copper is measured in the direction that is perpendicular to crystal axis c. The data obtained indicate the presence of hybridized p–d electronic states of copper. Theoretical calculations are used to separate the contributions of the two crystallographically nonequivalent positions of copper atoms in the unit cell of CuB{sub 2}O{sub 4} to the absorption and X-ray circular dichroism spectra of the crystal.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

NASA Astrophysics Data System (ADS)

Abramchik, Yu. A.; Timofeev, V. I.; Muravieva, T. I.; Esipov, R. S.; Kuranova, I. P.

2016-11-01

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P1211 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, β = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.

Multiple chiral topological states in liquid crystals from unstructured light beams

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loussert, Charles; Brasselet, Etienne, E-mail: e.brasselet@loma.u-bordeaux1.fr

2014-02-03

It is shown experimentally that unstructured light beams can generate a wealth of distinct metastable defect structures in thin films of chiral liquid crystals. Various kinds of individual chiral topological states are obtained as well as dimers and trimers, which correspond to the entanglement of several topological unit cells. Self-assembled nested assemblies of several metastable particle-like topological states can also be formed. Finally, we propose and experimentally demonstrate an opto-electrical approach to generate tailor-made architectures.

Optical trapping via guided resonance modes in a Slot-Suzuki-phase photonic crystal lattice.

PubMed

Ma, Jing; Martínez, Luis Javier; Povinelli, Michelle L

2012-03-12

A novel photonic crystal lattice is proposed for trapping a two-dimensional array of particles. The lattice is created by introducing a rectangular slot in each unit cell of the Suzuki-Phase lattice to enhance the light confinement of guided resonance modes. Large quality factors on the order of 10⁵ are predicted in the lattice. A significant decrease of the optical power required for optical trapping can be achieved compared to our previous design.

Phase equilibria and crystal chemistry of rubidium niobates and rubidium tantalates

NASA Technical Reports Server (NTRS)

Minor, D. B.; Roth, R. S.; Parker, H. S.; Brower, W. S.

1977-01-01

The phase equilibria relations and crystal chemistry of portions of the Rb2O-Nb2O5 and Rb2O-Ta2O5 systems were investigated for structures potentially useful as ionic conductors. A hexagonal tungsten bronze-type (HTB) structure was found in both systems as well as three hexagonal phases with mixed HTB-pyrochlore type structures. Ion exchange experiments between various alkali ions are described for several phases. Unit cell dimensions and X-ray diffraction powder patterns are reported.

Crystallization and preliminary X-ray diffraction analysis of mouse 3(17)α-hydroxysteroid dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

El-Kabbani, Ossama, E-mail: ossama.el-kabbani@vcp.monash.edu.au; Ishikura, Syuhei; Wagner, Armin

2005-07-01

Orthorhombic crystals of mouse 3(17)α-hydroxysteroid dehydrogenase were obtained from buffered polyethylene glycol solutions. The crystals diffracted to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA. The 3(17)α-hydroxysteroid dehydrogenase from mouse is involved in the metabolism of oestrogens, androgens, neurosteroids and xenobiotic compounds. The enzyme was crystallized by the hanging-drop vapour-diffusion method in space group P222{sub 1}, with unit-cell parameters a = 84.91, b = 84.90, c = 95.83 Å. The Matthews coefficient (V{sub M}) and the solvent content were 2.21 Å{sup 3} Da{sup −1} and 44.6%, respectively, assuming the presence of two molecules in the asymmetricmore » unit. Diffraction data were collected to a resolution of 1.8 Å at the Swiss Light Source beamline X06SA using a MAR CCD area detector and gave a data set with an overall R{sub merge} of 6.8% and a completeness of 91.1%.« less

Crystallization and preliminary X-ray crystallographic analysis of MacA from Actinobacillus actinomycetemcomitans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piao, Shunfu; Xu, Yongbin; Ha, Nam-Chul, E-mail: hnc@pusan.ac.kr

2008-05-01

A periplasmic membrane-fusion protein MacA from Actinobacillus actinomycetemcomitans, an essential component of the multidrug efflux pump in Gram-negative bacteria, was crystallized. Periplasmic membrane-fusion proteins (MFPs) are an essential component of the multidrug efflux pump in Gram-negative bacteria. They play a crucial role in bridging the outer membrane porin TolC and two distinct types of inner membrane transporters. The MFP MacA bridges the inner membrane ABC-type multidrug transporter MacB and the outer membrane porin TolC. MacA from the pathogenic bacterium Actinobacillus actinomycetemcomitans was expressed in Escherichia coli B834 (DE3) and the recombinant protein was purified using Ni–NTA affinity, Q anion-exchange andmore » gel-filtration chromatography. The purified MacA protein was crystallized using the vapour-diffusion method. A MAD diffraction data set was collected to a resolution of 3.0 Å at 100 K. The crystal belongs to space group P622, with unit-cell parameters a = b = 109.2, c = 255.4 Å, α = β = 90, γ = 120°, and contains one molecule in the asymmetric unit.« less

Expression, purification, crystallization and preliminary crystallographic analysis of MxiH, a subunit of the Shigella flexneri type III secretion system needle

PubMed Central

Deane, Janet E.; Cordes, Frank S.; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D.; Picking, Wendy L.; Lea, Susan M.; Blocker, Ariel

2006-01-01

A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiHCΔ5 and diffraction data were collected to 1.9 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 Å, β = 96.5°. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 Å3 Da−1 for two molecules per asymmetric unit, corresponding to a solvent content of 33%. PMID:16511329

Expression, purification, crystallization and preliminary crystallographic analysis of MxiH, a subunit of the Shigella flexneri type III secretion system needle.

PubMed

Deane, Janet E; Cordes, Frank S; Roversi, Pietro; Johnson, Steven; Kenjale, Roma; Picking, William D; Picking, Wendy L; Lea, Susan M; Blocker, Ariel

2006-03-01

A monodisperse truncation mutant of MxiH, the subunit of the needle from the Shigella flexneri type III secretion system (TTSS), has been overexpressed and purified. Crystals were grown of native and selenomethionine-labelled MxiH(CDelta5) and diffraction data were collected to 1.9 A resolution. The crystals belong to space group C2, with unit-cell parameters a = 183.4, b = 28.1, c = 27.8 A, beta = 96.5 degrees. An anomalous difference Patterson map calculated with the data from the SeMet-labelled crystals revealed a single peak on the Harker section v = 0. Inspection of a uranyl derivative also revealed one peak in the isomorphous difference Patterson map on the Harker section v = 0. Analysis of the self-rotation function indicates the presence of a twofold non-crystallographic symmetry axis approximately along a. The calculated Matthews coefficient is 1.9 A3 Da(-1) for two molecules per asymmetric unit, corresponding to a solvent content of 33%.

Purification, crystallization and preliminary X-ray analysis of native and selenomethionine class I tagatose-1,6-bisphosphate aldolase from Streptococcus pyogenes.

PubMed

Liotard, Brigitte; Sygusch, Jurgen

2004-03-01

Tagatose-1,6-bisphosphate aldolase (EC 4.1.2.40) is situated at the branching of the tagatose-6-phosphate and Embden-Meyerhof-Parnas (glycolysis) metabolic pathways, where it catalyzes the reversible cleavage of tagatose-1,6-bisphosphate to dihydroxyacetone phosphate and glyceraldehyde 3-phosphate. The recombinant protein from Streptococcus pyogenes was overexpressed in Escherichia coli in its native and selenomethionine-derivative forms and purified using ion-exchange and hydrophobic interaction chromatography. Orthorhombic crystals suitable for structural analysis were obtained by the hanging-drop vapour-diffusion method for both isoforms. The crystals belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 63.7, b = 108.1, c = 238.7 A for the native form and a = 64.1, b = 108.3, c = 239.8 A for the selenomethionine derivative. The asymmetric unit contains four protomers, corresponding to a crystal volume per protein weight (V(M)) of 2.8 A(3) Da(-1) and a solvent content of 56% by volume.

Crystallization and preliminary X-ray diffraction analysis of an endo-1,4-β-D-glucanase from Aspergillus aculeatus F-50.

PubMed

Chen, Yun; Huang, Jian Wen; Chen, Chun Chi; Lai, Hui Lin; Jin, Jian; Guo, Rey Ting

2015-04-01

Cellulose is the most abundant renewable biomass on earth, and its decomposition has proven to be very useful in a wide variety of industries. Endo-1,4-β-D-glucanase (EC 3.2.1.4; endoglucanase), which can catalyze the random hydrolysis of β-1,4-glycosidic bonds to cleave cellulose into smaller fragments, is a key cellulolytic enzyme. An endoglucanase isolated from Aspergillus aculeatus F-50 (FI-CMCase) that was classified into glycoside hydrolase family 12 has been found to be effectively expressed in the industrial strain Pichia pastoris. Here, recombinant FI-CMCase was crystallized. Crystals belonging to the orthorhombic space group C222₁, with unit-cell parameters a = 74.2, b = 75.1, c = 188.4 Å, were obtained by the sitting-drop vapour-diffusion method and diffracted to 1.6 Å resolution. Initial phase determination by molecular replacement clearly shows that the crystal contains two protein molecules in the asymmetric unit. Further model building and structure refinement are in progress.

Synthesis and an X-ray diffraction study of Rb{sub 2}[(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Serezhkina, L. B., E-mail: Lserezh@ssu.samara.ru; Peresypkina, E. V.; Neklyudova, N. A.

