A novel photonic crystal ring resonator configuration for add/drop filtering

NASA Astrophysics Data System (ADS)

Zhang, Juan; Liu, Hao; Ding, Yipeng; Wang, Yang

2018-07-01

A novel compact photonic crystal ring resonator (PCRR) configuration is proposed to realize high-efficiency waveguided add-drop filtering. Its wavelength selection and dropping-direction exchange functions are demonstrated numerically. The working mechanism of this nested dual-loop resonant cavity structure is analyzed in detail.

Sodium chloride crystallization from thin liquid sheets, thick layers, and sessile drops in microgravity

NASA Astrophysics Data System (ADS)

Fontana, Pietro; Pettit, Donald; Cristoforetti, Samantha

2015-10-01

Crystallization from aqueous sodium chloride solutions as thin liquid sheets, 0.2-0.7 mm thick, with two free surfaces supported by a wire frame, thick liquid layers, 4-6 mm thick, with two free surfaces supported by metal frame, and hemispherical sessile drops, 20-32 mm diameter, supported by a flat polycarbonate surface or an initially flat gelatin film, were carried out under microgravity on the International Space Station (ISS). Different crystal morphologies resulted based on the fluid geometry: tabular hoppers, hopper cubes, circular [111]-oriented crystals, and dendrites. The addition of polyethylene glycol (PEG-3350) inhibited the hopper growth resulting in flat-faced surfaces. In sessile drops, 1-4 mm tabular hopper crystals formed on the free surface and moved to the fixed contact line at the support (polycarbonate or gelatin) self-assembling into a shell. Ring formation created by sessile drop evaporation to dryness was observed but with crystals 100 times larger than particles in terrestrially formed coffee rings. No hopper pyramids formed. By choosing solution geometries offered by microgravity, we found it was possible to selectively grow crystals of preferred morphologies.

Systematic Improvement of Protein Crystals by Determining the Supersolubility Curves of Phase Diagrams

PubMed Central

Saridakis, Emmanuel; Chayen, Naomi E.

2003-01-01

A systematic approach for improving protein crystals by growing them in the metastable zone using the vapor diffusion technique is described. This is a simple technique for optimization of crystallization conditions. Screening around known conditions is performed to establish a working phase diagram for the crystallization of the protein. Dilutions of the crystallization drops across the supersolubility curve into the metastable zone are then carried out as follows: the coverslips holding the hanging drops are transferred, after being incubated for some time at conditions normally giving many small crystals, over reservoirs at concentrations which normally yield clear drops. Fewer, much larger crystals are obtained when the incubation times are optimized, compared with conventional crystallization at similar conditions. This systematic approach has led to the structure determination of the light-harvesting protein C-phycocyanin to the highest-ever resolution of 1.45 Å. PMID:12547801

Development of an automated large-scale protein-crystallization and monitoring system for high-throughput protein-structure analyses.

PubMed

Hiraki, Masahiko; Kato, Ryuichi; Nagai, Minoru; Satoh, Tadashi; Hirano, Satoshi; Ihara, Kentaro; Kudo, Norio; Nagae, Masamichi; Kobayashi, Masanori; Inoue, Michio; Uejima, Tamami; Oda, Shunichiro; Chavas, Leonard M G; Akutsu, Masato; Yamada, Yusuke; Kawasaki, Masato; Matsugaki, Naohiro; Igarashi, Noriyuki; Suzuki, Mamoru; Wakatsuki, Soichi

2006-09-01

Protein crystallization remains one of the bottlenecks in crystallographic analysis of macromolecules. An automated large-scale protein-crystallization system named PXS has been developed consisting of the following subsystems, which proceed in parallel under unified control software: dispensing precipitants and protein solutions, sealing crystallization plates, carrying robot, incubators, observation system and image-storage server. A sitting-drop crystallization plate specialized for PXS has also been designed and developed. PXS can set up 7680 drops for vapour diffusion per hour, which includes time for replenishing supplies such as disposable tips and crystallization plates. Images of the crystallization drops are automatically recorded according to a preprogrammed schedule and can be viewed by users remotely using web-based browser software. A number of protein crystals were successfully produced and several protein structures could be determined directly from crystals grown by PXS. In other cases, X-ray quality crystals were obtained by further optimization by manual screening based on the conditions found by PXS.

Model for determining vapor equilibrium rates in the hanging drop method for protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.

1987-01-01

An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented. Results are applied to 18 drop and well arrangements commonly encountered in the laboratory. The chemical nature of the salt, drop size and shape, drop concentration, well size, well concentration, and temperature are taken into account. The rate of evaporation increases with temperature, drop size, and the salt concentration difference between the drop and the well. The evaporation in this model possesses no unique half-life. Once the salt in the drop achieves 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.

[Stability of physical state on compound hawthorn dropping pills].

PubMed

Zhang, Wei; Chen, Hong-Yan; Jiang, Jian-Lan

2008-11-01

To evaluate the stability of physical state with accelerate test and dropping in process before and after on compound hawthorn dropping pills. Scanning electron microscope, TG-DTA, FT-IR and XRD were used. The active components presented amorphous, tiny crystal and molecular state in dropping pills, and it had no obvious reaction between PEG 4000 and active components. With time prolonging, a little of active components changed from amorphous state to tiny crystal or molecular state. Solid dispersion improved the stability and dissolution of compound hawthorn dropping pills.

Considerations on the moving contact-line singularity, with application to frictional drag on a slender drop

NASA Technical Reports Server (NTRS)

Durbin, P. A.

1988-01-01

It has previously been shown that the no-slip boundary conditions leads to a singularity at a moving contact line and that this presumes some form of slip. Present considerations on the energetics of slip due to shear stress lead to a yield stress boundary condition. A model for the distortion of the liquid state near solid boundaries gives a physical basis for this boundary condition. The yield stress condition is illustrated by an analysis of a slender drop rolling down an incline. That analysis provides a formula for the frictional drag resisting the drop movement. With the present boundary condition, the length of the slip region becomes a property of the fluid flow.

Evaporation kinetics in the hanging drop method of protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, James K.; Frieden, Richard W.; Meehan, E. J., Jr.; Twigg, Pamela J.; Howard, Sandra B.; Fowlis, William A.

1987-01-01

An engineering analysis of the rate of evaporation of solvent in the hanging drop method of protein crystal growth is presented; these results are applied to 18 different drop and well arrangements commonly encountered in the laboratory, taking into account the chemical nature of the salt, the drop size and shape, the drop concentration, the well size, the well concentration, and the temperature. It is found that the rate of evaporation increases with temperature, drop size, and with the salt concentration difference between the drop and the well. The evaporation possesses no unique half-life. Once the salt in the drop achieves about 80 percent of its final concentration, further evaporation suffers from the law of diminishing returns.

Tectonic plates, D (double prime) thermal structure, and the nature of mantle plumes

NASA Technical Reports Server (NTRS)

Lenardic, A.; Kaula, W. M.

1994-01-01

It is proposed that subducting tectonic plates can affect the nature of thermal mantle plumes by determining the temperature drop across a plume source layer. The temperature drop affects source layer stability and the morphology of plumes emitted from it. Numerical models are presented to demonstrate how introduction of platelike behavior in a convecting temperature dependent medium, driven by a combination of internal and basal heating, can increase the temperature drop across the lower boundary layer. The temperature drop increases dramatically following introduction of platelike behavior due to formation of a cold temperature inversion above the lower boundary layer. This thermal inversion, induced by deposition of upper boundary layer material to the system base, decays in time, but the temperature drop across the lower boundary layer always remains considerably higher than in models lacking platelike behavior. On the basis of model-inferred boundary layer temperature drops and previous studies of plume dynamics, we argue that generally accepted notions as to the nature of mantle plumes on Earth may hinge on the presence of plates. The implication for Mars and Venus, planets apparently lacking plate tectonics, is that mantle plumes of these planets may differ morphologically from those of Earth. A corollary model-based argument is that as a result of slab-induced thermal inversions above the core mantle boundary the lower most mantle may be subadiabatic, on average (in space and time), if major plate reorganization timescales are less than those acquired to diffuse newly deposited slab material.

Large charged drop levitation against gravity

NASA Technical Reports Server (NTRS)

Rhim, Won-Kyu; Chung, Sang Kun; Hyson, Michael T.; Trinh, Eugene H.; Elleman, Daniel D.

1987-01-01

A hybrid electrostatic-acoustic levitator that can levitate and manipulate a large liquid drop in one gravity is presented. To the authors' knowledge, this is the first time such large drops (up to 4 mm in diameter in the case of water) have been levitated against 1-gravity. This makes possible, for the first time, many new experiments both in space and in ground-based laboratories, such as 1)supercooling and superheating, 2) containerless crystal growth from various salt solutions or melts, 3) drop dynamics of oscillating or rotating liquid drops, 4) drop evaporation and Rayleigh bursting, and 5) containerless material processing in space. The digital control system, liquid drop launch process, principles of electrode design, and design of a multipurpose room temperature levitation chamber are described. Preliminary results that demonstrate drop oscillation and rotation, and crystal growth from supersaturated salt solutions are presented.

Hanging colloidal drop: A new photonic crystal synthesis route

NASA Astrophysics Data System (ADS)

Sandu, Ion; Dumitru, Marius; Fleaca, Claudiu Teodor; Dumitrache, Florian

2018-05-01

High-quality photonic crystals (hundreds of micrometres in thickness) were grown by the free evaporation of a colloidal drop consisting of silica and polystyrene nanospheres with dimensions of 300 nm, 500 nm, and 1000 nm. The essence of experimental findings is that the drop has to hang on a pillar. This leads to the inhibition of the droplet spreading, the minimisation of the convective force, and the zeroing of the static frictional force between nanospheres and the liquid/air interface, where the first layer is formed. The theoretical essence is the continuous adjustment of nanospheres positions during the growth of photonic crystal, a key condition of the self-assembling phenomenon.

Containerless protein crystal growth method

NASA Technical Reports Server (NTRS)

Rhim, Won-Kyu; Chung, Sang K.

1991-01-01

A method of growing protein crystals from levitated drops is introduced and unique features of containerless approach in 1-g and micro-G laboratories are discussed. Electrostatic multidrop levitation system which is capable of simultaneous four drop levitation is described. A method of controlling protein saturation level in a programmed way is introduced and discussed. Finally, some of the unique features of containerless approach of protein crystal growth in space are discussed and summarized.

Crystallization of highly supersaturated solutions - An experimental study

NASA Technical Reports Server (NTRS)

Queen, Brian; Hallett, John

1990-01-01

The crystallization of ammonium sulfate solutions under very high supersaturation is investigated. The results imply that high saturation ratios can exist at least to 30 +/- 5 and possibly higher in smaller drops. Under certain atmospheric conditions highly supersaturated drops can persist at even lower temperatures and humidities.

Ultrasmall multi-channel resonant-tunneling filter using mode gap of width-tuned photonic-crystal waveguide.

PubMed

Shinya, Akihiko; Mitsugi, Satoshi; Kuramochi, Eiichi; Notomi, Masaya

2005-05-30

We have devised an ultra-small multi-channel drop filter based on a two-port resonant tunneling system in a two-dimensional photonic crystal with a triangular air-hole lattice. This filter does not require careful consideration of the interference process to achieve a high dropping efficiency. First we develop three-port systems based on a two-port resonant tunneling filter. Next we devise a multi-port channel drop filter by cascading these three-port systems. In this paper, we demonstrate a ten-channel drop filter with an 18 mum device size by 2D-FDTD calculation, and a three-port resonant tunneling filter with 65+/- 20 % dropping efficiency by experiment.

Channel add-drop filter based on dual photonic crystal cavities in push-pull mode.

PubMed

Poulton, Christopher V; Zeng, Xiaoge; Wade, Mark T; Popović, Miloš A

2015-09-15

We demonstrate an add-drop filter based on a dual photonic crystal nanobeam cavity system that emulates the operation of a traveling wave resonator, and, thus, provides separation of the through and drop port transmission from the input port. The device is on a 3×3  mm chip fabricated in an advanced microelectronics silicon-on-insulator complementary metal-oxide semiconductor (SOI CMOS) process (IBM 45 nm SOI) without any foundry process modifications. The filter shows 1 dB of insertion loss in the drop port with a 3 dB bandwidth of 64 GHz, and 16 dB extinction in the through port. To the best of our knowledge, this is the first implementation of a port-separating, add-drop filter based on standing wave cavities coupled to conventional waveguides, and demonstrates a performance that suggests potential for photonic crystal devices within optical immersion lithography-based advanced CMOS electronics-photonics integration.

Crystal engineering: co-crystals of cinnamic acid derivatives with a pyridyl derivative co-crystallizer.

PubMed

Lorenzo, Daniel A; Forrest, Sebastian J K; Sparkes, Hazel A

2016-02-01

A number of hydrogen-bonded co-crystals, consisting of a cinnamic acid derivative and a pyridyl co-crystallizer, have been synthesized and their properties investigated by X-ray diffraction. Samples were prepared by recrystallization or solvent drop grinding of trans-cinnamic acid (1), 4-methylcinnamic acid (2), 4-methoxy cinnamic acid (3) or 3,4-methoxy cinnamic acid (4), with 4,4-dipyridyl (A), iso-nicotinamide (B) or nicotinamide (C). The X-ray single-crystal structures of seven novel co-crystals, obtained through recrystallization, are examined and the hydrogen-bonding interactions discussed. Consistent hydrogen-bonding motifs were observed for samples prepared when using 4,4-dipyridyl (A) or iso-nicotinamide (B) as the co-crystallizing agent. Powder X-ray diffraction analysis of the samples prepared by solvent drop grinding suggests the formation of ten co-crystals.

Expression, crystallization and phasing of vacuolar H(+)-ATPase subunit C (Vma5p) of Saccharomyces cerevisiae.

PubMed

Drory, Omri; Mor, Adi; Frolow, Felix; Nelson, Nathan

2004-10-01

The expression, crystallization and phasing of subunit C (Vma5p) of the yeast (Saccharomyces cerevisiae) vacuolar proton-translocating ATPase (V-ATPase) is described. The expressed protein consists of 412 residues: 392 from the reading frame of Vma5p and 20 N-terminal residues originating from the plasmid. Diffraction-quality crystals were obtained using the hanging-drop and sitting-drop vapour-diffusion methods assisted by streak-seeding, with PEG 3350 as precipitant. The crystals formed in hanging drops diffracted to 1.80 A and belong to space group P4(3)2(1)2(1), with unit-cell parameters a = b = 62.54, c = 327.37 A, alpha = beta = gamma = 90 degrees. The structure was solved using SIRAS with a Lu(O2C2H3)2 heavy-atom derivative.

Device For Controlling Crystallization Of Protein

NASA Technical Reports Server (NTRS)

Noever, David A.

1993-01-01

Variable sandwich spacer enables optimization of evaporative driving force that governs crystallization of protein from solution. Mechanically more rigid than hanging-drop and sitting-drop devices. Large oscillations and dislodgment of drop of solution in response to vibrations suppressed by glass plates. Other advantages include: suitable for automated delivery, stable handling, and programmable evaporation of protein solution; controlled configuration enables simple and accurate determination of volume of solution without disrupting crystallization; pH and concentration of precipitant controlled dynamically because pH and concentration coupled to rate of evaporation, controllable via adjustment of gap between plates; and enables variation of ratio between surface area and volume of protein solution. Alternative version, plates oriented vertically instead of horizontally.

Ultra-compact channel drop filter based on photonic crystal nanobeam cavities utilizing a resonant tunneling effect.

PubMed

Ge, Xiaochen; Shi, Yaocheng; He, Sailing

2014-12-15

The design, fabrication, and characterization of a compact photonic crystal nanobeam drop filter based on the tunneling effect of the degenerate modes are presented. The degeneracy was achieved by tuning the coupling distance between the nanobeam and input/output waveguides. The tunneling effect of degenerate resonances with different symmetries has been verified experimentally. Channel drop filters with an extinction ratio larger than 10 dB and a quality factor of ∼5000 have been experimentally demonstrated.

In situ synchrotron study of electromigration induced grain rotations in Sn solder joints

NASA Astrophysics Data System (ADS)

Shen, Hao; Zhu, Wenxin; Li, Yao; Tamura, Nobumichi; Chen, Kai

2016-04-01

Here we report an in situ study of the early stage of microstructure evolution induced by electromigration in a Pb-free β-Sn based solder joint by synchrotron polychromatic X-ray microdiffraction. With this technique, crystal orientation evolution is monitored at intragranular levels with high spatial and angular resolution. During the entire experiment, no crystal growth is detected, and rigid grain rotation is observed only in the two grains within the current crowding region, where high density and divergence of electric current occur. Theoretical calculation indicates that the trend of electrical resistance drop still holds under the present conditions in the grain with high electrical resistivity, while the other grain with low resistivity reorients to align its a-axis more parallel with the ones of its neighboring grains. A detailed study of dislocation densities and subgrain boundaries suggests that grain rotation in β-Sn, unlike grain rotation in high melting temperature metals which undergo displacive deformation, is accomplished via diffusional process mainly, due to the high homologous temperature.

Hanging drop crystal growth apparatus and method

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor); Smith, Robbie E. (Inventor)

1989-01-01

An apparatus (10) is constructed having a cylindrical enclosure (16) within which a disc-shaped wicking element (18) is positioned. A well or recess (22) is cut into an upper side (24) of this wicking element, and a glass cover plate or slip (28) having a protein drop disposed thereon is sealably positioned on the wicking element (18), with drop (12) being positioned over well or recess (22). A flow of control fluid is generated by a programmable gradient former (16), with this control fluid having a vapor pressure that is selectively variable. This flow of control fluid is coupled to the wicking element (18) where control fluid vapor diffusing from walls (26) of the recess (22) is exposed to the drop (12), forming a vapor pressure gradient between the drop (12) and the control fluid vapor. Initially, this gradient is adjusted to draw solvent from the drop (12) at a relatively high rate, and as the critical supersaturation point is approached (the point at which crystal nucleation occurs), the gradient is reduced to more slowly draw solvent from the drop (12). This allows discrete protein molecules more time to orient themselves into an ordered crystalline lattice, producing protein crystals which, when processed by X-ray crystallography, possess a high degree of resolution.

Transport phenomena in the crystallization of lysozyme by osmotic dewatering and liquid-liquid diffusion in low gravity

NASA Technical Reports Server (NTRS)

Todd, Paul; Sportiello, Michael G.; Gregory, Derek; Cassanto, John M.; Alvarado, Ulises A.; Ostroff, Robert; Korszun, Z. R.

1993-01-01

Two methods of protein crystallization, osmotic dewatering and liquid-liquid diffusion, like the vapor diffusion (hanging-drop and sessile-drop) methods allow a gradual approach to supersaturation conditions. The crystallization of hen egg-white lysozyme, an extensively characterized protein crystal, in the presence of sodium chloride was used as an experimental model with which to compare these two methods in low gravity and in the laboratory. Comparisons of crystal growth rates by the two methods under the two conditions have, to date, indicated that the rate of crystal growth by osmotic dewatering is nearly the same in low gravity and on the ground, while much faster crystal growth rates can be achieved by the liquid-liquid diffusion method in low gravity.

Diffuse-interface polycrystal plasticity: expressing grain boundaries as geometrically necessary dislocations

NASA Astrophysics Data System (ADS)

Admal, Nikhil Chandra; Po, Giacomo; Marian, Jaime

2017-12-01

The standard way of modeling plasticity in polycrystals is by using the crystal plasticity model for single crystals in each grain, and imposing suitable traction and slip boundary conditions across grain boundaries. In this fashion, the system is modeled as a collection of boundary-value problems with matching boundary conditions. In this paper, we develop a diffuse-interface crystal plasticity model for polycrystalline materials that results in a single boundary-value problem with a single crystal as the reference configuration. Using a multiplicative decomposition of the deformation gradient into lattice and plastic parts, i.e. F( X,t)= F L( X,t) F P( X,t), an initial stress-free polycrystal is constructed by imposing F L to be a piecewise constant rotation field R 0( X), and F P= R 0( X)T, thereby having F( X,0)= I, and zero elastic strain. This model serves as a precursor to higher order crystal plasticity models with grain boundary energy and evolution.

Visualization of boundary-layer development on turbomachine blades with liquid crystals

NASA Technical Reports Server (NTRS)

Vanzante, Dale E.; Okiishi, Theodore H.

1991-01-01

This report documents a study of the use of liquid crystals to visualize boundary layer development on a turbomachine blade. A turbine blade model in a linear cascade of blades was used for the tests involved. Details of the boundary layer development on the suction surface of the turbine blade model were known from previous research. Temperature sensitive and shear sensitive liquid crystals were tried as visual agents. The temperature sensitive crystals were very effective in their ability to display the location of boundary layer flow separation and reattachment. Visualization of natural transition from laminar to turbulent boundary layer flow with the temperature sensitive crystals was possible but subtle. The visualization of separated flow reattachment with the shear sensitive crystals was easily accomplished when the crystals were allowed to make a transition from the focal-conic to a Grandjean texture. Visualization of flow reattachment based on the selective reflection properties of shear sensitive crystals was achieved only marginally because of the larger surface shear stress and shear stress gradient levels required for more dramatic color differences.

Analysis of models for two solution crystal growth problems

NASA Technical Reports Server (NTRS)

Fehribach, Joseph D.; Rosenberger, Franz

1989-01-01

Two diffusive solution crystal growth models are considered which are characterized by two phases separated by an interface, a lack of convective mixing in either phase, and the presence of diffusion components differing widely in diffusivity. The first model describes precipitant-driven solution crystal growth and the second model describes a hanging drop evaporation problem. It is shown that for certain proteins sharp concentration gradients may develop in the drop during evaporation, while under the same conditions the concentrations of other proteins remain uniform.

On the relationship between tectonic plates and thermal mantle plume morphology

NASA Technical Reports Server (NTRS)

Lenardic, A.; Kaula, W. M.

1993-01-01

Models incorporating plate-like behavior, i.e., near uniform surface velocity and deformation concentrated at plate boundaries, into a convective system, heated by a mix of internal and basal heating and allowing for temperature dependent viscosity, were constructed and compared to similar models not possessing plate-like behavior. The simplified numerical models are used to explore how plate-like behavior in a convective system can effect the lower boundary layer from which thermal plumes form. A principal conclusion is that plate-like behavior can significantly increase the temperature drop across the lower thermal boundary layer. This temperature drop affects the morphology of plumes by determining the viscosity drop across the boundary layer. Model results suggest that plumes on planets possessing plate-like behavior, e.g., the Earth, may differ in morphologic type from plumes on planets not possessing plate-like behavior, e.g., Venus and Mars.

Fluorescent Approaches to High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth

2005-01-01

X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, 51%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear hits. Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.

Fluorescent Approaches to High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Minamitani, Elizabeth Forsythe; Pusey, Marc L.

2004-01-01

X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of a macromolecules purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals will show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "bits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.

Fluorescent Approaches to High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth

2004-01-01

X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically can not reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1%, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "hits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. This presentation will focus on the methodology for fluorescent labeling, the crystallization results, and the effects of the trace labeling on the crystal quality.

Self-Diffusion of Drops in a Dilute Sheared Emulsion

NASA Technical Reports Server (NTRS)

Loewenberg, Michael; Hinch, E. J.

1996-01-01

Self-diffusion coefficients that describe cross-flow migration of non-Brownian drops in a dilute sheared emulsion were obtained by trajectory calculations. A boundary integral formulation was used to describe pairwise interactions between deformable drops; interactions between undeformed drops were described with mobility functions for spherical drops. The results indicate that drops have large anisotropic self-diffusivities which depend strongly on the drop viscosity and modestly on the shear-rate. Pairwise interactions between drops in shear-flow do not appreciably promote drop breakup.

Formation of curved micrometer-sized single crystals.

PubMed

Koifman Khristosov, Maria; Kabalah-Amitai, Lee; Burghammer, Manfred; Katsman, Alex; Pokroy, Boaz

2014-05-27

Crystals in nature often demonstrate curved morphologies rather than classical faceted surfaces. Inspired by biogenic curved single crystals, we demonstrate that gold single crystals exhibiting curved surfaces can be grown with no need of any fabrication steps. These single crystals grow from the confined volume of a droplet of a eutectic composition melt that forms via the dewetting of nanometric thin films. We can control their curvature by controlling the environment in which the process is carried out, including several parameters, such as the contact angle and the curvature of the drops, by changing the surface tension of the liquid drop during crystal growth. Here we present an energetic model that explains this phenomenon and predicts why and under what conditions crystals will be forced to grow with the curvature of the microdroplet even though the energetic state of a curved single crystal is very high.

Fluorescent Approaches to High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth; Achari, Aniruddha

2006-01-01

We have shown that by covalently modifying a subpopulation, less than or equal to 1%, of a macromolecule with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification, and the presence of the probe at low concentrations does not affect the X-ray data quality or the crystallization behavior. The presence of the trace fluorescent label gives a number of advantages when used with high throughput crystallizations. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination crystals show up as bright objects against a dark background. Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Brightly fluorescent crystals are readily found against less bright precipitated phases, which under white light illumination may obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries as the protein or protein structures is all that shows up. Fluorescence intensity is a faster search parameter, whether visually or by automated methods, than looking for crystalline features. We are now testing the use of high fluorescence intensity regions, in the absence of clear crystalline features or "hits", as a means for determining potential lead conditions. A working hypothesis is that kinetics leading to non-structured phases may overwhelm and trap more slowly formed ordered assemblies, which subsequently show up as regions of brighter fluorescence intensity. Preliminary experiments with test proteins have resulted in the extraction of a number of crystallization conditions from screening outcomes based solely on the presence of bright fluorescent regions. Subsequent experiments will test this approach using a wider range of proteins. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons.

Corner wetting during the vapor-liquid-solid growth of faceted nanowires

NASA Astrophysics Data System (ADS)

Spencer, Brian; Davis, Stephen

2016-11-01

We consider the corner wetting of liquid drops in the context of vapor-liquid-solid growth of nanowires. Specifically, we construct numerical solutions for the equilibrium shape of a liquid drop on top of a faceted nanowire by solving the Laplace-Young equation with a free boundary determined by mixed boundary conditions. A key result for nanowire growth is that for a range of contact angles there is no equilibrium drop shape that completely wets the corner of the faceted nanowire. Based on our numerical solutions we determine the scaling behavior for the singular surface behavior near corners of the nanowire in terms of the Young contact angle and drop volume.

Grain Boundaries Act as Solid Walls for Charge Carrier Diffusion in Large Crystal MAPI Thin Films.

PubMed

Ciesielski, Richard; Schäfer, Frank; Hartmann, Nicolai F; Giesbrecht, Nadja; Bein, Thomas; Docampo, Pablo; Hartschuh, Achim

2018-03-07

Micro- and nanocrystalline methylammonium lead iodide (MAPI)-based thin-film solar cells today reach power conversion efficiencies of over 20%. We investigate the impact of grain boundaries on charge carrier transport in large crystal MAPI thin films using time-resolved photoluminescence (PL) microscopy and numerical model calculations. Crystal sizes in the range of several tens of micrometers allow for the spatially and time resolved study of boundary effects. Whereas long-ranged diffusive charge carrier transport is observed within single crystals, no detectable diffusive transport occurs across grain boundaries. The observed PL transients are found to crucially depend on the microscopic geometry of the crystal and the point of observation. In particular, spatially restricted diffusion of charge carriers leads to slower PL decay near crystal edges as compared to the crystal center. In contrast to many reports in the literature, our experimental results show no quenching or additional loss channels due to grain boundaries for the studied material, which thus do not negatively affect the performance of the derived thin-film devices.

LCP crystallization and X-ray diffraction analysis of VcmN, a MATE transporter from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kusakizako, Tsukasa; Tanaka, Yoshiki; Hipolito, Christopher J.

A V. cholerae MATE transporter was crystallized using the lipidic cubic phase (LCP) method. X-ray diffraction data sets were collected from single crystals obtained in a sandwich plate and a sitting-drop plate to resolutions of 2.5 and 2.2 Å, respectively. Multidrug and toxic compound extrusion (MATE) transporters, one of the multidrug exporter families, efflux xenobiotics towards the extracellular side of the membrane. Since MATE transporters expressed in bacterial pathogens contribute to multidrug resistance, they are important therapeutic targets. Here, a MATE-transporter homologue from Vibrio cholerae, VcmN, was overexpressed in Escherichia coli, purified and crystallized in lipidic cubic phase (LCP). X-raymore » diffraction data were collected to 2.5 Å resolution from a single crystal obtained in a sandwich plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 52.3, b = 93.7, c = 100.2 Å. As a result of further LCP crystallization trials, crystals of larger size were obtained using sitting-drop plates. X-ray diffraction data were collected to 2.2 Å resolution from a single crystal obtained in a sitting-drop plate. The crystal belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.9, b = 91.8, c = 100.9 Å. The present work provides valuable insights into the atomic resolution structure determination of membrane transporters.« less

On the Relationship of the Fractal Dimension of Structure with the State of Drying Drops of Crystallizing Solutions (Thermodynamic and Experimental Modeling)

NASA Astrophysics Data System (ADS)

Golovanova, O. A.; Chikanova, E. S.; Fedoseev, V. B.

2018-05-01

The processes occurring in aqueous salt solutions have been investigated based on thermodynamic and experimental modeling. The self-organization in a drying drop of dehydrated liquids is analyzed using the fractal theory, due to which the quantitative characteristics of the crystallization processes in a small volume are obtained.

A highly accurate boundary integral equation method for surfactant-laden drops in 3D

NASA Astrophysics Data System (ADS)

Sorgentone, Chiara; Tornberg, Anna-Karin

2018-05-01

The presence of surfactants alters the dynamics of viscous drops immersed in an ambient viscous fluid. This is specifically true at small scales, such as in applications of droplet based microfluidics, where the interface dynamics become of increased importance. At such small scales, viscous forces dominate and inertial effects are often negligible. Considering Stokes flow, a numerical method based on a boundary integral formulation is presented for simulating 3D drops covered by an insoluble surfactant. The method is able to simulate drops with different viscosities and close interactions, automatically controlling the time step size and maintaining high accuracy also when substantial drop deformation appears. To achieve this, the drop surfaces as well as the surfactant concentration on each surface are represented by spherical harmonics expansions. A novel reparameterization method is introduced to ensure a high-quality representation of the drops also under deformation, specialized quadrature methods for singular and nearly singular integrals that appear in the formulation are evoked and the adaptive time stepping scheme for the coupled drop and surfactant evolution is designed with a preconditioned implicit treatment of the surfactant diffusion.

Fluorescent Approaches to High Throughput Crystallography

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth; Achari, Amiruddha

2005-01-01

X-ray crystallography remains the primary method for determining the structure of macromolecules. The first requirement is to have crystals, and obtaining them is often the rate-limiting step. The numbers of crystallization trials that are set up for any one protein for structural genomics, and the rate at which they are being set up, now overwhelm the ability for strictly human analysis of the results. Automated analysis methods are now being implemented with varying degrees of success, but these typically cannot reliably extract intermediate results. By covalently modifying a subpopulation, less than or = 1 %, of a macromolecule solution with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination the crystals show up as bright objects against a dark background. As crystalline packing is more dense than amorphous precipitate, the fluorescence intensity can be used as a guide in distinguishing different types of precipitated phases, even in the absence of obvious crystalline features, widening the available potential lead conditions in the absence of clear "hits." Non-protein structures, such as salt crystals, will not incorporate the probe and will not show up under fluorescent illumination. Also, brightly fluorescent crystals are readily found against less fluorescent precipitated phases, which under white light illumination may serve to obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries and by having the protein or protein structures all that show up. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons. Preliminary experiments show that the presence of the fluorescent probe does not affect the nucleation process or the quality of the X-ray data obtained.

Fluorescent Applications to Crystallization

NASA Technical Reports Server (NTRS)

Pusey, Marc L.; Forsythe, Elizabeth; Achari, Aniruddha

2006-01-01

By covalently modifying a subpopulation, less than or equal to 1%, of a macromolecule with a fluorescent probe, the labeled material will add to a growing crystal as a microheterogeneous growth unit. Labeling procedures can be readily incorporated into the final stages of purification, and tests with model proteins have shown that labeling u to 5 percent of the protein molecules does not affect the X-ray data quality obtained . The presence of the trace fluorescent label gives a number of advantages. Since the label is covalently attached to the protein molecules, it "tracks" the protein s response to the crystallization conditions. The covalently attached probe will concentrate in the crystal relative to the solution, and under fluorescent illumination crystals show up as bright objects against a darker background. Non-protein structures, such as salt crystals, do not show up under fluorescent illumination. Crystals have the highest protein concentration and are readily observed against less bright precipitated phases, which under white light illumination may obscure the crystals. Automated image analysis to find crystals should be greatly facilitated, without having to first define crystallization drop boundaries as the protein or protein structures is all that shows up. Fluorescence intensity is a faster search parameter, whether visually or by automated methods, than looking for crystalline features. Preliminary tests, using model proteins, indicates that we can use high fluorescence intensity regions, in the absence of clear crystalline features or "hits", as a means for determining potential lead conditions. A working hypothesis is that more rapid amorphous precipitation kinetics may overwhelm and trap more slowly formed ordered assemblies, which subsequently show up as regions of brighter fluorescence intensity. Experiments are now being carried out to test this approach using a wider range, of proteins. The trace fluorescently labeled crystals will also emit with sufficient intensity to aid in the automation of crystal alignment using relatively low cost optics, further increasing throughput at synchrotrons.

The possible equilibrium shapes of static pendant drops

NASA Astrophysics Data System (ADS)

Sumesh, P. T.; Govindarajan, Rama

2010-10-01

Analytical and numerical studies are carried out on the shapes of two-dimensional and axisymmetric pendant drops hanging under gravity from a solid surface. Drop shapes with both pinned and equilibrium contact angles are obtained naturally from a single boundary condition in the analytical energy optimization procedure. The numerical procedure also yields optimum energy shapes, satisfying Young's equation without the explicit imposition of a boundary condition at the plate. It is shown analytically that a static pendant two-dimensional drop can never be longer than 3.42 times the capillary length. A related finding is that a range of existing solutions for long two-dimensional drops correspond to unphysical drop shapes. Therefore, two-dimensional drops of small volume display only one static solution. In contrast, it is known that axisymmetric drops can display multiple solutions for a given volume. We demonstrate numerically that there is no limit to the height of multiple-lobed Kelvin drops, but the total volume is finite, with the volume of successive lobes forming a convergent series. The stability of such drops is in question, though. Drops of small volume can attain large heights. A bifurcation is found within the one-parameter space of Laplacian shapes, with a range of longer drops displaying a minimum in energy in the investigated space. Axisymmetric Kelvin drops exhibit an infinite number of bifurcations.

Crystallization and preliminary X-ray analysis of Streptococcus mutans dextran glucosidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saburi, Wataru; Hondoh, Hironori, E-mail: hondoh@abs.agr.hokudai.ac.jp; Unno, Hideaki

2007-09-01

Dextran glucosidase from S. mutans was crystallized using the hanging-drop vapour-diffusion method. The crystals diffracted to 2.2 Å resolution. Dextran glucosidase from Streptococcus mutans is an exo-hydrolase that acts on the nonreducing terminal α-1,6-glucosidic linkage of oligosaccharides and dextran with a high degree of transglucosylation. Based on amino-acid sequence similarity, this enzyme is classified into glycoside hydrolase family 13. Recombinant dextran glucosidase was purified and crystallized by the hanging-drop vapour-diffusion technique using polyethylene glycol 6000 as a precipitant. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 72.72, b = 86.47, cmore » = 104.30 Å. A native data set was collected to 2.2 Å resolution from a single crystal.« less

Room-temperature serial crystallography using a kinetically optimized microfluidic device for protein crystallization and on-chip X-ray diffraction

PubMed Central

Heymann, Michael; Opthalage, Achini; Wierman, Jennifer L.; Akella, Sathish; Szebenyi, Doletha M. E.; Gruner, Sol M.; Fraden, Seth

2014-01-01

An emulsion-based serial crystallographic technology has been developed, in which nanolitre-sized droplets of protein solution are encapsulated in oil and stabilized by surfactant. Once the first crystal in a drop is nucleated, the small volume generates a negative feedback mechanism that lowers the supersaturation. This mechanism is exploited to produce one crystal per drop. Diffraction data are measured, one crystal at a time, from a series of room-temperature crystals stored on an X-ray semi-transparent microfluidic chip, and a 93% complete data set is obtained by merging single diffraction frames taken from different unoriented crystals. As proof of concept, the structure of glucose isomerase was solved to 2.1 Å, demonstrating the feasibility of high-throughput serial X-ray crystallography using synchrotron radiation. PMID:25295176

Phase-field study of grain boundary tracking behavior in crack-seal microstructures

NASA Astrophysics Data System (ADS)

Ankit, Kumar; Nestler, Britta; Selzer, Michael; Reichardt, Mathias

2013-12-01

In order to address the growth of crystals in veins, a multiphase-field model is used to capture the dynamics of crystals precipitating from a super-saturated solution. To gain a detailed understanding of the polycrystal growth phenomena in veins, we investigate the influence of various boundary conditions on crystal growth. In particular, we analyze the formation of vein microstructures resulting from the free growth of crystals as well as crack-sealing processes. We define the crystal symmetry by considering the anisotropy in surface energy to simulate crystals with flat facets and sharp corners. The resulting growth competition of crystals with different orientations is studied to deduce a consistent orientation selection rule in the free-growth regime. Using crack-sealing simulations, we correlate the grain boundary tracking behavior depending on the relative rate of crack opening, opening trajectory, initial grain size, and wall roughness. Further, we illustrate how these parameters induce the microstructural transition between blocky (crystals growing anisotropically) to fibrous morphology (isotropic) and formation of grain boundaries. The phase-field simulations of crystals in the free-growth regime (in 2D and 3D) indicate that the growth or consumption of a crystal is dependent on the orientation difference with neighboring crystals. The crack-sealing simulation results (in 2D and 3D) reveal that crystals grow isotropically and grain boundaries track the opening trajectory if the wall roughness is high, opening increments are small, and crystals touch the wall before the next crack increment starts. Further, we find that within the complete crack-seal regime, anisotropy in surface energy results in the formation of curved/oscillating grain boundaries (instead of straight) when the crack-opening velocity is increased and wall roughness is not sufficiently high. Additionally, the overall capability of phase-field method to simulate large-scale polycrystal growth in veins (in 3D) is demonstrated enumerating the main advantages of adopting the novel approach.

Expression, purification and crystallization of a human protein SH3BGRL at atomic resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yin, Lei; Zhu, De-Yu; Yang, Na

2005-04-01

The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The protein SH3BGRL, containing both SH3-binding and Homer EVH1-binding motifs, has been crystallized using the hanging-drop vapour-diffusion method. The crystals diffract to 0.88 Å resolution and belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 28.8886, b = 34.9676, c = 98.0016 Å. Preliminary analysis indicates that the asymmetric unit contains one molecule and has a solvent content of about 34%.

Crystallization and initial X-ray analysis of polyhydroxyalkanoate granule-associated protein from Aeromonas hydrophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Minglian; Li, Zhenguo; Zheng, Wei

The phasin PhaP{sub Ah} from A. hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Polyhydroxyalkanoate (PHA) granule-associated proteins (phasins) were discovered in PHA-accumulating bacteria. They play a crucial role as a structural protein during initial PHA-granule formation and granule growth and also serve as interfaces for granule stabilization in vivo. The phasin PhaP{sub Ah} from Aeromonas hydrophila strain 4AK4 was crystallized using the hanging-drop vapour-diffusion method. Single crystals were cryocooled for X-ray diffraction analysis. The phasin crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 80.8, b = 108.9, c = 134.4 Å.

Design of a micromachined terahertz electromagnetic crystals (EMXT) channel-drop filter on silicon-substrate

NASA Astrophysics Data System (ADS)

Zhou, Kai; Liu, Yong; Si, Liming; Lv, Xin

2013-08-01

An integrated 0.5 THz electromagnetic crystals(EMXT) channel-drop filter based on PBG structure is presented in this paper. A channel-drop filter is a device in which a narrow bandwidth is redirected to another "drop" waveguide while other frequencies are unaffected. It's capable of extracting a certain frequency from a continuous spectrum in the bus channel and passing it to the test channel. It has potential applications in photonic integrated circuits, radio astronomy, THz spectroscopy, THz communication and remote sensing radar receiver. PBG structures(or photonic crystals) are periodic structures which possess band gaps, where the electromagnetic wave of certain ranges of frequencies cannot pass through and is reflected. The proposed channel-drop filter consists of input waveguide,output waveguide and PBG structure. The proposed filter is simulated using the finite element method and can be fabricated by micro-electromechanical systems (MEMS) technology,due to its low cost, high performance and high processing precision.The filter operation principle and fabrication process are discussed.The simulation results show its ability to filter the frequency of 496GHz with a linewidth of approximately 4GHz and transmission of 27.2 dB above background.The loss at resonant frequency is less than 1dB considering the thickness and roughness of gold layer required by the MEMS process.The channel drop efficiency is 84%.

STS-73 Flight Day 5

NASA Technical Reports Server (NTRS)

1995-01-01

On this fifth day of the STS-73 sixteen day mission, the crew Cmdr. Kenneth Bowersox, Pilot Kent Rominger, Payload Specialists Albert Sacco and Fred Leslie, and Mission Specialists Kathryn Thornton, Catherine 'Cady' Coleman, and Michael Lopez-Alegria are shown performing several of the spaceborne experiments onboard the United States Microgravity Lab-2 (USML-2). These experiments are downlinked to Mission Control from the Spacelab using the High-Packed Digital Television (HI-PAC) systems onboard the Shuttle. The experiments shown include the Drop Physics Module (DPM) experiment, the Surface Tension Driven Convection Experiment (STDCE), the Protein Crystal Growth (PCG) experiment, and a Hand-Held Diffusion Test Cell experiment. Lopez-Alegria is interviewed in Spanish by two Spanish radio show hosts. Earth views include cloud cover, the Earth's horizon and atmospheric boundary layers, and several oceans.

Two Beam Energy Exchange in Hybrid Liquid Crystal Cells with Photorefractive Field Controlled Boundary Conditions (Postprint)

DTIC Science & Technology

2016-09-12

AFRL-RX-WP-JA-2017-0209 TWO BEAM ENERGY EXCHANGE IN HYBRID LIQUID CRYSTAL CELLS WITH PHOTOREFRACTIVE FIELD CONTROLLED BOUNDARY...estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the... CRYSTAL CELLS WITH PHOTOREFRACTIVE FIELD CONTROLLED BOUNDARY CONDITIONS (POSTPRINT) 5a. CONTRACT NUMBER FA8650-16-D-5402-0001 5b. GRANT

In situ synchrotron study of electromigration induced grain rotations in Sn solder joints

DOE PAGES

Shen, Hao; Zhu, Wenxin; Li, Yao; ...

2016-04-18

In this paper we report an in situ study of the early stage of microstructure evolution induced by electromigration in a Pb-free β-Sn based solder joint by synchrotron polychromatic X-ray microdiffraction. With this technique, crystal orientation evolution is monitored at intragranular levels with high spatial and angular resolution. During the entire experiment, no crystal growth is detected, and rigid grain rotation is observed only in the two grains within the current crowding region, where high density and divergence of electric current occur. Theoretical calculation indicates that the trend of electrical resistance drop still holds under the present conditions in themore » grain with high electrical resistivity, while the other grain with low resistivity reorients to align its a-axis more parallel with the ones of its neighboring grains. A detailed study of dislocation densities and subgrain boundaries suggests that grain rotation in β-Sn, unlike grain rotation in high melting temperature metals which undergo displacive deformation, is accomplished via diffusional process mainly, due to the high homologous temperature.« less

A deformable surface model for real-time water drop animation.

PubMed

Zhang, Yizhong; Wang, Huamin; Wang, Shuai; Tong, Yiying; Zhou, Kun

2012-08-01

A water drop behaves differently from a large water body because of its strong viscosity and surface tension under the small scale. Surface tension causes the motion of a water drop to be largely determined by its boundary surface. Meanwhile, viscosity makes the interior of a water drop less relevant to its motion, as the smooth velocity field can be well approximated by an interpolation of the velocity on the boundary. Consequently, we propose a fast deformable surface model to realistically animate water drops and their flowing behaviors on solid surfaces. Our system efficiently simulates water drop motions in a Lagrangian fashion, by reducing 3D fluid dynamics over the whole liquid volume to a deformable surface model. In each time step, the model uses an implicit mean curvature flow operator to produce surface tension effects, a contact angle operator to change droplet shapes on solid surfaces, and a set of mesh connectivity updates to handle topological changes and improve mesh quality over time. Our numerical experiments demonstrate a variety of physically plausible water drop phenomena at a real-time rate, including capillary waves when water drops collide, pinch-off of water jets, and droplets flowing over solid materials. The whole system performs orders-of-magnitude faster than existing simulation approaches that generate comparable water drop effects.

Crystallization and preliminary X-ray diffraction analysis of the lectin from Dioclea rostrata Benth seeds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Delatorre, Plínio; Departamento de Ciências Biológicas, Universidade Regional do Cariri, Crato, CE 63195-000; Nascimento, Kyria Santiago

2006-02-01

D. rostrata lectin was crystallized by hanging-drop vapor diffusion. The crystal belongs to the orthorhombic space group I222 and diffracted to 1.87 Å resolution. Lectins from the Diocleinae subtribe (Leguminosae) are highly similar proteins that promote various biological activities with distinctly differing potencies. The structural basis for this experimental data is not yet fully understood. Dioclea rostrata lectin was purified and crystallized by hanging-drop vapour diffusion at 293 K. The crystal belongs to the orthorhombic space group I222, with unit-cell parameters a = 61.51, b = 88.22, c = 87.76 Å. Assuming the presence of one monomer per asymmetric unit,more » the solvent content was estimated to be about 47.9%. A complete data set was collected at 1.87 Å resolution.« less

Optical Add-Drop Filters Based on Photonic Crystal Ring Resonators

DTIC Science & Technology

2007-02-19

34 Appl. Phys. Lett. 81,2499-2501 (2002). 17. V. Dinesh Kumar , T. Srinivas, A. Selvarajan, "Investigation of ring resonators in photonic crystal...No.4 / opncs EXPRESS 1824 Kumar et al. [17], where a large single quasi-rectangular ring was introduced as the frequency selective dropping elements...were introduced by Kumar et al. as well, in order to suppress the counter propagating modes which can cause spurious dips in the transmission spectrum

A morphological screening of protein crystals for interferon delivery by metal ion-chelate technology.

PubMed

Jiang, Yanbo; Shi, Kai; Wang, Shuo; Li, Xuefeng; Cui, Fude

2010-12-01

This study presents a preliminary exploration on extending the half-life of therapeutic proteins by crystallization strategy without new molecular entities generation. Recombinant human interferon (rhIFN) α-2b, a model protein drug in this case, was crystallized using a hanging-drop vapor diffusion method. A novel chelating technique with metal ions was employed to promote crystals formation. The effects of key factors such as seeding protein concentration, pH of the hanging drop, ionic strength of the equilibration solution, and precipitants were investigated. Size-exclusion liquid chromatography, antiviral activity determination, and enzyme-linked immunosorbent assay indicated that both the molecular integrity and biological potency of rhIFN were not significantly affected by crystallization process. In addition, the in vitro release behavior of rhIFN from crystal lattice was characterized by an initial fast release, followed by a sustained release up to 48 hour. The work described here suggested an exciting possibility of therapeutic protein crystals as a long-acting formulation.

Bloch wave deafness and modal conversion at a phononic crystal boundary

NASA Astrophysics Data System (ADS)

Laude, Vincent; Moiseyenko, Rayisa P.; Benchabane, Sarah; Declercq, Nico F.

2011-12-01

We investigate modal conversion at the boundary between a homogeneous incident medium and a phononic crystal, with consideration of the impact of symmetry on the excitation of Bloch waves. We give a quantitative criterion for the appearance of deaf Bloch waves, which are antisymmetric with respect to a symmetry axis of the phononic crystal, in the frame of generalized Fresnel formulas for reflection and transmission at the phononic crystal boundary. This criterion is used to index Bloch waves in the complex band structure of the phononic crystal, for directions of incidence along a symmetry axis. We argue that within deaf frequency ranges transmission is multi-exponential, as it is within frequency band gaps.

Fabrication of single crystal architecture in Sb-S-I glass: Transition from dot to line

DOE PAGES

Savytskii, Dmytro; Dierolf, Volkmar; Tamura, Nobumichi; ...

2017-12-08

We have investigated the occurrence of the sometimes observed grain boundaries, as initial seed is extended to form line in laser-fabricated single-crystal architecture in glass (SCAG). In particular, for Sb 2S 3 SCAG in Sb-S-I glass as a model system, grain boundaries are formed during the transition from laser-written initial seed dot to crystal line. Such grain boundaries during the growth of Sb 2S 3 crystals occur in 16SbI 3-84Sb 2S 3glass, whereas they are absent in Sb 2S 3 glass. We correlate this difference in tendency to form multiple grains with the relative glass forming ability i.e. the dynamicsmore » of nucleation and crystal growth as determined by differential scanning calorimetry (DSC). On the basis of this understanding, methods to minimize the appearance of grain boundaries in the transition region are suggested.« less

Fabrication of single crystal architecture in Sb-S-I glass: Transition from dot to line

DOE Office of Scientific and Technical Information (OSTI.GOV)

Savytskii, Dmytro; Dierolf, Volkmar; Tamura, Nobumichi

We have investigated the occurrence of the sometimes observed grain boundaries, as initial seed is extended to form line in laser-fabricated single-crystal architecture in glass (SCAG). In particular, for Sb 2S 3 SCAG in Sb-S-I glass as a model system, grain boundaries are formed during the transition from laser-written initial seed dot to crystal line. Such grain boundaries during the growth of Sb 2S 3 crystals occur in 16SbI 3-84Sb 2S 3glass, whereas they are absent in Sb 2S 3 glass. We correlate this difference in tendency to form multiple grains with the relative glass forming ability i.e. the dynamicsmore » of nucleation and crystal growth as determined by differential scanning calorimetry (DSC). On the basis of this understanding, methods to minimize the appearance of grain boundaries in the transition region are suggested.« less

Size-Dependent Grain-Boundary Structure with Improved Conductive and Mechanical Stabilities in Sub-10-nm Gold Crystals

NASA Astrophysics Data System (ADS)

Wang, Chunyang; Du, Kui; Song, Kepeng; Ye, Xinglong; Qi, Lu; He, Suyun; Tang, Daiming; Lu, Ning; Jin, Haijun; Li, Feng; Ye, Hengqiang

2018-05-01

Low-angle grain boundaries generally exist in the form of dislocation arrays, while high-angle grain boundaries (misorientation angle >15 ° ) exist in the form of structural units in bulk metals. Here, through in situ atomic resolution aberration corrected electron microscopy observations, we report size-dependent grain-boundary structures improving both stabilities of electrical conductivity and mechanical properties in sub-10-nm-sized gold crystals. With the diameter of a nanocrystal decreasing below 10 nm, the high-angle grain boundary in the crystal exists as an array of dislocations. This size effect may be of importance to a new generation of interconnects applications.

Containerless protein crystal growth technology: Electrostatic multidrop positioner

NASA Technical Reports Server (NTRS)

Rhim, Won-Kyu

1990-01-01

A brief discussion of containerless protein crystal growth in space and a diagram of the electrostatic multidrop positioner are presented. A picture of lysome crystals growing in a drop and a graph of levitation voltage versus time (minutes) are also presented.

Laser scattering in a hanging drop vapor diffusion apparatus for protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Casay, G. A.; Wilson, W. W.

1992-01-01

One type of hardware used to grow protein crystals in the microgravity environment aboard the U.S. Space Shuttle is a hanging drop vapor diffusion apparatus (HDVDA). In order to optimize crystal growth conditions, dynamic control of the HDVDA is desirable. A critical component in the dynamically controlled system is a detector for protein nucleation. We have constructed a laser scattering detector for the HDVDA capable of detecting the nucleation stage. The detector was successfully tested for several scatterers differing in size using dynamic light scattering techniques. In addition, the ability to detect protein nucleation using the HDVDA was demonstrated for lysozyme.

A Fiber Optic Probe for Monitoring Protein Aggregation, Nucleation, and Crystallization

NASA Technical Reports Server (NTRS)

Ansari, Rafat R.; Suh, Kwang I.; Arabshahi, Alireza; Wilson, William W.; Bray, Terry L.; DeLucas, Lawrence J.

1996-01-01

Protein crystals are experimentally grown in hanging drops in microgravity experiments on-board the Space Shuttle orbiter. The technique of dynamic light scattering (DLS) can be used to monitor crystal growth process in hanging droplets (approx. 30 (L)) in microgravity experiments, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. In this paper we demonstrate that such experiments are now feasible. We apply a newly developed fiber optic probe to various earth and space (micro- gravity) bound protein crystallization system configurations to test its capability. These include conventional batch (cuvette or capillary) systems, hanging drop method in a six-pack hanging drop vapor diffusion apparatus (HDVDA), a modified HDVDA for temperature- induced nucleation and aggregation studies, and a newly envisioned dynamically controlled vapor diffusion system (DCVDS) configuration. Our compact system exploits the principles of DLS and offers a fast (within a few seconds) means of quantitatively and non-invasively monitoring the various growth stages of protein crystallization. In addition to DLS capability, the probe can also be used for performing single-angle static light scattering measurements. It utilizes extremely low levels of laser power (approx. few (W)) without a need of having any optical alignment and vibration isolation. The compact probe is also equipped with a miniaturized microscope for visualization of macroscopic protein crystals. This new optical diagnostic system opens up enormous opportunity for exploring new ways to grow good quality crystals suitable for x-ray crystallographic analysis and may help develop a concrete scientific basis for understanding the process of crystallization.

1×3 optical drop splitter in a rod-type silicon photonic crystal

NASA Astrophysics Data System (ADS)

Zhuang, Dongxia; Chen, Xiyao; Li, Junjun; Lin, Guimin; Qiang, Zexuan; Qiu, Yishen; Li, Hui

2011-12-01

We report an 1×3 optical drop splitter (ODS) based on a self-collimation ring resonator (SCRR) in a rod-type silicon photonic crystal. The proposed 1×3 ODS consists of four beam splitters which are formed by changing the radius of one row of silicon rods. When the self-collimated light with resonance frequency is launched into the ODS, the light beam can be split into three parts come out from three drop ports while no light coming out from the through port. The splitting ratio of the three drop beams can be controlled by tuning the radii of the beam splitters. The FDTD method is employed to calculate the transmission of the 1×3 ODS. For the drop wavelength of 1550 nm, the free spectral range is 28.7 nm, which almost covers the whole optical communication C-band window. This 1×3 ODS may have applications in photonic integrated circuits.

Aerosol partitioning in natural mixed-phase clouds

NASA Astrophysics Data System (ADS)

Henning, S.; Bojinski, S.; Diehl, K.; Ghan, S.; Nyeki, S.; Weingartner, E.; Wurzler, S.; Baltensperger, U.

2004-03-01

In situ aerosol and cloud drop microphysical measurements at a high-alpine site are used to investigate aerosol partitioning between cloud and interstitial phases in natural, mid-latitude, mixed-phase clouds. Measurements indicate a decrease in the activated aerosol fraction (FN) for particle diameters dP > 100 nm with cloud temperature from FN ~ 0.54 in summer liquid-phase clouds to FN ~ 0.08 in winter mixed-phase clouds. The latter may be attributed to the Bergeron-Findeisen mechanism whereby ice crystals grow at the expense of liquid water drops, releasing formerly activated aerosols back into the interstitial phase. This provides a means to distinguish the indirect effects of aerosols on drops and ice crystals.

Crystallization and preliminary crystallographic analysis of recombinant immunoglobulin G-binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan, Abdul Hamid; Chu, Fuliang; Feng, Youjun

2008-08-01

Crystallization of recombinant IgG-binding protein expressed in Escherichia coli using the hanging-drop vapour-diffusion method is described. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c = 78.17 Å. Streptococcus suis, an important zoonotic pathogen, expresses immunoglobulin G-binding protein, which is thought to be helpful to the organism in eluding the host defence system. Recombinant IgG-binding protein expressed in Escherichia coli has been crystallized using the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 38.98, b = 43.94, c =more » 78.17 Å and one molecule in the asymmetric unit. Diffraction data were collected to 2.60 Å resolution.« less

Crystallization and preliminary crystallographic studies of the Pasteurella multocida toxin catalytic domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyazawa, Masayuki; Kitadokoro, Kengo; Kamitani, Shigeki

2006-09-01

The C-terminal catalytic domain of P. multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. The C-terminal catalytic domain of Pasteurella multocida toxin, which is the virulence factor of the organism in P. multocida, has been expressed, purified and subsequently crystallized using the sitting-drop vapour-diffusion technique. Native diffraction data to 1.9 Å resolution were obtained at the BL44XU beamline of SPring-8 from a flash-frozen crystal at 100 K. The crystals belong to space group C2, with unit-cell parameters a = 111.0, b = 150.4,more » c = 77.1 Å, β = 105.5°, and are likely to contain one C-PMT (726 residues) per asymmetric unit.« less

Preparation, crystallization and preliminary crystallographic analysis of old yellow enzyme from Trypanosoma cruzi

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugiyama, Shigeru; Tokuoka, Keiji; Uchiyama, Nahoko

2007-10-01

Old yellow enzyme from Trypanosoma cruzi, has been crystallized using the hanging-drop vapour-diffusion method. Old yellow enzyme (OYE) is an NADPH oxidoreductase that contains a flavin mononucleotide as a prosthetic group. The OYE from Trypanosoma cruzi, which produces prostaglandin F{sub 2α}, a potent mediator of various physiological and pathological processes, from prostaglandin H2. The protein was recombinantly expressed and purified from Escherichia coli and was crystallized using the hanging-drop vapour-diffusion method. The crystal belongs to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 56.3, b = 78.8, c = 78.8 Å, β = 93.4° and two moleculesmore » per asymmetric unit. The crystals were suitable for X-ray crystallographic studies and diffracted to 1.70 Å resolution. A Patterson search method is in progress using the structure of OYE from Pseudomonas putida as a starting model.« less

Crystallization in a model glass: Influence of the boundary conditions

NASA Astrophysics Data System (ADS)

Jund, P.; Jullien, R.

1998-06-01

Using molecular dynamics calculations and the Voronoï tessellation, we study the evolution of the local structure of a soft-sphere glass vs. temperature starting from the liquid phase at different quenching rates. This study is done for different sizes and for two different boundary conditions, namely the usual cubic periodic boundary conditions and the isotropic hyperspherical boundary conditions for which the particles evolve on the surface of a hypersphere in four dimensions. Our results show that for small system sizes, crystallization can indeed be induced by the cubic boundary conditions. On the other hand, we show that finite-size effects are more pronounced on the hypersphere and that crystallization is artificially inhibited even for large system sizes.

Investigation of 2D photonic crystal structure based channel drop filter using quad shaped photonic crystal ring resonator for CWDM system

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com; Dusad, Lalit Kumar; Rajasthan Technical University, Kota, Rajasthan

In this paper, the design & performance of two dimensional (2-D) photonic crystal structure based channel drop filter is investigated using quad shaped photonic crystal ring resonator. In this paper, Photonic Crystal (PhC) based on square lattice periodic arrays of Gallium Indium Phosphide (GaInP) rods in air structure have been investigated using Finite Difference Time Domain (FDTD) method and photonic band gap is being calculated using Plane Wave Expansion (PWE) method. The PhC designs have been optimized for telecommunication wavelength λ= 1571 nm by varying the rods lattice constant. The number of rods in Z and X directions is 21 andmore » 20, with lattice constant 0.540 nm it illustrates that the arrangement of Gallium Indium Phosphide (GaInP) rods in the structure which gives the overall size of the device around 11.4 µm × 10.8 µm. The designed filter gives good dropping efficiency using 3.298, refractive index. The designed structure is useful for CWDM systems. This device may serve as a key component in photonic integrated circuits. The device is ultra compact with the overall size around 123 µm{sup 2}.« less

Accessing Colony Boundary Strengthening of Fully Lamellar TiAl Alloys via Micromechanical Modeling

PubMed Central

Bargmann, Swantje

2017-01-01

In this article, we present a strategy to decouple the relative influences of colony, domain and lamella boundary strengthening in fully lamellar titanium aluminide alloys, using a physics-based crystal plasticity modeling strategy. While lamella and domain boundary strengthening can be isolated in experiments using polysynthetically twinned crystals or mircomechanical testing, colony boundary strengthening can only be investigated in specimens in which all three strengthening mechanisms act simultaneously. Thus, isolating the colony boundary strengthening Hall–Petch coefficient KC experimentally requires a sufficient number of specimens with different colony sizes λC but constant lamella thickness λL and domain size λD, difficult to produce even with sophisticated alloying techniques. The here presented crystal plasticity model enables identification of the colony boundary strengthening coefficient KC as a function of lamella thickness λL. The constitutive description is based on the model of a polysynthetically twinned crystal which is adopted to a representative volume element of a fully lamellar microstructure. In order to capture the micro yield and subsequent micro hardening in weakly oriented colonies prior to macroscopic yield, the hardening relations of the adopted model are revised and calibrated against experiments with polysynthetically twinned crystals for plastic strains up to 15%. PMID:28771218

Accessing Colony Boundary Strengthening of Fully Lamellar TiAl Alloys via Micromechanical Modeling.

PubMed

Schnabel, Jan Eike; Bargmann, Swantje

2017-08-03

In this article, we present a strategy to decouple the relative influences of colony, domain and lamella boundary strengthening in fully lamellar titanium aluminide alloys, using a physics-based crystal plasticity modeling strategy. While lamella and domain boundary strengthening can be isolated in experiments using polysynthetically twinned crystals or mircomechanical testing, colony boundary strengthening can only be investigated in specimens in which all three strengthening mechanisms act simultaneously. Thus, isolating the colony boundary strengthening Hall-Petch coefficient K C experimentally requires a sufficient number of specimens with different colony sizes λ C but constant lamella thickness λ L and domain size λ D , difficult to produce even with sophisticated alloying techniques. The here presented crystal plasticity model enables identification of the colony boundary strengthening coefficient K C as a function of lamella thickness λ L . The constitutive description is based on the model of a polysynthetically twinned crystal which is adopted to a representative volume element of a fully lamellar microstructure. In order to capture the micro yield and subsequent micro hardening in weakly oriented colonies prior to macroscopic yield, the hardening relations of the adopted model are revised and calibrated against experiments with polysynthetically twinned crystals for plastic strains up to 15%.

