Comparative analyses of CTCF and BORIS occupancies uncover two distinct classes of CTCF binding genomic regions.

PubMed

Pugacheva, Elena M; Rivero-Hinojosa, Samuel; Espinoza, Celso A; Méndez-Catalá, Claudia Fabiola; Kang, Sungyun; Suzuki, Teruhiko; Kosaka-Suzuki, Natsuki; Robinson, Susan; Nagarajan, Vijayaraj; Ye, Zhen; Boukaba, Abdelhalim; Rasko, John E J; Strunnikov, Alexander V; Loukinov, Dmitri; Ren, Bing; Lobanenkov, Victor V

2015-08-14

CTCF and BORIS (CTCFL), two paralogous mammalian proteins sharing nearly identical DNA binding domains, are thought to function in a mutually exclusive manner in DNA binding and transcriptional regulation. Here we show that these two proteins co-occupy a specific subset of regulatory elements consisting of clustered CTCF binding motifs (termed 2xCTSes). BORIS occupancy at 2xCTSes is largely invariant in BORIS-positive cancer cells, with the genomic pattern recapitulating the germline-specific BORIS binding to chromatin. In contrast to the single-motif CTCF target sites (1xCTSes), the 2xCTS elements are preferentially found at active promoters and enhancers, both in cancer and germ cells. 2xCTSes are also enriched in genomic regions that escape histone to protamine replacement in human and mouse sperm. Depletion of the BORIS gene leads to altered transcription of a large number of genes and the differentiation of K562 cells, while the ectopic expression of this CTCF paralog leads to specific changes in transcription in MCF7 cells. We discover two functionally and structurally different classes of CTCF binding regions, 2xCTSes and 1xCTSes, revealed by their predisposition to bind BORIS. We propose that 2xCTSes play key roles in the transcriptional program of cancer and germ cells.

PARP1 restricts Epstein Barr Virus lytic reactivation by binding the BZLF1 promoter.

PubMed

Lupey-Green, Lena N; Moquin, Stephanie A; Martin, Kayla A; McDevitt, Shane M; Hulse, Michael; Caruso, Lisa B; Pomerantz, Richard T; Miranda, Jj L; Tempera, Italo

2017-07-01

The Epstein Barr virus (EBV) genome persists in infected host cells as a chromatinized episome and is subject to chromatin-mediated regulation. Binding of the host insulator protein CTCF to the EBV genome has an established role in maintaining viral latency type, and in other herpesviruses, loss of CTCF binding at specific regions correlates with viral reactivation. Here, we demonstrate that binding of PARP1, an important cofactor of CTCF, at the BZLF1 lytic switch promoter restricts EBV reactivation. Knockdown of PARP1 in the Akata-EBV cell line significantly increases viral copy number and lytic protein expression. Interestingly, CTCF knockdown has no effect on viral reactivation, and CTCF binding across the EBV genome is largely unchanged following reactivation. Moreover, EBV reactivation attenuates PARP activity, and Zta expression alone is sufficient to decrease PARP activity. Here we demonstrate a restrictive function of PARP1 in EBV lytic reactivation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

NASA Astrophysics Data System (ADS)

Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

2017-02-01

Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

PubMed Central

Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf , Yvonne N.

2017-01-01

Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin. PMID:28150704

The retrovirus HTLV-1 inserts an ectopic CTCF-binding site into the human genome.

PubMed

Satou, Yorifumi; Miyazato, Paola; Ishihara, Ko; Yaguchi, Hiroko; Melamed, Anat; Miura, Michi; Fukuda, Asami; Nosaka, Kisato; Watanabe, Takehisa; Rowan, Aileen G; Nakao, Mitsuyoshi; Bangham, Charles R M

2016-03-15

Human T-lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes malignant and inflammatory diseases in ∼10% of infected people. A typical host has between 10(4) and 10(5) clones of HTLV-1-infected T lymphocytes, each clone distinguished by the genomic integration site of the single-copy HTLV-1 provirus. The HTLV-1 bZIP (HBZ) factor gene is constitutively expressed from the minus strand of the provirus, whereas plus-strand expression, required for viral propagation to uninfected cells, is suppressed or intermittent in vivo, allowing escape from host immune surveillance. It remains unknown what regulates this pattern of proviral transcription and latency. Here, we show that CTCF, a key regulator of chromatin structure and function, binds to the provirus at a sharp border in epigenetic modifications in the pX region of the HTLV-1 provirus in T cells naturally infected with HTLV-1. CTCF is a zinc-finger protein that binds to an insulator region in genomic DNA and plays a fundamental role in controlling higher order chromatin structure and gene expression in vertebrate cells. We show that CTCF bound to HTLV-1 acts as an enhancer blocker, regulates HTLV-1 mRNA splicing, and forms long-distance interactions with flanking host chromatin. CTCF-binding sites (CTCF-BSs) have been propagated throughout the genome by transposons in certain primate lineages, but CTCF binding has not previously been described in present-day exogenous retroviruses. The presence of an ectopic CTCF-BS introduced by the retrovirus in tens of thousands of genomic locations has the potential to cause widespread abnormalities in host cell chromatin structure and gene expression.

High-resolution mapping of chromatin packaging in mouse embryonic stem cells and sperm.

PubMed

Carone, Benjamin R; Hung, Jui-Hung; Hainer, Sarah J; Chou, Min-Te; Carone, Dawn M; Weng, Zhiping; Fazzio, Thomas G; Rando, Oliver J

2014-07-14

Mammalian embryonic stem cells (ESCs) and sperm exhibit unusual chromatin packaging that plays important roles in cellular function. Here, we extend a recently developed technique, based on deep paired-end sequencing of lightly digested chromatin, to assess footprints of nucleosomes and other DNA-binding proteins genome-wide in murine ESCs and sperm. In ESCs, we recover well-characterized features of chromatin such as promoter nucleosome depletion and further identify widespread footprints of sequence-specific DNA-binding proteins such as CTCF, which we validate in knockdown studies. We document global differences in nuclease accessibility between ESCs and sperm, finding that the majority of histone retention in sperm preferentially occurs in large gene-poor genomic regions, with only a small subset of nucleosomes being retained over promoters of developmental regulators. Finally, we describe evidence that CTCF remains associated with the genome in mature sperm, where it could play a role in organizing the sperm genome. Copyright © 2014 Elsevier Inc. All rights reserved.

Targeting CTCF to Control Virus Gene Expression: A Common Theme amongst Diverse DNA Viruses.

PubMed

Pentland, Ieisha; Parish, Joanna L

2015-07-06

All viruses target host cell factors for successful life cycle completion. Transcriptional control of DNA viruses by host cell factors is important in the temporal and spatial regulation of virus gene expression. Many of these factors are recruited to enhance virus gene expression and thereby increase virus production, but host cell factors can also restrict virus gene expression and productivity of infection. CCCTC binding factor (CTCF) is a host cell DNA binding protein important for the regulation of genomic chromatin boundaries, transcriptional control and enhancer element usage. CTCF also functions in RNA polymerase II regulation and in doing so can influence co-transcriptional splicing events. Several DNA viruses, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV) and human papillomavirus (HPV) utilize CTCF to control virus gene expression and many studies have highlighted a role for CTCF in the persistence of these diverse oncogenic viruses. CTCF can both enhance and repress virus gene expression and in some cases CTCF increases the complexity of alternatively spliced transcripts. This review article will discuss the function of CTCF in the life cycle of DNA viruses in the context of known host cell CTCF functions.

CCCTC-binding Factor Mediates Effects of Glucose On Beta Cell Survival

PubMed Central

Tsui, Shanli; Dai, Wei; Lu, Luo

2013-01-01

Objectives Pancreatic islet β-cell survival is important in regulating insulin activities and maintaining glucose homeostasis. Recently, Pax6 has been shown to be essential for many vital functions in β-cells, though the molecular mechanisms of its regulation in β-cells remain unclear. The present study investigates the novel effects of glucose- and insulin-induced CTCF activity on Pax6 gene expression as well as the subsequent effects of insulin-activated signaling pathways on β-cell proliferation. Material and methods Pancreatic β-TC-1-6 cells were cultured in DMEM medium and stimulated with high concentrations of glucose (5 to 125 mM) and cell viability was assessed by MTT assays. The effect of CTCF on Pax6 was evaluated in high glucose-induced and CCCTC-binding Factor (CTCF)/Erk suppressed cells by promoter reporter and Western analyses. Results Increases in glucose and insulin concentrations up-regulated CTCF and consequently down-regulated Pax6 in β-cell survival and proliferation. Knocking-down CTCF directly affected Pax6 transcription through CTCF binding and blocked the response to glucose. Altered Erk activity mediated the effects of CTCF on controlling Pax6 expression, which partially regulates β-cell proliferation. Conclusions CTCF functions as a molecular mediator between insulin-induced upstream Erk signaling and Pax6 expression in pancreatic β-cells. This pathway may contribute to regulation of β-cell survival and proliferation. PMID:24354619

Selective inhibition of CTCF binding by iAs directs TET-mediated reprogramming of 5-hydroxymethylation patterns in iAs-transformed cells

PubMed Central

Rea, Matthew; Gripshover, Tyler; Fondufe-Mittendorf, Yvonne

2017-01-01

Methylation at cytosine (5mC) is a fundamental epigenetic DNA modification recently associated with iAs-mediated carcinogenesis. In contrast, the role of 5-hydroxymethylcytosine (5hmC), the oxidation product of 5mC in iAs-mediated carcinogenesis is unknown. Here we assess the hydroxymethylome in iAs-transformed cells, showing that dynamic modulation of hydroxymethylated DNA is associated with specific transcriptional networks. Moreover, this pathologic iAs-mediated carcinogenesis is characterized by a shift toward a higher hydroxymethylation pattern genome-wide. At specific promoters, hydroxymethylation correlated with increased gene expression. Furthermore, this increase in hydroxymethylation occurs concurrently with an upregulation of ten-eleven translocation (TET) enzymes that oxidize 5-methylcytosine (5mC) in DNA. To gain an understanding into how iAs might impact TET expression, we found that iAs inhibits the binding of CTCF at the proximal, weak CTCF binding sites of the TET1 and TET2 gene promoters and enhances CTCF binding at the stronger distal binding site. Further analyses suggest that this distal site acts as an enhancer, thus high CTCF occupancy at the enhancer region of TET1 and TET2 possibly drives their high expression in iAs-transformed cells. These results have major implications in understanding the impact of differential CTCF binding, genome architecture and its consequences in iAs-mediated pathogenesis. PMID:29175454

A TAD boundary is preserved upon deletion of the CTCF-rich Firre locus.

PubMed

Barutcu, A Rasim; Maass, Philipp G; Lewandowski, Jordan P; Weiner, Catherine L; Rinn, John L

2018-04-13

The binding of the transcriptional regulator CTCF to the genome has been implicated in the formation of topologically associated domains (TADs). However, the general mechanisms of folding the genome into TADs are not fully understood. Here we test the effects of deleting a CTCF-rich locus on TAD boundary formation. Using genome-wide chromosome conformation capture (Hi-C), we focus on one TAD boundary on chromosome X harboring ~ 15 CTCF binding sites and located at the long non-coding RNA (lncRNA) locus Firre. Specifically, this TAD boundary is invariant across evolution, tissues, and temporal dynamics of X-chromosome inactivation. We demonstrate that neither the deletion of this locus nor the ectopic insertion of Firre cDNA or its ectopic expression are sufficient to alter TADs in a sex-specific or allele-specific manner. In contrast, Firre's deletion disrupts the chromatin super-loop formation of the inactive X-chromosome. Collectively, our findings suggest that apart from CTCF binding, additional mechanisms may play roles in establishing TAD boundary formation.

CTCF Mediates Effect of Insulin On Glucagon Expression

PubMed Central

Tsui, Shanli; Gao, Jie; Wang, Charles; Lu, Luo

2013-01-01

Pancreatic islet α-cell development and glucagon production are mainly regulated by Pax6 in the homeobox gene families. However, the molecular mechanism fine-tuning the regulation of these events in α-cell still remains unclear. In ocular cells, Pax6 transcription is regulated by CTCF through its binding to specific sites in Pax6 promoter. In this study, CTCF-mediated regulations of islet α-cell development and glucagon production were investigated in both CTCF transgenic mice and α-TC-1-6 cells. Over-expression of CTCF in transgenic mice affected development of pancreatic islets by significantly suppressing α-cell population in both embryonic and adult pancreases. The effect of CTCF on Pax6 gene expression and subsequently, on pro-glucagon production was however, examined in pancreatic islet α-cells. Over-expression and knock-down of CTCF directly affected Pax6 expression. More importantly, the CTCF binding sites upstream from Pax6 p0 promoter were required for regulating p0 promoter activity in islet α-cells. Stimulation of α-cells with insulin resulted in a significant increase in CTCF expression and a decrease in Pax6 expression, and consequently suppressed pro-glucagon expression. In contrast, these insulin-induced effects were blocked by knockdown of CTCF mRNA with specific siRNA in α-cells. Altogether, our results demonstrated for the first time that CTCF functions as a switch-like molecule between the insulin signaling and the regulations of Pax6 and glucagon expression in pancreatic islet α-cells. PMID:22426149

Restraint of angiogenesis by zinc finger transcription factor CTCF-dependent chromatin insulation

PubMed Central

Tang, Ming; Chen, Bo; Pardo, Carolina; Pampo, Christine; Chen, Jing; Lien, Ching-Ling; Wu, Lizi; Wang, Heiman; Yao, Kai; Oh, S. Paul; Seto, Edward; Smith, Lois E. H.; Siemann, Dietmar W.; Kladde, Michael P.; Cepko, Constance L.; Lu, Jianrong

2011-01-01

Angiogenesis is meticulously controlled by a fine balance between positive and negative regulatory activities. Vascular endothelial growth factor (VEGF) is a predominant angiogenic factor and its dosage is precisely regulated during normal vascular formation. In cancer, VEGF is commonly overproduced, resulting in abnormal neovascularization. VEGF is induced in response to various stimuli including hypoxia; however, very little is known about the mechanisms that confine its induction to ensure proper angiogenesis. Chromatin insulation is a key transcription mechanism that prevents promiscuous gene activation by interfering with the action of enhancers. Here we show that the chromatin insulator-binding factor CTCF binds to the proximal promoter of VEGF. Consistent with the enhancer-blocking mode of chromatin insulators, CTCF has little effect on basal expression of VEGF but specifically affects its activation by enhancers. CTCF knockdown cells are sensitized for induction of VEGF and exhibit elevated proangiogenic potential. Cancer-derived CTCF missense mutants are mostly defective in blocking enhancers at the VEGF locus. Moreover, during mouse retinal development, depletion of CTCF causes excess angiogenesis. Therefore, CTCF-mediated chromatin insulation acts as a crucial safeguard against hyperactivation of angiogenesis. PMID:21896759

Cohesin regulates tissue-specific expression by stabilizing highly occupied cis-regulatory modules

PubMed Central

Faure, Andre J.; Schmidt, Dominic; Watt, Stephen; Schwalie, Petra C.; Wilson, Michael D.; Xu, Huiling; Ramsay, Robert G.; Odom, Duncan T.; Flicek, Paul

2012-01-01

The cohesin protein complex contributes to transcriptional regulation in a CTCF-independent manner by colocalizing with master regulators at tissue-specific loci. The regulation of transcription involves the concerted action of multiple transcription factors (TFs) and cohesin's role in this context of combinatorial TF binding remains unexplored. To investigate cohesin-non-CTCF (CNC) binding events in vivo we mapped cohesin and CTCF, as well as a collection of tissue-specific and ubiquitous transcriptional regulators using ChIP-seq in primary mouse liver. We observe a positive correlation between the number of distinct TFs bound and the presence of CNC sites. In contrast to regions of the genome where cohesin and CTCF colocalize, CNC sites coincide with the binding of master regulators and enhancer-markers and are significantly associated with liver-specific expressed genes. We also show that cohesin presence partially explains the commonly observed discrepancy between TF motif score and ChIP signal. Evidence from these statistical analyses in wild-type cells, and comparisons to maps of TF binding in Rad21-cohesin haploinsufficient mouse liver, suggests that cohesin helps to stabilize large protein–DNA complexes. Finally, we observe that the presence of mirrored CTCF binding events at promoters and their nearby cohesin-bound enhancers is associated with elevated expression levels. PMID:22780989

Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping

PubMed Central

Kernohan, Kristin D.; Vernimmen, Douglas; Gloor, Gregory B.; Bérubé, Nathalie G.

2014-01-01

ATRX and MeCP2 belong to an expanding group of chromatin-associated proteins implicated in human neurodevelopmental disorders, although their gene-regulatory activities are not fully resolved. Loss of ATRX prevents full repression of an imprinted gene network in the postnatal brain and in this study we address the mechanistic aspects of this regulation. We show that ATRX binds many imprinted domains individually but that transient co-localization between imprinted domains in the nuclei of neurons does not require ATRX. We demonstrate that MeCP2 is required for ATRX recruitment and that deficiency of either ATRX or MeCP2 causes decreased frequency of long-range chromatin interactions associated with altered nucleosome density at CTCF-binding sites and reduced CTCF occupancy. These findings indicate that MeCP2 and ATRX regulate gene expression at a subset of imprinted domains by maintaining a nucleosome configuration conducive to CTCF binding and to the maintenance of higher order chromatin structure. PMID:24990380

CTCF genetic alterations in endometrial carcinoma are pro-tumorigenic

PubMed Central

Marshall, A D; Bailey, C G; Champ, K; Vellozzi, M; O'Young, P; Metierre, C; Feng, Y; Thoeng, A; Richards, A M; Schmitz, U; Biro, M; Jayasinghe, R; Ding, L; Anderson, L; Mardis, E R; Rasko, J E J

2017-01-01

CTCF is a haploinsufficient tumour suppressor gene with diverse normal functions in genome structure and gene regulation. However the mechanism by which CTCF haploinsufficiency contributes to cancer development is not well understood. CTCF is frequently mutated in endometrial cancer. Here we show that most CTCF mutations effectively result in CTCF haploinsufficiency through nonsense-mediated decay of mutant transcripts, or loss-of-function missense mutation. Conversely, we identified a recurrent CTCF mutation K365T, which alters a DNA binding residue, and acts as a gain-of-function mutation enhancing cell survival. CTCF genetic deletion occurs predominantly in poor prognosis serous subtype tumours, and this genetic deletion is associated with poor overall survival. In addition, we have shown that CTCF haploinsufficiency also occurs in poor prognosis endometrial clear cell carcinomas and has some association with endometrial cancer relapse and metastasis. Using shRNA targeting CTCF to recapitulate CTCF haploinsufficiency, we have identified a novel role for CTCF in the regulation of cellular polarity of endometrial glandular epithelium. Overall, we have identified two novel pro-tumorigenic roles (promoting cell survival and altering cell polarity) for genetic alterations of CTCF in endometrial cancer. PMID:28319062

CRISPR Inversion of CTCF Sites Alters Genome Topology and Enhancer/Promoter Function

PubMed Central

Guo, Ya; Xu, Quan; Canzio, Daniele; Shou, Jia; Li, Jinhuan; Gorkin, David U.; Jung, Inkyung; Wu, Haiyang; Zhai, Yanan; Tang, Yuanxiao; Lu, Yichao; Wu, Yonghu; Jia, Zhilian; Li, Wei; Zhang, Michael Q.; Ren, Bing; Krainer, Adrian R.; Maniatis, Tom; Wu, Qiang

2015-01-01

SUMMARY CTCF/cohesin play a central role in insulator function and higher-order chromatin organization of mammalian genomes. Recent studies identified a correlation between the orientation of CTCF-binding sites (CBSs) and chromatin loops. To test the functional significance of this observation, we combined CRISPR/Cas9-based genomic-DNA-fragment editing with chromosome-conformation-capture experiments to show that the location and relative orientations of CBSs determine the specificity of long-range chromatin looping in mammalian genomes, using protocadherin (Pcdh) and β-globin as model genes. Inversion of CBS elements within the Pcdh enhancer reconfigures the topology of chromatin loops between the distal enhancer and target promoters, and alters gene-expression patterns. Thus, although enhancers can function in an orientation-independent manner in reporter assays, in the native chromosome context the orientation of at least some enhancers carrying CBSs can determine both the architecture of topological chromatin domains and enhancer/promoter specificity. The findings reveal how 3D chromosome architecture can be encoded by genome sequence. PMID:26276636

EAST Organizes Drosophila Insulator Proteins in the Interchromosomal Nuclear Compartment and Modulates CP190 Binding to Chromatin

PubMed Central

Golovnin, Anton; Melnikova, Larisa; Shapovalov, Igor; Kostyuchenko, Margarita; Georgiev, Pavel

2015-01-01

Recent data suggest that insulators organize chromatin architecture in the nucleus. The best studied Drosophila insulator proteins, dCTCF (a homolog of the vertebrate insulator protein CTCF) and Su(Hw), are DNA-binding zinc finger proteins. Different isoforms of the BTB-containing protein Mod(mdg4) interact with Su(Hw) and dCTCF. The CP190 protein is a cofactor for the dCTCF and Su(Hw) insulators. CP190 is required for the functional activity of insulator proteins and is involved in the aggregation of the insulator proteins into specific structures named nuclear speckles. Here, we have shown that the nuclear distribution of CP190 is dependent on the level of EAST protein, an essential component of the interchromatin compartment. EAST interacts with CP190 and Mod(mdg4)-67.2 proteins in vitro and in vivo. Over-expression of EAST in S2 cells leads to an extrusion of the CP190 from the insulator bodies containing Su(Hw), Mod(mdg4)-67.2, and dCTCF. In consistent with the role of the insulator bodies in assembly of protein complexes, EAST over-expression led to a striking decrease of the CP190 binding with the dCTCF and Su(Hw) dependent insulators and promoters. These results suggest that EAST is involved in the regulation of CP190 nuclear localization. PMID:26489095

Transcription factor profiling reveals molecular choreography and key regulators of human retrotransposon expression

PubMed Central

Sun, Xiaoji; Wang, Xuya; Tang, Zuojian; Grivainis, Mark; Kahler, David; Yun, Chi; Mita, Paolo; Fenyö, David

2018-01-01

Transposable elements (TEs) represent a substantial fraction of many eukaryotic genomes, and transcriptional regulation of these factors is important to determine TE activities in human cells. However, due to the repetitive nature of TEs, identifying transcription factor (TF)-binding sites from ChIP-sequencing (ChIP-seq) datasets is challenging. Current algorithms are focused on subtle differences between TE copies and thus bias the analysis to relatively old and inactive TEs. Here we describe an approach termed “MapRRCon” (mapping repeat reads to a consensus) which allows us to identify proteins binding to TE DNA sequences by mapping ChIP-seq reads to the TE consensus sequence after whole-genome alignment. Although this method does not assign binding sites to individual insertions in the genome, it provides a landscape of interacting TFs by capturing factors that bind to TEs under various conditions. We applied this method to screen TFs’ interaction with L1 in human cells/tissues using ENCODE ChIP-seq datasets and identified 178 of the 512 TFs tested as bound to L1 in at least one biological condition with most of them (138) localized to the promoter. Among these L1-binding factors, we focused on Myc and CTCF, as they play important roles in cancer progression and 3D chromatin structure formation. Furthermore, we explored the transcriptomes of The Cancer Genome Atlas breast and ovarian tumor samples in which a consistent anti-/correlation between L1 and Myc/CTCF expression was observed, suggesting that these two factors may play roles in regulating L1 transcription during the development of such tumors. PMID:29802231

In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

PubMed Central

Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

2017-01-01

In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

Epigenetic Alterations Associated With CCCTC-Binding Factor Deregulation in Prostate Cancer

DTIC Science & Technology

2011-07-01

HPV16 E6 and/or E7 prostate cell lines. We have established stable cell lines containing inducible CTCF shRNA in pTRIPZ vector in PPC-1, LNCaPs, 293T...and non-tumorigenic HPV16 E6 and/or E7 prostate cell lines. We are in process of conducting CTCF knockdown experiments using transient transfection...which express high levels of endogenous CTCF and in non- tumorigenic HPV16 E6 and/or E7 prostate cell lines. We see efficient knockdown of CTCF

CCCTC-Binding Factor Locks Premature IgH Germline Transcription and Restrains Class Switch Recombination

PubMed Central

Marina-Zárate, Ester; Pérez-García, Arantxa; Ramiro, Almudena R.