2010-09-15

The synthesis and X-ray diffraction study of compound Rb{sub 2}[(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}], which crystallizes in the monoclinic crystal system, are performed. The unit cell parameters are as follows: a = 7.9996(6) A, b = 8.8259(8) A, c = 11.3220(7) A, {beta} = 105.394(2){sup o}, and V = 770.7(1) A{sup 3}; space group P2{sub 1}/n, Z = 2, and R{sub 1} = 0.0271. [(UO{sub 2}){sub 2}(C{sub 2}O{sub 4}){sub 3}]{sup 2-} layers belonging to the AK{sub 0.5}{sup 02}T{sup 11} crystal chemical group of uranyl complexes (A = UO{sub 2}{sup 2+}, K{sup 02} = C{sub 2}O{sub 4}{sup 2-}, and T{supmore » 11} = C{sub 2}O{sub 4}{sup 2-}) are uranium-containing structural units of the crystals. The layers are connected with outer-sphere rubidium cations by electrostatic interactions.« less

Crystallization and preliminary X-ray crystallographic analysis of hydroquinone dioxygenase from Sphingomonas sp. TTNP3

PubMed Central

Da Vela, Stefano; Ferraroni, Marta; Kolvenbach, Boris A.; Keller, Eva; Corvini, Philippe F. X.; Scozzafava, Andrea; Briganti, Fabrizio

2012-01-01

Hydroquinone dioxygenase (HQDO), a novel FeII ring-fission dioxygenase from Sphingomonas sp. strain TTNP3 which oxidizes a wide range of hydroquinones to the corresponding 4-hydroxymuconic semialdehydes, has been crystallized. The enzyme is an α2β2 heterotetramer constituted of two subunits of 19 and 38 kDa. Diffraction-quality crystals of HQDO were obtained using the sitting-drop vapour-diffusion method at 277 K from a solution consisting of 16% PEG 4000, 0.3 M MgCl2, 0.1 M Tris pH 8.5. The crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 88.4, b = 125.4, c = 90.8 Å, β = 105.3°. The asymmetric unit contained two heterotetramers, i.e. four copies of each of the two different subunits related by noncrystallographic 222 symmetry. A complete data set extending to a maximum resolution of 2.5 Å was collected at 100 K using a wavelength of 0.980 Å. PMID:22691794

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xie, Wei; Schimmel, Paul; Yang, Xiang-Lei, E-mail: xlyang@scripps.edu

2006-12-01

Crystallization and preliminary X-ray analysis of a native human tRNA synthetase whose allelic variants are associated with Charcot–Marie–Tooth Disease. Glycyl-tRNA synthetase (GlyRS) is one of a group of enzymes that catalyze the synthesis of aminoacyl-tRNAs for translation. Mutations of human and mouse GlyRSs are causally associated with Charcot–Marie–Tooth disease, the most common genetic disorder of the peripheral nervous system. As the first step towards a structure–function analysis of this disease, native human GlyRS was expressed, purified and crystallized. The crystal belonged to space group P4{sub 3}2{sub 1}2 or its enantiomorphic space group P4{sub 1}2{sub 1}2, with unit-cell parameters a =more » b = 91.74, c = 247.18 Å, and diffracted X-rays to 3.0 Å resolution. The asymmetric unit contained one GlyRS molecule and had a solvent content of 69%.« less

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans

PubMed Central

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-01-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (V M) of 2.05 Å3 Da−1 and a solvent content of 40.2%. PMID:23695570

Crystallization and preliminary X-ray diffraction analysis of the TetR-family transcriptional repressor YhgD from Bacillus halodurans.

PubMed

Yeo, Hyun Ku; Park, Young Woo; Kang, Jina; Lee, Jae Young

2013-05-01

YhgD is a member of the TetR-family transcription factors, which regulate genes encoding proteins involved in multidrug resistance, virulence, osmotic stress and pathogenicity. YhgD from the alkaliphilic bacterium Bacillus halodurans was cloned and overexpressed in Escherichia coli. YhgD (Bh2145) from B. halodurans is composed of 193 amino-acid residues with a molecular mass of 21 853 Da. YhgD was crystallized at 296 K using ethylene glycol as a precipitant by the sitting-drop vapour-diffusion method. The crystal diffracted to 1.9 Å resolution and belonged to the apparent triclinic space group P1, with unit-cell parameters a = 37.22, b = 47.85, c = 54.15 Å, α = 92.75, β = 107.9, γ = 90.27°. The asymmetric unit is likely to contain two molecules of monomeric YhgD, giving a crystal volume per mass (VM) of 2.05 Å(3) Da(-1) and a solvent content of 40.2%.

Cloning, expression, purification, crystallization and preliminary crystallographic analysis of pseudo death-effector domain of HIPPI, a molecular partner of Huntingtin-interacting protein HIP-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Manisha; Majumder, Pritha; Bhattacharyya, Nitai P.

2006-12-01

A pseudo death-effector domain (pDED) of HIPPI, a partner of Huntingtin-interacting protein HIP1, has been cloned, overexpressed and crystallized. The crystals of pDED-HIPPI diffracted to 2.2 Å. The formation of a heterodimer between Huntingtin-interacting protein-1 (HIP-1) and its novel partner HIPPI (HIP-1 protein interactor) through their pseudo death-effector domains (pDEDs) is a key step that recruits caspase-8 and initiates apoptosis. This could be one of the pathways by which apoptosis is increased in Huntington’s disease (HD). A construct consisting of the pDED of HIPPI has been cloned and overexpressed as 6NH-tagged protein and purified by Ni–NTA affinity chromatography. Crystals ofmore » the pDED of HIPPI were grown in space group P4{sub 1}, with unit-cell parameters a = b = 77.42, c = 33.31 Å and a calculated Matthews coefficient of 1.88 Å{sup 3} Da{sup −1} (33% solvent content) with two molecules per asymmetric unit.« less

Preliminary crystallographic analysis of avian infectious bronchitis virus main protease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jun; Shen, Wei; Liao, Ming, E-mail: mliao@scau.edu.cn

The avian infectious bronchitis virus main protease has been crystallized; crystals diffract to 2.7 Å resolution. Infectious bronchitis virus (IBV) is the prototype of the genus Coronavirus. It causes a highly contagious disease which affects the respiratory, reproductive, neurological and renal systems of chickens, resulting great economic losses in the poultry industry worldwide. The coronavirus (CoV) main protease (M{sup pro}), which plays a pivotal role in viral gene expression and replication through a highly complex cascade involving the proteolytic processing of replicase polyproteins, is an attractive target for antiviral drug design. In this study, IBV M{sup pro} was overexpressed inmore » Escherichia coli. Crystals suitable for X-ray crystallography have been obtained using microseeding techniques and belong to space group P6{sub 1}22. X-ray diffraction data were collected in-house to 2.7 Å resolution from a single crystal. The unit-cell parameters were a = b = 119.1, c = 270.7 Å, α = β = 90, γ = 120°. Three molecules were predicted to be present in the asymmetric unit from a calculated self-rotation function.« less

Synthesis, structure and properties of bimetallic sodium rare-earth (RE) borohydrides, NaRE(BH4)4, RE = Ce, Pr, Er or Gd.

PubMed

Payandeh GharibDoust, SeyedHosein; Ravnsbæk, Dorthe B; Černý, Radovan; Jensen, Torben R

2017-10-10

Formation, stability and properties of new metal borohydrides within RE(BH 4 ) 3 -NaBH 4 , RE = Ce, Pr, Er or Gd is investigated. Three new bimetallic sodium rare-earth borohydrides, NaCe(BH 4 ) 4 , NaPr(BH 4 ) 4 and NaEr(BH 4 ) 4 are formed based on an addition reaction between NaBH 4 and halide free rare-earth metal borohydrides RE(BH 4 ) 3 , RE = Ce, Pr, Er. All the new compounds crystallize in the orthorhombic crystal system. NaCe(BH 4 ) 4 has unit cell parameters of a = 6.8028(5), b = 17.5181(13), c = 7.2841(5) Å and space group Pbcn. NaPr(BH 4 ) 4 is isostructural to NaCe(BH 4 ) 4 with unit cell parameters of a = 6.7617(2), b = 17.4678(7), c = 7.2522(3) Å. NaEr(BH 4 ) 4 crystallizes in space group Cmcm with unit cell parameters of a = 8.5379(2), b = 12.1570(4), c = 9.1652(3) Å. The structural relationships, also to the known RE(BH 4 ) 3 , are discussed in detail and related to the stability and synthesis conditions. Heat treatment of NaBH 4 -Gd(BH 4 ) 3 mixture forms an unstable amorphous phase, which decomposes after one day at RT. NaCe(BH 4 ) 4 and NaPr(BH 4 ) 4 show reversible hydrogen storage capacity of 1.65 and 1.04 wt% in the fourth H 2 release, whereas that of NaEr(BH 4 ) 4 continuously decreases. This is mainly assigned to formation of metal hydrides and possibly slower formation of sodium borohydride. The dehydrogenated state clearly contains rare-earth metal borides, which stabilize boron in the dehydrogenated state.

Expression, crystallization and preliminary X-ray crystallographic analyses of two N-terminal acetyltransferase-related proteins from Thermoplasma acidophilum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Sang Hee; Ha, Jun Yong; Kim, Kyoung Hoon

2006-11-01

An N-terminal acetyltransferase ARD1 subunit-related protein (Ta0058) and an N-terminal acetyltransferase-related protein (Ta1140) from T. acidophilum were crystallized. X-ray diffraction data were collected to 2.17 and 2.40 Å, respectively. N-terminal acetylation is one of the most common protein modifications in eukaryotes, occurring in approximately 80–90% of cytosolic mammalian proteins and about 50% of yeast proteins. ARD1 (arrest-defective protein 1), together with NAT1 (N-acetyltransferase protein 1) and possibly NAT5, is responsible for the NatA activity in Saccharomyces cerevisiae. In mammals, ARD1 is involved in cell proliferation, neuronal development and cancer. Interestingly, it has been reported that mouse ARD1 (mARD1{sup 225}) mediatesmore » ∊-acetylation of hypoxia-inducible factor 1α (HIF-1α) and thereby enhances HIF-1α ubiquitination and degradation. Here, the preliminary X-ray crystallographic analyses of two N-terminal acetyltransferase-related proteins encoded by the Ta0058 and Ta1140 genes of Thermoplasma acidophilum are reported. The Ta0058 protein is related to an N-terminal acetyltransferase complex ARD1 subunit, while Ta1140 is a putative N-terminal acetyltransferase-related protein. Ta0058 shows 26% amino-acid sequence identity to both mARD1{sup 225} and human ARD1{sup 235}.The sequence identity between Ta0058 and Ta1140 is 28%. Ta0058 and Ta1140 were overexpressed in Escherichia coli fused with an N-terminal purification tag. Ta0058 was crystallized at 297 K using a reservoir solution consisting of 0.1 M sodium acetate pH 4.6, 8%(w/v) polyethylene glycol 4000 and 35%(v/v) glycerol. X-ray diffraction data were collected to 2.17 Å. The Ta0058 crystals belong to space group P4{sub 1} (or P4{sub 3}), with unit-cell parameters a = b = 49.334, c = 70.384 Å, α = β = γ = 90°. The asymmetric unit contains a monomer, giving a calculated crystal volume per protein weight (V{sub M}) of 2.13 Å{sup 3} Da{sup −1} and a solvent content of 42.1%. Ta1140 was also crystallized at 297 K using a reservoir solution consisting of 0.1 M trisodium citrate pH 5.6, 20%(v/v) 2-propanol, 20%(w/v) polyethylene glycol 4000 and 0.2 M sodium chloride. X-ray diffraction data were collected to 2.40 Å. The Ta1140 crystals belong to space group R3, with hexagonal unit-cell parameters a = b = 75.174, c = 179.607 Å, α = β = 90, γ = 120°. Two monomers are likely to be present in the asymmetric unit, with a V{sub M} of 2.51 Å{sup 3} Da{sup −1} and a solvent content of 51.0%.« less

Low cost solar array project production process and equipment task. A Module Experimental Process System Development Unit (MEPSDU)

NASA Technical Reports Server (NTRS)

1981-01-01

Technical readiness for the production of photovoltaic modules using single crystal silicon dendritic web sheet material is demonstrated by: (1) selection, design and implementation of solar cell and photovoltaic module process sequence in a Module Experimental Process System Development Unit; (2) demonstration runs; (3) passing of acceptance and qualification tests; and (4) achievement of a cost effective module.