Boiling regimes of impacting drops on a heated substrate under reduced pressure

NASA Astrophysics Data System (ADS)

van Limbeek, Michiel A. J.; Hoefnagels, Paul B. J.; Shirota, Minori; Sun, Chao; Lohse, Detlef

2018-05-01

We experimentally investigate the boiling behavior of impacting ethanol drops on a heated smooth sapphire substrate at pressures ranging from P =0.13 bar to atmospheric pressure. We employ frustrated total internal reflection imaging to study the wetting dynamics of the contact between the drop and the substrate. The spreading drop can be in full contact (contact boiling), it can partially touch (transition boiling), or the drop can be fully levitated (Leidenfrost boiling). We show that the temperature of the boundary between contact and transition boiling shows at most a weak dependence on the impact velocity, but a significant decrease with decreasing ambient gas pressure. A striking correspondence is found between the temperature of this boundary and the static Leidenfrost temperature for all pressures. We therefore conclude that both phenomena share the same mechanism and are dominated by the dynamics taking place at the contact line. On the other hand, the boundary between transition boiling and Leidenfrost boiling, i.e., the dynamic Leidenfrost temperature, increases for increasing impact velocity for all ambient gas pressures. Moreover, the dynamic Leidenfrost temperature coincides for pressures between P =0.13 and 0.54 bar, whereas for atmospheric pressure the dynamic Leidenfrost temperature is slightly elevated. This indicates that the dynamic Leidenfrost temperature is at most weakly dependent on the enhanced evaporation by the lower saturation temperature of the liquid.

Interaction Between Graphene-Coated SiC Single Crystal and Liquid Copper

NASA Astrophysics Data System (ADS)

Homa, M.; Sobczak, N.; Sobczak, J. J.; Kudyba, A.; Bruzda, G.; Nowak, R.; Pietrzak, K.; Chmielewski, M.; Strupiński, W.

2018-04-01

The wettability of graphene-coated SiC single crystal (CGn/SiCsc) by liquid Cu (99.99%) was investigated by a sessile drop method in vacuum conditions at temperature of 1100 °C. The graphene layer was produced via a chemical vapor deposition routine using 4H-SiC single crystal cut out from 6″ wafer. A dispensed drop technique combined with a non-contact heating of a couple of materials was applied. The Cu drop was squeezed from a graphite capillary and deposited on the substrate directly in a vacuum chamber. The first Cu drop did not wet the CGn/SiCsc substrate and showed a lack of adhesion to the substrate: the falling Cu drop only touched the substrate forming a contact angle of θ 0 = 121° and then immediately rolled like a ball along the substrate surface. After settling near the edge of the substrate in about 0.15 s, the Cu drop formed an asymmetric shape with the right and left contact angles of different values (θ R = 86° and θ L = 70°, respectively), while in the next 30 min, θ R and θ L achieved the same final value of 52°. The second Cu drop was put down on the displacement path of the first drop, and immediately after the deposition, it also did not wet the substrate (θ = 123°). This drop kept symmetry and the primary position, but its wetting behavior was unusual: both θ R and θ L decreased in 17 min to the value of 23° and next, they increased to a final value of 65°. Visual observations revealed a presence of 2.5-mm-thick interfacial phase layer reactively formed under the second drop. Scanning electron microscopy (SEM) investigations revealed the presence of carbon-enriched precipitates on the top surface of the first Cu drop. These precipitates were identified by the Raman spectroscopy as double-layer graphene. The Raman spectrum taken from the substrate far from the drop revealed the presence of graphene, while that obtained from the first drop displacement path exhibited a decreased intensity of 2D peak. The results of SEM investigations and Raman spectroscopy studies suggest that the presence of graphene layer on the SiC substrate suppresses but does not completely prevent chemical interaction between liquid Cu drop and SiC. Both chemical degradation (etching) and mechanical degradation of the graphene layer during drop rolling due to high adhesion of the Cu drop to the SiC substrate are responsible for mass transfer through the 2nd drop/substrate interface that in turn results in significant changes of structure and chemistry of the drop and the interface.

Interaction Between Graphene-Coated SiC Single Crystal and Liquid Copper

NASA Astrophysics Data System (ADS)

Homa, M.; Sobczak, N.; Sobczak, J. J.; Kudyba, A.; Bruzda, G.; Nowak, R.; Pietrzak, K.; Chmielewski, M.; Strupiński, W.

2018-05-01

The wettability of graphene-coated SiC single crystal (CGn/SiCsc) by liquid Cu (99.99%) was investigated by a sessile drop method in vacuum conditions at temperature of 1100 °C. The graphene layer was produced via a chemical vapor deposition routine using 4H-SiC single crystal cut out from 6″ wafer. A dispensed drop technique combined with a non-contact heating of a couple of materials was applied. The Cu drop was squeezed from a graphite capillary and deposited on the substrate directly in a vacuum chamber. The first Cu drop did not wet the CGn/SiCsc substrate and showed a lack of adhesion to the substrate: the falling Cu drop only touched the substrate forming a contact angle of θ 0 = 121° and then immediately rolled like a ball along the substrate surface. After settling near the edge of the substrate in about 0.15 s, the Cu drop formed an asymmetric shape with the right and left contact angles of different values ( θ R = 86° and θ L = 70°, respectively), while in the next 30 min, θ R and θ L achieved the same final value of 52°. The second Cu drop was put down on the displacement path of the first drop, and immediately after the deposition, it also did not wet the substrate ( θ = 123°). This drop kept symmetry and the primary position, but its wetting behavior was unusual: both θ R and θ L decreased in 17 min to the value of 23° and next, they increased to a final value of 65°. Visual observations revealed a presence of 2.5-mm-thick interfacial phase layer reactively formed under the second drop. Scanning electron microscopy (SEM) investigations revealed the presence of carbon-enriched precipitates on the top surface of the first Cu drop. These precipitates were identified by the Raman spectroscopy as double-layer graphene. The Raman spectrum taken from the substrate far from the drop revealed the presence of graphene, while that obtained from the first drop displacement path exhibited a decreased intensity of 2D peak. The results of SEM investigations and Raman spectroscopy studies suggest that the presence of graphene layer on the SiC substrate suppresses but does not completely prevent chemical interaction between liquid Cu drop and SiC. Both chemical degradation (etching) and mechanical degradation of the graphene layer during drop rolling due to high adhesion of the Cu drop to the SiC substrate are responsible for mass transfer through the 2nd drop/substrate interface that in turn results in significant changes of structure and chemistry of the drop and the interface.

Three dimensional grain boundary modeling in polycrystalline plasticity

NASA Astrophysics Data System (ADS)

Yalçinkaya, Tuncay; Özdemir, Izzet; Fırat, Ali Osman

2018-05-01

At grain scale, polycrystalline materials develop heterogeneous plastic deformation fields, localizations and stress concentrations due to variation of grain orientations, geometries and defects. Development of inter-granular stresses due to misorientation are crucial for a range of grain boundary (GB) related failure mechanisms, such as stress corrosion cracking (SCC) and fatigue cracking. Local crystal plasticity finite element modelling of polycrystalline metals at micron scale results in stress jumps at the grain boundaries. Moreover, the concepts such as the transmission of dislocations between grains and strength of the grain boundaries are not included in the modelling. The higher order strain gradient crystal plasticity modelling approaches offer the possibility of defining grain boundary conditions. However, these conditions are mostly not dependent on misorientation of grains and can define only extreme cases. For a proper definition of grain boundary behavior in plasticity, a model for grain boundary behavior should be incorporated into the plasticity framework. In this context, a particular grain boundary model ([l]) is incorporated into a strain gradient crystal plasticity framework ([2]). In a 3-D setting, both bulk and grain boundary models are implemented as user-defined elements in Abaqus. The strain gradient crystal plasticity model works in the bulk elements and considers displacements and plastic slips as degree of freedoms. Interface elements model the plastic slip behavior, yet they do not possess any kind of mechanical cohesive behavior. The physical aspects of grain boundaries and the performance of the model are addressed through numerical examples.

Computations of Drop Collision and Coalescence

NASA Technical Reports Server (NTRS)

Tryggvason, Gretar; Juric, Damir; Nas, Selman; Mortazavi, Saeed

1996-01-01

Computations of drops collisions, coalescence, and other problems involving drops are presented. The computations are made possible by a finite difference/front tracking technique that allows direct solutions of the Navier-Stokes equations for a multi-fluid system with complex, unsteady internal boundaries. This method has been used to examine the various collision modes for binary collisions of drops of equal size, mixing of two drops of unequal size, behavior of a suspension of drops in linear and parabolic shear flows, and the thermal migration of several drops. The key results from these simulations are reviewed. Extensions of the method to phase change problems and preliminary results for boiling are also shown.

Dual curved photonic crystal ring resonator based channel drop filter using two-dimensional photonic crystal structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com; Dusad, Lalit Kumar

In this paper channel drop filter (CDF) is designed using dual curved photonic crystal ring resonator (PCRR). The photonic band gap (PBG) is calculated by plane wave expansion (PWE) method and the photonic crystal (PhC) based on two dimensional (2D) square lattice periodic arrays of silicon (Si) rods in air structure have been investigated using finite difference time domain (FDTD) method. The number of rods in Z and X directions is 21 and 20 respectively with lattice constant 0.540 nm and rod radius r = 0.1 µm. The channel drop filter has been optimized for telecommunication wavelengths λ = 1.591 µm with refractivemore » indices 3.533. In the designed structure further analysis is also done by changing whole rods refractive index and it has been observed that this filter may be used for filtering several other channels also. The designed structure is useful for CWDM systems. This device may serve as a key component in photonic integrated circuits. The device is ultra compact with the overall size around 123 µm{sup 2}.« less

75 FR 49865 - Extension of Comment Period; Airplane and Engine Certification Requirements in Supercooled Large...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-16

... Ice Crystal Icing Conditions AGENCY: Federal Aviation Administration (FAA), DOT. ACTION: Notice of... airplanes most affected by these icing conditions, mixed phase and ice crystal conditions for all transport category airplanes, and supercooled large drop, mixed phase, and ice crystal icing conditions for all...

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids.

PubMed

Zipper, Lauren E; Aristide, Xavier; Bishop, Dylan P; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B; Santiago, Brianna M; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M; Soares, Alexei S

2014-12-01

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63-82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.

A Validated All-Pressure Fluid Drop Model and Lewis Number Effects for a Binary Mixture

NASA Technical Reports Server (NTRS)

Harstad, K.; Bellan, J.

1999-01-01

The differences between subcritical liquid drop and supercritical fluid drop behavior are discussed. Under subcritical, evaporative high emission rate conditions, a film layer is present in the inner part of the drop surface which contributes to the unique determination of the boundary conditions; it is this film layer which contributes to the solution's convective-diffusive character. In contrast, under supercritical condition as the boundary conditions contain a degree of arbitrariness due to the absence of a surface, and the solution has then a purely diffusive character. Results from simulations of a free fluid drop under no-gravity conditions are compared to microgravity experimental data from suspended, large drop experiments at high, low and intermediary temperatures and in a range of pressures encompassing the sub-and supercritical regime. Despite the difference between the conditions of the simulations and experiments (suspension vs. free floating), the time rate of variation of the drop diameter square is remarkably well predicted in the linear curve regime. The drop diameter is determined in the simulations from the location of the maximum density gradient, and agrees well with the data. It is also shown that the classical calculation of the Lewis number gives qualitatively erroneous results at supercritical conditions, but that an effective Lewis number previously defined gives qualitatively correct estimates of the length scales for heat and mass transfer at all pressures.

Drop Testing Representative Multi-Canister Overpacks

DOE Office of Scientific and Technical Information (OSTI.GOV)

Snow, Spencer D.; Morton, Dana K.

The objective of the work reported herein was to determine the ability of the Multi- Canister Overpack (MCO) canister design to maintain its containment boundary after an accidental drop event. Two test MCO canisters were assembled at Hanford, prepared for testing at the Idaho National Engineering and Environmental Laboratory (INEEL), drop tested at Sandia National Laboratories, and evaluated back at the INEEL. In addition to the actual testing efforts, finite element plastic analysis techniques were used to make both pre-test and post-test predictions of the test MCOs structural deformations. The completed effort has demonstrated that the canister design is capablemore » of maintaining a 50 psig pressure boundary after drop testing. Based on helium leak testing methods, one test MCO was determined to have a leakage rate not greater than 1x10 -5 std cc/sec (prior internal helium presence prevented a more rigorous test) and the remaining test MCO had a measured leakage rate less than 1x10 -7 std cc/sec (i.e., a leaktight containment) after the drop test. The effort has also demonstrated the capability of finite element methods using plastic analysis techniques to accurately predict the structural deformations of canisters subjected to an accidental drop event.« less

A simple 2D composite image analysis technique for the crystal growth study of L-ascorbic acid.

PubMed

Kumar, Krishan; Kumar, Virender; Lal, Jatin; Kaur, Harmeet; Singh, Jasbir

2017-06-01

This work was destined for 2D crystal growth studies of L-ascorbic acid using the composite image analysis technique. Growth experiments on the L-ascorbic acid crystals were carried out by standard (optical) microscopy, laser diffraction analysis, and composite image analysis. For image analysis, the growth of L-ascorbic acid crystals was captured as digital 2D RGB images, which were then processed to composite images. After processing, the crystal boundaries emerged as white lines against the black (cancelled) background. The crystal boundaries were well differentiated by peaks in the intensity graphs generated for the composite images. The lengths of crystal boundaries measured from the intensity graphs of composite images were in good agreement (correlation coefficient "r" = 0.99) with the lengths measured by standard microscopy. On the contrary, the lengths measured by laser diffraction were poorly correlated with both techniques. Therefore, the composite image analysis can replace the standard microscopy technique for the crystal growth studies of L-ascorbic acid. © 2017 Wiley Periodicals, Inc.

Atomic density effects on temperature characteristics and thermal transport at grain boundaries through a proper bin size selection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vo, Truong Quoc; Kim, BoHung, E-mail: muratbarisik@iyte.edu.tr, E-mail: bohungk@ulsan.ac.kr; Barisik, Murat, E-mail: muratbarisik@iyte.edu.tr, E-mail: bohungk@ulsan.ac.kr

2016-05-21

This study focuses on the proper characterization of temperature profiles across grain boundaries (GBs) in order to calculate the correct interfacial thermal resistance (ITR) and reveal the influence of GB geometries onto thermal transport. The solid-solid interfaces resulting from the orientation difference between the (001), (011), and (111) copper surfaces were investigated. Temperature discontinuities were observed at the boundary of grains due to the phonon mismatch, phonon backscattering, and atomic forces between dissimilar structures at the GBs. We observed that the temperature decreases gradually in the GB area rather than a sharp drop at the interface. As a result, threemore » distinct temperature gradients developed at the GB which were different than the one observed in the bulk solid. This behavior extends a couple molecular diameters into both sides of the interface where we defined a thickness at GB based on the measured temperature profiles for characterization. Results showed dependence on the selection of the bin size used to average the temperature data from the molecular dynamics system. The bin size on the order of the crystal layer spacing was found to present an accurate temperature profile through the GB. We further calculated the GB thickness of various cases by using potential energy (PE) distributions which showed agreement with direct measurements from the temperature profile and validated the proper binning. The variation of grain crystal orientation developed different molecular densities which were characterized by the average atomic surface density (ASD) definition. Our results revealed that the ASD is the primary factor affecting the structural disorders and heat transfer at the solid-solid interfaces. Using a system in which the planes are highly close-packed can enhance the probability of interactions and the degree of overlap between vibrational density of states (VDOS) of atoms forming at interfaces, leading to a reduced ITR. Thus, an accurate understanding of thermal characteristics at the GB can be formulated by selecting a proper bin size.« less

Atomic density effects on temperature characteristics and thermal transport at grain boundaries through a proper bin size selection

NASA Astrophysics Data System (ADS)

Vo, Truong Quoc; Barisik, Murat; Kim, BoHung

2016-05-01

This study focuses on the proper characterization of temperature profiles across grain boundaries (GBs) in order to calculate the correct interfacial thermal resistance (ITR) and reveal the influence of GB geometries onto thermal transport. The solid-solid interfaces resulting from the orientation difference between the (001), (011), and (111) copper surfaces were investigated. Temperature discontinuities were observed at the boundary of grains due to the phonon mismatch, phonon backscattering, and atomic forces between dissimilar structures at the GBs. We observed that the temperature decreases gradually in the GB area rather than a sharp drop at the interface. As a result, three distinct temperature gradients developed at the GB which were different than the one observed in the bulk solid. This behavior extends a couple molecular diameters into both sides of the interface where we defined a thickness at GB based on the measured temperature profiles for characterization. Results showed dependence on the selection of the bin size used to average the temperature data from the molecular dynamics system. The bin size on the order of the crystal layer spacing was found to present an accurate temperature profile through the GB. We further calculated the GB thickness of various cases by using potential energy (PE) distributions which showed agreement with direct measurements from the temperature profile and validated the proper binning. The variation of grain crystal orientation developed different molecular densities which were characterized by the average atomic surface density (ASD) definition. Our results revealed that the ASD is the primary factor affecting the structural disorders and heat transfer at the solid-solid interfaces. Using a system in which the planes are highly close-packed can enhance the probability of interactions and the degree of overlap between vibrational density of states (VDOS) of atoms forming at interfaces, leading to a reduced ITR. Thus, an accurate understanding of thermal characteristics at the GB can be formulated by selecting a proper bin size.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

Crystallization and preliminary crystallographic analysis of the catechol 2,3-dioxygenase PheB from Bacillus stearothermophilus BR219

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sugimoto, Keisuke; Matsufuzi, Kazuki; Ohnuma, Hiroaki

2006-02-01

PheB, an extradiol-cleaving catecholic dioxygenase, was crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The crystal belongs to the orthorhombic system, space group P2{sub 1}2{sub 1}2{sub 1}, and diffracts to 2.3 Å resolution. Class II extradiol-cleaving catecholic dioxygenase, a key enzyme of aromatic compound degradation in bacteria, cleaves the aromatic ring of catechol by adding two O atoms. PheB is one of the class II extradiol-cleaving catecholic dioxygenases and shows a high substrate specificity for catechol derivatives, which have one aromatic ring. In order to reveal the mechanism of the substrate specificity of PheB, PheB hasmore » been crystallized by the hanging-drop vapour-diffusion method using PEG 4000 as a precipitant. The space group of the obtained crystal was P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 65.5, b = 119.2, c = 158.7 Å. The crystal diffracted to 2.3 Å resolution.« less

A simple apparatus for controlling nucleation and size in protein crystal growth

NASA Technical Reports Server (NTRS)

Gernert, Kim M.; Smith, Robert; Carter, Daniel C.

1988-01-01

A simple device is described for controlling vapor equilibrium in macromolecular crystallization as applied to the protein crystal growth technique commonly referred to as the 'hanging drop' method. Crystal growth experiments with hen egg white lysozyme have demonstrated control of the nucleation rate. Nucleation rate and final crystal size have been found to be highly dependent upon the rate at which critical supersaturation is approached. Slower approaches show a marked decrease in the nucleation rate and an increase in crystal size.

Low-Temperature Band Transport and Impact of Contact Resistance in Organic Field-Effect Transistors Based on Single-Crystal Films of Ph-BTBT-C10

NASA Astrophysics Data System (ADS)

Cho, Joung-min; Mori, Takehiko

2016-06-01

Transistors based on single-crystal films of 2-decyl-7-phenyl-[1]benzothieno[3,2-b][1]benzothiophene (Ph-BTBT-10) fabricated using the blade-coating method are investigated by the four-probe method down to low temperatures. The four-probe mobility is as large as 18 cm2/V s at room temperature, and increases to 45 cm2/V s at 80 K. At 60 K the two-probe mobility drops abruptly by about 50%, but the mobility drop is mostly attributed to the increase of the source resistance. The carrier transport in the present single-crystal film is regarded as essentially bandlike down to 30 K.

Breakup of a thin drop under a stagnation point flow

NASA Astrophysics Data System (ADS)

Hooshanginejad, Alireza; Lee, Sungyon; Shelley, Michael

2017-11-01

Recent studies by Hooshanginejad and Lee (2017) have demonstrated complex depinning behaviors of a partially wetting droplet under wind. Motivated by this study, we examine the coupled evolution of a 2D thin drop and external wind, when it is initially held against a fast stagnation point flow. Our drop lubrication model employs the potential flow and Prandtl boundary layer theory for outer flow to compute the internal drop flow corresponding to drop deformations. Furthermore, both the analytical and numerical steady state solutions provide a partial prediction for the drop's final shape and help identify the range of droplet sizes that undergo a breakup for the given flow condition.

Highly mobile type II twin boundary in Ni-Mn-Ga five-layered martensite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sozinov, A.; Lanska, N.; Soroka, A.

2011-09-19

Twin relationships and stress-induced reorientation were studied in Ni{sub 2}Mn{sub 1.14}Ga{sub 0.86} single crystal with five-layered modulated martensite crystal structure. Very low twinning stress of about 0.1 MPa was found for twin boundaries which deviated a few degrees from the (011) crystallographic plane. However, twin boundaries oriented exactly parallel to the (011) plane exhibited considerably higher level of twinning stress, above 1 MPa. X-ray diffraction experiments and calculations based on approximation of the martensite crystal lattice as a tetragonal lattice with a slight monoclinic distortion identified the two different kinds of twin interfaces as type II and type I twinmore » boundaries.« less

The undercooling of liquids

NASA Technical Reports Server (NTRS)

Turnbull, D.

1984-01-01

The formation by melt quenching of such metastable structures as glassy or microcrystalline solids and highly supersaturated solutions is made possible by the extreme resistance of most melts to homophase crystal nucleation at deep undercooling. This nucleation resistance contrasts sharply with the very low kinetic resistance to the movement of crystal-melt interfaces, once formed, in metals and other fluid systems at even minute undercooling. The methods of nucleation study which have proven especially effective in bypassing nucleation by heterophase impurities thereby exposing the high resistance of melts to homophase nucleation may be summarized as follows: observation of the crystallization behavior of dispersed small droplets; drop tube experiments in which liquid drops solidify, under containerless conditions, during their fall in the tube; and observation of the crystallization of bulk specimens immersed in fluxes chosen to dissolve or otherwise deactivate (e.g., by wetting) heterophase nucleants. This method has proven to be remarkably effective in deactivating such nucleants in certain pure metals.

Crystallization screening test for the whole-cell project on Thermus thermophilus HB8

PubMed Central

Iino, Hitoshi; Naitow, Hisashi; Nakamura, Yuki; Nakagawa, Noriko; Agari, Yoshihiro; Kanagawa, Mayumi; Ebihara, Akio; Shinkai, Akeo; Sugahara, Mitsuaki; Miyano, Masashi; Kamiya, Nobuo; Yokoyama, Shigeyuki; Hirotsu, Ken; Kuramitsu, Seiki

2008-01-01

It was essential for the structural genomics of Thermus thermophilus HB8 to efficiently crystallize a number of proteins. To this end, three conventional robots, an HTS-80 (sitting-drop vapour diffusion), a Crystal Finder (hanging-drop vapour diffusion) and a TERA (modified microbatch) robot, were subjected to a crystallization condition screening test involving 18 proteins from T. thermophilus HB8. In addition, a TOPAZ (microfluidic free-interface diffusion) designed specifically for initial screening was also briefly examined. The number of diffraction-quality crystals and the time of appearance of crystals increased in the order HTS-80, Crystal Finder, TERA. With the HTS-80 and Crystal Finder, the time of appearance was short and the rate of salt crystallization was low. With the TERA, the number of diffraction-quality crystals was high, while the time of appearance was long and the rate of salt crystallization was relatively high. For the protein samples exhibiting low crystallization success rates, there were few crystallization conditions that were common to the robots used. In some cases, the success rate depended greatly on the robot used. The TOPAZ showed the shortest time of appearance and the highest success rate, although the crystals obtained were too small for diffraction studies. These results showed that the combined use of different robots significantly increases the chance of obtaining crystals, especially for proteins exhibiting low crystallization success rates. The structures of 360 of 944 purified proteins have been successfully determined through the combined use of an HTS-80 and a TERA. PMID:18540056

Crystallization and preliminary X-ray diffraction studies of the ferredoxin reductase component in the Rieske nonhaem iron oxygenase system carbazole 1,9a-dioxygenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ashikawa, Yuji; Uchimura, Hiromasa; Fujimoto, Zui

2007-06-01

The NAD(P)H:ferredoxin oxidoreductase in carbazole 1,9a-dioxygenase from Janthinobacterium sp. J3 was crystallized and diffraction data were collected to 2.60 Å resolution. Carbazole 1,9a-dioxygenase (CARDO), which consists of an oxygenase component (CARDO-O) and the electron-transport components ferredoxin (CARDO-F) and ferredoxin reductase (CARDO-R), catalyzes dihydroxylation at the C1 and C9a positions of carbazole. CARDO-R was crystallized at 277 K using the hanging-drop vapour-diffusion method with the precipitant PEG 8000. Two crystal types (types I and II) were obtained. The type I crystal diffracted to a maximum resolution of 2.80 Å and belonged to space group P4{sub 2}2{sub 1}2, with unit-cell parameters amore » = b = 158.7, c = 81.4 Å. The type II crystal was obtained in drops from which type I crystals had been removed; it diffracted to 2.60 Å resolution and belonged to the same space group, with unit-cell parameters a = b = 161.8, c = 79.5 Å.« less

A comparison between protein crystals grown with vapor diffusion methods in microgravity and protein crystals using a gel liquid-liquid diffusion ground-based method

NASA Technical Reports Server (NTRS)

Miller, Teresa Y.; He, Xiao-Min; Carter, Daniel C.

1992-01-01

Crystals of human serum albumin have been successfully grown in a variety of gels using crystallization conditions otherwise equivalent to those utilized in the popular hanging-drop vapor-equilibrium method. Preliminary comparisons of gel grown crystals with crystals grown by the vapor diffusion method via both ground-based and microgravity methods indicate that crystals superior in size and quality may be grown by limiting solutal convection. Preliminary X-ray diffraction statistics are presented.

Electrohydrodynamic deformation and interaction of a pair of emulsion drops

NASA Technical Reports Server (NTRS)

Baygents, James C.

1994-01-01

The response of a pair of emulsion drops to the imposition of a uniform electric field is examined. The case studied is that of equal-sized drops whose line of centers is parallel to the axis of the applied field. A new boundary integral solution to the governing equations of the leaky dielectric model is developed; the formulation accounts for the electrostatic and hydrodynamic interactions between the drops, as well as their deformations. Numerical calculations show that, after an initial transient during which the drops primarily deform, the pair drift slowly together due to their electrostatic interactions.

Method for controlling protein crystallization

NASA Technical Reports Server (NTRS)

Noever, David A. (Inventor)

1993-01-01

A method and apparatus for controlling the crystallization of protein by solvent evaporation including placing a drop of protein solution between and in contact with a pair of parallel plates and driving one of the plates toward and away from the other plate in a controlled manner to adjust the spacing between the plates is presented. The drop of solution forms a liquid cylinder having a height dependent upon the plate spacing thereby effecting the surface area available for solvent evaporation. When the spacing is close, evaporation is slow. Evaporation is increased by increasing the spacing between the plates until the breaking point of the liquid cylinder. One plate is mounted upon a fixed post while the other plate is carried by a receptacle movable relative to the post and driven by a belt driven screw drive. The temperature and humidity of the drop of protein solution are controlled by sealing the drop within the receptacle and mounting a heater and dessicant within the receptacle.

Protein crystals as scanned probes for recognition atomic force microscopy.

PubMed

Wickremasinghe, Nissanka S; Hafner, Jason H

2005-12-01

Lysozyme crystal growth has been localized at the tip of a conventional silicon nitride cantilever through seeded nucleation. After cross-linking with glutaraldehyde, lysozyme protein crystal tips image gold nanoparticles and grating standards with a resolution comparable to that of conventional tips. Force spectra between the lysozyme crystal tips and surfaces covered with antilysozyme reveal an adhesion force that drops significantly upon blocking with free lysozyme, thus confirming that lysozyme crystal tips can detect molecular recognition interactions.

How grain boundaries affect the efficiency of poly-CdTe solar-cells: A fundamental atomic-scale study of grain boundary dislocation cores using CdTe bi-crystal thin films.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klie, Robert

It is now widely accepted that grain boundaries in poly-crystalline CdTe thin film devices have a detrimental effect on the minority carrier lifetimes, the open circuit voltage and therefore the overall solar-cell performance. The goal of this project was to develop a fundamental understanding of the role of grain boundaries in CdTe on the carrier life-time, open-circuit voltage, Voc, and the diffusion of impurities. To achieve this goal, i) CdTe bi-crystals were fabricated with various misorientation angels, ii) the atomic- and electronic structures of the grain boundaries were characterized using scanning transmission electron microscopy (STEM), and iii) first-principles density functionalmore » theory modeling was performed on the structures determined by STEM to predict the grain boundary potential. The transport properties and minority carrier lifetimes of the bi-crystal grain boundaries were measured using a variety of approaches, including TRPL, and provided feedback to the characterization and modeling effort about the effectiveness of the proposed models.« less

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

PubMed Central

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; Joshi, Ishita; Kharzeev, Julia; Patel, Krishna B.; Santiago, Brianna M.; Joshi, Karan; Dorsinvil, Kahille; Sweet, Robert M.; Soares, Alexei S.

2014-01-01

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations. PMID:25484231

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

DOE PAGES

Zipper, Lauren E.; Aristide, Xavier; Bishop, Dylan P.; ...

2014-11-28

A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fitting the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under differentmore » conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. Ultimately, the results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

Feasibility of a tetracycline-binding method for detecting synovial fluid basic calcium phosphate crystals.

PubMed

Rosenthal, Ann K; Fahey, Mark; Gohr, Claudia; Burner, Todd; Konon, Irina; Daft, Laureen; Mattson, Eric; Hirschmugl, Carol; Ryan, Lawrence M; Simkin, Peter

2008-10-01

Basic calcium phosphate (BCP) crystals are common components of osteoarthritis (OA) synovial fluid. Progress in understanding the role of these bioactive particles in clinical OA has been hampered by difficulties in their identification. Tetracyclines stain calcium phosphate mineral in bone. The aim of this study was to investigate whether tetracycline staining might be an additional or alternative method for identifying BCP crystals in synovial fluid. A drop of oxytetracycline was mixed with a drop of fluid containing synthetic or native BCP, calcium pyrophosphate dihydrate (CPPD), or monosodium urate (MSU) crystals and placed on a microscope slide. Stained and unstained crystals were examined by light microscopy, with and without a portable broad-spectrum ultraviolet (UV) pen light. A small set of characterized synovial fluid samples were compared by staining with alizarin red S and oxytetracycline. Synthetic BCP crystals in synovial fluid were quantified fluorimetrically using oxytetracycline. After oxytetracycline staining, synthetic and native BCP crystals appeared as fluorescent amorphous aggregates under UV light. Oxytetracycline did not stain CPPD or MSU crystals or other particulates. Oxytetracycline staining had fewer false-positive test results than did alizarin red S staining and could provide estimates of the quantities of synthetic BCP crystals in synovial fluid. With further validation, oxytetracycline staining may prove to be a useful adjunct or alternative to currently available methods for identifying BCP crystals in synovial fluid.

Boundary-layer effects in droplet splashing

NASA Astrophysics Data System (ADS)

Riboux, Guillaume; Gordillo, Jose Manuel

2017-11-01

A drop falling onto a solid substrate will disintegrate into smaller parts when its impact velocity exceeds the so called critical velocity for splashing. Under these circumstances, the very thin liquid sheet ejected tangentially to the solid after the drop touches the substrate, lifts off as a consequence of the aerodynamic forces exerted on it and finally breaks into smaller droplets, violently ejected radially outwards, provoking the splash. Here, the tangential deceleration experienced by the fluid entering the thin liquid sheet is investigated making use of boundary layer theory. The velocity component tangent to the solid, computed using potential flow theory provides the far field boundary condition as well as the pressure gradient for the boundary layer equations. The structure of the flow permits to find a self similar solution of the boundary layer equations. This solution is then used to calculate the boundary layer thickness at the root of the lamella as well as the shear stress at the wall. The splash model presented in, which is slightly modified to account for the results obtained from the boundary layer analysis, provides a very good agreement between the measurements and the predicted values of the critical velocity for the splash.

Sizing of colloidal particle and protein molecules in a hanging fluid drop

NASA Technical Reports Server (NTRS)

Ansari, Rafat R.; Suh, Kwang I.

1995-01-01

We report non-invasive particle size measurements of polystyrene latex colloidal particles and bovine serum albumin (BSA) protein molecules suspended in tiny hanging fluid drops of 30 micro-Liter volume using a newly designed fiber optic probe. The probe is based upon the principles of the technique of dynamic light scattering (DLS). The motivation for this work comes from growing protein crystals in outer space. Protein crystals have been grown previously in hanging drops in microgravity experiments on-board the space shuttle orbiter. However, obtaining quantitative information on nucleation and growth of the protein crystals in real time has always been a desired goal, but hitherto not achieved. Several protein researchers have shown interest in using DLS to monitor crystal growth process in a droplet, but elaborate instrumentation and optical alignment problems have made in-situ applications difficult. We demonstrate that such an experiment is now possible. Our system offers fast (5 seconds) determination of particle size, utilize safe levels of very low laser power (less than or equal to 0.2 mW), a small scattering volume (approximately 2 x 10(exp -5) cu mm) and high spatial coherence (Beta) values. This is a major step forward when compared to currently available DLS systems.

Mechanisms of aluminium-induced crystallization and layer exchange upon low-temperature annealing of amorphous Si/polycrystalline Al bilayers.

PubMed

Wang, J Y; Wang, Z M; Jeurgens, L P H; Mittemeijer, E J

2009-06-01

Aluminium-induced crystallization (ALIC) of amorphous Si and subsequent layer exchange (ALILE) occur in amorphous-Si/polycrystalline-Al bilayers (a-Si/c-Al) upon annealing at temperatures as low as 165 degrees C and were studied by X-ray diffraction and Auger electron spectroscopic depth profiling. It follows that: (i) nucleation of Si crystallization is initiated at Al grain boundaries and not at the a-Si/c-Al interface; (ii) low-temperature annealing results in a large Si grain size in the continuous c-Si layer produced by ALILE. Thermodynamic model calculations show that: (i) Si can "wet" the Al grain boundaries due to the favourable a-Si/c-Al interface energy (as compared to the Al grain-boundary energy); (ii) the wetting-induced a-Si layer at the Al grain boundary can maintain its amorphous state only up to a critical thickness, beyond which nucleation of Si crystallization takes place; and (iii) a tiny driving force controls the kinetics of the layer exchange.

Static shape of an acoustically levitated drop with wave-drop interaction

NASA Astrophysics Data System (ADS)

Lee, C. P.; Anilkumar, A. V.; Wang, T. G.

1994-11-01

The static shape of a drop levitated and flattened by an acoustic standing wave field in air is calculated, requiring self-consistency between the drop shape and the wave. The wave is calculated for a given shape using the boundary integral method. From the resulting radiation stress on the drop surface, the shape is determined by solving the Young-Laplace equation, completing an iteration cycle. The iteration is continued until both the shape and the wave converge. Of particular interest are the shapes of large drops that sustain equilibrium, beyond a certain degree of flattening, by becoming more flattened at a decreasing sound pressure level. The predictions for flattening versus acoustic radiation stress, for drops of different sizes, compare favorably with experimental data.

Crystallization and preliminary X-ray diffraction study of thermostable RNase HIII from Bacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chon, Hyongi; Matsumura, Hiroyoshi; Koga, Yuichi

2005-03-01

A thermostable ribonuclease HIII from B. stearothermophilus (Bst RNase HIII) was crystallized and preliminary crystallographic studies were performed. Plate-like overlapping polycrystals were grown by the sitting-drop vapour-diffusion method at 283 K.

The organized melee: Emergence of collective behavior in concentrated suspensions of swimming bacteria and associated phenomena

NASA Astrophysics Data System (ADS)

Cisneros Salerno, Luis

Suspensions of the aerobic bacteria Bacilus subtilis develop patterns and flows from the interplay of motility, chemotaxis and buoyancy. In sessile drops, such bioconvectively driven flows carry plumes down the slanted meniscus and concentrate cells at the drop edge, while in pendant drops such self-concentration occurs at the bottom. These dynamics are explained quantitatively by a mathematical model consisting of oxygen diffusion and consumption, chemotaxis, and viscous fluid dynamics. Concentrated regions in both geometries comprise nearly close-packed populations, forming the collective "Zooming BioNematic" (ZBN) phase. This state exhibits large-scale orientational coherence, analogous to the molecular alignment of nematic liquid crystals, coupled with remarkable spatial and temporal correlations of velocity and vorticity, as measured by both novel and standard applications of particle imaging velocimetry. To probe mechanisms leading to this phase, response of individual cells to steric stress was explored, finding that they can reverse swimming direction at spatial constrictions without turning the cell body. The consequences of this propensity to flip the flagella are quantified, showing that "forwards" and "backwards" motion are dynamically and morphologically indistinguishable. Finally, experiments and mathematical modeling show that complex flows driven by previously unknown bipolar flagellar arrangements are induced when B. subtilis are confined in a thin layer of fluid, between asymmetric boundaries. The resulting driven flow circulates around the cell body ranging over several cell diameters, in contrast to the more localized flows surrounding free swimmers. This discovery extends our knowledge of the dynamic geometry of bacteria and their flagella, and reveals new mechanisms for motility-associated molecular transport and intercellular communication.

Lattice-Rotation Vortex at the Charged Monoclinic Domain Boundary in a Relaxor Ferroelectric Crystal

NASA Astrophysics Data System (ADS)

Shao, Yu-Tsun; Zuo, Jian-Min

2017-04-01

We present evidence of lattice-rotation vortices having an average radius of ˜7 nm at the ferroelectric domain boundary of (1 -x )Pb (Zn1 /3Nb2 /3)O3-xPbTiO3 (x =0.08 ). Maps of crystal orientations and domain symmetry breaking are obtained using scanning convergent beam electron diffraction, which show fractional rotation vortices near the 50° monoclinic domain walls. The merging of 2D and 1D topological defects is consistent with inhomogeneous boundary charge and expected to have a large impact on the domain-switching mechanisms in relaxor ferroelectric crystals and ferroelectric devices.

On the metal-insulator-transition in vanadium dioxide

NASA Astrophysics Data System (ADS)

Jovaini, Azita; Fujita, Shigeji; Godoy, Salvador; Suzuki, Akira

2012-02-01

Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity σ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop.

General equations for the motions of ice crystals and water drops in gravitational and electric fields

NASA Technical Reports Server (NTRS)

Nisbet, John S.

1988-01-01

General equations for the Reynolds number of a variety of types of ice crystals and water drops are given in terms of the Davies, Bond, and Knudsen numbers. The equations are in terms of the basic physical parameters of the system and are valid for calculating velocities in gravitational and electric fields over a very wide range of sizes and atmospheric conditions. The equations are asymptotically matched at the bottom and top of the size spectrum, useful when checking large computer codes. A numerical system for specifying the dimensional properties of ice crystals is introduced. Within the limits imposed by such variables as particle density, which have large deviations, the accuracy of velocities appears to be within 10 percent over the entire range of sizes of interest.

Effect of crystal size distribution on thermoelectric performance for Lanthanum-doped strontium titanate bulk material

NASA Astrophysics Data System (ADS)

Zhang, Boyu; Wang, Jun; Yaer, Xinba; Huo, Zhenzhen; Wu, Yin; Li, Yan; Miao, Lei; Liu, Chengyan; Zou, Tao; Ma, Wen

2015-07-01

Effect of crystal size distribution on thermoelectric performance of Lanthanum-doped strontium titanate (La-SrTiO3) ceramics are investigated in this study. Thermoelectric performance measurement, coupled with microstructure studies, shows that the electrical conductivity strongly depends on the crystal size, potential barrier on the grain boundary and porosity. Meantime, because the average potential barriers height are increased along with the reduction of crystal size, the Seebeck coefficients are increased by energy filtering effect at the large number of grain boundaries. As a result, by controlling of crystal size distribution, ZT value of La-SrTiO3 is improved.

Sharp Permeability Transitions due to Shallow Diagenesis of Subduction Zone Sediments

NASA Astrophysics Data System (ADS)

James, S.; Screaton, E.

2013-12-01

The permeability of hemipelagic sediments is an important factor in fluid flow in subduction zones and can be affected by porosity changes and cementation-dissolution processes acting during diagenesis. Anomalously high porosities have been observed in cores from the Shikoku Basin sediments approaching the Nankai Trough subduction zone. These high porosities have been attributed to the presence of minor amounts of amorphous silica cement that strengthen the sediment and inhibit consolidation. The porosity rapidly drops from 66-68% to 54-56% at a diagenetic boundary where the amorphous silica cement dissolves. Although the anomalous porosity profiles at Nankai have received attention, the magnitude of the corresponding permeability change has not been addressed. In this study, permeability profiles were constructed using permeability-porosity relationships from previous studies, to estimate the magnitude and rate of permeability changes with depth. The predicted permeability profiles for the Nankai Trough sediment cores indicate that permeability drops by almost one order of magnitude across the diagenetic boundary. This abrupt drop in permeability has the potential to facilitate significant changes in pore fluid pressures and thus to influence the deformation of the sediment onto the accretionary prism. At the Costa Rica subduction zone, results vary with location. Site U1414 offshore the Osa Peninsula shows porosities stable at 69% above 145 mbsf and then decrease to 54% over a 40 m interval. A porosity drop of that magnitude is predicted to correlate to an order of magnitude permeability decrease. In contrast, porosity profiles from Site 1039 offshore the Nicoya Peninsula and Site U1381 offshore the Osa Peninsula show anomalously high porosities but no sharp drop. It is likely that sediments do not cross the diagenetic boundary due to the extremely low (<10°C/km) thermal gradient at Site 1039 and the thin (<100 m) sediment cover at Site U1381. At these locations, the porosity loss and permeability reduction may occur after the sediment is subducted and contribute to high pore pressures at the plate boundary.

Computational Study of Surface Tension and Wall Adhesion Effects on an Oil Film Flow Underneath an Air Boundary Layer

NASA Technical Reports Server (NTRS)

Celic, Alan; Zilliac, Gregory G.

1998-01-01

The fringe-imaging skin friction (FISF) technique, which was originally developed by D. J. Monson and G. G. Mateer at Ames Research Center and recently extended to 3-D flows, is the most accurate skin friction measurement technique currently available. The principle of this technique is that the skin friction at a point on an aerodynamic surface can be determined by measuring the time-rate-of-change of the thickness of an oil drop placed on the surface under the influence of the external air boundary layer. Lubrication theory is used to relate the oil-patch thickness variation to shear stress. The uncertainty of FISF measurements is estimated to be as low as 4 percent, yet little is known about the effects of surface tension and wall adhesion forces on the measured results. A modified version of the free-surface Navier-Stokes solver RIPPLE, developed at Los Alamos National Laboratories, was used to compute the time development of an oil drop on a surface under a simulated air boundary layer. RIPPLE uses the volume of fluid method to track the surface and the continuum surface force approach to model surface tension and wall adhesion effects. The development of an oil drop, over a time period of approximately 4 seconds, was studied. Under the influence of shear imposed by an air boundary layer, the computed profile of the drop rapidly changes from its initial circular-arc shape to a wedge-like shape. Comparison of the time-varying oil-thickness distributions computed using RIPPLE and also computed using a greatly simplified numerical model of an oil drop equation which does not include surface tension and wall adhesion effects) was used to evaluate the effects of surface tension on FISF measurement results. The effects of surface tension were found to be small but not necessarily negligible in some cases.

Pore and grain boundary migration under a temperature gradient: A phase-field model study

DOE PAGES

Biner, S. B.

2016-03-16

In this study, the collective migration behavior of pores and grain boundaries under a temperature gradient is studied for simple single crystal, bi-crystal and polycrystal configurations with a phase-field model formulism. For simulation of the microstructure of solids, composed of pores and grain boundaries, the results indicate that not only the volume fraction of pores, but also its spatial partitioning between the grain boundary junctions and the grain boundary segments appears to be important. In addition to various physical properties, the evolution kinetics, under given temperature gradients, will be strongly influenced with the initial morphology of a poly-crystalline microstructure.

Study of magnetic field distribution in anisotropic single twin-boundary magnetic shape memory (MSM) element in actuators

NASA Astrophysics Data System (ADS)

Gabdullin, N.; Khan, S. H.

2017-10-01

Magnetic shape memory effect exhibited by certain alloys at room temperature is known for almost 20 years. The most studied MSM alloys are Ni-Mn-Ga alloys which exhibit up to 12% magnetic field-induced strain (change in shape) depending on microstructure. A multibillion cycle operation without malfunction along with their “smart” properties make them very promising for application in electromagnetic (EM) actuators and sensors. However, considerable twinning stress of MSM crystals resulting in magneto-mechanical hysteresis decreases the efficiency and output force of MSM actuators. Whereas twinning stress of conventional MSM crystals has been significantly decreased over the years, novel crystals with Type II twin boundaries (TBs) possess even lower twinning stress. Unfortunately, the microstructure of MSM crystals with very low twinning stress tends to be unstable leading to their rapid crack growth. Whilst this phenomenon has been studied experimentally, the magnetic field distribution in anisotropic single twin-boundary MSM elements has not been considered yet. This paper analyses the magnetic field distribution in two-variant single twin-boundary MSM elements and discusses its effects on magnetic field-induced stress acting on the twin boundary.

Solute boundary layer on a rotating crystal

NASA Astrophysics Data System (ADS)

Povinelli, Michelle L.; Korpela, Seppo A.; Chait, Arnon

1994-11-01

A perturbation analysis has been carried out for the solutal boundary layer next to a rotating crystal. Our aim is to extend the classical results of Burton, Prim and Slicher [1] in order to obtain higher order terms in asymptotic expansions for the concentration field and boundary-layer thickness. Expressions for the effective segregation coefficient are directly obtained from the concentration solution in the two limits that correspond to weak and strong rotation.

Is drop impact the same for both moving and inclined surfaces?

NASA Astrophysics Data System (ADS)

Buksh, Salman; Marengo, Marco; Amirfazli, Alidad; -Team

2017-11-01

Drop impact is an important phenomenon in a wide variety of applications. Researchers have largely examined drop impact onto a moving surface, and an inclined surface separately. Given that in both systems the impact phenomenon is influenced by tangential and normal velocity components, the question remains, if these two systems are essentially equivalent or gravity and boundary layer effects are such that the outcomes will be different. Experiments have been performed by varying liquid surface tension, viscosity and both normal and tangential velocities (0.3 to 2.9 m/s). The desired velocity components were achieved by changing the height where drop is released, the surface inclination angle for inclined system, and the horizontal velocity for the moving surface. To compare the systems, spreading was analyzed by measuring the width and length of the lamella at various time intervals; for splashing, top view images were compared to see the extent of splashing at initial stage. The data suggests that, for the given velocity, neither the boundary layer differences between the two systems nor the gravity play a role on spreading and splashing of the drop, as such one system can replace the other for future studies.

The buoyancy-driven motion of a single skirted bubble or drop rising through a viscous liquid

NASA Astrophysics Data System (ADS)

Ohta, Mitsuhiro; Sussman, Mark

2012-11-01

The buoyancy-driven motion of a single skirted bubble or drop rising through a viscous liquid is computationally explored by way of 3d-axisymmetric computations. The Navier-Stokes equations for incompressible two-fluid flow are solved numerically in which the coupled level-set and volume-of-fluid method is used to simulate the deforming bubble/drop boundary and the interface jump conditions on the deforming boundary are enforced through a sharp interface numerical treatment. Dynamic, block structured adaptive grid refinement is employed in order to sufficiently resolve the thin skirts. Results on the sensitivity of the thickness of trailing bubble/drop skirts to the density ratio and viscosity ratio are reported. It is shown that both the density ratio (not the density difference) and the viscosity ratio effect the skirt thickness. Previous theory for predicting skirt thickness can be refined as a result of our calculations. It is also discovered that the formation of thin skirts for bubbles and drops have little effect on the rise velocity. In other words, the measured Re number for cases without skirt formation have almost the same values for Re as cases with a thin skirt.

Soft Listeria: actin-based propulsion of liquid drops.

PubMed

Boukellal, Hakim; Campás, Otger; Joanny, Jean-François; Prost, Jacques; Sykes, Cécile

2004-06-01

We study the motion of oil drops propelled by actin polymerization in cell extracts. Drops deform and acquire a pearlike shape under the action of the elastic stresses exerted by the actin comet, a tail of cross-linked actin filaments. We solve this free boundary problem and calculate the drop shape taking into account the elasticity of the actin gel and the variation of the polymerization velocity with normal stress. The pressure balance on the liquid drop imposes a zero propulsive force if gradients in surface tension or internal pressure are not taken into account. Quantitative parameters of actin polymerization are obtained by fitting theory to experiment.

Crystal Nucleation and Growth in Undercooled Melts of Pure Zr, Binary Zr-Based and Ternary Zr-Ni-Cu Glass-Forming Alloys

NASA Astrophysics Data System (ADS)

Herlach, Dieter M.; Kobold, Raphael; Klein, Stefan

2018-03-01

Glass formation of a liquid undercooled below its melting temperature requires the complete avoidance of crystal nucleation and subsequent crystal growth. Even though they are not part of the glass formation process, a detailed knowledge of both processes involved in crystallization is mandatory to determine the glass-forming ability of metals and metallic alloys. In the present work, methods of containerless processing of drops by electrostatic and electromagnetic levitation are applied to undercool metallic melts prior to solidification. Heterogeneous nucleation on crucible walls is completely avoided giving access to large undercoolings. A freely suspended drop offers the additional benefit of showing the rapid crystallization process of an undercooled melt in situ by proper diagnostic means. As a reference, crystal nucleation and dendrite growth in the undercooled melt of pure Zr are experimentally investigated. Equivalently, binary Zr-Cu, Zr-Ni and Zr-Pd and ternary Zr-Ni-Cu alloys are studied, whose glass-forming abilities differ. The experimental results are analyzed within classical nucleation theory and models of dendrite growth. The findings give detailed knowledge about the nucleation-undercooling statistics and the growth kinetics over a large range of undercooling.

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murata, Kenji; Fisher, Andrew J.; Hedrick, Jerry L., E-mail: jlhedrick@ucdavis.edu

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 Å resolution. The crystal belongsmore » to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 Å, α = 90, β = 92.82, γ = 90°. The crystal is likely to contain eight molecules in the asymmetric unit (V{sub M} = 2.3 Å{sup 3} Da{sup −1}), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of orotidine 5′-monophosphate decarboxylase from the human malaria parasite Plasmodium falciparum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krungkrai, Sudaratana R.; Department of Molecular Protozoology, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamadaoka, Suita, Osaka 565-0871; Tokuoka, Keiji

Orotidine 5′-monophosphate decarboxylase of human malaria parasite P. falciparum was crystallized by the seeding method in a hanging drop using PEG 3000 as a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation. Orotidine 5′-monophosphate (OMP) decarboxylase (OMPDC; EC 4.1.1.23) catalyzes the final step in the de novo synthesis of uridine 5′-monophosphate (UMP) and defects in the enzyme are lethal in the malaria parasite Plasmodium falciparum. Active recombinant P. falciparum OMPDC (PfOMPDC) was crystallized by the seeding method in a hanging drop using PEG 3000 asmore » a precipitant. A complete set of diffraction data from a native crystal was collected to 2.7 Å resolution at 100 K using synchrotron radiation at the Swiss Light Source. The crystal exhibits trigonal symmetry (space group R3), with hexagonal unit-cell parameters a = b = 201.81, c = 44.03 Å. With a dimer in the asymmetric unit, the solvent content is 46% (V{sub M} = 2.3 Å{sup 3} Da{sup −1})« less

Crystallization and preliminary diffraction analysis of a DsbA homologue from Wolbachia pipientis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kurz, M.; Iturbe-Ormaetxe, I.; Jarrott, R.

2008-02-01

The first crystallization of a W. pipientis protein, α-DsbA1, was achieved using hanging-drop and sitting-drop vapour diffusion. α-DsbA1 is one of two DsbA homologues encoded by the Gram-negative α-proteobacterium Wolbachia pipientis, an endosymbiont that can behave as a reproductive parasite in insects and as a mutualist in medically important filarial nematodes. The α-DsbA1 protein is thought to be important for the folding and secretion of Wolbachia proteins involved in the induction of reproductive distortions. Crystals of native and SeMet α-DsbA1 were grown by vapour diffusion and belong to the monoclinic space group C2, with unit-cell parameters a = 71.4, bmore » = 49.5, c = 69.3 Å, β = 107.0° and one molecule in the asymmetric unit (44% solvent content). X-ray data were recorded from native crystals to a resolution of 2.01 Å using a copper anode and data from SeMet α-DsbA1 crystals were recorded to 2.45 Å resolution using a chromium anode.« less

Nano Liquid Crystal Droplet Impact on Solid Surfaces

NASA Astrophysics Data System (ADS)

Zhang, Rui; de Pablo, Juan; dePablo Team

2015-03-01

Liquid droplet impaction on solid surfaces is an important problem with a wide range of applications in everyday life. Liquid crystals (LCs) are anisotropic liquids whose internal structure gives rise to rich optical and morphological phenomena. In this work we study the liquid crystal droplet impaction on solid surfaces by molecular dynamics simulations. We employ a widely used Gay-Berne model to describe the elongated liquid crystal molecules and their interactions. Our work shows that, in contrast to isotropic liquids, drop deformation is symmetric unless an instability kicks in, in which case a nano scale liquid crystal droplet exhibits distinct anisotropic spreading modes that do not occur in simple liquids. The drop prefers spreading along the low viscosity direction, but inertia can in some cases overcome that bias. The effects of the director field of the droplet, preferred anchoring direction and the anchoring strength of the wall are investigated. Large scale (0.1 micron) simulations are performed to connect our nano scale results to the experiments. Our studies indicate that LCs could provide an interesting alternative for development of next-generation printing inks.

Crystallization and preliminary X-ray diffraction studies of choline-binding protein F from Streptococcus pneumoniae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molina, Rafael; González, Ana; Moscoso, Miriam

2007-09-01

The modular choline-binding protein F (CbpF) from S. pneumoniae has been crystallized by the hanging-drop vapour-diffusion method. A SAD data set from a gadolinium-complex derivative has been collected to 2.1 Å resolution. Choline-binding protein F (CbpF) is a modular protein that is bound to the pneumococcal cell wall through noncovalent interactions with choline moieties of the bacterial teichoic and lipoteichoic acids. Despite being one of the more abundant proteins on the surface, along with the murein hydrolases LytA, LytB, LytC and Pce, its function is still unknown. CbpF has been crystallized using the hanging-drop vapour-diffusion method at 291 K. Diffraction-qualitymore » orthorhombic crystals belong to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 49.13, b = 114.94, c = 75.69 Å. A SAD data set from a Gd-HPDO3A-derivatized CbpF crystal was collected to 2.1 Å resolution at the gadolinium L{sub III} absorption edge using synchrotron radiation.« less

Is it Possible to have the Similar Unit Cell in Crystals of Different form from the same Macromolecule? (A Case Study of Ribosome Crystals)

NASA Technical Reports Server (NTRS)

Karpova, E. A.; Rose, M. Franklin (Technical Monitor)

2000-01-01

Three different types of ribosome crystals were grown by the vapor diffusion technique in hanging drops as described in (1,2). The ribosome is a large asymmetric RNA-protein complex (2.3 million Da), which is protein syntheses machinery of the cell. In this poster we would like to discuss the features of ribosome crystallization. Ribosomes were purified from the thermophilic bacteria Thermus thermophilus by centrifugation (3). Three types of crystals (needle, flat tetragonal and tetragonal-like pyramid) can be grown from the same solution; furthermore, in the same drop using 10-15% 2-methyl-2,4- pentanediol as a precipitant. The crystals appeared in 5-48 hours. The crystals were stable and can co-exist in solution over long period of time. The kinetics of appearance of different crystal forms was different: first the needle crystals were grown, then the tetragonal, and finally the tetragonal pyramids. Later studies of the process of ribosome crystal growth depending on supersaturation showed that low supersaturation results in the appearance of tetragonal plates or tetragonal-like pyramids. An electron microscopy study, together with computer modeling, has shown that crystals of different forms have a high probability of having the same unit cell parameters. According to these experiments the following conclusion can be dranvn: the level of supersaturation of the macromolecule in a crystallizing solution is one of the major factors for forming three-dimensional crystals convenient for X-rays diffraction analysis. From the same macromolecule solution, crystals of different forms can be grown at approximately the same conditions by varying the concentration of macromolecule in the solution. Ion-macromolecule and water-macromolecule interactions, apparently, play the main role in the formation of the unit cell of the crystals.

X-ray monochromators for high-power synchrotron radiation sources

NASA Astrophysics Data System (ADS)

Hart, Michael

1990-11-01

Exact solutions to the problems of power flow from a line source of heat into a semicylinder and of uniform heat flow normal to a flat surface are discussed. These lead to bounds on feasible designs and the boundary layer problem can be placed in proper perspective. While finite element calculations are useful if the sample boundaries are predefined, they are much less help in establishing design principles. Previous work on hot beam X-ray crystal optics has emphasised the importance of coolant hydraulics and boundary layer heat transfer. Instead this paper emphasises the importance of the elastic response of crystals to thermal strainfields and the importance of maintaining the Darwin reflectivity. The conclusions of this design study are that the diffracting crystal region should be thin, but not very thin, similar in area to the hot beam footprint, part of a thin-walked buckling crystal box and remote from the support to which the crystal is rigidly clamped. Prototype 111 and 220 cooled silicon crystals tested at the National Synchrotron Light Source at Brookhaven have almost perfect rocking curves under a beam heat load of {1}/{3}kW.

Gentle, fast and effective crystal soaking by acoustic dispensing

PubMed Central

Ng, Jia Tsing; Talon, Romain; Nekrosiute, Karolina; Krojer, Tobias; Douangamath, Alice; Brandao-Neto, Jose; Pearce, Nicholas M.; von Delft, Frank

2017-01-01

The steady expansion in the capacity of modern beamlines for high-throughput data collection, enabled by increasing X-ray brightness, capacity of robotics and detector speeds, has pushed the bottleneck upstream towards sample preparation. Even in ligand-binding studies using crystal soaking, the experiment best able to exploit beamline capacity, a primary limitation is the need for gentle and nontrivial soaking regimens such as stepwise concentration increases, even for robust and well characterized crystals. Here, the use of acoustic droplet ejection for the soaking of protein crystals with small molecules is described, and it is shown that it is both gentle on crystals and allows very high throughput, with 1000 unique soaks easily performed in under 10 min. In addition to having very low compound consumption (tens of nanolitres per sample), the positional precision of acoustic droplet ejection enables the targeted placement of the compound/solvent away from crystals and towards drop edges, allowing gradual diffusion of solvent across the drop. This ensures both an improvement in the reproducibility of X-ray diffraction and increased solvent tolerance of the crystals, thus enabling higher effective compound-soaking concentrations. The technique is detailed here with examples from the protein target JMJD2D, a histone lysine demethylase with roles in cancer and the focus of active structure-based drug-design efforts. PMID:28291760

Acoustically induced oscillation and rotation of a large drop in space

NASA Astrophysics Data System (ADS)

Jacobi, N.; Croonquist, A. P.; Elleman, D. D.; Wang, T. G.

1982-03-01

A 2.5 cm diameter water drop was successfully deployed and manipulated in a triaxial acoustic resonance chamber during a 240 sec low-gravity SPAR rocket flight. Oscillation and rotation were induced by modulating and phase shifting the signals to the speakers. Portions of the film record were digitized and analyzed. Spectral analysis brought out the n = 2, 3, 4 free oscillation modes of the drop, its very low-frequency center-of-mass motion in the acoustic potential well, and the forced oscillation frequency. The drop boundaries were least-square fitted to general ellipses, providing eccentricities of the distorted drop. The normalized equatorial area of the rotating drop was plotted vs a rotational parameter, and was in excellent agreement with values derived from the theory of equilibrium shapes of rotating liquid drops.

Oscillations of a deformed liquid drop in an acoustic field

NASA Astrophysics Data System (ADS)

Shi, Tao; Apfel, Robert E.

1995-07-01

The oscillations of an axially symmetric liquid drop in an acoustic standing wave field in air have been studied using the boundary integral method. The interaction between the drop oscillation and sound field has been included in this analysis. Our computations focus on the frequency shift of small-amplitude oscillations of an acoustically deformed drop typical of a drop levitated in air. In the presence or absence of gravity, the trend and the magnitude of the frequency shift have been given in terms of drop size, drop deformation, and the strength of the sound field. Our calculations are compared with experiments performed on the United States Microgravity Laboratory (USML-1) and with ground-based measurements, and are found to be in good agreement within the accuracy of the experimental data.

A STUDY OF DISLOCATION STRUCTURE OF SUBBOUNDARIES IN MOLYBDENUM SINGLE CRYSTALS,

DTIC Science & Technology

MOLYBDENUM, *DISLOCATIONS), GRAIN STRUCTURES(METALLURGY), SINGLE CRYSTALS, ZONE MELTING, ELECTRON BEAM MELTING, GRAIN BOUNDARIES, MATHEMATICAL ANALYSIS, ETCHED CRYSTALS, ETCHING, ELECTROEROSIVE MACHINING, CHINA

Comment on 'Power loss in open cavity diodes and a modified Child-Langmuir law' [Phys. Plasmas 12, 093102 (2005)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swanekamp, S. B.; Ottinger, P. F.

In this Comment, it is shown that no modification of the Child-Langmuir law [Phys. Rev.32, 492 (1911); Phys. Rev. 2, 450 (1913)] is necessary to treat the space-charge-limited flow from a diode with an open boundary as reported in Phys. Plasmas 12, 093102 (2005). The open boundary condition in their simulations can be represented by a voltage source and a resistor whose value is the vacuum-wave impedance of the opening. The diode can be represented as a variable resistor whose value depends on the voltage drop across the diode (as measured by the line integral of E across the diodemore » gap). This is a simple voltage-divider circuit whose analysis shows that the real diode voltage drops as the vacuum-wave impedance increases. Furthermore, it is shown that in equilibrium, the voltage drop between the anode and cathode is independent of the path chosen for the line integral of the electric field so that E=-{nabla}{phi} is valid. In this case, the equations of electrostatics are applicable. This clearly demonstrates that the electric field is electrostatic and static fields DO NOT RADIATE. It is shown that the diode voltage drops as the vacuum wave impedance increases and the current drops according to the Child-Langmuir law. Therefore, the observed drop in circuit current can be explained by a real drop in voltage across the diode and not an effective drop as claimed by the authors.« less

Crystallization of the glassy phase of grain boundaries in silicon nitride

NASA Technical Reports Server (NTRS)

Jefferson, D. A.; Thomas, J. M.; Wen, S.