2017-01-01

In response to antigenic stimulation B cells undergo class switch recombination (CSR) at the immunoglobulin heavy chain (IgH) to replace the primary IgM/IgD isotypes by IgG, IgE, or IgA. CSR is initiated by activation-induced cytidine deaminase (AID) through the deamination of cytosine residues at the switch (S) regions of IgH. B cell stimulation promotes germline transcription (GLT) of specific S regions, a necessary event prior to CSR because it facilitates AID access to S regions. Here, we show that CCCTC-binding factor (CTCF)-deficient mice are severely impaired in the generation of germinal center B cells and plasma cells after immunization in vivo, most likely due to impaired cell survival. Importantly, we find that CTCF-deficient B cells have an increased rate of CSR under various stimulation conditions in vitro. This effect is not secondary to altered cell proliferation or AID expression in CTCF-deficient cells. Instead, we find that CTCF-deficient B cells harbor an increased mutation frequency at switch regions, probably reflecting an increased accessibility of AID to IgH in the absence of CTCF. Moreover, CTCF deficiency triggers premature GLT of S regions in naïve B cells. Our results indicate that CTCF restricts CSR by enforcing GLT silencing and limiting AID access to IgH. PMID:28928744

CTCF and cohesin regulate chromatin loop stability with distinct dynamics

PubMed Central

Hansen, Anders S; Pustova, Iryna; Cattoglio, Claudia; Tjian, Robert; Darzacq, Xavier

2017-01-01

Folding of mammalian genomes into spatial domains is critical for gene regulation. The insulator protein CTCF and cohesin control domain location by folding domains into loop structures, which are widely thought to be stable. Combining genomic and biochemical approaches we show that CTCF and cohesin co-occupy the same sites and physically interact as a biochemically stable complex. However, using single-molecule imaging we find that CTCF binds chromatin much more dynamically than cohesin (~1–2 min vs. ~22 min residence time). Moreover, after unbinding, CTCF quickly rebinds another cognate site unlike cohesin for which the search process is long (~1 min vs. ~33 min). Thus, CTCF and cohesin form a rapidly exchanging 'dynamic complex' rather than a typical stable complex. Since CTCF and cohesin are required for loop domain formation, our results suggest that chromatin loops are dynamic and frequently break and reform throughout the cell cycle. DOI: http://dx.doi.org/10.7554/eLife.25776.001 PMID:28467304

CTCF orchestrates the germinal centre transcriptional program and prevents premature plasma cell differentiation

PubMed Central

Pérez-García, Arantxa; Marina-Zárate, Ester; Álvarez-Prado, Ángel F.; Ligos, Jose M.; Galjart, Niels; Ramiro, Almudena R.

2017-01-01

In germinal centres (GC) mature B cells undergo intense proliferation and immunoglobulin gene modification before they differentiate into memory B cells or long-lived plasma cells (PC). GC B-cell-to-PC transition involves a major transcriptional switch that promotes a halt in cell proliferation and the production of secreted immunoglobulins. Here we show that the CCCTC-binding factor (CTCF) is required for the GC reaction in vivo, whereas in vitro the requirement for CTCF is not universal and instead depends on the pathways used for B-cell activation. CTCF maintains the GC transcriptional programme, allows a high proliferation rate, and represses the expression of Blimp-1, the master regulator of PC differentiation. Restoration of Blimp-1 levels partially rescues the proliferation defect of CTCF-deficient B cells. Thus, our data reveal an essential function of CTCF in maintaining the GC transcriptional programme and preventing premature PC differentiation. PMID:28677680

Multiple Nucleosome Positioning Sites Regulate the CTCF-Mediated Insulator Function of the H19 Imprinting Control Region†

PubMed Central

Kanduri, Meena; Kanduri, Chandrasekhar; Mariano, Piero; Vostrov, Alexander A.; Quitschke, Wolfgang; Lobanenkov, Victor; Ohlsson, Rolf

2002-01-01

The 5′ region of the H19 gene harbors a methylation-sensitive chromatin insulator within an imprinting control region (ICR). Insertional mutagenesis in combination with episomal assays identified nucleosome positioning sequences (NPSs) that set the stage for the remarkably precise distribution of the four target sites for the chromatin insulator protein CTCF to nucleosome linker sequences in the H19 ICR. Changing positions of the NPSs resulted in loss of both CTCF target site occupancy and insulator function, suggesting that the NPSs optimize the fidelity of the insulator function. We propose that the NPSs ensure the fidelity of the repressed status of the maternal Igf2 allele during development by constitutively maintaining availability of the CTCF target sites. PMID:11971967

Identification and analysis of pig chimeric mRNAs using RNA sequencing data

PubMed Central

2012-01-01

Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

Complete Biallelic Insulation at the H19/Igf2 Imprinting Control Region Position Results in Fetal Growth Retardation and Perinatal Lethality

PubMed Central

Lee, Dong-Hoon; Singh, Purnima; Tsark, Walter M. K.; Szabó, Piroska E.

2010-01-01

Background The H19/Igf2 imprinting control region (ICR) functions as an insulator exclusively in the unmethylated maternal allele, where enhancer-blocking by CTCF protein prevents the interaction between the Igf2 promoter and the distant enhancers. DNA methylation inhibits CTCF binding in the paternal ICR allele. Two copies of the chicken β-globin insulator (ChβGI)2 are capable of substituting for the enhancer blocking function of the ICR. Insulation, however, now also occurs upon paternal inheritance, because unlike the H19 ICR, the (ChβGI)2 does not become methylated in fetal male germ cells. The (ChβGI)2 is a composite insulator, exhibiting enhancer blocking by CTCF and chromatin barrier functions by USF1 and VEZF1. We asked the question whether these barrier proteins protected the (ChβGI)2 sequences from methylation in the male germ line. Methodology/Principal Findings We genetically dissected the ChβGI in the mouse by deleting the binding sites USF1 and VEZF1. The methylation of the mutant versus normal (ChβGI)2 significantly increased from 11% to 32% in perinatal male germ cells, suggesting that the barrier proteins did have a role in protecting the (ChβGI)2 from methylation in the male germ line. Contrary to the H19 ICR, however, the mutant (mChβGI)2 lacked the potential to attain full de novo methylation in the germ line and to maintain methylation in the paternal allele in the soma, where it consequently functioned as a biallelic insulator. Unexpectedly, a stricter enhancer blocking was achieved by CTCF alone than by a combination of the CTCF, USF1 and VEZF1 sites, illustrated by undetectable Igf2 expression upon paternal transmission. Conclusions/Significance In this in vivo model, hypomethylation at the ICR position together with fetal growth retardation mimicked the human Silver-Russell syndrome. Importantly, late fetal/perinatal death occurred arguing that strict biallelic insulation at the H19/Igf2 ICR position is not tolerated in development. PMID:20838620

The insulation of genes from external enhancers and silencing chromatin

PubMed Central

Burgess-Beusse, Bonnie; Farrell, Catherine; Gaszner, Miklos; Litt, Michael; Mutskov, Vesco; Recillas-Targa, Felix; Simpson, Melanie; West, Adam; Felsenfeld, Gary

2002-01-01

Insulators are DNA sequence elements that can serve in some cases as barriers to protect a gene against the encroachment of adjacent inactive condensed chromatin. Some insulators also can act as blocking elements to protect against the activating influence of distal enhancers associated with other genes. Although most of the insulators identified so far derive from Drosophila, they also are found in vertebrates. An insulator at the 5′ end of the chicken β-globin locus marks a boundary between an open chromatin domain and a region of constitutively condensed chromatin. Detailed analysis of this element shows that it possesses both enhancer blocking activity and the ability to screen reporter genes against position effects. Enhancer blocking is associated with binding of the protein CTCF; sites that bind CTCF are found at other critical points in the genome. Protection against position effects involves other properties that appear to be associated with control of histone acetylation and methylation. Insulators thus are complex elements that can help to preserve the independent function of genes embedded in a genome in which they are surrounded by regulatory signals they must ignore. PMID:12154228

Fred Hutchinson Cancer Research Center (FHCRC1): Genetic Disruption of CTCF Destabilizes DNA Methylation | Office of Cancer Genomics

Cancer.gov

The CTD2 Center at Fred Hutchinson Cancer Research Center identified the DNA binding protein CTCF as a tumor suppressor and regulator of DNA methylation. Read the abstract Experimental Approaches Read the detailed Experimental Approaches

Fred Hutchinson Cancer Research Center (FHCRC-1): Genetic Disruption of CTCF Destabilizes DNA Methylation | Office of Cancer Genomics

Cancer.gov

The CTD2 Center at Fred Hutchinson Cancer Research Center identified the DNA binding protein CTCF as a tumor suppressor and regulator of DNA methylation. Read the abstract Experimental Approaches Read the detailed Experimental Approaches

Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

PubMed Central

Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin

2016-01-01

Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

PubMed

Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

2010-01-01

Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

PubMed

Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-08-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

PubMed Central

Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

2013-01-01

Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

The nucleotides responsible for the direct physical contact between the chromatin insulator protein CTCF and the H19 imprinting control region manifest parent of origin-specific long-distance insulation and methylation-free domains

PubMed Central

Pant, Vinod; Mariano, Piero; Kanduri, Chandrasekhar; Mattsson, Anita; Lobanenkov, Victor; Heuchel, Rainer; Ohlsson, Rolf

2003-01-01

The repression of the maternally inherited Igf2 allele has been proposed to depend on a methylation-sensitive chromatin insulator organized by the 11 zinc finger protein CTCF at the H19 imprinting control region (ICR). Here we document that point mutations of the nucleotides in physical contact with CTCF within the endogenous H19 ICR lead to loss of CTCF binding and Igf2 imprinting only when passaged through the female germline. This effect is accompanied by a significant loss of methylation protection of the maternally derived H19 ICR. Because CTCF interacts with other imprinting control regions, it emerges as a central factor responsible for interpreting and propagating gamete-derived epigenetic marks and for organizing epigenetically controlled expression domains. PMID:12629040

Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

PubMed Central

Glinsky, Gennadi V.

2015-01-01

Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

MeCP2 regulates Tet1-catalyzed demethylation, CTCF binding, and learning-dependent alternative splicing of the BDNF gene in Turtle

PubMed Central

Zheng, Zhaoqing; Ambigapathy, Ganesh; Keifer, Joyce

2017-01-01

MECP2 mutations underlying Rett syndrome cause widespread misregulation of gene expression. Functions for MeCP2 other than transcriptional are not well understood. In an ex vivo brain preparation from the pond turtle Trachemys scripta elegans, an intraexonic splicing event in the brain-derived neurotrophic factor (BDNF) gene generates a truncated mRNA transcript in naïve brain that is suppressed upon classical conditioning. MeCP2 and its partners, splicing factor Y-box binding protein 1 (YB-1) and methylcytosine dioxygenase 1 (Tet1), bind to BDNF chromatin in naïve but dissociate during conditioning; the dissociation correlating with decreased DNA methylation. Surprisingly, conditioning results in new occupancy of BDNF chromatin by DNA insulator protein CCCTC-binding factor (CTCF), which is associated with suppression of splicing in conditioning. Knockdown of MeCP2 shows it is instrumental for splicing and inhibits Tet1 and CTCF binding thereby negatively impacting DNA methylation and conditioning-dependent splicing regulation. Thus, mutations in MECP2 can have secondary effects on DNA methylation and alternative splicing. DOI: http://dx.doi.org/10.7554/eLife.25384.001 PMID:28594324

CTCF-Mediated and Pax6-Associated Gene Expression in Corneal Epithelial Cell-Specific Differentiation

PubMed Central

Tsui, Shanli; Wang, Jie; Wang, Ling; Dai, Wei; Lu, Luo

2016-01-01

Background The purpose of the study is to elicit the epigenetic mechanism involving CCCTC binding factor (CTCF)-mediated chromatin remodeling that regulates PAX6 gene interaction with differentiation-associated genes to control corneal epithelial differentiation. Methods Cell cycle progression and specific keratin expressions were measured to monitor changes of differentiation-induced primary human limbal stem/progenitor (HLS/P), human corneal epithelial (HCE) and human telomerase-immortalized corneal epithelial (HTCE) cells. PAX6-interactive and differentiation-associated genes in chromatin remodeling mediated by the epigenetic factor CTCF were detected by circular chromosome conformation capture (4C) and ChIP (Chromatin immunoprecipitation)-on-chip approaches, and verified by FISH (Fluorescent in situ hybridization). Furthermore, CTCF activities were altered by CTCF-shRNA to study the effect of CTCF on mediating interaction of Pax6 and differentiation-associated genes in corneal epithelial cell fate. Results Our results demonstrated that differentiation-induced human corneal epithelial cells expressed typical corneal epithelial characteristics including morphological changes, increased keratin12 expression and G0/G1 accumulations. Expressions of CTCF and PAX6 were suppressed and elevated following the process of differentiation, respectively. During corneal epithelial cell differentiation, differentiation-induced RCN1 and ADAM17 were found interacting with PAX6 in the process of CTCF-mediated chromatin remodeling detected by 4C and verified by ChIP-on-chip and FISH. Diminished CTCF mRNA with CTCF-shRNA in HTCE cells weakened the interaction of PAX6 gene in controlling RCN1/ADAM17 and enhanced early onset of the genes in cell differentiation. Conclusion Our results explain how epigenetic factor CTCF-mediated chromatin remodeling regulates interactions between eye-specific PAX6 and those genes that are induced/associated with cell differentiation to modulate corneal epithelial cell-specific differentiation. PMID:27583466

Enhanced B Cell Alloantigen Presentation and Its Epigenetic Dysregulation in Liver Transplant Rejection.

PubMed

Ningappa, M; Ashokkumar, C; Higgs, B W; Sun, Q; Jaffe, R; Mazariegos, G; Li, D; Weeks, D E; Subramaniam, S; Ferrell, R; Hakonarson, H; Sindhi, R

2016-02-01

T cell suppression prevents acute cellular rejection but causes life-threatening infections and malignancies. Previously, liver transplant (LTx) rejection in children was associated with the single-nucleotide polymorphism (SNP) rs9296068 upstream of the HLA-DOA gene. HLA-DOA inhibits B cell presentation of antigen, a potentially novel antirejection drug target. Using archived samples from 122 white pediatric LTx patients (including 77 described previously), we confirmed the association between rs9296068 and LTx rejection (p = 0.001, odds ratio [OR] 2.55). Next-generation sequencing revealed that the putative transcription factor (CCCTC binding factor [CTCF]) binding SNP locus rs2395304, in linkage disequilibrium with rs9296068 (D' 0.578, r(2) = 0.4), is also associated with LTx rejection (p = 0.008, OR 2.34). Furthermore, LTx rejection is associated with enhanced B cell presentation of donor antigen relative to HLA-nonidentical antigen in a novel cell-based assay and with a downregulated HLA-DOA gene in a subset of these children. In lymphoblastoid B (Raji) cells, rs2395304 coimmunoprecipitates with CTCF, and CTCF knockdown with morpholino antisense oligonucleotides enhances alloantigen presentation and downregulates the HLA-DOA gene, reproducing observations made with HLA-DOA knockdown and clinical rejection. Alloantigen presentation is suppressed by inhibitors of methylation and histone deacetylation, reproducing observations made during resolution of rejection. Enhanced donor antigen presentation by B cells and its epigenetic dysregulation via the HLA-DOA gene represent novel opportunities for surveillance and treatment of transplant rejection. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

Long noncoding RNA HOTTIP cooperates with CCCTC-binding factor to coordinate HOXA gene expression.

PubMed

Wang, Feng; Tang, Zhongqiong; Shao, Honglian; Guo, Jun; Tan, Tao; Dong, Yang; Lin, Lianbing

2018-06-12

The spatiotemporal control of HOX gene expression is dependent on positional identity and often correlated to their genomic location within each loci. Maintenance of HOX expression patterns is under complex transcriptional and epigenetic regulation, which is not well understood. Here we demonstrate that HOTTIP, a lincRNA transcribed from the 5' edge of the HOXA locus, physically associates with the CCCTC-binding factor (CTCF) that serves as an insulator by organizing HOXA cluster into disjoint domains, to cooperatively maintain the chromatin modifications of HOXA genes and thus coordinate the transcriptional activation of distal HOXA genes in human foreskin fibroblasts. Our results reveal the functional connection of HOTTIP and CTCF, and shed light on lincRNAs in gene activation and CTCF mediated chromatin organization. Copyright © 2018 Elsevier Inc. All rights reserved.

CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart.

PubMed

Gomez-Velazquez, Melisa; Badia-Careaga, Claudio; Lechuga-Vieco, Ana Victoria; Nieto-Arellano, Rocio; Tena, Juan J; Rollan, Isabel; Alvarez, Alba; Torroja, Carlos; Caceres, Eva F; Roy, Anna R; Galjart, Niels; Delgado-Olguin, Paul; Sanchez-Cabo, Fatima; Enriquez, Jose Antonio; Gomez-Skarmeta, Jose Luis; Manzanares, Miguel

2017-08-01

Cardiac progenitors are specified early in development and progressively differentiate and mature into fully functional cardiomyocytes. This process is controlled by an extensively studied transcriptional program. However, the regulatory events coordinating the progression of such program from development to maturation are largely unknown. Here, we show that the genome organizer CTCF is essential for cardiogenesis and that it mediates genomic interactions to coordinate cardiomyocyte differentiation and maturation in the developing heart. Inactivation of Ctcf in cardiac progenitor cells and their derivatives in vivo during development caused severe cardiac defects and death at embryonic day 12.5. Genome wide expression analysis in Ctcf mutant hearts revealed that genes controlling mitochondrial function and protein production, required for cardiomyocyte maturation, were upregulated. However, mitochondria from mutant cardiomyocytes do not mature properly. In contrast, multiple development regulatory genes near predicted heart enhancers, including genes in the IrxA cluster, were downregulated in Ctcf mutants, suggesting that CTCF promotes cardiomyocyte differentiation by facilitating enhancer-promoter interactions. Accordingly, loss of CTCF disrupts gene expression and chromatin interactions as shown by chromatin conformation capture followed by deep sequencing. Furthermore, CRISPR-mediated deletion of an intergenic CTCF site within the IrxA cluster alters gene expression in the developing heart. Thus, CTCF mediates local regulatory interactions to coordinate transcriptional programs controlling transitions in morphology and function during heart development.

CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart

PubMed Central

Gomez-Velazquez, Melisa; Badia-Careaga, Claudio; Lechuga-Vieco, Ana Victoria; Nieto-Arellano, Rocio; Rollan, Isabel; Alvarez, Alba; Torroja, Carlos; Caceres, Eva F.; Roy, Anna R.; Galjart, Niels; Sanchez-Cabo, Fatima; Enriquez, Jose Antonio; Gomez-Skarmeta, Jose Luis

2017-01-01

Cardiac progenitors are specified early in development and progressively differentiate and mature into fully functional cardiomyocytes. This process is controlled by an extensively studied transcriptional program. However, the regulatory events coordinating the progression of such program from development to maturation are largely unknown. Here, we show that the genome organizer CTCF is essential for cardiogenesis and that it mediates genomic interactions to coordinate cardiomyocyte differentiation and maturation in the developing heart. Inactivation of Ctcf in cardiac progenitor cells and their derivatives in vivo during development caused severe cardiac defects and death at embryonic day 12.5. Genome wide expression analysis in Ctcf mutant hearts revealed that genes controlling mitochondrial function and protein production, required for cardiomyocyte maturation, were upregulated. However, mitochondria from mutant cardiomyocytes do not mature properly. In contrast, multiple development regulatory genes near predicted heart enhancers, including genes in the IrxA cluster, were downregulated in Ctcf mutants, suggesting that CTCF promotes cardiomyocyte differentiation by facilitating enhancer-promoter interactions. Accordingly, loss of CTCF disrupts gene expression and chromatin interactions as shown by chromatin conformation capture followed by deep sequencing. Furthermore, CRISPR-mediated deletion of an intergenic CTCF site within the IrxA cluster alters gene expression in the developing heart. Thus, CTCF mediates local regulatory interactions to coordinate transcriptional programs controlling transitions in morphology and function during heart development. PMID:28846746

Successive gain of insulator proteins in arthropod evolution.

PubMed

Heger, Peter; George, Rebecca; Wiehe, Thomas

2013-10-01

Alteration of regulatory DNA elements or their binding proteins may have drastic consequences for morphological evolution. Chromatin insulators are one example of such proteins and play a fundamental role in organizing gene expression. While a single insulator protein, CTCF (CCCTC-binding factor), is known in vertebrates, Drosophila melanogaster utilizes six additional factors. We studied the evolution of these proteins and show here that-in contrast to the bilaterian-wide distribution of CTCF-all other D. melanogaster insulators are restricted to arthropods. The full set is present exclusively in the genus Drosophila whereas only two insulators, Su(Hw) and CTCF, existed at the base of the arthropod clade and all additional factors have been acquired successively at later stages. Secondary loss of factors in some lineages further led to the presence of different insulator subsets in arthropods. Thus, the evolution of insulator proteins within arthropods is an ongoing and dynamic process that reshapes and supplements the ancient CTCF-based system common to bilaterians. Expansion of insulator systems may therefore be a general strategy to increase an organism's gene regulatory repertoire and its potential for morphological plasticity. © 2013 The Authors. Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

CTCF knockout reveals an essential role for this protein during the zebrafish development.