Anisotropic compressibility of the coordination polymer emim[Mn(btc)].

PubMed

Madsen, Solveig R; Moggach, Stephen A; Overgaard, Jacob; Brummerstedt Iversen, Bo

2016-06-01

The effect of pressure on the crystal structure of a coordination polymer, emim[Mn(II)(btc)] (emim = 1-ethyl,3-methyl imidazolium cation, btc = 1,3,5-benzene-tricarboxylate), was investigated with single-crystal X-ray diffraction. At 4.3 GPa the unit-cell volume had decreased by 14% compared with ambient conditions. The unit-cell contraction is highly anisotropic, with the a- and b-axes decreasing by 5.5 and 9.5%, respectively, and the c-axis compressing a mere 0.25% up to 1.7 GPa followed by a 0.2% expansion between 1.7 and 4.3 GPa. The 0.2% increase in length of the c-axis in this interval happens above the quasi-hydrostatic limit of the pressure-transmitting medium and therefore it might be a consequence of strain gradients. Under ambient conditions, two MnO6 units are connected by two carboxylate ligands to form dimeric units. On increasing pressure, a non-bonded O atom from a bridging carboxylate group approaches the Mn atom, with the Mn-O distance decreasing from 2.866 (1) Å at 0.3 GPa to 2.482 (6) Å at 4.3 GPa, increasing the coordination environment of the Mn ion from six- to seven-coordinated.

Compressional behavior of omphacite to 47 GPa

DOE PAGES

Zhang, Dongzhou; Hu, Yi; Dera, Przemyslaw K.

2016-07-08

Omphacite is an important mineral component of eclogite. Single crystal synchrotron X-ray diffraction data on natural (Ca,Na)(Mg,Fe,Al)Si 2O 6 omphacite have been collected at the Advanced Photon Source beamlines 13-BM-C and 13-ID-D up to 47 GPa at ambient temperature. Unit cell parameter and crystal structure refinements were carried out to constrain the isothermal equation of state and compression mechanism. The 3rd order Birch-Murnaghan equation of state (BM3) fit of all data gives V o = 423.9(3) Å3, K To = 116(2) GPa and K To’ = 4.3(2). These elastic parameters are consistent with the general trend of the diopside-jadeite join.more » The eight-coordinated polyhedra (M2 and M21) are the most compressible, and contribute to majority of the unit cell compression, while the SiO 4 tetrahedra (Si1 and Si2) behave as rigid structural units and are the most incompressible. Axial compressibilities are determined by fitting linearized BM 3 equation of state to pressure dependences of unit cell parameters. Throughout the investigated pressure range, the b-axis is more compressible than the c-axis. Here, the axial compressibility of the α-axis is the largest among the three axes at 0 GPa, yet it quickly drops to the smallest at pressures above 5 GPa, which is explained by the rotation of the stiffest compression axis toward the a-axis with the increase of pressure.« less

Formation of Fluorohydroxyapatite with Silver Diamine Fluoride

PubMed Central

Mei, M.L.; Nudelman, F.; Marzec, B.; Walker, J.M.; Lo, E.C.M.; Walls, A.W.; Chu, C.H.

2017-01-01

Silver diamine fluoride (SDF) is found to promote remineralization and harden the carious lesion. Hydroxyapatite crystallization is a crucial process in remineralization; however, the role of SDF in crystal formation is unknown. We designed an in vitro experiment with calcium phosphate with different SDF concentrations (0.38, 1.52, 2.66, 3.80 mg/mL) to investigate the effect of this additive on the nucleation and growth of apatite crystals. Two control groups were also prepared—calcium phosphate (CaCl2·2H2O + K2HPO4 in buffer solution) and SDF (Ag[NH3]2F in buffer solution). After incubation at 37 oC for 24 h, the shape and organization of the crystals were examined by bright-field transmission electron microscopy and electron diffraction. Unit cell parameters of the obtained crystals were determined with powder X-ray diffraction. The vibrational and rotational modes of phosphate groups were analyzed with Raman microscopy. The transmission electron microscopy and selected-area electron diffraction confirmed that all solids precipitated within the SDF groups were crystalline and that there was a positive correlation between the increased percentage of crystal size and the concentration of SDF. The powder X-ray diffraction patterns indicated that fluorohydroxyapatite and silver chloride were formed in all the SDF groups. Compared with calcium phosphate control, a contraction of the unit cell in the a-direction but not the c-direction in SDF groups was revealed, which suggested that small localized fluoride anions substituted the hydroxyl anions in hydroxyapatite crystals. This was further evidenced by the Raman spectra, which displayed up-field shift of the phosphate band in all the SDF groups and confirmed that the chemical environment of the phosphate functionalities indeed changed. The results suggested that SDF reacted with calcium and phosphate ions and produced fluorohydroxyapatite. This preferential precipitation of fluorohydroxyapatite with reduced solubility could be one of the main factors for arrest of caries lesions treated with SDF. PMID:28521107

Correlating Polymer Crystals via Self-Induced Nucleation

NASA Astrophysics Data System (ADS)

Reiter, Günter

Crystallizable polymers often form multiple stacks of uniquely oriented lamellae, which have good registry despite being separated by amorphous fold surfaces. These correlations require multiple synchronized, yet unidentified, nucleation events. Here, we demonstrate that in thin films of isotactic polystyrene, the probability of generating correlated lamellae is controlled by the branched morphology of a single primary lamella. The nucleation density ns of secondary lamellae is found to be dependent on the width of the branches of the primary lamella. This relation is independent of molecular weight, crystallization temperature, and film thickness. We propose a nucleation mechanism based on the insertion of polymers into a branched primary lamellar crystal. Even in single crystals, characterized by faceted structures with a well-defined envelope reflecting the underlying crystal unit cell, polymers are folded and thus in a meta-stable state. Annealing such meta-stable single crystals allowed to unveil the initial morphological framework of a dendritic single crystal, i.e. the initial stages of growth.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gil, D.M.; Osiry, H.; Pomiro, F.

The hydrogen bond and π-π stacking are two non-covalent interactions able to support cooperative magnetic ordering between paramagnetic centers. This contribution reports the crystal structure and related magnetic properties for VO[Fe(CN){sub 5}NO]·2H{sub 2}O, which has a layered structure. This solid crystallizes with an orthorhombic unit cell, in the Pna2{sub 1} space group, with cell parameters a=14.1804(2), b=10.4935(1), c=7.1722(8) Å and four molecules per unit cell (Z=4). Its crystal structure was solved and refined from powder X-ray diffraction data. Neighboring layers remain linked through a network of hydrogen bonds involving a water molecule coordinated to the axial position for the Vmore » atom and the unbridged axial NO and CN ligands. An uncoordinated water molecule is found forming a triple bridge between these last two ligands and the coordinated water molecule. The magnetic measurements, recorded down to 2 K, shows a ferromagnetic interaction between V atoms located at neighboring layers, with a Curie-Weiss constant of 3.14 K. Such ferromagnetic behavior was interpreted as resulting from a superexchange interaction through the network of strong OH····O{sub H2O}, OH····N{sub CN}, and OH····O{sub NO} hydrogen bonds that connects neighboring layers. The interaction within the layer must be of antiferromagnetic nature and it was detected close to 2 K. - Graphical abstract: Coordination environment for the metals in vanadyl (II) nitroprusside dihydrate. Display Omitted - Highlights: • Crystal structure of vanadyl nitroprusside dehydrate. • Network of hydrogen bonds. • Magnetic interactions through a network of hydrogen bonds. • Layered transition metal nitroprussides.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Crystallization of beef heart cytochrome c oxidase

NASA Astrophysics Data System (ADS)

Yoshikawa, Shinya; Shinzawa, Kyoko; Tsukihara, Tomitake; Abe, Toshio; Caughey, Winslow S.

1991-03-01

The three-dimensional structure of cytochrome c oxidase, a complex (multimetal, multisubunit) membrane protein is critical to elucidation of the mechanism of the enzymic reactions and their control. Our recent developments in the crystallization of the enzyme isolated from beef hearts are presented. The crystals appeared more readily at higher protein concentration, lower ionic strength, higher detergent concentration (Brij-35) and lower temperature. Large crystals were obtained by changing one of these parameters to the crystallization point as slowly as possible, keeping the other parameters constant. Increasing the detergent concentration was the most successful method, producing green crystals of the resting oxidized form as hexagonal bipyramids with typical dimensions of 0.6 mm. The usual procedures for crystallization of water soluble proteins, such as increasing ionic strength by vapor diffusion, were not applicable for this enzyme. Crystals of the resting oxidized enzyme belong to a space group of P6 2 or P6 4 with cell dimensions, a = b = 208.7 Å and c = 282.3 Å. The Patterson function shows that the crystal exhibited a non-crystallographic two-fold axis parallel to the c-axis in the asymmetric unit.