1984-01-01

Three types of hot-pressed silicon nitride specimens (containing 5wt% Y2O3 and 2wt% Al2O3 additives) which were subjected to different temperature heat treatments were studied by X-ray diffraction, X-ray microanalysis and high resolution electron microscopy. The results indicated that there were phase changes in the grain boundaries after heat treatment and the glassy phase at the grain boundaries was crystallized by heat treatment.

Purification, identification and preliminary crystallographic studies of an allergenic protein from Lathyrus sativus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qureshi, Insaf A.; Sethi, Dhruv K.; Salunke, Dinakar M., E-mail: dinakar@nii.res.in

2006-09-01

A 24 kDa protein was purified from the seeds of L. sativus by ammonium sulfate fractionation and ion-exchange chromatography. Crystals were obtained by the hanging-drop vapour-diffusion method. A 24 kDa protein was purified from the seeds of Lathyrus sativus by ammonium sulfate fractionation and ion-exchange chromatography. The N-terminal amino-acid sequence showed significant homology with the 2S albumin class of seed storage proteins. The protein showed 85% sequence homology with the seed albumin of Pisum sativum within the 40 N-terminal residues. Crystals were obtained by the hanging-drop vapour-diffusion method. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cellmore » parameters a = 43.5, b = 82.7, c = 153.4 Å.« less

Soliton-like defects in nematic liquid crystal thin layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chuvyrov, A. N.; Krekhov, A. P.; Lebedev, Yu. A., E-mail: lebedev@anrb.ru

The nonsingular soliton-like defects in plane nematic liquid crystal (NLC) layers and spherical NLC drops are experimentally detected and studied when the interaction of NLC molecules with a bounding surface is varied. The dynamics and the annihilation of nonsingular defects of opposite signs on a plane surface are investigated. Periodic transformations of the soliton-like defects in NLC drops in an electric field are detected. The theory of elasticity is used to show that the surface energy taken into account in the total free energy of NLC in the case of weak anchoring leads to the possibility of nonsingular solutions ofmore » a director equilibrium equation. The calculated pictures of director distribution in a plane NLC layer and in a spherical NLC drop characterized by weak surface anchoring agree well with the results of polarized light optical observations.« less

Control of solvent evaporation in hen egg white lysozyme crystallization

NASA Technical Reports Server (NTRS)

Wilson, L. J.; Suddath, F. L.

1992-01-01

An investigation of the role of solvent evaporation in tetragonal lysozyme crystallization was preformed with a device that employs N2(g) to control the evaporation of solvent from a micro-volume crystallization hanging drop. The number of crystals was found to vary with the rate at which the final supersaturation level was achieved. It was found that the more rapid the approach to supersaturation the larger the number of crystals. Accordingly, the crystals reached a smaller terminal size. Elongation of the (110) face parallel to the four-fold axis was observed with the slower evaporation rates.

Preliminary investigations of protein crystal growth using the Space Shuttle

NASA Technical Reports Server (NTRS)

Delucas, L. J.; Suddath, F. L.; Snyder, R.; Naumann, R.; Broom, M. B.; Pusey, M.; Yost, V.; Herren, B .; Carter, D.

1986-01-01

Four preliminary Shuttle experiments are described which have been used to develop prototype hardware for a more advanced system that will evaluate effects of gravity on protein crystal growth. The first phase of these experiments has centered on the development of micromethods for protein crystal growth by vapor-diffusion techniques (using a space version of the hanging-drop method) and on dialysis using microdialysis cells. Results suggest that the elimination of density-driven sedimentation can effect crystal morphology. In the dialysis experiment, space-grown crystals of concanavalin B were three times longer and 1/3 the thickness of earth-grown crystals.

Characterization and optimization of 3D-LCD module design

NASA Astrophysics Data System (ADS)

van Berkel, Cees; Clarke, John A.

1997-05-01

Autostereoscopic displays with flat panel liquid crystal display and lenticular sheets are receiving much attention. Multiview 3D-LCD is truly autostereoscopic because no head tracking is necessary and the technology is well poised to become a mass market consumer 3D display medium as the price of liquid crystal displays continues to drop. Making the viewing experience as natural as possible is of prime importance. The main challenges are to reduce the picket fence effect of the black mask and to try to get away with as few perspective views as possible. Our solution is to 'blur' the boundaries between the views. This hides the black mask image by spreading it out and softens the transition between one view and the next, encouraging the user to perceive 'solid objects' instead of a succession of flipping views. One way to achieve this is by introducing a new pixel design in which the pixels are slanted with respect to the column direction. Another way is to place the lenticular at a small (9.46 degree) angle with respect to the LCD columns. The effect of either method is that, as the observer moves sideways in front of the display, he always 'sees' a constant amount of black mask. This renders the black mask, in effect, invisible and eliminates the picket fence effect.

Protein crystal growth in space

NASA Technical Reports Server (NTRS)

Bugg, C. E.; Clifford, D. W.

1987-01-01

The advantages of protein crystallization in space, and the applications of protein crystallography to drug design, protein engineering, and the design of synthetic vaccines are examined. The steps involved in using protein crystallography to determine the three-dimensional structure of a protein are discussed. The growth chamber design and the hand-held apparatus developed for protein crystal growth by vapor diffusion techniques (hanging-drop method) are described; the experimental data from the four Shuttle missions are utilized to develop hardware for protein crystal growth in space and to evaluate the effects of gravity on protein crystal growth.

Drop evaporation in a single-axis acoustic levitator

NASA Technical Reports Server (NTRS)

Lierke, E. G.; Croonquist, A. P.

1990-01-01

A 20 kHz single-axis acoustic positioner is used to levitate aqueous-solution drops (volumes less than or approximately equal to 100 micro-liters). Drop evaporation rates are measured under ambient, isothermal conditions for different relative humidities. Acoustic convection around the levitated sample enhances the mass loss over that due to natural convection and diffusion. A theoretical treatment of the mass flow is developed in analogy to previous studies of the heat transfer from a sphere in an acoustic field. Predictions of the enhanced mass loss, in the form of Nusselt (Sherwood) numbers, are compared with observed rages of drop shrinking. The work is part of an ESA crystal growth from levitated solution drops.

Twin Crystal Induced near Zero Thermal Expansion in SnO2 Nanowires.

PubMed

Zhu, He; Li, Qiang; Yang, Chao; Zhang, Qinghua; Ren, Yang; Gao, Qilong; Wang, Na; Lin, Kun; Deng, Jinxia; Chen, Jun; Gu, Lin; Hong, Jiawang; Xing, Xianran

2018-06-20

Knowledge of controllable thermal expansion is a fundamental issue in the field of materials science and engineering. Direct blocking of the thermal expansions in positive thermal expansion materials is a challenging but fascinating task. Here we report a near zero thermal expansion (ZTE) of SnO 2 achieved from twin crystal nanowires, which is highly correlated to the twin boundaries. Local structural evolutions followed by pair distribution function revealed a remarkable thermal local distortion along the twin boundary. Lattice dynamics investigated by Raman scattering evidenced the hardening of phonon frequency induced by the twin crystal compressing, giving rise to the ZTE of SnO 2 nanowires. Further DFT calculation of Grüneisen parameters confirms the key role of compressive stress on ZTE. Our results provide an insight into the thermal expansion behavior regarding to twin crystal boundaries, which could be beneficial to the applications.

Multiple seeding for the growth of bulk GdBCO-Ag superconductors with single grain behaviour

NASA Astrophysics Data System (ADS)

Shi, Y.; Durrell, J. H.; Dennis, A. R.; Huang, K.; Namburi, D. K.; Zhou, D.; Cardwell, D. A.

2017-01-01

Rare earth-barium-copper oxide bulk superconductors fabricated in large or complicated geometries are required for a variety of engineering applications. Initiating crystal growth from multiple seeds reduces the time taken to melt-process individual samples and can reduce the problem of poor crystal texture away from the seed. Grain boundaries between regions of independent crystal growth can reduce significantly the flow of current due to crystallographic misalignment and the agglomeration of impurity phases. Enhanced supercurrent flow at such boundaries has been achieved by minimising the depth of the boundary between A growth sectors generated during the melt growth process by reducing second phase agglomerations and by a new technique for initiating crystal growth that minimises the misalignment between different growth regions. The trapped magnetic fields measured for the resulting samples exhibit a single trapped field peak indicating they are equivalent to conventional single grains.

The LPO Iron Pattern beneath the Earth's Inner Core Boundary

NASA Astrophysics Data System (ADS)

Mattesini, Maurizio; Belonoshko, Anatoly; Tkalčić, Hrvoje

2017-04-01

An Earth's inner core surface pattern for the iron Lattice Preferred Orientation (LPO) has been addressed for various iron crystal polymorphs. The geographical distribution of the amount of crystal alienation was achieved by bridging high-quality inner core probing seismic data [PKP(bc-df)] together with ab initio computed elastic constants. We show that the proposed topographic crystal alignment may be used as a boundary condition for dynamo simulations, providing an additional way to discriminate in between different and, often controversial, geodynamical scenarios.

The LPO Iron Pattern beneath the Earth's Inner Core Boundary

NASA Astrophysics Data System (ADS)

Mattesini, M.; Tkalcic, H.; Belonoshko, A. B.; Buforn, E.; Udias, A.

2015-12-01

An Earth's inner core surface pattern for the iron Lattice Preferred Orientation (LPO) has been addressed for various iron crystal polymorphs. The geographical distribution of the amount of crystal alienation was achieved by bridging high-quality inner core probing seismic data [PKP(bc-df)] together with ab initio computed elastic constants. We show that the proposed topographic crystal alignment may be used as a boundary condition for dynamo simulations, providing an additional way to discriminate in between different and, often controversial, geodynamical scenarios.

In-situ observation of impurity diffusion boundary layer in silicon Czochralski growth

NASA Astrophysics Data System (ADS)

Kakimoto, Koichi; Eguchi, Minoru; Watanabe, Hisao; Hibiya, Taketoshi

1990-01-01

In-situ observation of the impurity diffusion boundary layer during single crystal growth of indium-doped silicon was carried out by X-ray radiography. The difference in the transmitted X-ray image compared with molten silicon just beneath the crystal-melt interface was attributed to the concentration of indium impurities having a larger absorption coefficient. The intensity profile of the transmitted X-ray can be reproduced by a transmittance calculation that considers the meniscus shape and impurity distribution. The impurity distribution profile near the crystal-melt interface was estimated using the Burton-Prim-Slichter (BPS) equation. The observed impurity diffusion boundary layer thickness was about 0.5 mm. It was found that the boundary layer thickness was not constant in the radial direction, which cannot be explained by the BPS theory, since it is based on a one-dimensional calculation.

Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

PubMed

Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

1987-11-01

Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

What’s in a drop? Correlating observations and outcomes to guide macromolecular crystallization experiments

PubMed Central

Luft, Joseph R.; Wolfley, Jennifer R.; Snell, Edward H.

2011-01-01

Observations of crystallization experiments are classified as specific outcomes and integrated through a phase diagram to visualize solubility and thereby direct subsequent experiments. Specific examples are taken from our high-throughput crystallization laboratory which provided a broad scope of data from 20 million crystallization experiments on 12,500 different biological macromolecules. The methods and rationale are broadly and generally applicable in any crystallization laboratory. Through a combination of incomplete factorial sampling of crystallization cocktails, standard outcome classifications, visualization of outcomes as they relate chemically and application of a simple phase diagram approach we demonstrate how to logically design subsequent crystallization experiments. PMID:21643490

A soft porous drop in linear flows

NASA Astrophysics Data System (ADS)

Young, Yuan-Nan; Miksis, Michael; Mori, Yoichiro; Shelley, Michael

2017-11-01

The cellular cytoplasm consists a viscous fluid filled with fibrous networks that also have their own dynamics. Such fluid-structure interactions have been modeled as a soft porous material immersed in a viscous fluid. In this talk we focus on the hydrodynamics of a viscous drop filled with soft porous material inside. Suspended in a Stokes flow, such a porous viscous drop is allowed to deform, both the drop interface and the porous structures inside. Special focus is on the deformation dynamics of both the porosity and the shape of the drop under simple flows such as a uniform streaming flow and linear flows. We examine the effects of flow boundary conditions at interface between the porous drop and the surrounding viscous fluid. We also examine the dynamics of a porous drop with active stress from the porous network.

Drop interaction with solid boundaries in liquid/liquid systems

NASA Astrophysics Data System (ADS)

Bordoloi, Ankur Deep

The present experimental work was motivated primarily by the CO 2 sequestration process. In a possible scenario during this process, gravity driven CO2 bubbles coalesce at an interface near the rock surface. In another scenario, trapped CO2 fluid may escape from a porous matrix overcoming interfacial force inside a pore. Based on these potential scenarios, the current research was divided into two broad experimental studies. In the first part, coalescence at a quiescent interface of two analogous fluids (silicone oil and water/glycerin mixture) was investigated for water/glycerin drops with Bond number (Bo) ~7 and Ohnesorge number ~ 0.01 using high-speed imaging and time-resolved tomographic PIV. Two perturbation cases with a solid particle wetted in oil and water/glycerin placed adjacent to the coalescing drop were considered. The results were compared with coalescence of a single drop and that of a drop neighBored by a second drop of equivalent size. Each perturbing object caused an initial tilting of the drop, influencing its rupture location, subsequent film retraction and eventual collapse behavior. Once tilted, drops typically ruptured near their lowest vertical position which was located either toward or away from the perturbing object depending on the case. The trends in local retraction speed of the ruptured film and the overall dynamics of the collapsing drops were discussed in detail. In the second part, the motion of gravity driven drops (B o~0.8-11) through a confining orifice d/D<1) was studied using high speed imaging and planar PIV. Drops of water/glycerin, surrounded by silicone oil, fall toward and encounter the orifice plate after reaching terminal speed. The effects of surface wettability were investigated for Both round-edged and sharp-edged orifices. For the round-edged case, a thin film of surrounding oil prevented the drop fluid from contacting the orifice surface, such that the flow outcomes of the drops were independent of surface wettability. For d/D<0.8, the Boundary between drop capture and release depended on a modified Bond number relating drop gravitational time scale to orifice surface tension time scale. For the sharp-edged case, contact was initiated at the orifice edge immediately upon impact, such that surface wettability influenced the drop outcome.

Changes in magnetic domain structure during twin boundary motion in single crystal Ni-Mn-Ga exhibiting magnetic shape memory effect

NASA Astrophysics Data System (ADS)

Kopecký, V.; Fekete, L.; Perevertov, O.; Heczko, O.

2016-05-01

The complexity of Ni-Mn-Ga single crystal originates from the interplay between ferromagnetic domain structure and ferroelastic twinned microstructure. Magnetic domain structure in the vicinity of single twin boundary was studied using magneto-optical indicator film and magnetic force microscopy technique. The single twin boundary of Type I was formed mechanically and an initial magnetization state in both variants were restored by local application of magnetic field (≈40 kA/m). The differently oriented variants exhibited either stripe or labyrinth magnetic domain pattern in agreement with the uniaxial magnetocrystalline anisotropy of the martensite. The twin boundary was then moved by compressive or tensile stress. The passage of the boundary resulted in the formation of granular or rake domains, respectively. Additionally, the specific magnetic domains pattern projected by twin boundary gradually vanished during twin boundary motion.

Grain-Boundary Roughening in Colloidal Crystals

NASA Astrophysics Data System (ADS)

Liao, Maijia; Xiao, Xiao; Chui, Siu Tat; Han, Yilong

2018-04-01

In polycrystals, faceted grains may become round and rough at high temperatures. Such a roughening phenomenon remains poorly understood, partly because of the lack of experimental observations. Here, we directly visualize the roughening dynamics of grain boundaries inside thin-film colloidal crystals at the single-particle level using video microscopy. The thermal fluctuations of grain boundaries appear to exhibit both static and dynamic critical-like behaviors, in contrast to the Kosterlitz-Thouless transition in typical free surface roughening. The roughening point shifts towards the melting point as the grain boundary's mismatch angle θ decreases and is preempted by melting when θ <18 ° . Counterintuitively, the amplitude of grain-boundary fluctuations decreases above the roughening point. This could be attributed to the observed widening of the grain boundary. The roughening strongly affects the mobility of the grain boundary but not the stiffness. These results provide new guidance for the control of microstructures in polycrystals and further development of roughening theory.

Factors affecting the morphology of isocitrate lyase crystals

NASA Technical Reports Server (NTRS)

Demattei, Robert C.; Feigelson, Robert S.; Weber, Patricia C.

1992-01-01

Isocitrate lyase crystals have been grown by the hanging drop vapor equilibration method in both 1-g and microgravity and by vapor equilibrium in small capillaries. The crystal morphologies obtained have ranged from dendritic to 'octagonal' prisms. Theoretical evaporation models have been applied to these growth regimes. The results of these analyses along with other experimental results, indicate the factors which must be controlled to produce good growth morphologies.

Purification and crystallization of the ABC-type transport substrate-binding protein OppA from Thermoanaerobacter tengcongensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Jinlan; Li, Xiaolu; Tsinghua-Peking Joint Center for Life Sciences, Center for Structural Biology, School of Life Sciences, Tsinghua University, Beijing 100084, People's Republic of China

2012-06-22

Highlights: Black-Right-Pointing-Pointer We truncated the signal peptide of OppA{sub TTE0054} to make it express in Escherichia coli as a soluble protein. Black-Right-Pointing-Pointer Crystals of OppA{sub TTE0054} were grown by sitting-drop vapor diffusion method. Black-Right-Pointing-Pointer The crystal of OppA{sub TTE0054} diffracted to 2.25 A. -- Abstract: Di- and oligopeptide- binding protein OppAs play important roles in solute and nutrient uptake, sporulation, biofilm formation, cell wall muropeptides recycling, peptide-dependent quorum-sensing responses, adherence to host cells, and a variety of other biological processes. Soluble OppA from Thermoanaerobacter tengcongensis was expressed in Escherichia coli. The protein was found to be >95% pure with SDS-PAGEmore » after a series of purification steps and the purity was further verified by mass spectrometry. The protein was crystallized using the sitting-drop vapour-diffusion method with PEG 400 as the precipitant. Crystal diffraction extended to 2.25 A. The crystal belonged to space group C222{sub 1}, with unit-cell parameters of a = 69.395, b = 199.572, c = 131.673 A, and {alpha} = {beta} = {gamma} = 90 Degree-Sign .« less

Containerless crystallization of silicon

NASA Astrophysics Data System (ADS)

Kuribayashi, K.; Aoyama, T.

2002-04-01

Crystallization from undercooled melt of silicon was carried out by means of electro-magnetic levitation method under controlled undercooling. The measured growth rate vs. undercooling was categorized into three regions, I, II and III, respectively, from the point of the interface morphology. Thin plate crystals whose interface consisted of both faceted (1 1 1) plane and wavy edge plane like saw-tooth were observed in the region I where the undercooling is less than 100 K. The growth rate of the wavy edge plane was well described by the dendrite growth model. The morphology of growing crystals was abruptly changed to faceted dendrite in the region II, though there was no abrupt change in the growth rate. Seeding at temperatures in the region I changes the drop to a mono-crystalline sphere, if the growth rate along the normal direction of the thin plate crystal is controlled by step-wise growth on the faceted plane. Actually, the sample of 5 mm in diameter seeded at undercooling of 26 K was a quasi-single crystal with large grain, except for a small area where twinning and cracking are observed. The result suggests that the single crystal could be grown, if a smaller sample, 1 or 2 mm in diameter, that is difficult to be levitated by electro-magnetic force were processed with other methods such as free fall in a drop tube.

Crystallization and preliminary X-ray diffraction analysis of central structure domains from mumps virus F protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yueyong; Xu, Yanhui; Zhu, Jieqing

2005-09-01

Single crystals of the central structure domains from mumps virus F protein have been obtained by the hanging-drop vapour-diffusion method. A diffraction data set has been collected to 2.2 Å resolution. Fusion of members of the Paramyxoviridae family involves two glycoproteins: the attachment protein and the fusion protein. Changes in the fusion-protein conformation were caused by binding of the attachment protein to the cellular receptor. In the membrane-fusion process, two highly conserved heptad-repeat (HR) regions, HR1 and HR2, are believed to form a stable six-helix coiled-coil bundle. However, no crystal structure has yet been determined for this state in themore » mumps virus (MuV, a member of the Paramyxoviridae family). In this study, a single-chain protein consisting of two HR regions connected by a flexible amino-acid linker (named 2-Helix) was expressed, purified and crystallized by the hanging-drop vapour-diffusion method. A complete X-ray data set was obtained in-house to 2.2 Å resolution from a single crystal. The crystal belongs to space group C2, with unit-cell parameters a = 161.2, b = 60.8, c = 40.1 Å, β = 98.4°. The crystal structure will help in understanding the molecular mechanism of Paramyxoviridae family membrane fusion.« less

In situ study of the growth and degradation processes in tetragonal lysozyme crystals on a silicon substrate by high-resolution X-ray diffractometry

NASA Astrophysics Data System (ADS)

Kovalchuk, M. V.; Prosekov, P. A.; Marchenkova, M. A.; Blagov, A. E.; D'yakova, Yu. A.; Tereshchenko, E. Yu.; Pisarevskii, Yu. V.; Kondratev, O. A.

2014-09-01

The results of an in situ study of the growth of tetragonal lysozyme crystals by high-resolution X-ray diffractometry are considered. The crystals are grown by the sitting-drop method on crystalline silicon substrates of different types: both on smooth substrates and substrates with artificial surface-relief structures using graphoepitaxy. The crystals are grown in a special hermetically closed crystallization cell, which enables one to obtain images with an optical microscope and perform in situ X-ray diffraction studies in the course of crystal growth. Measurements for lysozyme crystals were carried out in different stages of the crystallization process, including crystal nucleation and growth, developed crystals, the degradation of the crystal structure, and complete destruction.

Protein crystal growth results from shuttle flight 51-F

NASA Technical Reports Server (NTRS)

Bugg, C. E.

1985-01-01

The protein crystal growth (PCG) experiments run on 51-F were analyzed. It was found that: (1) sample stability is increased over that observed during the experiments on flight 51-D; (2) the dialysis experiments produced lysozyme crystals that were significantly larger than those obtained in our identical ground-based studies; (3) temperature fluctuations apparently caused problems during the crystallization experiments on 51-F; (4) it is indicated that teflon tape stabilizes droplets on the syringe tips; (5) samples survived during the reentry and landing in glass tips that were not stoppered with plungers; (6) from the ground-based studies, it was expected that equilibration should be complete within 2 to 4 days for all of these vapor-diffusion experiments, thus it appears that the vapor diffusion rates are somewhat slower under microgravity conditions; (7) drop tethering was highly successful, all four of the tethered drops were stable, even though they contained MPD solutions; (8) the PCG experiments on 51-F were done to assess the hardware and experimental procedures that are developed for future flights, when temperature control will be available. Lysozyme crystals obtained by microdialysis are considerably larger than those obtained on the ground, using the identical apparatus and procedures.

Covalently Connecting Crystal Grains with Polyvinylammonium Carbochain Backbone To Suppress Grain Boundaries for Long-Term Stable Perovskite Solar Cells.

PubMed

Li, Han; Liang, Chao; Liu, Yingliang; Zhang, Yiqiang; Tong, Jincheng; Zuo, Weiwei; Xu, Shengang; Shao, Guosheng; Cao, Shaokui

2017-02-22

Grain boundaries act as rapid pathways for nonradiative carrier recombination, anion migration, and water corrosion, leading to low efficiency and poor stability of organometal halide perovskite solar cells (PSCs). In this work, the strategy suppressing the crystal grain boundaries is applied to improve the photovoltaic performance, especially moisture-resistant stability, with polyvinylammonium carbochain backbone covalently connecting the perovskite crystal grains. This cationic polyelectrolyte additive serves as nucleation sites and template for crystal growth of MAPbI 3 and afterward the immobilized adjacent crystal grains grow into the continuous compact, pinhole-free perovskite layer. As a result, the unsealed PSC devices, which are fabricated under low-temperature fabrication protocol with a proper content of polymer additive PVAm·HI, currently exhibit the maximum efficiency of 16.3%. Remarkably, these unsealed devices follow an "outside-in" corrosion mechanism and respectively retain 92% and 80% of the initial PCE value after being exposed under ambient environment for 50 days and 100 days, indicating the superiority of carbochain polymer additives in solving the long-term stability problem of PSCs.

A simple technique to reduce evaporation of crystallization droplets by using plate lids with apertures for adding liquids

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zipper, Lauren E.; Binghamton University, 4400 Vestal Parkway East, Vestal, NY 13902; Aristide, Xavier

This article describes the use of evaporation control lids that are fitted to crystallization plates to improve the reproducibility of trials using as little as 5 nl. The plate lids contain apertures which are large enough for the transfer of protein containing droplets, but small enough to greatly reduce the rate of evaporation during the time needed to prepare the plate. A method is described for using plate lids to reduce evaporation in low-volume vapor-diffusion crystallization experiments. The plate lids contain apertures through which the protein and precipitants were added to different crystallization microplates (the reservoir was filled before fittingmore » the lids). Plate lids were designed for each of these commonly used crystallization microplates. This system minimizes the dehydration of crystallization droplets containing just a few nanolitres of protein and precipitant, and results in more reproducible diffraction from the crystals. For each lid design, changes in the weight of the plates were used to deduce the rate of evaporation under different conditions of temperature, air movement, droplet size and precipitant. For comparison, the state of dehydration was also visually assessed throughout the experiment. Finally, X-ray diffraction methods were used to compare the diffraction of protein crystals that were conventionally prepared against those that were prepared on plates with plate lids. The measurements revealed that the plate lids reduced the rate of evaporation by 63–82%. Crystals grown in 5 nl drops that were set up with plate lids diffracted to higher resolution than similar crystals from drops that were set up without plate lids. The results demonstrate that plate lids can be instrumental for improving few-nanolitre crystallizations.« less

Initial drop size and velocity distributions for airblast coaxial atomizers

NASA Technical Reports Server (NTRS)

Eroglu, H.; Chigier, N.

1991-01-01

Phase Doppler measurements were used to determine initial drop size and velocity distributions after a complete disintegration of coaxial liquid jets. The Sauter mean diameter (SMD) distribution was found to be strongly affected by the structure and behavior of the preceding liquid intact jet. The axial measurement stations were determined from the photographs of the coaxial liquid jet at very short distances (1-2 mm) downstream of the observed break-up locations. Minimum droplet mean velocities were found at the center, and maximum velocities were near the spray boundary. Size-velocity correlations show that the velocity of larger drops did not change with drop size. Drop rms velocity distributions have double peaks whose radial positions coincide with the maximum mean velocity gradients.

Infiltration metasomatism within the Rum layered intrusion (Scotland)

NASA Astrophysics Data System (ADS)

Leuthold, J.; Blundy, J.; Holness, M.

2012-04-01

The well studied Rum Isle layered intrusion was built up by emplacement of a series of 15 macro-rhythmic units. Magma intruded 60.53±0.08 Ma (Hamilton et al., 1998), at a pressure <0.5 kbar (Holness, 1999). Units are composed of feldspathic peridotite at the base, overlain by troctolite and gabbro. Layering is induced by fractional crystallization from picritic magma (Upton et al., 2002; Holness et al., 2007). Rum magma liquid line of descent is complicated by reactive melt percolation within crystal mushes, either originating from continuous compaction of the cumulate pile or from a newly injected reactive picritic magma. The studied Unit 9 sequence is well known for the injection of a picritic sill within the layered intrusion. Clinopyroxene textures are very diverse above the Unit 9 intrusive picritic sill. (1) Late-stage interstitial crystals occur in the basal intrusive peridotite, corresponding to the picritic sill. The Cr2O3 content varies from 1.2 to 0.6 wt% along core to rim profiles. (2) Within the overlying troctolite, poikilitic crystals (up to 2 cm in diameter) enclose randomly oriented plagioclase and olivine, wrapped by a foliated troctolitic assemblage. Within the first 3 meters, the Cr2O3 composition of the few clinopyroxene crystals is very similar to the underlying peridotite one, but it then drops to lower concentration (0.5 to 0 wt%). The plagioclase-clinopyroxene-plagioclase median dihedral angle also decreases from ~90° to ~80° (Sides, 2008). The Cr2O3 content increases progressively towards the troctolite-gabbro wavy horizon. Gabbroic enclaves occur within the troctolite. (3) Cumulus clinopyroxene grains occur in the summit gabbro. Their Cr2O3 content regularly decreases from 1.2-0.8 to 0.7-0.3 across the gabbro pile. Cr-spinel crystals are rare. Median plagioclase-clinopyroxene-plagioclase dihedral angles evolve from ~85° to ~95°. We propose that troctolites, that contain gabbroic enclaves, result from clinopyroxene primocryst dissolution from a gabbroic crystal mush, when intruded by subsequent clinopyroxene under-saturated peridotite sills, dykes or fingers. Due to disequilibrium between crystals and invading magma, clinopyroxene is dissolved from the mush, leading progressively to saturation of the percolating magma (Holness et al., 2007) while Cr-spinel crystallizes. After transport along grain boundaries, Cr2O3-poor clinopyroxene is re-precipitated interstitially.

Thermocapillary-Induced Phase Separation with Coalescence

NASA Technical Reports Server (NTRS)

Davis, Robert H.

2003-01-01

Research has been undertaken on interactions of two or more deformable drops (or bubbles) in a viscous fluid and subject to a temperature, gravitational, or flow field. An asymptotic theory for nearly spherical drops shows that small deformations reduce the coalescence and phase separation rates. Boundary-integral simulations for large deformations show that bubbles experience alignment and enhanced coalescence, whereas more viscous drops may break as a result of hydrodynamic interactions. Experiments for buoyancy motion confirm these observations. Simulations of the sedimentation of many drops show clustering phenomena due to deformations, which lead to enhanced phase separation rates, and simulations of sheared emulsions show that deformations cause a reduction in the effective viscosity.

Affordance Boundaries Are Defined by Dynamic Capabilities of Parkour Athletes in Dropping from Various Heights

PubMed Central

Croft, James L.; Bertram, John E. A.

2017-01-01

Available behaviors are determined by the fit between features of the individual and reciprocal features of the environment. Beyond some critical boundary certain behaviors become impossible causing sudden transitions from one movement pattern to another. Parkour athletes have developed multiple movement patterns to deal with their momentum during landing. We were interested in whether drop distance would cause a sudden transition between a two-footed (precision) landing and a load-distributing roll and whether the transition height could be predicted by dynamic and geometric characteristics of individual subjects. Kinematics and ground reaction forces were measured as Parkour athletes stepped off a box from heights that were incrementally increased or decreased from 0.6 to 2.3 m. Individuals were more likely to roll from higher drops; those with greater body mass and less explosive leg power, were more likely to transition to a roll landing at a lower height. At some height a two-footed landing is no longer feasible but for some athletes this height was well within the maximum drop height used in this study. During low drops the primary task constraint of managing momentum could be achieved with either a precision landing or a roll. This meant that participants were free to select their preferred landing strategy, which was only partially influenced by the physical demands of the task. However, athletes with greater leg power appeared capable of managing impulse absorption through a leg mediated strategy up to a greater drop height. PMID:28979219

Spatially resolved resistivity near the vortex lattice phase transition in Bi 2Sr 2CaCu 2O 8+δ single crystals

NASA Astrophysics Data System (ADS)

Berseth, V.; Indenbom, M. V.; van der Beek, C. J.; D'Anna, G.; Benoit, W.

1997-08-01

Using a multiterminal contact configuration, we investigate the local variations of the resistivity drop near the vortex lattice first order phase transition in a very homogeneous Bi2Sr2CaCu2O8+δ (BSCCO) single crystal.

Single-drop optimization of protein crystallization.

PubMed

Meyer, Arne; Dierks, Karsten; Hilterhaus, Dierk; Klupsch, Thomas; Mühlig, Peter; Kleesiek, Jens; Schöpflin, Robert; Einspahr, Howard; Hilgenfeld, Rolf; Betzel, Christian

2012-08-01

A completely new crystal-growth device has been developed that permits charting a course across the phase diagram to produce crystalline samples optimized for diffraction experiments. The utility of the device is demonstrated for the production of crystals for the traditional X-ray diffraction data-collection experiment, of microcrystals optimal for data-collection experiments at a modern microbeam insertion-device synchrotron beamline and of nanocrystals required for data collection on an X-ray laser beamline.

Timescale of Destabilization of a Magma Ocean Cumulate

NASA Astrophysics Data System (ADS)

Morison, A.; Labrosse, S.; Deguen, R.; Alboussiere, T.

2017-12-01

A common scenario considered during the formation of terrestrial planets is the crystallization of a global magma ocean from the bottom-up. The crystallization of the surface magma ocean is expected to be rapid, on a timescale of the order of 1 Myr. This has lead several authors to assume convection in the solid part of the crystallizing mantle only sets out after the complete solidification of the surface magma ocean. Assuming fractionnal crystallization of this ocean, the magma (and resulting solid) is more and more enriched in FeO as the crystallization progresses. This leads to an unstable stratification and an overturn. After overturn, the resulting solid mantle would be strongly compositionally stratified. The present study tests the assumption that solid-state mantle overturn only occurs after complete crystallization of the surface magma ocean. We model convection in the solid part of the mantle only and parametrize the presence of a magma ocean with boundary conditions. Our model includes through these boundary conditions the possibility for matter to cross the boundary between the solid shell and the magma ocean by melting and freezing. We perfomed a linear stability analysis with respect to the temperature and compositional profiles obtained in a growing magma ocean cumulate to assess the destabilization timescale of such profiles as a function of the crystallized thickness. By comparing this timescale with a model of surface magma ocean crystallization, we deduce the time and crystallized thickness at which the convection timescale is comparable to the age of the solid crystallizing mantle. This time is found to be small ( 1 kyr) compared to the time needed to crystallize the entire surface magma ocean ( 1 Myr).

Experimental and computation study of liquid droplets impinging on an afterburner

NASA Astrophysics Data System (ADS)

Lavergne, G.; Hebrard, P.; Donnadille, Ph.

The actual development of three-dimensional computation codes of internal reactive flows in combustion chambers needs, for the liquid phase, accurate boundary conditions. A series of experiments was undertaken to identify and then to analyze physical phenomena occurring during spray transport and spray boundary interaction. The purpose of this paper is to investigate drop wall interaction, drop impingement, the liquid film, and the liquid flow rate captured by a flameholder. The experimental approach is divided in two parts: a parametric study on the captured fuel flow rate by a flameholder in an isothermal two-dimensional square facility, and a fundamental study of monosized droplet impingement on a hot plate to determine rebound criteria.

Features of bicrystal growth during the directional crystallization of metal melts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gubernatorov, V. V.; Sycheva, T. S., E-mail: sych@imp.uran.ru; Gundyrev, V. M.

2017-03-15

The factors responsible for the formation of different configurations of boundaries between adjacent crystallites during their growth from melt by Bridgman and Czochralski methods have been considered by an of example Fe–20 wt % Ga alloy and Ni bicrystals. It is found that the configuration of intercrystallite boundary is related to the features of crystallite growth, caused by the strained state of intercrystallite and interphase (crystal–melt) boundaries, the difference in the linear thermal expansion coefficients of the crystallite boundaries and bulk, and the shape (geometry) of the bicrystal cross section. It is suggested that the strained state of boundaries andmore » the formation of substructure in crystallites during directional crystallization from metal melt are significantly affected by their deformation under the melt weight.« less

Experimental and theoretical analysis of the rate of solvent equilibration in the hanging drop method of protein crystal growth

NASA Technical Reports Server (NTRS)

Fowlis, William W.; Delucas, Lawrence J.; Twigg, Pamela J.; Howard, Sandra B.; Meehan, Edward J.

1988-01-01

The principles of the hanging-drop method of crystal growth are discussed, and the rate of water evaporation in a water droplet (containing protein, buffer, and a precipitating agent) suspended above a well containing a double concentration of precipitating agent is investigated theoretically. It is shown that, on earth, the rate of evaporation may be determined from diffusion theory and the colligative properties of solutions. The parameters affecting the rate of evaporation include the temperature, the vapor pressure of water, the ionization constant of the salt, the volume of the drop, the contact angle between the droplet and the coverslip, the number of moles of salt in the droplet, the number of moles of water and salt in the well, the molar volumes of water and salt, the distance from the droplet to the well, and the coefficient of diffusion of water vapor through air. To test the theoretical equations, hanging-drop experiments were conducted using various reagent concentrations in 25-microliter droplets and measuring the evaporation times at 4 C and 25 C. The results showed good agreement with the theory.

Drop-on-Demand System for Manufacturing of Melt-based Solid Oral Dosage: Effect of Critical Process Parameters on Product Quality.

PubMed

Içten, Elçin; Giridhar, Arun; Nagy, Zoltan K; Reklaitis, Gintaras V

2016-04-01

The features of a drop-on-demand-based system developed for the manufacture of melt-based pharmaceuticals have been previously reported. In this paper, a supervisory control system, which is designed to ensure reproducible production of high quality of melt-based solid oral dosages, is presented. This control system enables the production of individual dosage forms with the desired critical quality attributes: amount of active ingredient and drug morphology by monitoring and controlling critical process parameters, such as drop size and product and process temperatures. The effects of these process parameters on the final product quality are investigated, and the properties of the produced dosage forms characterized using various techniques, such as Raman spectroscopy, optical microscopy, and dissolution testing. A crystallization temperature control strategy, including controlled temperature cycles, is presented to tailor the crystallization behavior of drug deposits and to achieve consistent drug morphology. This control strategy can be used to achieve the desired bioavailability of the drug by mitigating variations in the dissolution profiles. The supervisor control strategy enables the application of the drop-on-demand system to the production of individualized dosage required for personalized drug regimens.

Phase-field-crystal model for ordered crystals

NASA Astrophysics Data System (ADS)

Alster, Eli; Elder, K. R.; Hoyt, Jeffrey J.; Voorhees, Peter W.

2017-02-01

We describe a general method to model multicomponent ordered crystals using the phase-field-crystal (PFC) formalism. As a test case, a generic B2 compound is investigated. We are able to produce a line of either first-order or second-order order-disorder phase transitions, features that have not been incorporated in existing PFC approaches. Further, it is found that the only elastic constant for B2 that depends on ordering is C11. This B2 model is then used to study antiphase boundaries (APBs). The APBs are shown to reproduce classical mean-field results. Dynamical simulations of ordering across small-angle grain boundaries predict that dislocation cores pin the evolution of APBs.

Liquid Crystals

NASA Technical Reports Server (NTRS)

1990-01-01

Thermochromic liquid crystals, or TLCs, are a type of liquid crystals that react to changes in temperature by changing color. The Hallcrest/NASA collaboration involved development of a new way to visualize boundary layer transition in flight and in wind tunnel testing of aircraft wing and body surfaces. TLCs offered a new and potentially better method of visualizing the boundary layer transition in flight. Hallcrest provided a liquid crystal formulation technique that afforded great control over the sensitivity of the liquid crystals to varying conditions. Method is of great use to industry, government and universities for aerodynamic and hydrodynamic testing. Company's principal line is temperature indicating devices for industrial use, such as non-destructive testing and flaw detection in electric/electronic systems, medical application, such as diagnostic systems, for retail sale, such as room, refrigerator, baby bath and aquarium thermometers, and for advertising and promotion specials. Additionally, Hallcrest manufactures TLC mixtures for cosmetic applications, and liquid crystal battery tester for Duracell batteries.

Structural properties and defects of GaN crystals grown at ultra-high pressures: A molecular dynamics simulation

NASA Astrophysics Data System (ADS)

Gao, Tinghong; Li, Yidan; Xie, Quan; Tian, Zean; Chen, Qian; Liang, Yongchao; Ren, Lei; Hu, Xuechen

2018-01-01

The growth of GaN crystals at different pressures was studied by molecular dynamics simulation employing the Stillinger-Weber potential, and their structural properties and defects were characterized using the radial distribution function, the Voronoi polyhedron index method, and a suitable visualization technology. Crystal structures formed at 0, 1, 5, 10, and 20 GPa featured an overwhelming number of <4 0 0 0> Voronoi polyhedra, whereas amorphous structures comprising numerous disordered polyhedra were produced at 50 GPa. During quenching, coherent twin boundaries were easily formed between zinc-blende and wurtzite crystal structures in GaN. Notably, point defects usually appeared at low pressure, whereas dislocations were observed at high pressure, since the simultaneous growth of two crystal grains with different crystal orientations and their boundary expansion was hindered in the latter case, resulting in the formation of a dislocation between these grains.

From screen to structure with a harvestable microfluidic device.

PubMed

Stojanoff, Vivian; Jakoncic, Jean; Oren, Deena A; Nagarajan, V; Poulsen, Jens-Christian Navarro; Adams-Cioaba, Melanie A; Bergfors, Terese; Sommer, Morten O A

2011-08-01

Advances in automation have facilitated the widespread adoption of high-throughput vapour-diffusion methods for initial crystallization screening. However, for many proteins, screening thousands of crystallization conditions fails to yield crystals of sufficient quality for structural characterization. Here, the rates of crystal identification for thaumatin, catalase and myoglobin using microfluidic Crystal Former devices and sitting-drop vapour-diffusion plates are compared. It is shown that the Crystal Former results in a greater number of identified initial crystallization conditions compared with vapour diffusion. Furthermore, crystals of thaumatin and lysozyme obtained in the Crystal Former were used directly for structure determination both in situ and upon harvesting and cryocooling. On the basis of these results, a crystallization strategy is proposed that uses multiple methods with distinct kinetic trajectories through the protein phase diagram to increase the output of crystallization pipelines.

Measuring the force of drag on air sheared sessile drops

NASA Astrophysics Data System (ADS)

Milne, Andrew J. B.; Fleck, Brian; Amirfazli, Alidad

2012-11-01

To blow a drop along or off of a surface (i.e. to shed the drop), the drag force on the drop (based on flow conditions, drop shape, and fluid properties) must overcome the adhesion force between the drop and the surface (based on surface tension, drop shape, and contact angle). While the shedding of sessile drops by shear flow has been studied [Milne, A. J. B. & Amirfazli, A. Langmuir 25, 14155 (2009).], no independent measurements of the drag or adhesion forces have been made. Likewise, analytic predictions are limited to hemispherical drops and low air velocities. We present, therefore, measurements of the drag force on sessile drops at air velocities up to the point of incipient motion. Measurements were made using a modified floating element shear sensor in a laminar low speed wind tunnel to record drag force over the surface with the drop absent, and over the combined system of the surface and drop partially immersed in the boundary layer. Surfaces of different wettabilities were used to study the effects of drop shape and contact angles, with drop volume ranged between approximately 10 and 100 microlitres. The drag force for incipient motion (which by definition equals the maximum of the adhesion force) is compared to simplified models for drop adhesion such as that of Furmidge

Liquid-liquid diffusion crystallization improves the X-ray diffraction of EndoS, an endo-β-N-acetylglucosaminidase from Streptococcus pyogenes with activity on human IgG.

PubMed

Trastoy, Beatriz; Lomino, Joseph V; Wang, Lai Xi; Sundberg, Eric J

2013-12-01

Endoglycosidase S (EndoS) is an enzyme secreted by Streptococcus pyogenes that specifically hydrolyzes the β-1,4-di-N-acetylchitobiose core glycan on immunoglobulin G (IgG) antibodies. One of the most common human pathogens and the cause of group A streptococcal infections, S. pyogenes secretes EndoS in order to evade the host immune system by rendering IgG effector mechanisms dysfunctional. On account of its specificity for IgG, EndoS has also been used extensively for chemoenzymatic synthesis of homogeneous IgG glycoprotein preparations and is being developed as a novel therapeutic for a wide range of autoimmune diseases. The structural basis of its enzymatic activity and substrate specificity, however, remains unknown. Here, the purification and crystallization of EndoS are reported. Using traditional hanging-drop and sitting-drop vapor-diffusion crystallization, crystals of EndoS were grown that diffracted to a maximum of 3.5 Å resolution but suffered from severe anisotropy, the data from which could only be reasonably processed to 7.5 Å resolution. When EndoS was crystallized by liquid-liquid diffusion, it was possible to grow crystals with a different space group to those obtained by vapor diffusion. Crystals of wild-type endoglycosidase and glycosynthase constructs of EndoS grown by liquid-liquid diffusion diffracted to 2.6 and 1.9 Å resolution, respectively, with a greatly diminished anisotropy. Despite extensive efforts, the failure to reproduce these liquid-liquid diffusion-grown crystals by vapor diffusion suggests that these crystallization methods each sample a distinct crystallization space.

Automation of Vapor-Diffusion Growth of Protein Crystals

NASA Technical Reports Server (NTRS)

Hamrick, David T.; Bray, Terry L.

2005-01-01

Some improvements have been made in a system of laboratory equipment developed previously for studying the crystallization of proteins from solution by use of dynamically controlled flows of dry gas. The improvements involve mainly (1) automation of dispensing of liquids for starting experiments, (2) automatic control of drying of protein solutions during the experiments, and (3) provision for automated acquisition of video images for monitoring experiments in progress and for post-experiment analysis. The automation of dispensing of liquids was effected by adding an automated liquid-handling robot that can aspirate source solutions and dispense them in either a hanging-drop or a sitting-drop configuration, whichever is specified, in each of 48 experiment chambers. A video camera of approximately the size and shape of a lipstick dispenser was added to a mobile stage that is part of the robot, in order to enable automated acquisition of images in each experiment chamber. The experiment chambers were redesigned to enable the use of sitting drops, enable backlighting of each specimen, and facilitate automation.

Damping of drop oscillations by surfactants and surface viscosity

NASA Technical Reports Server (NTRS)

Rush, Brian M.; Nadim, Ali

1999-01-01

An energy equation is derived for the general case of a viscous drop suspended in a viscous medium with surfactants contaminating the interface. It contains terms that clearly identify dissipation contributions from the viscous effects in the bulk fluids, surface shear and dilatational viscosity effects at the interface, and surfactant transport. An efficient boundary integral method is developed which incorporates the effects of a constant surface dilatational viscosity in simulations of an oscillating two-dimensional inviscid drop. Surface dilatational viscosity is shown to have a significant damping effect on the otherwise undamped inviscid oscillations.

A variational approach to the study of capillary phenomena

NASA Technical Reports Server (NTRS)

Emmer, M.; Gonzalez, E.; Tamanini, I.

1982-01-01

The problem of determining the free surface of a liquid in a capillary tube, and of a liquid drop, sitting first on a horizontal plane and then on more general surfaces is considered. With some modifications, the method applies to the study of pendent drops and of rotating drops as well. The standard capillary problem, i.e. the determination of the free surface of a liquid in a thin tube of general cross section, which resuls from the simultaneous action of surface tension, boundary adhesion and gravity is discussed. It turns out that in this case the existence of the solution surface depends heavily on the validity of a simple geometric condition about the mean curvature of the boundary curve of the cross section of the capillary tube. Some particular examples of physical interest are also be discussed. Liquid drops sitting on or hanging from a fixed horizontal plane are discussed. The symmetry of the solutions (which can actually be proved, as consequence of a general symmetrization argument) now plays the chief role in deriving both the existence and the regularity of energy-minimizing configurations. When symmetry fails (this is the case, for example, when the contact angle between the drop and the plate is not constant, or when the supporting surface is not itself symmetric), then more sophisticated methods must be used. Extensions in this direction are outlined.

Growth and characterization of CaCu3Ti4O12 single crystals

NASA Astrophysics Data System (ADS)

Kim, Hui Eun; Yang, Sang-don; Lee, Jung-Woo; Park, Hyun Min; Yoo, Sang-Im

2014-12-01

The CaCu3Ti4O12 (CCTO) single crystals could be grown from the melt with the nominal composition of Ca:Cu:Ti=1:59:20 in a platinum (Pt) crucible using a self-flux method. The flux-grown CCTO single crystals have well-developed {100} habit planes, and their compositions are close to the ratio of Ca:Cu:Ti=1:3:4. Interestingly, flux-grown CCTO single crystals exhibited two different back reflection Laue patterns; one exhibited only [100] cubic Laue patterns, and the other showed not only [100] cubic Laue patterns but also the satellite spots related to the twin boundary, implying that twin-free CCTO single crystals can be grown by the self-flux method. Both the dielectric constants and losses of twinned CCTO single crystal are significantly higher than those of untwined CCTO crystal at relatively low frequency regime (<10 kHz), suggesting that the dielectric property is sensitive to the twin boundary.

The perfection and defect structure of organic hourglass inclusion K 2SO 4 crystals

NASA Astrophysics Data System (ADS)

Vetter, William M.; Totsuka, Hirono; Dudley, Michael; Kahr, Bart

2002-06-01

Hourglass inclusion crystals of K 2SO 4 were grown from aqueous solutions containing the dye acid fuchsin, and studied by synchrotron white-beam X-ray topography and reciprocal space mapping. Both self-nucleated and larger, seeded dye-included crystals were prepared, as well as comparable undoped crystals. While the dye modified the crystals' habit strongly, X-ray topographs showed it had no influence on their dislocation configurations, which were typical for solution-grown crystals. No kinematical contrast arising from the presence of the dye was observed that indicated dye-induced strain in the crystal lattice. Growth sector boundaries were visible in the dyed crystals but not in undoped crystals, implying there was a slightly higher lattice mismatch across growth sector boundaries in the dye-included crystals. Reciprocal space maps of small areas on an hourglass inclusion crystal within either a dye-included growth sector or an undoped growth sector showed single peaks with the same perfect crystal rocking curve width and no dilatation or tilt of the host lattice resulting from the dye's presence. These results showed hourglass inclusion crystals can be grown in which the presence of the dye disturbs the crystalline structure of the host salt minimally, and that hourglass inclusions have the nature of a solid solution.

Interacting effects of strengthening and twin boundary migration in nanotwinned materials

NASA Astrophysics Data System (ADS)

Joshi, Kartikey; Joshi, Shailendra P.

Twin boundaries play a governing role in the mechanical characteristics of nanotwinned materials. They act as yield strengthening agents by offering resistance to non-coplanar dislocation slip. Twin boundary migration may cause yield softening while also enhancing the strain hardening response. In this work, we investigate the interaction between strengthening and twin boundary migration mechanisms by developing a length-scale dependent crystal plasticity framework for face-centered-cubic nanotwinned materials. The crystal plasticity model incorporates strengthening mechanisms due to dislocation pile-up via slip and slip-rate gradients and twin boundary migration via source-based twin partial nucleation and lattice dislocation-twin boundary interaction. The coupled effect of the load orientation and initial twin size on the speed of twin boundary is discussed and an expression for the same is proposed in terms of relevant material parameters. The efficacy of finite element simulations and the analytical expression in predicting evolution of nanotwinned microstructures comprising size and spatial distributions of twins is demonstrated.

GPU-based optical propagation simulator of a laser-processed crystal block for the X'tal cube PET detector.

PubMed

Ogata, Yuma; Ohnishi, Takashi; Moriya, Takahiro; Inadama, Naoko; Nishikido, Fumihiko; Yoshida, Eiji; Murayama, Hideo; Yamaya, Taiga; Haneishi, Hideaki

2014-01-01

The X'tal cube is a next-generation DOI detector for PET that we are developing to offer higher resolution and higher sensitivity than is available with present detectors. It is constructed from a cubic monolithic scintillation crystal and silicon photomultipliers which are coupled on various positions of the six surfaces of the cube. A laser-processing technique is applied to produce 3D optical boundaries composed of micro-cracks inside the monolithic scintillator crystal. The current configuration is based on an empirical trial of a laser-processed boundary. There is room to improve the spatial resolution by optimizing the setting of the laser-processed boundary. In fact, the laser-processing technique has high freedom in setting the parameters of the boundary such as size, pitch, and angle. Computer simulation can effectively optimize such parameters. In this study, to design optical characteristics properly for the laser-processed crystal, we developed a Monte Carlo simulator which can model arbitrary arrangements of laser-processed optical boundaries (LPBs). The optical characteristics of the LPBs were measured by use of a setup with a laser and a photo-diode, and then modeled in the simulator. The accuracy of the simulator was confirmed by comparison of position histograms obtained from the simulation and from experiments with a prototype detector composed of a cubic LYSO monolithic crystal with 6 × 6 × 6 segments and multi-pixel photon counters. Furthermore, the simulator was accelerated by parallel computing with general-purpose computing on a graphics processing unit. The calculation speed was about 400 times faster than that with a CPU.

Microseismicity Induced by Fluid Pressure Drop (Laboratory Study)

NASA Astrophysics Data System (ADS)

Turuntaev, Sergey; Zenchenko, Evgeny; Melchaeva, Olga

2013-04-01

Pore pressure change in saturated porous rocks may result in its fracturing (Maury et Fourmaintraux, 1993) and corresponding microseismic event occurrences. Microseismicity due to fluid injection is considered in numerous papers (Maxwell, 2010, Shapiro et al., 2005). Another type of the porous medium fracturing is related with rapid pore pressure drop at some boundary. The mechanism of such fracturing was considered by (Khristianovich, 1985) as a model of sudden coal blowing and by (Alidibirov, Panov, 1998) as a model of volcano eruptions. If the porous saturated medium has a boundary where it directly contacted with fluid under the high pressure (in a hydraulic fracture or in a borehole), and the pressure at that boundary is dropped, the conditions for tensile cracks can be achieved at some distance from the boundary. In the paper, the results of experimental study of saturated porous sample fracturing due to pore pressure rapid drop are discussed. The samples (82 mm high, ∅60 mm) were made of quartz sand, which was cemented by "liquid glass" glue with mass fraction 1%. The sample (porosity 35%, uniaxial unconfined compression strength 2.5 MPa) was placed in a mould and saturated by oil. The upper end of the sample contacted with the mould upper lid, the lower end contacted with fluid. The fluid pressure was increased to 10 MPa and then discharged through the bottom nipple. The pressure increases/drops were repeated 30-50 times. Pore pressure and acoustic emission (AE) were registered by transducers mounted into upper and bottom lids of the mould. It was found, that AE sources (corresponded to microfracturing) were spreading from the open end to the closed end of the sample, and that maximal number of AE events was registered at some distance from the opened end. The number of AE pulses increased with every next pressure drop, meanwhile the number of pulses with high amplitudes diminished. It was found that AE maximal rate corresponded to the fluid pressure gradient maximal values. The model of AE relation with the pore pressure gradient was considered based on the following assumptions: AE event occurred when the pore pressure gradient reaches some critical value; the critical value varies and can be described by Weibull distribution. Permeability variation during the fluid pressure drop was estimated by means of fluid pressure data and pore-elastic equation solution for small time intervals (0.01 sec). The study showed possibility to solve both a direct problem of microseismicity variation relation with fluid pressure changes and an inverse problem of defining permeability by registering microseismic activity variation in particular volume of porous medium alongside with pore pressure measurements at some point.

A Cosserat crystal plasticity and phase field theory for grain boundary migration

NASA Astrophysics Data System (ADS)

Ask, Anna; Forest, Samuel; Appolaire, Benoit; Ammar, Kais; Salman, Oguz Umut

2018-06-01

The microstructure evolution due to thermomechanical treatment of metals can largely be described by viscoplastic deformation, nucleation and grain growth. These processes take place over different length and time scales which present significant challenges when formulating simulation models. In particular, no overall unified field framework exists to model concurrent viscoplastic deformation and recrystallization and grain growth in metal polycrystals. In this work a thermodynamically consistent diffuse interface framework incorporating crystal viscoplasticity and grain boundary migration is elaborated. The Kobayashi-Warren-Carter (KWC) phase field model is extended to incorporate the full mechanical coupling with material and lattice rotations and evolution of dislocation densities. The Cosserat crystal plasticity theory is shown to be the appropriate framework to formulate the coupling between phase field and mechanics with proper distinction between bulk and grain boundary behaviour.

The simulation and improved design of tunable channel drop filter using hexagonal photonic crystal ring resonator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chhipa, Mayur Kumar, E-mail: mayurchhipa1@gmail.com

2014-10-15

In this paper, we have proposed a new design of tunable two dimensional (2D) photonic crystal (PhC) channel drop filter (CDF) using ring resonators. The increasing interest in photonic integrated circuits (PIC's) and the increasing use of all-optical fiber networks as backbones for global communication systems have been based in large part on the extremely wide optical transmission bandwidth provided by dielectric materials. Based on the analysis we present novel photonic crystal channel drop filters. Simulations demonstrate that these filters exhibit ideal transfer characteristics. Channel dropping filters (CDF's) that access one channel of a wavelength division multiplexed (WDM) signal whilemore » leaving other channels undisturbed are essential components of PIC's and optical communication systems. In this paper we have investigated such parameters which have an effect on resonant wavelength in this Channel Drop Filter, such as dielectric constant of inner, coupling, adjacent and whole rods of the structure. The dimensions of these structures are taken as 20a×19a and the area of the proposed structure is about 125.6μm{sup 2}; therefore this structure can be used in the future photonic integrated circuits. While using this design the dropping efficiency at the resonance of single ring are 100%. The spectrum of the power transmission is obtained with finite difference time domain (FDTD) method. FDTD method is the most famous method for PhC analysis. In this paper the dielectric rods have a dielectric constant of 10.65, so the refractive index is 3.26 and radius r=0.213a is located in air, where a is a lattice constant. In this we have used five scatter rods for obtaining more coupling efficiency; radius of scatter rods is set to 0.215a. The proposed structure is simulated with OptiFDTD.v.8.0 software, the different dielectric constant of rods equal to ε{sub r}−0.4, ε{sub r} and ε{sub r}+0.4 at wavelength of 1570 nm.« less

Profiles of electrified drops and bubbles

NASA Technical Reports Server (NTRS)

Basaran, O. A.; Scriven, L. E.

1982-01-01

Axisymmetric equilibrium shapes of conducting drops and bubbles, (1) pendant or sessile on one face of a circular parallel-plate capacitor or (2) free and surface-charged, are found by solving simultaneously the free boundary problem consisting of the augmented Young-Laplace equation for surface shape and the Laplace equation for electrostatic field, given the surface potential. The problem is nonlinear and the method is a finite element algorithm employing Newton iteration, a modified frontal solver, and triangular as well as quadrilateral tessellations of the domain exterior to the drop in order to facilitate refined analysis of sharply curved drop tips seen in experiments. The stability limit predicted by this computer-aided theoretical analysis agrees well with experiments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baidakov, Vladimir G., E-mail: baidakov@itp.uran.ru; Tipeev, Azat O.

The method of molecular dynamics simulation has been used to investigate the phase decay of a metastable Lennard-Jones face-centered cubic crystal at positive and negative pressures. It is shown that at high degrees of metastability, crystal decay proceeds through the spontaneous formation and growth of new-phase nuclei. It has been found that there exists a certain boundary temperature. Below this temperature, the crystal phase disintegrates as the result of formation of voids, and above, as a result of formation of liquid droplets. The boundary temperature corresponds to the temperature of cessation of a crystal–liquid phase equilibrium when the melting linemore » comes in contact with the spinodal of the stretched liquid. The results of the simulations are interpreted in the framework of classical nucleation theory. The thermodynamics of phase transitions in solids has been examined with allowance for the elastic energy of stresses arising owing to the difference in the densities of the initial and the forming phases. As a result of the action of elastic forces, at negative pressures, the boundary of the limiting superheating (stretching) of a crystal approaches the spinodal, on which the isothermal bulk modulus of dilatation becomes equal to zero. At the boundary of the limiting superheating (stretching), the shape of liquid droplets and voids is close to the spherical one.« less

Numerical modeling of crystal growth in Bridgman device

NASA Astrophysics Data System (ADS)

Vompe, Dmitry Aleksandrovich

1997-12-01

The standard model for the growth of a crystal from a pure substance or diluted binary mixture contains transport equations for heat and phase change conditions at the solidification front. A numerical method is constructed for simulations of crystal growth in a vertical Bridgman device. The method is based on a boundary fitting technique in which melted and solidified regions are mapped onto a fixed rectangular logical domain. The Alternating Directions scheme (ADI) is used to treat the diffusive terms implicitly, with explicit methods are used for the remaining terms in the mapped temperature equations with variable coefficients. The nonlinear equation for the solid/liquid interface motion is solved by the modified Euler technique. Results obtained from the calculations have been used to study the influence of various boundary conditions imposed on the sidewalls and the top and bottom of the ampoule. Conditions are identified that lead to a steadily growing crystal and results are compared with an asymptotic one- dimensional model. Criteria based on ampoule length and boundary conditions being derived and compared with a previously developed one-dimensional model. Various cases have been considered to determine conditions for maintaining a nearly flat interface. It was found that the interface amplitude can be decreased by a factor of 100 (even 1,000) by optimizing temperature boundary conditions.

Characteristics of biogenic calcite in the prismatic layer of a pearl oyster, Pinctada fucata.

PubMed

Okumura, Taiga; Suzuki, Michio; Nagasawa, Hiromichi; Kogure, Toshihiro

2010-10-01

The fine structure of the calcite prism in the outer layer of a pearl oyster, Pinctada fucata, has been investigated using various electron beam techniques, in order to understand its characteristics and growth mechanism including the role of intracrystalline organic substances. As the calcite prismatic layer grows thicker, sinuous boundaries develop to divide the prism into a number of domains. The crystal misorientation between the adjacent domains is several to more than ten degrees. The component of the misorientation is mainly the rotation about the c-axis. There is no continuous organic membrane at the boundaries. Furthermore, the crystal orientation inside the domains changes gradually, as indicated by the electron back-scattered diffraction (EBSD) in a scanning electron microscope (SEM). Transmission electron microscopy (TEM) examination revealed that the domain consists of sub-grains of a few hundred nanometers divided by small-angle grain boundaries, which are probably the origin of the gradual change of the crystal orientation inside the domains. Spherular Fresnel contrasts were often observed at the small-angle grain boundaries, in defocused TEM images. Electron energy-loss spectroscopy (EELS) indicated the spherules are organic macromolecules, suggesting that incorporation of organic macromolecules during the crystal growth forms the sub-grain structure of the calcite prism.