PubMed

Carmona-Aldana, Francisco; Zampedri, Cecilia; Suaste-Olmos, Fernando; Murillo-de-Ozores, Adrián; Guerrero, Georgina; Arzate-Mejía, Rodrigo; Maldonado, Ernesto; Navarro, Rosa; Chimal-Monroy, Jesús; Recillas-Targa, Félix

2018-05-01

Chromatin regulation and organization are essential processes that regulate gene activity. The CCCTC-binding factor (CTCF) is a protein with different and important molecular functions related with chromatin dynamics. It is conserved since invertebrates to vertebrates, posing it as a factor with an important role in the physiology. In this work, we aimed to understand the distribution and functional relevance of CTCF during the embryonic development of the zebrafish (Danio rerio). We generated a zebrafish specific anti-Ctcf antibody, and found this protein to be ubiquitous, through different stages and tissues. We used the CRISPR-Cas9 system to induce molecular alterations in the locus. This resulted in early lethality. We delayed the lethality performing knockdown morpholino experiments, and found an aberrant embryo morphology involving malformations in structures through all the length of the embryo. These phenotypes were rescued with human CTCF mRNA injections, showing the specificity of the morpholinos and a partial functional conservation between the fish and the human proteins. Lastly, we found that the pro-apoptotic genes p53 and bbc3/PUMA are deregulated in the ctcf morpholino-injected embryos. In conclusion, CTCF is a ubiquitous factor during the zebrafish development, which regulates the correct formation of different structures of the embryo, and its deregulation impacts on essential cell survival genes. Overall, this work provides a basis to look for the particular functions of CTCF in the different developing tissues and organs of the zebrafish. Copyright © 2018. Published by Elsevier B.V.

Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

PubMed

Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

2018-04-10

Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

PubMed Central

2011-01-01

Background Mutations in the Otopetrin 1 gene (Otop1) in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP) family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH) subtype 1G (Ush1g), both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF), a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq) data in mouse and human embryonic stem (ES) cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s) of Ush1g and Otop in developmental pathways. PMID:21261979

Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements.

PubMed

Kyrchanova, Olga; Chetverina, Darya; Maksimenko, Oksana; Kullyev, Andrey; Georgiev, Pavel

2008-12-01

Insulators are defined as a class of regulatory elements that delimit independent transcriptional domains within eukaryotic genomes. According to previous data, an interaction (pairing) between some Drosophila insulators can support distant activation of a promoter by an enhancer. Here, we have demonstrated that pairs of well-studied insulators such as scs-scs, scs'-scs', 1A2-1A2 and Wari-Wari support distant activation of the white promoter by the yeast GAL4 activator in an orientation-dependent manner. The same is true for the efficiency of the enhancer that stimulates white expression in the eyes. In all insulator pairs tested, stimulation of the white gene was stronger when insulators were inserted between the eye enhancer or GAL4 and the white promoter in opposite orientations relative to each other. As shown previously, Zw5, Su(Hw) and dCTCF proteins are required for the functioning of different insulators that do not interact with each other. Here, strong functional interactions have been revealed between DNA fragments containing binding sites for either Zw5 or Su(Hw) or dCTCF protein but not between heterologous binding sites [Zw5-Su(Hw), dCTCF-Su(Hw), or dCTCF-Zw5]. These results suggest that insulator proteins can support selective interactions between distant regulatory elements.

Ectopically tethered CP190 induces large-scale chromatin decondensation

NASA Astrophysics Data System (ADS)

Ahanger, Sajad H.; Günther, Katharina; Weth, Oliver; Bartkuhn, Marek; Bhonde, Ramesh R.; Shouche, Yogesh S.; Renkawitz, Rainer

2014-01-01

Insulator mediated alteration in higher-order chromatin and/or nucleosome organization is an important aspect of epigenetic gene regulation. Recent studies have suggested a key role for CP190 in such processes. In this study, we analysed the effects of ectopically tethered insulator factors on chromatin structure and found that CP190 induces large-scale decondensation when targeted to a condensed lacO array in mammalian and Drosophila cells. In contrast, dCTCF alone, is unable to cause such a decondensation, however, when CP190 is present, dCTCF recruits it to the lacO array and mediates chromatin unfolding. The CP190 induced opening of chromatin may not be correlated with transcriptional activation, as binding of CP190 does not enhance luciferase activity in reporter assays. We propose that CP190 may mediate histone modification and chromatin remodelling activity to induce an open chromatin state by its direct recruitment or targeting by a DNA binding factor such as dCTCF.

Drosophila CTCF tandemly aligns with other insulator proteins at the borders of H3K27me3 domains.

PubMed

Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Yang, Jingping; Wahi, Jessica E; Corces, Victor G

2012-11-01

Several multiprotein DNA complexes capable of insulator activity have been identified in Drosophila melanogaster, yet only CTCF, a highly conserved zinc finger protein, and the transcription factor TFIIIC have been shown to function in mammals. CTCF is involved in diverse nuclear activities, and recent studies suggest that the proteins with which it associates and the DNA sequences that it targets may underlie these various roles. Here we show that the Drosophila homolog of CTCF (dCTCF) aligns in the genome with other Drosophila insulator proteins such as Suppressor of Hairy wing [SU(HW)] and Boundary Element Associated Factor of 32 kDa (BEAF-32) at the borders of H3K27me3 domains, which are also enriched for associated insulator proteins and additional cofactors. RNAi depletion of dCTCF and combinatorial knockdown of gene expression for other Drosophila insulator proteins leads to a reduction in H3K27me3 levels within repressed domains, suggesting that insulators are important for the maintenance of appropriate repressive chromatin structure in Polycomb (Pc) domains. These results shed new insights into the roles of insulators in chromatin domain organization and support recent models suggesting that insulators underlie interactions important for Pc-mediated repression. We reveal an important relationship between dCTCF and other Drosophila insulator proteins and speculate that vertebrate CTCF may also align with other nuclear proteins to accomplish similar functions.

Drosophila CTCF tandemly aligns with other insulator proteins at the borders of H3K27me3 domains

PubMed Central

Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Yang, Jingping; Wahi, Jessica E.; Corces, Victor G.

2012-01-01

Several multiprotein DNA complexes capable of insulator activity have been identified in Drosophila melanogaster, yet only CTCF, a highly conserved zinc finger protein, and the transcription factor TFIIIC have been shown to function in mammals. CTCF is involved in diverse nuclear activities, and recent studies suggest that the proteins with which it associates and the DNA sequences that it targets may underlie these various roles. Here we show that the Drosophila homolog of CTCF (dCTCF) aligns in the genome with other Drosophila insulator proteins such as Suppressor of Hairy wing [SU(HW)] and Boundary Element Associated Factor of 32 kDa (BEAF-32) at the borders of H3K27me3 domains, which are also enriched for associated insulator proteins and additional cofactors. RNAi depletion of dCTCF and combinatorial knockdown of gene expression for other Drosophila insulator proteins leads to a reduction in H3K27me3 levels within repressed domains, suggesting that insulators are important for the maintenance of appropriate repressive chromatin structure in Polycomb (Pc) domains. These results shed new insights into the roles of insulators in chromatin domain organization and support recent models suggesting that insulators underlie interactions important for Pc-mediated repression. We reveal an important relationship between dCTCF and other Drosophila insulator proteins and speculate that vertebrate CTCF may also align with other nuclear proteins to accomplish similar functions. PMID:22722341

Genome-wide DNase hypersensitivity, and occupancy of RUNX2 and CTCF reveal a highly dynamic gene regulome during MC3T3 pre-osteoblast differentiation.

PubMed

Tai, Phillip W L; Wu, Hai; van Wijnen, André J; Stein, Gary S; Stein, Janet L; Lian, Jane B

2017-01-01

The ability to discover regulatory sequences that control bone-related genes during development has been greatly improved by massively parallel sequencing methodologies. To expand our understanding of cis-regulatory regions critical to the control of gene expression during osteoblastogenesis, we probed the presence of open chromatin states across the osteoblast genome using global DNase hypersensitivity (DHS) mapping. Our profiling of MC3T3 mouse pre-osteoblasts during differentiation has identified more than 224,000 unique DHS sites. Approximately 65% of these sites are dynamic during temporal stages of osteoblastogenesis, and a majority of them are located within non-promoter (intergenic and intronic) regions. Nearly half of all DHS sites (both constitutive and dynamic) overlap binding events of the bone-essential RUNX2 and/or the chromatin-related CTCF transcription factors. This finding reinforces the role of these regulatory proteins as essential components of the bone gene regulome. We observe a reduction in chromatin accessibility throughout the genome between pre-osteoblast and early osteoblasts. Our analysis also defined a class of differentially expressed genes that harbor DHS peaks centered within 1 kb downstream of transcriptional end sites (TES). These DHSs at the 3'-flanks of genes exhibit dynamic changes during differentiation that may impact regulation of the osteoblast genome. Taken together, the distribution of DHS regions within non-promoter locations harboring osteoblast and chromatin related transcription factor binding motifs, reflect novel cis-regulatory requirements to support temporal gene expression in differentiating osteoblasts.

Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

PubMed

Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

2018-06-13

MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

Spatial enhancer clustering and regulation of enhancer-proximal genes by cohesin

PubMed Central

Ing-Simmons, Elizabeth; Seitan, Vlad C.; Faure, Andre J.; Flicek, Paul; Carroll, Thomas; Dekker, Job; Fisher, Amanda G.; Lenhard, Boris

2015-01-01

In addition to mediating sister chromatid cohesion during the cell cycle, the cohesin complex associates with CTCF and with active gene regulatory elements to form long-range interactions between its binding sites. Genome-wide chromosome conformation capture had shown that cohesin's main role in interphase genome organization is in mediating interactions within architectural chromosome compartments, rather than specifying compartments per se. However, it remains unclear how cohesin-mediated interactions contribute to the regulation of gene expression. We have found that the binding of CTCF and cohesin is highly enriched at enhancers and in particular at enhancer arrays or “super-enhancers” in mouse thymocytes. Using local and global chromosome conformation capture, we demonstrate that enhancer elements associate not just in linear sequence, but also in 3D, and that spatial enhancer clustering is facilitated by cohesin. The conditional deletion of cohesin from noncycling thymocytes preserved enhancer position, H3K27ac, H4K4me1, and enhancer transcription, but weakened interactions between enhancers. Interestingly, ∼50% of deregulated genes reside in the vicinity of enhancer elements, suggesting that cohesin regulates gene expression through spatial clustering of enhancer elements. We propose a model for cohesin-dependent gene regulation in which spatial clustering of enhancer elements acts as a unified mechanism for both enhancer-promoter “connections” and “insulation.” PMID:25677180

Distinct Roles of Chromatin Insulator Proteins in Control of the Drosophila Bithorax Complex

PubMed Central

Savitsky, Mikhail; Kim, Maria; Kravchuk, Oksana; Schwartz, Yuri B.

2016-01-01

Chromatin insulators are remarkable regulatory elements that can bring distant genomic sites together and block unscheduled enhancer–promoter communications. Insulators act via associated insulator proteins of two classes: sequence-specific DNA binding factors and “bridging” proteins. The latter are required to mediate interactions between distant insulator elements. Chromatin insulators are critical for correct expression of complex loci; however, their mode of action is poorly understood. Here, we use the Drosophila bithorax complex as a model to investigate the roles of the bridging proteins Cp190 and Mod(mdg4). The bithorax complex consists of three evolutionarily conserved homeotic genes Ubx, abd-A, and Abd-B, which specify anterior–posterior identity of the last thoracic and all abdominal segments of the fly. Looking at effects of CTCF, mod(mdg4), and Cp190 mutations on expression of the bithorax complex genes, we provide the first functional evidence that Mod(mdg4) acts in concert with the DNA binding insulator protein CTCF. We find that Mod(mdg4) and Cp190 are not redundant and may have distinct functional properties. We, for the first time, demonstrate that Cp190 is critical for correct regulation of the bithorax complex and show that Cp190 is required at an exceptionally strong Fub insulator to partition the bithorax complex into two topological domains. PMID:26715665

Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

PubMed

Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

2004-09-01

Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

A Novel Pathway Links Oxidative Stress to Loss of Insulin Growth Factor-2 (IGF2) Imprinting through NF-κB Activation

PubMed Central

Yang, Bing; Wagner, Jennifer; Damaschke, Nathan; Yao, Tianyu; Wuerzberger-Davis, Shelly M.; Lee, Moon-Hee; Svaren, John; Miyamoto, Shigeki; Jarrard, David F.

2014-01-01

Genomic imprinting is the allele-specific expression of a gene based on parental origin. Loss of imprinting(LOI) of Insulin-like Growth Factor 2 (IGF2) during aging is important in tumorigenesis, yet the regulatory mechanisms driving this event are largely unknown. In this study oxidative stress, measured by increased NF-κB activity, induces LOI in both cancerous and noncancerous human prostate cells. Decreased expression of the enhancer-blocking element CCCTC-binding factor(CTCF) results in reduced binding of CTCF to the H19-ICR (imprint control region), a major factor in the allelic silencing of IGF2. This ICR then develops increased DNA methylation. Assays identify a recruitment of the canonical pathway proteins NF-κB p65 and p50 to the CTCF promoter associated with the co-repressor HDAC1 explaining gene repression. An IκBα super-repressor blocks oxidative stress-induced activation of NF-κB and IGF2 imprinting is maintained. In vivo experiments using IκBα mutant mice with continuous NF-κB activation demonstrate increased IGF2 LOI further confirming a central role for canonical NF-κB signaling. We conclude CTCF plays a central role in mediating the effects of NF-κB activation that result in altered imprinting both in vitro and in vivo. This novel finding connects inflammation found in aging prostate tissues with the altered epigenetic landscape. PMID:24558376

Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

PubMed

Osato, Naoki

2018-01-19

Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.

The effect of preconception paternal alcohol exposure on epigenetic remodeling of the h19 and rasgrf1 imprinting control regions in mouse offspring.

PubMed

Knezovich, Jaysen Gregory; Ramsay, Michèle

2012-01-01

Imprinted loci play a critical role in fetal development. Their expression is often regulated by CCCTC-binding factor (CTCF) protein binding at imprinting control regions (ICRs). Prenatal alcohol exposure has been shown to reduce global DNA methylation in the developing mouse fetus. This study explored the effect of preconception paternal alcohol exposure on DNA methylation at two paternally methylated ICRs (H19 and Rasgrf1) in the sperm of exposed males and somatic DNA of sired offspring. Significant reductions at the H19 CTCF 1 (p = 0.0027) and CTCF 2 (p = 0.0009) binding sites were observed in the offspring of ethanol-treated sires, which was significantly correlated with reduced weight at postnatal days 35-42 (p < 0.05). As birth weight was unaffected and growth was only delayed during the postnatal weaning period, with subsequent re-convergence, we hypothesize that this may be the result of a mental deficit causing delayed establishment of independent feeding following weaning and would explain why this effect is transient. No difference in DNA methylation was observed in the sperm of alcohol-exposed males, indicating that the transmission of the epigenetic signal at conception is not due to altered methylation, but may be the result of an RNA-mediated mechanism or altered chromatin remodeling.

Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity

PubMed Central

Song, Lingyun; Zhang, Zhancheng; Grasfeder, Linda L.; Boyle, Alan P.; Giresi, Paul G.; Lee, Bum-Kyu; Sheffield, Nathan C.; Gräf, Stefan; Huss, Mikael; Keefe, Damian; Liu, Zheng; London, Darin; McDaniell, Ryan M.; Shibata, Yoichiro; Showers, Kimberly A.; Simon, Jeremy M.; Vales, Teresa; Wang, Tianyuan; Winter, Deborah; Zhang, Zhuzhu; Clarke, Neil D.; Birney, Ewan; Iyer, Vishwanath R.; Crawford, Gregory E.; Lieb, Jason D.; Furey, Terrence S.

2011-01-01

The human body contains thousands of unique cell types, each with specialized functions. Cell identity is governed in large part by gene transcription programs, which are determined by regulatory elements encoded in DNA. To identify regulatory elements active in seven cell lines representative of diverse human cell types, we used DNase-seq and FAIRE-seq (Formaldehyde Assisted Isolation of Regulatory Elements) to map “open chromatin.” Over 870,000 DNaseI or FAIRE sites, which correspond tightly to nucleosome-depleted regions, were identified across the seven cell lines, covering nearly 9% of the genome. The combination of DNaseI and FAIRE is more effective than either assay alone in identifying likely regulatory elements, as judged by coincidence with transcription factor binding locations determined in the same cells. Open chromatin common to all seven cell types tended to be at or near transcription start sites and to be coincident with CTCF binding sites, while open chromatin sites found in only one cell type were typically located away from transcription start sites and contained DNA motifs recognized by regulators of cell-type identity. We show that open chromatin regions bound by CTCF are potent insulators. We identified clusters of open regulatory elements (COREs) that were physically near each other and whose appearance was coordinated among one or more cell types. Gene expression and RNA Pol II binding data support the hypothesis that COREs control gene activity required for the maintenance of cell-type identity. This publicly available atlas of regulatory elements may prove valuable in identifying noncoding DNA sequence variants that are causally linked to human disease. PMID:21750106

Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

PubMed Central

Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

2011-01-01

The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

Principles of Chromosome Architecture Revealed by Hi-C.

PubMed

Eagen, Kyle P

2018-06-01

Chromosomes are folded and compacted in interphase nuclei, but the molecular basis of this folding is poorly understood. Chromosome conformation capture methods, such as Hi-C, combine chemical crosslinking of chromatin with fragmentation, DNA ligation, and high-throughput DNA sequencing to detect neighboring loci genome-wide. Hi-C has revealed the segregation of chromatin into active and inactive compartments and the folding of DNA into self-associating domains and loops. Depletion of CTCF, cohesin, or cohesin-associated proteins was recently shown to affect the majority of domains and loops in a manner that is consistent with a model of DNA folding through extrusion of chromatin loops. Compartmentation was not dependent on CTCF or cohesin. Hi-C contact maps represent the superimposition of CTCF/cohesin-dependent and -independent folding states. Copyright © 2018 Elsevier Ltd. All rights reserved.

Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes

PubMed Central

Thybert, David; Roller, Maša; Navarro, Fábio C.P.; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C.; Laukaitis, Christina M.; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A.; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J.; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M.; Odom, Duncan T.; Flicek, Paul

2018-01-01

Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli, which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. PMID:29563166

Loss of maternal CTCF is associated with peri-implantation lethality of Ctcf null embryos.

PubMed

Moore, James M; Rabaia, Natalia A; Smith, Leslie E; Fagerlie, Sara; Gurley, Kay; Loukinov, Dmitry; Disteche, Christine M; Collins, Steven J; Kemp, Christopher J; Lobanenkov, Victor V; Filippova, Galina N

2012-01-01

CTCF is a highly conserved, multifunctional zinc finger protein involved in critical aspects of gene regulation including transcription regulation, chromatin insulation, genomic imprinting, X-chromosome inactivation, and higher order chromatin organization. Such multifunctional properties of CTCF suggest an essential role in development. Indeed, a previous report on maternal depletion of CTCF suggested that CTCF is essential for pre-implantation development. To distinguish between the effects of maternal and zygotic expression of CTCF, we studied pre-implantation development in mice harboring a complete loss of function Ctcf knockout allele. Although we demonstrated that homozygous deletion of Ctcf is early embryonically lethal, in contrast to previous observations, we showed that the Ctcf nullizygous embryos developed up to the blastocyst stage (E3.5) followed by peri-implantation lethality (E4.5-E5.5). Moreover, one-cell stage Ctcf nullizygous embryos cultured ex vivo developed to the 16-32 cell stage with no obvious abnormalities. Using a single embryo assay that allowed both genotype and mRNA expression analyses of the same embryo, we demonstrated that pre-implantation development of the Ctcf nullizygous embryos was associated with the retention of the maternal wild type Ctcf mRNA. Loss of this stable maternal transcript was temporally associated with loss of CTCF protein expression, apoptosis of the developing embryo, and failure to further develop an inner cell mass and trophoectoderm ex vivo. This indicates that CTCF expression is critical to early embryogenesis and loss of its expression rapidly leads to apoptosis at a very early developmental stage. This is the first study documenting the presence of the stable maternal Ctcf transcript in the blastocyst stage embryos. Furthermore, in the presence of maternal CTCF, zygotic CTCF expression does not seem to be required for pre-implantation development.

The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages

PubMed Central

Daniel, Bence; Hah, Nasun; Horvath, Attila; Czimmerer, Zsolt; Poliska, Szilard; Gyuris, Tibor; Keirsse, Jiri; Gysemans, Conny; Van Ginderachter, Jo A.; Balint, Balint L.; Evans, Ronald M.; Barta, Endre; Nagy, Laszlo

2014-01-01

RXR signaling is predicted to have a major impact in macrophages, but neither the biological consequence nor the genomic basis of its ligand activation is known. Comprehensive genome-wide studies were carried out to map liganded RXR-mediated transcriptional changes, active binding sites, and cistromic interactions in the context of the macrophage genome architecture. The macrophage RXR cistrome has 5200 genomic binding sites, which are not impacted by ligand. Active enhancers are characterized by PU.1 binding, an increase of enhancer RNA, and P300 recruitment. Using these features, 387 liganded RXR-bound enhancers were linked to 226 genes, which predominantly reside in CTCF/cohesin-limited functional domains. These findings were molecularly validated using chromosome conformation capture (3C) and 3C combined with sequencing (3C-seq), and we show that selected long-range enhancers communicate with promoters via stable or RXR-induced loops and that some of the enhancers interact with each other, forming an interchromosomal network. A set of angiogenic genes, including Vegfa, has liganded RXR-controlled enhancers and provides the macrophage with a novel inducible program. PMID:25030696

Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes.

PubMed

Thybert, David; Roller, Maša; Navarro, Fábio C P; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C; Laukaitis, Christina M; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M; Odom, Duncan T; Flicek, Paul

2018-04-01

Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli , which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. © 2018 Thybert et al.; Published by Cold Spring Harbor Laboratory Press.

Formation of chromosomal domains in interphase by loop extrusion

NASA Astrophysics Data System (ADS)

Fudenberg, Geoffrey

While genomes are often considered as one-dimensional sequences, interphase chromosomes are organized in three dimensions with an essential role for regulating gene expression. Recent studies have shown that Topologically Associating Domains (TADs) are fundamental structural and functional building blocks of human interphase chromosomes. Despite observations that architectural proteins, including CTCF, demarcate and maintain the borders of TADs, the mechanisms underlying TAD formation remain unknown. Here we propose that loop extrusion underlies the formation TADs. In this process, cis-acting loop-extruding factors, likely cohesins, form progressively larger loops, but stall at TAD boundaries due to interactions with boundary proteins, including CTCF. This process dynamically forms loops of various sizes within but not between TADs. Using polymer simulations, we find that loop extrusion can produce TADs as determined by our analyses of the highest-resolution experimental data. Moreover, we find that loop extrusion can explain many diverse experimental observations, including: the preferential orientation of CTCF motifs and enrichments of architectural proteins at TAD boundaries; TAD boundary deletion experiments; and experiments with knockdown or depletion of CTCF, cohesin, and cohesin-loading factors. Together, the emerging picture from our work is that TADs are formed by rapidly associating, growing, and dissociating loops, presenting a clear framework for understanding interphase chromosomal organization.

Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization.