Indexing amyloid peptide diffraction from serial femtosecond crystallography: New algorithms for sparse patterns

DOE PAGES

Brewster, Aaron S.; Sawaya, Michael R.; Rodriguez, Jose; ...

2015-01-23

Still diffraction patterns from peptide nanocrystals with small unit cells are challenging to index using conventional methods owing to the limited number of spots and the lack of crystal orientation information for individual images. New indexing algorithms have been developed as part of the Computational Crystallography Toolbox( cctbx) to overcome these challenges. Accurate unit-cell information derived from an aggregate data set from thousands of diffraction patterns can be used to determine a crystal orientation matrix for individual images with as few as five reflections. These algorithms are potentially applicable not only to amyloid peptides but also to any set ofmore » diffraction patterns with sparse properties, such as low-resolution virus structures or high-throughput screening of still images captured by raster-scanning at synchrotron sources. As a proof of concept for this technique, successful integration of X-ray free-electron laser (XFEL) data to 2.5 Å resolution for the amyloid segment GNNQQNY from the Sup35 yeast prion is presented.« less

Voxel based parallel post processor for void nucleation and growth analysis of atomistic simulations of material fracture.

PubMed

Hemani, H; Warrier, M; Sakthivel, N; Chaturvedi, S

2014-05-01

Molecular dynamics (MD) simulations are used in the study of void nucleation and growth in crystals that are subjected to tensile deformation. These simulations are run for typically several hundred thousand time steps depending on the problem. We output the atom positions at a required frequency for post processing to determine the void nucleation, growth and coalescence due to tensile deformation. The simulation volume is broken up into voxels of size equal to the unit cell size of crystal. In this paper, we present the algorithm to identify the empty unit cells (voids), their connections (void size) and dynamic changes (growth and coalescence of voids) for MD simulations of large atomic systems (multi-million atoms). We discuss the parallel algorithms that were implemented and discuss their relative applicability in terms of their speedup and scalability. We also present the results on scalability of our algorithm when it is incorporated into MD software LAMMPS. Copyright © 2014 Elsevier Inc. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beckman, D.E.

The structures of 0-0-dimethyl-0-(3,5,6-trichloro-2-pyridyl) phosphorothioate (Dowco 214) and dicarbonylbis(eta-cyclopentadienyl)-..mu..-carbonyl-..mu..-thiocarbonyldiiron have been solved by single crystal x-ray diffraction and use of a modified Patterson superposition technique that uses two multiple vectors to define a structural parallelogram. This method results in a simpler and more accurate shift vector position determination and a general improvement in map clarity. Dowco 214 crystallizes in the space group P/sub 1//sup -/ with a = 11.598(2) A, b = 13.619(3) A, c = 8.281(1) A, ..cap alpha.. = 94.65(1)/sup 0/, ..beta.. = 94.87(2)/sup 0/, ..gamma.. = 79.97(2)/sup 0/ and four molecules per cell (two per asymmetric unit).more » A CNDO II calculation was performed and partial charge densities assigned. The molecule contains distances between positively charged centers that correspond well to the reported anionic-esteratic distance (a possible reaction variable) in AChE. Additional reaction variables are discussed. Cp/sub 2/Fe/sub 2/(CO)/sub 3/CS crystallizes in the space group P2/sub 1//c with a = 14.508(8) A, b = 13.618(5) A, c = 15.193(7) A, ..beta.. = 110.50(6)/sup 0/ and eight molecules per unit cell (two per asymmetric unit). The compound contains both a carbonyl and thiocarbonyl bridge and ..pi..-bonded cyclopentadienyl rings that are cis to one another. The iron--iron bond length is intermediate to that of its carbonyl and thiocarbonyl analogs.« less

Cloning, overexpression, purification and preliminary X-ray analysis of a feast/famine regulatory protein (Rv2779c) from Mycobacterium tuberculosis H37Rv.

PubMed

Dey, Abhishek; Ramachandran, Ravishankar

2014-01-01

Rv2779c from Mycobacterium tuberculosis is a feast/famine regulatory protein. This class of proteins are also known as the leucine-responsive regulatory protein/asparagine synthase C family (Lrp/AsnC) of transcriptional regulators and are known to be involved in various metabolic processes in bacteria and fungi. They contain a RAM (regulator of amino-acid metabolism) domain that is rarely found in humans and acts as the oligomerization domain. Since the oligomeric status is often linked to the particular functional role in these proteins, binding of ligands to the domain can elicit specific functional responses. Full-length Rv2779c corresponding to a molecular mass of 19.8 kDa and 179 residues was cloned and purified to homogeneity following transformation into Escherichia coli C41 (DE3) cells. Crystals were grown by vapour diffusion using the hanging-drop method. Diffraction data extending to 2.8 Å resolution were collected from a single crystal that belonged to space group P2(1)2(1)2, with unit-cell parameters a = 99.6, b = 146.0, c = 49.9 Å. Matthews coefficient (VM) calculations suggest that four molecules are present in the asymmetric unit, corresponding to a solvent content of ∼46%. Molecular-replacement calculations using the crystal structure of a homologue, Rv3291c, as the search model gave an unambiguous solution corresponding to four subunits in the asymmetric unit.

Production, crystallization and preliminary X-ray diffraction of the Gαs α-helical domain in complex with a nanobody.

PubMed

Triest, Sarah; Wohlkönig, Alexandre; Pardon, Els; Steyaert, Jan

2014-11-01

GPCR-G-protein complexes are one of the most important components of cell-signalling cascades. Extracellular signals are sensed by membrane-associated G-protein-coupled receptors (GPCRs) and transduced via G proteins towards intracellular effector molecules. Structural studies of these transient complexes are crucial to understand the molecular details of these interactions. Although a nucleotide-free GPCR-G-protein complex is stable, it is not an ideal sample for crystallization owing to the intrinsic mobility of the Gαs α-helical domain (AHD). To stabilize GPCR-G-protein complexes in a nucleotide-free form, nanobodies were selected that target the flexible GαsAHD. One of these nanobodies, CA9177, was co-crystallized with the GαsAHD. Initial crystals were obtained using the sitting-drop method in a sparse-matrix screen and further optimized. The crystals diffracted to 1.59 Å resolution and belonged to the monoclinic space group P2₁, with unit-cell parameters a=44.07, b=52.55, c=52.66 Å, α=90.00, β=107.89, γ=90.00°. The structure of this specific nanobody reveals its binding epitope on GαsAHD and will help to determine whether this nanobody could be used as crystallization chaperone for GPCR-G-protein complexes.

Phormidium phycoerythrin forms hexamers in crystals: a crystallographic study

PubMed Central

Sonani, Ravi Raghav; Sharma, Mahima; Gupta, Gagan Deep; Kumar, Vinay; Madamwar, Datta

2015-01-01

The crystallographic analysis of a marine cyanobacterium (Phormidium sp. A09DM) phycoerythrin (PE) that shows distinct sequence features compared with known PE structures from cyanobacteria and red algae is reported. Phormidium PE was crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant. Diffraction data were collected on the protein crystallography beamline at the Indus-2 synchrotron. The crystals diffracted to about 2.1 Å resolution at 100 K. The crystals, with an apparent hexagonal morphology, belonged to space group P1, with unit-cell parameters a = 108.3, b = 108.4 Å, c = 116.6 Å, α = 78.94, β = 82.50, γ = 60.34°. The molecular-replacement solution confirmed the presence of 12 αβ monomers in the P1 cell. The Phormidium PE elutes as an (αβ)3 trimer of αβ monomers from a molecular-sieve column and exists as [(αβ)3]2 hexamers in the crystal lattice. Unlike red algal PE proteins, the hexamers of Phormidium PE do not form higher-order structures in the crystals. The existence of only one characteristic visual absorption band at 564 nm suggests the presence of phycoerythrobilin chromophores, and the absence of any other types of bilins, in the Phormidium PE assembly. PMID:26249689

Antiurolithiatic Potential of Neeri against Calcium-Oxalate Stones by Crystallization Inhibition, Free Radicals Scavenging, and NRK-52E Cell Protection from Oxalate Injury.

PubMed

Goyal, Parveen Kumar; Verma, Santosh Kumar; Sharma, Anil Kumar

2017-10-01

Neeri is a well-established polyherbal formulation prescribed for renal stones by the physicians but has not been experimentally evaluated for its antiurolithiatic potential using cell-lines. This study is aimed to scientifically substantiate the antiurolithiatic effect of Neeri extract (NRE) through calcium oxalate (CaOx) crystallization inhibition, scavenging of free radicals, and protection of renal tubular epithelial NRK-52E cells from oxalate-induced injury. The crystallization inhibition was studied by turbidimetric assay while the free radical scavenging potential was determined for superoxide and nitric oxide (NO) radicals. The cytoprotective effect against oxalate-induced injury was assessed by estimating lactate dehydrogenase (LDH) leakage and determining cell viability using 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. NRE significantly inhibited the CaOx crystallization in a concentration-dependent manner and also scavenged superoxide (IC 50 302.88 μg/ml) and NO (IC 50 300.45 μg/ml) free radicals. It did not show any significant cytotoxicity for NRK-52E cells till the highest dose (500 μg/ml) and found to be safe. When NRK-52E cells, injured by exposing to oxalate crystals for 24 h, were treated with NRE, it appreciably prevented the cell injury in a dose-dependent manner. It significantly decreased the elevated LDH leakage toward normal range and improved renal cell viability (82.37% ± 0.87%), hence, prevented growth and retention of crystals. The experimental findings concluded that Neeri is a potent antiurolithiatic formulation that inhibited CaOx crystallization and prevented tubular retention of crystals by protecting the renal cells against oxalate-induced injury as well as reducing the oxidative stress by scavenging free radicals. Neeri extract significantly ( P < 0.001) inhibited the in vitro crystallization (88.11% ± 7.70%) of calcium oxalateIt reduced oxidative stress by scavenging superoxide and nitric oxide free radicalsIt significantly ( P < 0.001) improved the cell viability by inhibiting the leakage of lactate dehydrogenase in a dose-dependent manner. Abbreviations used: A c : Absorbance of control, A t : Absorbance of test, ANOVA: Analysis of variance, CaOx: Calcium oxalate, DMEM: Dulbecco's Modified Eagle's Medium, DMSO: Dimethyl sulfoxide, EDTA: Ethylenediaminetetraacetic acid, FBS: Fetal bovine serum, INT: Iodonitrotetrazolium, LDH: Lactate dehydrogenase, M: Molar, ml: Milliliter, mM: Millimolar, MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, NAD: Nicotinamide adenine dinucleotide, NADPH: Nicotinamide adenine dinucleotide phosphate, NBT: Nitro blue tetrazolium, nm: Nanometer, NO: Nitric oxide, NRE: Neeri extract, PMS: Phenazine methosulfate, ROS: Reactive oxygen species, S c : Slope of the graph of control, SEM: Standard error of mean, S i : Slope of the graph with inhibitor, U/I: International unit, mg: Microgram, ml: Microliter.