Fast H-DROP: A thirty times accelerated version of H-DROP for interactive SVM-based prediction of helical domain linkers

NASA Astrophysics Data System (ADS)

Richa, Tambi; Ide, Soichiro; Suzuki, Ryosuke; Ebina, Teppei; Kuroda, Yutaka

2017-02-01

Efficient and rapid prediction of domain regions from amino acid sequence information alone is often required for swift structural and functional characterization of large multi-domain proteins. Here we introduce Fast H-DROP, a thirty times accelerated version of our previously reported H-DROP (Helical Domain linker pRediction using OPtimal features), which is unique in specifically predicting helical domain linkers (boundaries). Fast H-DROP, analogously to H-DROP, uses optimum features selected from a set of 3000 ones by combining a random forest and a stepwise feature selection protocol. We reduced the computational time from 8.5 min per sequence in H-DROP to 14 s per sequence in Fast H-DROP on an 8 Xeon processor Linux server by using SWISS-PROT instead of Genbank non-redundant (nr) database for generating the PSSMs. The sensitivity and precision of Fast H-DROP assessed by cross-validation were 33.7 and 36.2%, which were merely 2% lower than that of H-DROP. The reduced computational time of Fast H-DROP, without affecting prediction performances, makes it more interactive and user-friendly. Fast H-DROP and H-DROP are freely available from http://domserv.lab.tuat.ac.jp/.

The effect of protein–precipitant interfaces and applied shear on the nucleation and growth of lysozyme crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reis, Nuno M.; Chirgadze, Dimitri Y.; Blundell, Tom L.

The nucleation of lysozyme in microbatch experiments was linked to the formation of protein–precipitant interfaces. The use of oscillatory shear allowed decreasing the nucleation rate and extending the growth period for lysozyme crystals, presumably through the control of the number of interfaces and removal of impurities or defects. This paper is concerned with the effect of protein–precipitant interfaces and externally applied shear on the nucleation and growth kinetics of hen egg-white lysozyme crystals. The early stages of microbatch crystallization of lysozyme were explored using both optical and confocal fluorescence microscopy imaging. Initially, an antisolvent (precipitant) was added to a proteinmore » drop and the optical development of the protein–precipitant interface was followed with time. In the presence of the water-soluble polymer poly(ethylene glycol) (PEG) a sharp interface was observed to form immediately within the drop, giving an initial clear separation between the lighter protein solution and the heavier precipitant. This interface subsequently became unstable and quickly developed within a few seconds into several unstable ‘fingers’ that represented regions of high concentration-gradient interfaces. Confocal microscopy demonstrated that the subsequent nucleation of protein crystals occurred preferentially in the region of these interfaces. Additional experiments using an optical shearing system demonstrated that oscillatory shear significantly decreased nucleation rates whilst extending the growth period of the lysozyme crystals. The experimental observations relating to both nucleation and growth have relevance in developing efficient and reliable protocols for general crystallization procedures and the controlled crystallization of single large high-quality protein crystals for use in X-ray crystallography.« less

Direct measurement of concentration distribution within the boundary layer of an ion-exchange membrane.

PubMed

Choi, Jae-Hwan; Park, Jin-Soo; Moon, Seung-Hyeon

2002-07-15

In this study the concentration distributions within the diffusion boundary layer were obtained by directly measuring the potential drops while the currents (under- and overlimiting) passed through the Neosepta CMX cation-exchange membrane (Tokuyama Corp., Japan). Potential drops according to the distance from the membrane surface on the depleted side were measured using a microelectrode to obtain the concentration profile. From the concentration profiles obtained, it was observed that the diffusion boundary layers existed in the range of 300-350 microm, which reasonably coincide with the theoretical diffusion boundary layer thickness calculated from the limiting current density. Although there were some deviations between the concentrations determined from the Nernst model and those from experiments, it was confirmed that the Nernst model effectively depicts the transport phenomena in the ion-exchange membrane system. In addition it was found that the salt concentration at the membrane surface increased when the currents applied exceeded the limiting current. It is thought that the concentration polarization formed in the diffusion boundary layer at currents near or lower than the limiting current was disturbed by a turbulent convection when the current was greater than the limiting current. As a consequence, the concentration at the membrane surface increased to a sufficient level for generation of the overlimiting current.

Absence of molecular slip on ultraclean and SAM-coated surfaces

NASA Astrophysics Data System (ADS)

Pye, Justin; Wood, Clay; Burton, Justin

2016-11-01

The liquid/solid boundary condition is a complex problem that is becoming increasingly important for the development of nanoscale fluidic devices. Many groups have now measured slip near an interface at nanoscale dimensions using a variety of experimental techniques. In simple systems, large slip lengths are generally measured for non-wetting liquid/solid combinations, but many conflicting measurements and interpretations remain. We have developed a novel pseudo-differential technique using a quartz crystal microbalance (QCM) to measure slip lengths on various surfaces. A drop of one liquid is grown on the QCM in the presence of a second, ambient liquid. We have isolated any anomalous boundary effects such as interfacial slip by choosing two liquids which have identical bulk effects on the QCM frequency and dissipation in the presence of no-slip. Slip lengths are -less than 2 nm- for water (relative to undecane) on all surfaces measured, including plasma cleaned gold, SiO2, and two different self assembled monolayers (SAMs), regardless of contact angle. We also find that surface cleanliness is crucial to accurately measure slip lengths. Additionally, clean glass substrates appear to have a significant adsorbed water layer and SAM surfaces show excess dissipation, possibly associated with contact line motion. In addition to investigating other liquid pairs, future work will include extending this technique to surfaces with independently controllable chemistry and roughness, both of which are known to strongly affect interfacial hydrodynamics.

Metal Insulator transition in Vanadium Dioxide

NASA Astrophysics Data System (ADS)

Jovaini, Azita; Fujita, Shigeji; Suzuki, Akira; Godoy, Salvador

2012-02-01

MAR12-2011-000262 Abstract Submitted for the MAR12 Meeting of The American Physical Society Sorting Category: 03.9 (T) On the metal-insulator-transition in vanadium dioxide AZITA JOVAINI, SHIGEJI FUJITA, University at Buffalo, SALVADOR GODOY, UNAM, AKIRA SUZUKI, Tokyo University of Science --- Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity _/ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop. Prefer Oral Session X Prefer .

Compact Apparatus Grows Protein Crystals

NASA Technical Reports Server (NTRS)

Bugg, Charles E.; Delucas, Lawrence J.; Suddath, Fred L.; Snyder, Robert S.; Herren, Blair J.; Carter, Daniel C.; Yost, Vaughn H.

1989-01-01

Laboratory apparatus provides delicately balanced combination of materials and chemical conditions for growth of protein crystals. Apparatus and technique for growth based on hanging-drop method for crystallization of macromolecules. Includes pair of syringes with ganged plungers. One syringe contains protein solution; other contains precipitating-agent solution. Syringes intrude into cavity lined with porous reservoir material saturated with 1 mL or more of similar precipitating-agent solution. Prior to activation, ends of syringes plugged to prevent transport of water vapor among three solutions.

Boundaries of intergrowths between mineral individuals: A zone of secondary mineral formation in aggregates

NASA Astrophysics Data System (ADS)

Brodskaya, R. L.; Bil'Skaya, I. V.; Lyakhnitskaya, V. D.; Markovsky, B. A.; Sidorov, E. G.

2007-12-01

Intergrowth boundaries between mineral individuals in dunite of the Gal’moenan massif in Koryakia was studied in terms of crystal morphology, crystal optics, and ontogenesis. The results obtained allowed us to trace the staged formation of olivine and chromite and four generations of these minerals. Micro-and nanotopography of boundary surfaces between intergrown mineral individuals of different generations was examined with optic, electron, and atomic force microscopes. The boundaries between mineral individuals of different generations are distinguished by their microsculpture for both olivine and chromite grains. Both minerals demonstrate a compositional trend toward refinement from older to younger generations. The decrease in the iron mole fraction in olivine and chromite is accompanied by the crystallization of magnetite along weakened zones in olivine of the first generation and as outer rims around the chromite grains of the second generation observable under optic and electronic microscopes. The subsequent refinement of chromite results in the release of PGE from its lattice, as established by atomic power microscopy. The newly formed PGM are localized at the boundaries between mineral individuals and, thus, mark a special stage in the ontogenetic evolution of mineral aggregates. Further recrystallization is expressed in the spatial redistribution of grain boundaries and the formation of monomineralic intergrowth boundaries, i.e., the glomerogranular structure of rock and substructures of PGM, chromite, and olivine grains as intermediate types of organization of the granular assemblies in the form of reticulate, chain, and cellular structures and substructures of aggregates.

Crystallization and preliminary X-ray studies of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Jing; Li, Ming; Chen, Jiashu

Crystals of a non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of A. acutus have been obtained and characterized by X-ray diffraction. A non-haemorrhagic fibrin(ogen)olytic metalloproteinase from the venom of Agkistrodon acutus has been crystallized by the hanging-drop method. The crystals belong to space group P3{sub 1}21, with unit-cell parameters a = b = 80.57, c = 66.77 Å and one molecule in the asymmetric unit. X-ray diffraction data were collected to 1.86 Å resolution.

Crystallization and preliminary X-ray crystallographic analysis of strictosidine synthase from Rauvolfia: the first member of a novel enzyme family.

PubMed

Ma, Xueyan; Koepke, Juergen; Fritzsch, Günter; Diem, Ralf; Kutchan, Toni M; Michel, Hartmut; Stöckigt, Joachim

2004-10-01

Strictosidine synthase is a central enzyme involved in the biosynthesis of almost all plant monoterpenoid indole alkaloids. Strictosidine synthase from Rauvolfia serpentina was heterologously expressed in Escherichia coli. Crystals of the purified recombinant enzyme have been obtained by the hanging-drop technique at 303 K with potassium sodium tartrate tetrahydrate as precipitant. The crystals belong to the space group R3 with cell dimensions of a=b=150.3 A and c=122.4 A. Under cryoconditions (120 K), the crystals diffract to about 2.95 A.

Crystallization and X-ray diffraction analysis of a catalytic domain of hyperthermophilic chitinase from Pyrococcus furiosus

PubMed Central

Mine, Shouhei; Nakamura, Tsutomu; Hirata, Kunio; Ishikawa, Kazuhiko; Hagihara, Yoshihisa; Uegaki, Koichi

2006-01-01

The crystallization and preliminary X-ray diffraction analysis of a catalytic domain of chitinase (PF1233 gene) from the hyperthermophilic archaeon Pyrococcus furiosus is reported. The recombinant protein, prepared using an Escherichia coli expression system, was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected at the undulator beamline BL44XU at SPring-8 to a resolution of 1.50 Å. The crystals belong to space group P212121, with unit-cell parameters a = 90.0, b = 92.8, c = 107.2 Å. PMID:16880559

Crystallization and diffraction analysis of [beta]-N-acetylhexosaminidase from Aspergillus oryzae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanek, Ondrej; Brynd, Jirí; Hofbauerová, Katerina

2012-05-08

Fungal {beta}-N-acetylhexosaminidases are enzymes that are used in the chemoenzymatic synthesis of biologically interesting oligosaccharides. The enzyme from Aspergillus oryzae was produced and purified from its natural source and crystallized using the hanging-drop vapor-diffusion method. Diffraction data from two crystal forms (primitive monoclinic and primitive tetragonal) were collected to resolutions of 3.2 and 2.4 {angstrom}, respectively. Electrophoretic and quantitative N-terminal protein-sequencing analyses confirmed that the crystals are formed by a complete biologically active enzyme consisting of a glycosylated catalytic unit and a noncovalently attached propeptide.

Screening and Crystallization Plates for Manual and High-throughput Protein Crystal Growth

NASA Technical Reports Server (NTRS)

Thorne, Robert E. (Inventor); Berejnov, Viatcheslav (Inventor); Kalinin, Yevgeniy (Inventor)

2010-01-01

In one embodiment, a crystallization and screening plate comprises a plurality of cells open at a top and a bottom, a frame that defines the cells in the plate, and at least two films. The first film seals a top of the plate and the second film seals a bottom of the plate. At least one of the films is patterned to strongly pin the contact lines of drops dispensed onto it, fixing their position and shape. The present invention also includes methods and other devices for manual and high-throughput protein crystal growth.

Purification, crystallization and preliminary X-ray crystallographic studies of Rv3705c from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, Feifei; Gao, Feng; Li, Honglin

The cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of Rv3705c from M. tuberculosis are described. The conserved protein Rv3705c from Mycobacterium tuberculosis has been cloned, expressed, purified and crystallized by the sitting-drop vapour-diffusion method using PEG 3350 as a precipitant. The Rv3705c crystals exhibited space group P6{sub 1}22 or P6{sub 5}22, with unit-cell parameters a = b = 198.0, c = 364.1 Å, α = β = 90, γ = 120°, and diffracted to a resolution of 3.3 Å.

A boundary element method for particle and droplet electrohydrodynamics in the Quincke regime

NASA Astrophysics Data System (ADS)

Das, Debasish; Saintillan, David

2014-11-01

Quincke electrorotation is the spontaneous rotation of dielectric particles suspended in a dielectric liquid of higher conductivity when placed in a sufficiently strong electric field. This phenomenon of Quincke rotation has interesting implications for the rheology of these suspensions, whose effective viscosity can be controlled and reduced by application of an external field. While spherical harmonics can be used to solve the governing equations for a spherical particle, they cannot be used to study the dynamics of particles of more complex shapes or deformable particles or droplets. Here, we develop a novel boundary element formulation to model the dynamics of a dielectric particle under Quincke rotation based on the Taylor-Melcher leaky dielectric model, and compare the numerical results to theoretical predictions. We then employ this boundary element method to analyze the dynamics of a two-dimensional drop under Quincke rotation, where we allow the drop to deform under the electric field. Extensions to three-dimensions and to the electrohydrodynamic interactions of multiple droplets are also discussed.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Keyu; Shenzhen Key Laboratory of Micro-Nano Photonic Information Technology, Shenzhen 518067; College of Electronic Science and Technology, Shenzhen University, Shenzhen 518067

We present a versatile add-drop integrated photonic filter (ADF) consisting of nonreciprocal waveguides in which the propagation of light is restricted in one predetermined direction. With the bus and add/drop waveguides symmetrically coupled through a cavity, the four-port device allows each individual port to add and/or drop a signal of the same frequency. The scheme is general and we demonstrate the nonreciprocal ADF with magneto-optical photonic crystals. The filter is immune to waveguide defects, allowing straightforward implementation of multi-channel ADFs by cascading the four-port designs. The results should find applications in wavelength-division multiplexing and related integrated photonic techniques.

Structural and Biochemical Studies of the Ovarian Tumor Domain

DTIC Science & Technology

2007-05-01

solution containing Bis-Tris pH 5.5-6.5, 16-20% PEG 3350 , and 100-200 mM of a magnesium cation. These crystals belong to spacegroup P64 with unit...drop method using a reservoir solution containing Bis-Tris pH 5.5-6.5, 16-20% PEG 3350 , and 50-200 mM ammonium acetate . Orthorhombic crystals

Formation of Bragg band gaps in anisotropic phononic crystals analyzed with the empty lattice model

DOE PAGES

Wang, Yan -Feng; Maznev, Alexei; Laude, Vincent

2016-05-11

Bragg band gaps of phononic crystals generally, but not always, open at Brillouin zone boundaries. The commonly accepted explanation stems from the empty lattice model: assuming a small material contrast between the constituents of the unit cell, avoided crossings in the phononic band structure appear at frequencies and wavenumbers corresponding to band intersections; for scalar waves the lowest intersections coincide with boundaries of the first Brillouin zone. However, if a phononic crystal contains elastically anisotropic materials, its overall symmetry is not dictated solely by the lattice symmetry. We construct an empty lattice model for phononic crystals made of isotropic andmore » anisotropic materials, based on their slowness curves. We find that, in the anisotropic case, avoided crossings generally do not appear at the boundaries of traditionally defined Brillouin zones. Furthermore, the Bragg "planes" which give rise to phononic band gaps, are generally not flat planes but curved surfaces. Lastly, the same is found to be the case for avoided crossings between shear (transverse) and longitudinal bands in the isotropic case.« less

Formation of Bragg band gaps in anisotropic phononic crystals analyzed with the empty lattice model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yan -Feng; Maznev, Alexei; Laude, Vincent

Bragg band gaps of phononic crystals generally, but not always, open at Brillouin zone boundaries. The commonly accepted explanation stems from the empty lattice model: assuming a small material contrast between the constituents of the unit cell, avoided crossings in the phononic band structure appear at frequencies and wavenumbers corresponding to band intersections; for scalar waves the lowest intersections coincide with boundaries of the first Brillouin zone. However, if a phononic crystal contains elastically anisotropic materials, its overall symmetry is not dictated solely by the lattice symmetry. We construct an empty lattice model for phononic crystals made of isotropic andmore » anisotropic materials, based on their slowness curves. We find that, in the anisotropic case, avoided crossings generally do not appear at the boundaries of traditionally defined Brillouin zones. Furthermore, the Bragg "planes" which give rise to phononic band gaps, are generally not flat planes but curved surfaces. Lastly, the same is found to be the case for avoided crossings between shear (transverse) and longitudinal bands in the isotropic case.« less

Purification and crystallization of Kokobera virus helicase

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Colibus, Luigi; Speroni, Silvia; Coutard, Bruno

2007-03-01

Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method and exhibit a diffraction limit of 2.3 Å. Kokobera virus is a mosquito-borne flavivirus belonging, like West Nile virus, to the Japanese encephalitis virus serocomplex. The flavivirus genus is characterized by a positive-sense single-stranded RNA genome. The unique open reading frame of the viral RNA is transcribed and translated as a single polyprotein which is post-translationally cleaved to yield three structural and seven nonstructural proteins, one of which ismore » the NS3 gene that encodes a C-terminal helicase domain consisting of 431 amino acids. Helicase inhibitors are potential antiviral drugs as the helicase is essential to viral replication. Crystals of the Kokobera virus helicase domain were obtained by the hanging-drop vapour-diffusion method. The crystals belong to space group P3{sub 1}21 (or P3{sub 2}21), with unit-cell parameters a = 88.6, c = 138.6 Å, and exhibit a diffraction limit of 2.3 Å.« less

Dislocation Mobility and Anomalous Shear Modulus Effect in ^4He Crystals

NASA Astrophysics Data System (ADS)

Malmi-Kakkada, Abdul N.; Valls, Oriol T.; Dasgupta, Chandan

2017-02-01

We calculate the dislocation glide mobility in solid ^4He within a model that assumes the existence of a superfluid field associated with dislocation lines. Prompted by the results of this mobility calculation, we study within this model the role that such a superfluid field may play in the motion of the dislocation line when a stress is applied to the crystal. To do this, we relate the damping of dislocation motion, calculated in the presence of the assumed superfluid field, to the shear modulus of the crystal. As the temperature increases, we find that a sharp drop in the shear modulus will occur at the temperature where the superfluid field disappears. We compare the drop in shear modulus of the crystal arising from the temperature dependence of the damping contribution due to the superfluid field, to the experimental observation of the same phenomena in solid ^4He and find quantitative agreement. Our results indicate that such a superfluid field plays an important role in dislocation pinning in a clean solid ^4He at low temperatures and in this regime may provide an alternative source for the unusual elastic phenomena observed in solid ^4He.

Solubility- and temperature-driven thin film structures of polymeric thiophene derivatives for high performance OFET applications

NASA Astrophysics Data System (ADS)

LeFevre, Scott W.; Bao, Zhenan; Ryu, Chang Y.; Siegel, Richard W.; Yang, Hoichang

2007-09-01

It has been shown that high charge mobility in solution-processible organic semiconductor-based field effect transistors is due in part to a highly parallel π-π stacking plane orientation of the semiconductors with respect to gate-dielectric. Fast solvent evaporation methods, generally, exacerbate kinetically random crystal orientations in the films deposited, specifically, from good solvents. We have investigated solubility-driven thin film structures of thiophene derivative polymers via spin- and drop-casting with volatile solvents of a low boiling point. Among volatile solvents examined, marginal solvents, which have temperature-dependent solubility for the semiconductors (e.g. methylene chloride for regioregular poly(3-alkylthiophene)s), can be used to direct the favorable crystal orientation regardless of solvent drying time, when the temperature of gate-dielectrics is held to relatively cooler than the warm solution. Grazing-incidence X-ray diffraction and atomic force microscopy strongly support that significant control of crystal orientation and mesoscale morphology using a "cold" substrate holds true for both drop and spin casting. The effects of physiochemical post-modificaiton on film crystal structures and morphologies of poly(9,9-dioctylfluorene-co-bithiophene) have also been investigated.

Expression, purification, crystallization and preliminary X-ray analysis of the ligand-binding domain of metabotropic glutamate receptor 7

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muto, Takanori; Tsuchiya, Daisuke; Morikawa, Kosuke, E-mail: morikako@protein.osaka-u.ac.jp

2007-07-01

The ligand-binding domain of metabotropic glutamate receptor 7 has been overexpressed, purified, and crystallized by the hanging-drop vapour-diffusion method. A complete data set has been collected to 3.30 Å. Glutamate is the major excitatory neurotransmitter and its metabotropic glutamate receptor (mGluR) plays an important role in the central nervous system. The ligand-binding domain (LBD) of mGluR subtype 7 (mGluR7) was produced using the baculovirus expression system and purified from the culture medium. The purified protein was characterized by gel-filtration chromatography, SDS–PAGE and a ligand-binding assay. Crystals of mGluR7 LBD were grown at 293 K by the hanging-drop vapour-diffusion method. Themore » crystals diffracted X-rays to 3.30 Å resolution using synchrotron radiation and belong to the trigonal space group P3{sub 1}21, with unit-cell parameters a = b = 92.4, c = 114.3 Å. Assuming the presence of one protomer per crystallographic asymmetric unit, the Matthews coefficient V{sub M} was calculated to be 2.5 Å{sup 3} Da{sup −1} and the solvent content was 51%.« less

A Chebyshev Collocation Method for Moving Boundaries, Heat Transfer, and Convection During Directional Solidification

NASA Technical Reports Server (NTRS)

Zhang, Yiqiang; Alexander, J. I. D.; Ouazzani, J.

1994-01-01

Free and moving boundary problems require the simultaneous solution of unknown field variables and the boundaries of the domains on which these variables are defined. There are many technologically important processes that lead to moving boundary problems associated with fluid surfaces and solid-fluid boundaries. These include crystal growth, metal alloy and glass solidification, melting and name propagation. The directional solidification of semi-conductor crystals by the Bridgman-Stockbarger method is a typical example of such a complex process. A numerical model of this growth method must solve the appropriate heat, mass and momentum transfer equations and determine the location of the melt-solid interface. In this work, a Chebyshev pseudospectra collocation method is adapted to the problem of directional solidification. Implementation involves a solution algorithm that combines domain decomposition, finite-difference preconditioned conjugate minimum residual method and a Picard type iterative scheme.

Influence of twin boundaries on superconducting gap nodes in FeSe single crystal studied by STM/STS

NASA Astrophysics Data System (ADS)

Watashige, T.; Hanaguri, T.; Kohsaka, Y.; Iwaya, K.; Fu, Y.; Kasahara, S.; Watanabe, D.; Mizukami, Y.; Mikami, T.; Kawamoto, Y.; Kurata, S.; Shibauchi, T.; Matsuda, Y.; Böhmer, A. E.; Wolf, T.; Meingast, C.; Löhneysen, H. V.

2014-03-01

We performed scanning tunneling microscopy (STM) and spectroscopy (STS) measurements on high-quality FeSe single crystals grown by vapor transport technique to examine the superconducting-gap structure. In MBE-grown FeSe thin films, based on the V-shaped tunneling spectra, nodal superconductivity is suggested. It is interesting to investigate how the nodes are affected by various kinds of defects. We found that twin boundaries bring about drastic effects on the gap nodes. With approaching to the twin boundary, V-shaped spectra gradually change to U-shaped ones. Interestingly, in the area between the twin boundaries separated by about 30 nm, the gap node is completely lifted and there appears a finite gap over +/-0.4 meV. This unusual twin-boundary effect will give us a hint to elucidate the superconducting-gap structure.

Suppression of large edge-localized modes in high-confinement DIII-D plasmas with a stochastic magnetic boundary.

PubMed

Evans, T E; Moyer, R A; Thomas, P R; Watkins, J G; Osborne, T H; Boedo, J A; Doyle, E J; Fenstermacher, M E; Finken, K H; Groebner, R J; Groth, M; Harris, J H; La Haye, R J; Lasnier, C J; Masuzaki, S; Ohyabu, N; Pretty, D G; Rhodes, T L; Reimerdes, H; Rudakov, D L; Schaffer, M J; Wang, G; Zeng, L

2004-06-11

A stochastic magnetic boundary, produced by an applied edge resonant magnetic perturbation, is used to suppress most large edge-localized modes (ELMs) in high confinement (H-mode) plasmas. The resulting H mode displays rapid, small oscillations with a bursty character modulated by a coherent 130 Hz envelope. The H mode transport barrier and core confinement are unaffected by the stochastic boundary, despite a threefold drop in the toroidal rotation. These results demonstrate that stochastic boundaries are compatible with H modes and may be attractive for ELM control in next-step fusion tokamaks.

A generalized crystal-cutting method for modeling arbitrarily oriented crystals in 3D periodic simulation cells with applications to crystal-crystal interfaces

NASA Astrophysics Data System (ADS)

Kroonblawd, Matthew P.; Mathew, Nithin; Jiang, Shan; Sewell, Thomas D.

2016-10-01

A Generalized Crystal-Cutting Method (GCCM) is developed that automates construction of three-dimensionally periodic simulation cells containing arbitrarily oriented single crystals and thin films, two-dimensionally (2D) infinite crystal-crystal homophase and heterophase interfaces, and nanostructures with intrinsic N-fold interfaces. The GCCM is based on a simple mathematical formalism that facilitates easy definition of constraints on cut crystal geometries. The method preserves the translational symmetry of all Bravais lattices and thus can be applied to any crystal described by such a lattice including complicated, low-symmetry molecular crystals. Implementations are presented with carefully articulated combinations of loop searches and constraints that drastically reduce computational complexity compared to simple loop searches. Orthorhombic representations of monoclinic and triclinic crystals found using the GCCM overcome some limitations in standard distributions of popular molecular dynamics software packages. Stability of grain boundaries in β-HMX was investigated using molecular dynamics and molecular statics simulations with 2D infinite crystal-crystal homophase interfaces created using the GCCM. The order of stabilities for the four grain boundaries studied is predicted to correlate with the relative prominence of particular crystal faces in lab-grown β-HMX crystals. We demonstrate how nanostructures can be constructed through simple constraints applied in the GCCM framework. Example GCCM constructions are shown that are relevant to some current problems in materials science, including shock sensitivity of explosives, layered electronic devices, and pharmaceuticals.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli.

PubMed

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-02-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 A resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 A , and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 A , and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement.

Purification, crystallization and preliminary crystallographic analysis of a 6-pyruvoyltetrahydropterin synthase homologue from Esherichia coli

PubMed Central

Seo, Kyung Hye; Supangat; Kim, Hye Lim; Park, Young Shik; Jeon, Che Ok; Lee, Kon Ho

2008-01-01

6-Pyruvoyltetrahydropterin synthase from E. coli (ePTPS) has been crystallized using the hanging-drop vapour-diffusion method. Hexagonal- and rectangular-shaped crystals were obtained. Diffraction data were collected from the hexagonal and rectangular crystals to 3.0 and 2.3 Å resolution, respectively. The hexagonal plate-shaped crystals belonged to space group P321, with unit-cell parameters a = b = 112.59, c = 68.82 Å, and contained two molecules in the asymmetric unit. The rectangular crystals belonged to space group I222, with unit-cell parameters a = 112.76, b = 117.66, c = 153.57 Å, and contained six molecules in the asymmetric unit. The structure of ePTPS in both crystal forms has been determined by molecular replacement. PMID:18271114

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kish, Kevin; McDonnell, Patricia A.; Goldfarb, Valentina

Protein tyrosine phosphatase {gamma} is a membrane-bound receptor and is designated RPTP{gamma}. RPTP{gamma} and two mutants, RPTP{gamma}(V948I, S970T) and RPTP{gamma}(C858S, S970T), were recombinantly expressed and purified for X-ray crystallographic studies. The purified enzymes were crystallized using the hanging-drop vapor-diffusion method. Crystallographic data were obtained from several different crystal forms in the absence and the presence of inhibitor. In this paper, a description is given of how three different crystal forms were obtained that were used with various ligands. An orthorhombic crystal form and a trigonal crystal form were obtained both with and without ligand, and a monoclinic crystal form wasmore » only obtained in the presence of a particularly elaborated inhibitor.« less

Nonlinear electrohydrodynamics of leaky dielectric drops in the Quincke regime: Numerical simulations

NASA Astrophysics Data System (ADS)

Das, Debasish; Saintillan, David

2015-11-01

The deformation of leaky dielectric drops in a dielectric fluid medium when subject to a uniform electric field is a classic electrohydrodynamic phenomenon best described by the well-known Melcher-Taylor leaky dielectric model. In this work, we develop a three-dimensional boundary element method for the full leaky dielectric model to systematically study the deformation and dynamics of liquid drops in strong electric fields. We compare our results with existing numerical studies, most of which have been constrained to axisymmetric drops or have neglected interfacial charge convection by the flow. The leading effect of convection is to enhance deformation of prolate drops and suppress deformation of oblate drops, as previously observed in the axisymmetric case. The inclusion of charge convection also enables us to investigate the dynamics in the Quincke regime, in which experiments exhibit a symmetry-breaking bifurcation leading to a tank-treading regime. Our simulations confirm the existence of this bifurcation for highly viscous drops, and also reveal the development of sharp interfacial charge gradients driven by convection near the drop's equator. American Chemical Society, Petroleum Research Fund.

Bending nanowire growth in solution by mechanical disturbance.

PubMed

Wang, Chao; Wei, Yujie; Jiang, Hongyuan; Sun, Shouheng

2010-06-09

The effect of mechanical disturbance on one-dimensional nanocrystal growth in solution phase is investigated by controlled growth of Au nanowires with and without stirring. While a static growth leads to straight, single-crystal Au nanowires, the mechanic disturbance by stirring tends to bend the nanowire growth, yielding nanowire kinks abundant in various types of crystal defects including dislocations, twin boundaries, and grain boundaries. Mechanical modeling and analysis is introduced to elucidate the nanowire growth mechanisms in these two conditions. The provided fundamental understanding of crystal defect formation at nanoscale could be applied to guide the development of advanced nanomaterials with shape control and unique mechanical properties.

Crystal regularity with high-resolution synchrotron X-radiation diffraction imaging

NASA Technical Reports Server (NTRS)

Steiner, Bruce; Dobbyn, Ronald C.

1991-01-01

New, high-resolution sources of X-radiation such as monochromatic synchrotron radiation beams with subarcsec divergence allow observation of regularities in a range of crystals with sufficient clarity for comprehensive analyses, whose results can deepen understanding of the nature of various crystal irregularities, their sources, and their effects on device performance. An account is presented of the results thus achievable with irregularities encountered in lattice orientation and strain, grain and subgrain boundaries, dislocations, domain boundaries, additional phases, and surface scratches. Significant achievements to date encompass the observation of critical anomalies in lead tin telluride, the reconciliation of disparate observations of GaAs, the determination of the performance effects of irregularities in mercuric iodide, and the characterization of the origins of crystal growth in bismuth silicon oxide.

Study of Etching Pits in a Large-grain Single Cell Bulk Niobium Cavity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Xin; Ciovati, Gianluigi; Reece, Charles E.

2009-11-01

Performance of SRF cavities are limited by non-linear localized effects. The variation of local material characters between "hot" and "cold" spots is thus of intense interest. Such locations were identified in a BCP-etched large-grain single-cell cavity and removed for examination by high resolution electron microscopy (SEM), electron-back scattering diffraction microscopy (EBSD), optical microscopy, and 3D profilometry. Pits with clearly discernable crystal facets were observed in both "hotspot" and "coldspot" specimens. The pits were found in-grain, at bi-crystal boundaries, and on tri-crystal junctions. They are interpreted as etch pits induced by surface crystal defects (e.g. dislocations). All "coldspots" examined had qualitativelymore » low density of etching pits or very shallow tri-crystal boundary junction. EBSD revealed crystal structure surrounding the pits via crystal phase orientation mapping, while 3D profilometry gave information on the depth and size of the pits. In addition, a survey of the samples by energy dispersive X-ray analysis (EDX) did not show any significant contamination of the samples surface.« less

Carrier Transport, Recombination, and the Effects of Grain Boundaries in Polycrystalline Cadmium Telluride Thin Films for Photovoltaics

NASA Astrophysics Data System (ADS)

Tuteja, Mohit

Cadmium Telluride (CdTe), a chalcogenide semiconductor, is currently used as the absorber layer in one of the highest efficiency thin film solar cell technologies. Current efficiency records are over 22%. In 2011, CdTe solar cells accounted for 8% of all solar cells installed. This is because, in part, CdTe has a low degradation rate, high optical absorption coefficient, and high tolerance to intrinsic defects. Solar cells based on polycrystalline CdTe exhibit a higher short-circuit current, fill factor, and power conversion efficiency than their single crystal counterparts. This is despite the fact that polycrystalline CdTe devices exhibit lower open-circuit voltages. This is contrary to the observation for silicon and III-V semiconductors, where material defects cause a dramatic drop in device performance. For example, grain boundaries in covalently-bonded semiconductors (a) act as carrier recombination centers, and (b) lead to localized energy states, causing carrier trapping. Despite significant research to date, the mechanism responsible for the superior current collection properties of polycrystalline CdTe solar cells has not been conclusively answered. This dissertation focuses on the macro-scale electronic band structure, and micro scale electronic properties of grains and grain boundaries in device-grade CdTe thin films to answer this open question. My research utilized a variety of experimental techniques. Samples were obtained from leading groups fabricating the material and devices. A CdCl 2 anneal is commonly performed as part of this fabrication and its effects were also investigated. Photoluminescence (PL) spectroscopy was employed to study the band structure and defect states in CdTe polycrystals. Cadmium vacancy- and chlorine-related states lead to carrier recombination, as in CdTe films grown by other methods. Comparing polycrystalline and single crystal CdTe, showed that the key to explaining the improved performance of polycrystalline CdTe does not lie in macroscopic analysis. The nanoscale majority carrier concentration was studied using scanning microwave impedance microscopy, which revealed an existence of majority carrier depletion along the grain boundaries, independent of the growth process used, which was absent in films that were not subjected to CdCl2 annealing. This effect promotes carrier separation and collection. Conductive atomic force microscopy showed enhanced conduction of electrons along the grain boundaries in samples subjected to the CdCl2 anneal treatment while holes were shown to move through the grain bulk. The separation of conduction channels minimizes recombination while simultaneously reducing series resistance and hence enhancing fill factor. Several technical capabilities demonstrated in this work can be easily extended to other semiconductor materials.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Yongsoo; Chen, Chien-Chun; Scott, M. C.

Perfect crystals are rare in nature. Real materials often contain crystal defects and chemical order/disorder such as grain boundaries, dislocations, interfaces, surface reconstructions and point defects. Such disruption in periodicity strongly affects material properties and functionality. Despite rapid development of quantitative material characterization methods, correlating three-dimensional (3D) atomic arrangements of chemical order/disorder and crystal defects with material properties remains a challenge. On a parallel front, quantum mechanics calculations such as density functional theory (DFT) have progressed from the modelling of ideal bulk systems to modelling ‘real’ materials with dopants, dislocations, grain boundaries and interfaces; but these calculations rely heavily onmore » average atomic models extracted from crystallography. To improve the predictive power of first-principles calculations, there is a pressing need to use atomic coordinates of real systems beyond average crystallographic measurements. Here we determine the 3D coordinates of 6,569 iron and 16,627 platinum atoms in an iron-platinum nanoparticle, and correlate chemical order/disorder and crystal defects with material properties at the single-atom level. We identify rich structural variety with unprecedented 3D detail including atomic composition, grain boundaries, anti-phase boundaries, anti-site point defects and swap defects. We show that the experimentally measured coordinates and chemical species with 22 picometre precision can be used as direct input for DFT calculations of material properties such as atomic spin and orbital magnetic moments and local magnetocrystalline anisotropy. The work presented here combines 3D atomic structure determination of crystal defects with DFT calculations, which is expected to advance our understanding of structure–property relationships at the fundamental level.« less

Deciphering chemical order/disorder and material properties at the single-atom level.

PubMed

Yang, Yongsoo; Chen, Chien-Chun; Scott, M C; Ophus, Colin; Xu, Rui; Pryor, Alan; Wu, Li; Sun, Fan; Theis, Wolfgang; Zhou, Jihan; Eisenbach, Markus; Kent, Paul R C; Sabirianov, Renat F; Zeng, Hao; Ercius, Peter; Miao, Jianwei

2017-02-01

Perfect crystals are rare in nature. Real materials often contain crystal defects and chemical order/disorder such as grain boundaries, dislocations, interfaces, surface reconstructions and point defects. Such disruption in periodicity strongly affects material properties and functionality. Despite rapid development of quantitative material characterization methods, correlating three-dimensional (3D) atomic arrangements of chemical order/disorder and crystal defects with material properties remains a challenge. On a parallel front, quantum mechanics calculations such as density functional theory (DFT) have progressed from the modelling of ideal bulk systems to modelling 'real' materials with dopants, dislocations, grain boundaries and interfaces; but these calculations rely heavily on average atomic models extracted from crystallography. To improve the predictive power of first-principles calculations, there is a pressing need to use atomic coordinates of real systems beyond average crystallographic measurements. Here we determine the 3D coordinates of 6,569 iron and 16,627 platinum atoms in an iron-platinum nanoparticle, and correlate chemical order/disorder and crystal defects with material properties at the single-atom level. We identify rich structural variety with unprecedented 3D detail including atomic composition, grain boundaries, anti-phase boundaries, anti-site point defects and swap defects. We show that the experimentally measured coordinates and chemical species with 22 picometre precision can be used as direct input for DFT calculations of material properties such as atomic spin and orbital magnetic moments and local magnetocrystalline anisotropy. This work combines 3D atomic structure determination of crystal defects with DFT calculations, which is expected to advance our understanding of structure-property relationships at the fundamental level.

Crystallization of accessory phases in magmas by local saturation adjacent to phenocrysts

USGS Publications Warehouse

Bacon, C.R.

1989-01-01

Accessory minerals commonly occur attached to or included in the major crystalline phases of felsic and some intermediate igneous rocks. Apatite is particularly common as inclusions, but Fe-Ti oxides, pyrrhotite, zircon, monazite, chevkinite and xenotime are also known from silicic rocks. Accessories may nucleate near the host crystal/ liquid interface as a result of local saturation owing to formation of a differentiated chemical boundary layer in which accessory mineral solubility would be lower than in the surrounding liquid. Differentiation of this boundary layer would be greatest adjacent to ferromagnesian phenocrysts, especially Fe-Ti oxides; it is with oxides that accessories are most commonly associated in rocks. A boundary layer may develop if the crystal grows more rapidly than diffusion can transport incorporated and rejected elements to and from the phenocryst. Diffusion must dominate over convection as a mode of mass transfer near the advancing crystal/liquid interface in order for a boundary layer to exist. Accumulation of essential structural constituent elements of accessory minerals owing to their slow diffusion in evolved silicate melt also may force local saturation, but this is not a process that applies to all cases. Local saturation is an attractive mechanism for enhancing fractionation during crystallization differentiation. If accessory minerals attached to or included in phenocrysts formed because of local saturation, their host phenocrysts must have grown rapidly when accessories nucleated in comparison to lifetimes of magma reservoirs. Some inconsistencies remain in a local saturation origin for accessory phases that cannot be evaluated without additional information. ?? 1989.

Advancements in the Quantification of the Crystal Structure of ZNS Materials Produced in Variable Gravity

NASA Astrophysics Data System (ADS)

Castillo, Martin

2016-07-01

Screens and displays consume tremendous amounts of power. Global trends to significantly consume less power and increase battery life have led to the reinvestigation of electroluminescent materials. The state of the art in ZnS materials has not been furthered in the past 30 years and there is much potential in improving electroluminescent properties of these materials with advanced processing techniques. Self-propagating high temperature synthesis (SHS) utilises a rapid exothermic process involving high energy and nonlinearity coupled with a high cooling rate to produce materials formed outside of normal equilibrium boundaries thus possessing unique properties. The elimination of gravity during this process allows capillary forces to dominate mixing of the reactants which results in a superior and enhanced homogeneity in the product materials. ZnS type materials have been previously conducted in reduced gravity and normal gravity. It has been claimed in literature that a near perfect phases of ZnS wurtzite was produced. Although, the SHS of this material is possible at high pressures, there has been no quantitative information on the actual crystal structures and lattice parameters that were produced in this work. Utilising this process with ZnS doped with Cu, Mn, or rare earth metals such as Eu and Pr leads to electroluminescence properties, thus making this an attractive electroluminescent material. The work described here will revisit the synthesis of ZnS via high pressure SHS and will re-examine the work performed in both normal gravity and in reduced gravity within the ZARM drop tower facility. Quantifications in the lattice parameters, crystal structures, and phases produced will be presented to further explore the unique structure-property performance relationships produced from the SHS of ZnS materials.

Discovering the Role of Grain Boundary Complexions in Materials

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harmer, Martin P.

Grain boundaries are inherently an area of disorder in polycrystalline materials which define the transport and various other material properties. The relationship between the interfacial chemistry, structure and the material properties is not well understood. Among the various taxonomies for grain boundaries, Grain Boundary Complexion is a relatively new conceptual scheme that relates the structure and kinetic properties of grain boundaries. In this classification scheme, grain boundaries are considered to be distinct three dimensional (the thickness being considerably smaller as compared to the other two dimensions but nonetheless discernible) equilibrium thermodynamic phases abutted between two crystalline phases. The stability andmore » structure of these interfacial phases are dictated by various thermodynamic variables such as temperature, stress (pressure), interfacial chemistry (chemical potential) and most importantly by the energies of the adjoining crystal surfaces. These phases are only stable within the constraint of the adjoining grains. Although these interfacial phases are not stable in bulk form, they can transform from one complexion to another as a function of various thermodynamic variables analogous to the behavior of bulk phases. Examples of different complexions have been reported in various publications. However, a systematic investigation exploring the existence of grain boundary complexions in material systems other than alumina remains to be done. Although the role of interfacial chemistry on grain boundary complexions in alumina has been addressed, a clear understanding of the underlying thermodynamics governing complexion formation is lacking. Finally, the effects of grain boundary complexions in bulk material properties are widely unknown. Factors above urge a thorough exploration of grain boundary complexions in a range of different materials systems The purpose of the current program is to verify the existence of grain boundary complexion in a range of materials systems, and to characterize their structures, range of stability and selected physical properties. First, an Au-based bilayer interfacial phase was discovered at a bicrystal boundary in the Si-Au system. This bilayer transitioned abruptly to an intrinsic (“clean”) grain boundary phase, suggesting first-order phase behavior. This study represents the discovery of grain boundary complexions in a completely new system, i.e., a semiconductor-metal system, giving further support to the expectation that grain boundary complexions are a general phenomenon not limited to any particular class of materials. The TiO 2-CuO system exhibited four grain boundary interfacial phases: a monolayer, disordered bilayer, disordered trilayer, and non-wetting nanoscale amorphous drop (which likely resulted from dewetting of a nanoscale IGF). SiO 2 contamination was discovered in the TiO 2-CuO samples, and we hypothesize that this impurity may have caused an “order-disorder” transition to occur. In other words, we expect that pure TiO 2-CuO may have a higher tendency to exhibit ordered bilayer and trilayer complexions, which may also exhibit a well-defined order-disorder transition temperature. In this effort we have also identified unique complexion transitions in yttria and strontium titanate.« less

Grain boundary diffusion in olivine (Invited)

NASA Astrophysics Data System (ADS)

Marquardt, K.; Dohmen, R.

2013-12-01

Olivine is the main constituent of Earth's upper mantle. The individual mineral grains are separated by grain boundaries that have very distinct properties compared to those of single crystals and strongly affect large-scale physical and chemical properties of rocks, e.g. viscosity, electrical conductivity and diffusivity. Knowledge on the grain boundary physical and chemical properties, their population and distribution in polycrystalline materials [1] is a prerequisite to understand and model bulk (rock) properties, including their role as pathways for element transport [2] and the potential of grain boundaries as storage sites for incompatible elements [3]. Studies on selected and well characterized single grain boundaries are needed for a detailed understanding of the influence of varying grain boundaries. For instance, the dependence of diffusion on the grain boundary structure (defined by the lattice misfit) and width in silicates is unknown [2, 4], but limited experimental studies in material sciences indicate major effects of grain boundary orientation on diffusion rates. We characterized the effect of grain boundary orientation and temperature on element diffusion in forsterite grain boundaries by transmission electron microscopy (TEM).The site specific TEM-foils were cut using the focused ion beam technique (FIB). To study diffusion we prepared amorphous thin-films of Ni2SiO4 composition perpendicular to the grain boundary using pulsed laser deposition. Annealing (800-1450°C) leads to crystallization of the thin-film and Ni-Mg inter-diffuse into the crystal volume and along the grain boundary. The inter-diffusion profiles were measured using energy dispersive x-ray spectrometry in the TEM, standardized using the Cliff-Lorimer equation and EMPA measurements. We obtain volume diffusion coefficients that are comparable to Ni-Mg inter-diffusion rates in forsterite determined in previous studies at comparable temperatures, with similar activation energies. Grain boundary diffusion perpendicular to the dislocation lines of the small angle grain boundaries proved to be about an order of magnitude faster than volume diffusion, whereas diffusion in high angle grain boundaries is several orders of magnitude faster. We will discuss the variation of element diffusion rates with grain boundary orientation and the temperature- and/or time-induced transition from one diffusion regime to the next regime. This is done using time series experiments and two-dimensional grain boundary diffusion simulations. Finally, we will debate the differences between our data and other data sets that result from different experimental setups, conditions and analyses.

Magnetism out of antisite disorder in the J =0 compound Ba2YIrO6

NASA Astrophysics Data System (ADS)

Chen, Q.; Svoboda, C.; Zheng, Q.; Sales, B. C.; Mandrus, D. G.; Zhou, H. D.; Zhou, J.-S.; McComb, D.; Randeria, M.; Trivedi, N.; Yan, J.-Q.

2017-10-01

We systematically investigate the magnetic properties and local structure of Ba2YIrO6 to demonstrate that Y and Ir lattice defects in the form of antiphase boundary or clusters of antisite disorder affect the magnetism observed in this 5 d4 compound. The experimental investigation involved comparison of the magnetic properties and atomic imaging of (1) a slow-cooled crystal, (2) a crystal quenched from 900°C after growth, and (3) a crystal grown using a faster cooling rate during growth than the slow-cooled one. Atomic-scale imaging by scanning transmission electron microscopy (STEM) shows that quenching from 900°C introduces Ir-rich antiphase boundaries in the crystals, and a faster cooling rate during crystal growth leads to clusters of Y and Ir antisite disorder. Compared to the slow-cooled crystals, Ba2YIrO6 crystals with clusters of antisite defects have a larger effective moment and a larger saturation moment, while quenched crystals with Ir-rich antiphase boundary show a slightly suppressed moment. Our DFT and model magnetic Hamiltonian calculations suggest magnetic condensation is unlikely, as the energy to be gained from superexchange is small compared to the spin-orbit gap. However, once Y is replaced by Ir in the antisite disordered region, the picture of local nonmagnetic singlets breaks down and magnetism can be induced. This is because of (a) enhanced interactions due to increased orbital overlap and (b) increased number of orbitals mediating the interactions. Our work highlights the importance of lattice defects in understanding the experimentally observed magnetism in Ba2YIrO6 and other J =0 systems.

A statistical study of the inner edge of the electron plasma sheet and the net convection potential as a function of geomagnetic activity

NASA Astrophysics Data System (ADS)

Jiang, F.; Kivelson, M. G.; Walker, R. J.; Khurana, K. K.; Angelopoulos, V.; Hsu, T.

2011-06-01

A widely accepted explanation of the location of the inner edge of the electron plasma sheet and its dependence on electron energy is based on drift motions of individual particles. The boundary is identified as the separatrix between drift trajectories linking the tail to the dayside magnetopause (open paths) and trajectories closed around the Earth. A statistical study of the inner edge of the electron plasma sheet using THEMIS Electrostatic Analyzer plasma data from November 2007 to April 2009 enabled us to examine this model. Using a dipole magnetic field and a Volland-Stern electric field with shielding, we find that a steady state drift boundary model represents the average location of the electron plasma sheet boundary and reflects its variation with the solar wind electric field in the local time region between 21:00 and 06:00, except at high activity levels. However, the model does not reproduce the observed energy dispersion of the boundaries. We have also used the location of the inner edge of the electron plasma sheet to parameterize the potential drop of the tail convection electric field as a function of solar wind electric field (Esw) and geomagnetic activity. The range of Esw examined is small because the data were acquired near solar minimum. For the range of values tested (meaningful statistics only for Esw < 2 mV/m), reasonably good agreement is found between the potential drop of the tail convection electric field inferred from the location of the inner edge and the polar cap potential drop calculated from the model of Boyle et al. (1997).

Diffusion Of Mass In Evaporating Multicomponent Drops

NASA Technical Reports Server (NTRS)

Bellan, Josette; Harstad, Kenneth G.

1992-01-01

Report summarizes study of diffusion of mass and related phenomena occurring in evaporation of dense and dilute clusters of drops of multicomponent liquids intended to represent fuels as oil, kerosene, and gasoline. Cluster represented by simplified mathematical model, including global conservation equations for entire cluster and conditions on boundary between cluster and ambient gas. Differential equations of model integrated numerically. One of series of reports by same authors discussing evaporation and combustion of sprayed liquid fuels.

High-throughput method for optimum solubility screening for homogeneity and crystallization of proteins

DOEpatents

Kim, Sung-Hou [Moraga, CA; Kim, Rosalind [Moraga, CA; Jancarik, Jamila [Walnut Creek, CA

2012-01-31

An optimum solubility screen in which a panel of buffers and many additives are provided in order to obtain the most homogeneous and monodisperse protein condition for protein crystallization. The present methods are useful for proteins that aggregate and cannot be concentrated prior to setting up crystallization screens. A high-throughput method using the hanging-drop method and vapor diffusion equilibrium and a panel of twenty-four buffers is further provided. Using the present methods, 14 poorly behaving proteins have been screened, resulting in 11 of the proteins having highly improved dynamic light scattering results allowing concentration of the proteins, and 9 were crystallized.

Bubble formation during drop impact on a heated pool

NASA Astrophysics Data System (ADS)

Tian, Yuansi; Alhazmi, Muath; Kouraytem, Nadia; Thoroddsen, Sigurdur

2017-11-01

Ultra high-speed video imaging, at up to 200 kfps, is used to investigate a drop impinging onto a high temperature pool. The room-temperature perfluorohexane drop, which has a boiling temperature as low as 56 °C impacts on the soybean oil pool heated up to around 200 °C, which is overwhelmingly higher than the boiling temperature of the drop. The bottom of the drop is therefore covered by a layer of vapor which prevents contact between the two immiscible liquid surfaces, akin to the Leidenfrost effect However, as the pool temperature is reduced, one starts seeing contact and the dynamics transition into the vapor explosion regime. At the boundary of this regime we observe some entrapment of scattered or a toroidal ring of small bubbles. Experimental video data will be presented to show this novel phenomenon and explain how these bubbles are formed and evolve.

Electrohydrodynamics of drops in strong electric fields: Simulations and theory

NASA Astrophysics Data System (ADS)

Saintillan, David; Das, Debasish

2016-11-01

Weakly conducting dielectric liquid drops suspended in another dielectric liquid exhibit a wide range of dynamical behaviors when subject to an applied uniform electric field contingent on field strength and material properties. These phenomena are best described by the much celebrated Maylor-Taylor leaky dielectric model that hypothesizes charge accumulation on the drop-fluid interface and prescribes a balance between charge relaxation, the jump in Ohmic currents and charge convection by the interfacial fluid flow. Most previous numerical simulations based on this model have either neglected interfacial charge convection or restricted themselves to axisymmetric drops. In this work, we develop a three-dimensional boundary element method for the complete leaky dielectric model to systematically study the deformation and dynamics of liquid drops in electric fields. The inclusion of charge convection in our simulation permits us to investigate drops in the Quincke regime, in which experiments have demonstrated symmetry-breaking bifurcations leading to steady electrorotation. Our simulation results show excellent agreement with existing experimental data and small deformation theories. ACSPRF Grant 53240-ND9.

Crystallization of human estrogenic 17β-hydroxysteroid dehydrogenase under microgravity

NASA Astrophysics Data System (ADS)

Zhu, Dao-Wei; Zhou, Ming; Mao, Ying; Labrie, Fernand; Lin, Sheng-Xiang

1995-11-01

Human 17β-hydroxysteroid dehydrogenase has been crystallized on the ground in the complex form with NADP + and a complete data set of the crystal was primarily collected at 2.9 Å [D.-W. Zhu, X. Lee, R. Breton, D. Ghosh, W. Pangborn, W.L. Duax and S.-X. Lin, J. Mol. Biol. 234 (1993) 242]. To eliminate multiseeding, formation of multicrystals and to obtain higher quality crystals, we carried out the crystallization aboard the Russian MIR space station and crystals were recovered in January, 1994. Crystals of the enzyme were formed in 9 of the total 12 sitting drops in the space mission, in the presence of NADP + or estradiol. This is a first attempt of crystallization of a membrane-associated protein under microgravity in the presence of a detergent. The space experiments showed better results in nucleation number, crystal size and morphology than the ground ones, obtaining crystals diffracting to resolutions between 2.5-2.7 Å. The too early ground mixing has limited a more important improvement of the crystallization.

Time lapse microscopy of temperature control during self-assembly of 3D DNA crystals

NASA Astrophysics Data System (ADS)

Conn, Fiona W.; Jong, Michael Alexander; Tan, Andre; Tseng, Robert; Park, Eunice; Ohayon, Yoel P.; Sha, Ruojie; Mao, Chengde; Seeman, Nadrian C.

2017-10-01

DNA nanostructures are created by exploiting the high fidelity base-pairing interactions of double-stranded branched DNA molecules. These structures present a convenient medium for the self-assembly of macroscopic 3D crystals. In some self-assemblies in this system, crystals can be formed by lowering the temperature, and they can be dissolved by raising it. The ability to monitor the formation and melting of these crystals yields information that can be used to monitor crystal formation and growth. Here, we describe the development of an inexpensive tool that enables direct observation of the crystal growth process as a function of both time and temperature. Using the hanging-drop crystallization of the well-characterized 2-turn DNA tensegrity triangle motif for our model system, its response to temperature has been characterized visually.

Aberrated surface soliton formation in a nonlinear 1D and 2D photonic crystal

PubMed Central

Lysak, Tatiana M.; Trykin, Evgenii M.

2018-01-01

We discuss a novel type of surface soliton—aberrated surface soliton—appearance in a nonlinear one dimensional photonic crystal and a possibility of this surface soliton formation in two dimensional photonic crystal. An aberrated surface soliton possesses a nonlinear distribution of the wavefront. We show that, in one dimensional photonic crystal, the surface soliton is formed at the photonic crystal boundary with the ambient medium. Essentially, that it occupies several layers at the photonic crystal boundary and penetrates into the ambient medium at a distance also equal to several layers, so that one can infer about light energy localization at the lateral surface of the photonic crystal. In the one dimensional case, the surface soliton is formed from an earlier formed soliton that falls along the photonic crystal layers at an angle which differs slightly from the normal to the photonic crystal face. In the two dimensional case, the soliton can appear if an incident Gaussian beam falls on the photonic crystal face. The influence of laser radiation parameters, optical properties of photonic crystal layers and ambient medium on the one dimensional surface soliton formation is investigated. We also discuss the influence of two dimensional photonic crystal configuration on light energy localization near the photonic crystal surface. It is important that aberrated surface solitons can be created at relatively low laser pulse intensity and for close values of alternating layers dielectric permittivity which allows their experimental observation. PMID:29558497

DOE Office of Scientific and Technical Information (OSTI.GOV)

Imamura, Kayo; Matsuura, Takanori; Ye, Zhengmao

Disproportionating enzyme from potato was crystallized and preliminarily analyzed using X-ray diffraction. Disproportionating enzyme (D-enzyme; EC 2.4.1.25) is a 59 kDa protein that belongs to the α-amylase family. D-enzyme catalyses intramolecular and intermolecular transglycosylation reactions of α-1,4 glucan. A crystal of the D-enzyme from potato was obtained by the hanging-drop vapour-diffusion method. Preliminary X-ray data showed that the crystal diffracts to 2.0 Å resolution and belongs to space group C222{sub 1}, with unit-cell parameters a = 69.7, b = 120.3, c = 174.2 Å.

Expression, purification, crystallization and preliminary X-ray studies of Lactobacillus jensenii enolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.

2010-09-02

Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.

Effect of interface deformability on thermocapillary motion of a drop in a tube

NASA Astrophysics Data System (ADS)

Mahesri, S.; Haj-Hariri, H.; Borhan, A.

2014-03-01

The effect of an externally imposed axial temperature gradient on the mobility and deformation of a drop in an otherwise stagnant liquid within an insulated cylindrical tube is investigated. In the absence of bulk transport of momentum and energy, the boundary integral technique is used to obtain the flow and temperature fields inside and outside the deformable drop. The steady drop shapes and the corresponding migration velocities are examined over a wide range of the dimensionless parameters. The steady drop shape is nearly spherical for dimensionless drop sizes <0.5, but becomes slightly elongated in the axial direction for drop sizes comparable to tube diameter. The adverse effect of drop deformation on the effective temperature gradient driving the motion is slightly more pronounced than its favorable effect of reducing drag, thereby leading to a slight reduction in drop mobility with increasing drop deformation. Increasing the viscosity ratio reduces drop deformation and leads to a slight enhancement in the relative mobility (with respect to free thermocapillary motion) of confined drops. When the drop fluid has a lower thermal conductivity than the exterior phase, the presence of the thermally-insulating wall increases the thermal driving force for drop motion (compared to that for the same drop in unbounded domain) by causing more pronounced bending of the isotherms toward the drop. However, the favorable thermal effect of the confining wall is overwhelmed by its retarding hydrodynamic effect, causing the confined drop to always move slower than its unbounded counterpart regardless of the value of the thermal conductivity ratio.

Protein crystal growth in a microgravity environment

NASA Technical Reports Server (NTRS)

Bugg, Charles E.

1988-01-01

Protein crystal growth is a major experimental problem and is the bottleneck in widespread applications of protein crystallography. Research efforts now being pursued and sponsored by NASA are making fundamental contributions to the understanding of the science of protein crystal growth. Microgravity environments offer the possibility of performing new types of experiments that may produce a better understanding of protein crystal growth processes and may permit growth environments that are more favorable for obtaining high quality protein crystals. A series of protein crystal growth experiments using the space shuttle was initiated. The first phase of these experiments was focused on the development of micro-methods for protein crystal growth by vapor diffusion techniques, using a space version of the hanging drop method. The preliminary space experiments were used to evolve prototype hardware that will form the basis for a more advanced system that can be used to evaluate effects of gravity on protein crystal growth.

Crystallization and preliminary X-ray analysis of gamma-glutamyltranspeptidase from Escherichia coli K-12.

PubMed

Kumagai, H; Nohara, S; Suzuki, H; Hashimoto, W; Yamamoto, K; Sakai, H; Sakabe, K; Fukuyama, K; Sakabe, N

1993-12-20

gamma-Glutamyltranspeptidase (EC 2.3.2.2) from Escherichia coli K-12 has been purified and crystallized by means of vapor diffusion in hanging drops. Two kinds of crystals on cell dimensions were found for X-ray diffraction analysis, one from ammonium sulfate and the other from polyethylene glycol 6000 as precipitants. The crystals of the orthorhombic form grown in the presence of 15% polyethylene glycol and 20 mM sodium acetate buffer were chosen for further analysis. The crystals belonged to space group P2(1)2(1)2(1), with cell dimensions of a = 128.1, b = 129.9 and c = 79.2 A, and two molecules constitute an asymmetric unit. These crystals diffracted to 2.0 A resolution and were suitable for X-ray crystallographic studies.

Experimental Characterization and Simulation of Slip Transfer at Grain Boundaries and Microstructurally-Sensitive Crack Propagation

NASA Technical Reports Server (NTRS)

Gupta, Vipul; Hochhalter, Jacob; Yamakov, Vesselin; Scott, Willard; Spear, Ashley; Smith, Stephen; Glaessgen, Edward

2013-01-01

A systematic study of crack tip interaction with grain boundaries is critical for improvement of multiscale modeling of microstructurally-sensitive fatigue crack propagation and for the computationally-assisted design of more durable materials. In this study, single, bi- and large-grain multi-crystal specimens of an aluminum-copper alloy are fabricated, characterized using electron backscattered diffraction (EBSD), and deformed under tensile loading and nano-indentation. 2D image correlation (IC) in an environmental scanning electron microscope (ESEM) is used to measure displacements near crack tips, grain boundaries and within grain interiors. The role of grain boundaries on slip transfer is examined using nano-indentation in combination with high-resolution EBSD. The use of detailed IC and EBSD-based experiments are discussed as they relate to crystal-plasticity finite element (CPFE) model calibration and validation.

The role of subgrain boundaries in partial melting

NASA Astrophysics Data System (ADS)

Levine, Jamie S. F.; Mosher, Sharon; Rahl, Jeffrey M.

2016-08-01

Evidence for partial melting along subgrain boundaries in quartz and plagioclase is documented for rocks from the Lost Creek Gneiss of the Llano Uplift, central Texas, the Wet Mountains of central Colorado, and the Albany-Fraser Orogen, southwestern Australia. Domains of quartz or plagioclase crystals along subgrain boundaries are preferentially involved in partial melting over unstrained domains of these minerals. Material along subgrain boundaries in quartz and plagioclase has the same morphology as melt pseudomorphs present along grain boundaries and is commonly laterally continuous with this former grain boundary melt, indicating the material along subgrain boundaries can also be categorized as a melt pseudomorph. Subgrain boundaries consist of arrays of dislocations within a crystal lattice, and unlike fractures would not act as conduits for melt migration. Instead, the presence of former melt along subgrain boundaries requires that partial melting occurred in these locations because it is kinetically more favorable for melting reactions to occur there. Preferential melting in high strain locations may be attributed to strain energy, which provides a minor energetic contribution to the reaction and leads to preferential melting in locations with weakened bonds, and/or the presence of small quantities of water associated with dislocations, which may enhance diffusion rates or locally lower the temperature needed for partial melting.

A novel boundary layer sensor utilizing domain switching in ferroelectric liquid crystals

NASA Technical Reports Server (NTRS)

Parmar, D. S.