PubMed

Nora, Elphège P; Goloborodko, Anton; Valton, Anne-Laure; Gibcus, Johan H; Uebersohn, Alec; Abdennur, Nezar; Dekker, Job; Mirny, Leonid A; Bruneau, Benoit G

2017-05-18

The molecular mechanisms underlying folding of mammalian chromosomes remain poorly understood. The transcription factor CTCF is a candidate regulator of chromosomal structure. Using the auxin-inducible degron system in mouse embryonic stem cells, we show that CTCF is absolutely and dose-dependently required for looping between CTCF target sites and insulation of topologically associating domains (TADs). Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding. CTCF remains essential for TAD organization in non-dividing cells. Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs. Furthermore, our data support that CTCF mediates transcriptional insulator function through enhancer blocking but not as a direct barrier to heterochromatin spreading. Beyond defining the functions of CTCF in chromosome folding, these results provide new fundamental insights into the rules governing mammalian genome organization. Copyright © 2017 Elsevier Inc. All rights reserved.

Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization

PubMed Central

Nora, Elphège P.; Goloborodko, Anton; Valton, Anne-Laure; Gibcus, Johan H.; Uebersohn, Alec; Abdennur, Nezar; Dekker, Job; Mirny, Leonid A.; Bruneau, Benoit G.

2017-01-01

Summary The molecular mechanisms underlying folding of mammalian chromosomes remain poorly understood. The transcription factor CTCF is a candidate regulator of chromosomal structure. Using the auxin-inducible degron system in mouse embryonic stem cells, we show that CTCF is absolutely and dose-dependently required for looping between CTCF target sites and insulation of topologically associating domains (TADs). Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding. CTCF remains essential for TAD organization in non-dividing cells. Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs. Further, our data support that CTCF mediates transcriptional insulator function through enhancer-blocking but not as a direct barrier to heterochromatin spreading. Beyond defining the functions of CTCF in chromosome folding these results provide new fundamental insights into the rules governing mammalian genome organization. PMID:28525758

High-Resolution Mapping of Chromatin Conformation in Cardiac Myocytes Reveals Structural Remodeling of the Epigenome in Heart Failure

PubMed Central

Rosa-Garrido, Manuel; Chapski, Douglas J.; Schmitt, Anthony D.; Kimball, Todd H.; Karbassi, Elaheh; Monte, Emma; Balderas, Enrique; Pellegrini, Matteo; Shih, Tsai-Ting; Soehalim, Elizabeth; Liem, David; Ping, Peipei; Galjart, Niels J.; Ren, Shuxun; Wang, Yibin; Ren, Bing

2017-01-01

Background: Cardiovascular disease is associated with epigenomic changes in the heart; however, the endogenous structure of cardiac myocyte chromatin has never been determined. Methods: To investigate the mechanisms of epigenomic function in the heart, genome-wide chromatin conformation capture (Hi-C) and DNA sequencing were performed in adult cardiac myocytes following development of pressure overload–induced hypertrophy. Mice with cardiac-specific deletion of CTCF (a ubiquitous chromatin structural protein) were generated to explore the role of this protein in chromatin structure and cardiac phenotype. Transcriptome analyses by RNA-seq were conducted as a functional readout of the epigenomic structural changes. Results: Depletion of CTCF was sufficient to induce heart failure in mice, and human patients with heart failure receiving mechanical unloading via left ventricular assist devices show increased CTCF abundance. Chromatin structural analyses revealed interactions within the cardiac myocyte genome at 5-kb resolution, enabling examination of intra- and interchromosomal events, and providing a resource for future cardiac epigenomic investigations. Pressure overload or CTCF depletion selectively altered boundary strength between topologically associating domains and A/B compartmentalization, measurements of genome accessibility. Heart failure involved decreased stability of chromatin interactions around disease-causing genes. In addition, pressure overload or CTCF depletion remodeled long-range interactions of cardiac enhancers, resulting in a significant decrease in local chromatin interactions around these functional elements. Conclusions: These findings provide a high-resolution chromatin architecture resource for cardiac epigenomic investigations and demonstrate that global structural remodeling of chromatin underpins heart failure. The newly identified principles of endogenous chromatin structure have key implications for epigenetic therapy. PMID:28802249

High-Resolution Mapping of Chromatin Conformation in Cardiac Myocytes Reveals Structural Remodeling of the Epigenome in Heart Failure.

PubMed

Rosa-Garrido, Manuel; Chapski, Douglas J; Schmitt, Anthony D; Kimball, Todd H; Karbassi, Elaheh; Monte, Emma; Balderas, Enrique; Pellegrini, Matteo; Shih, Tsai-Ting; Soehalim, Elizabeth; Liem, David; Ping, Peipei; Galjart, Niels J; Ren, Shuxun; Wang, Yibin; Ren, Bing; Vondriska, Thomas M

2017-10-24

Cardiovascular disease is associated with epigenomic changes in the heart; however, the endogenous structure of cardiac myocyte chromatin has never been determined. To investigate the mechanisms of epigenomic function in the heart, genome-wide chromatin conformation capture (Hi-C) and DNA sequencing were performed in adult cardiac myocytes following development of pressure overload-induced hypertrophy. Mice with cardiac-specific deletion of CTCF (a ubiquitous chromatin structural protein) were generated to explore the role of this protein in chromatin structure and cardiac phenotype. Transcriptome analyses by RNA-seq were conducted as a functional readout of the epigenomic structural changes. Depletion of CTCF was sufficient to induce heart failure in mice, and human patients with heart failure receiving mechanical unloading via left ventricular assist devices show increased CTCF abundance. Chromatin structural analyses revealed interactions within the cardiac myocyte genome at 5-kb resolution, enabling examination of intra- and interchromosomal events, and providing a resource for future cardiac epigenomic investigations. Pressure overload or CTCF depletion selectively altered boundary strength between topologically associating domains and A/B compartmentalization, measurements of genome accessibility. Heart failure involved decreased stability of chromatin interactions around disease-causing genes. In addition, pressure overload or CTCF depletion remodeled long-range interactions of cardiac enhancers, resulting in a significant decrease in local chromatin interactions around these functional elements. These findings provide a high-resolution chromatin architecture resource for cardiac epigenomic investigations and demonstrate that global structural remodeling of chromatin underpins heart failure. The newly identified principles of endogenous chromatin structure have key implications for epigenetic therapy. © 2017 The Authors.

Genome Organization Drives Chromosome Fragility.

PubMed

Canela, Andres; Maman, Yaakov; Jung, Seolkyoung; Wong, Nancy; Callen, Elsa; Day, Amanda; Kieffer-Kwon, Kyong-Rim; Pekowska, Aleksandra; Zhang, Hongliang; Rao, Suhas S P; Huang, Su-Chen; Mckinnon, Peter J; Aplan, Peter D; Pommier, Yves; Aiden, Erez Lieberman; Casellas, Rafael; Nussenzweig, André

2017-07-27

In this study, we show that evolutionarily conserved chromosome loop anchors bound by CCCTC-binding factor (CTCF) and cohesin are vulnerable to DNA double strand breaks (DSBs) mediated by topoisomerase 2B (TOP2B). Polymorphisms in the genome that redistribute CTCF/cohesin occupancy rewire DNA cleavage sites to novel loop anchors. While transcription- and replication-coupled genomic rearrangements have been well documented, we demonstrate that DSBs formed at loop anchors are largely transcription-, replication-, and cell-type-independent. DSBs are continuously formed throughout interphase, are enriched on both sides of strong topological domain borders, and frequently occur at breakpoint clusters commonly translocated in cancer. Thus, loop anchors serve as fragile sites that generate DSBs and chromosomal rearrangements. VIDEO ABSTRACT. Published by Elsevier Inc.

Computational characterization of chromatin domain boundary-associated genomic elements

PubMed Central

Hong, Seungpyo

2017-01-01

Abstract Topologically associated domains (TADs) are 3D genomic structures with high internal interactions that play important roles in genome compaction and gene regulation. Their genomic locations and their association with CCCTC-binding factor (CTCF)-binding sites and transcription start sites (TSSs) were recently reported. However, the relationship between TADs and other genomic elements has not been systematically evaluated. This was addressed in the present study, with a focus on the enrichment of these genomic elements and their ability to predict the TAD boundary region. We found that consensus CTCF-binding sites were strongly associated with TAD boundaries as well as with the transcription factors (TFs) Zinc finger protein (ZNF)143 and Yin Yang (YY)1. TAD boundary-associated genomic elements include DNase I-hypersensitive sites, H3K36 trimethylation, TSSs, RNA polymerase II, and TFs such as Specificity protein 1, ZNF274 and SIX homeobox 5. Computational modeling with these genomic elements suggests that they have distinct roles in TAD boundary formation. We propose a structural model of TAD boundaries based on these findings that provides a basis for studying the mechanism of chromatin structure formation and gene regulation. PMID:28977568

Nonequilibrium Chromosome Looping via Molecular Slip Links

NASA Astrophysics Data System (ADS)

Brackley, C. A.; Johnson, J.; Michieletto, D.; Morozov, A. N.; Nicodemi, M.; Cook, P. R.; Marenduzzo, D.

2017-09-01

We propose a model for the formation of chromatin loops based on the diffusive sliding of molecular slip links. These mimic the behavior of molecules like cohesin, which, along with the CTCF protein, stabilize loops which contribute to organizing the genome. By combining 3D Brownian dynamics simulations and 1D exactly solvable nonequilibrium models, we show that diffusive sliding is sufficient to account for the strong bias in favor of convergent CTCF-mediated chromosome loops observed experimentally. We also find that the diffusive motion of multiple slip links along chromatin is rectified by an intriguing ratchet effect that arises if slip links bind to the chromatin at a preferred "loading site." This emergent collective behavior favors the extrusion of loops which are much larger than the ones formed by single slip links.

Euchromatin islands in large heterochromatin domains are enriched for CTCF binding and differentially DNA-methylated regions

PubMed Central

2012-01-01

Background The organization of higher order chromatin is an emerging epigenetic mechanism for understanding development and disease. We and others have previously observed dynamic changes during differentiation and oncogenesis in large heterochromatin domains such as Large Organized Chromatin K (lysine) modifications (LOCKs), of histone H3 lysine-9 dimethylation (H3K9me2) or other repressive histone posttranslational modifications. The microstructure of these regions has not previously been explored. Results We analyzed the genome-wide distribution of H3K9me2 in two human pluripotent stem cell lines and three differentiated cells lines. We identified > 2,500 small regions with very low H3K9me2 signals in the body of LOCKs, which were termed as euchromatin islands (EIs). EIs are 6.5-fold enriched for DNase I Hypersensitive Sites and 8-fold enriched for the binding of CTCF, the major organizer of higher-order chromatin. Furthermore, EIs are 2–6 fold enriched for differentially DNA-methylated regions associated with tissue types (T-DMRs), reprogramming (R-DMRs) and cancer (C-DMRs). Gene ontology (GO) analysis suggests that EI-associated genes are functionally related to organ system development, cell adhesion and cell differentiation. Conclusions We identify the existence of EIs as a finer layer of epigenomic architecture within large heterochromatin domains. Their enrichment for CTCF sites and DNAse hypersensitive sites, as well as association with DMRs, suggest that EIs play an important role in normal epigenomic architecture and its disruption in disease. PMID:23102236

Regulatory polymorphisms modulate the expression of HLA class II molecules and promote autoimmunity

PubMed Central

Raj, Prithvi; Rai, Ekta; Song, Ran; Khan, Shaheen; Wakeland, Benjamin E; Viswanathan, Kasthuribai; Arana, Carlos; Liang, Chaoying; Zhang, Bo; Dozmorov, Igor; Carr-Johnson, Ferdicia; Mitrovic, Mitja; Wiley, Graham B; Kelly, Jennifer A; Lauwerys, Bernard R; Olsen, Nancy J; Cotsapas, Chris; Garcia, Christine K; Wise, Carol A; Harley, John B; Nath, Swapan K; James, Judith A; Jacob, Chaim O; Tsao, Betty P; Pasare, Chandrashekhar; Karp, David R; Li, Quan Zhen; Gaffney, Patrick M; Wakeland, Edward K

2016-01-01

Targeted sequencing of sixteen SLE risk loci among 1349 Caucasian cases and controls produced a comprehensive dataset of the variations causing susceptibility to systemic lupus erythematosus (SLE). Two independent disease association signals in the HLA-D region identified two regulatory regions containing 3562 polymorphisms that modified thirty-seven transcription factor binding sites. These extensive functional variations are a new and potent facet of HLA polymorphism. Variations modifying the consensus binding motifs of IRF4 and CTCF in the XL9 regulatory complex modified the transcription of HLA-DRB1, HLA-DQA1 and HLA-DQB1 in a chromosome-specific manner, resulting in a 2.5-fold increase in the surface expression of HLA-DR and DQ molecules on dendritic cells with SLE risk genotypes, which increases to over 4-fold after stimulation. Similar analyses of fifteen other SLE risk loci identified 1206 functional variants tightly linked with disease-associated SNPs and demonstrated that common disease alleles contain multiple causal variants modulating multiple immune system genes. DOI: http://dx.doi.org/10.7554/eLife.12089.001 PMID:26880555

Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

PubMed

Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

2017-07-11

In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

Robust k-mer frequency estimation using gapped k-mers

PubMed Central

Ghandi, Mahmoud; Mohammad-Noori, Morteza

2013-01-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

Robust k-mer frequency estimation using gapped k-mers.

PubMed

Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

2014-08-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

Simultaneous measurement of chromatin accessibility, DNA methylation, and nucleosome phasing in single cells

PubMed Central

Pott, Sebastian

2017-01-01

Gaining insights into the regulatory mechanisms that underlie the transcriptional variation observed between individual cells necessitates the development of methods that measure chromatin organization in single cells. Here I adapted Nucleosome Occupancy and Methylome-sequencing (NOMe-seq) to measure chromatin accessibility and endogenous DNA methylation in single cells (scNOMe-seq). scNOMe-seq recovered characteristic accessibility and DNA methylation patterns at DNase hypersensitive sites (DHSs). An advantage of scNOMe-seq is that sequencing reads are sampled independently of the accessibility measurement. scNOMe-seq therefore controlled for fragment loss, which enabled direct estimation of the fraction of accessible DHSs within individual cells. In addition, scNOMe-seq provided high resolution of chromatin accessibility within individual loci which was exploited to detect footprints of CTCF binding events and to estimate the average nucleosome phasing distances in single cells. scNOMe-seq is therefore well-suited to characterize the chromatin organization of single cells in heterogeneous cellular mixtures. DOI: http://dx.doi.org/10.7554/eLife.23203.001 PMID:28653622

Changes of the nucleolus architecture in absence of the nuclear factor CTCF.

PubMed

Hernández-Hernández, A; Soto-Reyes, E; Ortiz, R; Arriaga-Canon, C; Echeverría-Martinez, O M; Vázquez-Nin, G H; Recillas-Targa, F

2012-01-01

CTCF is a multifunctional nuclear factor involved in many cellular processes like gene regulation, chromatin insulation and genomic organization. Recently, CTCF has been shown to be involved in the transcriptional regulation of ribosomal genes and nucleolar organization in Drosophila cells and different murine cell types, including embryonic stem cells. Moreover, it has been suggested that CTCF could be associated to the nucleolus of human erythroleukemic K562 cells. In the present work, we took advantage of efficient small hairpin RNA interference against human CTCF to analyze nucleolar organization in HeLa cells. We have found that key components of the nucleolar architecture are altered. As a consequence of such alterations, an upregulation of ribosomal gene transcription was observed. We propose that CTCF contributes to the structural organization of the nucleolus and, through epigenetic mechanisms, to the regulation of the ribosomal gene expression. Copyright © 2012 S. Karger AG, Basel.

Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci.

PubMed

Amaral, Paulo P; Leonardi, Tommaso; Han, Namshik; Viré, Emmanuelle; Gascoigne, Dennis K; Arias-Carrasco, Raúl; Büscher, Magdalena; Pandolfini, Luca; Zhang, Anda; Pluchino, Stefano; Maracaja-Coutinho, Vinicius; Nakaya, Helder I; Hemberg, Martin; Shiekhattar, Ramin; Enright, Anton J; Kouzarides, Tony

2018-03-15

The mammalian genome is transcribed into large numbers of long noncoding RNAs (lncRNAs), but the definition of functional lncRNA groups has proven difficult, partly due to their low sequence conservation and lack of identified shared properties. Here we consider promoter conservation and positional conservation as indicators of functional commonality. We identify 665 conserved lncRNA promoters in mouse and human that are preserved in genomic position relative to orthologous coding genes. These positionally conserved lncRNA genes are primarily associated with developmental transcription factor loci with which they are coexpressed in a tissue-specific manner. Over half of positionally conserved RNAs in this set are linked to chromatin organization structures, overlapping binding sites for the CTCF chromatin organiser and located at chromatin loop anchor points and borders of topologically associating domains (TADs). We define these RNAs as topological anchor point RNAs (tapRNAs). Characterization of these noncoding RNAs and their associated coding genes shows that they are functionally connected: they regulate each other's expression and influence the metastatic phenotype of cancer cells in vitro in a similar fashion. Furthermore, we find that tapRNAs contain conserved sequence domains that are enriched in motifs for zinc finger domain-containing RNA-binding proteins and transcription factors, whose binding sites are found mutated in cancers. This work leverages positional conservation to identify lncRNAs with potential importance in genome organization, development and disease. The evidence that many developmental transcription factors are physically and functionally connected to lncRNAs represents an exciting stepping-stone to further our understanding of genome regulation.

The nucleoplasmin homolog NLP mediates centromere clustering and anchoring to the nucleolus.

PubMed

Padeken, Jan; Mendiburo, María José; Chlamydas, Sarantis; Schwarz, Hans-Jürgen; Kremmer, Elisabeth; Heun, Patrick

2013-04-25

Centromere clustering during interphase is a phenomenon known to occur in many different organisms and cell types, yet neither the factors involved nor their physiological relevance is well understood. Using Drosophila tissue culture cells and flies, we identified a network of proteins, including the nucleoplasmin-like protein (NLP), the insulator protein CTCF, and the nucleolus protein Modulo, to be essential for the positioning of centromeres. Artificial targeting further demonstrated that NLP and CTCF are sufficient for clustering, while Modulo serves as the anchor to the nucleolus. Centromere clustering was found to depend on centric chromatin rather than specific DNA sequences. Moreover, unclustering of centromeres results in the spatial destabilization of pericentric heterochromatin organization, leading to partial defects in the silencing of repetitive elements, defects during chromosome segregation, and genome instability. Copyright © 2013 Elsevier Inc. All rights reserved.

Insulated Foamy Viral Vectors

PubMed Central

Browning, Diana L.; Collins, Casey P.; Hocum, Jonah D.; Leap, David J.; Rae, Dustin T.; Trobridge, Grant D.

2016-01-01

Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34+ cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy. PMID:26715244

Parental origin of sequence variants associated with complex diseases.

PubMed

Kong, Augustine; Steinthorsdottir, Valgerdur; Masson, Gisli; Thorleifsson, Gudmar; Sulem, Patrick; Besenbacher, Soren; Jonasdottir, Aslaug; Sigurdsson, Asgeir; Kristinsson, Kari Th; Jonasdottir, Adalbjorg; Frigge, Michael L; Gylfason, Arnaldur; Olason, Pall I; Gudjonsson, Sigurjon A; Sverrisson, Sverrir; Stacey, Simon N; Sigurgeirsson, Bardur; Benediktsdottir, Kristrun R; Sigurdsson, Helgi; Jonsson, Thorvaldur; Benediktsson, Rafn; Olafsson, Jon H; Johannsson, Oskar Th; Hreidarsson, Astradur B; Sigurdsson, Gunnar; Ferguson-Smith, Anne C; Gudbjartsson, Daniel F; Thorsteinsdottir, Unnur; Stefansson, Kari

2009-12-17

Effects of susceptibility variants may depend on from which parent they are inherited. Although many associations between sequence variants and human traits have been discovered through genome-wide associations, the impact of parental origin has largely been ignored. Here we show that for 38,167 Icelanders genotyped using single nucleotide polymorphism (SNP) chips, the parental origin of most alleles can be determined. For this we used a combination of genealogy and long-range phasing. We then focused on SNPs that associate with diseases and are within 500 kilobases of known imprinted genes. Seven independent SNP associations were examined. Five-one with breast cancer, one with basal-cell carcinoma and three with type 2 diabetes-have parental-origin-specific associations. These variants are located in two genomic regions, 11p15 and 7q32, each harbouring a cluster of imprinted genes. Furthermore, we observed a novel association between the SNP rs2334499 at 11p15 and type 2 diabetes. Here the allele that confers risk when paternally inherited is protective when maternally transmitted. We identified a differentially methylated CTCF-binding site at 11p15 and demonstrated correlation of rs2334499 with decreased methylation of that site.

Wt1 Flip-Flops Chromatin in a CTCF Domain

PubMed Central

Gurudatta, B. V.; Corces, Victor G.

2011-01-01

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. PMID:21920307

Wt1 flip-flops chromatin in a CTCF domain.