Use of variations in unit cell length, reflectance and hardness for determining the origin of Fe disulphides in sedimentary rocks

NASA Astrophysics Data System (ADS)

Dill, H. G.; Eberhard, E.; Hartmann, B.

1997-01-01

Fe disulphides are common opaque accessories in sedimentary rocks. Both marcasite and pyrite may shed some light on the depositional environment and help determine the diagenesis of their host rocks. Quantitative ore microscopy (reflectance measurements, Vickers hardness numbers) and X-ray diffraction methods, supplemented with scanning electron microscopy and chemical analyses, were applied to pyrite (and some marcasite) hosted by sedimentary rocks spanning the interval from the Devonian to the Pliocene, and formed in various marine and continental environments. Quantitative ore microscopy of pyrites of sedimentary origin does not seem to be an efficient tool for analyzing the environment owing to the inhomogeneous nature of sulphide aggregates when viewed under the ore microscope, and the variable amounts of minor elements (e.g., As, Ni, and Co) that control the reflectance values (RV) and Vickers hardness numbers (VHN) of the host sulphides. However, such parameters as crystal habit and unit cell length of pyrite, which correlate with FeS x, are useful for environmental analysis. The redox conditions and the presence of organic remains during formation are the main factors determining these crystallographic parameters. Differences in these parameters from those of pure, ideal FeS 2 can be related to substitution of, e.g., wustite in the pyrite lattice, reflecting moderate oxidation (i.e. in the microenvironment). As far as crystal habit and length of the cell edge are concerned, late stage diagenesis is obviously less important than the microenvironment attending initial formation. The environment of deposition (i.e. the macroenvironment) of pyrite-bearing rocks has no influence on the crystal morphology or the length of the unit cell of Fe disulphide. X-ray diffraction measurements demonstrate that this method provides useful evidence on the microenvironment of sulphide precipitation around a single, equant pyrite, as well as around pyritized fossils.

Synthesis, Structure, and Rigid Unit Mode-like Anisotropic Thermal Expansion of BaIr 2 In 9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calta, Nicholas P.; Han, Fei; Kanatzidis, Mercouri G.

2015-09-08

This Article reports the synthesis of large single crystals of BaIr 2In 9 using In flux and their characterization by variable-temperature single-crystal and synchrotron powder X-ray diffraction, resistivity, and magnetization measurements. The title compound adopts the BaFe 2Al 9-type structure in the space group P6/mmm with room temperature unit cell parameters a = 8.8548(6) angstrom and c = 4.2696(4) A. BaIr 2In 9 exhibits anisotropic thermal expansion behavior with linear expansion along the c axis more than 3 times larger than expansion in the ab plane between 90 and 400 K. This anisotropic expansion originates from a rigid unit mode-likemore » mechanism similar to the mechanism of zero and negative thermal expansion observed in many anomalous thermal expansion materials such as ZrW 2O 8 and ScF 3.« less

Synthesis, Structure, and Rigid Unit Mode-like Anisotropic Thermal Expansion of BaIr2In9.

PubMed

Calta, Nicholas P; Han, Fei; Kanatzidis, Mercouri G

2015-09-08

This Article reports the synthesis of large single crystals of BaIr2In9 using In flux and their characterization by variable-temperature single-crystal and synchrotron powder X-ray diffraction, resistivity, and magnetization measurements. The title compound adopts the BaFe2Al9-type structure in the space group P6/mmm with room temperature unit cell parameters a = 8.8548(6) Å and c = 4.2696(4) Å. BaIr2In9 exhibits anisotropic thermal expansion behavior with linear expansion along the c axis more than 3 times larger than expansion in the ab plane between 90 and 400 K. This anisotropic expansion originates from a rigid unit mode-like mechanism similar to the mechanism of zero and negative thermal expansion observed in many anomalous thermal expansion materials such as ZrW2O8 and ScF3.

Crystal structures of the diastereomeric salt pair of the prostaglandin intermediate 1 R, 2 S(+)- cis-2-hydroxycyclopent-4-enylacetic acid with S- and R- 1-phenylethylamine

NASA Astrophysics Data System (ADS)

Czugler, Mátyás; Csöregh, Ingeborg; Kálmán, Alajos; Faigl, Ferenc; Ács, Mária

1989-05-01

Crystal structures of an enantiomeric salt pair formed between 1 R,2 S- cis-2-hydroxycyclopent-4-enylacetic acid ( S-HCA) and R(+)-1-phenylethylamine ( R-PEA) and the corresponding S-PEA salt have been determined by X-ray crystallography. The S-HCA: R-PEA 1:1 salt ( R-HCA-PEA hereafter) is orthorhombic, P2 12 12 1, with the unit-cell parameters a = 5.806(1), b = 9.261(1), c = 27.624(2) Å and R = 0.056 for 1162 reflections at ambient temperature. The S-HCA: S-PEA 1:1 salt ( S-HCAPEA) is also orthorhombic, P2 12 12 1, with the unit-cell data a = 6.034(2), b = 11.840(7), c = 20.198(11) Å at 170 K, R = 0.082 for 1196 data measured at low temperatures (170 K). The R-HCAPEA salt has its two components assembled into an elongated rod-like shape via two-dimensional hydrogen bonding between cations and anions thus forming a well-ordered crystal. In contrast, the cation and anion in the S-HCAPEA salt forms a more globular aggregate and displays orientation disorder in the five-membered ring part of the anion and maintains an essentially one-dimensional hydrogen-bond network, while the total number of hydrogen bonds between cationic and anionic species remains three in both crystals.

Preparation of (Ga1−xZnx)(N1−xOx) Photocatalysts from the Reaction of NH3 with Ga2O3/ZnO and ZnGa2O4: In Situ Time-Resolved XRD and XAFS Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, H.; Wen , W; Wang, Q

Hibiscus chlorotic ringspot virus (HCRSV) is a positive-sense monopartite single-stranded RNA virus that belongs to the Carmovirus genus of the Tombusviridae family, which includes carnation mottle virus (CarMV). The HCRSV virion has a 30 nm diameter icosahedral capsid with T = 3 quasi-symmetry containing 180 copies of a 38 kDa coat protein (CP) and encapsidates a full-length 3.9 kb genomic RNA. Authentic virus was harvested from infected host kenaf leaves and was purified by saturated ammonium sulfate precipitation, sucrose density-gradient centrifugation and anion-exchange chromatography. Virus crystals were grown in multiple conditions; one of the crystals diffracted to 3.2 A resolutionmore » Ad allowed the collection of a partial data set. The crystal belonged to space group R32, with unit-cell parameters a = b = 336.4, c = 798.5 A. Packing considerations and rotation-function analysis determined that there were three particles per unit cell, all of which have the same orientation and fixed positions, and resulted in tenfold noncrystallography symmetry for real-space averaging. The crystals used for the structure determination of southern bean mosaic virus (SBMV) have nearly identical characteristics. Together, these findings will greatly aid the high-resolution structure determination of HCRSV.« less

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

PubMed Central

Balasubramanian, Anuradha; Ponnuraj, Karthe

2008-01-01

Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized and the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å. PMID:18607103

Description of the atomic disorder (local order) in crystals by the mixed-symmetry method

NASA Astrophysics Data System (ADS)

Dudka, A. P.; Novikova, N. E.

2017-11-01

An approach to the description of local atomic disorder (short-range order) in single crystals by the mixed-symmetry method based on Bragg scattering data is proposed, and the corresponding software is developed. In defect-containing crystals, each atom in the unit cell can be described by its own symmetry space group. The expression for the calculated structural factor includes summation over different sets of symmetry operations for different atoms. To facilitate the search for new symmetry elements, an "atomic disorder expert" was developed, which estimates the significance of tested models. It is shown that the symmetry lowering for some atoms correlates with the existence of phase transitions (in langasite family crystals) and the anisotropy of physical properties (in rare-earth dodecaborides RB12).

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

Crystallization and preliminary X-ray diffraction analysis of a novel Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murakami, Mário T.; Center for Applied Toxinology, CAT-CEPID, São Paulo, SP; Advanced Center for Genomics and Proteomics, UNESP-State University of São Paulo, São José do Rio Preto 15054-000

2007-07-01

A single crystal of zhaoermiatoxin with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å. Zhaoermiatoxin, an Arg49 phospholipase A{sub 2} homologue from Zhaoermia mangshanensis (formerly Trimeresurus mangshanensis, Ermia mangshanensis) venom is a novel member of the PLA{sub 2}-homologue family that possesses an arginine residue at position 49, probably arising from a secondary Lys49→Arg substitution that does notmore » alter the catalytic inactivity towards phospholipids. Like other Lys49 PLA{sub 2} homologues, zhaoermiatoxin induces oedema and strong myonecrosis without detectable PLA{sub 2} catalytic activity. A single crystal with maximum dimensions of 0.2 × 0.2 × 0.5 mm was used for X-ray diffraction data collection to a resolution of 2.05 Å using synchrotron radiation and the diffraction pattern was indexed in the hexagonal space group P6{sub 4}, with unit-cell parameters a = 72.9, b = 72.9, c = 93.9 Å.« less

Crystallization of the Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae

PubMed Central

Casutt, Marco S.; Wendelspiess, Severin; Steuber, Julia; Fritz, Günter

2010-01-01

The Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from the human pathogen Vibrio cholerae couples the exergonic oxidation of NADH by membrane-bound quinone to Na+ translocation across the membrane. Na+-NQR consists of six different subunits (NqrA–NqrF) and contains a [2Fe–2S] cluster, a noncovalently bound FAD, a noncovalently bound riboflavin, two covalently bound FMNs and potentially Q8 as cofactors. Initial crystallization of the entire Na+-NQR complex was achieved by the sitting-drop method using a nanolitre dispenser. Optimization of the crystallization conditions yielded flat yellow-coloured crystals with dimensions of up to 200 × 80 × 20 µm. The crystals diffracted to 4.0 Å resolution and belonged to space group P21, with unit-cell parameters a = 94, b = 146, c = 105 Å, α = γ = 90, β = 111°. PMID:21139223

Crystallization and preliminary X-ray diffraction study of recombinant ribokinase from Thermus Species 2.9

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abramchik, Yu. A.; Timofeev, V. I., E-mail: tostars@mail.ru; Muravieva, T. I.