1991-01-01

This paper describes the design and the principles of operation of a novel sensor for the optical detection of a shear stress field induced by air or gas flow on a rigid surface. The detection relies on the effects of shear-induced optical switching in ferroelectric liquid crystals. It is shown that the method overcomes many of the limitations of similar measuring techniques including those using cholesteric liquid crystals. The present method offers a preferred alternative for flow visualization and skin friction measurements in wind-tunnel experiments on laminar boundary layer transition investigations. A theoretical model for the optical response to shear stress is presented together with a schematic diagram of the experimental setup.

Shear-induced surface alignment of polymer dispersed liquid crystal microdroplets on the boundary layer

NASA Technical Reports Server (NTRS)

Parmar, D. S.; Singh, J. J.

1993-01-01

Polymer dispersed liquid crystal thin films have been deposited on a glass substrate, utilizing the processes of polymerization and solvent evaporation induced phase separation. Liquid crystal microdroplets trapped on the upper surface of the thin film respond to the shear stress due to air or gas flow on the surface layer. Response to an applied step shear stress input on the surface layer has been measured by measuring the time response of the transmitted light intensity. Initial results on the measurements of the light transmission as a function of the air flow differential pressure indicate that these systems offer features suitable for boundary layer and gas flow sensors.

Detergent-Specific Membrane Protein Crystallization Screens

NASA Technical Reports Server (NTRS)

Wiener, Michael

2007-01-01

A suite of reagents has been developed for three-dimensional crystallization of integral membranes present in solution as protein-detergent complexes (PDCs). The compositions of these reagents have been determined in part by proximity to the phase boundaries (lower consolute boundaries) of the detergents present in the PDCs. The acquisition of some of the requisite phase-boundary data and the preliminary design of several of the detergent- specific screens was supported by a NASA contract. At the time of expiration of the contract, a partial set of preliminary screens had been developed. This work has since been extended under non-NASA sponsorship, leading to near completion of a set of 20 to 30 different and unique detergent- specific 96-condition screens.

DISPOSITION OF THE INNER RADIATION BELT AND MAGNETIC FIELD OF THE EARTH

DOE Office of Scientific and Technical Information (OSTI.GOV)

GORCHAKOV, IE. V.

1963-02-01

A scintillation counter on Sputnik III was used to conduct ionization measurement in a sodium iodide crystal and register the number of events releasing more than 35 kev in the crystal. The boundary of the inner radiation belt shows a strong longitudinal effect. The observed dependence on longitude of the boundary was explained by the fact that the inner belt consists of particles captured by the geomagnetic field and constitutes a noncentral dipole field. (C.E.S.)

Depressed scattering across grain boundaries in single crystal graphene

NASA Astrophysics Data System (ADS)

Chen, Jiao; Jin, Zhi; Ma, Peng; Wang, Hong; Wang, Haomin; Shi, Jingyuan; Peng, Songang; Liu, Xinyu; Ye, Tianchun

2012-10-01

We investigated the electrical and quantum properties of single-crystal graphene (SCG) synthesized by chemical vapor deposition (CVD). Quantum Hall effect and Shubnikov de Hass oscillation, a distinguishing feature of a 2-dimensional electronic material system, were observed during the low temperature transport measurements. Decreased scattering from grain boundaries in SCG was proven through extracting information from weak localization theory. Our results facilitate understanding the electrical properties of SCG grown by CVD and its applications in high speed transistor and quantum devices.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grenon, Cedric; Lake, Kayll

The generalized Swiss-cheese model, consisting of a Lemaitre-Tolman (inhomogeneous dust) region matched, by way of a comoving boundary surface, onto a Robertson-Walker background of homogeneous dust, has become a standard construction in modern cosmology. Here, we ask if this construction can be made more realistic by introducing some evolution of the boundary surface. The answer we find is no. To maintain a boundary surface using the Darmois-Israel junction conditions, as opposed to the introduction of a surface layer, the boundary must remain exactly comoving. The options are to drop the assumption of dust or allow the development of surface layers.more » Either option fundamentally changes the original construction.« less

Boundary effects in a quasi-two-dimensional driven granular fluid.

PubMed

Smith, N D; Smith, M I

2017-12-01

The effect of a confining boundary on the spatial variations in granular temperature of a driven quasi-two-dimensional layer of particles is investigated experimentally. The radial drop in the relative granular temperature ΔT/T exhibits a maximum at intermediate particle numbers which coincides with a crossover from kinetic to collisional transport of energy. It is also found that at low particle numbers, the distributions of radial velocities are increasingly asymmetric as one approaches the boundary. The radial and tangential granular temperatures split, and in the tails of the radial velocity distribution there is a higher population of fast moving particles traveling away rather than towards the boundary.

Single crystalline silicene consist of various superstructures using a flexible ultrathin Ag(111) template on Si(111)

NASA Astrophysics Data System (ADS)

Hsu, Hung-Chang; Lu, Yi-Hung; Su, Tai-Lung; Lin, Wen-Chin; Fu, Tsu-Yi

2018-07-01

Using scanning tunneling microscopy, we studied the formation of silicene on an ultrathin Ag(111) film with a thickness of 6–12 monolayers, which was prepared on a Si(111) substrate. A low-energy electron diffraction pattern with an oval spot indicated that the ultrathin Ag(111) film is more disordered than the single-crystal Ag(111). After Si epitaxy growth, we still measured the classical 4 × 4, √13 × √13, and 2√3 × 2√3 silicene superstructures, which are the same as the silicene superstructure on single-crystal Ag(111). Growing silicene on a single-crystal Ag(111) bulk usually results in the formation of a defect boundary due to the inconsistent orientation of various superstructures. By comparing the angles and boundary conditions between various silicene superstructures on the ultrathin film and single-crystal Ag(111), we discovered that a consistent orientation of various superstructures without obvious boundary defects formed on the ultrathin Ag(111) film. The results indicated single crystalline silicene formation, which was attributed to the domain rotation and lateral shift of the disordered ultrathin Ag(111) film.

Crystallization and crystallographic studies of kallistatin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Fang; Zhou, Aiwu; Wei, Zhenquan, E-mail: weizhq@gmail.com

2015-08-25

The crystallization of human kallistatin in the relaxed conformation is reported. Kallistatin is a serine protease inhibitor (serpin) which specifically inhibits human tissue kallikrein; however, its inhibitory activity is inhibited by heparin. In order to elucidate the underlying mechanism, recombinant human kallistatin was prepared in Escherichia coli and the protein was crystallized by the sitting-drop vapour-diffusion method. X-ray diffraction data were collected to 1.9 Å resolution. The crystals were found to belong to space group P6{sub 1}, with unit-cell parameters a = 113.51, b = 113.51, c = 76.17 Å. Initial analysis indicated that the crystallized kallistatin was in amore » relaxed conformation, with its reactive-centre loop inserted in the central β-sheet.« less

Crystallization and preliminary X-ray analysis of native and selenomethionyl vinorine synthase from Rauvolfia serpentina.

PubMed

Ma, Xueyan; Koepke, Juergen; Bayer, Anja; Fritzsch, Günter; Michel, Hartmut; Stöckigt, Joachim

2005-06-01

Vinorine synthase (VS) is a central enzyme of the biosynthesis of the antiarrhythmic drug ajmaline and is a member of the BAHD superfamily of acyltransferases. So far, no three-dimensional structure with significant sequence homology with VS is known. Crystals of VS and selenomethionyl-labelled VS from the medicinal plant Rauvolfia serpentina have been obtained by the hanging-drop technique at 305 K with ammonium sulfate and PEG 400 as precipitants. VS crystals diffract to 2.8 A and belong to space group P2(1)2(1)2(1), with unit-cell parameters a = 82.3, b = 89.6, c = 136.2 A. The selenomethionyl VS crystal was nearly isomorphous with the VS crystal.

Crystallization and preliminary X-ray analysis of PH1566, a putative ribosomal RNA-processing factor from the hyperthermophilic archaeon Pyrococcus horikoshii OT3

PubMed Central

Jia, Min Ze; Ohtsuka, Jun; Lee, Woo Cheol; Nagata, Koji; Tanokura, Masaru

2006-01-01

A putative ribosomal RNA-processing factor consisting of two KH domains from Pyrococcus horikoshii OT3 (PH1566; 25 kDa) was crystallized by the sitting-drop vapour-diffusion method using PEG 3000 as the precipitant. The crystals diffracted X-rays to beyond 2.0 Å resolution using a synchrotron-radiation source. The space group of the crystals was determined as primitive orthorhombic P212121, with unit-cell parameters a = 45.9, b = 47.4, c = 95.7 Å. The crystals contain one molecule in the asymmetric unit (V M = 2.5 Å3 Da−1) and have a solvent content of 50%. PMID:16511260

Monoclinic nanodomains in morphotropic phase boundary Pb(Mg{sub 1/3}Nb{sub 2/3})O{sub 3}–PbTiO{sub 3}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sato, Y., E-mail: y-sato@sigma.t.u-tokyo.ac.jp; Hirayama, T.; Ikuhara, Y.

2014-02-24

Crystalline structure is a fundamental characteristic of many materials, and drastic changes in properties may accompany crystal phase transitions. A prominent example of this is the morphotropic phase boundary of (Pb(Mg{sub 1/3}Nb{sub 2/3})O{sub 3}-PbTiO{sub 3}) single crystal, a region that exhibits a high piezoelectric effect. Although the highest piezoelectricity is often attributed to a monoclinic crystal phase, formation of ferroelectric nanodomains (NDs) complicates understanding of this crystal structure. In this Letter, we report dedicated transmission electron microscopy and electron diffraction analysis to understand the crystal structure at the ND level. Splitting of diffraction spots, caused by very small lattice distortionmore » in the NDs, is important to understanding crystal structure and has been unambiguously observed. The results can be explained by monoclinic phase NDs. Combining these results with our previous findings on ND dynamics [Sato et al. Phys. Rev. Lett. 107, 187601 (2011)], monoclinic NDs can potentially make a considerable contribution to the piezoelectricity in these materials.« less

Electron-Hole Condensation in Semiconductors: Electrons and holes condense into freely moving liquid metallic droplets, a plasma phase with novel properties.

PubMed

Jeffries, C D

1975-09-19

In Ge and Si, and also in Ge-Si alloys (74), there is extensive evidence for the stable binding of electrons and holes into a cold plasma of constant density, which undergoes a phase separation. Liquid metallic drops 1 to 300 microm in size are formed, with lifetimes ranging from 0.1 to 600 microsec. For Ge a surprising amount is known: the phase diagram, the surface energy, the work function, the decay kinetics. Much less is known for Si. There is good agreement between theoretical and experimental values of the liquid density, the critical density, the critical temperature, and the binding energy. The stability of the liquid phase is strikingly dependent on band structure. The multivalley structure and mass anisotropy of Si, Ge, and Ge-Si, together with their indirect band gap, are no doubt responsible for the observed stability in these crystals. In the similar semiconductor gallium phosphide, drops have not yet been observed, most likely because the high impurity content traps the excitons. In gallium arsenide the existence of drops is controversial (75). Undoubtedly drops will be found to exist in other semiconductors, perhaps at even higher temperatures. This is an exciting field for the experimentalist; new phenomena are being rapidly discovered, usually before they are predicted. For the theorist, the electron-hole drop is of high intrinsic interest. It represents the first example of a quantum liquid of constant density in a periodic crystal lattice. A number of challenging experimental and theoretical problems remain.

Origin of Aphyric Phonolitic Magmas: Natural Evidences and Experimental Constraints

NASA Astrophysics Data System (ADS)

Masotta, M.; Freda, C.; Gaeta, M.

2010-12-01

Large explosive phonolitic eruptions are commonly characterised by aphyric juvenile eruptive products. Taking into account the low density contrast among phonolitic composition and settling phases (i.e., feldspar and leucite), the almost complete lack of crystals in these differentiated compositions rises the question of which process could produce such an efficient crystal-melt separation. Seeking for an answer, we have investigated crystallization in presence of a thermal gradient as a possible mechanism for crystal-melt separation, considering both chemical and physical effects acting on a variably crystallized system. Using a natural tephri-phonolitic composition as starting material (M.te Aguzzo scoria cone, Sabatini Volcanic District, Central Italy), we have reproduced thermal gradient-driven crystallization in order to simulate the crystallization process in a thermally zoned magma chamber. Crystallization degree (paragenesis made of clinopyroxene±feldspars±leucite) as well as melt composition varies along the thermal gradient. In particular, melt composition ranges from the tephri-phonolitic starting composition at the bottom of the charge (hottest and aphyric zone) to phonolitic at the top (cooler and heterogeneously-crystallised zone). Backscattered images of experimental products clearly evidence: i) the aphyric tephri-phonolitic melt region at the bottom of the charge; ii) a drop-shaped crystal clustering in the middle zone; and iii) large aphyric belt and pockets (up to 100 µm wide) of phonolitic melt, with large deformed-shaped sanidine occurring at their margin, at the charge top region. The latter two features, resulting from solid-melt displacements, suggest that the segregation of phonolitic melt can be related to crystal sinking and compaction. On the other hand, the compositional variability of the melt along the thermal gradient is directly related to the crystallization degree, indicating that chemical diffusion and thermal migration have negligible effect at the experimental scale. Experimental results suggest that, in presence of a thermal gradient, a filter-press differentiation mechanism (i.e. sinking+compaction) is able to produce heterogeneous magma differentiation characterised by a wide range of melt compositions (in our case from tephri-phonolitic to phonolitic). Although the limitation due to the vertical shape of the charge and consequent shear effects occurring at the lateral walls (thus limiting the mobility of the crystal clusters), experimental duration of 24 h is enough to allow crystal-melt separation by means of settling and compaction, indicating that timescale for such a process is extremely rapid and effective at experimental conditions. Actually, experimental textures and phase relations are in good agreement with those observed in natural lithic enclaves (from Sabatini Volcanic District) representative of the crystallizing boundary layer of a phonolitic magma chamber. Thus, we speculate that gravitative collapses of a mushy zone from the magma chamber roof of a thermally zoned magma chamber may produce top accumulation of highly differentiated and aphyric melts.

Improved expression, purification and crystallization of a putative N-acetyl-γ-glutamyl-phosphate reductase from rice (Oryza sativa)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miura-Ohnuma, Jun; Nonaka, Tsuyoshi; Katoh, Shizue

2005-12-01

Crystals of OsAGPR were obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å. N-Acetyl-γ-glutamyl-phosphate reductase (AGPR) catalyzes the third step in an eight-step arginine-biosynthetic pathway that starts with glutamate. This enzyme converts N-acetyl-γ-glutamyl phosphate to N-acetylglutamate-γ-semialdehyde by an NADPH-dependent reductive dephosphorylation. AGPR from Oryza sativa (OsAGPR) was expressed in Escherichia coli at 291 K as a soluble fusion protein with an upstream thioredoxin-hexahistidine [Trx-(His){sub 6}] extension. OsAGPR(Ala50–Pro366) was purified and crystals weremore » obtained using the sitting-drop vapour-diffusion method at 293 K and diffract X-rays to at least 1.8 Å resolution. They belong to the hexagonal space group P6{sub 1}, with unit-cell parameters a = 86.11, c = 316.3 Å.« less

On charging of snow particles in blizzard

NASA Technical Reports Server (NTRS)

Shio, Hisashi

1991-01-01

The causes of the charge polarity on the blizzard, which consisted of fractured snow crystals and ice particles, were investigated. As a result, the charging phenomena showed that the characteristics of the blizzard are as follows: (1) In the case of the blizzard with snowfall, the fractured snow particles drifting near the surface of snow field (lower area: height 0.3 m) had positive charge, while those drifting at higher area (height 2 m) from the surface of snow field had negative charge. However, during the series of blizzards two kinds of particles positively and negatively charged were collected in equal amounts in a Faraday Cage. It may be considered that snow crystals with electrically neutral properties were separated into two kinds of snow flakes (charged positively and negatively) by destruction of the snow crystals. (2) In the case of the blizzard which consisted of irregularly formed ice drops (generated by peeling off the hardened snow field), the charge polarity of these ice drops salting over the snow field was particularly controlled by the crystallographic characteristics of the surface of the snow field hardened by the powerful wind pressure.

Colloidal crystal grain boundary formation and motion

PubMed Central

Edwards, Tara D.; Yang, Yuguang; Beltran-Villegas, Daniel J.; Bevan, Michael A.

2014-01-01

The ability to assemble nano- and micro- sized colloidal components into highly ordered configurations is often cited as the basis for developing advanced materials. However, the dynamics of stochastic grain boundary formation and motion have not been quantified, which limits the ability to control and anneal polycrystallinity in colloidal based materials. Here we use optical microscopy, Brownian Dynamic simulations, and a new dynamic analysis to study grain boundary motion in quasi-2D colloidal bicrystals formed within inhomogeneous AC electric fields. We introduce “low-dimensional” models using reaction coordinates for condensation and global order that capture first passage times between critical configurations at each applied voltage. The resulting models reveal that equal sized domains at a maximum misorientation angle show relaxation dominated by friction limited grain boundary diffusion; and in contrast, asymmetrically sized domains with less misorientation display much faster grain boundary migration due to significant thermodynamic driving forces. By quantifying such dynamics vs. compression (voltage), kinetic bottlenecks associated with slow grain boundary relaxation are understood, which can be used to guide the temporal assembly of defect-free single domain colloidal crystals. PMID:25139760

Deformation, recrystallization, strength, and fracture of press-forged ceramic crystals.

NASA Technical Reports Server (NTRS)

Rice, R. W.

1972-01-01

Sapphire and ruby were very difficult to press-forge because they deformed without cracking only in a limited temperature range before they melted. Spinel crystals were somewhat easier and MgO, CaO, and TiC crystals much easier to forge. The degree of recrystallization that occurred during forging (which was related to the ease and type of slip intersections) varied from essentially zero in Al2O3 to complete (i.e., random polycrystalline bodies were produced) in CaO. Forging of bi- and polycrystalline bodies produced incoherent bodies as a result of grain-boundary sliding. Strengths of the forged crystals were comparable to those of dense polycrystalline bodies of similar grain size. However, forged and recrystallized CaO crystals were ductile at lower temperatures than dense hot-pressed CaO. This behavior is attributed to reduced grain-boundary impurities and porosity. Fracture origins could be located, indicating that fracture in the CaO occurs internally as a result of surface work hardening caused by machining.-

RH-temperature phase diagrams of hydrate forming deliquescent crystalline ingredients.

PubMed

Allan, Matthew; Mauer, Lisa J

2017-12-01

Several common deliquescent crystalline food ingredients (including glucose and citric acid) are capable of forming crystal hydrate structures. The propensity of such crystals to hydrate/dehydrate or deliquesce is dependent on the environmental temperature and relative humidity (RH). As an anhydrous crystal converts to a crystal hydrate, water molecules internalize into the crystal structure resulting in different physical properties. Deliquescence is a solid-to-solution phase transformation. RH-temperature phase diagrams of the food ingredients alpha-d-glucose and citric acid, along with sodium sulfate, were produced using established and newly developed methods. Each phase diagram included hydrate and anhydrate deliquescence boundaries, the anhydrate-hydrate phase boundary, and the peritectic temperature (above which the hydrate was no longer stable). This is the first report of RH-temperature phase diagrams of glucose and citric acid, information which is beneficial for selecting storage and processing conditions to promote or avoid hydrate formation or loss and/or deliquescence. Copyright © 2017 Elsevier Ltd. All rights reserved.

Motion of deformable drops through granular media and other confined geometries.

PubMed

Davis, Robert H; Zinchenko, Alexander Z

2009-06-15

This article features recent simulation studies of the flow of emulsions containing deformable drops through pores, constrictions, and granular media. The flow is assumed to be at low Reynolds number, so that viscous forces dominate, and boundary-integral methods are used to determine interfacial velocities and, hence, track the drop motion and shapes. A single drop in a flat channel migrates to the channel centerplane due to deformation-induced drift, which increases its steady-state velocity along the channel. A drop moving towards a smaller interparticle constriction squeezes through the constriction if the capillary number (ratio of viscous deforming forces and interfacial tension forces) is large enough, but it becomes trapped when the capillary number is below a critical value. These concepts then influence the flow of an emulsion through a granular medium, for which the drop phase moves faster than the suspending liquid at large capillary numbers but slower than the suspending liquid at smaller capillary numbers. The permeabilities of the granular medium to both phases increase with increasing capillary number, due to the reduced resistance to squeezing of easily deformed drops, though drop breakup must also be considered at large capillary numbers.

Design of dual ring wavelength filters for WDM applications

NASA Astrophysics Data System (ADS)

Sathyadevaki, R.; Shanmuga sundar, D.; Sivanantha Raja, A.

2016-12-01

Wavelength division multiplexing plays a prime role in an optical communication due to its advantages such as easy network expansion, longer span lengths etc. In this work, photonic crystal based filters with the dual rings are proposed which act as band pass filters (BPF) and channel drop filter (CDF) that has found a massive applications in C and L-bands used for wavelength selection and noise filtering at erbium doped fiber amplifiers and dense wavelength division multiplexing operation. These filters are formulated on the square lattice with crystal rods of silicon material of refractive index 3.4 which are perforated on an air of refractive index 1. Dual ring double filters (band pass filter and channel drop filter) on single layout possess passing and dropping band of wavelengths in two distinct arrangements with entire band quality factors of 92.09523 & 505.263 and 124.85019 & 456.8633 for the pass and drop filters of initial setup and amended setup respectively. These filters have the high-quality factor with broad and narrow bandwidths of 16.8 nm & 3.04 nm and 12.85 nm & 3.3927 nm. Transmission spectra and band gap of the desired filters is analyzed using Optiwave software suite. Two dual ring filters incorporated on a single layout comprises the size of 15×11 μm which can also be used in the integrated photonic chips for the ultra-compact unification of devices.

Deciphering chemical order/disorder and material properties at the single-atom level

DOE PAGES

Yang, Yongsoo; Chen, Chien-Chun; Scott, M. C.; ...

2017-02-01

Perfect crystals are rare in nature. Real materials often contain crystal defects and chemical order/disorder such as grain boundaries, dislocations, interfaces, surface reconstructions and point defects. Such disruption in periodicity strongly affects material properties and functionality. Despite rapid development of quantitative material characterization methods, correlating three-dimensional (3D) atomic arrangements of chemical order/disorder and crystal defects with material properties remains a challenge. On a parallel front, quantum mechanics calculations such as density functional theory (DFT) have progressed from the modelling of ideal bulk systems to modelling ‘real’ materials with dopants, dislocations, grain boundaries and interfaces; but these calculations rely heavily onmore » average atomic models extracted from crystallography. To improve the predictive power of first-principles calculations, there is a pressing need to use atomic coordinates of real systems beyond average crystallographic measurements. Here we determine the 3D coordinates of 6,569 iron and 16,627 platinum atoms in an iron-platinum nanoparticle, and correlate chemical order/disorder and crystal defects with material properties at the single-atom level. We identify rich structural variety with unprecedented 3D detail including atomic composition, grain boundaries, anti-phase boundaries, anti-site point defects and swap defects. We show that the experimentally measured coordinates and chemical species with 22 picometre precision can be used as direct input for DFT calculations of material properties such as atomic spin and orbital magnetic moments and local magnetocrystalline anisotropy. The work presented here combines 3D atomic structure determination of crystal defects with DFT calculations, which is expected to advance our understanding of structure–property relationships at the fundamental level.« less

Subgrain boundary analyses in deformed orthopyroxene by TEM/STEM with EBSD-FIB sample preparation technique

NASA Astrophysics Data System (ADS)

Kogure, Toshihiro; Raimbourg, Hugues; Kumamoto, Akihito; Fujii, Eiko; Ikuhara, Yuichi

2014-12-01

High-resolution structure analyses using electron beam techniques have been performed for the investigation of subgrain boundaries (SGBs) in deformed orthopyroxene (Opx) in mylonite from Hidaka Metamorphic Belt, Hokkaido, Japan, to understand ductile deformation mechanism of silicate minerals in shear zones. Scanning electron microscopy (SEM) and electron backscatter diffraction (EBSD) analysis of Opx porphyroclasts in the mylonitic rock indicated that the crystal orientation inside the Opx crystals gradually changes by rotation about the b-axis by SGBs and crystal folding. In order to observe the SGBs along the b-axis by transmission electron microscopy (TEM) or scanning TEM (STEM), the following sample preparation protocol was adopted. First, petrographic thin sections were slightly etched with hydrofluoric acid to identify SGBs in SEM. The Opx crystals whose b-axes were oriented close to the normal of the surface were identified by EBSD, and the areas containing SGBs were picked and thinned for (S) TEM analysis with a focused ion beam instrument with micro-sampling system. High-resolution TEM imaging of the SGBs in Opx revealed various boundary structures from a periodic array of dissociated (100) [001] edge dislocations to partially or completely incoherent crystals, depending on the misorientation angle. Atomic-resolution STEM imaging clearly confirmed the formation of clinopyroxene (Cpx) structure between the dissociated partial dislocations. Moreover, X-ray microanalysis in STEM revealed that the Cpx contains a considerable amount of calcium replacing iron. Such chemical inhomogeneity may limit glide motion of the dislocation and eventually the plastic deformation of the Opx porphyroclasts at a low temperature. Chemical profiles across the high-angle incoherent SGB also showed an enrichment of the latter in calcium at the boundary, suggesting that SGBs are an efficient diffusion pathway of calcium out of host Opx grain during cooling.

Crystallization kinetics in Si-1 at%Sn during rapid solidification in undercooled melt

NASA Astrophysics Data System (ADS)

Kuribayashi, K.; Ozawa, S.; Nagayama, K.; Inatomi, Y.

2017-06-01

In order to elucidate the cause of the morphological transition of crystals growing in an undercooled melt of semiconducting materials, we carried out the containerless solidification of undoped Si and Si-1 at%Sn using a CO2 laser-equipped electromagnetic levitator (EML). The crystallization of these materials was successfully achieved under controlled undercooling. The relation between the shape of growing crystals and the degree of undercooling in Si-1 at%Sn was similar to that in undoped Si; that is, plate-like needle crystals were observed at low undercooling, whereas at medium and high undercooling the shape of growing crystals changed to massive dendrites. The grain-size of as-solidified samples of Si-1 at%Sn was remarkably small compared with that of undoped Si. The surface morphologies of samples solidified by dropping the melt onto a chill plate of mirror-polished silicon consisted of typical twin-related <110> dendrites. On the other hand, samples that were dropped from the undercooled state consisted of twin-free <100> dendrites. The nucleation rate of two-dimensional nuclei calculated on the basis of two mechanisms, which are the twin-plane re-entrant edge mechanism and the twin-free mechanism, suggested that the morphological transition to twin-free <100> dendrites from twin-related <110> dendrites occurs when the degree of undercooling becomes larger than the critical value. These results indicate that the cause of the morphological transition of Si growing in the undercooled melt is not the roughening transition of the crystal-melt interface but the transition of the nucleation kinetics to the twin-free mechanism from the twin-related mechanism.

21 CFR 161.190 - Canned tuna.

Code of Federal Regulations, 2014 CFR

2014-04-01

... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... section. Beginning with the top sieve, lift and drop each sieve by its open edge three times. Each time...

21 CFR 161.190 - Canned tuna.

Code of Federal Regulations, 2013 CFR

2013-04-01

... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... section. Beginning with the top sieve, lift and drop each sieve by its open edge three times. Each time...

A Bulk Microphysics Parameterization with Multiple Ice Precipitation Categories.

NASA Astrophysics Data System (ADS)

Straka, Jerry M.; Mansell, Edward R.

2005-04-01

A single-moment bulk microphysics scheme with multiple ice precipitation categories is described. It has 2 liquid hydrometeor categories (cloud droplets and rain) and 10 ice categories that are characterized by habit, size, and density—two ice crystal habits (column and plate), rimed cloud ice, snow (ice crystal aggregates), three categories of graupel with different densities and intercepts, frozen drops, small hail, and large hail. The concept of riming history is implemented for conversions among the graupel and frozen drops categories. The multiple precipitation ice categories allow a range of particle densities and fall velocities for simulating a variety of convective storms with minimal parameter tuning. The scheme is applied to two cases—an idealized continental multicell storm that demonstrates the ice precipitation process, and a small Florida maritime storm in which the warm rain process is important.

Corneal crystalline deposits associated with topically applied gatifloxacin.

PubMed

Elia, Maxwell; Khodadadeh, Sarah; Chow, Jessica

2014-06-01

To report a case of corneal crystalline deposits from the use of gatifloxacin 0.5% topical antibiotic after combined cataract extraction and trabeculotomy ab interno surgery. A 59-year-old woman presented after combined cataract extraction and trabeculotomy ab interno with crystalline deposits in the anterior corneal stroma. Clinical examination and slit-lamp photography were performed. The slit-lamp examination showed inferior white crystal deposition in the anterior stroma with overlying punctate epithelial erosions 4 weeks postoperatively. The eye was asymptomatic, but the deposition was cosmetically noticeable to the patient. Serial slit-lamp photography demonstrated resolution of the crystalline deposits 30 days after the discontinuation of eye drops. The authors present a rare case of stromal crystallization from topical gatifloxacin treatment. Complete resolution of corneal deposits was seen 30 days after the discontinuation of the drops without sequelae.

Towards physical implementation of an optical add-drop multiplexer (OADM) based upon properties of 12-fold photonic quasicrystals

NASA Astrophysics Data System (ADS)

Gauthier, Robert C.; Mnaymneh, Khaled

2005-09-01

The key feature that gives photonic crystals (PhCs) their ability to form photonic band gaps (PBGs) analogous to electronic band gaps of semiconductors is their translation symmetries. In recent years, however, it has been found that structures that possess only rotational symmetries can also have PBGs. In addition, these structures, known as Photonic Quasicrystals (PhQs), have other interesting qualities that set them apart of their translational cousins. One interesting feature is how defect states can be created in PhQs. If the rotational symmetry is disturbed, defect states analogous to defects states that are created in PhCs can be obtained. Simulation results of these defect states and other propagation properties of planar 12-fold photonic quasicrystal patterns, and its physical implementations in Silicon-On-Insulator (SOI) are presented. The main mechanisms required to make any optical multiplexing system is propagation; stop bands and add/drop ports. With the rotationally symmetry of the PhQ causing the stop bands, line defects facilitating propagation and now these specially design defect states acting as add/drop ports, a physical implementation of an OADM can be presented. Theoretical, practical and manufacturing benefits of PhQs are discussed. Simulated transmission plots are shown for various fill factors, dielectric contrast and propagation direction. It is shown that low index waveguides can be produced using the quasi-crystal photonic crystal pattern. Fabrication steps and results are shown.

Expression, purification, crystallization and initial crystallographic characterization of the p-hydroxybenzoate hydroxylase from Corynebacterium glutamicum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwon, Soo-Young; Kang, Beom Sik; Kim, Ghyung-Hwa

2007-11-01

PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collected to a maximum resolution of 2.5 Å on a synchrotron beamline. p-Hydroxybenzoate hydroxylase (PHBH) is an FAD-dependent monooxygenase that catalyzes the hydroxylation of p-hydroxybenzoate (pOHB) to 3,4-dihydroxybenzoate in an NADPH-dependent reaction and plays an important role in the biodegradation of aromatic compounds. PHBH from Corynebacterium glutamicum was crystallized using the hanging-drop vapour-diffusion method in the presence of NaH{sub 2}PO{sub 4} and K{sub 2}HPO{sub 4} as precipitants. X-ray diffraction data were collectedmore » to a maximum resolution of 2.5 Å on a synchrotron beamline. The crystal belongs to the hexagonal space group P6{sub 3}22, with unit-cell parameters a = b = 94.72, c = 359.68 Å, γ = 120°. The asymmetric unit contains two molecules, corresponding to a packing density of 2.65 Å{sup 3} Da{sup −1}. The structure was solved by molecular replacement. Structure refinement is in progress.« less

Crystallization and preliminary X-ray diffraction studies of the glutaminyl cyclase from Carica papaya latex

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Clantin, Bernard; Bompard, Coralie

2005-01-01

The glutaminyl cyclase isolated from C. papaya latex has been crystallized using the hanging-drop method. Diffraction data have been collected at ESRF beamline BM14 and processed to 1.7 Å resolution. In living systems, the intramolecular cyclization of N-terminal glutamine residues is accomplished by glutaminyl cyclase enzymes (EC 2.3.2.5). While in mammals these enzymes are involved in the synthesis of hormonal and neurotransmitter peptides, the physiological role played by the corresponding plant enzymes still remains to be unravelled. Papaya glutaminyl cyclase (PQC), a 33 kDa enzyme found in the latex of the tropical tree Carica papaya, displays an exceptional resistance tomore » chemical and thermal denaturation as well as to proteolysis. In order to elucidate its enzymatic mechanism and to gain insights into the structural determinants underlying its remarkable stability, PQC was isolated from papaya latex, purified and crystallized by the hanging-drop vapour-diffusion method. The crystals belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 62.82, b = 81.23, c = 108.17 Å and two molecules per asymmetric unit. Diffraction data have been collected at ESRF beamline BM14 and processed to a resolution of 1.7 Å.« less

Crystallization and preliminary X-ray crystallographic analysis of BxlE, a xylobiose transporter from Streptomyces thermoviolaceus OPC-520

DOE Office of Scientific and Technical Information (OSTI.GOV)

Seike, Kiho; Sato, Junji; Tomoo, Koji, E-mail: tomoo@gly.oups.ac.jp

2007-07-01

To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. Together with the integral membrane proteins BxlF and BxlG, BxlE isolated from Streptomyces thermoviolaceus OPC-520 forms an ATP-binding cassette (ABC) transport system that mediates the uptake of xylan. To clarify the structural basis of sugar binding by BxlE at the atomic level, recombinant BxlE was crystallized using the hanging-drop vapour-diffusion method at 290 K. The crystals belonged to the monoclinic space group P2{sub 1}, with unit-cell parameters a = 44.63, b = 63.27, cmore » = 66.40 Å, β = 103.05°, and contained one 48 kDa molecule per asymmetric unit (V{sub M} = 1.96 Å{sup 3} Da{sup −1}). Diffraction data collected to a resolution of 1.65 Å using a rotating-anode X-ray source gave a data set with an overall R{sub merge} of 2.6% and a completeness of 91.3%. A data set from a platinum derivative is being used for phasing by the SAD method.« less

An equivalent dipole analysis of PZT ceramics and lead-free piezoelectric single crystals

NASA Astrophysics Data System (ADS)

Bell, Andrew J.

2016-04-01

The recently proposed Equivalent Dipole Model for describing the electromechanical properties of ionic solids in terms of 3 ions and 2 bonds has been applied to PZT ceramics and lead-free single crystal piezoelectric materials, providing analysis in terms of an effective ionic charge and the asymmetry of the interatomic force constants. For PZT it is shown that, as a function of composition across the morphotropic phase boundary, the dominant bond compliance peaks at 52% ZrO2. The stiffer of the two bonds shows little composition dependence with no anomaly at the phase boundary. The effective charge has a maximum value at 50% ZrO2, decreasing across the phase boundary region, but becoming constant in the rhombohedral phase. The single crystals confirm that both the asymmetry in the force constants and the magnitude of effective charge are equally important in determining the values of the piezoelectric charge coefficient and the electromechanical coupling coefficient. Both are apparently temperature dependent, increasing markedly on approaching the Curie temperature.

On the protein crystal formation as an interface-controlled process with prototype ion-channeling effect.

PubMed

Siódmiak, Jacek; Uher, Jan J; Santamaría-Holek, Ivan; Kruszewska, Natalia; Gadomski, Adam

2007-08-01

A superdiffusive random-walk action in the depletion zone around a growing protein crystal is considered. It stands for a dynamic boundary condition of the growth process and competes steadily with a quasistatic, curvature-involving (thermodynamic) free boundary condition, both of them contributing to interpret the (mainly late-stage) growth process in terms of a prototype ion-channeling effect. An overall diffusion function contains quantitative signatures of both boundary conditions mentioned and indicates whether the new phase grows as an orderly phase or a converse scenario occurs. This situation can be treated in a quite versatile way both numerically and analytically, within a generalized Smoluchowski framework. This study can help in (1) elucidating some dynamic puzzles of a complex crystal formation vs biomolecular aggregation, also those concerning ion-channel formation, and (2) seeing how ion-channel-type dynamics of non-Markovian nature may set properly the pace of model (dis)ordered protein aggregation.

Determination of Interfacial Rheological Properties through Microgravity Oscillations of Bubbles and Drops

NASA Technical Reports Server (NTRS)

Nadim, Ali; Rush, Brian M.

2000-01-01

This report summarizes our derivations of analytical expressions for the frequencies and damping constants for small-amplitude axisymmetric shape oscillations of a liquid drop suspended in an immiscible fluid host in microgravity. In particular, this work addresses large Reynolds number shape oscillations and focuses on the surface rheological effects that arise from the presence of insoluble surfactants at the interface. Parameters characterizing viscous effects from the bulk phases, surface viscous effects, Marangoni effects from the surface advection and diffusion of surfactants, and the Gibbs elasticity are all considered and analyzed to determine the relative importance of each contribution. Supplementing the analytical treatment for small-amplitude oscillations, a numerical boundary integral equation formulation is developed for the study of large-amplittide axisymmetric oscillations of a drop in vacuum. The boundary integral formulation is an extension of classical potential flow theory and approximately accounts for viscous effects in the bulk fluid as well as the surface viscous and Marangoni effects resulting from an insoluble surfactant contaminating the interface. Theoretical and numerical results are presented for four distinct cases. These, range from the case when the effects of the surfactants are 'negligible' to 'large' when compared to the viscous effects in the bulk phases. The feasibility of the non-contact measurement of the surface parameters, using experimental observations for the oscillation frequencies and damping constants of drops and bubbles, is discussed.

Macrofossil extinction patterns at Bay of Biscay Cretaceous-Tertiary boundary sections

NASA Technical Reports Server (NTRS)

Ward, Peter D.; Macleod, Kenneth

1988-01-01

Researchers examined several K-T boundary cores at Deep Sea Drilling Project (DSDP) core repositories to document biostratigraphic ranges of inoceramid shell fragments and prisms. As in land-based sections, prisms in the deep sea cores disappear well before the K-T boundary. Ammonites show a very different extinction pattern than do the inoceramids. A minimum of seven ammonite species have been collected from the last meter of Cretaceous strata in the Bay of Biscay basin. In three of the sections there is no marked drop in either species numbers or abundance prior to the K-T boundary Cretaceous strata; at the Zumaya section, however, both species richness and abundance drop in the last 20 m of the Cretaceous, with only a single ammonite specimen recovered to date from the uppermost 12 m of Cretaceous strata in this section. Researchers conclude that inoceramid bivalves and ammonites showed two different times and patterns of extinction, at least in the Bay of Biscay region. The inoceramids disappeared gradually during the Early Maestrichtian, and survived only into the earliest Late Maestrichtian. Ammonites, on the other hand, maintained relatively high species richness throughout the Maestrichtian, and then disappeared suddenly, either coincident with, or immediately before the microfossil extinction event marking the very end of the Cretaceous.

Electron transport in stepped Bi2Se3 thin films

NASA Astrophysics Data System (ADS)

Bauer, S.; Bobisch, C. A.

2017-08-01

We analyse the electron transport in a 16 quintuple layer thick stepped Bi2Se3 film grown on Si(1 1 1) by means of scanning tunnelling potentiometry (STP) and multi-point probe measurements. Scanning tunnelling microscopy images reveal that the local structure of the Bi2Se3 film is dominated by terrace steps and domain boundaries. From a microscopic study on the nm scale by STP, we find a mostly linear gradient of the voltage on the Bi2Se3 terraces which is interrupted by voltage drops at the position of the domain boundaries. The voltage drops indicate that the domain boundaries are scatterers for the electron transport. Macroscopic resistance measurements (2PP and in-line 4PP measurement) on the µm scale support the microscopic results. An additional rotational square 4PP measurement shows an electrical anisotropy of the sheet conductance parallel and perpendicular to the Bi2Se3 steps of about 10%. This is a result of the anisotropic step distribution at the stepped Bi2Se3 surface while domain boundaries are distributed isotropically. The determined value of the conductivity of the Bi2Se3 steps of about 1000 S cm-1 verifies the value of an earlier STP study.

Defects at grain boundaries: A coarse-grained, three-dimensional description by the amplitude expansion of the phase-field crystal model

NASA Astrophysics Data System (ADS)

Salvalaglio, Marco; Backofen, Rainer; Elder, K. R.; Voigt, Axel

2018-05-01

We address a three-dimensional, coarse-grained description of dislocation networks at grain boundaries between rotated crystals. The so-called amplitude expansion of the phase-field crystal model is exploited with the aid of finite element method calculations. This approach allows for the description of microscopic features, such as dislocations, while simultaneously being able to describe length scales that are orders of magnitude larger than the lattice spacing. Moreover, it allows for the direct description of extended defects by means of a scalar order parameter. The versatility of this framework is shown by considering both fcc and bcc lattice symmetries and different rotation axes. First, the specific case of planar, twist grain boundaries is illustrated. The details of the method are reported and the consistency of the results with literature is discussed. Then, the dislocation networks forming at the interface between a spherical, rotated crystal embedded in an unrotated crystalline structure, are shown. Although explicitly accounting for dislocations which lead to an anisotropic shrinkage of the rotated grain, the extension of the spherical grain boundary is found to decrease linearly over time in agreement with the classical theory of grain growth and recent atomistic investigations. It is shown that the results obtained for a system with bcc symmetry agree very well with existing results, validating the methodology. Furthermore, fully original results are shown for fcc lattice symmetry, revealing the generality of the reported observations.

Splashing, feeding, contracting: Drop impact and fluid dynamics of Vorticella

NASA Astrophysics Data System (ADS)

Pepper, Rachel E.

This thesis comprises two main topics: understanding drop impact and splashing, and studying the feeding and contracting of the microorganism Vorticella. In Chapter 1, we study the effect of substrate compliance on the splash threshold of a liquid drop using an elastic membrane under variable tension. We find that splashing can be suppressed by reducing this tension. Measurements of the velocity and acceleration of the spreading drop after impact indicate that the splashing behavior is set at very early times after, or possibly just before, impact, far before the actual splash occurs. We also provide a model for the tension dependence of the splashing threshold. In Chapter 2, we study the evolution of the ejected liquid sheet, or lamella, created after impact of a liquid drop onto a solid surface using high-speed video. We find that the lamella rim thickness is always much larger than the boundary layer thickness, and that this thickness decreases with increasing impact speed. We also observe an unusual plateau behavior in thickness versus time at higher impact speeds as we approach the splash threshold. In Chapter 3, we show through calculations, simulations, and experiments that the eddies often observed near sessile filter feeders are due to the presence of nearby boundaries. We model the common filter feeder Vorticella, and also track particles around live feeding Vorticella to determine the experimental flow field. Our models are in good agreement both with each other and with the experiments. We also provide simple approximate equations to predict experimental eddy sizes due to boundaries. In Chapter 4, we show through calculations that filter feeders such as Vorticella can greatly enhance their nutrient uptake by feeding at an angle rather than perpendicular to a substrate. We also show experimental evidence that living Vorticella use this strategy. Finally, in Chapter 5, we discuss possible future directions for these projects, including potential insights from a close examination of lamella behavior at the splash threshold, and calculations to determine if Vorticella contract rapidly towards the substrate to which they are attached in order to mix the surrounding fluid.

The study of the effects of sea-spray drops on the marine atmospheric boundary layer by direct numerical simulation

NASA Astrophysics Data System (ADS)

Druzhinin, O.; Troitskaya, Yu; Zilitinkevich, S.

2018-01-01

The detailed knowledge of turbulent exchange processes occurring in the atmospheric marine boundary layer are of primary importance for their correct parameterization in large-scale prognostic models. These processes are complicated, especially at sufficiently strong wind forcing conditions, by the presence of sea-spray drops which are torn off the crests of sufficiently steep surface waves by the wind gusts. Natural observations indicate that mass fraction of sea-spray drops increases with wind speed and their impact on the dynamics of the air in the vicinity of the sea surface can become quite significant. Field experiments, however, are limited by insufficient accuracy of the acquired data and are in general costly and difficult. Laboratory modeling presents another route to investigate the spray-mediated exchange processes in much more detail as compared to the natural experiments. However, laboratory measurements, contact as well as Particle Image Velocimetry (PIV) methods, also suffer from inability to resolve the dynamics of the near-surface air-flow, especially in the surface wave troughs. In this report, we present a first attempt to use Direct Numerical Simulation (DNS) as tool for investigation of the drops-mediated momentum, heat and moisture transfer in a turbulent, droplet-laden air flow over a wavy water surface. DNS is capable of resolving the details of the transfer processes and do not involve any closure assumptions typical of Large-Eddy and Reynolds Averaged Navier-Stokes (LES and RANS) simulations. Thus DNS provides a basis for improving parameterizations in LES and RANS closure models and further development of large-scale prognostic models. In particular, we discuss numerical results showing the details of the modification of the air flow velocity, temperature and relative humidity fields by multidisperse, evaporating drops. We use Eulerian-Lagrangian approach where the equations for the air-flow fields are solved in a Eulerian frame whereas the drops dymanics equations are solved in a Largangain frame. The effects of air flow and drops on the water surface wave are neglected. A point-force approximation is employed to model the feed-back contributions by the drops to the air momentum, heat and moisture transfer.

Drop Ejection From an Oscillating Rod

NASA Technical Reports Server (NTRS)

Wilkes, E. D.; Basaran, O. A.

1999-01-01

The dynamics of a drop of a Newtonian liquid that is pendant from or sessile on a solid rod that is forced to undergo time-periodic oscillations along its axis is studied theoretically. The free boundary problem governing the time evolution of the shape of the drop and the flow field inside it is solved by a method of lines using a finite element algorithm incorporating an adaptive mesh. When the forcing amplitude is small, the drop approaches a limit cycle at large times and undergoes steady oscillations thereafter. However, drop breakup is the consequence if the forcing amplitude exceeds a critical value. Over a wide range of amplitudes above this critical value, drop ejection from the rod occurs during the second oscillation period from the commencement of rod motion. Remarkably, the shape of the interface at breakup and the volume of the primary drop formed are insensitive to changes in forcing amplitude. The interface shape at times close to and at breakup is a multi-valued function of distance measured along the rod axis and hence cannot be described by recently popularized one-dimensional approximations. The computations show that drop ejection occurs without the formation of a long neck. Therefore, this method of drop formation holds promise of preventing formation of undesirable satellite droplets.

Rolling hills on the core-mantle boundary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Daoyuan; Helmberger, Don V.; Jackson, Jennifer M.

2014-07-17

Recent results suggest that an iron-rich oxide may have fractionally crystallized from a primordial magma ocean and settled on the core–mantle boundary (CMB). Based on experimental results, the presence of only a few percent of Fe-rich oxide could slow seismic waves down by several percent. This heavy layer can become highly undulating as predicted from dynamic modeling but can remain as a distinct structure with uniform velocity reductions. Here, we use the large USArray seismic network to search for such structures. Strong constraints on D" are provided by the core-phase SKS where it bifurcates, containing a short segment of P-wavemore » diffractions (P d) when crossing the CMB, called SKS d. Synthetics from models with moderate velocity drops (less than 10%) involving a layer with variable thickness, perhaps a composite of sharp small structures, with strong variation in thickness can explain both the observed SKS d waveforms and large scatter in differential times between SKKS and SKS. A smooth 3D image is obtained from inverting SKS d waveforms displaying rolling-hills with elongated dome-like structures sitting on the CMB. The most prominent one has an 80-km height, ~8° length, and ~4° width, thus adding still more structural complexity to the lower mantle. We suggest that these results can be explained by a dynamically-stabilized material containing small amounts (~5%) iron-rich (Mg,Fe)O providing a self-consistent physical interpretation.« less

Prediction of Giant Thermoelectric Efficiency in Crystals with Interlaced Nanostructure.

PubMed

Puzyrev, Y S; Shen, X; Pantelides, S T

2016-01-13

We present a theoretical study of the thermoelectric efficiency of "interlaced crystals", recently discovered in hexagonal-CuInS2 nanoparticles. Interlaced crystals are I-III-VI2 or II-IV-V2 tetrahedrally bonded compounds. They have a perfect Bravais lattice in which the two cations have an infinite set of possible ordering patterns within the cation sublattice. The material comprises nanoscale interlaced domains and phases with corresponding boundaries. Here we employ density functional theory and large-scale molecular dynamics calculations based on model classical potentials to demonstrate that the phase and domain boundaries are effective phonon scatterers and greatly suppress thermal conductivity. However, the absence of both structural defects and strain in the interlaced material results in a minimal effect on electronic properties. We predict an increase of thermal resistivity of up to 2 orders of magnitude, which makes interlaced crystals an exceptional candidate for thermoelectric applications.

Purification, crystallization and preliminary crystallographic study of low oxygen-affinity haemoglobin from cat (Felis silvestris catus) in two different crystal forms.

PubMed

Balasubramanian, M; Moorthy, Pon Sathya; Neelagandan, K; Ponnuswamy, M N

2009-03-01

Haemoglobin is a metalloprotein which plays a major role in the transportation of oxygen from the lungs to tissues and of carbon dioxide back to the lungs. The present work reports the preliminary crystallographic study of low oxygen-affinity haemoglobin from cat in different crystal forms. Cat blood was collected, purified by anion-exchange chromatography and crystallized in two different conditions by the hanging-drop vapour-diffusion method under unbuffered low-salt and buffered high-salt concentrations using PEG 3350 as a precipitant. Intensity data were collected using MAR345 and MAR345dtb image-plate detector systems. Cat haemoglobin crystallizes in monoclinic and orthorhombic crystal forms with one and two whole biological molecules (alpha(2)beta(2)), respectively, in the asymmetric unit.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Ken-ichi; Tanaka, Nobutada, E-mail: ntanaka@pharm.showa-u.ac.jp; Ishikura, Shuhei

Pig heart carbonyl reductase has been crystallized in the presence of NADPH. Diffraction data have been collected using synchrotron radiation. Pig heart carbonyl reductase (PHCR), which belongs to the short-chain dehydrogenase/reductase (SDR) family, has been crystallized by the hanging-drop vapour-diffusion method. Two crystal forms (I and II) have been obtained in the presence of NADPH. Form I crystals belong to the tetragonal space group P4{sub 2}, with unit-cell parameters a = b = 109.61, c = 94.31 Å, and diffract to 1.5 Å resolution. Form II crystals belong to the tetragonal space group P4{sub 1}2{sub 1}2, with unit-cell parameters amore » = b = 120.10, c = 147.00 Å, and diffract to 2.2 Å resolution. Both crystal forms are suitable for X-ray structure analysis at high resolution.« less

21 CFR 161.190 - Canned tuna.

Code of Federal Regulations, 2011 CFR

2011-04-01

... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... and drop each sieve by its open edge three times. Each time, the open edge of the sieve is lifted the...

21 CFR 161.190 - Canned tuna.

Code of Federal Regulations, 2012 CFR

2012-04-01

... section. For the purpose of inhibiting the development of struvite crystals, sodium acid pyrophosphate may... and drop each sieve by its open edge three times. Each time, the open edge of the sieve is lifted the...

Structural analysis of bacteriophage-encoded peptidoglycan hydrolase domain KMV36C: crystallization and preliminary X-ray diffraction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van Hecke, Kristof, E-mail: kristof.vanhecke@chem.kuleuven.be; Briers, Yves; Derua, Rita

2008-04-01

Crystallization and X-ray data collection of the C-terminus of gp36 from bacteriophage ϕKMV (KMV36C) are reported. The C-terminus of gp36 of bacteriophage ϕKMV (KMV36C) functions as a particle-associated muramidase, presumably as part of the injection needle of the ϕKMV genome during infection. Crystals of KMV36C were obtained by hanging-drop vapour diffusion and diffracted to a resolution of 1.6 Å. The crystals belong to the cubic space group P432, with unit-cell parameters a = b = c = 102.52 Å. KMV36C shows 30% sequence identity to T4 lysozyme (PDB code)

Crystallization kinetics of GeTe phase-change thin films grown by pulsed laser deposition

NASA Astrophysics Data System (ADS)

Sun, Xinxing; Thelander, Erik; Gerlach, Jürgen W.; Decker, Ulrich; Rauschenbach, Bernd

2015-07-01

Pulsed laser deposition was employed to the growth of GeTe thin films on Silicon substrates. X-ray diffraction measurements reveal that the critical crystallization temperature lies between 220 and 240 °C. Differential scanning calorimetry was used to investigate the crystallization kinetics of the as-deposited films, determining the activation energy to be 3.14 eV. Optical reflectivity and in situ resistance measurements exhibited a high reflectivity contrast of ~21% and 3-4 orders of magnitude drop in resistivity of the films upon crystallization. The results show that pulsed laser deposited GeTe films can be a promising candidate for phase-change applications.

Crystallization and X-ray diffraction analysis of 6-­aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72

PubMed Central

Ohki, Taku; Mizuno, Nobuhiro; Shibata, Naoki; Takeo, Masahiro; Negoro, Seiji; Higuchi, Yoshiki

2005-01-01

To investigate the structure–function relationship between 6-aminohexanoate-dimer hydrolase (EII) from Arthrobacter sp. and a cryptic protein (EII′) which shows 88% sequence identity to EII, a hybrid protein (named Hyb-24) of EII and EII′ was overexpressed, purified and crystallized using the sitting-drop vapour-diffusion method with ammonium sulfate as a precipitant in MES buffer pH 6.5. The crystal belongs to space group P3121 or P3221, with unit-cell parameters a = b = 96.37, c = 113.09 Å. Diffraction data were collected from native and methylmercuric chloride derivative crystals to resolutions of 1.75 and 1.80 Å, respectively. PMID:16511198

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Purification, crystallization and preliminary X-ray diffraction studies of N-acetylglucosamine-phosphate mutase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishitani, Yuichi; Maruyama, Daisuke; Nonaka, Tsuyoshi

2006-04-01

Preliminary X-ray diffraction studies on N-acetylglucosamine-phosphate mutase from C. albicans are reported. N-acetylglucosamine-phosphate mutase (AGM1) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine (UDP-GlcNAc) in eukaryotes and belongs to the α-d-phosphohexomutase superfamily. AGM1 from Candida albicans (CaAGM1) was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals obtained belong to the primitive monoclinic space group P2{sub 1}, with unit-cell parameters a = 60.2, b = 130.2, c = 78.0 Å, β = 106.7°. The crystals diffract X-rays to beyond 1.8 Å resolution using synchrotron radiation.

Multiscale real-space quantum-mechanical tight-binding calculations of electronic structure in crystals with defects using perfectly matched layers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pourmatin, Hossein, E-mail: mpourmat@andrew.cmu.edu; Dayal, Kaushik, E-mail: kaushik@cmu.edu

2016-10-15

Graphical abstract: - Abstract: We consider the scattering of incident plane-wave electrons from a defect in a crystal modeled by the time-harmonic Schrödinger equation. While the defect potential is localized, the far-field potential is periodic, unlike standard free-space scattering problems. Previous work on the Schrödinger equation has been almost entirely in free-space conditions; a few works on crystals have been in one-dimension. We construct absorbing boundary conditions for this problem using perfectly matched layers in a tight-binding formulation. Using the example of a point defect in graphene, we examine the efficiency and convergence of the proposed absorbing boundary condition.

The Oseen-Frank Limit of Onsager's Molecular Theory for Liquid Crystals

NASA Astrophysics Data System (ADS)

Liu, Yuning; Wang, Wei

2018-03-01

We study the relationship between Onsager's molecular theory, which involves the effects of nonlocal molecular interactions and the Oseen-Frank theory for nematic liquid crystals. Under the molecular setting, we prove the existence of global minimizers for the generalized Onsager's free energy, subject to a nonlocal boundary condition which prescribes the second moment of the number density function near the boundary. Moreover, when the re-scaled interaction distance tends to zero, the global minimizers will converge to a uniaxial distribution predicted by a minimizing harmonic map. This is achieved through the investigations of the compactness property and the boundary behaviors of the corresponding second moments. A similar result is established for critical points of the free energy that fulfill a natural energy bound.

Creation and Analysis of Atomic Structures for CdTe Bi-crystal Interfaces by the Grain Boundary Genie

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buurma, Christopher; Sen, Fatih G.; Paulauskas, Tadas

2015-01-01

Grain boundaries (GB) in poly-CdTe solar cells play an important role in species diffusion, segregation, defect formation, and carrier recombination. While the creation of specific high-symmetry interfaces can be straight forward, the creation of general GB structures in many material systems is difficult if periodic boundary conditions are to be enforced. Here we describe a novel algorithm and implementation to generate initial general GB structures for CdTe in an automated way, and we investigate some of these structures using density functional theory (DFT). Example structures include those with bi-crystals already fabricated for comparison, and those planning to be investigated inmore » the future.« less

Expression, purification, crystallization and structure determination of the N terminal domain of Fhb, a factor H binding protein from Streptococcus suis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Chunmao; Yu, You; Yang, Maojun, E-mail: maojunyang@tsinghua.edu.cn

2015-10-23

Fhb is a surface virulence protein from Streptococcus suis, which could aid bacterial evasion of host innate immune defense by recruiting complement regulator factor H to inactivate C3b deposited on bacterial surface in blood. Here we successfully expressed and purified the N terminal domain of Fhb (N-Fhb) and obtained crystals of the N-Fhb by sitting-drop vapor diffusion method with a resolution of 1.50 Å. The crystals belong to space group C2 with unit cell parameters a = 127.1 Å, b = 77.3 Å, c = 131.6 Å, α = 90°, β = 115.9°, γ = 90°. The structure of N-Fhb was determined by SAD method and the core structure of N-Fhb is a β sandwich. Wemore » speculated that binding of Fhb to human factor H may be mainly mediated by surface amino acids with negative charges. - Highlights: • We expressed N-Fhb as the soluble protein in Escherichia coli. • Crystals of N-Fhb were grown by sitting drop vapor diffusion method. • Crystals of N-Fhb could diffracted to 1.5 Å. • The core structure of N-Fhb was a β sandwich. • A part of the surface of N-Fhb was rich with negative charges.« less

Three dimensional modeling of cirrus during the 1991 FIRE IFO 2: Detailed process study

NASA Technical Reports Server (NTRS)

Jensen, Eric J.; Toon, Owen B.; Westphal, Douglas L.

1993-01-01

A three-dimensional model of cirrus cloud formation and evolution, including microphysical, dynamical, and radiative processes, was used to simulate cirrus observed in the FIRE Phase 2 Cirrus field program (13 Nov. - 7 Dec. 1991). Sulfate aerosols, solution drops, ice crystals, and water vapor are all treated as interactive elements in the model. Ice crystal size distributions are fully resolved based on calculations of homogeneous freezing of solution drops, growth by water vapor deposition, evaporation, aggregation, and vertical transport. Visible and infrared radiative fluxes, and radiative heating rates are calculated using the two-stream algorithm described by Toon et al. Wind velocities, diffusion coefficients, and temperatures were taken from the MAPS analyses and the MM4 mesoscale model simulations. Within the model, moisture is transported and converted to liquid or vapor by the microphysical processes. The simulated cloud bulk and microphysical properties are shown in detail for the Nov. 26 and Dec. 5 case studies. Comparisons with lidar, radar, and in situ data are used to determine how well the simulations reproduced the observed cirrus. The roles played by various processes in the model are described in detail. The potential modes of nucleation are evaluated, and the importance of small-scale variations in temperature and humidity are discussed. The importance of competing ice crystal growth mechanisms (water vapor deposition and aggregation) are evaluated based on model simulations. Finally, the importance of ice crystal shape for crystal growth and vertical transport of ice are discussed.

Mechanistic principles of colloidal crystal growth by evaporation-induced convective steering.

PubMed

Brewer, Damien D; Allen, Joshua; Miller, Michael R; de Santos, Juan M; Kumar, Satish; Norris, David J; Tsapatsis, Michael; Scriven, L E

2008-12-02

We simulate evaporation-driven self-assembly of colloidal crystals using an equivalent network model. Relationships between a regular hexagonally close-packed array of hard, monodisperse spheres, the associated pore space, and selectivity mechanisms for face-centered cubic microstructure propagation are described. By accounting for contact line rearrangement and evaporation at a series of exposed menisci, the equivalent network model describes creeping flow of solvent into and through a rigid colloidal crystal. Observations concerning colloidal crystal growth are interpreted in terms of the convective steering hypothesis, which posits that solvent flow into and through the pore space of the crystal may play a major role in colloidal self-assembly. Aspects of the convective steering and deposition of high-Peclet-number rigid spherical particles at a crystal boundary are inferred from spatially resolved solvent flow into the crystal. Gradients in local flow through boundary channels were predicted due to the channels' spatial distribution relative to a pinned free surface contact line. On the basis of a uniform solvent and particle flux as the criterion for stability of a particular growth plane, these network simulations suggest the stability of a declining {311} crystal interface, a symmetry plane which exclusively propagates fcc microstructure. Network simulations of alternate crystal planes suggest preferential growth front evolution to the declining {311} interface, in consistent agreement with the proposed stability mechanism for preferential fcc microstructure propagation in convective assembly.

Mixing in Sessile Drops Merging on a Surface

NASA Astrophysics Data System (ADS)

Anna, Shelley; Zhang, Ying; Oberdick, Samuel; Garoff, Stephen

2011-11-01

We investigate the mixing of two sessile drops that merge on a surface. The drops consist of low viscosity glycerol-water mixtures deposited on a silicone elastomer surface with contact angle near 90°. We observe the shape of the drops and the location of their intersection by placing a fluorescent dye in one drop and using a laser light sheet to image a plane perpendicular to the surface. The initial healing of the meniscus bridge between the merging drops, and the damping of capillary waves appearing on their surfaces occur on timescales comparable to the inertio-capillary relaxation time. However, the interface between the two fluids remains sharp, broadening diffusively over several minutes. The shape of the merged drops and the boundary between them also continues to evolve on a timescale of minutes. This later motion is controlled by gravity, capillary pressure, and viscous stresses. Images of the 3D drop shape indicate that small contact line motions are correlated to the slow relaxation. Although the two drops contain identical liquids except for the presence of the dye, the shape of the interface consistently evolves asymmetrically, assuming a characteristic crescent shape. We note that very tiny surface tension gradients can produce an asymmetric flow like the one observed here. We characterize the long timescale flow as a function of the drop sizes, and we use numerical simulations to aid in elucidating the essential physics.

Evaporation of oil-water emulsion drops when heated at high temperature

NASA Astrophysics Data System (ADS)

Strizhak, P. A.; Piskunov, M. V.; Kuznetsov, G. V.; Voytkov, I. S.