PubMed

Gurudatta, B V; Corces, Victor G

2011-09-13

CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

Luminal lncRNAs Regulation by ERα-Controlled Enhancers in a Ligand-Independent Manner in Breast Cancer Cells

PubMed Central

Miano, Valentina; Rosti, Valentina; Manitta, Eleonora; Elhasnaoui, Jamal; Basile, Giulia

2018-01-01

Estrogen receptor-α (ERα) is a ligand-inducible protein which mediates estrogenic hormones signaling and defines the luminal BC phenotype. Recently, we demonstrated that even in absence of ligands ERα (apoERα) binds chromatin sites where it regulates transcription of several protein-coding and lncRNA genes. Noteworthy, apoERα-regulated lncRNAs marginally overlap estrogen-induced transcripts, thus representing a new signature of luminal BC genes. By the analysis of H3K27ac enrichment in hormone-deprived MCF-7 cells, we defined a set of Super Enhancers (SEs) occupied by apoERα, including one mapped in proximity of the DSCAM-AS1 lncRNA gene. This represents a paradigm of apoERα activity since its expression is largely unaffected by estrogenic treatment, despite the fact that E2 increases ERα binding on DSCAM-AS1 promoter. We validated the enrichment of apoERα, p300, GATA3, FoxM1 and CTCF at both DSCAM-AS1 TSS and at its associated SE by ChIP-qPCR. Furthermore, by analyzing MCF-7 ChIA-PET data and by 3C assays, we confirmed long range chromatin interaction between the SE and the DSCAM-AS1 TSS. Interestingly, CTCF and p300 binding showed an enrichment in hormone-depleted medium and in the presence of ERα, elucidating the dynamics of the estrogen-independent regulation of DSCAM-AS1 expression. The analysis of this lncRNA provides a paradigm of transcriptional regulation of a luminal specific apoERα regulated lncRNA. PMID:29462945

Structural organization of the inactive X chromosome in the mouse

PubMed Central

Giorgetti, Luca; Lajoie, Bryan R.; Carter, Ava C.; Attia, Mikael; Zhan, Ye; Xu, Jin; Chen, Chong Jian; Kaplan, Noam; Chang, Howard Y.; Heard, Edith; Dekker, Job

2017-01-01

X-chromosome inactivation (XCI) involves major reorganization of the X chromosome as it becomes silent and heterochromatic. During female mammalian development, XCI is triggered by upregulation of the non-coding Xist RNA from one of the two X chromosomes. Xist coats the chromosome in cis and induces silencing of almost all genes via its A-repeat region1,2, although some genes (constitutive escapees) avoid silencing in most cell types, and others (facultative escapees) escape XCI only in specific contexts3. A role for Xist in organizing the inactive X (Xi) chromosome has been proposed4–6. Recent chromosome conformation capture approaches have revealed global loss of local structure on the Xi chromosome and formation of large mega-domains, separated by a region containing the DXZ4 macrosatellite7–10. However, the molecular architecture of the Xi chromosome, in both the silent and expressed regions, remains unclear. Here we investigate the structure, chromatin accessibility and expression status of the mouse Xi chromosome in highly polymorphic clonal neural progenitors (NPCs) and embryonic stem cells. We demonstrate a crucial role for Xist and the DXZ4-containing boundary in shaping Xi chromosome structure using allele-specific genome-wide chromosome conformation capture (Hi-C) analysis, an assay for transposase-accessible chromatin with high throughput sequencing (ATAC–seq) and RNA sequencing. Deletion of the boundary disrupts mega-domain formation, and induction of Xist RNA initiates formation of the boundary and the loss of DNA accessibility. We also show that in NPCs, the Xi chromosome lacks active/inactive compartments and topologically associating domains (TADs), except around genes that escape XCI. Escapee gene clusters display TAD-like structures and retain DNA accessibility at promoter-proximal and CTCF-binding sites. Furthermore, altered patterns of facultative escape genes in different neural progenitor clones are associated with the presence of different TAD-like structures after XCI. These findings suggest a key role for transcription and CTCF in the formation of TADs in the context of the Xi chromosome in neural progenitors. PMID:27437574

CUDR promotes liver cancer stem cell growth through upregulating TERT and C-Myc

PubMed Central

Pu, Hu; Zheng, Qidi; Li, Haiyan; Wu, Mengying; An, Jiahui; Gui, Xin; Li, Tianming; Lu, Dongdong

2015-01-01

Cancer up-regulated drug resistant (CUDR) is a novel non-coding RNA gene. Herein, we demonstrate excessive CUDR cooperates with excessive CyclinD1 or PTEN depletion to accelerate liver cancer stem cells growth and liver stem cell malignant transformation in vitro and in vivo. Mechanistically, we reveal the decrease of PTEN in cells may lead to increase binding capacity of CUDR to CyclinD1. Therefore, CUDR-CyclinD1 complex loads onto the long noncoding RNA H19 promoter region that may lead to reduce the DNA methylation on H19 promoter region and then to enhance the H19 expression. Strikingly, the overexpression of H19 increases the binding of TERT to TERC and reduces the interplay between TERT with TERRA, thus enhancing the cell telomerase activity and extending the telomere length. On the other hand, insulator CTCF recruits the CUDR-CyclinD1 complx to form the composite CUDR-CyclinD1-insulator CTCF complex which occupancied on the C-myc gene promoter region, increasing the outcome of oncogene C-myc. Ultimately, excessive TERT and C-myc lead to liver cancer stem cell and hepatocyte-like stem cell malignant proliferation. To understand the novel functions of long noncoding RNA CUDR will help in the development of new liver cancer therapeutic and diagnostic approaches. PMID:26513297

Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements

PubMed Central

Kyrchanova, Olga; Chetverina, Darya; Maksimenko, Oksana; Kullyev, Andrey; Georgiev, Pavel

2008-01-01

Insulators are defined as a class of regulatory elements that delimit independent transcriptional domains within eukaryotic genomes. According to previous data, an interaction (pairing) between some Drosophila insulators can support distant activation of a promoter by an enhancer. Here, we have demonstrated that pairs of well-studied insulators such as scs–scs, scs’–scs’, 1A2–1A2 and Wari–Wari support distant activation of the white promoter by the yeast GAL4 activator in an orientation-dependent manner. The same is true for the efficiency of the enhancer that stimulates white expression in the eyes. In all insulator pairs tested, stimulation of the white gene was stronger when insulators were inserted between the eye enhancer or GAL4 and the white promoter in opposite orientations relative to each other. As shown previously, Zw5, Su(Hw) and dCTCF proteins are required for the functioning of different insulators that do not interact with each other. Here, strong functional interactions have been revealed between DNA fragments containing binding sites for either Zw5 or Su(Hw) or dCTCF protein but not between heterologous binding sites [Zw5–Su(Hw), dCTCF–Su(Hw), or dCTCF–Zw5]. These results suggest that insulator proteins can support selective interactions between distant regulatory elements. PMID:18987002

RNAi-independent role for Argonaute2 in CTCF/CP190 chromatin insulator function

PubMed Central

Moshkovich, Nellie; Nisha, Parul; Boyle, Patrick J.; Thompson, Brandi A.; Dale, Ryan K.; Lei, Elissa P.

2011-01-01

A major role of the RNAi pathway in Schizosaccharomyces pombe is to nucleate heterochromatin, but it remains unclear whether this mechanism is conserved. To address this question in Drosophila, we performed genome-wide localization of Argonaute2 (AGO2) by chromatin immunoprecipitation (ChIP)-seq in two different embryonic cell lines and found that AGO2 localizes to euchromatin but not heterochromatin. This localization pattern is further supported by immunofluorescence staining of polytene chromosomes and cell lines, and these studies also indicate that a substantial fraction of AGO2 resides in the nucleus. Intriguingly, AGO2 colocalizes extensively with CTCF/CP190 chromatin insulators but not with genomic regions corresponding to endogenous siRNA production. Moreover, AGO2, but not its catalytic activity or Dicer-2, is required for CTCF/CP190-dependent Fab-8 insulator function. AGO2 interacts physically with CTCF and CP190, and depletion of either CTCF or CP190 results in genome-wide loss of AGO2 chromatin association. Finally, mutation of CTCF, CP190, or AGO2 leads to reduction of chromosomal looping interactions, thereby altering gene expression. We propose that RNAi-independent recruitment of AGO2 to chromatin by insulator proteins promotes the definition of transcriptional domains throughout the genome. PMID:21852534

Functional Dissection of the Blocking and Bypass Activities of the Fab-8 Boundary in the Drosophila Bithorax Complex.

PubMed

Kyrchanova, Olga; Mogila, Vladic; Wolle, Daniel; Deshpande, Girish; Parshikov, Alexander; Cléard, Fabienne; Karch, Francois; Schedl, Paul; Georgiev, Pavel

2016-07-01

Functionally autonomous regulatory domains direct the parasegment-specific expression of the Drosophila Bithorax complex (BX-C) homeotic genes. Autonomy is conferred by boundary/insulator elements that separate each regulatory domain from its neighbors. For six of the nine parasegment (PS) regulatory domains in the complex, at least one boundary is located between the domain and its target homeotic gene. Consequently, BX-C boundaries must not only block adventitious interactions between neighboring regulatory domains, but also be permissive (bypass) for regulatory interactions between the domains and their gene targets. To elucidate how the BX-C boundaries combine these two contradictory activities, we have used a boundary replacement strategy. We show that a 337 bp fragment spanning the Fab-8 boundary nuclease hypersensitive site and lacking all but 83 bp of the 625 bp Fab-8 PTS (promoter targeting sequence) fully rescues a Fab-7 deletion. It blocks crosstalk between the iab-6 and iab-7 regulatory domains, and has bypass activity that enables the two downstream domains, iab-5 and iab-6, to regulate Abdominal-B (Abd-B) transcription in spite of two intervening boundary elements. Fab-8 has two dCTCF sites and we show that they are necessary both for blocking and bypass activity. However, CTCF sites on their own are not sufficient for bypass. While multimerized dCTCF (or Su(Hw)) sites have blocking activity, they fail to support bypass. Moreover, this bypass defect is not rescued by the full length PTS. Finally, we show that orientation is critical for the proper functioning the Fab-8 replacement. Though the inverted Fab-8 boundary still blocks crosstalk, it disrupts the topology of the Abd-B regulatory domains and does not support bypass. Importantly, altering the orientation of the Fab-8 dCTCF sites is not sufficient to disrupt bypass, indicating that orientation dependence is conferred by other factors.

Functional Dissection of the Blocking and Bypass Activities of the Fab-8 Boundary in the Drosophila Bithorax Complex

PubMed Central

Wolle, Daniel; Deshpande, Girish; Parshikov, Alexander; Cléard, Fabienne; Karch, Francois; Schedl, Paul; Georgiev, Pavel

2016-01-01

Functionally autonomous regulatory domains direct the parasegment-specific expression of the Drosophila Bithorax complex (BX-C) homeotic genes. Autonomy is conferred by boundary/insulator elements that separate each regulatory domain from its neighbors. For six of the nine parasegment (PS) regulatory domains in the complex, at least one boundary is located between the domain and its target homeotic gene. Consequently, BX-C boundaries must not only block adventitious interactions between neighboring regulatory domains, but also be permissive (bypass) for regulatory interactions between the domains and their gene targets. To elucidate how the BX-C boundaries combine these two contradictory activities, we have used a boundary replacement strategy. We show that a 337 bp fragment spanning the Fab-8 boundary nuclease hypersensitive site and lacking all but 83 bp of the 625 bp Fab-8 PTS (promoter targeting sequence) fully rescues a Fab-7 deletion. It blocks crosstalk between the iab-6 and iab-7 regulatory domains, and has bypass activity that enables the two downstream domains, iab-5 and iab-6, to regulate Abdominal-B (Abd-B) transcription in spite of two intervening boundary elements. Fab-8 has two dCTCF sites and we show that they are necessary both for blocking and bypass activity. However, CTCF sites on their own are not sufficient for bypass. While multimerized dCTCF (or Su(Hw)) sites have blocking activity, they fail to support bypass. Moreover, this bypass defect is not rescued by the full length PTS. Finally, we show that orientation is critical for the proper functioning the Fab-8 replacement. Though the inverted Fab-8 boundary still blocks crosstalk, it disrupts the topology of the Abd-B regulatory domains and does not support bypass. Importantly, altering the orientation of the Fab-8 dCTCF sites is not sufficient to disrupt bypass, indicating that orientation dependence is conferred by other factors. PMID:27428541

An integrated model for detecting significant chromatin interactions from high-resolution Hi-C data

PubMed Central

Carty, Mark; Zamparo, Lee; Sahin, Merve; González, Alvaro; Pelossof, Raphael; Elemento, Olivier; Leslie, Christina S.

2017-01-01

Here we present HiC-DC, a principled method to estimate the statistical significance (P values) of chromatin interactions from Hi-C experiments. HiC-DC uses hurdle negative binomial regression account for systematic sources of variation in Hi-C read counts—for example, distance-dependent random polymer ligation and GC content and mappability bias—and model zero inflation and overdispersion. Applied to high-resolution Hi-C data in a lymphoblastoid cell line, HiC-DC detects significant interactions at the sub-topologically associating domain level, identifying potential structural and regulatory interactions supported by CTCF binding sites, DNase accessibility, and/or active histone marks. CTCF-associated interactions are most strongly enriched in the middle genomic distance range (∼700 kb–1.5 Mb), while interactions involving actively marked DNase accessible elements are enriched both at short (<500 kb) and longer (>1.5 Mb) genomic distances. There is a striking enrichment of longer-range interactions connecting replication-dependent histone genes on chromosome 6, potentially representing the chromatin architecture at the histone locus body. PMID:28513628

A pooling-based approach to mapping genetic variants associated with DNA methylation

PubMed Central

Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.; McEwen, Lisa M.; Kobor, Michael S.; Fraser, Hunter B.

2015-01-01

DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a truly genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. We found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data. PMID:25910490

A pooling-based approach to mapping genetic variants associated with DNA methylation

DOE PAGES

Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.; ...

2015-04-24

DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a trulymore » genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. Here we found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.

DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a trulymore » genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. Here we found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data.« less

Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens

PubMed Central

Glinsky, Gennadi V.

2016-01-01

Abstract Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8–10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. PMID:27503290

Architectural roles of multiple chromatin insulators at the human apolipoprotein gene cluster

PubMed Central

Mishiro, Tsuyoshi; Ishihara, Ko; Hino, Shinjiro; Tsutsumi, Shuichi; Aburatani, Hiroyuki; Shirahige, Katsuhiko; Kinoshita, Yoshikazu; Nakao, Mitsuyoshi

2009-01-01

Long-range regulatory elements and higher-order chromatin structure coordinate the expression of multiple genes in cluster, and CTCF/cohesin-mediated chromatin insulator may be a key in this regulation. The human apolipoprotein (APO) A1/C3/A4/A5 gene region, whose alterations increase the risk of dyslipidemia and atherosclerosis, is partitioned at least by three CTCF-enriched sites and three cohesin protein RAD21-enriched sites (two overlap with the CTCF sites), resulting in the formation of two transcribed chromatin loops by interactions between insulators. The C3 enhancer and APOC3/A4/A5 promoters reside in the same loop, where the APOC3/A4 promoters are pointed towards the C3 enhancer, whereas the APOA1 promoter is present in the different loop. The depletion of either CTCF or RAD21 disrupts the chromatin loop structure, together with significant changes in the APO expression and the localization of transcription factor hepatocyte nuclear factor (HNF)-4α and transcriptionally active form of RNA polymerase II at the APO promoters. Thus, CTCF/cohesin-mediated insulators maintain the chromatin loop formation and the localization of transcriptional apparatus at the promoters, suggesting an essential role of chromatin insulation in controlling the expression of clustered genes. PMID:19322193

CTCF-KDM4A complex correlates with histone modifications that negatively regulate CHD5 gene expression in cancer cell lines

PubMed Central

Guerra-Calderas, Lissania; González-Barrios, Rodrigo; Patiño, Carlos César; Alcaraz, Nicolás; Salgado-Albarrán, Marisol; de León, David Cantú; Hernández, Clementina Castro; Sánchez-Pérez, Yesennia; Maldonado-Martínez, Héctor Aquiles; De la Rosa-Velazquez, Inti A.; Vargas-Romero, Fernanda; Herrera, Luis A.; García-Carrancá, Alejandro; Soto-Reyes, Ernesto

2018-01-01

Histone demethylase KDM4A is involved in H3K9me3 and H3K36me3 demethylation, which are epigenetic modifications associated with gene silencing and RNA Polymerase II elongation, respectively. KDM4A is abnormally expressed in cancer, affecting the expression of multiple targets, such as the CHD5 gene. This enzyme localizes at the first intron of CHD5, and the dissociation of KDM4A increases gene expression. In vitro assays showed that KDM4A-mediated demethylation is enhanced in the presence of CTCF, suggesting that CTCF could increase its enzymatic activity in vivo, however the specific mechanism by which CTCF and KDM4A might be involved in the CHD5 gene repression is poorly understood. Here, we show that CTCF and KDM4A form a protein complex, which is recruited into the first intron of CHD5. This is related to a decrease in H3K36me3/2 histone marks and is associated with its transcriptional downregulation. Depletion of CTCF or KDM4A by siRNA, triggered the reactivation of CHD5 expression, suggesting that both proteins are involved in the negative regulation of this gene. Furthermore, the knockout of KDM4A restored the CHD5 expression and H3K36me3 and H3K36me2 histone marks. Such mechanism acts independently of CHD5 promoter DNA methylation. Our findings support a novel mechanism of epigenetic repression at the gene body that does not involve promoter silencing. PMID:29682202

Extrusion without a motor: a new take on the loop extrusion model of genome organization

PubMed Central

Johnson, J.; Michieletto, D.; Morozov, A. N.; Nicodemi, M.; Cook, P. R.; Marenduzzo, D.

2018-01-01

ABSTRACT Chromatin loop extrusion is a popular model for the formation of CTCF loops and topological domains. Recent HiC data have revealed a strong bias in favour of a particular arrangement of the CTCF binding motifs that stabilize loops, and extrusion is the only model to date which can explain this. However, the model requires a motor to generate the loops, and although cohesin is a strong candidate for the extruding factor, a suitable motor protein (or a motor activity in cohesin itself) has yet to be found. Here we explore a new hypothesis: that there is no motor, and thermal motion within the nucleus drives extrusion. Using theoretical modelling and computer simulations we ask whether such diffusive extrusion could feasibly generate loops. Our simulations uncover an interesting ratchet effect (where an osmotic pressure promotes loop growth), and suggest, by comparison to recent in vitro and in vivo measurements, that diffusive extrusion can in principle generate loops of the size observed in the data. Extra View on : C. A. Brackley, J. Johnson, D. Michieletto, A. N. Morozov, M. Nicodemi, P. R. Cook, and D. Marenduzzo “Non-equilibrium chromosome looping via molecular slip-links”, Physical Review Letters 119 138101 (2017) PMID:29300120

Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens.

PubMed

Glinsky, Gennadi V

2016-09-19

Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8-10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Fast, Accurate and Automatic Ancient Nucleosome and Methylation Maps with epiPALEOMIX.

PubMed

Hanghøj, Kristian; Seguin-Orlando, Andaine; Schubert, Mikkel; Madsen, Tobias; Pedersen, Jakob Skou; Willerslev, Eske; Orlando, Ludovic

2016-12-01

The first epigenomes from archaic hominins (AH) and ancient anatomically modern humans (AMH) have recently been characterized, based, however, on a limited number of samples. The extent to which ancient genome-wide epigenetic landscapes can be reconstructed thus remains contentious. Here, we present epiPALEOMIX, an open-source and user-friendly pipeline that exploits post-mortem DNA degradation patterns to reconstruct ancient methylomes and nucleosome maps from shotgun and/or capture-enrichment data. Applying epiPALEOMIX to the sequence data underlying 35 ancient genomes including AMH, AH, equids and aurochs, we investigate the temporal, geographical and preservation range of ancient epigenetic signatures. We first assess the quality of inferred ancient epigenetic signatures within well-characterized genomic regions. We find that tissue-specific methylation signatures can be obtained across a wider range of DNA preparation types than previously thought, including when no particular experimental procedures have been used to remove deaminated cytosines prior to sequencing. We identify a large subset of samples for which DNA associated with nucleosomes is protected from post-mortem degradation, and nucleosome positioning patterns can be reconstructed. Finally, we describe parameters and conditions such as DNA damage levels and sequencing depth that limit the preservation of epigenetic signatures in ancient samples. When such conditions are met, we propose that epigenetic profiles of CTCF binding regions can be used to help data authentication. Our work, including epiPALEOMIX, opens for further investigations of ancient epigenomes through time especially aimed at tracking possible epigenetic changes during major evolutionary, environmental, socioeconomic, and cultural shifts. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells.

PubMed

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2010-05-01

Genome-wide occupancy profiles of five components of the RNA polymerase III (Pol III) machinery in human cells identified the expected tRNA and noncoding RNA targets and revealed many additional Pol III-associated loci, mostly near short interspersed elements (SINEs). Several genes are targets of an alternative transcription factor IIIB (TFIIIB) containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike nonexpressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner.

Genomic Binding Profiles of Functionally Distinct RNA Polymerase III Transcription Complexes in Human Cells

PubMed Central

Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J.; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

2012-01-01

Genome-wide occupancy profiles of five components of the RNA Polymerase III (Pol III) machinery in human cells identified the expected tRNA and non-coding RNA targets and revealed many additional Pol III-associated loci, mostly near SINEs. Several genes are targets of an alternative TFIIIB containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike non-expressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner. PMID:20418883

Aberrant methylation patterns affect the molecular pathogenesis of rheumatoid arthritis.

PubMed

Lin, Yang; Luo, Zhengqiang

2017-05-01

This study aims to investigate DNA methylation signatures in fibroblast-like synoviocytes (FLS) from patients with rheumatoid arthritis (RA), and to explore the relationship with transcription factors (TFs) that help to distinguish RA from osteoarthritis (OA). Microarray dataset of GSE46346, including six FLS samples from patients with RA and five FLS samples from patients with OA, was downloaded from the Gene Expression Omnibus database. RA and OA samples were screened for differentially methylated loci (DMLs). The corresponding differentially methylated genes (DMGs) were identified, followed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology (GO) enrichment analysis. A transcriptional regulatory network was built with TFs and their corresponding DMGs. Overall, 280 hypomethylated loci and 561 hypermethylated loci were screened. Genes containing hypermethylated loci were enriched in pathways in cancer, ECM-receptor interaction, focal adhesion and neurotrophin signaling pathways. Genes containing hypomethylated loci were enriched in the neurotrophin signaling pathway. Moreover, we found that CCCTC-binding factor (CTCF), Yin Yang 1 (YY1), v-myc avian myelocytomatosis viral oncogene homolog (c-MYC), and early growth response 1 (EGR1) were important TFs in the transcriptional regulatory network. Therefore, DMGs might participate in the neurotrophin signaling pathway, pathways in cancer, ECM-receptor interaction and focal adhesion pathways in RA. Furthermore, CTCF, c-MYC, YY1, and EGR1 may play important roles in RA through regulating DMGs. Copyright © 2017 Elsevier B.V. All rights reserved.

The connection between BRG1, CTCF and topoisomerases at TAD boundaries.

PubMed

Barutcu, A Rasim; Lian, Jane B; Stein, Janet L; Stein, Gary S; Imbalzano, Anthony N

2017-03-04

The eukaryotic genome is partitioned into topologically associating domains (TADs). Despite recent advances characterizing TADs and TAD boundaries, the organization of these structures is an important dimension of genome architecture and function that is not well understood. Recently, we demonstrated that knockdown of BRG1, an ATPase driving the chromatin remodeling activity of mammalian SWI/SNF enzymes, globally alters long-range genomic interactions and results in a reduction of TAD boundary strength. We provided evidence suggesting that this effect may be due to BRG1 affecting nucleosome occupancy around CTCF sites present at TAD boundaries. In this review, we elaborate on our findings and speculate that BRG1 may contribute to the regulation of the structural and functional properties of chromatin at TAD boundaries by affecting the function or the recruitment of CTCF and DNA topoisomerase complexes.

The genomic landscape of pediatric and young adult T-lineage acute lymphoblastic leukemia | Office of Cancer Genomics

Cancer.gov

Genetic alterations that activate NOTCH1 signaling and T cell transcription factors, coupled with inactivation of the INK4/ARF tumor suppressors, are hallmarks of T-lineage acute lymphoblastic leukemia (T-ALL), but detailed genome-wide sequencing of large T-ALL cohorts has not been carried out. Using integrated genomic analysis of 264 T-ALL cases, we identified 106 putative driver genes, half of which had not previously been described in childhood T-ALL (for example, CCND3, CTCF, MYB, SMARCA4, ZFP36L2 and MYCN).

Developmental Control of NRAMP1 (SLC11A1) Expression in Professional Phagocytes.