2016-11-15

Ribokinase from a thermophilic strain of Thermus species 2.9 belonging to the carbohydrate ribokinase family (EC 2.7.1.15) was isolated, purified, and crystallized. The crystallization conditions were found by the vapor-diffusion technique and were then optimized to apply the capillary counter-diffusion technique. The X-ray diffraction data set was collected from the crystals, which were grown by the counter-diffusion technique, at the SPring-8 synchrotron radiation facility to 2.87 Å resolution. The crystals belong to sp. gr. P12{sub 1}1 and have the following unit-cell parameters: a = 81.613 Å, b = 156.132 Å, c = 87.714 Å, α = γ = 90°, βmore » = 103.819°. The X-ray diffraction data set is suitable for determining the three-dimensional structure of the protein by the molecular-replacement method.« less

Purification, crystallization and preliminary X-ray analysis of urease from pigeon pea (Cajanus cajan)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balasubramanian, Anuradha; Ponnuraj, Karthe, E-mail: pkarthe@hotmail.com

Urease from pigeon pea was purified and crystallized and X-ray diffraction data were collected at 2.5 Å resolution. Urease is a seed protein that is common to most Leguminosae. It also occurs in many bacteria, fungi and several species of yeast. Urease catalyzes the hydrolysis of urea to ammonia and carbon dioxide, thus allowing organisms to use exogenous and internally generated urea as a nitrogen source. Urease from pigeon pea seeds has been purified to electrophoretic homogeneity using a series of steps involving ammonium sulfate fractionation, acid precipitation, ion-exchange and size-exclusion chromatography techniques. The pigeon pea urease was crystallized andmore » the resulting crystals diffracted to 2.5 Å resolution. The crystals belong to the rhombohedral space group R32, with unit-cell parameters a = b = 176.29, c = 346.44 Å.« less

Single crystal growth of the Er2PdSi3 intermetallic compound

NASA Astrophysics Data System (ADS)

Mazilu, I.; Frontzek, M.; Löser, W.; Behr, G.; Teresiak, A.; Schultz, L.

2005-02-01

Single crystals of the Er2PdSi3 intermetallic compound melting congruently at 1648 ∘C, were grown by a floating zone method with radiation heating. The control of oxygen content was the key factor to avoid oxide precipitates, which can affect effective grain selection in the crystal growth process. Crystals grown at velocities of 5 mm/h with a preferred direction close to (1 0 0) with inclination angles of about 12 ∘ against the rod axis show very distinct facets at the rod surface. The crystals are Pd-depleted and Si-rich with respect to the nominal Er2PdSi3 stoichiometry, but exhibit inferior element segregation. Measurements on oriented single crystalline samples revealed antiferromagnetic ordering below 7 K, a magnetic easy axis parallel to the (0 0 1) axis of the AlB2-type hexagonal unit cell, and anisotropic electric properties.

Imperfection and radiation damage in protein crystals studied with coherent radiation

PubMed Central

Nave, Colin; Sutton, Geoff; Evans, Gwyndaf; Owen, Robin; Rau, Christoph; Robinson, Ian; Stuart, David Ian

2016-01-01

Fringes and speckles occur within diffraction spots when a crystal is illuminated with coherent radiation during X-ray diffraction. The additional information in these features provides insight into the imperfections in the crystal at the sub-micrometre scale. In addition, these features can provide more accurate intensity measurements (e.g. by model-based profile fitting), detwinning (by distinguishing the various components), phasing (by exploiting sampling of the molecular transform) and refinement (by distinguishing regions with different unit-cell parameters). In order to exploit these potential benefits, the features due to coherent diffraction have to be recorded and any change due to radiation damage properly modelled. Initial results from recording coherent diffraction at cryotemperatures from polyhedrin crystals of approximately 2 µm in size are described. These measurements allowed information about the type of crystal imperfections to be obtained at the sub-micrometre level, together with the changes due to radiation damage. PMID:26698068

Purification, crystallization and preliminary x-ray crystallographic studies of RAIDD Death-Domain (DD).

PubMed

Jang, Tae-ho; Park, Hyun Ho

2009-06-03

Caspase-2 activation by formation of PIDDosome is critical for genotoxic stress induced apoptosis. PIDDosome is composed of three proteins, RAIDD, PIDD, and Caspase-2. RAIDD is an adaptor protein containing an N-terminal Caspase-Recruiting-Domain (CARD) and a C-terminal Death-Domain (DD). Its interactions with Caspase-2 and PIDD through CARD and DD respectively and formation of PIDDosome are important for the activation of Caspase-2. RAIDD DD cloned into pET26b vector was expressed in E. coli cells and purified by nickel affinity chromatography and gel filtration. Although it has been known that the most DDs are not soluble in physiological condition, RAIDD DD was soluble and interacts tightly with PIDD DD in physiological condition. The purified RAIDD DD alone has been crystallized. Crystals are trigonal and belong to space group P3(1)21 (or its enantiomorph P3(2)21) with unit-cell parameters a = 56.3, b = 56.3, c = 64.9 A and gamma = 120 degrees . The crystals were obtained at room temperature and diffracted to 2.0 A resolution.

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

Crystallization and preliminary X-ray diffraction studies of the lipopolysaccharide core biosynthetic enzyme ADP-L-glycero-D-mannoheptose 6-epimerase from Escherichia coli K-12.

PubMed

Ding, L; Zhang, Y; Deacon, A M; Ealick, S E; Ni, Y; Sun, P; Coleman, W G

1999-03-01

ADP-L-glycero-D-mannoheptose 6-epimerase is a 240 kDa NAD-dependent nucleotide diphosphosugar epimerase from Escherichia coli K12 which catalyzes the interconversion of ADP-D-glycero-D-mannoheptose and ADP-L-glycero-D-mannoheptose. ADP-L-glycero-D-mannoheptose is a required intermediate for lipopolysaccharide inner-core and outer-membrane biosynthesis in several genera of pathogenic and non-pathogenic Gram-negative bacteria. ADP-L-glycero-D-mannoheptose 6-epimerase was overexpressed in E. coli and purified to apparent homogeneity by chromatographic methods. Three crystal forms of the epimerase were obtained by a hanging-drop vapor-diffusion method. A native data set for crystal form III was collected in-house on a Rigaku R-AXIS-IIC image plate at 3.0 A resolution. The form III crystals belong to the monoclinic space group P21. The unit-cell parameters are a = 98.94, b = 110.53, c = 180.68 A and beta = 90.94 degrees. Our recent results show that these crystals diffract to 2.0 A resolution at the Cornell High Energy Synchrotron Source. The crystal probably contains six 40 kDa monomers per asymmetric unit, with a corresponding volume per protein mass (Vm) of 4.11 A3 Da-1 and a solvent fraction of 70%.

Expression, purification and crystallization of Trypanosoma cruzi dihydroorotate dehydrogenase complexed with orotate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Inaoka, Daniel Ken; Takashima, Eizo; Osanai, Arihiro

2005-10-01

The Trypanosoma cruzi dihydroorotate dehydrogenase, a key enzyme in pyrimidine de novo biosynthesis and redox homeostasis, was crystallized in complex with its first reaction product, orotate. Dihydroorotate dehydrogenase (DHOD) catalyzes the oxidation of dihydroorotate to orotate, the fourth step and the only redox reaction in the de novo biosynthesis of pyrimidine. DHOD from Trypanosoma cruzi (TcDHOD) has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. Crystals of the TcDHOD–orotate complex were grown at 277 K by the sitting-drop vapour-diffusion technique using polyethylene glycol 3350 as a precipitant. The crystals diffract to better than 1.8 Åmore » resolution using synchrotron radiation (λ = 0.900 Å). X-ray diffraction data were collected at 100 K and processed to 1.9 Å resolution with 98.2% completeness and an overall R{sub merge} of 7.8%. The TcDHOD crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 67.87, b = 71.89, c = 123.27 Å. The presence of two molecules in the asymmetric unit (2 × 34 kDa) gives a crystal volume per protein weight (V{sub M}) of 2.2 Å{sup 3} Da{sup −1} and a solvent content of 44%.« less

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain

PubMed Central

Rodamilans, Bernardo; Montoya, Guillermo

2007-01-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P21, with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 Å, α = γ = 90, β = 101.02°, and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 Å using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS). PMID:17401195

Expression, purification, crystallization and preliminary X-ray diffraction analysis of the DDX3 RNA helicase domain.

PubMed

Rodamilans, Bernardo; Montoya, Guillermo

2007-04-01

DDX3 is a human RNA helicase that is involved in RNA processing and important human diseases. This enzyme belongs to the DEAD-box protein family, the members of which are characterized by the presence of nine conserved motifs including the Asp-Glu-Ala-Asp motif that defines the family. DDX3 has two distinct domains: an ATP-binding domain in the central region of the protein and a helicase domain in the carboxy-terminal region. The helicase domain of DDX3 was cloned and overexpressed in Escherichia coli. Crystallization experiments yielded crystals that were suitable for X-ray diffraction analysis. The final crystallization conditions were a reservoir solution consisting of 2 M ammonium sulfate, 0.1 M imidazole pH 6.4 plus 5 mM spermine tetrahydrochloride and a protein solution containing 10 mM HEPES, 500 mM ammonium sulfate pH 8.0. The crystals of the helicase domain belong to the monoclinic space group P2(1), with unit-cell parameters a = 43.85, b = 60.72, c = 88.39 A, alpha = gamma = 90, beta = 101.02 degrees , and contained three molecules per asymmetric unit. These crystals diffracted to a resolution limit of 2.2 A using synchrotron radiation at the European Synchrotron Radiation Facility (ESRF) and the Swiss Light Source (SLS).