2017-10-01

An experimental study on conditions and main characteristics for high-temperature (more than 700 K) evaporation of oil-water drops is presented. The high-temperature water purification from impurities can be the main practical application of research results. Thus, the heating of drops is implemented by the two typical schemes: on a massive substrate (the heating conditions are similar to those achieved in a heating chamber) and in a flow of the heated air. In the latter case, the heating conditions correspond to those attained while moving water drops with impurities in a counter high-temperature gaseous flow in the process of water purification. Evaporation time as function of heating temperature is presented. The influence of oil product concentration in an emulsion drop on evaporation characteristics is discussed. The conditions for intensive flash boiling of an emulsion drop and its explosive breakup with formation of the fine droplets cloud are pointed out. Heat fluxes required for intensive flash boiling and explosive breakup of a drop with further formation of the fine aerosol are determined in the boundary layer of a drop. The fundamental differences between flash boiling and explosive breakup of an emulsion drop when heated on a substrate and in a flow of the heated air are described. The main prospects for the development of the high-temperature water purification technology are detailed taking into account the fast emulsion drop breakup investigated in the paper.

Finite-size Scaling of the Density of States in Photonic Band Gap Crystals

NASA Astrophysics Data System (ADS)

Hasan, Shakeeb Bin; Mosk, Allard P.; Vos, Willem L.; Lagendijk, Ad

2018-06-01

The famous vanishing of the density of states (DOS) in a band gap, be it photonic or electronic, pertains to the infinite-crystal limit. In contrast, all experiments and device applications refer to finite crystals, which raises the question: Upon increasing the linear size L of a crystal, how fast does the DOS approach the infinite-crystal limit? We present a theory for finite crystals that includes Bloch-mode broadening due to the presence of crystal boundaries. Our results demonstrate that the DOS for frequencies inside a band gap has a 1 /L scale dependence for crystals in one, two and three dimensions.

Generalized Swiss-cheese cosmologies. II. Spherical dust

NASA Astrophysics Data System (ADS)

Grenon, Cédric; Lake, Kayll

2011-10-01

The generalized Swiss-cheese model, consisting of a Lemaître-Tolman (inhomogeneous dust) region matched, by way of a comoving boundary surface, onto a Robertson-Walker background of homogeneous dust, has become a standard construction in modern cosmology. Here, we ask if this construction can be made more realistic by introducing some evolution of the boundary surface. The answer we find is no. To maintain a boundary surface using the Darmois-Israel junction conditions, as opposed to the introduction of a surface layer, the boundary must remain exactly comoving. The options are to drop the assumption of dust or allow the development of surface layers. Either option fundamentally changes the original construction.

X-ray Crystal Truncation Rod Studies of Surface Oxidation and Reduction on Pt(111)

DOE PAGES

Liu, Yihua; Barbour, Andi; Komanicky, Vladimir; ...

2016-02-26

Here, we present X-ray crystal truncation rods measurements of Pt(111) surface under electrochemical conditions. Analyses of crystal truncation rods reveal that surface oxide formation buckles the top surface layer of platinum to two different heights at the potential (0.95 V vs RHE) below the so-called place-exchange potential. While the anti-Bragg intensity, sensitive to the top surface layer, drops in response to the anodic charge transfers, its responses to the cathodic charge transfers are significantly delayed. Implications to the surface oxidation and reduction behaviors are discussed.

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus.

PubMed

Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J

2008-06-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.

New theoretical results for the Lehmann effect in cholesteric liquid crystals

NASA Technical Reports Server (NTRS)

Brand, Helmut R.; Pleiner, Harald

1988-01-01

The Lehmann effect arising in a cholesteric liquid crystal drop when a temperature gradient is applied parallel to its helical axis is investigated theoretically using a local approach. A pseudoscalar quantity is introduced to allow for cross couplings which are absent in nematic liquid crystals, and the statics and dissipative dynamics are analyzed in detail. It is shown that the Lehmann effect is purely dynamic for the case of an external electric field and purely static for an external density gradient, but includes both dynamic and static coupling contributions for the cases of external temperature or concentration gradients.

The control of float zone interfaces by the use of selected boundary conditions

NASA Technical Reports Server (NTRS)

Foster, L. M.; Mcintosh, J.

1983-01-01

The main goal of the float zone crystal growth project of NASA's Materials Processing in Space Program is to thoroughly understand the molten zone/freezing crystal system and all the mechanisms that govern this system. The surface boundary conditions required to give flat float zone solid melt interfaces were studied and computed. The results provide float zone furnace designers with better methods for controlling solid melt interface shapes and for computing thermal profiles and gradients. Documentation and a user's guide were provided for the computer software.

The Growth of Melt Inclusion- and Water-Rich Zones in Clinopyroxene Phenocrysts of the Powai Ankaramite Flow, Deccan Traps, India: Rapid Closed System Oscillatory Mineral Growth

NASA Astrophysics Data System (ADS)

Seaman, S. J.

2015-12-01

Water concentrations were measured and mapped using FTIR spectroscopy in clinopyroxene phenocrysts of the Powai ankaramite flow, located near Mumbai, west of the Western Ghats escarpment of the Deccan province, India. Samples were provided by Dr. Hetu Sheth of the Indian Institute of Technology, Mumbai. Chatterjee and Sheth (2015) showed that phenocrysts in the flow were part of a cumulate layer intruded by high-temperature basaltic melt at ~ 6 kb and ~1230oC. Cpx phenocrysts are euhedral and have concentric bands (100 to 200 microns thick) of fine (10-20 micron diameter) melt inclusions. Cpx bands that host melt inclusions have higher concentrations of water than inclusion-free bands. Water concentrations of cpx and ol were used to calculate water concentrations in the melt from which the crystals formed. Water concentrations in the parent magma were between 4.35 and 8.26 wt. % based on water concentrations in cpx, and between 8.24 and 9.41 wt. % based on those in ol. Both Mg and Fe are relatively depleted in the water- and melt inclusion-rich zones in cpx, and Ca is enriched in these zones. We suggest that oscillatory zoning in cpx is a result of repeated growth of cpx in water-richer and water-poorer boundary layers in which water lowered melt viscosity and enhanced diffusion and crystal growth rates. Water-enhanced growth rates may have resulted in preferential capture of melt inclusions preserved in water-rich cpx zones. Mg was preferentially incorporated into the cpx, causing Ca and water to build up in the boundary layer, and Mg and Fe to become relatively depleted in the boundary layer, as discussed for oscillatorially-zoned minerals by Wang and Merino (1993). Application of the equations for growth of oscillatory zones in crystals given by Wang and Merino (1993) to the growth of cpx crystals in the Powai ankaramite indicate that crystal growth occurred relatively quickly, on the order of days, although the width of the boundary zone, which is uncertain, controls the rate. These results are consistent with Wang and Merino's contention that oscillatory growth zones in crystals can be the result of closed system processes involving advection and diffusion of ionic species into and out of the boundary zone between crystal and melt, and, on a broader scale, suggest that at least this Deccan magma was relatively hydrous.

The Assembly and Emplacement of the Mushy Magma Model: A Historical Perspective

NASA Astrophysics Data System (ADS)

Bergantz, G. W.

2012-12-01

The "mush model" for magmatic systems has emerged as an alternative to the classic notion of a silicate liquid dominated reservoir, the so-called big tank model. The mush model is motivated by a concurrence of geochemical, geophysical and geological observations and new ideas on multiphase fluid dynamics. This presentation will review the historical development and remaining open questions about the mush model as it pertains to silicic systems. The observation that rhyolites have extreme depletions in Sr, Ba and Eu, as well as depletions in Zr and LREE, precluded an origin by direct crustal melting, instead requiring crystallization differentiation. This initially motivated the sidewall crystallization model, where less dense, evolved liquid originated and percolated upwards through a crystal-rich boundary zone, adjacent to a liquid dominated reservoir. The 'defrosting' or remobilization of this sidewall was proposed as a mechanism for producing complex temporal signatures in erupted suites, and this notion later found additional support in the recognition of so-called 'antecrysts.' Lab bench scale tank models of crystallizing salt solutions were offered as analogs for these boundary layer driven magmatic systems. However, it was recognized that features of this boundary layer model that did not agree with seismic, gravity and magnetotelluric, and geological observations. Seismic studies of silicic systems typically indicate P-wave velocity anomalies of 15% or greater for both shallow and deeper systems. But they do not show velocity anomalies that would indicate substantial regions of pure liquid in the core. Rather, the geophysical anomalies, are consistent with a with a spatially extensive crystal mush with an overlying thin melt lens. In addition the observation that erupted crystal poor liquids abruptly transition into crystal rich magmas with interstitial liquid compositions that are nearly identical to the crystal poor ones, provides evidence of a geometrical and source relationship between crystal poor and subjacent crystal rich mush. Lastly, it was appreciated that the boundary layer fluid dynamic models lacked geological verisimilitude, and invoked assumptions on heat transfer rates that were not in accord with geological conditions. Taken together this required a new conceptual model that could honor a broader range of constraints, and led to the 'full chamber' mush model as described by Hildreth (2001, 2004, 2007) and subsequently Bachmann and Bergantz (2004, 2008). However there are many open questions about this model, particularly how they are assembled, the physics of melt movement and mixing, and the way they respond to open system events. For example it is now recognized that crystal mushes can be remobilized rapidly and mineral isotopic and trace element zoning requires that the mush can go through some re-melting, consistent with the unzipping model of Burgisser and Bergantz (2011).

Wetting and Spreading of Molten Volcanic Ash in Jet Engines.

PubMed

Song, Wenjia; Lavallée, Yan; Wadsworth, Fabian B; Hess, Kai-Uwe; Dingwell, Donald B

2017-04-20

A major hazard to jet engines posed by volcanic ash is linked to the wetting and spreading of molten ash droplets on engine component surfaces. Here, using the sessile drop method, we study the evolution of the wettability and spreading of volcanic ash. We employ rapid temperature changes up to 1040-1450 °C, to replicate the heating conditions experienced by volcanic ash entering an operating jet engine. In this scenario, samples densify as particles coalesce under surface tension until they form a large system-sized droplet (containing remnant gas bubbles and crystals), which subsequently spreads on the surface. The data exhibit a transition from a heterogeneous to a homogeneous wetting regime above 1315 °C as crystals in the drops are dissolved in the melt. We infer that both viscosity and microstructural evolution are key controls on the attainment of equilibrium in the wetting of molten volcanic ash droplets.

Preferred orientations of laterally grown silicon films over amorphous substrates using the vapor-liquid-solid technique

NASA Astrophysics Data System (ADS)

LeBoeuf, J. L.; Brodusch, N.; Gauvin, R.; Quitoriano, N. J.

2014-12-01

A novel method has been optimized so that adhesion layers are no longer needed to reliably deposit patterned gold structures on amorphous substrates. Using this technique allows for the fabrication of amorphous oxide templates known as micro-crucibles, which confine a vapor-liquid-solid (VLS) catalyst of nominally pure gold to a specific geometry. Within these confined templates of amorphous materials, faceted silicon crystals have been grown laterally. The novel deposition technique, which enables the nominally pure gold catalyst, involves the undercutting of an initial chromium adhesion layer. Using electron backscatter diffraction it was found that silicon nucleated in these micro-crucibles were 30% single crystals, 45% potentially twinned crystals and 25% polycrystals for the experimental conditions used. Single, potentially twinned, and polycrystals all had an aversion to growth with the {1 0 0} surface parallel to the amorphous substrate. Closer analysis of grain boundaries of potentially twinned and polycrystalline samples revealed that the overwhelming majority of them were of the 60° Σ3 coherent twin boundary type. The large amount of coherent twin boundaries present in the grown, two-dimensional silicon crystals suggest that lateral VLS growth occurs very close to thermodynamic equilibrium. It is suggested that free energy fluctuations during growth or cooling, and impurities were the causes for this twinning.

Analysis of edge birefringence.

PubMed Central

Oldenbourg, R

1991-01-01

We present an experimental and theoretical study of the phenomenon of edge birefringence that appears near boundaries of transparent objects which are observed with high extinction and high resolution polarized light microscopy. As test objects, thin flakes of isotropic KCl crystals were immersed in media of various refractive indices. The measured retardation near crystal edges increased linearly with both the crystal thickness (tested between 0.3 and 1 micron), and the difference in refractive indices n between crystal (n = 1.49) and immersion liquids (n between 1.36 and 1.62). The specific edge birefringence, i.e., the retardation per thickness and per refractive index difference, is 0.029 on the high refractive index side of the boundary and -0.015 on the low refractive index side. The transition through zero birefringence specifies the position of a boundary at a much higher precision than predicted by the diffraction limit of the optical setup. The theoretical study employs a ray tracing procedure modeling the change in phase and polarization of rays passing through the specimen. We find good agreement between the model calculations and the experimental results indicating that edge birefringence can be attributed to the change in polarization of light that is refracted and reflected by dielectric interfaces. Images FIGURE 1 FIGURE 3 FIGURE 4 PMID:1932552

Spherical crystals of Pb 1 - xSn xTe grown in microgravity

NASA Astrophysics Data System (ADS)

Kinoshita, Kyoichi; Yamada, Tomoaki

1996-07-01

Pb 1- xSn xTe spherical crystals were unintentionally obtained along with a cylindrical Pb 1 - xSn xTe crystal grown during the {SL-J}/{FMPT} mission on board the space shuttle "Endeavor". About 25 spherical crystals ranged from 0.5 to 11 mm in diameter. Melt leaked from the melt reservoir into the spring that plays the role of pushing the melt toward a seed crystal and eliminating free surface areas of the melt. Because of the surface tension of the melt, spherical melt drops formed in the hollow of the spring, then solidified into spherical crystals during the cooling process. Some of the crystals had lower dislocation densities, in the order of 10 4 cm -2, two orders smaller than those of terrestrially grown crystals from a melt. The experiment showed a way of stably positioning a large volume of liquid in microgravity without touching the crucible wall and a way of reducing crystalline defects by such growth.

Crystallization and preliminary crystallographic analysis of maganese(II)-dependent 2,3-dihydroxybiphenyl 1,2-dioxygenase from Bacillus sp. JF8

PubMed Central

Senda, Miki; Hatta, Takashi; Kimbara, Kazuhide; Senda, Toshiya

2010-01-01

A thermostable manganese(II)-dependent 2,3-dihydroxybiphenyl-1,2-dioxygenase derived from Bacillus sp. JF8 was crystallized. The initial screening for crystallization was performed by the sitting-drop vapour-diffusion method using a crystallization robot, resulting in the growth of two crystal forms. The first crystal belonged to space group P1, with unit-cell parameters a = 62.7, b = 71.4, c = 93.6 Å, α = 71.2, β = 81.0, γ = 64.0°, and diffracted to 1.3 Å resolution. The second crystal belonged to space group I222, with unit-cell parameters a = 74.2, b = 90.8, c = 104.3 Å, and diffracted to 1.3 Å resolution. Molecular-replacement trials using homoprotocatechuate 2,3-dioxygenase from Arthrobacter globiformis (28% amino-acid sequence identity) as a search model provided a satisfactory solution for both crystal forms. PMID:20208161

Formulation and Solid State Characterization of Nicotinamide-based Co-crystals of Fenofibrate

PubMed Central

Shewale, Sheetal; Shete, A. S.; Doijad, R. C.; Kadam, S. S.; Patil, V. A.; Yadav, A. V.

2015-01-01

The present investigation deals with formulation of nicotinamide-based co-crystals of fenofibrate by different methods and solid-state characterization of the prepared co-crystals. Fenofibrate and nicotinamide as a coformer in 1:1 molar ratio were used to formulate molecular complexes by kneading, solution crystallization, antisolvent addition and solvent drop grinding methods. The prepared molecular complexes were characterized by powder X-ray diffractometry, differential scanning calorimetry, Fourier transform infrared spectroscopy, nuclear magnetic resonance spectroscopy and in vitro dissolution study. Considerable improvement in the dissolution rate of fenofibrate from optimized co-crystal formulation was due to an increased solubility that is attributed to the super saturation from the fine co-crystals is faster because of large specific surface area of small particles and prevention of phase transformation to pure fenofibrate. In vitro dissolution study showed that the formation of co-crystals improves the dissolution rate of fenofibrate. Nicotinamide forms the co-crystals with fenofibrate, theoretically and practically. PMID:26180279

A molecular dynamics study of the effect of thermal boundary conductance on thermal transport of ideal crystal of n-alkanes with different number of carbon atoms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastgarkafshgarkolaei, Rouzbeh; Zeng, Yi; Khodadadi, J. M., E-mail: khodajm@auburn.edu

2016-05-28

Phase change materials such as n-alkanes that exhibit desirable characteristics such as high latent heat, chemical stability, and negligible supercooling are widely used in thermal energy storage applications. However, n-alkanes have the drawback of low thermal conductivity values. The low thermal conductivity of n-alkanes is linked to formation of randomly oriented nano-domains of molecules in their solid structure that is responsible for excessive phonon scattering at the grain boundaries. Thus, understanding the thermal boundary conductance at the grain boundaries can be crucial for improving the effectiveness of thermal storage systems. The concept of the ideal crystal is proposed in thismore » paper, which describes a simplified model such that all the nano-domains of long-chain n-alkanes are artificially aligned perfectly in one direction. In order to study thermal transport of the ideal crystal of long-chain n-alkanes, four (4) systems (C{sub 20}H{sub 42}, C{sub 24}H{sub 50}, C{sub 26}H{sub 54}, and C{sub 30}H{sub 62}) are investigated by the molecular dynamics simulations. Thermal boundary conductance between the layers of ideal crystals is determined using both non-equilibrium molecular dynamics (NEMD) and equilibrium molecular dynamics (EMD) simulations. Both NEMD and EMD simulations exhibit no significant change in thermal conductance with the molecular length. However, the values obtained from the EMD simulations are less than the values from NEMD simulations with the ratio being nearly three (3) in most cases. This difference is due to the nature of EMD simulations where all the phonons are assumed to be in equilibrium at the interface. Thermal conductivity of the n-alkanes in three structures including liquid, solid, and ideal crystal is investigated utilizing NEMD simulations. Our results exhibit a very slight rise in thermal conductivity values as the number of carbon atoms of the chain increases. The key understanding is that thermal transport can be significantly altered by how the molecules and the nano-domains are oriented in the structure rather than by the length of the n-alkane molecules.« less

A 106-fold enhancement in the conductivity of a discotic liquid crystal doped with only 1% (w/w) gold nanoparticles

NASA Astrophysics Data System (ADS)

Holt, Lucy A.; Bushby, Richard J.; Evans, Stephen D.; Burgess, Andrew; Seeley, Gordon

2008-03-01

The presence of 1% (w/w) of methylbenzene thiol coated gold nanoparticles increases the conductivity of the discotic liquid crystal 2,3,6,7,10,11-hexakis(hexyloxy)triphenylene (HAT6) by about two orders of magnitude in all three phases (crystal, columnar liquid crystal, and isotropic liquid). However, when a field (above a certain critical value) is applied to the isotropic phase, the conductivity rapidly increases by another three or four orders of magnitude after which the higher conductivity is maintained regardless of phase, field, or temperature. This increase in conductivity is attributed to the formation of chains of gold nanoparticles. A similar phenomenon is observed for 1% (w/w) gold nanoparticles in the isotropic phase of hexadecane. However, the liquid crystal/nanoparticle mixture preserves its high conductivity when it is cooled into the crystalline phase whereas that of the hexadecane/nanoparticle mixture is lost. In hexadecane, crystal grain boundaries are expected to form in a random fashion and this disrupts the conductive pathways. However, if HAT6 crystallizes via the homeotropically aligned columnar phase, the grain boundaries form predominantly surface to surface (electrode to electrode) so that the conductive nanoparticle chains are trapped in a stabilizing solid matrix.

Human serum albumin crystals and method of preparation

NASA Technical Reports Server (NTRS)

Carter, Daniel C. (Inventor)

1989-01-01

Human serum albumin (HSA) crystals are provided in the form of tetragonal plates having the space groups P42(sub 1)2, the crystals being grown to sizes in excess of 0.5 mm in two dimensions and a thickness of 0.1 mm. Growth of the crystals is carried out by a hanging drop method wherein a precipitant solution containing polyethylene glycol (PEG) and a phosphate buffer is mixed with an HSA solution, and a droplet of mixed solution is suspended over a well of precipitant solution. Crystals grow to the desired size in 3 to 7 days. Concentration of reagents, pH and other parameters are controlled within prescribed limits. The resulting crystals exhibit a size and quality such as to allow performance of x ray diffraction studies and enable the conduct of drug binding studies as well as genetic engineering studies.

Phase diagram of a crystalline protein: Determination of the solubility of concanavalin A by a microquantitation assay

NASA Astrophysics Data System (ADS)

Mikol, Vincent; Giegé, Richard

1989-09-01

A quick and miniature method has been devised for determining protein solubility and used to investigate the equilibrium solubility of concanavalin A from the Jack Bean with its crystals as a function of ammonium sulfate concentration, temperature and pH. The crystals were characterized by X-ray diffraction and their morphologies related to the corresponding solubilities. The protein solution concentration was estimated out of small crystallizing drops using a rapid and sensitive microassay. Measurements of protein quantity were carried out in 96-well microplates in an automatic spectrophotometer. The resulting phase diagram has permitted to analyse the solubility of concanavalin A, to estimate supersaturation and to devise readily new ways of crystal growth of this lectin, namely by pH and temperature variations. Moreover, the approach is proved to be a valuable tool to design crystallization experiments of new molecules and to improve and control protein crystal growth.

Expression, purification, crystallization and preliminary X-ray analysis of a C-terminal fragment of the Epstein–Barr virus ZEBRA protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morand, Patrice; Laboratoire de Virologie Moléculaire et Structurale, EA 2939, Université Joseph Fourier, Grenoble; Budayova-Spano, Monika

A C-terminal fragment of the Epstein–Barr virus lytic switch protein ZEBRA has been crystallized in complex with DNA. A C-terminal fragment of the Epstein–Barr virus immediate-early transcription factor ZEBRA has been expressed as a recombinant protein in Escherichia coli and purified to homogeneity. The fragment behaves as a dimer in solution, consistent with the presence of a basic region leucine-zipper (bZIP) domain. Crystals of the fragment in complex with a DNA duplex were grown by the hanging-drop vapour-diffusion technique using polyethylene glycol 4000 and magnesium acetate as crystallization agents. Crystals diffract to better than 2.5 Å resolution using synchrotron radiationmore » (λ = 0.976 Å). Crystals belong to space group C2, with unit-cell parameters a = 94.2, b = 26.5, c = 98.1 Å, β = 103.9°.« less

Observation of extraordinary transmission in deep UV region from aluminum film coated two dimensional photonic crystals

NASA Astrophysics Data System (ADS)

Venkatesh, A.; Piragash Kumar, R. M.; Moorthy, V. H. S.

2018-05-01

We report the first observation of extraordinary transmission of deep-UV light (λ = 289nm) through 20nm aluminum film coated two-dimensional photonic crystals. The two-dimensional photonic crystals are made of self-assembled hexagonally arranged monolayer of 200 nm polystyrene spheres fabricated using drop casting method. The high quality photonic crystal exhibits a well-defined photonic band gap of 4.59 eV (λ = 270nm) and the aluminum coated two-dimensional photonic crystal displays extraordinary transmission in the deep-UV region at λ = 289 nm. The fabricated aluminum nanostructure produces a sensitivity of 42nm/RIU and 57nm/RIU when the refractive index of the surrounding medium is changed from 1 (= air) to 1.36 (= ethanol) and 1.49 (=toluene), respectively. Therefore, the aluminum film coated two-dimensional photonic crystals could be utilized to fabricate cost-effective and ultrasensitive chemical sensors.

High-efficency stable 213-nm generation for LASIK application

NASA Astrophysics Data System (ADS)

Wang, Zhenglin; Alameh, Kamal; Zheng, Rong

2005-01-01

213nm Solid-state laser technology provides an alternative method to replace toxic excimer laser in LASIK system. In this paper, we report a compact fifth harmonic generation system to generate high pulse energy 213nm laser from Q-switched Nd:YAG laser for LASIK application based on three stages harmonic generation procedures. A novel crystal housing was specifically designed to hold the three crystals with each crystal has independent, precise angular adjustment structure and automatic tuning control. The crystal temperature is well maintained at ~130°C to improve harmonic generation stability and crystal operation lifetime. An output pulse energy 35mJ is obtained at 213nm, corresponding to total conversion efficiency ~10% from 1064nm pump laser. In system verification tests, the 213nm output power drops less than 5% after 5 millions pulse shots and no significant damage appears in the crystals.

Periodic grain-boundary formation in a poly-Si thin film crystallized by linearly polarized Nd:YAG pulse laser with an oblique incident angle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaki, Hirokazu; Horita, Susumu

2005-01-01

We investigated the periodic grain-boundary formation in the polycrystalline silicon film crystallized by a linearly polarized Nd:YAG (where YAG is yttrium aluminum garnet) pulse laser with an oblique incident angle {theta}{sub i}=25 deg. , compared with the normal incident angle {theta}{sub i}=0. The alignment of the grain boundary was uncontrollable and fluctuated in the case of the oblique incident and large irradiation pulse number while that in the case of the normal incident was performed stably. It was found that the main cause for its low controllability was the nonphase matching between the periodic surface corrugation of the crystallized siliconmore » film and the periodic temperature profile induced by the laser irradiation. Also, it was found that, in the case of {theta}{sub i}=25 deg. , the dominant periodic width of the grain boundary depended on the pulse number N. That is, it was around {lambda}/(1+sin {theta}{sub i}) for small N{approx_equal}10 and {lambda}/(1-sin {theta}{sub i}) for large N{approx_equal}100 at the laser wavelength of {lambda}=532 nm. In order to explain this dependence, we proposed a model to take into account the periodic corrugation height proportional to the molten volume of the silicon film, the impediment in interference between the incident beam and diffracted beam on the irradiated surface due to the corrugation height, and the reduction of the liquid surface roughness during melting-crystallization process due to liquid-silicon viscosity.« less

Crystallization of Chicken Egg White Lysozyme from Assorted Sulfate Salts

NASA Technical Reports Server (NTRS)

Forsythe, Elizabeth L.; Snell, Edward H.; Malone, Christine C.; Pusey, Marc L.

1998-01-01

Chicken egg white lysozyme has been found to crystallize from ammonium, sodium, potassium, rubidium, magnesium, and manganese sulfates at acidic and basic pH, with protein concentrations from 60 to 190 mg/ml. Four different crystal morphologies have been obtained, depending upon the temperature, protein concentration, and precipitating salt employed, Crystals grown at 15 C were generally tetragonal, with space group P43212. Crystallization at 20 C typically resulted in the formation of orthorhombic crystals, space group P21212 1. The tetragonal much less than orthorhombic morphology transition appeared to be a function of both the temperature and protein concentration, occurring between 15 and 20 C and between 100 and 125 mg/ml protein concentration. Crystallization from 0.8 -1.2M magnesium sulfate at pH 7.6 - 8.0 gave a hexagonal (trigonal) crystal form, space group P3121, which diffracted to 2.8 A. Ammonium sulfate was also found to result in a monoclinic form, space group C2. Small twinned monoclinic crystals of approx. 0.2 mm on edge were grown by dialysis followed by seeded sitting drop crystallization.

Raman Spectroscopy Adds Complementary Detail to the High-Resolution X-Ray Crystal Structure of Photosynthetic PsbP from Spinacia oleracea

PubMed Central

Lapkouski, Mikalai; Hofbauerova, Katerina; Sovova, Zofie; Ettrichova, Olga; González-Pérez, Sergio; Dulebo, Alexander; Kaftan, David; Kuta Smatanova, Ivana; Revuelta, Jose L.; Arellano, Juan B.; Carey, Jannette; Ettrich, Rüdiger

2012-01-01

Raman microscopy permits structural analysis of protein crystals in situ in hanging drops, allowing for comparison with Raman measurements in solution. Nevertheless, the two methods sometimes reveal subtle differences in structure that are often ascribed to the water layer surrounding the protein. The novel method of drop-coating deposition Raman spectropscopy (DCDR) exploits an intermediate phase that, although nominally “dry,” has been shown to preserve protein structural features present in solution. The potential of this new approach to bridge the structural gap between proteins in solution and in crystals is explored here with extrinsic protein PsbP of photosystem II from Spinacia oleracea. In the high-resolution (1.98 Å) x-ray crystal structure of PsbP reported here, several segments of the protein chain are present but unresolved. Analysis of the three kinds of Raman spectra of PsbP suggests that most of the subtle differences can indeed be attributed to the water envelope, which is shown here to have a similar Raman intensity in glassy and crystal states. Using molecular dynamics simulations cross-validated by Raman solution data, two unresolved segments of the PsbP crystal structure were modeled as loops, and the amino terminus was inferred to contain an additional beta segment. The complete PsbP structure was compared with that of the PsbP-like protein CyanoP, which plays a more peripheral role in photosystem II function. The comparison suggests possible interaction surfaces of PsbP with higher-plant photosystem II. This work provides the first complete structural picture of this key protein, and it represents the first systematic comparison of Raman data from solution, glassy, and crystalline states of a protein. PMID:23071614

Green-emissive transparent BaSi 2O 5:Eu 2 + film phosphor on quartz glass created by a sputtering thermal diffusion process

NASA Astrophysics Data System (ADS)

Seo, K. I.; Park, J. H.; Kim, J. S.; Na, Y. H.; Choi, J. C.; Bae, J. S.

2009-10-01

Eu 2+-doped BaSi 2O 5 film phosphors on quartz substrates are fabricated by radio-frequency magnetron sputtering thermal diffusion. The BaSi 2O 5: Eu 2+ phosphor crystals have some preferred orientations that are lattice-spacing matched with the crystallized β- SiO 2 crystals, and they show pore and grain boundary-free morphology with a rod-like shape fused into the crystallized β- SiO 2 crystals. The BaSi 2O 5: Eu 2+ film phosphor has a high transparency, with a transmittance of about 30% in visible light. The BaSi 2O 5: Eu 2+ film phosphor shows 510 nm green emission from the f-d transition of the Eu 2+ ions, and in particular the best sample shows a green photoluminescence brightness of about 5% of a BaSi 2O 5: Eu 2+ powder phosphor screen. These excellences in optical properties can be explained by less optical scattering at pores or grain boundaries, and less reflection at the continuously index-changed interface.

Effect of Gravity Level on the Particle Shape and Size During Zeolite Crystal Growth

NASA Technical Reports Server (NTRS)

Song, Hong-Wei; Ilebusi, Olusegun J.; Sacco, Albert, Jr.

2003-01-01

A microscopic diffusion model is developed to represent solute transport in the boundary layer of a growing zeolite crystal. This model is used to describe the effect of gravity on particle shape and solute distribution. Particle dynamics and crystal growth kinetics serve as the boundary conditions of flow and convection-diffusion equations. A statistical rate theory is used to obtain the rate of solute transport across the growing interface, which is expressed in terms of concentration and velocity of solute species. Microgravity can significantly decrease the solute velocity across the growing interface compared to its earth-based counterpart. The extent of this reduction highly depends on solute diffusion constant in solution. Under gravity, the flow towards the crystal enhances solute transport rate across the growing interface while the flow away from crystals reduces this rate, suggesting a non-uniform growth rate and thus an elliptic final shape. However, microgravity can significantly reduce the influence of flow and obtain a final product with perfect spherical shape. The model predictions compare favorably with the data of space experiment of zeolites grown in space.

Crystal Resonators with Increased Immunity to Acceleration Fields

DTIC Science & Technology

1980-07-01

D. H. Donnay, McGill University; June :977, pp. 3-7. and M . J. Buerger and C. Frondel, Harvard University. 1241 M . Ono, K. Furusawa , S. Ishigami, T...crystal boundary to the mounting ’copnens supports. The stress distribution within the crystal depends t vi ron m ents of manpack and aircraft...Sase, and M . Sato, "Quartz crystal accelerometer insensitive to temperature variation," in Proc. 31stAFCS, June 1977, pp. 62-70. REFERENCES’ [251 D

The effect of antiphase boundaries on the elastic properties of Ni-Mn-Ga austenite and premartensite

NASA Astrophysics Data System (ADS)

Seiner, Hanuš; Sedlák, Petr; Bodnárová, Lucie; Drahokoupil, Jan; Kopecký, Vít; Kopeček, Jaromír; Landa, Michal; Heczko, Oleg

2013-10-01

The evolution of elastic properties with temperature and magnetic field was studied in two differently heat-treated single crystals of the Ni-Mn-Ga magnetic shape memory alloy using resonant ultrasound spectroscopy. Quenching and slow furnace cooling were used to obtain different densities of antiphase boundaries. We found that the crystals exhibited pronounced differences in the c‧ elastic coefficient and related shear damping in high-temperature ferromagnetic phases (austenite and premartensite). The difference can be ascribed to the formation of fine magnetic domain patterns and pinning of the magnetic domain walls on antiphase boundaries in the material with a high density of antiphase boundaries due to quenching. The fine domain pattern arising from mutual interactions between antiphase boundaries and ferromagnetic domain walls effectively reduces the magnetocrystalline anisotropy and amplifies the contribution of magnetostriction to the elastic response of the material. As a result, the anomalous elastic softening prior to martensite transformation is significantly enhanced in the quenched sample. Thus, for any comparison of experimental data and theoretical calculations the microstructural changes induced by specific heat treatment must be taken into account.

The effect of antiphase boundaries on the elastic properties of Ni-Mn-Ga austenite and premartensite.

PubMed

Seiner, Hanuš; Sedlák, Petr; Bodnárová, Lucie; Drahokoupil, Jan; Kopecký, Vít; Kopeček, Jaromír; Landa, Michal; Heczko, Oleg

2013-10-23

The evolution of elastic properties with temperature and magnetic field was studied in two differently heat-treated single crystals of the Ni-Mn-Ga magnetic shape memory alloy using resonant ultrasound spectroscopy. Quenching and slow furnace cooling were used to obtain different densities of antiphase boundaries. We found that the crystals exhibited pronounced differences in the c' elastic coefficient and related shear damping in high-temperature ferromagnetic phases (austenite and premartensite). The difference can be ascribed to the formation of fine magnetic domain patterns and pinning of the magnetic domain walls on antiphase boundaries in the material with a high density of antiphase boundaries due to quenching. The fine domain pattern arising from mutual interactions between antiphase boundaries and ferromagnetic domain walls effectively reduces the magnetocrystalline anisotropy and amplifies the contribution of magnetostriction to the elastic response of the material. As a result, the anomalous elastic softening prior to martensite transformation is significantly enhanced in the quenched sample. Thus, for any comparison of experimental data and theoretical calculations the microstructural changes induced by specific heat treatment must be taken into account.

Pseudosymmetric features of non-centrosymmetric AB type crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gazhulina, A.P., E-mail: asyagazhulina@yandex.ru; Marychev, M.O.

2016-07-15

This work is supplement to our previous investigation (Gazhulina and Marychev, 2015) [1]. We have considered pseudosymmetric features with respect to the operation of inversion (pseudoinversion) for 340 non-centrosymmetric AB type crystals. Analysis of the features of particular structure types allowed us to determine the positions of pseudoinversion centers, subdivide them into separate types, and classify the entire set of crystals studied with respect to the types of pseudoinversion centers and peculiarities of the behavior of the degree of pseudoinversion depending on the ratio of atomic numbers of A and B components. For each group of crystals, average values andmore » lower boundaries of the maximum pseudoinversion are determined and distribution with respect to the degree of pseudoinversion is constructed. - Graphical abstract: A group of 340 non-centrosymmetric AB type crystals have been considered for their pseudosymmetry features with respect to the operation of inversion. Positions of pseudoinversion centers, subdivision of them into separate types, classification of the entire set of crystals studied with respect to the types of pseudoinversion centers and peculiarities of the behavior of the degree of pseudoinversion are established and discussed. Display Omitted - Highlights: • We consider pseudoinversion of 340 non-centrosymmetric AB type crystals. • AB type crystals are divided into three groups with respect to pseudoinversion. • Positions and types of pseudoinversion centers are determined. • Lower boundaries of the maximum pseudoinversion are determined.« less

Convective diffusion in protein crystal growth

NASA Technical Reports Server (NTRS)

Baird, J. K.; Meehan, E. J., Jr.; Xidis, A. L.; Howard, S. B.

1986-01-01

A protein crystal modeled as a flat plate suspended in the parent solution, with the normal to the largest face perpendicular to gravity and the protein concentration in the solution adjacent to the plate taken to be the equilibrium solubility, is studied. The Navier-Stokes equation and the equation for convective diffusion in the boundary layer next to the plate are solved to calculate the flow velocity and the protein mass flux. The local rate of growth of the plate is shown to vary significantly with depth due to the convection. For an aqueous solution of lysozyme at a concentration of 40 mg/ml, the boundary layer at the top of a 1-mm-high crystal has a thickness of 80 microns at 1 g, and 2570 microns at 10 to the -6th g.

Coulomb-like elastic interaction induced by symmetry breaking in nematic liquid crystal colloids.

PubMed

Lee, Beom-Kyu; Kim, Sung-Jo; Kim, Jong-Hyun; Lev, Bohdan

2017-11-21

It is generally thought that colloidal particles in a nematic liquid crystal do not generate the first multipole term called deformation elastic charge as it violates the mechanical equilibrium. Here, we demonstrate theoretically and experimentally that this is not the case, and deformation elastic charges, as well as dipoles and quadrupoles, can be induced through anisotropic boundary conditions. We report the first direct observation of Coulomb-like elastic interactions between colloidal particles in a nematic liquid crystal. The behaviour of two spherical colloidal particles with asymmetric anchoring conditions induced by asymmetric alignment is investigated experimentally; the interaction of two particles located at the boundary of twist and parallel aligned regions is observed. We demonstrate that such particles produce deformation elastic charges and interact by Coulomb-like interactions.

Tunable Polymer Lens

DTIC Science & Technology

2008-08-04

can also be initiated mechanically to produce variable lenses [9-11]. Recent work shows lens properties of a controlled liquid drop shape, with no... liquid crystal spherical lens ," Appl. Phys. Lett. 84, 4789-4791 (2004). 3. H. W. Ren, D. W. Fox, B. Wu, and S. T. Wu, " Liquid crystal lens with large...and S. S. Lee, "Focal tunable liquid lens integrated with an electromagnetic actuator," Appl. Phys. Lett. 90, 121129 (2007). 10. H. W. Ren, D. Fox

Liquid crystal droplet formation and anchoring dynamics in a microfluidic device

NASA Astrophysics Data System (ADS)

Steinhaus, Ben; Shen, Amy; Feng, James; Link, Darren

2004-11-01

Liquid crystal drops dispersed in a continuous phase of silicon oil are generated with a narrow distribution in droplet size in microfluidic devices both above and below the nematic to isotropic transition temperature. For these two cases, we observe not only the different LC droplet generation and coalescence dynamics, but also distinct droplet morphology. Our experiments show that the nematic liquid crystalline order is important for the LC droplet formation and anchoring dynamics.

Patterns of protein–protein interactions in salt solutions and implications for protein crystallization

PubMed Central

Dumetz, André C.; Snellinger-O'Brien, Ann M.; Kaler, Eric W.; Lenhoff, Abraham M.

2007-01-01

The second osmotic virial coefficients of seven proteins—ovalbumin, ribonuclease A, bovine serum albumin, α-lactalbumin, myoglobin, cytochrome c, and catalase—were measured in salt solutions. Comparison of the interaction trends in terms of the dimensionless second virial coefficient b2 shows that, at low salt concentrations, protein–protein interactions can be either attractive or repulsive, possibly due to the anisotropy of the protein charge distribution. At high salt concentrations, the behavior depends on the salt: In sodium chloride, protein interactions generally show little salt dependence up to very high salt concentrations, whereas in ammonium sulfate, proteins show a sharp drop in b2 with increasing salt concentration beyond a particular threshold. The experimental phase behavior of the proteins corroborates these observations in that precipitation always follows the drop in b2. When the proteins crystallize, they do so at slightly lower salt concentrations than seen for precipitation. The b2 measurements were extended to other salts for ovalbumin and catalase. The trends follow the Hofmeister series, and the effect of the salt can be interpreted as a water-mediated effect between the protein and salt molecules. The b2 trends quantify protein–protein interactions and provide some understanding of the corresponding phase behavior. The results explain both why ammonium sulfate is among the best crystallization agents, as well as some of the difficulties that can be encountered in protein crystallization. PMID:17766383

Expression, purification, crystallization and preliminary X-ray crystallographic studies of Deinococcus radiodurans thioredoxin reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Obiero, Josiah; Bonderoff, Sara A.; Goertzen, Meghan M.

2006-08-01

Recombinant D. radiodurans TrxR with a His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. Deinococcus radiodurans, a Gram-positive bacterium capable of withstanding extreme ionizing radiation, contains two thioredoxins (Trx and Trx1) and a single thioredoxin reductase (TrxR) as part of its response to oxidative stress. Thioredoxin reductase is a member of the family of pyridine nucleotide-disulfide oxidoreductase flavoenzymes. Recombinant D. radiodurans TrxR with amore » His tag at the N-terminus was expressed in Escherichia coli and purified by metal-affinity chromatography. The protein was crystallized using the sitting-drop vapour-diffusion method in the presence of 35% PEG 4000, 0.2 M ammonium acetate and citric acid buffer pH 5.1 at 293 K. X-ray diffraction data were collected on a cryocooled crystal to a resolution of 1.9 Å using a synchrotron-radiation source. The space group was determined to be P3{sub 2}21, with unit-cell parameters a = b = 84.33, c = 159.88 Å. The structure of the enzyme has been solved by molecular-replacement methods and structure refinement is in progress.« less

The structure of 110 tilt boundaries in large area solar silicon

NASA Technical Reports Server (NTRS)

Ast, D. G.; Cunningham, B.; Vaudin, M.

1982-01-01

The models of Hornstra and their connection to the repeating group description of grain boundaries (7-10) are discussed. A model for the Sigma = 27 boundary containing a zig-zag arrangement of dislocations is constructed and it is shown that zig-zag models can account for the contrast features observed in high resolution transmission electron micrographs of second and third order twin boundaries in silicon. The boundaries discussed are symmetric with a 110 tilt axis and a (110) boundary plane in the median lattice (the median plane). The median lattice is identical in structure and halfway in orientation between the crystal lattices either side of the boundary.

Direct observation of in-plane anisotropy of the superconducting critical current density in Ba (Fe1-xCox) 2As2 crystals

NASA Astrophysics Data System (ADS)

Hecher, J.; Ishida, S.; Song, D.; Ogino, H.; Iyo, A.; Eisaki, H.; Nakajima, M.; Kagerbauer, D.; Eisterer, M.

2018-01-01

The phase diagram of iron-based superconductors exhibits structural transitions, electronic nematicity, and magnetic ordering, which are often accompanied by an electronic in-plane anisotropy and a sharp maximum of the superconducting critical current density (Jc) near the phase boundary of the tetragonal and the antiferromagnetic-orthorhombic phase. We utilized scanning Hall-probe microscopy to visualize the Jc of twinned and detwinned Ba (Fe1-xCox) 2As2 (x =5 %-8 % ) crystals to compare the electronic normal state properties with superconducting properties. We find that the electronic in-plane anisotropy continues into the superconducting state. The observed correlation between the electronic and the Jc anisotropy agrees qualitatively with basic models, however, the Jc anisotropy is larger than predicted from the resistivity data. Furthermore, our measurements show that the maximum of Jc at the phase boundary does not vanish when the crystals are detwinned. This shows that twin boundaries are not responsible for the large Jc, suggesting an exotic pinning mechanism.

Stability relationship for water droplet crystallization with the NASA Lewis icing spray

NASA Technical Reports Server (NTRS)

Marek, C. John; Bartlett, C. Scott

1987-01-01

In order to produce small droplets for icing cloud simulation, high pressure air atomizing nozzles are used. For certain icing testing applications, median drop sizes as small as 5 mm are needed, which require air atomizing pressures greater than 3000 kPa. Isentropic expansion of the ambient temperature atomizing air to atmospheric pressure can result in air stream temperatures of -160 C which results in ice crystals forming in the cloud. To avoid such low temperatures, it is necessary to heat the air and water to high initial temperatures. An icing spray research program was conducted to map the temperatures below which ice crystals form. A soot slide technique was used to determine the presence of crystals in the spray.

Purification, crystallization and preliminary X-ray diffraction studies of D-tagatose 3-epimerase from Pseudomonas cichorii.

PubMed

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-02-01

D-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of D-psicose has not been reported with epimerases other than P. cichorii D-TE and D-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 A, beta = 102.82 degrees . Diffraction data were collected to 2.5 A resolution. The asymmetric unit is expected to contain four molecules.

Growth kinetics of physical vapor transport processes: Crystal growth of the optoelectronic material mercurous chloride

NASA Technical Reports Server (NTRS)

Singh, N. B.; Duval, W. M.

1991-01-01

Physical vapor transport processes were studied for the purpose of identifying the magnitude of convective effects on the crystal growth process. The effects of convection on crystal quality were were studied by varying the aspect ratio and those thermal conditions which ultimately affect thermal convection during physical vapor transport. An important outcome of the present study was the observation that the convection growth rate increased up to a certain value and then dropped to a constant value for high aspect ratios. This indicated that a very complex transport had occurred which could not be explained by linear stability theory. Better quality crystals grown at a low Rayleigh number confirmed that improved properties are possible in convectionless environments.

The Role of Body Crystallization in Asteroidal Cores

NASA Astrophysics Data System (ADS)

Wasson, J. T.

1993-07-01

Large fractionations (factors of 2000-6000) in Ir/Ni and other ratios demonstrate that the magmatic groups of iron meteorites formed by fractional crystallization, and thus that the residual liquid remained well stirred during core crystallization. Past models have relied on solidification at the base or the top of the core, but body crystallization offers an attractive alternative. The simplest of the earlier models involved convective maxing induced by the liberation of heat and light elements (especially S) during upward crystallization from the center of the core. Other models involving downward crystallization from the core-mantle interface are based on the fact that temperatures at this location are slightly lower than those at the center; no whole-core stirring mechanism is provided by these models. Haack and Scott recently published a variant of the downward crystallization model involving the growth of giant (kilometer-scale) dendrites. Because crystallization creates a boundary layer enriched in S that does not participate in the convection, these models require several K of supercooling to induce crystallization (this undercooling is much greater than the temperature difference between the center of the core and the core-mantle interface). Buoyant forces will occasionally remove droplets of the basal boundary fluid; thus it was thinner and its degree of undercooling less than in that at the ceiling of the magma chamber. Homogeneous nucleation of metals is difficult to achieve; generally 200-300 K of undercooling is required, much more than could possibly occur in an asteroidal core. Crystals could, however, nucleate in the magma body on chromite, probably the first liquidus phase (A. Kracher, personal communication, notes that this is required to explain why Cr behaved like a compatible element despite having a solid/liquid D < 1). In addition, some tiny, submillimeter dendrites that formed at the top of the core must have pinched off and fallen into the magma. Such seeds settle as a result of buoyant forces (thus stirring the magma) and, as a result, achieve very thin boundary layers and require low degrees of undercooling in order to crystallize. The rate of core crystallization is limited by the rate of heat transport across the core-mantle interface. If sufficient nuclei are available at different sites, the bulk of the crystallization occurs where undercooling is least. It is possible that a larger fraction of the total crystallization occurred in the body of the magma than at its base or ceiling.

Measurements in liquid fuel sprays

NASA Technical Reports Server (NTRS)

Chigier, N.; Mao, C. P.

1985-01-01

A ground test facility is being established at NASA Lewis Research Center to simulate the environmental and flight conditions needed to study adverse weather effects. One of the most important components is the water spray system which consists of many nozzles fitted on spray bars. Water is injected through air-assisted atomizers to generate uniform size drops to simulate icing in clouds. The primary objective is to provide experimental data on drop size distribution over a wide range of operating conditions. Correlation equations for mean drop size and initial injection parameters are being determined to assist in the design and modification of the Altitude Wind Tunnel. Special emphasis is being placed on the study of the aerodynamic structure of the air-assisted atomizer sprays. Detailed measurements of the variation of drop size distribution and velocity as a function of time and space are being made. Accurate initial and boundary conditions are being provided for computer model evaluation.

A case of Alzheimer's disease in magmatic crystals

NASA Astrophysics Data System (ADS)

Costa Rodriguez, F.; Bouvet de Maisonneuve, C.

2012-12-01

The reequilibration of chemical zoning in crystals from volcanic rocks is increasingly used to determine the duration of the processes involved in their origin, residence and transport. There now exist a good number of determinations of diffusion coefficients in olivine (Fe-Mg, Mn, Ca, Ni, Cr), plagioclase (CaAl-NaSi, Mg, Sr, Ba, REE), pyroxenes (Fe-Mg, Mn, Ca, REE) and quartz (Ti), but most studies have used a single element or component in a single mineral group. Although this is a good approach, it can only access a limited range of time scales, typically the short-term memory of the crystal. In other words, for process durations that are longer than the combination of the diffusivity and diffusion distance (and for a constant boundary), the long-term memory of the crystal might have been lost. This could explain why most time determinations of magmatic processes from volcanic rocks give times of about < 100 years, and why these are shorter than the thousands of years obtained from U-Th series disequilibrium isotopes. We have done a series of numerical calculations and natural observation to determine the time windows that can be accessed with different elements and minerals, and how they may affect the time scales and interpretations of processes that the crystals might be recording. We have looked at two end-members representative of mafic and silicic magmas by changing the temperature and mineral compositions. 3 dimensional calculations of diffusion reequilibration at the center of a 1 x 0.5 x 0.5 mm crystal and using a constant boundary as first case. We find that for mafic magma and olivine, 90 % of equilibration of Fe-Mg, Mn, and Ni occurs in a few decades, but gradients in Ca and Cr persist for a few thousand years. These results can for example explain the large ranges of Ca and Cr contents at a given Fe/Mg of olivine, and why apparently contradictory times can be obtained from elements with different diffusivities in the same crystal. At the same time these findings also highlight that there is a long-term memory of the crystal that is typically not accessed by current studies. However, unraveling this memory is more complex because it seems unrealistic to assume a constant composition at the boundary for hundreds or thousands of years, and because crystals can be growing and dissolving multiple times. Additional models considering growth and a variable boundary show that a significant part of the memory is lost by multiple changes in concentration being superimposed at the crystal rim. Here we also report a case where accessing the older history of the crystals might be possible by a combination of X-Ray element maps plus multiple element zoning traverses (Fe-Mg, Ca, Mn, Ni, Al, P, Cr) in olivine from Llaima volcano (Chile). Element distributions reveal that the crystals had an early history of fast growth. The delicate structures of P zoning have been used to recognize any crystal dissolution. Cr, Fe-Mg, Ni, Mn are zoned but the times obtained from Cr are 4 x longer than those of the other elements. Our interpretation is that the Cr zoning records the older memory of the crystal since eruption but that of Fe-Mg has lost part of the memory due to multiple changes at the rim or complete homogenization of the crystal. Thus using multiple elements and minerals allow accessing the long and short term memory of the crystals and associated magma.

Generalized continuum modeling of scale-dependent crystalline plasticity

NASA Astrophysics Data System (ADS)

Mayeur, Jason R.

The use of metallic material systems (e.g. pure metals, alloys, metal matrix composites) in a wide range of engineering applications from medical devices to electronic components to automobiles continues to motivate the development of improved constitutive models to meet increased performance demands while minimizing cost. Emerging technologies often incorporate materials in which the dominant microstructural features have characteristic dimensions reaching into the submicron and nanometer regime. Metals comprised of such fine microstructures often exhibit unique and size-dependent mechanical response, and classical approaches to constitutive model development at engineering (continuum) scales, being local in nature, are inadequate for describing such behavior. Therefore, traditional modeling frameworks must be augmented and/or reformulated to account for such phenomena. Crystal plasticity constitutive models have proven quite capable of capturing first-order microstructural effects such as grain orientation (elastic/plastic anisotropy), grain morphology, phase distribution, etc. on the deformation behavior of both single and polycrystals, yet suffer from the same limitations as other local continuum theories with regard to capturing scale-dependent mechanical response. This research is focused on the development, numerical implementation, and application of a generalized (nonlocal) theory of single crystal plasticity capable of describing the scale-dependent mechanical response of both single and polycrystalline metals that arises as a result of heterogeneous deformation. This research developed a dislocation-based theory of micropolar single crystal plasticity. The majority of nonlocal crystal plasticity theories are predicated on the connection between gradients of slip and geometrically necessary dislocations. Due to the diversity of existing nonlocal crystal plasticity theories, a review, summary, and comparison of representative model classes is presented in Chapter 2 from a unified dislocation-based perspective. The discussion of the continuum crystal plasticity theories is prefaced by a brief review of discrete dislocation plasticity, which facilitates the comparison of certain model aspects and also serves as a reference for latter segments of the research which make connection to this constitutive description. Chapter 2 has utility not only as a literature review, but also as a synthesis and analysis of competing and alternative nonlocal crystal plasticity modeling strategies from a common viewpoint. The micropolar theory of single crystal plasticity is presented in Chapter 3. Two different types of flow criteria are considered - the so-called single and multicriterion theories, and several variations of the dislocation-based strength models appropriate for each theory are presented and discussed. The numerical implementation of the two-dimensional version of the constitutive theory is given in Chapter 4. A user element subroutine for the implicit commercial finite element code Abaqus/Standard is developed and validated through the solution of initial-boundary value problems with closed-form solutions. Convergent behavior of the subroutine is also demonstrated for an initial-boundary value problem exhibiting strain localization. In Chapter 5, the models are employed to solve several standard initial-boundary value problems for heterogeneously deforming single crystals including simple shearing of a semi-infinite constrained thin film, pure bending of thin films, and simple shearing of a metal matrix composite with elastic inclusions. The simulation results are compared to those obtained from the solution of equivalent boundary value problems using discrete dislocation dynamics and alternative generalized crystal plasticity theories. Comparison and calibration with respect to the former provides guidance in the specification of non-traditional material parameters that arise in the model formulation and demonstrates its effectiveness at capturing the heterogeneous deformation fields and size-dependent mechanical behavior predicted by a finer scale constitutive description. Finally, in Chapter 6, the models are applied to simulate the deformation behavior of small polycrystalline ensembles. Several grain boundary constitutive descriptions are explored and the response characteristics are analyzed with respect to experimental observations as well as results obtained from discrete dislocation dynamics and alternative nonlocal crystal plasticity theories. Particular attention is focused on how the various grain boundary descriptions serve to either locally concentrate or diffuse deformation heterogeneity as a function of grain size.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli.

PubMed

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-08-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7''-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 A and belongs to space group P3(2)21, with unit-cell parameters a = b = 71.0, c = 125.0 A. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

PubMed Central

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika; Kawakami, Ryouta; Sasaki, Yasuyuki; Hoshino, Takayuki; Ohsawa, Kanju; Nakamura, Akira; Yajima, Shunsuke

2007-01-01

Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3221, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein. PMID:17671368

Crystallization and preliminary X-ray analysis of copper amine oxidase from Escherichia coli K-12.

PubMed

Roh, J H; Suzuki, H; Kumagai, H; Yamashita, M; Azakami, H; Murooka, Y; Mikami, B

1994-05-13

Copper-containing monoamine oxidase (MAO) from Escherichia coli was overproduced in the periplasmic space by expression of the cloned gene. The purified MAO has been crystallized by means of the hanging drop technique using sodium citrate as a precipitant. The crystals belong to the orthorhombic system, space group P2(1)2(1)2(1), with unit cell dimensions of a = 136.1 A, b = 168.4 A and c = 81.6 A. The asymmetric unit contains one molecule of MAO, with a crystal volume per protein mass (Vm) of 2.88 A3/Da and a solvent content of 58% by volume. The crystals diffract X-rays to a resolution limit of at least 2.7 A and are resistant to X-ray radiation damage. They appear to be suitable for X-ray structure analysis.

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum.

PubMed

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J; Ren, Bin

2013-04-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell parameters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution.

Zero-G experiments in two-phase fluids flow regimes

NASA Technical Reports Server (NTRS)

Heppner, D. B.; King, C. D.; Littles, J. W.

1975-01-01

The two-phase flows studied were liquid and gas mixtures in a straight flow channel of circular cross-section. Boundaries between flow regimes have been defined for normogravity on coordinates of gas quality and total mass velocity; and, when combined with boundary expressions having a Froude number term, an analytical model was derived predicting boundary shifts with changes in gravity level. Experiments with air and water were performed, first in the normogravity environment of a ground laboratory and then in 'zero gravity' aboard a KC-135 aircraft flying parabolic trajectories. Data reduction confirmed regime boundary shifts in the direction predicted, although the magnitude was a little less than predicted. Pressure drop measurements showed significant increases for the low gravity condition.

On the Azimuthal Variation of Core Plasma in the Equatorial Magnetosphere

NASA Technical Reports Server (NTRS)

Gallagher, D. L.; Craven, P. D.; Comfort, R. H.; Moore, T. E.

1995-01-01

Previous results of plasmapause position surveys have been synthesized into a description of the underlying global distribution of plasmasphere-like or core plasma densities unique to a steady state magnetosphere. Under these steady conditions, the boundary between high- and low-density regions is taken to represent the boundary between diurnal near-corotation and large-scale circulation streamlines that traverse the entire magnetosphere. Results indicate a boundary that has a pronounced bulge in the dusk sector that is rotated westward and markedly reduced in size at increased levels of geomagnetic activity (and presumably magnetospheric convection). The derived profile is empirical confirmation of an underlying 'tear drop' distribution of core plasma, which is valid only for prolonged steady conditions and is somewhat different from that associated with the simple superposition of sunward flow and corotation, both in its detailed shape and in its varying orientation. Variation away from the tear drop profile suggests that magnetospheric circulation departs from a uniform flow field, having a radial dependence with respect to the Earth that is qualitatively consistent with electrostatic shielding of the convection electric field and which is rotated westward at increased levels of geophysical activity.

Oscillating-Crucible Technique for Silicon Growth

NASA Technical Reports Server (NTRS)

Daud, T.; Dumas, K. A.; Kim, K. M.; Schwuttke, G. H.; Smetana, P.

1984-01-01

Technique yields better mixing of impurities and superior qualiity crystals. Accellerated motion stirs melt which reduces temperature gradients and decreases boundary layer for diffusion of impurities near growing surface. Results better mixing of impurities into melt, decrease in tendency for dendritic growth or cellular growth and crystals with low dislocation density. Applied with success to solution growth and Czochralski growth, resulting in large crystals of superior quality.

Phase-field-crystal model for magnetocrystalline interactions in isotropic ferromagnetic solids

NASA Astrophysics Data System (ADS)

Faghihi, Niloufar; Provatas, Nikolas; Elder, K. R.; Grant, Martin; Karttunen, Mikko

2013-09-01

An isotropic magnetoelastic phase-field-crystal model to study the relation between morphological structure and magnetic properties of pure ferromagnetic solids is introduced. Analytic calculations in two dimensions were used to determine the phase diagram and obtain the relationship between elastic strains and magnetization. Time-dependent numerical simulations in two dimensions were used to demonstrate the effect of grain boundaries on the formation of magnetic domains. It was shown that the grain boundaries act as nucleating sites for domains of reverse magnetization. Finally, we derive a relation for coercivity versus grain misorientation in the isotropic limit.

Linking nanoscale mechanical behavior to bulk physical properties and phenomena of energetic materials

NASA Astrophysics Data System (ADS)

Taw, Matthew R.

The hardness and reduced modulus of aspirin, RDX, HMX, TATB, FOX-7, ADAAF, and TNT/CL-20 were experimentally measured with nanoindentation. These values are reported for the first time using as-received micron sized crystals of energetic materials with no additional mechanical processing. The results for TATB, ADAAF, and TNT/CL-20 are the first of their kind, while comparisons to previous nanoindentation studies on large, carefully grown single crystals of the other energetic materials show that mechanical properties of the larger crystals are comparable to crystals in the condition they are practically used. Measurements on aspirin demonstrate the variation that can occur between nanoindentation indents based on the orientation of a Berkovich tip relative to the surface of the sample. The Hertzian elastic contact model was used to analyze the materials initial yield, or pop-in, behavior. The length, energy, indentation load, and shear stress at initial yielding were used to characterize each material. For the energetic materials the length and energy of the yield excursions were compared to the drop weight sensitivity. This comparison revealed a general trend that more impact sensitive materials have longer, more severe pop-in excursions. Hot spot initiation mechanisms involving crystal defects such as void collapses and dislocation pile-up followed by avalanche are supported by these trends. While this only takes one aspect of impact sensitivity into consideration, if this trend is observed in a larger range of energetics these methods could possibly be used to great advantage in the early stages of new explosives synthesis to obtain an estimation of drop weight sensitivity.

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, fromSphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtainedP3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding usingP3 121/P3 221 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space groupP2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c= 128.1 Å. TheP2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing the cryoconditions. Phasing using the single anomalous diffractionmore » method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Overcoming a hemihedral twinning problem in tetrahydrofolate-dependent O -demethylase crystals by the microseeding method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harada, Ayaka; Sato, Yukari; Kamimura, Naofumi

2016-11-30

A tetrahydrofolate-dependentO-demethylase, LigM, from Sphingobiumsp. SYK-6 was crystallized by the hanging-drop vapour-diffusion method. However, the obtained P3 121 orP3 221 crystals, which diffracted to 2.5–3.3 Å resolution, were hemihedrally twinned. To overcome the twinning problem, microseeding using P3 121/P3 2 21 crystals as microseeds was performed with optimization of the reservoir conditions. As a result, another crystal form was obtained. The newly obtained crystal diffracted to 2.5–3.0 Å resolution and belonged to space group P2 12 12, with unit-cell parametersa= 102.0,b= 117.3,c = 128.1 Å. The P2 12 12 crystals diffracted to better than 2.0 Å resolution after optimizing themore » cryoconditions. Phasing using the single anomalous diffraction method was successful at 3.0 Å resolution with a Pt-derivative crystal. This experience suggested that microseeding is an effective method to overcome the twinning problem, even when twinned crystals are utilized as microseeds.« less

Protein nanocrystallography: growth mechanism and atomic structure of crystals induced by nanotemplates.

PubMed

Pechkova, E; Vasile, F; Spera, R; Fiordoro, S; Nicolini, C

2005-11-01

Protein nanocrystallography, a new technology for crystal growth based on protein nanotemplates, has recently been shown to produce diffracting, stable and radiation-resistant lysozyme crystals. This article, by computing these lysozyme crystals' atomic structures, obtained by the diffraction patterns of microfocused synchrotron radiation, provides a possible mechanism for this increased stability, namely a significant decrease in water content accompanied by a minor but significant alpha-helix increase. These data are shown to be compatible with the circular dichroism and two-dimensional Fourier transform spectra of high-resolution H NMR of proteins dissolved from the same nanotemplate-based crystal versus those from a classical crystal. Finally, evidence for protein direct transfer from the nanotemplate to the drop and the participation of the template proteins in crystal nucleation and growth is provided by high-resolution NMR spectrometry and mass spectrometry. Furthermore, the lysozyme nanotemplate appears stable up to 523 K, as confirmed by a thermal denaturation study using spectropolarimetry. The overall data suggest that heat-proof lysozyme presence in the crystal provides a possible explanation of the crystal's resistance to synchrotron radiation.