PubMed

Cellier, Mathieu F M

2017-05-03

NRAMP1 (SLC11A1) is a professional phagocyte membrane importer of divalent metals that contributes to iron recycling at homeostasis and to nutritional immunity against infection. Analyses of data generated by several consortia and additional studies were integrated to hypothesize mechanisms restricting NRAMP1 expression to mature phagocytes. Results from various epigenetic and transcriptomic approaches were collected for mesodermal and hematopoietic cell types and compiled for combined analysis with results of genetic studies associating single nucleotide polymorphisms (SNPs) with variations in NRAMP1 expression (eQTLs). Analyses establish that NRAMP1 is part of an autonomous topologically associated domain delimited by ubiquitous CCCTC-binding factor (CTCF) sites. NRAMP1 locus contains five regulatory regions: a predicted super-enhancer (S-E) key to phagocyte-specific expression; the proximal promoter; two intronic areas, including 3' inhibitory elements that restrict expression during development; and a block of upstream sites possibly extending the S-E domain. Also the downstream region adjacent to the 3' CTCF locus boundary may regulate expression during hematopoiesis. Mobilization of the locus 14 predicted transcriptional regulatory elements occurs in three steps, beginning with hematopoiesis; at the onset of myelopoiesis and through myelo-monocytic differentiation. Basal expression level in mature phagocytes is further influenced by genetic variation, tissue environment, and in response to infections that induce various epigenetic memories depending on microorganism nature. Constitutively associated transcription factors (TFs) include CCAAT enhancer binding protein beta (C/EBPb), purine rich DNA binding protein (PU.1), early growth response 2 (EGR2) and signal transducer and activator of transcription 1 (STAT1) while hypoxia-inducible factors (HIFs) and interferon regulatory factor 1 (IRF1) may stimulate iron acquisition in pro-inflammatory conditions. Mouse orthologous locus is generally conserved; chromatin patterns typify a de novo myelo-monocytic gene whose expression is tightly controlled by TFs Pu.1, C/ebps and Irf8; Irf3 and nuclear factor NF-kappa-B p 65 subunit (RelA) regulate expression in inflammatory conditions. Functional differences in the determinants identified at these orthologous loci imply that species-specific mechanisms control gene expression.

Tissue- and age-specific DNA replication patterns at the CTG/CAG-expanded human myotonic dystrophy type 1 locus.

PubMed

Cleary, John D; Tomé, Stéphanie; López Castel, Arturo; Panigrahi, Gagan B; Foiry, Laurent; Hagerman, Katharine A; Sroka, Hana; Chitayat, David; Gourdon, Geneviève; Pearson, Christopher E

2010-09-01

Myotonic dystrophy, caused by DM1 CTG/CAG repeat expansions, shows varying instability levels between tissues and across ages within patients. We determined DNA replication profiles at the DM1 locus in patient fibroblasts and tissues from DM1 transgenic mice of various ages showing different instability. In patient cells, the repeat is flanked by two replication origins demarcated by CTCF sites, with replication diminished at the expansion. In mice, the expansion replicated from only the downstream origin (CAG as lagging template). In testes from mice of three different ages, replication toward the repeat paused at the earliest age and was relieved at later ages-coinciding with increased instability. Brain, pancreas and thymus replication varied with CpG methylation at DM1 CTCF sites. CTCF sites between progressing forks and repeats reduced replication depending on chromatin. Thus, varying replication progression may affect tissue- and age-specific repeat instability.

miRNA-122 Protects Mice and Human Hepatocytes from Acetaminophen Toxicity by Regulating Cytochrome P450 Family 1 Subfamily A Member 2 and Family 2 Subfamily E Member 1 Expression.

PubMed

Chowdhary, Vivek; Teng, Kun-Yu; Thakral, Sharda; Zhang, Bo; Lin, Cho-Hao; Wani, Nissar; Bruschweiler-Li, Lei; Zhang, Xiaoli; James, Laura; Yang, Dakai; Junge, Norman; Brüschweiler, Rafael; Lee, William M; Ghoshal, Kalpana

2017-12-01

Acetaminophen toxicity is a leading cause of acute liver failure (ALF). We found that miRNA-122 (miR-122) is down-regulated in liver biopsy specimens of patients with ALF and in acetaminophen-treated mice. A marked decrease in the primary miR-122 expression occurs in mice on acetaminophen overdose because of suppression of its key transactivators, hepatocyte nuclear factor (HNF)-4α and HNF6. More importantly, the mortality rates of male and female liver-specific miR-122 knockout (LKO) mice were significantly higher than control mice when injected i.p. with an acetaminophen dose not lethal to the control. LKO livers exhibited higher basal expression of cytochrome P450 family 2 subfamily E member 1 (CYP2E1) and cytochrome P450 family 1 subfamily A member 2 (CYP1A2) that convert acetaminophen to highly reactive N-acetyl-p-benzoquinone imine. Upregulation of Cyp1a2 primary transcript and mRNA in LKO mice correlated with the elevation of aryl hydrocarbon receptor (AHR) and mediator 1 (MED1), two transactivators of Cyp1a2. Analysis of ChIP-seq data in the ENCODE (Encyclopedia of DNA Element) database identified association of CCCTC-binding factor (CTCF) with Ahr promoter in mouse livers. Both MED1 and CTCF are validated conserved miR-122 targets. Furthermore, depletion of Ahr, Med1, or Ctcf in Mir122 -/- hepatocytes reduced Cyp1a2 expression. Pulse-chase studies found that CYP2E1 protein level is upregulated in LKO hepatocytes. Notably, miR-122 depletion sensitized differentiated human HepaRG cells to acetaminophen toxicity that correlated with upregulation of AHR, MED1, and CYP1A2 expression. Collectively, these results reveal a critical role of miR-122 in acetaminophen detoxification and implicate its therapeutic potential in patients with ALF. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

CTCF and Cohesin in Genome Folding and Transcriptional Gene Regulation.

PubMed

Merkenschlager, Matthias; Nora, Elphège P

2016-08-31

Genome function, replication, integrity, and propagation rely on the dynamic structural organization of chromosomes during the cell cycle. Genome folding in interphase provides regulatory segmentation for appropriate transcriptional control, facilitates ordered genome replication, and contributes to genome integrity by limiting illegitimate recombination. Here, we review recent high-resolution chromosome conformation capture and functional studies that have informed models of the spatial and regulatory compartmentalization of mammalian genomes, and discuss mechanistic models for how CTCF and cohesin control the functional architecture of mammalian chromosomes.

The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

PubMed

Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

2018-01-01

Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights a role of homologous chromosome pairing in the regulation of gene expression in the Drosophila genome.

CREBBP mutations in relapsed acute lymphoblastic leukaemia

PubMed Central

Mullighan, Charles G.; Zhang, Jinghui; Kasper, Lawryn H.; Lerach, Stephanie; Payne-Turner, Debbie; Phillips, Letha A.; Heatley, Sue L.; Holmfeldt, Linda; Collins-Underwood, J. Racquel; Ma, Jing; Buetow, Kenneth H.; Pui, Ching-Hon; Baker, Sharyn D.; Brindle, Paul K.; Downing, James R.

2010-01-01

Relapsed acute lymphoblastic leukaemia (ALL) is a leading cause of death due to disease in young people, but the biologic determinants of treatment failure remain poorly understood. Recent genome-wide profiling of structural DNA alterations in ALL have identified multiple submicroscopic somatic mutations targeting key cellular pathways1,2, and have demonstrated substantial evolution in genetic alterations from diagnosis to relapse3. However, detailed analysis of sequence mutations in ALL has not been performed. To identify novel mutations in relapsed ALL, we resequenced 300 genes in matched diagnosis and relapse samples from 23 patients with ALL. This identified 52 somatic non-synonymous mutations in 32 genes, many of which were novel, including the transcriptional coactivators CREBBP and NCOR1, the transcription factors ERG, SPI1, TCF4 and TCF7L2, components of the Ras signalling pathway, histone genes, genes involved in histone modification (CREBBP and CTCF), and genes previously shown to be targets of recurring DNA copy number alteration in ALL. Analysis of an extended cohort of 71 diagnosis-relapse cases and 270 acute leukaemia cases that did not relapse found that 18.3% of relapse cases had sequence or deletion mutations of CREBBP, which encodes the transcriptional coactivator and histone acetyltransferase (HAT) CREB-binding protein (CBP)4. The mutations were either present at diagnosis or acquired at relapse, and resulted in truncated alleles or deleterious substitutions in conserved residues of the HAT domain. Functionally, the mutations impaired histone acetylation and transcriptional regulation of CREBBP targets, including glucocorticoid responsive genes. Several mutations acquired at relapse were detected in subclones at diagnosis, suggesting that the mutations may confer resistance to therapy. These results extend the landscape of genetic alterations in leukaemia, and identify mutations targeting transcriptional and epigenetic regulation as a mechanism of resistance in ALL. PMID:21390130

Predictive Computational Modeling of Chromatin Folding

NASA Astrophysics Data System (ADS)

di Pierro, Miichele; Zhang, Bin; Wolynes, Peter J.; Onuchic, Jose N.

In vivo, the human genome folds into well-determined and conserved three-dimensional structures. The mechanism driving the folding process remains unknown. We report a theoretical model (MiChroM) for chromatin derived by using the maximum entropy principle. The proposed model allows Molecular Dynamics simulations of the genome using as input the classification of loci into chromatin types and the presence of binding sites of loop forming protein CTCF. The model was trained to reproduce the Hi-C map of chromosome 10 of human lymphoblastoid cells. With no additional tuning the model was able to predict accurately the Hi-C maps of chromosomes 1-22 for the same cell line. Simulations show unknotted chromosomes, phase separation of chromatin types and a preference of chromatin of type A to sit at the periphery of the chromosomes.

A mechanistic link between gene regulation and genome architecture in mammalian development.

PubMed

Bonora, Giancarlo; Plath, Kathrin; Denholtz, Matthew

2014-08-01

The organization of chromatin within the nucleus and the regulation of transcription are tightly linked. Recently, mechanisms underlying this relationship have been uncovered. By defining the organizational hierarchy of the genome, determining changes in chromatin organization associated with changes in cell identity, and describing chromatin organization within the context of linear genomic features (such as chromatin modifications and transcription factor binding) and architectural proteins (including Cohesin, CTCF, and Mediator), a new paradigm in genome biology was established wherein genomes are organized around gene regulatory factors that govern cell identity. As such, chromatin organization plays a central role in establishing and maintaining cell state during development, with gene regulation and genome organization being mutually dependent effectors of cell identity. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protein Self-Assembly and Protein-Induced DNA Morphologies

NASA Astrophysics Data System (ADS)

Mawhinney, Matthew T.

The ability of biomolecules to associate into various structural configurations has a substantial impact on human physiology. The synthesis of protein polypeptide chains using the information encoded by DNA is mediated through the use of regulatory proteins, known as transcription factors. Some transcription factors perform function by inducing local curvature in deoxyribonucleic acid (DNA) strands, the mechanisms of which are not entirely known. An important architectural protein, eleven zinc finger CTCF (11 ZF CTCF) is involved in genome organization and hypothesized to mediate DNA loop formation. Direct evidence for these CTCF-induced DNA loops has yet to be observed. In this thesis, the effect of 11 ZF CTCF on DNA morphology is examined using atomic force microscopy, a powerful technique for visualizing biomolecules with nanometer resolution. The presence of CTCF is revealed to induce a variety of morphologies deviating from the relaxed state of control DNA samples, including compact circular complexes, meshes, and networks. Images reveal quasi-circular DNA/CTCF complexes consistent with a single DNA molecule twice wrapped around the protein. The structures of DNA and proteins are highly important for operations in the cell. Structural irregularities may lead to a variety of issues, including more than twenty human pathologies resulting from aberrant protein misfolding into amyloid aggregates of elongated fibrils. Insulin deficiency and resistance characterizing type 2 diabetes often requires administration of insulin. Injectable and inhalable delivery methods have been documented to result in the deposition of amyloid fibrils. Oligomers, soluble multiprotein assemblies, are believed to play an important role in this process. Insulin aggregation under physiological conditions is not well understood and oligomers have not yet been fully characterized. In this thesis, in vitro insulin aggregation at acidic and neutral pH is explored using a variety of techniques, including kinetic thioflavin T fluorescence, circular dichroism spectroscopy, atomic force and electron microscopy imaging. The size distribution of insulin oligomers at different assembly stages is characterized through covalent cross-linking and gel electrophoresis. Results show that at the earliest assembly stage, oligomers comprise up to 40% and 70% of soluble insulin at acidic and neutral pH, respectively. While the highest oligomer order increases with insulin concentration at acidic pH, the opposite tendency is observed at neutral pH, with heptamers formed in 10 muM insulin. These findings suggest that oligomers may be on- and off- pathway assemblies for insulin at acidic and neutral pH, respectively. Agitation, required to induce insulin aggregation at neutral pH, increases fibril formation rate and fibrillar mass by an order of magnitude each. Insulin incubated under agitated conditions at neutral pH rapidly aggregates into large micrometer-sized aggregates, which provides insight into injection-site amyloidosis and toxic pulmonary aggregates induced by administration of extraneous insulin.

Exhaustive methylation analysis revealed uneven profiles of methylation at IGF2/ICR1/H19 11p15 loci in Russell Silver syndrome.

PubMed

Azzi, Salah; Steunou, Virginie; Tost, Jörg; Rossignol, Sylvie; Thibaud, Nathalie; Das Neves, Cristina; Le Jule, Marilyne; Habib, Walid Abi; Blaise, Annick; Koudou, Yves; Busato, Florence; Le Bouc, Yves; Netchine, Irène

2015-01-01

The structural organisation of the human IGF2/ICR1/H19 11p15 domain is very complex, and the mechanisms underlying its regulation are poorly understood. The Imprinted Center Region 1 (ICR1) contains seven binding sites for the zinc-finger protein CTCF (CBS: CTCF Binding Sites); three additional differentially methylated regions (DMR) are located at the H19 promoter (H19DMR) and two in the IGF2 gene (DMR0 and DMR2), respectively. Loss of imprinting at the IGF2/ICR1/H19 domain results in two growth disorders with opposite phenotypes: Beckwith-Wiedemann syndrome and Russell Silver syndrome (RSS). Despite the IGF2/ICR1/H19 locus being widely studied, the extent of hypomethylation across the domain remains not yet addressed in patients with RSS. We assessed a detailed investigation of the methylation status of the 11p15 ICR1 CBS1-7, IGF2DMR0 and H19DMR (H19 promoter) in a population of controls (n=50) and RSS carrying (n=104) or not (n=65) carrying a hypomethylation at the 11p15 ICR1 region. The methylation indexes (MI) were balanced at all regions in the control population and patients with RSS without any as yet identified molecular anomaly. Interestingly, patients with RSS with ICR1 hypomethylation showed uneven profiles of methylation among the CBSs and DMRs. Furthermore, normal MIs at CBS1 and CBS7 were identified in 9% of patients. The hypomethylation does not spread equally throughout the IGF2/ICR1/H19 locus, and some loci could have normal MI, which may lead to underdiagnosis of patients with RSS with ICR1 hypomethylation. The uneven pattern of methylation suggests that some CBSs may play different roles in the tridimensional chromosomal looping regulation of this locus. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells

PubMed Central

Malashchuk, Igor; Lajoie, Brian R.; Mardaryev, Andrei N.; Gdula, Michal R.; Sharov, Andrey A.; Kohwi-Shigematsu, Terumi; Fessing, Michael Y.

2017-01-01

Mammalian genomes contain several dozens of large (>0.5 Mbp) lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs) in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C) technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC) locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac) revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene promoters and enhancers at the multi-TAD EDC locus in skin epithelial cells are cell type-specific and involve extensive contacts within TADs as well as between different gene-rich TADs, forming the framework for lineage-specific transcription. PMID:28863138

Enriching the international clinical nomenclature with Chinese daily used synonyms and concept recognition in physician notes.

PubMed

Zhang, Rui; Liu, Jialin; Huang, Yong; Wang, Miye; Shi, Qingke; Chen, Jun; Zeng, Zhi

2017-05-02

It has been shown that the entities in everyday clinical text are often expressed in a way that varies from how they are expressed in the nomenclature. Owing to lots of synonyms, abbreviations, medical jargons or even misspellings in the daily used physician notes in clinical information system (CIS), the terminology without enough synonyms may not be adequately suitable for the task of Chinese clinical term recognition. This paper demonstrates a validated system to retrieve the Chinese term of clinical finding (CTCF) from CIS and map them to the corresponding concepts of international clinical nomenclature, such as SNOMED CT. The system focuses on the SNOMED CT with Chinese synonyms enrichment (SCCSE). The literal similarity and the diagnosis-related similarity metrics were used for concept mapping. Two CTCF recognition methods, the rule- and terminology-based approach (RTBA) and the conditional random field machine learner (CRF), were adopted to identify the concepts in physician notes. The system was validated against the history of present illness annotated by clinical experts. The RTBA and CRF could be combined to predict new CTCFs besides SCCSE persistently. Around 59,000 CTCF candidates were accepted as valid and 39,000 of them occurred at least once in the history of present illness. 3,729 of them were accordant with the description in referenced Chinese clinical nomenclature, which could cross map to other international nomenclature such as SNOMED CT. With the hybrid similarity metrics, another 7,454 valid CTCFs (synonyms) were succeeded in concept mapping. For CTCF recognition in physician notes, a series of experiments were performed to find out the best CRF feature set, which gained an F-score of 0.887. The RTBA achieved a better F-score of 0.919 by the CTCF dictionary created in this research. This research demonstrated that it is feasible to help the SNOMED CT with Chinese synonyms enrichment based on physician notes in CIS. With continuous maintenance of SCCSE, the CTCFs could be precisely retrieved from free text, and the CTCFs arranged in semantic hierarchy of SNOMED CT could greatly improve the meaningful use of electronic health record in China. The methodology is also useful for clinical synonyms enrichment in other languages.

Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains

PubMed Central

Ulianov, Sergey V.; Khrameeva, Ekaterina E.; Gavrilov, Alexey A.; Flyamer, Ilya M.; Kos, Pavel; Mikhaleva, Elena A.; Penin, Aleksey A.; Logacheva, Maria D.; Imakaev, Maxim V.; Chertovich, Alexander; Gelfand, Mikhail S.; Shevelyov, Yuri Y.; Razin, Sergey V.

2016-01-01

Recent advances enabled by the Hi-C technique have unraveled many principles of chromosomal folding that were subsequently linked to disease and gene regulation. In particular, Hi-C revealed that chromosomes of animals are organized into topologically associating domains (TADs), evolutionary conserved compact chromatin domains that influence gene expression. Mechanisms that underlie partitioning of the genome into TADs remain poorly understood. To explore principles of TAD folding in Drosophila melanogaster, we performed Hi-C and poly(A)+ RNA-seq in four cell lines of various origins (S2, Kc167, DmBG3-c2, and OSC). Contrary to previous studies, we find that regions between TADs (i.e., the inter-TADs and TAD boundaries) in Drosophila are only weakly enriched with the insulator protein dCTCF, while another insulator protein Su(Hw) is preferentially present within TADs. However, Drosophila inter-TADs harbor active chromatin and constitutively transcribed (housekeeping) genes. Accordingly, we find that binding of insulator proteins dCTCF and Su(Hw) predicts TAD boundaries much worse than active chromatin marks do. Interestingly, inter-TADs correspond to decompacted inter-bands of polytene chromosomes, whereas TADs mostly correspond to densely packed bands. Collectively, our results suggest that TADs are condensed chromatin domains depleted in active chromatin marks, separated by regions of active chromatin. We propose the mechanism of TAD self-assembly based on the ability of nucleosomes from inactive chromatin to aggregate, and lack of this ability in acetylated nucleosomal arrays. Finally, we test this hypothesis by polymer simulations and find that TAD partitioning may be explained by different modes of inter-nucleosomal interactions for active and inactive chromatin. PMID:26518482

Alterations in expression of imprinted genes from the H19/IGF2 loci in a multigenerational model of intrauterine growth restriction (IUGR).

PubMed

Gonzalez-Rodriguez, Pablo; Cantu, Jessica; O'Neil, Derek; Seferovic, Maxim D; Goodspeed, Danielle M; Suter, Melissa A; Aagaard, Kjersti M

2016-05-01

The H19/IGF2 imprinted loci have attracted recent attention because of their role in cellular differentiation and proliferation, heritable gene regulation, and in utero or early postnatal growth and development. Expression from the imprinted H19/IGF2 locus involves a complex interplay of 3 means of epigenetic regulation: proper establishment of DNA methylation, promoter occupancy of CTCF, and expression of microRNA-675. We have demonstrated previously in a multigenerational rat model of intrauterine growth restriction the epigenetic heritability of adult metabolic syndrome in a F2 generation. We have further demonstrated abrogation of the F2 adult metabolic syndrome phenotype with essential nutrient supplementation of intermediates along the 1-carbon pathway and shown that alterations in the metabolome precede the adult onset of metabolic syndrome. The upstream molecular and epigenomic mediators underlying these observations, however, have yet to be elucidated fully. In the current study, we sought to characterize the impact of the intrauterine growth-restricted lineage and essential nutrient supplementation on both levels and molecular mediators of H19 and IGF2 gene expression in the F2 generation. F2 intrauterine growth-restricted and sham lineages were obtained by exposing P1 (grandmaternal) pregnant dams to bilateral uterine artery ligation or sham surgery at gestational day 19.5. F1 pups were allocated to the essential nutrient supplemented or control diet at postnatal day 21, and bred at 6-7 weeks of age. Hepatic tissues from the resultant F2 offspring at birth and at weaning (day 21) were obtained. Bisulfite modification and sequencing was employed for methylation analysis. H19 and IGF2 expression was measured by quantitative polymerase chain reaction. Promoter occupancy was quantified by the use of chromatin immunoprecipitation, or ChIP, against CTCF insulator proteins. Growth-restricted F2 on control diet demonstrated significant down-regulation in H19 expression compared with sham lineage (0.7831 vs 1.287; P < .05); however, essential nutrient supplementation diet abrogates this difference (4.995 vs 5.100; P > .05). Conversely, Igf2 was up-regulated by essential nutrient supplemented diet on the sham lineage (2.0 fold, P = .01), an effect that was not observed in the growth restricted offspring. A significant differential methylation was observed in the promoter region of region H19 among the intrauterine growth-restricted lineage (18% vs 25%; P < .05) on a control diet, whereas the essential nutrient supplemented diet was alternately associated with hypermethylation in both lineages (sham: 50%; intrauterine growth restriction: 84%, P < .05). Consistent with essential nutrient supplementation impacting the epigenome, a decrease of CTCF promoter occupancy was observed in CTCF4 of the growth restricted lineage (2.45% vs 0.56%; P < .05) on the control diet, an effect that was repressed with essential nutrient supplementation. Heritable growth restriction is associated with changes in H19 gene expression; these changes are reversible with diet supplementation to favorably impact adult metabolic syndrome. Copyright © 2016. Published by Elsevier Inc.

Functional and topological characteristics of mammalian regulatory domains

PubMed Central

Symmons, Orsolya; Uslu, Veli Vural; Tsujimura, Taro; Ruf, Sandra; Nassari, Sonya; Schwarzer, Wibke; Ettwiller, Laurence; Spitz, François

2014-01-01

Long-range regulatory interactions play an important role in shaping gene-expression programs. However, the genomic features that organize these activities are still poorly characterized. We conducted a large operational analysis to chart the distribution of gene regulatory activities along the mouse genome, using hundreds of insertions of a regulatory sensor. We found that enhancers distribute their activities along broad regions and not in a gene-centric manner, defining large regulatory domains. Remarkably, these domains correlate strongly with the recently described TADs, which partition the genome into distinct self-interacting blocks. Different features, including specific repeats and CTCF-binding sites, correlate with the transition zones separating regulatory domains, and may help to further organize promiscuously distributed regulatory influences within large domains. These findings support a model of genomic organization where TADs confine regulatory activities to specific but large regulatory domains, contributing to the establishment of specific gene expression profiles. PMID:24398455

Chromatin insulator elements: establishing barriers to set heterochromatin boundaries.