Preparation, crystal structure and thermal decomposition kinetics of 1-(2,4-dinitrophenyl)azo-1-nitrocyclohexane

NASA Astrophysics Data System (ADS)

Yang, Desuo; Ma, Haixia; Hu, Rongzu; Song, Jirong; Zhao, Fengqi

2005-11-01

A new three-nitro-group compound of 1-(2,4-dinitrophenyl)azo-1-nitrocyclohexane was prepared by the reaction of cyclohexanone-2,4-dinitrophenylhydrazine with nitric oxide at ambient temperature. The single crystal structure has been determined by a four-circle X-ray diffractometer. The compound is monoclinic with space group P2(1)/ c and unit-cell parameters a=11.300(2) Å, b=12.993(2) Å, c=10.155(1) Å, β=98.33(1) o, F(000)=672, the unit-cell volume V=1475.2(5) Å 3, the molecule number in one unit-cell Z=4, the absorption coefficient μ=1.19 cm -1, the calculated density Dc=1.456 g cm -3. The exothermic decomposition reaction kinetics of the compound has been studied by DSC. The kinetic model function in differential form, apparent activation energy and pre-exponential constant of this reaction are (3/4)(1-α)[-ln(1-α)] 1/4, 123.88 kJ mol -1 and 10 11.49 s -1, respectively. The critical temperature of thermal explosion of the title compound is 161.15 oC and the entropy of activation (ΔS), enthalpy of activation (ΔH), and free energy of activation (ΔG) are -34.16 J mol -1 K -1, 115.7, and 130.48 kJ mol -1, respectively.

AFM Studies of Salt Concentration Effects on the (110) Surface Structure of Tetragonal Lysozyme Crystals

NASA Technical Reports Server (NTRS)

Pusey, Marc Lee; Gorti, Sridhar; Forsythe, Elizabeth; Konnert, John

2002-01-01

Previous high resolution AFM studies of the (110) surface of tetragonal chicken egg white lysozyme crystals had shown that only one of two possible molecular surfaces is present, those constituting the completed 43 helices. These suggested that the crystal growth process was by the solution-phase assembly of the growth units, which then attach to the surface. However, the best fit for the imaged surfaces, vs. those predicted based upon the bulk crystallographic coordinates, were obtained when the packing about the 43 helices was "tightened up", while maintaining the underlying crystallographic unit cell spacing. This results in a widening of the gap between adjacent helices, and the top- most layer(s) may no longer be in contact. We postulated that the tightened packing about the helices is a result of the high salt concentrations in the bulk solution, used to crystallize the protein, driving hydrophobic interactions. Once the crystal surface is sufficiently buried by subsequent growth layers the ratio of salt to protein molecules decreases and the helices relax to their bulk crystallographic coordinates. The crystal surface helix structure is thus a reflection of the solution structure, and the tightness of the packing about the 43 helices would be a function of the bulk salt concentration. AFM images of the (110) surface of tetragonal lysozyme crystals grown under low (2%) and high (5%) NaCl concentrations reveal differences in the packing about the 43 helices consistent with the above proposal.

Optimization of crystals from nanodrops: crystallization and preliminary crystallographic study of a pheromone-binding protein from the honeybee Apis mellifera L.

PubMed

Lartigue, Audrey; Gruez, Arnaud; Briand, Loïc; Pernollet, Jean-Claude; Spinelli, Silvia; Tegoni, Mariella; Cambillau, Christian

2003-05-01

Pheromone-binding proteins (PBPs) are small helical proteins ( approximately 13-17 kDa) present in various sensory organs from moths and other insect species. They are involved in the transport of pheromones from the sensillar lymph to the olfactory receptors. Here, crystals of a PBP (Amel-ASP1) originating from honeybee (Apis mellifera L.) antennae and expressed as recombinant protein using the yeast Pichia pastoris are reported. Crystals of Amel-ASP1 have been obtained by the sitting-drop vapour-diffusion method using a nanodrop-dispensing robot under the following conditions: 200 nl of 40 mg ml(-1) protein solution in 10 mM Tris, 25 mM NaCl pH 8.0 was mixed with 100 nl of well solution containing 0.15 M sodium citrate, 1.5 M ammonium sulfate pH 5.5. The protein crystallizes in space group C222(1), with unit-cell parameters a = 74.8, b = 85.8, c = 50.2 A. With one molecule in the asymmetric unit, V(M) is 3.05 A(3) Da(-1) and the solvent content is 60%. A complete data set has been collected at 1.6 A resolution on beamline ID14-2 (ESRF, Grenoble). The nanodrop crystallization technique used with a novel optimization procedure made it possible to consume small amounts of protein and to obtain a unique crystal per nanodrop, suitable directly for data collection in-house or at a synchrotron-radiation source.

Crystal structure of bis­[tetra­kis­(tri­phenyl­phosphane-κP)silver(I)] (nitrilo­tri­acetato-κ4 N,O,O′,O′′)(tri­phenyl­phosphane-κP)argentate(I) with an unknown amount of methanol as solvate

PubMed Central

Noll, Julian; Korb, Marcus; Lang, Heinrich

2016-01-01

The structure of the title compound, [Ag(C18H15P)4]2[Ag(C6H6NO6)(C18H15P)], exhibits trigonal (P-3) symmetry, with a C 3 axis through all three complex ions, resulting in an asymmetric unit that contains one third of the atoms present in the formula unit. The formula unit thus contains two of the cations, one anion and disordered mol­ecules of methanol as the packing solvent. Attempts to refine the solvent model were unsuccessful, indicating uninter­pretable disorder. Thus, the SQUEEZE procedure in PLATON [Spek (2015 ▸). Acta Cryst. C71, 9–18] was applied, accounting for 670 electrons per unit cell, representing approximately 18 mol­ecules of methanol in the formula unit. The stated crystal data for M r, μ etc do not take these into account. PMID:27006796

Atomic structure of granulin determined from native nanocrystalline granulovirus using an X-ray free-electron laser

PubMed Central

Gati, Cornelius; Oberthuer, Dominik; Yefanov, Oleksandr; Stellato, Francesco; Chiu, Elaine; Yeh, Shin-Mei; Aquila, Andrew; Basu, Shibom; Bean, Richard; Beyerlein, Kenneth R.; Botha, Sabine; Boutet, Sébastien; DePonte, Daniel P.; Doak, R. Bruce; Fromme, Raimund; Galli, Lorenzo; Grotjohann, Ingo; James, Daniel R.; Kupitz, Christopher; Lomb, Lukas; Messerschmidt, Marc; Nass, Karol; Rendek, Kimberly; Shoeman, Robert L.; Wang, Dingjie; Weierstall, Uwe; White, Thomas A.; Williams, Garth J.; Zatsepin, Nadia A.; Fromme, Petra; Spence, John C. H.; Goldie, Kenneth N.; Jehle, Johannes A.; Metcalf, Peter; Barty, Anton

2017-01-01

To understand how molecules function in biological systems, new methods are required to obtain atomic resolution structures from biological material under physiological conditions. Intense femtosecond-duration pulses from X-ray free-electron lasers (XFELs) can outrun most damage processes, vastly increasing the tolerable dose before the specimen is destroyed. This in turn allows structure determination from crystals much smaller and more radiation sensitive than previously considered possible, allowing data collection from room temperature structures and avoiding structural changes due to cooling. Regardless, high-resolution structures obtained from XFEL data mostly use crystals far larger than 1 μm3 in volume, whereas the X-ray beam is often attenuated to protect the detector from damage caused by intense Bragg spots. Here, we describe the 2 Å resolution structure of native nanocrystalline granulovirus occlusion bodies (OBs) that are less than 0.016 μm3 in volume using the full power of the Linac Coherent Light Source (LCLS) and a dose up to 1.3 GGy per crystal. The crystalline shell of granulovirus OBs consists, on average, of about 9,000 unit cells, representing the smallest protein crystals to yield a high-resolution structure by X-ray crystallography to date. The XFEL structure shows little to no evidence of radiation damage and is more complete than a model determined using synchrotron data from recombinantly produced, much larger, cryocooled granulovirus granulin microcrystals. Our measurements suggest that it should be possible, under ideal experimental conditions, to obtain data from protein crystals with only 100 unit cells in volume using currently available XFELs and suggest that single-molecule imaging of individual biomolecules could almost be within reach. PMID:28202732

High pressure phase transitions in lawsonite at simultaneous high pressure and temperature: A single crystal study

NASA Astrophysics Data System (ADS)

O'Bannon, E. F., III; Vennari, C.; Beavers, C. C. G.; Williams, Q. C.

2015-12-01

Lawsonite (CaAl2Si2O7(OH)2.H2O) is a hydrous mineral with a high overall water content of ~11.5 wt.%. It is a significant carrier of water in subduction zones to depths greater than ~150 km. The structure of lawsonite has been extensively studied under room temperature, high-pressure conditions. However, simultaneous high-pressure and high-temperature experiments are scarce. We have conducted synchrotron-based simultaneous high-pressure and temperature single crystal experiments on lawsonite up to a maximum pressure of 8.4 GPa at ambient and high temperatures. We used a natural sample of lawsonite from Valley Ford, California (Sonoma County). At room pressure and temperature lawsonite crystallizes in the orthorhombic system with Cmcm symmetry. Room temperature compression indicates that lawsonite remains in the orthorhombic Cmcm space group up to ~9.0 GPa. Our 5.0 GPa crystal structure is similar to the room pressure structure, and shows almost isotropic compression of the crystallographic axes. Unit cell parameters at 5.0 GPa are a- 5.7835(10), b- 8.694(2), and c- 13.009(3). Single-crystal measurements at simultaneous high-pressure and temperature (e.g., >8.0 GPa and ~100 oC) can be indexed to a monoclinic P-centered unit cell. Interestingly, a modest temperature increase of ~100 oC appears to initiate the orthorhombic to monoclinic phase transition at ~0.6-2.4 GPa lower than room temperature compression studies have shown. There is no evidence of dehydration or H atom disorder under these conditions. This suggests that the orthorhombic to monoclinic transition could be kinetically impeded at 298 K, and that monoclinic lawsonite could be the dominant water carrier through much of the depth range of upper mantle subduction processes.