The habit of crystals in aggregates: five parameter grain boundary characterization of olivine

NASA Astrophysics Data System (ADS)

Marquardt, K.; Rohrer, G. S.; Morales, L. F. G.; De Graef, M.; Farla, R. J.

2016-12-01

There is growing evidence that the presence of interfaces in rocks, including phase and grain boundaries influence macroscopic properties. To model resulting bulk rock properties and ultimately interpret geophysical signals, such as electrical conductivity, knowledge about the relative abundance of specific grain boundaries is needed. To date, neither the anisotropic frequency of appearance of specific grain boundaries nor its dependence on chemical composition is known for rock forming minerals. Here, we report detailed interface characterizations in olivine, the most abundant phase in the upper mantle. To obtain the area distribution of the geometrically varying interfaces, which is among the most fundamental information, we used electron backscatter diffraction (EBSD) to detect the orientations of over 3x104grains corresponding to more than 6000 mm length of grain boundary separating them. Subsequently we used a stereological approach to determine the grain boundary character distribution (GBCD), defined as the relative areas of grain boundaries of different types, distinguished by their five degrees of freedom (Rohrer et al. 2004). We discuss data collected from different olivine aggregates with chemical compositions ranging from Mg2SiO4 forsterite to Mg1.8Fe0.2SiO4 derived from different synthesis methods. We show that standard EBSD indexing as commonly used is sufficient for many applications, but when characterizing grain boundaries higher accuracy and precision is fundamental and provided by the new dictionary indexing approach, where clean up procedures, that can cause artifacts, are superfluous. The grain boundary planes show a preference for low index planes, which is in agreement with observations on other materials (e.g. MgO, TiO2, SrTiO3, MgAl2O4). We find that the principal crystallographic planes have the lowest energies resulting in crystal habits dominated by (001) planes, followed by (010) and (001) planes and that 90°/[001] (100)(010) are the most frequent grain boundaries, for pure forsterite aggregates. However in the absence of any impurities such as Al or Ca on the grain boundaries the (001) planes dominate the crystal habits. Rohrer G. S. et al. (2004) The distribution of internal interfaces in polycrystals. Zeitschrift für Met. 95, 197-214.

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis.

PubMed

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-03-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 A, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 A.

Two approaches to the rapid screening of crystallization conditions

NASA Technical Reports Server (NTRS)

Mcpherson, Alexander

1992-01-01

A screening procedure is described for estimating conditions under which crystallization will proceed, thus providing a starting point for more careful experiments. The initial procedure uses the experimental setup of McPherson (1982) which supports 24 individual hanging drop experiments for screening variables such as the precipitant type, the pH, the temperature, and the effects of certain additives and which uses about 1 mg of protein. A second approach is proposed (which is rather hypothetical at this stage and needs a larger sample), based on the isoelectric focusing of protein samples on concentration gradients of common precipitating agents. Using this approach, crystals of concanavalin B and canavalin were obtained.

Purification, crystallization and preliminary crystallographic analysis of biotin protein ligase from Staphylococcus aureus

PubMed Central

Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.

2008-01-01

Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065

Measurements of Translational and Rotational Mobilities of Inclusions near a Boundary in TiltedFreely-Suspended Smectic Liquid Crystal Films

NASA Astrophysics Data System (ADS)

Cadenhead, Ian; Green, Adam; Park, Cheol; Glaser, Matt; Maclennan, Joe; Clark, Noel

Freely-suspended liquid crystal films serve as an excellent model system for investigating two-dimensional hydrodynamics, including the study of inclusion mobilities near fixed boundaries. We present experimental measurements using digital video microscopy of the translational and rotational mobilities of smectic islands near the boundary of a rectangular smectic A film a few molecular layers thick. The islands are thicker, circular domains that behave as large particles embedded in the film. Tilting the film causes the islands to drift under gravity. Measuring the diffusion and velocities of these islands allows us to extract the translational and rotational mobilities of the inclusions as a function of distance from the film boundary. The results are compared to Saffman-Delbrück theory using the general approach of Levine and MacKintosh. This work was supported by NASA Grant No. NNX-13AQ81G, and NSF MRSEC Grants No. DMR-0820579 and DMR-1420736.

Effect of interface-dependent crystalline boundary on sub-threshold characteristics in a solution-processed 6,13-bis(triisopropylsilylethynyl)-pentacene thin-film transistor

NASA Astrophysics Data System (ADS)

Kwon, Jin-Hyuk; Kang, In Man; Bae, Jin-Hyuk

2014-03-01

We demonstrate how the sub-threshold characteristics are affected by the density of crystalline domain boundaries directly governed by an organic semiconductor (OSC) - a gate insulator interface in a solution-processed 6,13-bis(triisopropylsilylethynyl)-pentacene (TIPS-pentacene) thin-film transistor (TFT). For generation of an engineered interface, a self assembled monolayer of octadecyltricholorosilane (OTS) was produced between a solution processed TIPS-pentacene film and a silicon dioxide layer. The interfacial charge trap density (Ntrap) deduced from the sub-threshold characteristics was significantly minimized after OTS treatment due to reduced crystal domain boundaries in the TIPS-pentacene film. In addition, the carrier mobility exhibits a value twice as large by OTS treatment. It is found that less crystal domain boundaries in the solution-processed OSC obtained from the engineered interface play an important role in inducing improved sub-threshold characteristics together with increased carrier mobility in organic TFTs.

The potential for the indirect crystal structure verification of methyl glycosides based on acetates' parent structures: GIPAW and solid-state NMR approaches

NASA Astrophysics Data System (ADS)

Szeleszczuk, Łukasz; Gubica, Tomasz; Zimniak, Andrzej; Pisklak, Dariusz M.; Dąbrowska, Kinga; Cyrański, Michał K.; Kańska, Marianna

2017-10-01

A convenient method for the indirect crystal structure verification of methyl glycosides was demonstrated. Single-crystal X-ray diffraction structures for methyl glycoside acetates were deacetylated and subsequently subjected to DFT calculations under periodic boundary conditions. Solid-state NMR spectroscopy served as a guide for calculations. A high level of accuracy of the modelled crystal structures of methyl glycosides was confirmed by comparison with published results of neutron diffraction study using RMSD method.

High Intensity Electro-Magnetic and Ultrasonic Effects on Inorganic Materials Behavior and Processing Held in Raleigh, North Carolina on 17-18 July 1989

DTIC Science & Technology

1990-02-01

constants (KBar): C11 1800 C12 100 C44 260 <G> 430 405 Figure 2. 0 A SIMULATION OF CRYSTAL GROWTH By studying successively larger crystal fragments...Virginia, Charlottesville, VA 22901 Since before 1981, K. Lal and co-workers have studied effects of electr- ic fields on non-conductor crystals ...ultrasound attenuation studies can be made. Attenuation of the ultrasound is usually caused by crystal imperfections (mainly grain boundaries

Studying the field induced breakup of acoustically levitated drops

NASA Astrophysics Data System (ADS)

Warschat, C.; Riedel, J.

2017-10-01

Coulomb fission of charged droplets (The terms drop and droplet are often used synonymous. Throughout this manuscript, to avoid confusion, the terms drop and droplet will be used for liquid spheres with radii in the millimeter range and the micrometer range, respectively. In our experiments, the first correspond to the parent drop while the latter describes the ejected progeny droplets.) is a well-studied natural phenomenon. Controlled droplet fission is already successfully employed in several technological applications. Still, since the occurring surface rupture relies on the exact understanding and description of the liquid gas boundary, some details are still under debate. Most empirical systematic studies observe falling micrometer droplets passing through the electric field inside a plate capacitor. This approach, although easily applicable and reliable, limits the experimental degrees of freedom regarding the observable time and the maximum size of the drops and can only be performed in consecutive individual observations of different subsequent drops. Here we present a novel setup to study the field induced breakup of acoustically levitated drops. The design does not bear any restrictions towards the temporal window of observation, and allows handling of drops of a tunable radius ranging from 10 μm to several millimeters and a real-time monitoring of one single drop. Our comprehensive study includes a time resolved visual inspection, laser shadowgraphy, laser induced fluorescence imaging, and ambient mass spectrometric interrogation of the nascent Taylor cone. The results shown for a millimeter sized drop, previously inaccessible for Coulomb fission experiments, are mostly comparable with previous results for smaller drops. The major difference is the time scale and the threshold potential of the drop rupture. Both values, however, resemble theoretically extrapolations to the larger radius. The technique allows for a systematic study of breakup behavior of drops of different charge, material, and size.

Exocharmic Reactions up Close

ERIC Educational Resources Information Center

Ramette, R. W.

2007-01-01

The exocharmic reactions that can be observed microscopically are discussed. The students can discover the optimal concentration of an acidic lead nitrate solution, so that a crystal of potassium iodide, nudged to the edge of a drop, results in glinting golden hexagons of lead iodide.

Chemical analysis of acoustically levitated drops by Raman spectroscopy.

PubMed

Tuckermann, Rudolf; Puskar, Ljiljana; Zavabeti, Mahta; Sekine, Ryo; McNaughton, Don

2009-07-01

An experimental apparatus combining Raman spectroscopy with acoustic levitation, Raman acoustic levitation spectroscopy (RALS), is investigated in the field of physical and chemical analytics. Whereas acoustic levitation enables the contactless handling of microsized samples, Raman spectroscopy offers the advantage of a noninvasive method without complex sample preparation. After carrying out some systematic tests to probe the sensitivity of the technique to drop size, shape, and position, RALS has been successfully applied in monitoring sample dilution and preconcentration, evaporation, crystallization, an acid-base reaction, and analytes in a surface-enhanced Raman spectroscopy colloidal suspension.

The crystal acceleration effect for cold neutrons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braginetz, Yu. P., E-mail: aiver@pnpi.spb.ru; Berdnikov, Ya. A.; Fedorov, V. V., E-mail: vfedorov@pnpi.spb.ru

A new mechanism of neutron acceleration is discussed and studied experimentally in detail for cold neutrons passing through the accelerated perfect crystal with the energies close to the Bragg one. The effect arises due to the following reason. The crystal refraction index (neutron-crystal interaction potential) for neutron in the vicinity of the Bragg resonance sharply depends on the parameter of deviation from the exact Bragg condition, i.e. on the crystal-neutron relative velocity. Therefore the neutrons enter into accelerated crystal with one neutron-crystal interaction potential and exit with the other. Neutron kinetic energy cannot vary inside the crystal due to itsmore » homogeneity. So after passage through such a crystal neutrons will be accelerated or decelerated because of the different energy change at the entrance and exit crystal boundaries.« less

Advanced Protein Crystallization Facility (APCF)

NASA Technical Reports Server (NTRS)

1998-01-01

This section of the Life and Microgravity Spacelab (LMS) publication contains articles entitled: (1) Crystallization of EGFR-EGF; (2) Crystallization of Apocrustacyanin C1; (3) Crystallization and X-ray Analysis of 5S rRNA and the 5S rRNA Domain A; (4) Growth of Lysozyme Crystals at Low Nucleation Density; (5) Comparative Analysis of Aspartyl tRNA-synthetase and Thaumatin Crystals Grown on Earth and In Microgravity; (6) Lysosome Crystal Growth in the Advanced Protein Crystallization Facility Monitored via Mach-Zehnder Interferometry and CCD Video; (7) Analysis of Thaumatin Crystals Grown on Earth and in Microgravity; (8) Crystallization of the Nucleosome Core Particle; (9) Crystallization of Photosystem I; (10) Mechanism of Membrane Protein Crystal Growth: Bacteriorhodopsin-mixed Micelle Packing at the Consolution Boundary, Stabilized in Microgravity; (11) Crystallization in a Microgravity Environment of CcdB, a Protein Involved in the Control of Cell Death; and (12) Crystallization of Sulfolobus Solfataricus

Human-computer interface

DOEpatents

Anderson, Thomas G.

2004-12-21

The present invention provides a method of human-computer interfacing. Force feedback allows intuitive navigation and control near a boundary between regions in a computer-represented space. For example, the method allows a user to interact with a virtual craft, then push through the windshield of the craft to interact with the virtual world surrounding the craft. As another example, the method allows a user to feel transitions between different control domains of a computer representation of a space. The method can provide for force feedback that increases as a user's locus of interaction moves near a boundary, then perceptibly changes (e.g., abruptly drops or changes direction) when the boundary is traversed.

1. Innovative Relaxor-Based PiezoCrystals: Phase Diagrams, Crystal Growth, Domain Structures and Electric Properties. 2. Piezo- and Ferroelectric Materials Based on Morphotropic Phase Boundary Synthesis, Characterization and Structure - Property Relations

DTIC Science & Technology

2006-03-31

crystals by the flux method and modified Bridgman technique, the growth results were hardly reproducible, and the quality of the crystals was still a serious... growth . 2.2.1.2.2) Solution Bridgman Growth A modified Bridgman method using excess of PbO as solvent was developed for the growth of PZNT91/9 crystals ...of growth , the grown crystal can be rotated via the A120 3 rod which was driven by a motor at a speed of 0 to 30 rmp. Figure 15(b) gives the

When a water drop freezes before it solidifies

NASA Astrophysics Data System (ADS)

Kavehpour, Pirouz; Davis, Stephen; Tavakoli, Faryar

2012-11-01

When a drop of liquid is placed on a substrate which temperature is below the melting point of the liquid, one would expect the drop to solidify instantaneously. However, many liquids, such as water, must be subcooled to solidify below its melting temperature due to homogeneous nucleation's high activation energy. Most of the drop solidification research, particularly for water, phase change is assumed to occur at equilibrium freezing temperature; however, this is not the case. We found that after a certain degree of supercooling, a kinetic based nucleation begins and latent heat of fusion is suddenly liberated, causing an increase in liquid temperature. At the end of this stage, approximately 20% of the drop is crystallized. This phenomenon is known among metallurgists as recalescence. This is followed by a slow solidification process at the melting point. As a water droplet spreads on a cold substrate, its contact line stops just prior to freezing inception from the liquid-solid interface. In this study, we assert that recalescence prior to solidification may be the cause of water's sudden immobility, which results in a fixed contact angle and droplet diameter. In our experiments, the nucleation front initiates from the trijunction point and propagates to the drop volume.

Tunable all-optical photonic crystal channel drop filter for DWDM systems

NASA Astrophysics Data System (ADS)

Habibiyan, H.; Ghafoori-Fard, H.; Rostami, A.

2009-06-01

In this paper we propose a tunable channel drop filter in a two-dimensional photonic crystal, based on coupled-cavity waveguides with alternating small and large defects and an electromagnetically induced transparency phenomenon. By utilizing this phenomenon a narrower linewidth is obtained and also the frequency of the dropped signal becomes tunable. Simulation results show that the proposed filter is suitable for dense wavelength-division multiplexing (DWDM) systems with 0.8 nm channel spacing. Using this novel component, two ultrasmall eight-channel double-sided and single-sided demultiplexers are introduced. The properties of these devices are investigated using the finite-difference time-domain method. For the single-sided device, transmission loss is 1.5 ± 0.5 dB, the cross-talk level between adjacent channels is better than -18 dB and the average 3 dB optical passband is 0.36 nm. Using planar silicon-on-insulator technology, the physical area for the single-sided component is 700 µm2 and for the double-sided component is 575 µm2. To the best of our knowledge, these are the smallest all-optical demultiplexers with this spectral resolution reported to date. Malfunction of the proposed device due to fabrication errors is modeled and its tunable characteristic is demonstrated.

Characterization of the Protein Crystal Growth Apparatus for Microgravity Aboard the Space Station

NASA Technical Reports Server (NTRS)

Kundrot, Craig E.; Roeber, D.; Achari, A.; Stinson, Thomas N. (Technical Monitor)

2002-01-01

We have conducted experiments to determine the equilibration rates of some major precipitants used in protein crystallography aboard the International Space Station (ISS). The solutions were placed in the Protein Crystallization Apparatus for Microgravity (PCAM) which mimic Cryschem sitting drop trays. The trays were placed in cylinders. These cylinders were placed inside a Single locker Thermal Enclosure System (STES), and were activated for different durations during the flight. Bumpers pressed against elastomers seal drops in a deactivated state during pre-flight and prior to transfer to the ISS. Activation occurs while in flight on the ISS by releasing the bumpers allowing the drops to be exposed to the reservoir. PCAM was flown to the ISS on STS 100, Flight 6A, on April 19, 2001. Six series of equilibration experiments were tested for each precipitant with a small amount of Green Fluorescent Protein (GFP). Cylinder 10 was never activated, 7 was activated for 40 days, 8 was activated for 20 days, 9 was activated for 10 days, 11 was activated for 4 days and 12 was activated for 2 days. Upon the return to Earth by STS 104 on July 24,2001 the samples were transferred to Marshall Space Flight Center. The samples were then brought to the lab and the volumes of each sample were measured.

Effect of grain-boundary crystallization on the high-temperature strength of silicon nitride

NASA Technical Reports Server (NTRS)

Pierce, L. A.; Mieskowski, D. M.; Sanders, W. A.

1986-01-01

Si3N4 specimens having the composition 88.7 wt pct Si3N4-4.9 wt pct SiO2-6.4 wt pct Y2O3 were sintered at 2140 C under 25 atm N2 for 1 h and then subjected to a 5 h anneal at 1500 C. Crystallization of an amorphous grain-boundary phase resulted in the formation of Y2Si2O7. The short-time 1370 C strength of this material was compared with that of material of the same composition having no annealing treatment. No change in strength was noted. This is attributed to the refractory nature of the yttrium-rich grain-boundary phase (apparently identical in both glassy and crystalline phases) and the subsequent domination of the failure process by common processing flaws.

Surfactant Effect on the Average Flow Generation Near Curved Interface

NASA Astrophysics Data System (ADS)

Klimenko, Lyudmila; Lyubimov, Dmitry

2018-02-01

The present work is devoted to the average flow generation near curved interface with a surfactant adsorbed on the surface layer. The investigation was carried out for a liquid drop embedded in a viscous liquid with a different density. The liquid flows inside and outside the drop are generated by small amplitude and high frequency vibrations. Surfactant exchange between the drop surface and the surrounding liquid is limited by the process of adsorption-desorption. It was assumed that the surfactant is soluble in the surrounding liquid, but not soluble in the liquid drop. Surrounding liquid and the liquid in the drop are considered incompressible. Normal and shear viscous stresses balance at the interface is performed under the condition that the film thickness of the adsorbed surfactant is negligible. The problem is solved under assumption that the shape of the drop in the presence of adsorbed surfactant remains spherical symmetry. The effective boundary conditions for the tangential velocity jump and shear stress jump, describing the above generation have been obtained by matched asymptotic expansions method. The conditions under which the drop surface can be considered as a quasi-solid are determined. It is shown that in the case of the significant effect of surfactant on the surface tension, the dominant mechanism for the generation is the Schlichting mechanisms under vibrations.

Preferred orientations of laterally grown silicon films over amorphous substrates using the vapor–liquid–solid technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

LeBoeuf, J. L., E-mail: jerome.leboeuf@mail.mcgill.ca; Brodusch, N.; Gauvin, R.

2014-12-28

A novel method has been optimized so that adhesion layers are no longer needed to reliably deposit patterned gold structures on amorphous substrates. Using this technique allows for the fabrication of amorphous oxide templates known as micro-crucibles, which confine a vapor–liquid–solid (VLS) catalyst of nominally pure gold to a specific geometry. Within these confined templates of amorphous materials, faceted silicon crystals have been grown laterally. The novel deposition technique, which enables the nominally pure gold catalyst, involves the undercutting of an initial chromium adhesion layer. Using electron backscatter diffraction it was found that silicon nucleated in these micro-crucibles were 30%more » single crystals, 45% potentially twinned crystals and 25% polycrystals for the experimental conditions used. Single, potentially twinned, and polycrystals all had an aversion to growth with the (1 0 0) surface parallel to the amorphous substrate. Closer analysis of grain boundaries of potentially twinned and polycrystalline samples revealed that the overwhelming majority of them were of the 60° Σ3 coherent twin boundary type. The large amount of coherent twin boundaries present in the grown, two-dimensional silicon crystals suggest that lateral VLS growth occurs very close to thermodynamic equilibrium. It is suggested that free energy fluctuations during growth or cooling, and impurities were the causes for this twinning.« less

Correlative microscopy of the constituents of a dinosaur rib fossil and hosting mudstone: Implications on diagenesis and fossil preservation.

PubMed

Kim, Jung-Kyun; Kwon, Yong-Eun; Lee, Sang-Gil; Kim, Chang-Yeon; Kim, Jin-Gyu; Huh, Min; Lee, Eunji; Kim, Youn-Joong

2017-01-01

We have applied correlative microscopy to identify the key constituents of a dorsal rib fossil from Koreanosaurus boseongensis and its hosting mudstone discovered at the rich fossil site in Boseong, South Korea, to investigate the factors that likely contributed to diagenesis and the preservation of fossil bone. Calcite and illite were the commonly occurring phases in the rib bone, hosting mudstone, and the boundary region in-between. The boundary region may have contributed to bone preservation once it fully formed by acting as a protective shell. Fluorapatite crystals in the rib bone matrix signified diagenetic alteration of the original bioapatite crystals. While calcite predominantly occupied vascular channels and cracks, platy illite crystals widely occupied miniscule pores throughout the bone matrix. Thorough transmission electron microscopy (TEM) study of illite within the bone matrix indicated the solid-state transformation of 1M to 2M without composition change, which was more evident from the lateral variation of 1M to 2M within the same layer. The high level of lattice disordering of 2M illite suggested an early stage of 1M to 2M transformation. Thus, the diagenetic alteration of both apatite and illite crystals within the bone matrix may have increased its overall density, as the preferred orientation of apatite crystals from moderate to strong degrees was evident despite the poor preservation of osteohistological features. The combined effects of rapid burial, formation of a boundary region, and diagenesis of illite and apatite within the bone matrix may have contributed to the rib bone preservation.

Mechanical Twinning and Microstructures in Experimentally Stressed Quartzite

NASA Astrophysics Data System (ADS)

Minor, A.; Sintubin, M.; Wenk, H. R.; Rybacki, E.

2015-12-01

Since Dauphiné twins in quartz have been identified as a stress-related intracrystalline microstructure, several electron backscatter diffraction (EBSD) studies revealed that Dauphiné twins are present in naturally deformed quartz-bearing rocks in a wide range of tectono-metamorphic conditions. EBSD studies on experimentally stressed quartzite showed that crystals with particular crystallographic orientations contain many Dauphiné twin boundaries, while neighboring crystals with different orientations are largely free of twin boundaries. To understand the relationship between stress direction and orientation of Dauphiné twinned quartz crystals, a detailed EBSD study was performed on experimentally stressed quartzite samples and compared with an undeformed reference sample. We stressed 4 cylindrical samples in triaxial compression in a Paterson type gas deformation apparatus at GFZ Potsdam. Experimental conditions were 300MPa confining pressure, 500°C temperature and axial stresses of 145MPa, 250MPa and 460MPa for about 30 hours, resulting in a minor strain <0.04%. EBSD scans were obtained with a Zeiss Evo scanning electron microscope and TSL software at UC Berkeley. The EBSD maps show that Dauphiné twinning is present in the starting material as well as in experimentally stressed samples. Pole figures of the bulk orientation of the reference sample compared with stressed samples show a significant difference regarding the distribution for the r and z directions. The reference sample shows an indistinct maximum for r and z, whereas the stressed samples show a maximum for r poles and a minimum for z poles in the axial stress direction. EBSD scans of the reference and stressed samples were further analyzed manually to identify the orientations of single grains, which are free of twin boundaries and those, which contain twin boundaries. This analysis aims to quantify the relationship of crystal orientation and stress magnitude to initiate mechanical twinning.

Relation between the structural parameters of metallic glasses at the onset crystallization temperatures and threshold values of the effective diffusion coefficients

NASA Astrophysics Data System (ADS)

Tkatch, V. I.; Svyrydova, K. A.; Vasiliev, S. V.; Kovalenko, O. V.

2017-08-01

Using the results of differential scanning calorimetry and X-ray diffractometry, an analysis has been carried out of the initial stages of the eutectic and primary mechanisms of crystallization of a series of metallic glasses based on Fe and Al with the established temperature dependences of the effective diffusion coefficients. Analytical relationships, which relate the volume density of crystallites formed in the glasses at the temperatures of the onset of crystallization with the values of the effective diffusion coefficients at these temperatures have been proposed. It has been established that, in the glasses, the crystallization of which begins at the lower boundary of the threshold values of the effective diffusion coefficients ( 10-20 m2/s), structures are formed with the volume density of crystallites on the order of 1023-1024 m-3 and, at the upper boundary (10-18 m2/s), of the order of 1018 and 1020 m-3 in the glasses that are crystallized via the eutectic and primary mechanisms, respectively. Good agreement between the calculated and experimental estimates indicates that the threshold values of the effective diffusion coefficients are the main factors that determine the structure of glasses at the initial stages of crystallization.

Grain size effect on the electrical and magneto-transport properties of nanosized Pr0.67Sr0.33MnO3

NASA Astrophysics Data System (ADS)

Ng, S. W.; Lim, K. P.; Halim, S. A.; Jumiah, H.

2018-06-01

In this study, nanosized of Pr0.67Sr0.33MnO3 prepared via sol-gel method followed by heat treatment at 600-1000 °C in intervals of 100 °C were synthesized. The structure, surface morphology, electrical, magneto-transport and magnetic properties of the samples were investigated. Rietveld refinements of X-ray diffraction patterns confirm that single phase orthorhombic crystal structure with the space group of Pnma (62) is formed at 600 °C. A strong dependence of surface morphology, electrical and magneto-transport properties on grain size have been observed in this manganites system. Both grain size and crystallite size are increases with the sintering temperature due to the congregation effect. Upon increasing grain size, the paramagnetic-ferromagnetic transition temperature increases from 278 K to 295 K. The resistivity drops and the metal-insulator transition temperature shifted from 184 K to 248 K with increases of grain size due to the grain growth and reduction of grain boundary. Below metal-insulator transition temperature, the samples fit well to the combination of resistivity due to grain or domain boundaries, electron-electron scattering process and electron-phonon interaction. The resistivity data above the metal-insulator transition temperature is well described using small polaron hopping and variable range hopping models. It is found that the negative magnetoresistance also increases with larger grain size where the highest %MR of - 26% can be observed for sample sintered at 1000 °C (245 nm).

Sum-frequency nonlinear Cherenkov radiation generated on the boundary of bulk medium crystal.

PubMed

Wang, Xiaojing; Cao, Jianjun; Zhao, Xiaohui; Zheng, Yuanlin; Ren, Huaijin; Deng, Xuewei; Chen, Xianfeng

2015-12-14

We demonstrated experimentally a method to generate the sum-frequency Nonlinear Cherenkov radiation (NCR) on the boundary of bulk medium by using two synchronized laser beam with wavelength of 1300 nm and 800 nm. It is also an evidence that the polarization wave is always confined to the boundary. Critical conditions of surface sum-frequency NCR under normal and anomalous dispersion condition is discussed.

Hypersolidus geothermal energy from the moving freeze-fracture-flow boundary

NASA Astrophysics Data System (ADS)

Carrigan, Charles; Eichelberger, John; Sigmundsson, Freysteinn; Papale, Paolo; Sun, Yunwei

2014-05-01

Rhyolitic magmas at low pressure undergo much of their crystallization over a small temperature interval just above the solidus. This hypersolidus material has a high energy density and effective heat capacity because of stored heat of crystallization, yet may sustain fractures and therefore admit heat exchange with fluids because of its interlocking crystal framework. Rhyolitic magmas emplaced near the liquidus should at first cool rapidly, owing to internal convection, modest crystallization with declining temperature, and extreme temperature gradients at their boundaries. However, once the solidus is approached the rapid rise in effective heat capacity should result in low temperature gradients and rates of heat flow within the bodies. They are suspended for a time in the hypersolidus state. Prodigious quantities of heat can be released from these thermal masses by hydrothermal systems, natural or perhaps stimulated, fracturing their way inward from the margins. The fracture front drives the solidus isotherm ahead of it. Heat of crystallization in front of the advancing solidus is transferred across the thin, moving boundary zone to the external fluid, which advects it away. Once the material is below (outboard of) the solidus, it behaves as normal rock and cools rapidly, having a heat capacity only about 20% that of water. Variations on this theme were published by Lister (1974) for mid-ocean ridges, Hardee (1980) for lava lakes, and Bjornsson et al (1982) for Grimsvotn and Heimaey, who cited possible geothermal energy exploitiation. This scenario is consistent with a number of observations: 1. The geophysical rarity of imaging mostly liquid magma in the shallow crust, despite common petrologic evidence that silicic magma has undergone shallow storage. 2. More common imaging of "partial melt" volumes, whose inferred properties suggest some, but not dominant proportion of melt. 3. Evidence that pure-melt rhyolitic eruptions may have drained relatively shallow hypersolidus plutons. 4. Downward propagating thin conductive boundary zone observed in repeated coring of Kilauea Iki lava lake, Hawaii 5. Record enthalpy flow and temperature during flow-testing of Iceland Deep Drilling Project (IDDP)-1 in Krafla Caldera by Landsvirkjun Co. Production came from a 2.1-km-deep 500oC "magma" contact zone, from the vicinity of which fresh rhyolite glass-bearing felsite and crystal-poor rhyolite glass fragments were recovered. The hypothesis of a moving freeze-fracture-flow boundary raises the possibility of ultra-high-temperature, natural or engineered geothermal systems in volcanic areas. We believe that this prospect, as well as the benefit to understanding volcanic hazards at restless calderas, gives merit to further exploration of the hypersolidus regime beneath Krafla Caldera.

Graded Interface Models for more accurate Determination of van der Waals-London Dispersion Interactions across Grain Boundaries

DOE Office of Scientific and Technical Information (OSTI.GOV)

van Benthem, Klaus; Tan, Guolong; French, Roger H

2006-01-01

Attractive van der Waals V London dispersion interactions between two half crystals arise from local physical property gradients within the interface layer separating the crystals. Hamaker coefficients and London dispersion energies were quantitatively determined for 5 and near- 13 grain boundaries in SrTiO3 by analysis of spatially resolved valence electron energy-loss spectroscopy (VEELS) data. From the experimental data, local complex dielectric functions were determined, from which optical properties can be locally analysed. Both local electronic structures and optical properties revealed gradients within the grain boundary cores of both investigated interfaces. The obtained results show that even in the presence ofmore » atomically structured grain boundary cores with widths of less than 1 nm, optical properties have to be represented with gradual changes across the grain boundary structures to quantitatively reproduce accurate van der Waals V London dispersion interactions. London dispersion energies of the order of 10% of the apparent interface energies of SrTiO3 were observed, demonstrating their significance in the grain boundary formation process. The application of different models to represent optical property gradients shows that long-range van der Waals V London dispersion interactions scale significantly with local, i.e atomic length scale property variations.« less

Orientation dependence of the stress rupture properties of Nickel-base superalloy single crystals

NASA Technical Reports Server (NTRS)

Mackay, R. A.

1981-01-01

The influence of orientation of the stress rupture behavior of Mar-M247 single crystals was studied. Stress rupture tests were performed at 724 MPa and 774 C where the effect of anisotropy is prominent. The mechanical behavior of the single crystals was rationalized on the basis of the Schmid factors for the operative slip systems and the lattice rotations which the crystals underwent during deformation. The stress rupture lives were found to be greatly influenced by the lattice rotations required to produce intersecting slip, because steady-state creep does not begin until after the onset of intersecting slip. Crystals which required large rotations to become oriented for intersecting slip exhibited a large primary creep strain, a large effective stress level at the onset of steady-state creep, and consequently a short stress rupture life. A unified analysis was attained for the stress rupture behavior of the Mar-M247 single crystals tested in this study at 774 C and that of the Mar-M200 single crystals tested in a prior study at 760 C. In this analysis, the standard 001-011-111 stereographic triangle was divided into several regions of crystallographic orientation which were rank ordered according to stress rupture life for this temperature regime. This plot indicates that those crystals having orientations within about 25 deg of the 001 exhibited significantly longer lives when their orientations were closer to the 001-011 boundary of the stereographic triangle than to the 001-111 boundary.

Crystallization and preliminary X-ray analysis of 2,3-diketo-5-methylthiopentyl-1-phosphate enolase from Bacillus subtilis

PubMed Central

Tamura, Haruka; Ashida, Hiroki; Koga, Shogo; Saito, Yohtaro; Yadani, Tomonori; Kai, Yasushi; Inoue, Tsuyoshi; Yokota, Akiho; Matsumura, Hiroyoshi

2009-01-01

2,3-Diketo-5-methylthiopentyl-1-phosphate enolase (DK-MTP-1P enolase) from Bacillus subtilis was crystallized using the hanging-drop vapour-diffusion method. Crystals grew using PEG 3350 as the precipitant at 293 K. The crystals diffracted to 2.3 Å resolution at 100 K using synchrotron radiation and were found to belong to the monoclinic space group P21, with unit-cell parameters a = 79.3, b = 91.5, c = 107.0 Å, β = 90.8°. The asymmetric unit contained four molecules of DK-MTP-1P enolase, with a V M value of 2.2 Å3 Da−1 and a solvent content of 43%. PMID:19194007

Purification, crystallization and preliminary X-ray diffraction of the C-terminal bromodomain from human BRD2

PubMed Central

Umehara, Takashi; Wakamori, Masatoshi; Tanaka, Akiko; Padmanabhan, Balasundaram; Yokoyama, Shigeyuki

2007-01-01

BRD2 is a bromodomain-containing BET-family protein that associates with acetylated histones throughout the cell cycle. Although the tertiary structures of the bromodomains involved in histone acetyl transfer are already known, the structures of the BET-type bromodomains, which are required for tight association with acetylated chromatin, are poorly understood. Here, the expression, purification and crystallization of the C-terminal bromodomain of human BRD2 are reported. The protein was crystallized by the sitting-drop vapour-diffusion method in the orthorhombic space group P21212, with unit-cell parameters a = 71.78, b = 52.60, c = 32.06 Å and one molecule per asymmetric unit. The crystal diffracted beyond 1.80 Å resolution using synchrotron radiation. PMID:17620725

Crystallization and preliminary X-ray diffraction analysis of a chitin-binding domain of hyperthermophilic chitinase from Pyrococcus furiosus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakamura, Tsutomu; Ishikawa, Kazuhiko; Hagihara, Yoshihisa

The expression, purification and preliminary X-ray diffraction studies of a chitin-binding domain of the chitinase from P. furiosus are reported. The crystallization and preliminary X-ray diffraction analysis of the chitin-binding domain of chitinase from a hyperthermophilic archaeon, Pyrococcus furiosus, are reported. The recombinant protein was prepared using an Escherichia coli overexpression system and was crystallized by the hanging-drop vapour-diffusion method. An X-ray diffraction data set was collected to 1.70 Å resolution. The crystal belonged to space group P4{sub 3}2{sub 1}2 or P4{sub 1}2{sub 1}2. The unit-cell parameters were determined to be a = b = 48.8, c = 85.0 Å.

Purification, crystallization and preliminary X-ray diffraction studies of d-tagatose 3-epimerase from Pseudomonas cichorii

PubMed Central

Yoshida, Hiromi; Yamada, Mitsugu; Nishitani, Takeyori; Takada, Goro; Izumori, Ken; Kamitori, Shigehiro

2007-01-01

d-Tagatose 3-epimerase (D-TE) from Pseudomonas cichorii catalyzes the epimerization of various ketohexoses at the C3 position. The epimerization of d-­psicose has not been reported with epimerases other than P. cichorii D-­TE and d-psicose 3-epimerase from Agrobacterium tumefaciens. Recombinant P. cichorii D-TE has been purified and crystallized. Crystals of P. cichorii D-TE were obtained by the sitting-drop method at room temperature. The crystal belongs to the monoclinic space group P21, with unit-cell parameters a = 76.80, b = 94.92, c = 91.73 Å, β = 102.82°. Diffraction data were collected to 2.5 Å resolution. The asymmetric unit is expected to contain four molecules. PMID:17277456

Studies of Nucleation, Growth, Specific Heat, and Viscosity of Undercooled Melts of Quasicrystals and Polytetrahedral-Phase-Forming Alloys

NASA Technical Reports Server (NTRS)

Kelton, K. F.; Croat, T. K.; Gangopadhyay, A.; Holland-Moritz, D.; Hyers, Robert W.; Rathz, Thomas J.; Robinson, Michael B.; Rogers, Jan R.

2001-01-01

Undercooling experiments and thermal physical property measurements of metallic alloys on the International Space Station (ISS) are planned. This recently-funded research focuses on fundamental issues of the formation and structure of highly-ordered non-crystallographic phases (quasicrystals) and related crystal phases (crystal approximants), and the connections between the atomic structures of these phases and those of liquids and glasses. It extends studies made previously by us of the composition dependence of crystal nucleation processes in silicate and metallic glasses, to the case of nucleation from the liquid phase. Motivating results from rf-levitation and drop-tube measurements of the undercooling of Ti/Zr-based liquids that form quasicrystals and crystal approximants are discussed. Preliminary measurements by electrostatic levitation (ESL) are presented.

Crystallization and preliminary crystallographic analysis of human common-type acylphosphatase

PubMed Central

Yeung, Rachel C. Y.; Lam, Sonia Y.; Wong, Kam-Bo

2006-01-01

Human acylphosphatase, an 11 kDa enzyme that catalyzes the hydrolysis of carboxyl phosphate bonds, has been studied extensively as a model system for amyloid-fibril formation. However, the structure is still not known of any isoform of human acylphosphatase. Here, the crystallization and preliminary X-­ray diffraction data analysis of human common-type acylphosphatase are reported. Crystals of human common-type acylphosphatase have been grown by the sitting-drop vapour-diffusion method at 289 K using polyethylene glycol 4000 as precipitant. Diffraction data were collected to 1.45 Å resolution at 100 K. The crystals belong to space group P212121, with unit-cell parameters a = 42.58, b = 47.23, c = 57.26 Å. PMID:16511269

On the autonomous motion of active drops or bubbles.

PubMed

Ryazantsev, Yuri S; Velarde, Manuel G; Guzman, Eduardo; Rubio, Ramón G; Ortega, Francisco; Montoya, Juan-Jose

2018-05-19

Thermo-capillary stresses on the surface of a drop can be the result of a non-isothermal surface chemical conversion of a reactant dissolved in the host fluid. The strength of heat production (with e.g. absorption) on the surface is ruled by the diffusion of the reactant and depends on the state of motion of the drop. Such thermo-capillary stresses can provoke the motion of the drop or its motionless state in the presence of an external body force. If in the balance of forces, including indeed viscous drag, the net resultant force vanishes there is the possibility of autonomous motion with constant velocity of the drop. Focusing on drops with radii in the millimeter range provided here is a quantitative study of the possibility of such autonomous motion when the drop, considered as active unit, is seat of endo- or exo-thermic reactive processes that dominate its motion. The framework is restricted to Stokes flows in the hydrodynamics, negligible heat Peclet number while the solute Peclet number is considered very high. A boundary layer approximation is used in the description of reactant diffusion. Those processes eventually end up in the action being expressed by surface tension gradients and the Marangoni effect. Explicit expressions of the force acting on the drop and the velocity fields inside and outside the drop are provided. Some significant particular cases are discussed to illustrate the usefulness of the theory. Copyright © 2018. Published by Elsevier Inc.

A simplified counter diffusion method combined with a 1D simulation program for optimizing crystallization conditions.

PubMed

Tanaka, Hiroaki; Inaka, Koji; Sugiyama, Shigeru; Takahashi, Sachiko; Sano, Satoshi; Sato, Masaru; Yoshitomi, Susumu

2004-01-01

We developed a new protein crystallization method has been developed using a simplified counter-diffusion method for optimizing crystallization condition. It is composed of only a single capillary, the gel in the silicon tube and the screw-top test tube, which are readily available in the laboratory. The one capillary can continuously scan a wide range of crystallization conditions (combination of the concentrations of the precipitant and the protein) unless crystallization occurs, which means that it corresponds to many drops in the vapor-diffusion method. The amount of the precipitant and the protein solutions can be much less than in conventional methods. In this study, lysozyme and alpha-amylase were used as model proteins for demonstrating the efficiency of this method. In addition, one-dimensional (1-D) simulations of the crystal growth were performed based on the 1-D diffusion model. The optimized conditions can be applied to the initial crystallization conditions for both other counter-diffusion methods with the Granada Crystallization Box (GCB) and for the vapor-diffusion method after some modification.

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708

PubMed Central

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-01-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 Å resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P212121, with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 Å. The Matthews coefficient (V M = 1.76 Å3 Da−1) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit. PMID:19923737

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Purification, crystallization and preliminary X-ray diffraction study of human ribosomal protein L10 core domain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishimura, Mitsuhiro; Protein Research Group, RIKEN Yokohama Institute, RIKEN Genomic Sciences Center, 1-7-22 Suehiro-cho, Tsurumi, Yokohama 230-0045; Kaminishi, Tatsuya

2007-11-01

A truncated variant of human ribosomal protien L10 was prepared and crystallized. Diffraction data were collected to 2.5 Å resolution. Eukaryotic ribosomal protein L10 is an essential component of the large ribosomal subunit, which organizes the architecture of the aminoacyl-tRNA binding site. The human L10 protein is also called the QM protein and consists of 214 amino-acid residues. For crystallization, the L10 core domain (L10CD, Phe34–Glu182) was recombinantly expressed in Escherichia coli and purified to homogeneity. A hexagonal crystal of L10CD was obtained by the sitting-drop vapour-diffusion method. The L10CD crystal diffracted to 2.5 Å resolution and belongs to spacemore » group P3{sub 1}21 or P3{sub 2}21.« less

In Situ μGISAXS: II. Thaumatin Crystal Growth Kinetic

PubMed Central

Gebhardt, Ronald; Pechkova, Eugenia; Riekel, Christian; Nicolini, Claudio

2010-01-01

The formation of thaumatin crystals by Langmuir-Blodgett (LB) film nanotemplates was studied by the hanging-drop technique in a flow-through cell by synchrotron radiation micrograzing-incidence small-angle x-ray scattering. The kinetics of crystallization was measured directly on the interface of the LB film crystallization nanotemplate. The evolution of the micrograzing-incidence small-angle x-ray scattering patterns suggests that the increase in intensity in the Yoneda region is due to protein incorporation into the LB film. The intensity variation suggests several steps, which were modeled by system dynamics based on first-order differential equations. The kinetic data can be described by two processes that take place on the LB film, a first, fast, process, attributed to the crystal growth and its detachment from the LB film, and a second, slower process, attributed to an unordered association and conversion of protein on the LB film. PMID:20713011

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin.

PubMed

Jagadeesan, G; Malathy, P; Gunasekaran, K; Harikrishna Etti, S; Aravindhan, S

2014-11-01

Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to the trigonal system P3₁21, with unit-cell parameters a=b=55.64, c=153.38 Å, β=120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.

Crystallization of the Na+-translocating NADH:quinone oxidoreductase from Vibrio cholerae

PubMed Central

Casutt, Marco S.; Wendelspiess, Severin; Steuber, Julia; Fritz, Günter

2010-01-01

The Na+-translocating NADH:quinone oxidoreductase (Na+-NQR) from the human pathogen Vibrio cholerae couples the exergonic oxidation of NADH by membrane-bound quinone to Na+ translocation across the membrane. Na+-NQR consists of six different subunits (NqrA–NqrF) and contains a [2Fe–2S] cluster, a noncovalently bound FAD, a noncovalently bound riboflavin, two covalently bound FMNs and potentially Q8 as cofactors. Initial crystallization of the entire Na+-NQR complex was achieved by the sitting-drop method using a nanolitre dispenser. Optimization of the crystallization conditions yielded flat yellow-coloured crystals with dimensions of up to 200 × 80 × 20 µm. The crystals diffracted to 4.0 Å resolution and belonged to space group P21, with unit-cell parameters a = 94, b = 146, c = 105 Å, α = γ = 90, β = 111°. PMID:21139223

Purification, crystallization and preliminary X-ray diffraction studies of UDP-N-acetylglucosamine pyrophosphorylase from Candida albicans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maruyama, Daisuke; Nishitani, Yuichi; Nonaka, Tsuyoshi

2006-12-01

UDP-N-acetylglucosamine pyrophosphorylase was purified and crystallized and X-ray diffraction data were collected to 2.3 Å resolution. UDP-N-acetylglucosamine pyrophosphorylase (UAP) is an essential enzyme in the synthesis of UDP-N-acetylglucosamine. UAP from Candida albicans was purified and crystallized by the sitting-drop vapour-diffusion method. The crystals of the substrate and product complexes both diffract X-rays to beyond 2.3 Å resolution using synchrotron radiation. The crystals of the substrate complex belong to the triclinic space group P1, with unit-cell parameters a = 47.77, b = 62.89, c = 90.60 Å, α = 90.01, β = 97.72, γ = 92.88°, whereas those of the productmore » complex belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 61.95, b = 90.87, c = 94.88 Å.« less

Expression, purification, crystallization and preliminary X-ray analysis of tannase from Lactobacillus plantarum

PubMed Central

Wu, Mingbo; Peng, Xiaohong; Wen, Hua; Wang, Qin; Chen, Qianming; McKinstry, William J.; Ren, Bin

2013-01-01

Tannase catalyses the hydrolysis of the galloyl ester bond of tannins to release gallic acid. It belongs to the serine esterases and has wide applications in the food, feed, beverage, pharmaceutical and chemical industries. The tannase from Lactobacillus plantarum was cloned, expressed and purified. The protein was crystallized by the sitting-drop vapour-diffusion method with microseeding. The crystals belonged to space group P1, with unit-cell paramters a = 46.5, b = 62.8, c = 83.8 Å, α = 70.4, β = 86.0, γ = 79.4°. Although the enzyme exists mainly as a monomer in solution, it forms a dimer in the asymmetric unit of the crystal. The crystals diffracted to beyond 1.60 Å resolution using synchrotron radiation and a complete data set was collected to 1.65 Å resolution. PMID:23545659

Crystallization and preliminary X-ray analysis of CTP:phosphoethanolamine cytidylyltransferase (ECT) from Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ohtsuka, Jun; Nagata, Koji; Lee, Woo Cheol

2006-10-01

CTP:phosphoethanolamine cytidylyltransferase from S. cerevisiae has been expressed, purified and crystallized. CTP:phosphoethanolamine cytidylyltransferase (ECT) is the enzyme that catalyzes the conversion of phosphoethanolamine to CDP-ethanolamine in the phosphatidylethanolamine-biosynthetic pathway (Kennedy pathway). ECT from Saccharomyces cerevisiae was crystallized by the sitting-drop vapour-diffusion method using PEG 4000 as precipitant. The crystals diffracted X-rays from a synchrotron-radiation source to 1.88 Å resolution. The space group was assigned as primitive tetragonal, P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = b = 66.3, c = 150.8 Å. The crystals contain one ECT molecule in the asymmetric unit (V{sub M} = 2.2more » Å{sup 3} Da{sup −1}), with a solvent content of 43%.« less

Crystallization and X-ray analysis of the salmon-egg lectin SEL24K.

PubMed

Murata, Kenji; Fisher, Andrew J; Hedrick, Jerry L

2007-05-01

The 24 kDa egg lectin of Chinook salmon (Oncorhynchus tshawytscha) is released from the egg during the cortical reaction. The lectin functions in blocking polyspermy during the fertilization process. The egg lectin was purified by affinity chromatography from salmon eggs and crystallized by the hanging-drop vapor-diffusion method using 15/4 EO/OH (pentaerythritol ethoxylate) as a precipitant. The crystal diffracted synchrotron-radiation X-rays to 1.63 A resolution. The crystal belongs to the monoclinic space group P2(1), with unit-cell parameters a = 93.0, b = 73.6, c = 113.6 A, alpha = 90, beta = 92.82, gamma = 90 degrees. The crystal is likely to contain eight molecules in the asymmetric unit (V(M) = 2.3 A3 Da(-1)), corresponding to a solvent content of 45.5%. A self-rotation function suggests an arrangement with 222 point symmetry within the asymmetric unit.

Transient integral boundary layer method to calculate the translesional pressure drop and the fractional flow reserve in myocardial bridges.

PubMed

Bernhard, Stefan; Möhlenkamp, Stefan; Tilgner, Andreas

2006-06-21

The pressure drop-flow relations in myocardial bridges and the assessment of vascular heart disease via fractional flow reserve (FFR) have motivated many researchers the last decades. The aim of this study is to simulate several clinical conditions present in myocardial bridges to determine the flow reserve and consequently the clinical relevance of the disease. From a fluid mechanical point of view the pathophysiological situation in myocardial bridges involves fluid flow in a time dependent flow geometry, caused by contracting cardiac muscles overlying an intramural segment of the coronary artery. These flows mostly involve flow separation and secondary motions, which are difficult to calculate and analyse. Because a three dimensional simulation of the haemodynamic conditions in myocardial bridges in a network of coronary arteries is time-consuming, we present a boundary layer model for the calculation of the pressure drop and flow separation. The approach is based on the assumption that the flow can be sufficiently well described by the interaction of an inviscid core and a viscous boundary layer. Under the assumption that the idealised flow through a constriction is given by near-equilibrium velocity profiles of the Falkner-Skan-Cooke (FSC) family, the evolution of the boundary layer is obtained by the simultaneous solution of the Falkner-Skan equation and the transient von-Kármán integral momentum equation. The model was used to investigate the relative importance of several physical parameters present in myocardial bridges. Results have been obtained for steady and unsteady flow through vessels with 0 - 85% diameter stenosis. We compare two clinical relevant cases of a myocardial bridge in the middle segment of the left anterior descending coronary artery (LAD). The pressure derived FFR of fixed and dynamic lesions has shown that the flow is less affected in the dynamic case, because the distal pressure partially recovers during re-opening of the vessel in diastole. We have further calculated the wall shear stress (WSS) distributions in addition to the location and length of the flow reversal zones in dependence on the severity of the disease. The described boundary layer method can be used to simulate frictional forces and wall shear stresses in the entrance region of vessels. Earlier models are supplemented by the viscous effects in a quasi three-dimensional vessel geometry with a prescribed wall motion. The results indicate that the translesional pressure drop and the mean FFR compares favourably to clinical findings in the literature. We have further shown that the mean FFR under the assumption of Hagen-Poiseuille flow is overestimated in developing flow conditions.

Transient integral boundary layer method to calculate the translesional pressure drop and the fractional flow reserve in myocardial bridges

PubMed Central

Bernhard, Stefan; Möhlenkamp, Stefan; Tilgner, Andreas

2006-01-01

Background The pressure drop – flow relations in myocardial bridges and the assessment of vascular heart disease via fractional flow reserve (FFR) have motivated many researchers the last decades. The aim of this study is to simulate several clinical conditions present in myocardial bridges to determine the flow reserve and consequently the clinical relevance of the disease. From a fluid mechanical point of view the pathophysiological situation in myocardial bridges involves fluid flow in a time dependent flow geometry, caused by contracting cardiac muscles overlying an intramural segment of the coronary artery. These flows mostly involve flow separation and secondary motions, which are difficult to calculate and analyse. Methods Because a three dimensional simulation of the haemodynamic conditions in myocardial bridges in a network of coronary arteries is time-consuming, we present a boundary layer model for the calculation of the pressure drop and flow separation. The approach is based on the assumption that the flow can be sufficiently well described by the interaction of an inviscid core and a viscous boundary layer. Under the assumption that the idealised flow through a constriction is given by near-equilibrium velocity profiles of the Falkner-Skan-Cooke (FSC) family, the evolution of the boundary layer is obtained by the simultaneous solution of the Falkner-Skan equation and the transient von-Kármán integral momentum equation. Results The model was used to investigate the relative importance of several physical parameters present in myocardial bridges. Results have been obtained for steady and unsteady flow through vessels with 0 – 85% diameter stenosis. We compare two clinical relevant cases of a myocardial bridge in the middle segment of the left anterior descending coronary artery (LAD). The pressure derived FFR of fixed and dynamic lesions has shown that the flow is less affected in the dynamic case, because the distal pressure partially recovers during re-opening of the vessel in diastole. We have further calculated the wall shear stress (WSS) distributions in addition to the location and length of the flow reversal zones in dependence on the severity of the disease. Conclusion The described boundary layer method can be used to simulate frictional forces and wall shear stresses in the entrance region of vessels. Earlier models are supplemented by the viscous effects in a quasi three-dimensional vessel geometry with a prescribed wall motion. The results indicate that the translesional pressure drop and the mean FFR compares favourably to clinical findings in the literature. We have further shown that the mean FFR under the assumption of Hagen-Poiseuille flow is overestimated in developing flow conditions. PMID:16790065

Air cushioning in drop impact

NASA Astrophysics Data System (ADS)

de Ruiter, Jolet; Oh, Jung; van den Ende, Dirk; Mugele, Frieder

2011-11-01

Liquid drops impacting on solid surfaces deform under the influence of the ambient gas that needs to be squeezed out before a true solid-liquid contact can be established. We demonstrate experimentally the existence of this theoretically predicted air layer and follow its evolution with time for moderate impact speeds (We ~ 1 ... 10) using reflection interference microscopy with a thickness resolution of approximately 10nm. For a wide range of fluid properties (ρ, γ, η) we find a very robust generic behavior that includes the predicted formation of a dimple in the center of the drop with a local minimum of the air film thickness at its boundary. Depending on We as well as the fluid properties, a skating layer of more or less constant thickness as well as a second local minimum of the air film thickness farther away from the drop center develop in time. Eventually, solid-liquid contact is generated via random nucleation event. The nucleation spot spreads across the drop-substrate interface within a few milliseconds. This process can lead to the entrapment of an air bubble.

Equilibrium Kinetics Studies and Crystallization Aboard the International Space Station (ISS) Using the Protein Crystallization Apparatus for Microgravity (PCAM)

NASA Technical Reports Server (NTRS)

Achari, Aniruddha; Roeber, Dana F.; Barnes, Cindy L.; Kundrot, Craig E.; Stinson, Thomas N. (Technical Monitor)

2002-01-01

Protein Crystallization Apparatus in Microgravity (PCAM) trays have been used in Shuttle missions to crystallize proteins in a microgravity environment. The crystallization experiments are 'sitting drops' similar to that in Cryschem trays, but the reservoir solution is soaked in a wick. From early 2001, crystallization experiments are conducted on the International Space Station using mission durations of months rather than two weeks on previous shuttle missions. Experiments were set up in April 2001 on Flight 6A to characterize the time crystallization experiments will take to reach equilibrium in a microgravity environment using salts, polyethylene glycols and an organic solvent as precipitants. The experiments were set up to gather data for a series of days of activation with different droplet volumes and precipitants. The experimental set up on ISS and results of this study will be presented. These results will help future users of PCAM to choose precipitants to optimize crystallization conditions for their target macromolecules for a particular mission with known mission duration. Changes in crystal morphology and size between the ground and space grown crystals of a protein and a protein -DNA complex flown on the same mission will also be presented.

Near-liquidus growth of feldspar spherulites in trachytic melts: 3D morphologies and implications in crystallization mechanisms

NASA Astrophysics Data System (ADS)

Arzilli, Fabio; Mancini, Lucia; Voltolini, Marco; Cicconi, Maria Rita; Mohammadi, Sara; Giuli, Gabriele; Mainprice, David; Paris, Eleonora; Barou, Fabrice; Carroll, Michael R.

2015-02-01

The nucleation and growth processes of spherulitic alkali feldspar have been investigated in this study through X-ray microtomography and electron backscatter diffraction (EBSD) data. Here we present the first data on Shape Preferred Orientation (SPO) and Crystal Preferred Orientation (CPO) of alkali feldspar within spherulites. The analysis of synchrotron X-ray microtomography and EBSD datasets allowed us to study the morphometric characteristics of spherulites in trachytic melts in quantitative fashion, highlighting the three-dimensional shape, preferred orientation, branching of lamellae and crystal twinning, providing insights about the nucleation mechanism involved in the crystallization of the spherulites. The nucleation starts with a heterogeneous nucleus (pre-existing crystal or bubble) and subsequently it evolves forming "bow tie" morphologies, reaching radially spherulitic shapes in few hours. Since each lamella within spherulite is also twinned, these synthetic spherulites cannot be considered as single nuclei but crystal aggregates originated by heterogeneous nucleation. A twin boundary may have a lower energy than general crystal-crystal boundaries and many of the twinned grains show evidence of strong local bending which, combined with twin plane, creates local sites for heterogeneous nucleation. This study shows that the growth rates of the lamellae (10- 6-10- 7 cm/s) in spherulites are either similar or slightly higher than that for single crystals by up to one order of magnitude. Furthermore, the highest volumetric growth rates (10- 11-10- 12 cm3/s) show that the alkali feldspar within spherulites can grow fast reaching a volumetric size of ~ 10 μm3 in 1 s.

Acousto-optic control of internal acoustic reflection in tellurium dioxide crystal in case of strong elastic energy walkoff [Invited].

PubMed

Voloshinov, Vitaly; Polikarpova, Nataliya; Ivanova, Polina; Khorkin, Vladimir

2018-04-01

Peculiar cases of acoustic wave propagation and reflection may be observed in strongly anisotropic acousto-optical crystals. A tellurium dioxide crystal serves as a prime example of such media, since it possesses record indexes of acoustic anisotropy. We studied one of the unusual scenarios of acoustic incidence and reflection from a free crystal-vacuum boundary in paratellurite. The directions of the acoustic waves in the (001) plane of the crystal were determined, and their basic characteristics were calculated. The carried-out acousto-optic experiment at the wavelength of light 532 nm and the acoustic frequency 73 MHz confirmed the theoretical predictions. The effects examined in the paper include the acoustic wave propagation with the record walkoff angle 74°. We also observed the incidence of the wave on the boundary at the angle exceeding 90°. Finally, we registered the close-to-back reflection of acoustic energy following the incidence. One of the stunning aspects is the distribution of energy between the incident and the back-reflected wave. The unusual features of the acoustic wave reflections pointed out in the paper are valuable for their possible applications in acousto-optic devices.

Engineering materials properties and process technologies for electronic and energy applications

NASA Astrophysics Data System (ADS)

Hailey, Anna Kathryn

In this thesis, we pushed the boundaries of knowledge toward exciting new alternatives in the fields of electronic materials and energy. In Part 1, we focused on organic semiconductors, assessing how disorder on different length scales impacts the electrical properties in organic thin-film transistors (OTFTs). We first explored the effect of disorder at the molecular scale due to the coexistence of isomers in thin films. By blending fractional quantities of syn and anti isomers of triethylsilylethynyl anthradithiophene (TES ADT), we found that the electrical properties of devices comprising the anti isomer plummet to that of syn after the addition of only 10% syn. Through single-crystal computational analysis, we determined that the addition of syn disorders the two-dimensional electronic coupling between anti molecules, thereby increasing charge trapping and decreasing mobilities in OTFTs with increasing syn concentrations in the active layers. We also elucidated the impact of disorder stemming from boundaries between crystalline superstructures in polycrystalline thin films. By measuring the electrical characteristics of OTFTs across interspherulite boundaries (ISBs) in TES ADT and rubrene thin films, we found the energy barriers for charge transport across ISBs to be more akin to those found across the boundaries between polymer crystallites than between conventional molecular-semiconductor grains. In contrast to sharp, creviced grain boundaries, ISBs presumably comprise trapped molecules that electrically connect neighboring spherulites, as polymer chains connect crystallites in polymer-semiconductor thin films. In Part 2, we turned our focus to the production of alternative liquid fuels, evaluating process designs to produce "drop-in" replacement diesel and gasoline from non-food biomass and domestic natural gas. By considering the storage of captured byproduct CO2 in nearby depleted shale-gas wells, these processes produce liquid fuels with low-to-negative lifecycle greenhouse-gas emissions. We assessed the economics of these processes under a range of effective emissions prices, finding that fuels from first-of-a-kind facilities will compete with petroleum-derived fuels when the prices of crude oil and emissions are at least 100/bbl and 250/tCO2,eq, respectively. Since "learning by doing" facilitates economic competitiveness, we estimate that fuels from future plants will compete at oil prices as low as $85/bbl without any emissions price.

Lattice continuum and diffusional creep.

PubMed

Mesarovic, Sinisa Dj

2016-04-01

Diffusional creep is characterized by growth/disappearance of lattice planes at the crystal boundaries that serve as sources/sinks of vacancies, and by diffusion of vacancies. The lattice continuum theory developed here represents a natural and intuitive framework for the analysis of diffusion in crystals and lattice growth/loss at the boundaries. The formulation includes the definition of the Lagrangian reference configuration for the newly created lattice, the transport theorem and the definition of the creep rate tensor for a polycrystal as a piecewise uniform, discontinuous field. The values associated with each crystalline grain are related to the normal diffusional flux at grain boundaries. The governing equations for Nabarro-Herring creep are derived with coupled diffusion and elasticity with compositional eigenstrain. Both, bulk diffusional dissipation and boundary dissipation accompanying vacancy nucleation and absorption, are considered, but the latter is found to be negligible. For periodic arrangements of grains, diffusion formally decouples from elasticity but at the cost of a complicated boundary condition. The equilibrium of deviatorically stressed polycrystals is impossible without inclusion of interface energies. The secondary creep rate estimates correspond to the standard Nabarro-Herring model, and the volumetric creep is small. The initial (primary) creep rate is estimated to be much larger than the secondary creep rate.

Lattice continuum and diffusional creep

NASA Astrophysics Data System (ADS)

Mesarovic, Sinisa Dj.

2016-04-01

Diffusional creep is characterized by growth/disappearance of lattice planes at the crystal boundaries that serve as sources/sinks of vacancies, and by diffusion of vacancies. The lattice continuum theory developed here represents a natural and intuitive framework for the analysis of diffusion in crystals and lattice growth/loss at the boundaries. The formulation includes the definition of the Lagrangian reference configuration for the newly created lattice, the transport theorem and the definition of the creep rate tensor for a polycrystal as a piecewise uniform, discontinuous field. The values associated with each crystalline grain are related to the normal diffusional flux at grain boundaries. The governing equations for Nabarro-Herring creep are derived with coupled diffusion and elasticity with compositional eigenstrain. Both, bulk diffusional dissipation and boundary dissipation accompanying vacancy nucleation and absorption, are considered, but the latter is found to be negligible. For periodic arrangements of grains, diffusion formally decouples from elasticity but at the cost of a complicated boundary condition. The equilibrium of deviatorically stressed polycrystals is impossible without inclusion of interface energies. The secondary creep rate estimates correspond to the standard Nabarro-Herring model, and the volumetric creep is small. The initial (primary) creep rate is estimated to be much larger than the secondary creep rate.