PubMed

Barkess, Gráinne; West, Adam G

2012-02-01

Epigenomic profiling has revealed that substantial portions of genomes in higher eukaryotes are organized into extensive domains of transcriptionally repressive chromatin. The boundaries of repressive chromatin domains can be fixed by DNA elements known as barrier insulators, to both shield neighboring gene expression and to maintain the integrity of chromosomal silencing. Here, we examine the current progress in identifying vertebrate barrier elements and their binding factors. We overview the design of the reporter assays used to define enhancer-blocking and barrier insulators. We look at the mechanisms vertebrate barrier proteins, such as USF1 and VEZF1, employ to counteract Polycomb- and heterochromatin-associated repression. We also undertake a critical analysis of whether CTCF could also act as a barrier protein. There is good evidence that barrier elements in vertebrates can form repressive chromatin domain boundaries. Future studies will determine whether barriers are frequently used to define repressive domain boundaries in vertebrates.

Epigenetics of the myotonic dystrophy-associated DMPK gene neighborhood

PubMed Central

Buckley, Lauren; Lacey, Michelle; Ehrlich, Melanie

2016-01-01

Aim: Identify epigenetic marks in the vicinity of DMPK (linked to myotonic dystrophy, DM1) that help explain tissue-specific differences in its expression. Materials & methods: At DMPK and its flanking genes (DMWD, SIX5, BHMG1 and RSPH6A), we analyzed many epigenetic and transcription profiles from myoblasts, myotubes, skeletal muscle, heart and 30 nonmuscle samples. Results: In the DMPK gene neighborhood, muscle-associated DNA hypermethylation and hypomethylation, enhancer chromatin, and CTCF binding were seen. Myogenic DMPK hypermethylation correlated with high expression and decreased alternative promoter usage. Testis/sperm hypomethylation of BHMG1 and RSPH6A was associated with testis-specific expression. G-quadruplex (G4) motifs and sperm-specific hypomethylation were found near the DM1-linked CTG repeats within DMPK. Conclusion: Tissue-specific epigenetic features in DMPK and neighboring genes help regulate its expression. G4 motifs in DMPK DNA and RNA might contribute to DM1 pathology. PMID:26756355

Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures

PubMed Central

Naughton, Catherine; Avlonitis, Nicolaos; Corless, Samuel; Prendergast, James G.; Mati, Ioulia K.; Eijk, Paul P.; Cockroft, Scott L.; Bradley, Mark; Ylstra, Bauke; Gilbert, Nick

2013-01-01

DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes. PMID:23416946

A high-resolution transcriptome map of cell cycle reveals novel connections between periodic genes and cancer

PubMed Central

Dominguez, Daniel; Tsai, Yi-Hsuan; Gomez, Nicholas; Jha, Deepak Kumar; Davis, Ian; Wang, Zefeng

2016-01-01

Progression through the cell cycle is largely dependent on waves of periodic gene expression, and the regulatory networks for these transcriptome dynamics have emerged as critical points of vulnerability in various aspects of tumor biology. Through RNA-sequencing of human cells during two continuous cell cycles (>2.3 billion paired reads), we identified over 1 000 mRNAs, non-coding RNAs and pseudogenes with periodic expression. Periodic transcripts are enriched in functions related to DNA metabolism, mitosis, and DNA damage response, indicating these genes likely represent putative cell cycle regulators. Using our set of periodic genes, we developed a new approach termed “mitotic trait” that can classify primary tumors and normal tissues by their transcriptome similarity to different cell cycle stages. By analyzing >4 000 tumor samples in The Cancer Genome Atlas (TCGA) and other expression data sets, we found that mitotic trait significantly correlates with genetic alterations, tumor subtype and, notably, patient survival. We further defined a core set of 67 genes with robust periodic expression in multiple cell types. Proteins encoded by these genes function as major hubs of protein-protein interaction and are mostly required for cell cycle progression. The core genes also have unique chromatin features including increased levels of CTCF/RAD21 binding and H3K36me3. Loss of these features in uterine and kidney cancers is associated with altered expression of the core 67 genes. Our study suggests new chromatin-associated mechanisms for periodic gene regulation and offers a predictor of cancer patient outcomes. PMID:27364684

Spores of the mycorrhizal fungus Glomus mosseae host yeasts that solubilize phosphate and accumulate polyphosphates.

PubMed

Mirabal Alonso, Loreli; Kleiner, Diethelm; Ortega, Eduardo

2008-04-01

The present paper reports the presence of bacteria and yeasts tightly associated with spores of an isolate of Glomus mosseae. Healthy spores were surface disinfected by combining chloramine-T 5%, Tween-40, and cephalexin 2.5 g L(-1) (CTCf). Macerates of these spores were incubated on agar media, microorganisms were isolated, and two yeasts were characterized (EndoGm1, EndoGm11). Both yeasts were able to solubilize low-soluble P sources (Ca and Fe phosphates) and accumulate polyphosphates (polyPs). Sequence analysis of 18S ribosomal deoxyribonucleic acid showed that the yeasts belong to the genera Rhodotorula or Rhodosporidium (EndoGm1) and Cryptococcus (EndoGm11). Results from inoculation experiments showed an effect of the spore-associated yeasts on the root growth of rice, suggesting potential tripartite interactions with mycorrhizal fungi and plants.

Long range epigenetic silencing is a trans-species mechanism that results in cancer specific deregulation by overriding the chromatin domains of normal cells.

PubMed

Forn, Marta; Muñoz, Mar; Tauriello, Daniele V F; Merlos-Suárez, Anna; Rodilla, Verónica; Bigas, Anna; Batlle, Eduard; Jordà, Mireia; Peinado, Miguel A

2013-12-01

DNA methylation and chromatin remodeling are frequently implicated in the silencing of genes involved in carcinogenesis. Long Range Epigenetic Silencing (LRES) is a mechanism of gene inactivation that affects multiple contiguous CpG islands and has been described in different human cancer types. However, it is unknown whether there is a coordinated regulation of the genes embedded in these regions in normal cells and in early stages of tumor progression. To better characterize the molecular events associated with the regulation and remodeling of these regions we analyzed two regions undergoing LRES in human colon cancer in the mouse model. We demonstrate that LRES also occurs in murine cancer in vivo and mimics the molecular features of the human phenomenon, namely, downregulation of gene expression, acquisition of inactive histone marks, and DNA hypermethylation of specific CpG islands. The genes embedded in these regions showed a dynamic and autonomous regulation during mouse intestinal cell differentiation, indicating that, in the framework considered here, the coordinated regulation in LRES is restricted to cancer. Unexpectedly, benign adenomas in Apc(Min/+) mice showed overexpression of most of the genes affected by LRES in cancer, which suggests that the repressive remodeling of the region is a late event. Chromatin immunoprecipitation analysis of the transcriptional insulator CTCF in mouse colon cancer cells revealed disrupted chromatin domain boundaries as compared with normal cells. Malignant regression of cancer cells by in vitro differentiation resulted in partial reversion of LRES and gain of CTCF binding. We conclude that genes in LRES regions are plastically regulated in cell differentiation and hyperproliferation, but are constrained to a coordinated repression by abolishing boundaries and the autonomous regulation of chromatin domains in cancer cells. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

3D chromosome rendering from Hi-C data using virtual reality

NASA Astrophysics Data System (ADS)

Zhu, Yixin; Selvaraj, Siddarth; Weber, Philip; Fang, Jennifer; Schulze, Jürgen P.; Ren, Bing

2015-01-01

Most genome browsers display DNA linearly, using single-dimensional depictions that are useful to examine certain epigenetic mechanisms such as DNA methylation. However, these representations are insufficient to visualize intrachromosomal interactions and relationships between distal genome features. Relationships between DNA regions may be difficult to decipher or missed entirely if those regions are distant in one dimension but could be spatially proximal when mapped to three-dimensional space. For example, the visualization of enhancers folding over genes is only fully expressed in three-dimensional space. Thus, to accurately understand DNA behavior during gene expression, a means to model chromosomes is essential. Using coordinates generated from Hi-C interaction frequency data, we have created interactive 3D models of whole chromosome structures and its respective domains. We have also rendered information on genomic features such as genes, CTCF binding sites, and enhancers. The goal of this article is to present the procedure, findings, and conclusions of our models and renderings.

FMR1 Epigenetic Silencing Commonly Occurs in Undifferentiated Fragile X-Affected Embryonic Stem Cells

PubMed Central

Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

2014-01-01

Summary Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5′-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases. PMID:25418717

FMR1 epigenetic silencing commonly occurs in undifferentiated fragile X-affected embryonic stem cells.

PubMed

Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

2014-11-11

Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5'-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

Long-lasting alterations to DNA methylation and ncRNAs could underlie the effects of fetal alcohol exposure in mice

PubMed Central

Laufer, Benjamin I.; Mantha, Katarzyna; Kleiber, Morgan L.; Diehl, Eric J.; Addison, Sean M. F.; Singh, Shiva M.

2013-01-01

SUMMARY Fetal alcohol spectrum disorders (FASDs) are characterized by life-long changes in gene expression, neurodevelopment and behavior. What mechanisms initiate and maintain these changes are not known, but current research suggests a role for alcohol-induced epigenetic changes. In this study we assessed alterations to adult mouse brain tissue by assaying DNA cytosine methylation and small noncoding RNA (ncRNA) expression, specifically the microRNA (miRNA) and small nucleolar RNA (snoRNA) subtypes. We found long-lasting alterations in DNA methylation as a result of fetal alcohol exposure, specifically in the imprinted regions of the genome harboring ncRNAs and sequences interacting with regulatory proteins. A large number of major nodes from the identified networks, such as Pten signaling, contained transcriptional repressor CTCF-binding sites in their promoters, illustrating the functional consequences of alcohol-induced changes to DNA methylation. Next, we assessed ncRNA expression using two independent array platforms and quantitative PCR. The results identified 34 genes that are targeted by the deregulated miRNAs. Of these, four (Pten, Nmnat1, Slitrk2 and Otx2) were viewed as being crucial in the context of FASDs given their roles in the brain. Furthermore, ∼20% of the altered ncRNAs mapped to three imprinted regions (Snrpn-Ube3a, Dlk1-Dio3 and Sfmbt2) that showed differential methylation and have been previously implicated in neurodevelopmental disorders. The findings of this study help to expand on the mechanisms behind the long-lasting changes in the brain transcriptome of FASD individuals. The observed changes could contribute to the initiation and maintenance of the long-lasting effect of alcohol. PMID:23580197

Early de novo DNA methylation and prolonged demethylation in the muscle lineage.

PubMed

Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M; Song, Lingyun; Crawford, Gregory E; Myers, Richard M; Lacey, Michelle; Ehrlich, Melanie

2013-03-01

Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues.

Early de novo DNA methylation and prolonged demethylation in the muscle lineage

PubMed Central

Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E.; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M.; Song, Lingyun; Crawford, Gregory E.; Myers, Richard M.; Lacey, Michelle; Ehrlich, Melanie

2013-01-01

Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues. PMID:23417056

ClusterTAD: an unsupervised machine learning approach to detecting topologically associated domains of chromosomes from Hi-C data.

PubMed

Oluwadare, Oluwatosin; Cheng, Jianlin

2017-11-14

With the development of chromosomal conformation capturing techniques, particularly, the Hi-C technique, the study of the spatial conformation of a genome is becoming an important topic in bioinformatics and computational biology. The Hi-C technique can generate genome-wide chromosomal interaction (contact) data, which can be used to investigate the higher-level organization of chromosomes, such as Topologically Associated Domains (TAD), i.e., locally packed chromosome regions bounded together by intra chromosomal contacts. The identification of the TADs for a genome is useful for studying gene regulation, genomic interaction, and genome function. Here, we formulate the TAD identification problem as an unsupervised machine learning (clustering) problem, and develop a new TAD identification method called ClusterTAD. We introduce a novel method to represent chromosomal contacts as features to be used by the clustering algorithm. Our results show that ClusterTAD can accurately predict the TADs on a simulated Hi-C data. Our method is also largely complementary and consistent with existing methods on the real Hi-C datasets of two mouse cells. The validation with the chromatin immunoprecipitation (ChIP) sequencing (ChIP-Seq) data shows that the domain boundaries identified by ClusterTAD have a high enrichment of CTCF binding sites, promoter-related marks, and enhancer-related histone modifications. As ClusterTAD is based on a proven clustering approach, it opens a new avenue to apply a large array of clustering methods developed in the machine learning field to the TAD identification problem. The source code, the results, and the TADs generated for the simulated and real Hi-C datasets are available here: https://github.com/BDM-Lab/ClusterTAD .

BORIS/CTCFL mRNA isoform expression and epigenetic regulation in epithelial ovarian cancer

PubMed Central

Link, Petra A.; Zhang, Wa; Odunsi, Kunle; Karpf, Adam R.

2013-01-01

Cancer germline (CG) genes are normally expressed in germ cells and aberrantly expressed in a variety of cancers; their immunogenicity has led to the widespread development of cancer vaccines targeting these antigens. BORIS/CTCFL is an autosomal CG antigen and promising cancer vaccine target. BORIS is the only known paralog of CTCF, a gene intimately involved in genomic imprinting, chromatin insulation, and nuclear regulation. We have previously shown that BORIS is expressed in epithelial ovarian cancer (EOC) and that its expression coincides with promoter and global DNA hypomethylation. Recently, 23 different BORIS mRNA variants have been described, and have been functionally grouped into six BORIS isoform families (sf1–sf6). In the present study, we have characterized the expression of BORIS isoform families in normal ovary (NO) and EOC, the latter of which were selected to include two groups with widely varying global DNA methylation status. We find selective expression of BORIS isoform families in NO, which becomes altered in EOC, primarily by the activation of BORIS sf1 in EOC. When comparing EOC samples based on methylation status, we find that BORIS sf1 and sf2 isoform families are selectively activated in globally hypomethylated tumors. In contrast, CTCF is downregulated in EOC, and the ratio of BORIS sf1, sf2, and sf6 isoform families as a function of CTCF is elevated in hypomethylated tumors. Finally, the expression of all BORIS isoform families was induced to varying extents by epigenetic modulatory drugs in EOC cell lines, particularly when DNMT and HDAC inhibitors were used in combination. PMID:23390377

Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

PubMed

Clifford, Jacob; Adami, Christoph

2015-09-02

Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

Efficient Identification of Murine M2 Macrophage Peptide Targeting Ligands by Phage Display and Next-Generation Sequencing.

PubMed

Liu, Gary W; Livesay, Brynn R; Kacherovsky, Nataly A; Cieslewicz, Maryelise; Lutz, Emi; Waalkes, Adam; Jensen, Michael C; Salipante, Stephen J; Pun, Suzie H

2015-08-19

Peptide ligands are used to increase the specificity of drug carriers to their target cells and to facilitate intracellular delivery. One method to identify such peptide ligands, phage display, enables high-throughput screening of peptide libraries for ligands binding to therapeutic targets of interest. However, conventional methods for identifying target binders in a library by Sanger sequencing are low-throughput, labor-intensive, and provide a limited perspective (<0.01%) of the complete sequence space. Moreover, the small sample space can be dominated by nonspecific, preferentially amplifying "parasitic sequences" and plastic-binding sequences, which may lead to the identification of false positives or exclude the identification of target-binding sequences. To overcome these challenges, we employed next-generation Illumina sequencing to couple high-throughput screening and high-throughput sequencing, enabling more comprehensive access to the phage display library sequence space. In this work, we define the hallmarks of binding sequences in next-generation sequencing data, and develop a method that identifies several target-binding phage clones for murine, alternatively activated M2 macrophages with a high (100%) success rate: sequences and binding motifs were reproducibly present across biological replicates; binding motifs were identified across multiple unique sequences; and an unselected, amplified library accurately filtered out parasitic sequences. In addition, we validate the Multiple Em for Motif Elicitation tool as an efficient and principled means of discovering binding sequences.

Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

PubMed

Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

2006-08-15

The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

PubMed Central

Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

1993-01-01

The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

Integrated pathway-based approach identifies association between genomic regions at CTCF and CACNB2 and schizophrenia.

PubMed

Juraeva, Dilafruz; Haenisch, Britta; Zapatka, Marc; Frank, Josef; Witt, Stephanie H; Mühleisen, Thomas W; Treutlein, Jens; Strohmaier, Jana; Meier, Sandra; Degenhardt, Franziska; Giegling, Ina; Ripke, Stephan; Leber, Markus; Lange, Christoph; Schulze, Thomas G; Mössner, Rainald; Nenadic, Igor; Sauer, Heinrich; Rujescu, Dan; Maier, Wolfgang; Børglum, Anders; Ophoff, Roel; Cichon, Sven; Nöthen, Markus M; Rietschel, Marcella; Mattheisen, Manuel; Brors, Benedikt

2014-06-01

In the present study, an integrated hierarchical approach was applied to: (1) identify pathways associated with susceptibility to schizophrenia; (2) detect genes that may be potentially affected in these pathways since they contain an associated polymorphism; and (3) annotate the functional consequences of such single-nucleotide polymorphisms (SNPs) in the affected genes or their regulatory regions. The Global Test was applied to detect schizophrenia-associated pathways using discovery and replication datasets comprising 5,040 and 5,082 individuals of European ancestry, respectively. Information concerning functional gene-sets was retrieved from the Kyoto Encyclopedia of Genes and Genomes, Gene Ontology, and the Molecular Signatures Database. Fourteen of the gene-sets or pathways identified in the discovery dataset were confirmed in the replication dataset. These include functional processes involved in transcriptional regulation and gene expression, synapse organization, cell adhesion, and apoptosis. For two genes, i.e. CTCF and CACNB2, evidence for association with schizophrenia was available (at the gene-level) in both the discovery study and published data from the Psychiatric Genomics Consortium schizophrenia study. Furthermore, these genes mapped to four of the 14 presently identified pathways. Several of the SNPs assigned to CTCF and CACNB2 have potential functional consequences, and a gene in close proximity to CACNB2, i.e. ARL5B, was identified as a potential gene of interest. Application of the present hierarchical approach thus allowed: (1) identification of novel biological gene-sets or pathways with potential involvement in the etiology of schizophrenia, as well as replication of these findings in an independent cohort; (2) detection of genes of interest for future follow-up studies; and (3) the highlighting of novel genes in previously reported candidate regions for schizophrenia.

Special AT-rich sequence binding protein 1 promotes tumor growth and metastasis of esophageal squamous cell carcinoma.

PubMed

Ma, Jun; Wu, Kaiming; Zhao, Zhenxian; Miao, Rong; Xu, Zhe

2017-03-01

Esophageal squamous cell carcinoma is one of the most aggressive malignancies worldwide. Special AT-rich sequence binding protein 1 is a nuclear matrix attachment region binding protein which participates in higher order chromatin organization and tissue-specific gene expression. However, the role of special AT-rich sequence binding protein 1 in esophageal squamous cell carcinoma remains unknown. In this study, western blot and quantitative real-time polymerase chain reaction analysis were performed to identify differentially expressed special AT-rich sequence binding protein 1 in a series of esophageal squamous cell carcinoma tissue samples. The effects of special AT-rich sequence binding protein 1 silencing by two short-hairpin RNAs on cell proliferation, migration, and invasion were assessed by the CCK-8 assay and transwell assays in esophageal squamous cell carcinoma in vitro. Special AT-rich sequence binding protein 1 was significantly upregulated in esophageal squamous cell carcinoma tissue samples and cell lines. Silencing of special AT-rich sequence binding protein 1 inhibited the proliferation of KYSE450 and EC9706 cells which have a relatively high level of special AT-rich sequence binding protein 1, and the ability of migration and invasion of KYSE450 and EC9706 cells was distinctly suppressed. Special AT-rich sequence binding protein 1 could be a potential target for the treatment of esophageal squamous cell carcinoma and inhibition of special AT-rich sequence binding protein 1 may provide a new strategy for the prevention of esophageal squamous cell carcinoma invasion and metastasis.

Architectural protein subclasses shape 3-D organization of genomes during lineage commitment

PubMed Central

Phillips-Cremins, Jennifer E.; Sauria, Michael E. G.; Sanyal, Amartya; Gerasimova, Tatiana I.; Lajoie, Bryan R.; Bell, Joshua S. K.; Ong, Chin-Tong; Hookway, Tracy A.; Guo, Changying; Sun, Yuhua; Bland, Michael J.; Wagstaff, William; Dalton, Stephen; McDevitt, Todd C.; Sen, Ranjan; Dekker, Job; Taylor, James; Corces, Victor G.

2013-01-01

Summary Understanding the topological configurations of chromatin may reveal valuable insights into how the genome and epigenome act in concert to control cell fate during development. Here we generate high-resolution architecture maps across seven genomic loci in embryonic stem cells and neural progenitor cells. We observe a hierarchy of 3-D interactions that undergo marked reorganization at the sub-Mb scale during differentiation. Distinct combinations of CTCF, Mediator, and cohesin show widespread enrichment in looping interactions at different length scales. CTCF/cohesin anchor long-range constitutive interactions that form the topological basis for invariant sub-domains. Conversely, Mediator/cohesin together with pioneer factors bridge shortrange enhancer-promoter interactions within and between larger sub-domains. Knockdown of Smc1 or Med12 in ES cells results in disruption of spatial architecture and down-regulation of genes found in cohesin-mediated interactions. We conclude that cell type-specific chromatin organization occurs at the sub-Mb scale and that architectural proteins shape the genome in hierarchical length scales. PMID:23706625

Sub-kb Hi-C in D. melanogaster reveals conserved characteristics of TADs between insect and mammalian cells.

PubMed

Wang, Qi; Sun, Qiu; Czajkowsky, Daniel M; Shao, Zhifeng

2018-01-15

Topologically associating domains (TADs) are fundamental elements of the eukaryotic genomic structure. However, recent studies suggest that the insulating complexes, CTCF/cohesin, present at TAD borders in mammals are absent from those in Drosophila melanogaster, raising the possibility that border elements are not conserved among metazoans. Using in situ Hi-C with sub-kb resolution, here we show that the D. melanogaster genome is almost completely partitioned into >4000 TADs, nearly sevenfold more than previously identified. The overwhelming majority of these TADs are demarcated by the insulator complexes, BEAF-32/CP190, or BEAF-32/Chromator, indicating that these proteins may play an analogous role in flies as that of CTCF/cohesin in mammals. Moreover, extended regions previously thought to be unstructured are shown to consist of small contiguous TADs, a property also observed in mammals upon re-examination. Altogether, our work demonstrates that fundamental features associated with the higher-order folding of the genome are conserved from insects to mammals.