Atomic structure of granulin determined from native nanocrystalline granulovirus using an X-ray free-electron laser

DOE PAGES

Gati, Cornelius; Oberthuer, Dominik; Yefanov, Oleksandr; ...

2017-02-15

To understand how molecules function in biological systems, new methods are required to obtain atomic resolution structures from biological material under physiological conditions. Intense femtosecond-duration pulses from X-ray free-electron lasers (XFELs) can outrun most damage processes, vastly increasing the tolerable dose before the specimen is destroyed. This in turn allows structure determination from crystals much smaller and more radiation sensitive than previously considered possible, allowing data collection from room temperature structures and avoiding structural changes due to cooling. Regardless, high-resolution structures obtained from XFEL data mostly use crystals far larger than 1 μm3 in volume, whereas the X-ray beam ismore » often attenuated to protect the detector from damage caused by intense Bragg spots. Here, we describe the 2 Å resolution structure of native nanocrystalline granulovirus occlusion bodies (OBs) that are less than 0.016 μm3 in volume using the full power of the Linac Coherent Light Source (LCLS) and a dose up to 1.3 GGy per crystal. The crystalline shell of granulovirus OBs consists, on average, of about 9,000 unit cells, representing the smallest protein crystals to yield a high-resolution structure by X-ray crystallography to date. The XFEL structure shows little to no evidence of radiation damage and is more complete than a model determined using synchrotron data from recombinantly produced, much larger, cryocooled granulovirus granulin microcrystals. Furthermore, our measurements suggest that it should be possible, under ideal experimental conditions, to obtain data from protein crystals with only 100 unit cells in volume using currently available XFELs and suggest that single-molecule imaging of individual biomolecules could almost be within reach.« less

Cloning, sequencing, purification, and crystal structure of Grenache (Vitis vinifera) polyphenol oxidase.

PubMed

Virador, Victoria M; Reyes Grajeda, Juan P; Blanco-Labra, Alejandro; Mendiola-Olaya, Elizabeth; Smith, Gary M; Moreno, Abel; Whitaker, John R

2010-01-27

The full-length cDNA sequence (P93622_VITVI) of polyphenol oxidase (PPO) cDNA from grape Vitis vinifera L., cv Grenache, was found to encode a translated protein of 607 amino acids with an expected molecular weight of ca. 67 kDa and a predicted pI of 6.83. The translated amino acid sequence was 99%, identical to that of a white grape berry PPO (1) (5 out of 607 amino acid potential sequence differences). The protein was purified from Grenache grape berries by using traditional methods, and it was crystallized with ammonium acetate by the hanging-drop vapor diffusion method. The crystals were orthorhombic, space group C222(1). The structure was obtained at 2.2 A resolution using synchrotron radiation using the 39 kDa isozyme of sweet potato PPO (PDB code: 1BT1 ) as a phase donor. The basic symmetry of the cell parameters (a, b, and c and alpha, beta, and gamma) as well as in the number of asymmetric units in the unit cell of the crystals of PPO, differed between the two proteins. The structures of the two enzymes are quite similar in overall fold, the location of the helix bundles at the core, and the active site in which three histidines bind each of the two catalytic copper ions, and one of the histidines is engaged in a thioether linkage with a cysteine residue. The possibility that the formation of the Cys-His thioether linkage constitutes the activation step is proposed. No evidence of phosphorylation or glycoslyation was found in the electron density map. The mass of the crystallized protein appears to be only 38.4 kDa, and the processing that occurs in the grape berry that leads to this smaller size is discussed.

Crystallization and preliminary X-ray crystallographic analysis of an ice-binding protein (FfIBP) from Flavobacterium frigoris PS1.

PubMed

Do, Hackwon; Lee, Jun Hyuck; Lee, Sung Gu; Kim, Hak Jun

2012-07-01

Ice growth in a cold environment is fatal for polar organisms, not only because of the physical destruction of inner cell organelles but also because of the resulting chemical damage owing to processes such as osmotic shock. The properties of ice-binding proteins (IBPs), which include antifreeze proteins (AFPs), have been characterized and IBPs exhibit the ability to inhibit ice growth by binding to specific ice planes and lowering the freezing point. An ice-binding protein (FfIBP) from the Gram-negative bacterium Flavobacterium frigoris PS1, which was isolated from the Antarctic, has recently been overexpressed. Interestingly, the thermal hysteresis activity of FfIBP was approximately 2.5 K at 50 µM, which is ten times higher than that of the moderately active IBP from Arctic yeast (LeIBP). Although FfIBP closely resembles LeIBP in its amino-acid sequence, the antifreeze activity of FfIBP appears to be much greater than that of LeIBP. In an effort to understand the reason for this difference, an attempt was made to solve the crystal structure of FfIBP. Here, the crystallization and X-ray diffraction data of FfIBP are reported. FfIBP was crystallized using the hanging-drop vapour-diffusion method with 0.1 M sodium acetate pH 4.4 and 3 M sodium chloride as precipitant. A complete diffraction data set was collected to a resolution of 2.9 Å. The crystal belonged to space group P4(1)22, with unit-cell parameters a = b = 69.4, c = 178.2 Å. The asymmetric unit contained one monomer.

A preliminary neutron diffraction study of rasburicase, a recombinant urate oxidase enzyme, complexed with 8-azaxanthin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Budayova-Spano, Monika, E-mail: spano@embl-grenoble.fr; Institut Laue-Langevin, 6 Rue Jules Horowitz, BP 156, 38042 Grenoble; Bonneté, Françoise

2006-03-01

Neutron diffraction data of hydrogenated recombinant urate oxidase enzyme (Rasburicase), complexed with a purine-type inhibitor 8-azaxanthin, was collected to 2.1 Å resolution from a crystal grown in D{sub 2}O by careful control and optimization of crystallization conditions via knowledge of the phase diagram. Deuterium atoms were clearly seen in the neutron-scattering density map. Crystallization and preliminary neutron diffraction measurements of rasburicase, a recombinant urate oxidase enzyme expressed by a genetically modified Saccharomyces cerevisiae strain, complexed with a purine-type inhibitor (8-azaxanthin) are reported. Neutron Laue diffraction data were collected to 2.1 Å resolution using the LADI instrument from a crystal (grownmore » in D{sub 2}O) with volume 1.8 mm{sup 3}. The aim of this neutron diffraction study is to determine the protonation states of the inhibitor and residues within the active site. This will lead to improved comprehension of the enzymatic mechanism of this important enzyme, which is used as a protein drug to reduce toxic uric acid accumulation during chemotherapy. This paper illustrates the high quality of the neutron diffraction data collected, which are suitable for high-resolution structural analysis. In comparison with other neutron protein crystallography studies to date in which a hydrogenated protein has been used, the volume of the crystal was relatively small and yet the data still extend to high resolution. Furthermore, urate oxidase has one of the largest primitive unit-cell volumes (space group I222, unit-cell parameters a = 80, b = 96, c = 106 Å) and molecular weights (135 kDa for the homotetramer) so far successfully studied with neutrons.« less

Preliminary Work in Obtaining Site-Directed Mutants of Hen Egg White Lysozyme

NASA Technical Reports Server (NTRS)

Holmes, Leonard D.

1996-01-01

Protein crystal growth studies are recognized as a critical endeavor in the field of molecular biotechnology. The scientific applications of this field include the understanding of how enzymes function and the accumulation of accurate information of atomic structures, a key factor in the process of rational drug design. NASA has committed substantial investment and resources to the field of protein crystal growth and has conducted many microgravity protein crystal growth experiments aboard shuttle flights. Crystals grown in space tend to be larger, denser and have a more perfect habit and geometry. These improved properties gained in the microgravity environment of space result largely from the reduction of solutal convection, and the elimination of sedimentation at the growing crystal surface. Shuttle experiments have yielded many large, high quality crystals that are suitable for high resolution X-ray diffraction analysis. Examples of biologically important macromolecules which have been successfully crystallized during shuttle missions include: lysozyme, isocitrate lyase, gamma-interferon, insulin, human serum albumin and canavalin. Numerous other examples are also available. In addition to obtaining high quality crystals, investigators are also interested in learning the mechanisms by which the growth events take place. Crystallization experiments indicate that for the enzyme HEWL, measured growth rates do not follow mathematical models for 2D nucleation and dislocation-led growth of tetragonal protein crystals. As has been suggested by the laboratory of Marc L. Pusey, a possible explanation for the disagreement between observation and data is that HEWL tetraconal crystals form by aggregated units of lysozyme in supersaturated solutions. Surface measurement data was shown to fit very well with a model using an octamer unit cell as the growth unit. According to this model, the aggregation pathway and subsequent crystal growth is described by: monomer < ------ > dimer < ------- > tetramer < ------ > octamer < ------ > higher order. It is believed that multimer aggregation of lysozyme occurs by interaction at specific binding sites on the surface of the protein crystals. If the presence of discrete binding sites and the aggregation hypothesis is true, then it follows that the alteration of the binding site(s) should have significant effect on the measurements obtained during growth experiments. Site-directed mutagenesis allows the specific alteration of proteins by replacement, deletion or addition of specific amino acid residues. This report outlines the approach for this strategy and the progress made thus far toward that end.

Electrostatic energy of transfer and macrobond analyses of intermolecular interactions and hydration effects in protein crystals in a low ionic environment

NASA Astrophysics Data System (ADS)

Sugawara, Yoko; Hirano, Yuji; Yamamura, Shigefumi; Endo, Shigeru; Ootaki, Masanori; Matsumoto, Naoki; Takahashi, Takuya

2017-06-01

We developed an electrostatic energy of transfer (EET) analysis applicable to periodic boundary condition, including a nonrectangular unit cell. It was applied to monoclinic ribonuclease A crystallized with ethanol as a precipitant. Macrobond analysis was also carried out. Owing to the low ionic strength of the solvent region, atomic EET values were non-negligible even at long-distance points. Most of the molecular EET values-defined as the individual contribution of each surrounding molecule-were positive. The inclusion of the molecular EET values of hydration water molecules reduced the repulsive force, and the evaluation of hydration effects in protein crystals was found to be imperative.

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jens, Jason; Raghunathan, Kannan; Vago, Frank

2010-01-12

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.