Performance improvement for solution-processed high-mobility ZnO thin-film transistors

NASA Astrophysics Data System (ADS)

Sha Li, Chen; Li, Yu Ning; Wu, Yi Liang; Ong, Beng S.; Loutfy, Rafik O.

2008-06-01

The fabrication technology of stable, non-toxic, transparent, high performance zinc oxide (ZnO) thin-film semiconductors via the solution process was investigated. Two methods, which were, respectively, annealing a spin-coated precursor solution and annealing a drop-coated precursor solution, were compared. The prepared ZnO thin-film semiconductor transistors have well-controlled, preferential crystal orientation and exhibit superior field-effect performance characteristics. But the ZnO thin-film transistor (TFT) fabricated by annealing a drop-coated precursor solution has a distinctly elevated linear mobility, which further approaches the saturated mobility, compared with that fabricated by annealing a spin-coated precursor solution. The performance of the solution-processed ZnO TFT was further improved when substituting the spin-coating process by the drop-coating process.

Microstructural changes in Beta-silicon nitride grains upon crystallizing the grain-boundary glass

NASA Technical Reports Server (NTRS)

Lee, William E.; Hilmas, Gregory E.; Lange, F. F. (Editor)

1991-01-01

Crystallizing the grain boundary glass of a liquid phase sintered Si3N4 ceramic for 2 h or less at 1500 C led to formation of gamma Y2Si2O7. After 5 h at 1500 C, the gamma Y2Si2O7 had transformed to beta Y2Si2O7 with a concurrent dramatic increase in dislocation density within beta Si3N4 grains. Reasons for the increased dislocation density is discussed. Annealing for 20 h at 1500 C reduced dislocation densities to the levels found in as-sintered materials.

In-situ crystal structure determination of seifertite SiO 2 at 129 GPa: Studying a minor phase near Earth’s core–mantle boundary

DOE PAGES

Zhang, Li; Popov, Dmitry; Meng, Yue; ...

2016-01-01

Seifertite SiO₂ likely exists as a minor phase near the core–mantle boundary. By simulating the pressure and temperature conditions near the core–mantle boundary, seifertite was synthesized as a minor phase in a coarse-grained, polycrystalline sample coexisting with the (Mg,Fe)SiO₃ post-perovskite (pPv) phase at 129 GPa and 2500 K. Here we report the first in situ single-crystal structure determination and refinement of seifertite at high pressure and after a temperature quench from laser heating. We improved the data coverage of a minor phase from a diamond-anvil cell (DAC) by merging single-crystal data of seifertite from six selected grains that had differentmore » orientations. Observed systematic absences of reflections from the six individual grains allowed only one space group: Pbcn. The refined results of seifertite are in good agreement with the predictions from previous first-principles calculations at high pressure. This approach provides a method for structure determination of a minor phase in a mineral assemblage synthesized under P-T conditions representative of the deep Earth.« less

In-situ crystal structure determination of seifertite SiO 2 at 129 GPa: Studying a minor phase near Earth’s core–mantle boundary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Li; Popov, Dmitry; Meng, Yue

Seifertite SiO₂ likely exists as a minor phase near the core–mantle boundary. By simulating the pressure and temperature conditions near the core–mantle boundary, seifertite was synthesized as a minor phase in a coarse-grained, polycrystalline sample coexisting with the (Mg,Fe)SiO₃ post-perovskite (pPv) phase at 129 GPa and 2500 K. Here we report the first in situ single-crystal structure determination and refinement of seifertite at high pressure and after a temperature quench from laser heating. We improved the data coverage of a minor phase from a diamond-anvil cell (DAC) by merging single-crystal data of seifertite from six selected grains that had differentmore » orientations. Observed systematic absences of reflections from the six individual grains allowed only one space group: Pbcn. The refined results of seifertite are in good agreement with the predictions from previous first-principles calculations at high pressure. This approach provides a method for structure determination of a minor phase in a mineral assemblage synthesized under P-T conditions representative of the deep Earth.« less

Purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies of great cormorant (Phalacrocorax carbo) haemoglobin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jagadeesan, G.; Malathy, P.; Gunasekaran, K.

2014-10-25

The great cormorant hemoglobin has been isolated, purified and crystallized and the three dimensional structure is solved using molecular replacement technique. Haemoglobin is the iron-containing oxygen-transport metalloprotein that is present in the red blood cells of all vertebrates. In recent decades, there has been substantial interest in attempting to understand the structural basis and functional diversity of avian haemoglobins. Towards this end, purification, crystallization, preliminary X-ray diffraction and molecular-replacement studies have been carried out on cormorant (Phalacrocorax carbo) haemoglobin. Crystals were grown by the hanging-drop vapour-diffusion method using PEG 3350, NaCl and glycerol as precipitants. The crystals belonged to themore » trigonal system P3{sub 1}21, with unit-cell parameters a = b = 55.64, c = 153.38 Å, β = 120.00°; a complete data set was collected to a resolution of 3.5 Å. Matthews coefficient analysis indicated that the crystals contained a half-tetramer in the asymmetric unit.« less

Crystallization and preliminary crystallographic analysis of hygromycin B phosphotransferase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iino, Daisuke; Takakura, Yasuaki; Kuroiwa, Mika

2007-08-01

The crystallization and preliminary X-ray studies of the aminoglycoside antibiotic-modifying enzyme hygromycin B phosphotransferase from E. coli are reported. Aminoglycoside antibiotics, such as hygromycin, kanamycin, neomycin, spectinomycin and streptomycin, inhibit protein synthesis by acting on bacterial and eukaryotic ribosomes. Hygromycin B phosphotransferase (Hph; EC 2.7.1.119) converts hygromycin B to 7′′-O-phosphohygromycin using a phosphate moiety from ATP, resulting in the loss of its cell-killing activity. The Hph protein has been crystallized for the first time using a thermostable mutant and the hanging-drop vapour-diffusion method. The crystal provided diffraction data to a resolution of 2.1 Å and belongs to space group P3{submore » 2}21, with unit-cell parameters a = b = 71.0, c = 125.0 Å. Crystals of complexes of Hph with hygromycin B and AMP-PNP or ADP have also been obtained in the same crystal form as that of the apoprotein.« less

Rapid crystallization of WS2 films assisted by a thin nickel layer: An in situ energy-dispersive X-ray diffraction study

NASA Astrophysics Data System (ADS)

Ellmer, K.; Seeger, S.; Mientus, R.

2006-08-01

By rapid thermal crystallization of an amorphous WS3+x film, deposited by reactive magnetron sputtering at temperatures below 150 °C, layer-type semiconducting tungsten disulfide films (WS2) were grown. The rapid crystallization was monitored in real-time by in situ energy-dispersive X-ray diffraction. The films crystallize very fast (>40 nm/s), provided that a thin nickel film acts as nucleation seeds. Experiments on different substrates and the onset of the crystallization only at a temperature between 600 and 700 °C points to the decisive role of seeds for the textured growth of WS2, most probably liquid NiSx drops. The rapidly crystallized WS2 films exhibit a pronounced (001) texture with the van der Waals planes oriented parallel to the surface, leading to photoactive layers with a high hole mobility of about 80 cm2/Vs making such films suitable as absorbers for thin film solar cells.

Encapsulation of Polymer Colloids in a Sol-Gel Matrix. Direct-Writing of Coassembling Organic-Inorganic Hybrid Photonic Crystals.

PubMed

Mikosch, Annabel; Kuehne, Alexander J C

2016-03-22

The spontaneous self-assembly of polymer colloids into ordered arrangements provides a facile strategy for the creation of photonic crystals. However, these structures often suffer from defects and insufficient cohesion, which result in flaking and delamination from the substrate. A coassembly process has been developed for convective assembly, resulting in large-area encapsulated colloidal crystals. However, to generate patterns or discrete deposits in designated places, convective assembly is not suitable. Here we experimentally develop conditions for direct-writing of coassembling monodisperse dye-doped polystyrene particles with a sol-gel precursor to form solid encapsulated photonic crystals. In a simple procedure the colloids are formulated in a sol-gel precursor solution, drop-cast on a flat substrate, and dried. We here establish the optimal parameters to form reproducible highly ordered photonic crystals with good optical performance. The obtained photonic crystals interact with light in the visible spectrum with a narrow optical stop-gap.

Morphological, spectroscopic and thermal studies of samarium chloride coordinated single crystal grown by slow evaporation method

NASA Astrophysics Data System (ADS)

Slathia, Goldy; Raina, Bindu; Gupta, Rashmi; Bamzai, K. K.

2018-05-01

The synthesis of samarium chloride coordinated single crystal was carried out at room temperature by slow evaporation method. The crystal possesses a well defined hexagonal morphology with six symmetrically equivalent growth sectors separated by growth boundaries. The theoretical morphology has been established by structural approach using Bravaise-Friedele-Donnaye-Harker (BFDH) law. Fourier transform infra red spectroscopy was carried in order to study the geometry and structure of the crystal. The detailed thermogravimetric analysis elucidates the thermal stability of the complex.

Crystallization of the glassy grain boundary phase in silicon nitride ceramics

NASA Technical Reports Server (NTRS)

Drummond, Charles H., III

1991-01-01

The role was studied of the intergranular glassy phase in silicon nitride as-processed with yttria as a sintering aid. The microstructure, crystallization, and viscosity of the glassy phase were areas studied. Crystallization of the intergranular glassy phase to more refractory crystalline phases should improve the high temperature mechanical properties of the silicon nitride. The addition of a nucleating agent will increase the rate of crystallization. The measurement of the viscosity of the glassy phase will permit the estimation of the high temperature deformation of the silicon nitride.

Slip Continuity in Explicit Crystal Plasticity Simulations Using Nonlocal Continuum and Semi-discrete Approaches

DTIC Science & Technology

2013-01-01

Based Micropolar Single Crystal Plasticity: Comparison of Multi - and Single Criterion Theories. J. Mech. Phys. Solids 2011, 59, 398–422. ALE3D ...element boundaries in a multi -step constitutive evaluation (Becker, 2011). The results showed the desired effects of smoothing the deformation field...Implementation The model was implemented in the large-scale parallel, explicit finite element code ALE3D (2012). The crystal plasticity

Crystalline perfection and optical studies of L-Histidinium dihydrogen phosphate orthophosphoric acid (LHDP) single crystals

NASA Astrophysics Data System (ADS)

Ittyachan, Reena; Arunkumar, A.; Bhagavannarayana, G.

2015-10-01

Single crystals of L-Histidinium dihydrogenphosphate orthophosphoric acid (LHDP) were grown by slow evaporation solution growth technique. The grown crystals were confirmed by single crystal X-ray diffraction techniques. The HRXRD rocking curve measurements revealed the crystalline perfection of grown crystal and the absence of structural grain boundaries. The lower optical cut-off wavelength for this crystal was observed at 240 nm. The third order nonlinear refractive index (n2), nonlinear absorption coefficient (β) and susceptibility (χ(3)) were calculated by Z-scan studies using Nd: YAG laser as a source. The single shot laser damage threshold of grown crystal was measured to be 6.286 GW/cm2 using Nd: YAG laser.

Heterologous expression, purification, crystallization and preliminary X-ray analysis of raucaffricine glucosidase, a plant enzyme specifically involved in Rauvolfia alkaloid biosynthesis

PubMed Central

Ruppert, Martin; Panjikar, Santosh; Barleben, Leif; Stöckigt, Joachim

2006-01-01

Raucaffricine glucosidase (RG) is an enzyme that is specifically involved in the biosynthesis of indole alkaloids from the plant Rauvolfia serpentina. After heterologous expression in Escherichia coli cells, crystals of RG were obtained by the hanging-drop vapour-diffusion technique at 293 K with 0.3 M ammonium sulfate, 0.1 M sodium acetate pH 4.6 buffer and 11% PEG 4000 as precipitant. Crystals belong to space group I222 and diffract to 2.30 Å, with unit-cell parameters a = 102.8, b = 127.3, c = 215.8 Å. PMID:16511316

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jens, Jason; Raghunathan, Kannan; Vago, Frank

2010-01-12

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

Stabilizing the body centered cubic crystal in titanium alloys by a nano-scale concentration modulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, H. L.; Shah, S. A. A.; Hao, Y. L.

It is well-known that the body centered cubic (bcc) crystal in titanium alloys reaches its stability limit as the electron-to-atom (e/a) ratio of the alloy drops down to ~4.24. This critical value, however, is much higher than that of a multifunctional bcc type alloy (e/a = 4.15). Here we demonstrate that a nano-scale concentration modulation created by spinodal decomposition is what stabilizes the bcc crystal of the alloy. Aided by such a nano-scale concentration heterogeneity, unexpected properties from its chemically homogeneous counterpart are obtained. This provides a new strategy to design functional titanium alloys by tuning the spinodal decomposition.

Control of effect on the nucleation rate for hen egg white lysozyme crystals under application of an external ac electric field.

PubMed

Koizumi, H; Uda, S; Fujiwara, K; Nozawa, J

2011-07-05

The effect of an external ac electric field on the nucleation rate of hen egg white lysozyme crystals increased with an increase in the concentration of the precipitant used, which enabled the design of an electric double layer (EDL) formed at the inner surface of the drop in the oil. This is attributed to the thickness of the EDL controlled by the ionic strength of the precipitant used. Control of the EDL formed at the interface between the two phases is important to establishing this novel technique for the crystallization of proteins under the application of an external ac electric field. © 2011 American Chemical Society

Polarized quantum dot emission in electrohydrodynamic jet printed photonic crystals

DOE Office of Scientific and Technical Information (OSTI.GOV)

See, Gloria G.; Xu, Lu; Nuzzo, Ralph G.

2015-08-03

Tailored optical output, such as color purity and efficient optical intensity, are critical considerations for displays, particularly in mobile applications. To this end, we demonstrate a replica molded photonic crystal structure with embedded quantum dots. Electrohydrodynamic jet printing is used to control the position of the quantum dots within the device structure. This results in significantly less waste of the quantum dot material than application through drop-casting or spin coating. In addition, the targeted placement of the quantum dots minimizes any emission outside of the resonant enhancement field, which enables an 8× output enhancement and highly polarized emission from themore » photonic crystal structure.« less

Expression, purification and preliminary crystallographic analysis of sucrose phosphate synthase (SPS) from Halothermothrix orenii

PubMed Central

Huynh, Frederick; Tan, Tien-Chye; Swaminathan, Kunchithapadam; Patel, Bharat K. C.

2005-01-01

This is the first report of the crystallization of a sucrose phosphate synthase (SPS; EC 2.4.1.14). It also constitutes the first study of a sucrose phosphate synthase from a non-photosynthetic thermohalophilic anaerobic bacterium, Halothermothrix orenii. The purified recombinant spsA protein has been crystallized in the monoclinic space group C2, with unit-cell parameters a = 154.2, b = 47.9, c = 72.3 Å, β = 103.16°, using the hanging-drop vapour-diffusion method. The crystal diffracts X-rays to a resolution limit of 3.01 Å. Heavy-metal and halide-soaking trials are currently in progress to solve the structure. PMID:16508108

Terrace-like morphology of the boundary created through basal-prismatic transformation in magnesium

DOE PAGES

Liu, Bo -Yu; Wan, Liang; Wang, Jian; ...

2015-01-24

Here, the boundaries created through basal-prismatic transformation in submicron-sized single crystal magnesium have been investigated systematically using in situ transmission electron microscopy. We found that these boundaries not only deviated significantly from the twin plane associated with {101¯2} twin, but also possessed a non-planar morphology. After the sample was thinned to be less than 90 nm, aberration-corrected scanning transmission electron microscopy observation found that the basic components of these boundaries are actually terrace-like basal-prismatic interfaces.

Effect of surface charge convection and shape deformation on the dielectrophoretic motion of a liquid drop

NASA Astrophysics Data System (ADS)

Mandal, Shubhadeep; Bandopadhyay, Aditya; Chakraborty, Suman

2016-04-01

The dielectrophoretic motion and shape deformation of a Newtonian liquid drop in an otherwise quiescent Newtonian liquid medium in the presence of an axisymmetric nonuniform dc electric field consisting of uniform and quadrupole components is investigated. The theory put forward by Feng [J. Q. Feng, Phys. Rev. E 54, 4438 (1996), 10.1103/PhysRevE.54.4438] is generalized by incorporating the following two nonlinear effects—surface charge convection and shape deformation—towards determining the drop velocity. This two-way coupled moving boundary problem is solved analytically by considering small values of electric Reynolds number (ratio of charge relaxation time scale to the convection time scale) and electric capillary number (ratio of electrical stress to the surface tension) under the framework of the leaky dielectric model. We focus on investigating the effects of charge convection and shape deformation for different drop-medium combinations. A perfectly conducting drop suspended in a leaky (or perfectly) dielectric medium always deforms to a prolate shape and this kind of shape deformation always augments the dielectrophoretic drop velocity. For a perfectly dielectric drop suspended in a perfectly dielectric medium, the shape deformation leads to either increase (for prolate shape) or decrease (for oblate shape) in the dielectrophoretic drop velocity. Both surface charge convection and shape deformation affect the drop motion for leaky dielectric drops. The combined effect of these can significantly increase or decrease the dielectrophoretic drop velocity depending on the electrohydrodynamic properties of both the liquids and the relative strength of the electric Reynolds number and electric capillary number. Finally, comparison with the existing experiments reveals better agreement with the present theory.

Tilt Grain Boundary Topology Induced by Substrate Topography.

PubMed

Yu, Henry; Gupta, Nitant; Hu, Zhili; Wang, Kai; Srijanto, Bernadeta R; Xiao, Kai; Geohegan, David B; Yakobson, Boris I

2017-09-26

Synthesis of two-dimensional (2D) crystals is a topic of great current interest, since their chemical makeup, electronic, mechanical, catalytic, and optical properties are so diverse. A universal challenge, however, is the generally random formation of defects caused by various growth factors on flat surfaces. Here we show through theoretical analysis and experimental demonstration that nonplanar, curved-topography substrates permit the intentional and controllable creation of topological defects within 2D materials. We augment a common phase-field method by adding a geometric phase to track the crystal misorientation on a curved surface and to detect the formation of grain boundaries, especially when a growing monocrystal "catches its own tail" on a nontrivial topographical feature. It is specifically illustrated by simulated growth of a trigonal symmetry crystal on a conical-planar substrate, to match the experimental synthesis of WS 2 on silicon template, with satisfactory and in some cases remarkable agreement of theory predictions and experimental evidence.

Mapping the droplet transfer modes for an ER100S-1 GMAW electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heald, P.R.; Madigan, R.B.; Siewert, T.A.

1994-02-01

Welds were made with a 1.2-mm-diameter AWS ER100S-1 electrode using Ar-2% O[sub 2] shielding gas to map the effects of contact-tube-to-work distance (13, 19 and 25 mm), current, voltage, and wire feed rate on metal transfer. The droplet transfer modes were identified for each map by both the sound of the arc and images from a laser back-lit high-speed video system. The modes were correlated to digital records of the voltage and current fluctuations. The maps contain detailed information on the spray transfer mode, including the boundaries of drop spray, streaming spray and rotating spray modes. The metal transfer modemore » boundaries shifted with an increase in contact-tube-to-work distance. Increasing the contact-tube-to-work distance from 13 to 19 mm resulted in a 15 mm/s increase in the wire feet rate for the globular-to-drop-spray transition.« less

Determination of grain boundary mobility during recrystallization by statistical evaluation of electron backscatter diffraction measurements

DOE Office of Scientific and Technical Information (OSTI.GOV)

Basu, I., E-mail: basu@imm.rwth-aachen.de; Chen, M.; Loeck, M.

One of the key aspects influencing microstructural design pathways in metallic systems is grain boundary motion. The present work introduces a method by means of which direct measurement of grain boundary mobility vs. misorientation dependence is made possible. The technique utilizes datasets acquired by means of serial electron backscatter diffraction (EBSD) measurements. The experimental EBSD measurements are collectively analyzed, whereby datasets were used to obtain grain boundary mobility and grain aspect ratio with respect to grain boundary misorientation. The proposed method is further validated using cellular automata (CA) simulations. Single crystal aluminium was cold rolled and scratched in order tomore » nucleate random orientations. Subsequent annealing at 300 °C resulted in grains growing, in the direction normal to the scratch, into a single deformed orientation. Growth selection was observed, wherein the boundaries with misorientations close to Σ7 CSL orientation relationship (38° 〈111〉) migrated considerably faster. The obtained boundary mobility distribution exhibited a non-monotonic behavior with a maximum corresponding to misorientation of 38° ± 2° about 〈111〉 axes ± 4°, which was 10–100 times higher than the mobility values of random high angle boundaries. Correlation with the grain aspect ratio values indicated a strong growth anisotropy displayed by the fast growing grains. The observations have been discussed in terms of the influence of grain boundary character on grain boundary motion during recrystallization. - Highlights: • Statistical microstructure method to measure grain boundary mobility during recrystallization • Method implementation independent of material or crystal structure • Mobility of the Σ7 boundaries in 5N Al was calculated as 4.7 × 10{sup –8} m{sup 4}/J ⋅ s. • Pronounced growth selection in the recrystallizing nuclei in Al • Boundary mobility values during recrystallization 2–3 orders of magnitude larger vis-à-vis curvature driven motion.« less

Insights into crystal growth rates from a study of orbicular granitoids from western Australia

NASA Astrophysics Data System (ADS)

Zhang, J.; Lee, C. T.

2017-12-01

The purpose of this study is to develop new tools for constraining crystal growth rate in geologic systems. Of interest is the growth of crystals in magmatic systems because crystallization changes the rheology of a magma as well as provides surfaces on which bubbles can nucleate. To explore crystal growth in more detail, we conducted a case study of orbicular granitoids from western Australia. The orbicules occur as spheroids dispersed in a granitic matrix. Most orbicules have at least two to three concentric bands, composed of elongate and radially oriented hornblende surrounded by interstitial plagioclase. We show that mineral modes and hence bulk composition at the scale of the band is homogeneous from rim to core. Crystal number density decreases and crystal size increases from rim to core. These observations suggest that the orbicules crystallized rapidly from rim to core. We hypothesize that the orbicules are blobs of hot dioritic liquid injected into a cold granitic magma and subsequently cooled and solidified. Crystals stop growing when the mass transport rate tends to zero due to the low temperature. We estimated cooling timescales based on conductive cooling models, constraining crystal growth rates to be 10-6 to 10-5 m/s. We also show that the oscillatory banding is controlled by disequilibrium crystallization, wherein hornblende preferentially crystallizes, resulting in the diffusive growth of a chemical boundary layer enriched in plagioclase component, which in turns results in crystallization of plagioclase. We show that the correlation between the width of each crystallization couplet (band) with distance from orbicule rim is linear, with the slope corresponding to the square root of the ratio between chemical diffusivity in the growth medium and thermal diffusivity. We estimate chemical diffusivity of 2*10-7 m2/s, which is remarkably fast for silicate liquids but reasonable for diffusion in hot aqueous fluids, suggesting that crystallization occurred during water-saturated conditions. Combined with the estimate of the boundary layer thickness, we use the diffusivity to estimate the diffusive flux, arriving at crystal growth rates similar to that constrained by thermal modeling. In the presence of fluids, we show that crystal growth rates in magmatic systems may be under-estimated.

Studying the kinetics of magnetization in high Tc superconductors

NASA Technical Reports Server (NTRS)

Turchinskaya, Marina

1993-01-01

The first microscopic maps of magnetic induction in YBa2Cu3O(7-x) crystals which directly show the dependence of flux flow on twin density and polytwin block and twin boundary orientation are reported. These maps were obtained by means of a recently-improved magneto-optical imaging technique. Pinning was lowest in untwinned regions and increased with increasing twin density. An isotropy in twin boundary pinning, defined as the ratio of the magnetic induction gradient across twin boundaries to that along twin boundaries, was 10 at 17 K; this ratio increased with increasing temperature. In polycrystals, twin boundaries also had a strongly anisotropic effect on flux flow into a grain from a grain boundary.

Studying the kinetics of magnetization in high Tc superconductors

NASA Technical Reports Server (NTRS)

1993-01-01

We report the first microscopic maps of magnetic induction in YBa2Cu3O(7-x) crystals which directly show the dependence of flux flow on twin density, polytwin block, and twin boundary orientation. These maps were obtained by means of a recently-improved magneto-optical imaging technique. Pinning was lowest in untwinned regions and increasing with increasing twin density. Anisotropy in twin boundary pinning, defined as the ratio of the magnetic induction gradient across twin boundaries to that along twin boundaries, was 10 at 17 K; this ratio increased with increasing temperature. In polycrystals, twin boundaries also had a strongly anisotropic effect on flux flow into a grain from a grain boundary.

Influence of dislocations and second phases on the magnetostrictive behavior of iron-gallium and other iron alloy single crystals

NASA Astrophysics Data System (ADS)

Saha, Biswadeep

Rare-earth-free Fe-Ga magnetostrictive alloys exhibit an excellent combination of large low-field magnetostriction, strength, ductility, wide operating temperature range, and low cost. Various observations in these and other alpha-Fe-based magnetostrictive alloys suggest that lattice strain modulations that are influenced by solute elements, near neighbor atomic environments around Fe atoms, coherent and incoherent precipitates, and structural defects such as dislocations likely play an important role in their magnetostrictive behavior. In the first part, the effect of dislocations on the magnetostriction of Fe-Ga single crystals was examined. The [001]- and [126]-oriented Fe-20 at.% Ga single crystal samples were deformed in a controlled way to introduce dislocation arrays with two different array geometries. Magnetostriction values showed a much lower decrease after deformation for the case of a [001]-oriented crystal, where eight different slip systems were operative and consequently eight different sets of dislocation arrays are expected. A drastic drop in magnetostriction measured along the sample axis is observed in the sample subjected to a small strain by deformation of a [126]-oriented crystal during which slip occurred on only one slip system. The nature of strain modulation introduced in this case was spatially asymmetric. The [126] deformation was accompanied by an acoustic emission during the formation of slip band. Transmission electron microscopy was carried out to examine the nature of dislocation distribution. The results show that the nature of strain modulation introduced by the dislocation arrays has a strong influence on the magnetostrictive behavior of magnetostrictive alloys. In the second part of this research, the effect of Mo addition to Fe was examined in detail. Addition of Mo to Fe increased the magnetostriction (3/2)lambda100 Fe very rapidly to 137 ppm at 10 at.% Mo, the highest value observed in these alloys. Further Mo additions decreased the magnetostriction. Magnetization data show a drastic drop in magnetization to 63 emu/gm for Fe-20 at.% Mo from 176 emu/gm for Fe-10 at.% Mo suggesting the formation large amounts of nonmagnetic second phase and reduction in total Fe content of the alloy. The drop in magnetostriction at higher Mo contents is associated with the formation of a second phase.

A Case Study of Ship Track Formation in a Polluted Marine Boundary Layer.

NASA Astrophysics Data System (ADS)

Noone, Kevin J.; Johnson, Doug W.; Taylor, Jonathan P.; Ferek, Ronald J.; Garrett, Tim; Hobbs, Peter V.; Durkee, Philip A.; Nielsen, Kurt; Öström, Elisabeth; O'Dowd, Colin; Smith, Michael H.; Russell, Lynn M.; Flagan, Richard C.; Seinfeld, John H.; de Bock, Lieve; van Grieken, René E.; Hudson, James G.; Brooks, Ian;  Gasparovic, Richard F.;  Pockalny, Robert A.

2000-08-01

A case study of the effects of ship emissions on the microphysical, radiative, and chemical properties of polluted marine boundary layer clouds is presented. Two ship tracks are discussed in detail. In situ measurements of cloud drop size distributions, liquid water content, and cloud radiative properties, as well as aerosol size distributions (outside-cloud, interstitial, and cloud droplet residual particles) and aerosol chemistry, are presented. These are related to remotely sensed measurements of cloud radiative properties.The authors examine the processes behind ship track formation in a polluted marine boundary layer as an example of the effects of anthropogenic particulate pollution on the albedo of marine stratiform clouds.

Protein Crystal Movements and Fluid Flows During Microgravity Growth

NASA Technical Reports Server (NTRS)

Boggon, Titus J.; Chayen, Naomi E.; Snell, Edward H.; Dong, Jun; Lautenschlager, Peter; Potthast, Lothar; Siddons, D. Peter; Stojanoff, Vivian; Gordon, Elspeth; Thompson, Andrew W.;

Electrowetting on semiconductors

NASA Astrophysics Data System (ADS)

Palma, Cesar; Deegan, Robert

2015-01-01

Applying a voltage difference between a conductor and a sessile droplet sitting on a thin dielectric film separating it from the conductor will cause the drop to spread. When the conductor is a good metal, the change of the drop's contact angle due to the voltage is given by the Young-Lippmann (YL) equation. Here, we report experiments with lightly doped, single crystal silicon as the conductive electrode. We derive a modified YL equation that includes effects due to the semiconductor and contact line pinning. We show that light induces a non-reversible wetting transition, and that our model agrees well with our experimental results.

Joint optic disc and cup boundary extraction from monocular fundus images.

PubMed

Chakravarty, Arunava; Sivaswamy, Jayanthi

2017-08-01

Accurate segmentation of optic disc and cup from monocular color fundus images plays a significant role in the screening and diagnosis of glaucoma. Though optic cup is characterized by the drop in depth from the disc boundary, most existing methods segment the two structures separately and rely only on color and vessel kink based cues due to the lack of explicit depth information in color fundus images. We propose a novel boundary-based Conditional Random Field formulation that extracts both the optic disc and cup boundaries in a single optimization step. In addition to the color gradients, the proposed method explicitly models the depth which is estimated from the fundus image itself using a coupled, sparse dictionary trained on a set of image-depth map (derived from Optical Coherence Tomography) pairs. The estimated depth achieved a correlation coefficient of 0.80 with respect to the ground truth. The proposed segmentation method outperformed several state-of-the-art methods on five public datasets. The average dice coefficient was in the range of 0.87-0.97 for disc segmentation across three datasets and 0.83 for cup segmentation on the DRISHTI-GS1 test set. The method achieved a good glaucoma classification performance with an average AUC of 0.85 for five fold cross-validation on RIM-ONE v2. We propose a method to jointly segment the optic disc and cup boundaries by modeling the drop in depth between the two structures. Since our method requires a single fundus image per eye during testing it can be employed in the large-scale screening of glaucoma where expensive 3D imaging is unavailable. Copyright © 2017 Elsevier B.V. All rights reserved.

Ferroelectric Tungsten Bronze Bulk Crystals and Epitaxial Thin Films for Electro-Optic Device Applications

DTIC Science & Technology

1984-02-01

110) film orientations. Electro - optic measurements on SBN:60 single crystals have shown a high value for r51 of 80 x 10 to the minus 12th power m/v...showing morphotropic boundary conditions with enhanced dielectric properties. Both systems look promising for future electro - optic development.

Origin of colossal dielectric permittivity of rutile Ti 0.9In 0.05Nb 0.05O 2: single crystal and polycrystalline

DOE PAGES

Song, Yongli; Wang, Xianjie; Sui, Yu; ...

2016-02-12

Here in this article, we investigated the dielectric properties of (In + Nb) co-doped rutile TiO 2 single crystal and polycrystalline ceramics. Both of them showed colossal, up to 10 4, dielectric permittivity at room temperature. The single crystal sample showed one dielectric relaxation process with a large dielectric loss. The voltage-dependence of dielectric permittivity and the impedance spectrum suggest that the high dielectric permittivity of single crystal originated from the surface barrier layer capacitor (SBLC). The impedance spectroscopy at different temperature confirmed that the (In+Nb) co-doped rutile TiO 2 polycrystalline ceramic had semiconductor grains and insulating grain boundaries, andmore » that the activation energies were calculated to be 0.052 eV and 0.35 eV for grain and grain boundary, respectively. The dielectric behavior and impedance spectrum of the polycrystalline ceramic sample indicated that the internal barrier layer capacitor (IBLC) mode made a major contribution to the high ceramic dielectric permittivity, instead of the electron-pinned defect-dipoles.« less

Origin of colossal dielectric permittivity of rutile Ti0.9In0.05Nb0.05O2: single crystal and polycrystalline

PubMed Central

Song, Yongli; Wang, Xianjie; Sui, Yu; Liu, Ziyi; Zhang, Yu; Zhan, Hongsheng; Song, Bingqian; Liu, Zhiguo; Lv, Zhe; Tao, Lei; Tang, Jinke

2016-01-01

In this paper, we investigated the dielectric properties of (In + Nb) co-doped rutile TiO2 single crystal and polycrystalline ceramics. Both of them showed colossal, up to 104, dielectric permittivity at room temperature. The single crystal sample showed one dielectric relaxation process with a large dielectric loss. The voltage-dependence of dielectric permittivity and the impedance spectrum suggest that the high dielectric permittivity of single crystal originated from the surface barrier layer capacitor (SBLC). The impedance spectroscopy at different temperature confirmed that the (In + Nb) co-doped rutile TiO2 polycrystalline ceramic had semiconductor grains and insulating grain boundaries, and that the activation energies were calculated to be 0.052 eV and 0.35 eV for grain and grain boundary, respectively. The dielectric behavior and impedance spectrum of the polycrystalline ceramic sample indicated that the internal barrier layer capacitor (IBLC) mode made a major contribution to the high ceramic dielectric permittivity, instead of the electron-pinned defect-dipoles. PMID:26869187

Origin of colossal dielectric permittivity of rutile Ti0.9In0.05Nb0.05O2: single crystal and polycrystalline

NASA Astrophysics Data System (ADS)

Song, Yongli; Wang, Xianjie; Sui, Yu; Liu, Ziyi; Zhang, Yu; Zhan, Hongsheng; Song, Bingqian; Liu, Zhiguo; Lv, Zhe; Tao, Lei; Tang, Jinke

2016-02-01

In this paper, we investigated the dielectric properties of (In + Nb) co-doped rutile TiO2 single crystal and polycrystalline ceramics. Both of them showed colossal, up to 104, dielectric permittivity at room temperature. The single crystal sample showed one dielectric relaxation process with a large dielectric loss. The voltage-dependence of dielectric permittivity and the impedance spectrum suggest that the high dielectric permittivity of single crystal originated from the surface barrier layer capacitor (SBLC). The impedance spectroscopy at different temperature confirmed that the (In + Nb) co-doped rutile TiO2 polycrystalline ceramic had semiconductor grains and insulating grain boundaries, and that the activation energies were calculated to be 0.052 eV and 0.35 eV for grain and grain boundary, respectively. The dielectric behavior and impedance spectrum of the polycrystalline ceramic sample indicated that the internal barrier layer capacitor (IBLC) mode made a major contribution to the high ceramic dielectric permittivity, instead of the electron-pinned defect-dipoles.

Origin of colossal dielectric permittivity of rutile Ti₀.₉In₀.₀₅Nb₀.₀₅O₂: single crystal and polycrystalline.

PubMed

Song, Yongli; Wang, Xianjie; Sui, Yu; Liu, Ziyi; Zhang, Yu; Zhan, Hongsheng; Song, Bingqian; Liu, Zhiguo; Lv, Zhe; Tao, Lei; Tang, Jinke

2016-02-12

In this paper, we investigated the dielectric properties of (In + Nb) co-doped rutile TiO2 single crystal and polycrystalline ceramics. Both of them showed colossal, up to 10(4), dielectric permittivity at room temperature. The single crystal sample showed one dielectric relaxation process with a large dielectric loss. The voltage-dependence of dielectric permittivity and the impedance spectrum suggest that the high dielectric permittivity of single crystal originated from the surface barrier layer capacitor (SBLC). The impedance spectroscopy at different temperature confirmed that the (In + Nb) co-doped rutile TiO2 polycrystalline ceramic had semiconductor grains and insulating grain boundaries, and that the activation energies were calculated to be 0.052 eV and 0.35 eV for grain and grain boundary, respectively. The dielectric behavior and impedance spectrum of the polycrystalline ceramic sample indicated that the internal barrier layer capacitor (IBLC) mode made a major contribution to the high ceramic dielectric permittivity, instead of the electron-pinned defect-dipoles.

Growth of zinc selenide single crystals by physical vapor transport in microgravity

NASA Technical Reports Server (NTRS)

Rosenberger, Franz

1993-01-01

The goals of this research were the optimization of growth parameters for large (20 mm diameter and length) zinc selenide single crystals with low structural defect density, and the development of a 3-D numerical model for the transport rates to be expected in physical vapor transport under a given set of thermal and geometrical boundary conditions, in order to provide guidance for an advantageous conduct of the growth experiments. In the crystal growth studies, it was decided to exclusively apply the Effusive Ampoule PVT technique (EAPVT) to the growth of ZnSe. In this technique, the accumulation of transport-limiting gaseous components at the growing crystal is suppressed by continuous effusion to vacuum of part of the vapor contents. This is achieved through calibrated leaks in one of the ground joints of the ampoule. Regarding the PVT transport rates, a 3-D spectral code was modified. After introduction of the proper boundary conditions and subroutines for the composition-dependent transport properties, the code reproduced the experimentally determined transport rates for the two cases with strongest convective flux contributions to within the experimental and numerical error.

Appearance of superconductivity at the vacancy order-disorder boundary in KxFe2 -ySe2

NASA Astrophysics Data System (ADS)

Duan, Chunruo; Yang, Junjie; Ren, Yang; Thomas, Sean M.; Louca, Despina

2018-05-01

The role of phase separation and the effect of Fe-vacancy ordering in the emergence of superconductivity in alkali metal doped iron selenides AxFe2 -ySe2 (A = K, Rb, Cs) is explored. High energy x-ray diffraction and Monte Carlo simulation were used to investigate the crystal structure of quenched superconducting (SC) and as-grown nonsuperconducting (NSC) KxFe2 -ySe2 single crystals. The coexistence of superlattice structures with the in-plane √{2 }×√{2 } K-vacancy ordering and the √{5 }×√{5 } Fe-vacancy ordering were observed in both the SC and NSC crystals alongside the I4/mmm Fe-vacancy-free phase. Moreover, in the SC crystals, an Fe-vacancy-disordered phase is additionally proposed to be present. Monte Carlo simulations suggest that it appears at the boundary between the I4/mmm vacancy-free phase and the I4/m vacancy-ordered phases (√{5 }×√{5 } ). The vacancy-disordered phase is nonmagnetic and is most likely the host of superconductivity.

Deformation of leaky-dielectric fluid globules under strong electric fields: Boundary layers and jets at large Reynolds numbers

NASA Astrophysics Data System (ADS)

Schnitzer, Ory; Frankel, Itzchak; Yariv, Ehud

2013-11-01

In Taylor's theory of electrohydrodynamic drop deformation (Proc. R. Soc. Lond. A, vol. 291, 1966, pp. 159-166), inertia is neglected at the outset, resulting in fluid velocity that scales as the square of the applied-field magnitude. For large drops, with increasing field strength the Reynolds number predicted by this scaling may actually become large, suggesting the need for a complementary large-Reynolds-number investigation. Balancing viscous stresses and electrical shear forces in this limit reveals a different velocity scaling, with the 4/3-power of the applied-field magnitude. We focus here on the flow over a gas bubble. It is essentially confined to two boundary layers propagating from the poles to the equator, where they collide to form a radial jet. At leading order in the Capillary number, the bubble deforms due to (i) Maxwell stresses; (ii) the hydrodynamic boundary-layer pressure associated with centripetal acceleration; and (iii) the intense pressure distribution acting over the narrow equatorial deflection zone, appearing as a concentrated load. Remarkably, the unique flow topology and associated scalings allow to obtain a closed-form expression for this deformation through application of integral mass and momentum balances. On the bubble scale, the concentrated pressure load is manifested in the appearance of a non-smooth equatorial dimple.

Influence of initial seed distribution on the pattern formation of the phase field crystals

NASA Astrophysics Data System (ADS)

Starodumov, Ilya; Galenko, Peter; Kropotin, Nikolai; Alexandrov, Dmitri V.

2017-11-01

The process of crystal growth can be expressed as a transition of atomic structure to a finally stable state or to a metastable state. In the Phase Field Crystal Model (PFC-model) these states are described by regular distributions of the atomic density. Getting the system into any metastable condition may be caused by the peculiarities of the computational domain, initial and boundary conditions. However, an important factor in the formation of the crystal structure can be the initial disturbance. In the report we show how different types of initial disturbance can change the finally stable state of crystal structure in equilibrium.

The Influence of Aerosols on the Shortwave Cloud Radiative Forcing from North Pacific Oceanic Clouds: Results from the Cloud Indirect Forcing Experiment (CIFEX)

NASA Technical Reports Server (NTRS)

Wilcox, Eric M.; Roberts, Greg; Ramanathan, V.

2006-01-01

Aerosols over the Northeastern Pacific Ocean enhance the cloud drop number concentration and reduce the drop size for marine stratocumulus and cumulus clouds. These microphysical effects result in brighter clouds, as evidenced by a combination of aircraft and satellite observations. In-situ measurements from the Cloud Indirect Forcing Experiment (CIFEX) indicate that the mean cloud drop number concentration in low clouds over the polluted marine boundary layer is greater by 53/cu cm compared to clean clouds, and the mean cloud drop effective radius is smaller by 4 microns. We link these in-situ measurements of cloud modification by aerosols, for the first time, with collocated satellite broadband radiative flux observations from the Clouds and the Earth's Radiant Energy System (CERES) to show that these microphysical effects of aerosols enhance the top-of-atmosphere cooling by -9.9+/-4.3 W/sq m for overcast conditions.

Shear-lag analysis about an internally-dropped ply

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vizzini, A.J.

1995-12-31

The region around a terminated ply is modeled as several elastic layers separated by shear regions. A shear-lag analysis is then performed allowing for the thickness of the elastic and shear layers to vary. Boundary conditions, away for the ply drop, are based on the deflections determined by a finite element model. The interlaminar stresses are compared against those generated by the finite element model for tapered laminates under pure extension, pure bending, and extension-bending coupling. The shear-lag analysis predicts the interlaminar shear at and near the ply drop for pure extension and in cases involving bending if the deflectionsmore » due to bending are removed. The interlaminar shear stress and force equilibrium are used to determine the interlaminar normal stress. The trends in the interlaminar normal stress shown by the finite element model are partially captured by the shear-lag analysis. This simple analysis indicates that the mechanism for load transfer about a ply drop is primarily due to shear transfer through the resin rich areas.« less

Crystallographic characterizations of eutectic and secondary carbides in a Fe-12Cr-2.5Mo-1.5W-3V-1.25C alloy

NASA Astrophysics Data System (ADS)

Guo, Jing; Liu, Ligang; Feng, Yunli; Liu, Sha; Ren, Xuejun; Yang, Qingxiang

2017-03-01

In this work, the morphology and structures of the eutectic and secondary carbides in a new high chromium Fe-12Cr-2.5Mo-1.5W-3V-1.25C designed for cold-rolling work roll were systematically studied. The precipitated carbides inside the grains and along the grain boundaries were investigated with optical microscope, scanning electron microscopy with energy dispersive spectroscopy, transmission electron microscopy and X-Ray diffraction. Selected area diffraction patterns have been successfully used to identify the crystal formation and lattice constants of the carbides with different alloying elements. The results show that the eutectic carbides precipitated contain MC and M2C distributed along the grain boundaries with dendrite feature. The composition and crystal structure analysis shows that the eutectic MC carbides contain VC and WC with a cubic and hexagonal crystal lattice structures respectively, while the eutectic M2C carbides predominantly contain V2C and Mo2C with orthorhombic and hexagonal crystal lattices respectively. The secondary carbides contain MC, M2C, M7C3 formed along the grain boundaries and their sizes are much larger than the eutectic carbides ones. The secondary M23C6 is much small (0.3-0.5μm) and is distributed dispersively inside the grain. Similar to the eutectic carbides, the secondary carbides also contain VC, WC, V2C, and Mo2C. M7C3 is hexagonal (Fe,Cr)7C3, while M23C6 is indexed to be in a cubic crystal form.

The History of a Plutonic-Volcanic System Determined from Compositional and Mineral Inclusion Mapping of Alkali Feldspar Megacrysts

NASA Astrophysics Data System (ADS)

Belfanti, S. A. D.; Gualda, G. A. R.

2017-12-01

Alkali-feldspar megacrysts (2-20 cm long) occur in many granitic rocks, providing extensive records of crystallization within magma bodies. We will use megacrysts from Yosemite National Park's Tuolumne Intrusive Suite to determine if and how megacrysts record recharge and eruption. Preliminary work has focused on 4 crystals. Based on BSE patterns, crystals can be divided into 3 zones: (1) the core, which represents the crystal's first growth and sometimes displays some resorption; (2) the interior, including a series of sub-zones that correspond to different growth periods; and (3) the rim, or outermost growth stage. Common BSE patterns include decreasing brightness from the inner portion of a growth period outward, increasing brightness towards either side of a boundary, and periods of constant brightness, for a full or partial period. Most mineral inclusions appear as single crystals ( 10-25%) or as groups of 2-4 crystals ( 60-75%). Large clusters of 10 or more individuals are less common ( 5-15%), and clusters of >20 crystals are rare ( 1-3%). Most crystals (85-95%) occur on growth boundaries or within the core. Magnetite is common in the more central parts of the interior zone, appearing only occasionally in the core and towards the rim. Accessories, amphibole, and biotite are more evenly distributed within the megacryst. Biotite and titanite grains large enough to display habit appear to be within 20 degrees of parallel with zone boundaries. Most other inclusions are small or not elongated enough to display clear alignment. The total volume of inclusions (excluding quartz and plagioclase, which have X-ray attenuation very similar to that of alkali feldspar) does not exceed 1% of megacryst volume. Plagioclase seems to be at least equal in volume to all other inclusions combined, but as noted above, its exact volume is currently indiscernible. Magnetite makes up about 1/6 of inclusion volume, zircon 1/3, and all others the remaining half. We will complement our dataset by performing XCT, BSE, EDS, and LA-ICP-MS analysis on the crystals, and continue to improve methods to better discern the zoning patterns. Identifying zoning patterns that are discernable from one another is an important first step towards understanding individual megacryst histories.

Investigating a Drop-on-Demand Microdispenser for Standardized Sample Preparation

DTIC Science & Technology

2012-09-01

Demand Microdispenser for Standardized Sample Preparation Ellen L. Holthoff, Mikella E. Farrell, and Paul M. Pellegrino Sensors and Electron Devices...instrument. The use of a gravimetric method, such as a quartz crystal microbalance4 ( QCM ) or a sensitive microbalance as discussed in this report, is

76 FR 16417 - Product Cancellation Order for Certain Pesticide Registrations

Federal Register 2010, 2011, 2012, 2013, 2014

2011-03-23

...) Regulatory Public Docket in Rm. S- 4400, One Potomac Yard (South Bldg.), 2777 S. Crystal Dr., Arlington, VA... Shot Phenothrin Wasp & Hornet Tetramethrin Spray. 013283-00013 Rainbow Wasp & Ant Bioallethrin Spray... Neopynamim Tetramethrin Technical. 073510-00008 Marketquest One Permethrin Drop Flea & Tick Control-2. 082498...

Multiple factors in the origin of the Cretaceous/Tertiary boundary: the role of environmental stress and Deccan Trap volcanism.

PubMed

Glasby, G P; Kunzendorf, H

1996-06-01

A review of the scenarios for the Cretaceous/ Tertiary (K/T) boundary event is presented and a coherent hypothesis for the origin of the event is formulated. Many scientists now accept that the event was caused by a meteorite impact at Chicxulub in the Yucatan Peninsula, Mexico. Our investigations show that the oceans were already stressed by the end of the Late Cretaceous as a result of the long-term drop in atmospheric CO2, the long-term drop in sea level and the frequent development of oceanic anoxia. Extinction of some marine species was already occurring several million years prior to the K/T boundary. The biota were therefore susceptible to change. The eruption of the Deccan Traps, which began at 66.2 Ma, coincides with the K/T boundary events. It erupted huge quantities of H2SO4, HCl, CO2, dust and soot into the atmosphere and led to a significant drop in sea level and marked changes in ocean temperature. The result was a major reduction in oceanic productivity and the creation of an almost dead ocean. The volcanism lasted almost 0.7 m.y. Extinction of biological species was graded and appeared to correlate with the main eruptive events. Elements such as Ir were incorporated into the volcanic ash, possibly on soot particles. This horizon accumulated under anoxic conditions in local depressions and became the marker horizon for the K/T boundary. An oxidation front penetrated this horizon leading to the redistribution of elements. The eruption of the Deccan Traps is the largest volcanic event since the Permian-Triassic event at 245 Ma. It followed a period of 36 m.y. in which the earth's magnetic field failed to reverse. Instabilities in the mantle are thought to be responsible for this eruption and therefore for the K/T event. We therefore believe that the K/T event can be explained in terms of the effects of the Deccan volcanism on an already stressed biosphere. The meteorite impact at Chicxulub took place after the onset of Deccan volcanism. It probably played a regional, rather than global, role in the K/T extinction.

Invited review liquid crystal models of biological materials and silk spinning.

PubMed

Rey, Alejandro D; Herrera-Valencia, Edtson E

2012-06-01

A review of thermodynamic, materials science, and rheological liquid crystal models is presented and applied to a wide range of biological liquid crystals, including helicoidal plywoods, biopolymer solutions, and in vivo liquid crystals. The distinguishing characteristics of liquid crystals (self-assembly, packing, defects, functionalities, processability) are discussed in relation to biological materials and the strong correspondence between different synthetic and biological materials is established. Biological polymer processing based on liquid crystalline precursors includes viscoelastic flow to form and shape fibers. Viscoelastic models for nematic and chiral nematics are reviewed and discussed in terms of key parameters that facilitate understanding and quantitative information from optical textures and rheometers. It is shown that viscoelastic modeling the silk spinning process using liquid crystal theories sheds light on textural transitions in the duct of spiders and silk worms as well as on tactoidal drops and interfacial structures. The range and consistency of the predictions demonstrates that the use of mesoscopic liquid crystal models is another tool to develop the science and biomimetic applications of mesogenic biological soft matter. Copyright © 2011 Wiley Periodicals, Inc.

Crystallization and preliminary X-ray crystallographic analysis of a carbonyl reductase from Candida parapsilosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rongzhen; Xu, Yan, E-mail: biosean@yahoo.com.cn; Sun, Ying

2008-04-01

A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. A novel short-chain NADPH-dependent (S)-1-phenyl-1,2-ethanediol dehydrogenase (SCR) has been crystallized. Two distinct but related crystal forms of SCR were obtained using the hanging-drop vapour-diffusion method and a reservoir solution consisting of 18%(w/v) polyethylene glycol 2000 monomethyl ether and 8%(v/v) 2-propanol as the precipitant. The crystals were rhomboid in shape with average dimensions of 0.3 × 0.3 × 0.4 mm and diffracted to a resolution of 2.7–3.0 Å. The crystal forms both belong to space group P2{sub 1}2{sub 1}2{sub 1} and have unit-cell parameters a = 104.7, b = 142.8, cmore » = 151.8 Å and a = 101.1, b = 146.0, c = 159.8 Å. The calculated values of V{sub M}, rotation-function and translation-function solutions and consideration of potential crystal packing suggest that there are eight protein subunits per asymmetric unit.« less

Crystallization and preliminary X-ray analysis of a protease inhibitor from the latex of Carica papaya

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azarkan, Mohamed; Garcia-Pino, Abel; Dibiani, Rachid

2006-12-01

The Kunitz-type trypsin/chymotrypsin inhibitor isolated from C. papaya latex has been crystallized using the hanging-drop vapour-diffusion method. Two different crystal forms are observed, diffracting to 2.6 and 1.7 Å. A Kunitz-type protease inhibitor purified from the latex of green papaya (Carica papaya) fruits was crystallized in the presence and absence of divalent metal ions. Crystal form I, which is devoid of divalent cations, diffracts to a resolution of 2.6 Å and belongs to space group P3{sub 1} or P3{sub 2}. This crystal form is a merohedral twin with two molecules in the asymmetric unit and unit-cell parameters a = bmore » = 74.70, c = 78.97 Å. Crystal form II, which was grown in the presence of Co{sup 2+}, diffracts to a resolution of 1.7 Å and belongs to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 44.26, b = 81.99, c = 140.89 Å.« less

A numerical study of drop-on-demand ink jets

NASA Technical Reports Server (NTRS)

Fromm, J.

1982-01-01

Ongoing work related to development and utilization of a numerical model for treating the fluid dynamics of ink jets is discussed. The model embodies the complete nonlinear, time dependent, axi-symmetric equations in finite difference form. The jet nozzle geometry with no-slip boundary conditions and the existence of a contact circle are included. The contact circle is allowed some freedom of movement, but wetting of exterior surfaces is not addressed. The principal objective in current numerical experiments is to determine what pressure history, in conjunction with surface forces, will lead to clean drop formation.

Crystallization and preliminary X-ray analysis of the atrial natriuretic peptide (ANP) receptor extracellular domain complex with ANP: use of ammonium sulfate as the cryosalt.

PubMed

Ogawa, Haruo; Zhang, Xiaolun; Qiu, Yue; Ogata, Craig M; Misono, Kunio S

2003-10-01

Atrial natriuretic peptide (ANP) plays a major role in blood pressure and volume regulation owing to its natriuretic and vasodilatory activities. The ANP receptor is a single-span transmembrane receptor coupled to its intrinsic guanylyl cyclase activity. The extracellular hormone-binding domain of rat ANP receptor (ANPR) was overexpressed by permanent transfection in CHO cells and purified. ANPR complexed with ANP was crystallized at 301 K by the hanging-drop vapor-diffusion method. The crystals were frozen in 3.4 M ammonium sulfate used as a cryoprotectant. The crystals diffracted to 3.1 A resolution using synchrotron radiation and belonged to the hexagonal space group P6(1), with unit-cell parameters a = b = 100.3, c = 258.6 A.

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6

PubMed Central

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-01-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P212121, with unit-cell parameters a = 88.35, b = 128.73, c = 131.03 Å. PMID:24100567

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum.

PubMed

Cranston, Laura J; Roszak, Aleksander W; Cogdell, Richard J

2014-06-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment-protein complex that is involved in harvesting light energy and transferring it to the LH1-RC `core' complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a=b=109.36, c=80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer.

Crystallization and preliminary X-ray diffraction analysis of the peripheral light-harvesting complex LH2 from Marichromatium purpuratum

PubMed Central

Cranston, Laura J.; Roszak, Aleksander W.; Cogdell, Richard J.

2014-01-01

LH2 from the purple photosynthetic bacterium Marichromatium (formerly known as Chromatium) purpuratum is an integral membrane pigment–protein complex that is involved in harvesting light energy and transferring it to the LH1–RC ‘core’ complex. The purified LH2 complex was crystallized using the sitting-drop vapour-diffusion method at 294 K. The crystals diffracted to a resolution of 6 Å using synchrotron radiation and belonged to the tetragonal space group I4, with unit-cell parameters a = b = 109.36, c = 80.45 Å. The data appeared to be twinned, producing apparent diffraction symmetry I422. The tetragonal symmetry of the unit cell and diffraction for the crystals of the LH2 complex from this species reveal that this complex is an octamer. PMID:24915099

Crystallization and preliminary X-ray study of a (2R,3R)-2,3-butanediol dehydrogenase from Bacillus coagulans 2-6.

PubMed

Miao, Xiangzhi; Huang, Xianhui; Zhang, Guofang; Zhao, Xiufang; Zhu, Xianming; Dong, Hui

2013-10-01

(2R,3R)-2,3-Butanediol dehydrogenase (R,R-BDH) from Bacillus coagulans 2-6 is a zinc-dependent medium-chain alcohol dehydrogenase. Recombinant R,R-BDH with a His6 tag at the C-terminus was expressed in Escherichia coli BL21 (DE3) cells and purified by Ni2+-chelating affinity and size-exclusion chromatography. Crystals were grown by the hanging-drop vapour-diffusion method at 289 K. The crystallization condition consisted of 8%(v/v) Tacsimate pH 4.6, 18%(w/v) polyethylene glycol 3350. The crystal diffracted to 2.8 Å resolution in the orthorhombic space group P2₁2₁2₁, with unit-cell parameters a=88.35, b=128.73, c=131.03 Å.

Nonlinear response of silicon photonic crystal microresonators excited via an integrated waveguide and fiber taper.

PubMed

Barclay, Paul; Srinivasan, Kartik; Painter, Oskar

2005-02-07

A technique is demonstrated which efficiently transfers light between a tapered standard single-mode optical fiber and a high-Q, ultra-small mode volume, silicon photonic crystal resonant cavity. Cavity mode quality factors of 4.7x10(4) are measured, and a total fiber-to-cavity coupling efficiency of 44% is demonstrated. Using this efficient cavity input and output channel, the steady-state nonlinear absorption and dispersion of the photonic crystal cavity is studied. Optical bistability is observed for fiber input powers as low as 250 microW, corresponding to a dropped power of 100 microW and 3 fJ of stored cavity energy. A high-density effective free-carrier lifetime for these silicon photonic crystal resonators of ~ 0.5 ns is also estimated from power dependent loss and dispersion measurements.

Laboratory studies of crystal growth in magma

NASA Astrophysics Data System (ADS)

Hammer, J. E.; Welsch, B. T.; First, E.; Shea, T.

2012-12-01

The proportions, compositions, and interrelationships among crystalline phases and glasses in volcanic rocks cryptically record pre-eruptive intensive conditions, the timing of changes in crystallization environment, and the devolatilization history of eruptive ascent. These parameters are recognized as important monitoring tools at active volcanoes and interpreting geologic events at prehistoric and remote eruptions, thus motivating our attempts to understand the information preserved in crystals through an experimental appoach. We are performing laboratory experiments in mafic, felsic, and intermediate composition magmas to study the mechanisms of crystal growth in thermochemical environments relevant to volcanic environments. We target features common to natural crystals in igneous rocks for our experimental studies of rapid crystal growth phenomena: (1) Surface curvature. Do curved interfaces and spongy cores represent evidence of dissolution (i.e., are they corrosion features), or do they record the transition from dendritic to polyhedral morphology? (2) Trapped melt inclusions. Do trapped liquids represent bulk (i.e., far-field) liquids, boundary layer liquids, or something intermediate, depending on individual species diffusivity? What sequence of crystal growth rates leads to preservation of sealed melt inclusions? (3) Subgrain boundaries. Natural phenocrysts commonly exhibit tabular subgrain regions distinguished by small angle lattice misorientations or "dislocation lamellae" and undulatory extinction. Might these crystal defects be produced as dendrites undergo ripening? (4) Clusters. Contacting clusters of polymineralic crystals are the building blocks of cumulates, and are ubiquitous features of mafic volcanic rocks. Are plagioclase and clinopyroxene aligned crystallographically, suggesting an epitaxial (surface energy) relationship? (5) Log-normal size distribution. What synthetic cooling histories produce "natural" distributions of crystal sizes, and are phenocrystic textures uniquely attributed to staged cooling? In addition, we seek to explore the limitations of the experimental approach. Which aspects of natural crystallization sequences are adequately reproduced in experimental charges, and which are compromised by the obligatory reduced temporal and spatial scales of crystal growth experiments? What are the implications of synthetic starting materials and thermal pre-treatments for nucleation, growth, heterophase equilibria, and textural maturation?

A discrete twin-boundary approach for simulating the magneto-mechanical response of Ni-Mn-Ga

NASA Astrophysics Data System (ADS)

Faran, Eilon; Shilo, Doron

2016-09-01

The design and optimization of ferromagnetic shape memory alloys (FSMA)-based devices require quantitative understanding of the dynamics of twin boundaries within these materials. Here, we present a discrete twin boundary modeling approach for simulating the behavior of an FSMA Ni-Mn-Ga crystal under combined magneto-mechanical loading conditions. The model is based on experimentally measured kinetic relations that describe the motion of individual twin boundaries over a wide range of velocities. The resulting calculations capture the dynamic response of Ni-Mn-Ga and reveal the relations between fundamental material parameters and actuation performance at different frequencies of the magnetic field. In particular, we show that at high field rates, the magnitude of the lattice barrier that resists twin boundary motion is the important property that determines the level of actuation strain, while the contribution of twinning stress property is minor. Consequently, type II twin boundaries, whose lattice barrier is smaller compared to type I, are expected to show better actuation performance at high rates, irrespective of the differences in the twinning stress property between the two boundary types. In addition, the simulation enables optimization of the actuation strain of a Ni-Mn-Ga crystal by adjusting the magnitude of the bias mechanical stress, thus providing direct guidelines for the design of actuating devices. Finally, we show that the use of a linear kinetic law for simulating the twinning-based response is inadequate and results in incorrect predictions.

Investigation of Dispersed and Dispersed Annular (rivulet or Thin Film) Flow Phase Separation in Tees.

NASA Astrophysics Data System (ADS)

McCreery, Glenn Ernest

An experimental and analytical investigation of dispersed and dispersed-annular (rivulet or thin film) flow phase separation in tees has been successfully completed. The research was directed at, but is not specific to, determining flow conditions, following a loss of coolant accident, in the large rectangular passageways leading to vacuum buildings in the containment envelope of some CANDU nuclear reactors. The primary objectives of the research were to: (1) obtain experimental data to help formulate and test mechanistic analytical models of phase separation, and (2) develop the analytical models in computer programs which predict phase separation from upstream flow and pressure conditions and downstream and side branch pressure boundary conditions. To meet these objectives an air-water experimental apparatus was constructed, and consists of large air blowers attached to a long rectangular duct leading to a tee in the horizontal plane. A variety of phenomena was investigated including, for comparison with computer predictions, air streamlines and eddy boundary geometry, drop size spectra, macroscopic mass balances, liquid rivulet pathlines, and trajectories of drops of known size and velocity. Four separate computer programs were developed to analyze phase separation. Three of the programs are used sequentially to calculate dispersed mist phase separation in a tee. The fourth is used to calculate rivulet or thin film pathlines. Macroscopic mass balances are calculated from a summation of mass balances for drops with representative sizes (and masses) spaced across the drop size spectrum. The programs are tested against experimental data, and accurately predict gas flow fields, drop trajectories, rivulet pathlines and macroscopic mass balances. In addition to development of the computer programs, analysis was performed to specify the scaling of dispersed mist and rivulet or thin film flow, to investigate pressure losses in tees, and the inter-relationship of loss coefficients, contraction coefficients, and eddy geometry. The important transient effects of liquid storage in eddies were also analyzed.