Quantification of Retinogenesis in 3D Cultures Reveals Epigenetic Memory and Higher Efficiency in iPSCs Derived from Rod Photoreceptors.

PubMed

Hiler, Daniel; Chen, Xiang; Hazen, Jennifer; Kupriyanov, Sergey; Carroll, Patrick A; Qu, Chunxu; Xu, Beisi; Johnson, Dianna; Griffiths, Lyra; Frase, Sharon; Rodriguez, Alberto R; Martin, Greg; Zhang, Jiakun; Jeon, Jongrye; Fan, Yiping; Finkelstein, David; Eisenman, Robert N; Baldwin, Kristin; Dyer, Michael A

2015-07-02

Cell-based therapies to treat retinal degeneration are now being tested in clinical trials. However, it is not known whether the source of stem cells is important for the production of differentiated cells suitable for transplantation. To test this, we generated induced pluripotent stem cells (iPSCs) from murine rod photoreceptors (r-iPSCs) and scored their ability to make retinae by using a standardized quantitative protocol called STEM-RET. We discovered that r-iPSCs more efficiently produced differentiated retinae than did embryonic stem cells (ESCs) or fibroblast-derived iPSCs (f-iPSCs). Retinae derived from f-iPSCs had fewer amacrine cells and other inner nuclear layer cells. Integrated epigenetic analysis showed that DNA methylation contributes to the defects in f-iPSC retinogenesis and that rod-specific CTCF insulator protein-binding sites may promote r-iPSC retinogenesis. Together, our data suggest that the source of stem cells is important for producing retinal neurons in three-dimensional (3D) organ cultures. Copyright © 2015 Elsevier Inc. All rights reserved.

A putative carbohydrate-binding domain of the lactose-binding Cytisus sessilifolius anti-H(O) lectin has a similar amino acid sequence to that of the L-fucose-binding Ulex europaeus anti-H(O) lectin.

PubMed

Konami, Y; Yamamoto, K; Osawa, T; Irimura, T

1995-04-01

The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).

Transcriptomic data from panarthropods shed new light on the evolution of insulator binding proteins in insects : Insect insulator proteins.

PubMed

Pauli, Thomas; Vedder, Lucia; Dowling, Daniel; Petersen, Malte; Meusemann, Karen; Donath, Alexander; Peters, Ralph S; Podsiadlowski, Lars; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Heger, Peter; Wiehe, Thomas; Hering, Lars; Mayer, Georg; Misof, Bernhard; Niehuis, Oliver

2016-11-03

Body plan development in multi-cellular organisms is largely determined by homeotic genes. Expression of homeotic genes, in turn, is partially regulated by insulator binding proteins (IBPs). While only a few enhancer blocking IBPs have been identified in vertebrates, the common fruit fly Drosophila melanogaster harbors at least twelve different enhancer blocking IBPs. We screened recently compiled insect transcriptomes from the 1KITE project and genomic and transcriptomic data from public databases, aiming to trace the origin of IBPs in insects and other arthropods. Our study shows that the last common ancestor of insects (Hexapoda) already possessed a substantial number of IBPs. Specifically, of the known twelve insect IBPs, at least three (i.e., CP190, Su(Hw), and CTCF) already existed prior to the evolution of insects. Furthermore we found GAF orthologs in early branching insect orders, including Zygentoma (silverfish and firebrats) and Diplura (two-pronged bristletails). Mod(mdg4) is most likely a derived feature of Neoptera, while Pita is likely an evolutionary novelty of holometabolous insects. Zw5 appears to be restricted to schizophoran flies, whereas BEAF-32, ZIPIC and the Elba complex, are probably unique to the genus Drosophila. Selection models indicate that insect IBPs evolved under neutral or purifying selection. Our results suggest that a substantial number of IBPs either pre-date the evolution of insects or evolved early during insect evolution. This suggests an evolutionary history of insulator binding proteins in insects different to that previously thought. Moreover, our study demonstrates the versatility of the 1KITE transcriptomic data for comparative analyses in insects and other arthropods.

A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

PubMed Central

Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

2001-01-01

Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

2008-06-06

Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

Detecting cooperative sequences in the binding of RNA Polymerase-II

NASA Astrophysics Data System (ADS)

Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

2008-03-01

Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

PubMed

Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

2017-05-01

Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

A peptide sequence on carcinoembryonic antigen binds to a 80kD protein on Kupffer cells.

PubMed

Thomas, P; Petrick, A T; Toth, C A; Fox, E S; Elting, J J; Steele, G

1992-10-30

Clearance of carcinoembryonic antigen (CEA) from the circulation is by binding to Kupffer cells in the liver. We have shown that CEA binding to Kupffer cells occurs via a peptide sequence YPELPK representing amino acids 107-112 of the CEA sequence. This peptide sequence is located in the region between the N-terminal and the first immunoglobulin like loop domain. Using native CEA and peptides containing this sequence complexed with a heterobifunctional crosslinking agent and ligand blotting with biotinylated CEA and NCA we have shown binding to an 80kD protein on the Kupffer cell surface. This binding protein may be important in the development of hepatic metastases.

In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

PubMed

Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

2017-02-07

Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

Hyperdiversity of Genes Encoding Integral Light-Harvesting Proteins in the Dinoflagellate Symbiodinium sp

PubMed Central

Boldt, Lynda; Yellowlees, David; Leggat, William

2012-01-01

The superfamily of light-harvesting complex (LHC) proteins is comprised of proteins with diverse functions in light-harvesting and photoprotection. LHC proteins bind chlorophyll (Chl) and carotenoids and include a family of LHCs that bind Chl a and c. Dinophytes (dinoflagellates) are predominantly Chl c binding algal taxa, bind peridinin or fucoxanthin as the primary carotenoid, and can possess a number of LHC subfamilies. Here we report 11 LHC sequences for the chlorophyll a-chlorophyll c 2-peridinin protein complex (acpPC) subfamily isolated from Symbiodinium sp. C3, an ecologically important peridinin binding dinoflagellate taxa. Phylogenetic analysis of these proteins suggests the acpPC subfamily forms at least three clades within the Chl a/c binding LHC family; Clade 1 clusters with rhodophyte, cryptophyte and peridinin binding dinoflagellate sequences, Clade 2 with peridinin binding dinoflagellate sequences only and Clades 3 with heterokontophytes, fucoxanthin and peridinin binding dinoflagellate sequences. PMID:23112815

SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

PubMed

Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

2018-05-25

Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

PubMed

Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

2014-11-01

As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Replication domains are self-interacting structural chromatin units of human chromosomes

NASA Astrophysics Data System (ADS)

Arneodo, Alain

2011-03-01

In higher eukaryotes, the absence of specific sequence motifs marking the origins of replication has been a serious hindrance to the understanding of the mechanisms that regulate the initiation and the maintenance of the replication program in different cell types. In silico analysis of nucleotide compositional skew has predicted the existence, in the germline, of replication N-domains bordered by putative replication origins and where the skew decreases rather linearly as the signature of a progressive inversion of the average fork polarity. Here, from the demonstration that the average fork polarity can be directly extracted from the derivative of replication timing profiles, we develop a wavelet-based pattern recognition methodology to delineate replication U-domains where the replication timing profile is shaped as a U and its derivative as a N. Replication U-domains are robustly found in seven cell lines as covering a significant portion (40-50%) of the human genome where the replication timing data actually displays some plasticity between cell lines. The early replication initiation zones at U-domains borders are found to be hypersensitive to DNase I cleavage, to be associated with transcriptional activity and to present a significant enrichment in insular-binding proteins CTCF, the hallmark of an open chromatin structure. A comparative analysis of genome-wide chromatin interaction (HiC) data shows that replication-U domains correspond to self-interacting structural high order chromatin units of megabase characteristic size. Taken together, these findings provide evidence that the epigenetic compartmentalization of the human genome into autonomous replication U-domains comes along with an extensive remodelling of the threedimensional chromosome architecture during development or in specific diseases. The observed cell specific conservation of the replication timing between the human and mouse genomes strongly suggests that this chromosome organization into self-interacting structural and functional units is a general feature of mammalian organisms.

Links between DNA methylation and nucleosome occupancy in the human genome.

PubMed

Collings, Clayton K; Anderson, John N

2017-01-01

DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

Structure and Sequence Search on Aptamer-Protein Docking

NASA Astrophysics Data System (ADS)

Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

2015-03-01

Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

PubMed Central

2017-01-01

Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

PubMed Central

Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

1988-01-01

The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

Phage display selection of peptides that target calcium-binding proteins.

PubMed

Vetter, Stefan W

2013-01-01

Phage display allows to rapidly identify peptide sequences with binding affinity towards target proteins, for example, calcium-binding proteins (CBPs). Phage technology allows screening of 10(9) or more independent peptide sequences and can identify CBP binding peptides within 2 weeks. Adjusting of screening conditions allows selecting CBPs binding peptides that are either calcium-dependent or independent. Obtained peptide sequences can be used to identify CBP target proteins based on sequence homology or to quickly obtain peptide-based CBP inhibitors to modulate CBP-target interactions. The protocol described here uses a commercially available phage display library, in which random 12-mer peptides are displayed on filamentous M13 phages. The library was screened against the calcium-binding protein S100B.

Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

PubMed

Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

2016-11-01

High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

PubMed

Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

2017-09-01

Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

CTCF, a Novel Regulator of Alternative Splicing | Center for Cancer Research

Cancer.gov

Alternative splicing, or the inclusion of different patterns of exons from the same gene, plays an important role in expanding the coding possibilities of a limited genome. The immune system is an ideal system to study this since alternative splicing is used to generate an almost unlimited number of antibodies against any pathogen we might encounter.

Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchman, A.R.; Kimmerly, W.J.; Rine, J.

1988-01-01

Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

RNA polymerase III transcription - regulated by chromatin structure and regulator of nuclear chromatin organization.

PubMed

Pascali, Chiara; Teichmann, Martin

2013-01-01

RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.

Genome-wide nucleosome map and cytosine methylation levels of an ancient human genome.

PubMed

Pedersen, Jakob Skou; Valen, Eivind; Velazquez, Amhed M Vargas; Parker, Brian J; Rasmussen, Morten; Lindgreen, Stinus; Lilje, Berit; Tobin, Desmond J; Kelly, Theresa K; Vang, Søren; Andersson, Robin; Jones, Peter A; Hoover, Cindi A; Tikhonov, Alexei; Prokhortchouk, Egor; Rubin, Edward M; Sandelin, Albin; Gilbert, M Thomas P; Krogh, Anders; Willerslev, Eske; Orlando, Ludovic

2014-03-01

Epigenetic information is available from contemporary organisms, but is difficult to track back in evolutionary time. Here, we show that genome-wide epigenetic information can be gathered directly from next-generation sequence reads of DNA isolated from ancient remains. Using the genome sequence data generated from hair shafts of a 4000-yr-old Paleo-Eskimo belonging to the Saqqaq culture, we generate the first ancient nucleosome map coupled with a genome-wide survey of cytosine methylation levels. The validity of both nucleosome map and methylation levels were confirmed by the recovery of the expected signals at promoter regions, exon/intron boundaries, and CTCF sites. The top-scoring nucleosome calls revealed distinct DNA positioning biases, attesting to nucleotide-level accuracy. The ancient methylation levels exhibited high conservation over time, clustering closely with modern hair tissues. Using ancient methylation information, we estimated the age at death of the Saqqaq individual and illustrate how epigenetic information can be used to infer ancient gene expression. Similar epigenetic signatures were found in other fossil material, such as 110,000- to 130,000-yr-old bones, supporting the contention that ancient epigenomic information can be reconstructed from a deep past. Our findings lay the foundation for extracting epigenomic information from ancient samples, allowing shifts in epialleles to be tracked through evolutionary time, as well as providing an original window into modern epigenomics.

Genome-wide nucleosome map and cytosine methylation levels of an ancient human genome

PubMed Central

Pedersen, Jakob Skou; Valen, Eivind; Velazquez, Amhed M. Vargas; Parker, Brian J.; Rasmussen, Morten; Lindgreen, Stinus; Lilje, Berit; Tobin, Desmond J.; Kelly, Theresa K.; Vang, Søren; Andersson, Robin; Jones, Peter A.; Hoover, Cindi A.; Tikhonov, Alexei; Prokhortchouk, Egor; Rubin, Edward M.; Sandelin, Albin; Gilbert, M. Thomas P.; Krogh, Anders; Willerslev, Eske; Orlando, Ludovic

2014-01-01

Epigenetic information is available from contemporary organisms, but is difficult to track back in evolutionary time. Here, we show that genome-wide epigenetic information can be gathered directly from next-generation sequence reads of DNA isolated from ancient remains. Using the genome sequence data generated from hair shafts of a 4000-yr-old Paleo-Eskimo belonging to the Saqqaq culture, we generate the first ancient nucleosome map coupled with a genome-wide survey of cytosine methylation levels. The validity of both nucleosome map and methylation levels were confirmed by the recovery of the expected signals at promoter regions, exon/intron boundaries, and CTCF sites. The top-scoring nucleosome calls revealed distinct DNA positioning biases, attesting to nucleotide-level accuracy. The ancient methylation levels exhibited high conservation over time, clustering closely with modern hair tissues. Using ancient methylation information, we estimated the age at death of the Saqqaq individual and illustrate how epigenetic information can be used to infer ancient gene expression. Similar epigenetic signatures were found in other fossil material, such as 110,000- to 130,000-yr-old bones, supporting the contention that ancient epigenomic information can be reconstructed from a deep past. Our findings lay the foundation for extracting epigenomic information from ancient samples, allowing shifts in epialleles to be tracked through evolutionary time, as well as providing an original window into modern epigenomics. PMID:24299735

THE GENOMIC LANDSCAPE OF PEDIATRIC AND YOUNG ADULT T-LINEAGE ACUTE LYMPHOBLASTIC LEUKEMIA

PubMed Central

Liu, Yu; Easton, John; Shao, Ying; Maciaszek, Jamie; Wang, Zhaoming; Wilkinson, Mark R.; McCastlain, Kelly; Edmonson, Michael; Pounds, Stanley B.; Shi, Lei; Zhou, Xin; Ma, Xiaotu; Sioson, Edgar; Li, Yongjin; Rusch, Michael; Gupta, Pankaj; Pei, Deqing; Cheng, Cheng; Smith, Malcolm A.; Auvil, Jaime Guidry; Gerhard, Daniela S.; Relling, Mary V.; Winick, Naomi J.; Carroll, Andrew J.; Heerema, Nyla A.; Raetz, Elizabeth; Devidas, Meenakshi; Willman, Cheryl L.; Harvey, Richard C.; Carroll, William L.; Dunsmore, Kimberly P.; Winter, Stuart S.; Wood, Brent L; Sorrentino, Brian P.; Downing, James R.; Loh, Mignon L.; Hunger, Stephen P; Zhang, Jinghui; Mullighan, Charles G.

2017-01-01

Genetic alterations activating NOTCH1 signaling and T cell transcription factors, coupled with inactivation of the INK4/ARF tumor suppressors are hallmarks of T-ALL, but detailed genome-wide sequencing of large T-ALL cohorts has not been performed. Using integrated genomic analysis of 264 T-ALL cases, we identify 106 putative driver genes, half of which were not previously described in childhood T-ALL (e.g. CCND3, CTCF, MYB, SMARCA4, ZFP36L2 and MYCN). We described new mechanisms of coding and non-coding alteration, and identify 10 recurrently altered pathways, with associations between mutated genes and pathways, and stage or subtype of T-ALL. For example, NRAS/FLT3 mutations were associated with immature T-ALL, JAK3/STAT5B mutations in HOX1 deregulated ALL, PTPN2 mutations in TLX1 T-ALL, and PIK3R1/PTEN mutations in TAL1 ALL, suggesting that different signaling pathways have distinct roles according to maturational stage. This genomic landscape provides a logical framework for the development of faithful genetic models and new therapeutic approaches. PMID:28671688

Sequence specificity of single-stranded DNA-binding proteins: a novel DNA microarray approach

PubMed Central

Morgan, Hugh P.; Estibeiro, Peter; Wear, Martin A.; Max, Klaas E.A.; Heinemann, Udo; Cubeddu, Liza; Gallagher, Maurice P.; Sadler, Peter J.; Walkinshaw, Malcolm D.

2007-01-01

We have developed a novel DNA microarray-based approach for identification of the sequence-specificity of single-stranded nucleic-acid-binding proteins (SNABPs). For verification, we have shown that the major cold shock protein (CspB) from Bacillus subtilis binds with high affinity to pyrimidine-rich sequences, with a binding preference for the consensus sequence, 5′-GTCTTTG/T-3′. The sequence was modelled onto the known structure of CspB and a cytosine-binding pocket was identified, which explains the strong preference for a cytosine base at position 3. This microarray method offers a rapid high-throughput approach for determining the specificity and strength of ss DNA–protein interactions. Further screening of this newly emerging family of transcription factors will help provide an insight into their cellular function. PMID:17488853

STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

PubMed Central

Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

2013-01-01

The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

PubMed

Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

2015-08-01

Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

Specific minor groove solvation is a crucial determinant of DNA binding site recognition

PubMed Central

Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

2014-01-01

The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

DOE PAGES

Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

2016-03-09

The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

Identification and application of self-binding zipper-like sequences in SARS-CoV spike protein.

PubMed

Zhang, Si Min; Liao, Ying; Neo, Tuan Ling; Lu, Yanning; Liu, Ding Xiang; Vahlne, Anders; Tam, James P

2018-05-22

Self-binding peptides containing zipper-like sequences, such as the Leu/Ile zipper sequence within the coiled coil regions of proteins and the cross-β spine steric zippers within the amyloid-like fibrils, could bind to the protein-of-origin through homophilic sequence-specific zipper motifs. These self-binding sequences represent opportunities for the development of biochemical tools and/or therapeutics. Here, we report on the identification of a putative self-binding β-zipper-forming peptide within the severe acute respiratory syndrome-associated coronavirus spike (S) protein and its application in viral detection. Peptide array scanning of overlapping peptides covering the entire length of S protein identified 34 putative self-binding peptides of six clusters, five of which contained octapeptide core consensus sequences. The Cluster I consensus octapeptide sequence GINITNFR was predicted by the Eisenberg's 3D profile method to have high amyloid-like fibrillation potential through steric β-zipper formation. Peptide C6 containing the Cluster I consensus sequence was shown to oligomerize and form amyloid-like fibrils. Taking advantage of this, C6 was further applied to detect the S protein expression in vitro by fluorescence staining. Meanwhile, the coiled-coil-forming Leu/Ile heptad repeat sequences within the S protein were under-represented during peptide array scanning, in agreement with that long peptide lengths were required to attain high helix-mediated interaction avidity. The data suggest that short β-zipper-like self-binding peptides within the S protein could be identified through combining the peptide scanning and predictive methods, and could be exploited as biochemical detection reagents for viral infection. Copyright © 2018. Published by Elsevier Ltd.

Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

PubMed

Elder, Robert M; Jayaraman, Arthi

2013-10-10

Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

Comparative genomics and evolution of the amylase-binding proteins of oral streptococci.

PubMed

Haase, Elaine M; Kou, Yurong; Sabharwal, Amarpreet; Liao, Yu-Chieh; Lan, Tianying; Lindqvist, Charlotte; Scannapieco, Frank A

2017-04-20

Successful commensal bacteria have evolved to maintain colonization in challenging environments. The oral viridans streptococci are pioneer colonizers of dental plaque biofilm. Some of these bacteria have adapted to life in the oral cavity by binding salivary α-amylase, which hydrolyzes dietary starch, thus providing a source of nutrition. Oral streptococcal species bind α-amylase by expressing a variety of amylase-binding proteins (ABPs). Here we determine the genotypic basis of amylase binding where proteins of diverse size and function share a common phenotype. ABPs were detected in culture supernatants of 27 of 59 strains representing 13 oral Streptococcus species screened using the amylase-ligand binding assay. N-terminal sequences from ABPs of diverse size were obtained from 18 strains representing six oral streptococcal species. Genome sequencing and BLAST searches using N-terminal sequences, protein size, and key words identified the gene associated with each ABP. Among the sequenced ABPs, 14 matched amylase-binding protein A (AbpA), 6 matched amylase-binding protein B (AbpB), and 11 unique ABPs were identified as peptidoglycan-binding, glutamine ABC-type transporter, hypothetical, or choline-binding proteins. Alignment and phylogenetic analyses performed to ascertain evolutionary relationships revealed that ABPs cluster into at least six distinct, unrelated families (AbpA, AbpB, and four novel ABPs) with no phylogenetic evidence that one group evolved from another, and no single ancestral gene found within each group. AbpA-like sequences can be divided into five subgroups based on the N-terminal sequences. Comparative genomics focusing on the abpA gene locus provides evidence of horizontal gene transfer. The acquisition of an ABP by oral streptococci provides an interesting example of adaptive evolution.

Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

PubMed Central

Siepel, Adam; Lis, John T.

2012-01-01

DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

Architecture of a Fur Binding Site: a Comparative Analysis

PubMed Central

Lavrrar, Jennifer L.; McIntosh, Mark A.

2003-01-01

Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

PubMed

Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

2016-04-01

Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

PubMed

Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

2017-03-14

Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

Predicting protein-binding RNA nucleotides with consideration of binding partners.

PubMed

Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

2015-06-01

In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in most performance measures. To the best of our knowledge, this is the first sequence-based prediction of protein-binding nucleotides in RNA which considers the binding partner of RNA. The new model will provide valuable information for designing biochemical experiments to find putative protein-binding sites in RNA with unknown structure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

PubMed

Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

2018-01-16

DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

PubMed Central

Pastor, N; Pardo, L; Weinstein, H

1997-01-01

The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

PubMed

Álvarez-Martos, Isabel; Ferapontova, Elena E

2017-08-05

A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

Purification and sequencing of the active site tryptic peptide from penicillin-binding protein 1b of Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nicholas, R.A.; Suzuki, H.; Hirota, Y.

This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less

Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

PubMed Central

Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

2013-01-01

Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

Sequence2Vec: a novel embedding approach for modeling transcription factor binding affinity landscape.

PubMed

Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

2017-11-15

An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

Phosphorylation-dependent mineral-type specificity for apatite-binding peptide sequences.

PubMed

Addison, William N; Miller, Sharon J; Ramaswamy, Janani; Mansouri, Ahmad; Kohn, David H; McKee, Marc D

2010-12-01

Apatite-binding peptides discovered by phage display provide an alternative design method for creating functional biomaterials for bone and tooth tissue repair. A limitation of this approach is the absence of display peptide phosphorylation--a post-translational modification important to mineral-binding proteins. To refine the material specificity of a recently identified apatite-binding peptide, and to determine critical design parameters (net charge, charge distribution, amino acid sequence and composition) controlling peptide affinity for mineral, we investigated the effects of phosphorylation and sequence scrambling on peptide adsorption to four different apatites (bone-like mineral, and three types of apatite containing initially 0, 5.6 and 10.5% carbonate). Phosphorylation of the VTKHLNQISQSY peptide (VTK peptide) led to a 10-fold increase in peptide adsorption (compared to nonphosphorylated peptide) to bone-like mineral, and a 2-fold increase in adsorption to the carbonated apatite, but there was no effect of phosphorylation on peptide affinity to pure hydroxyapatite (without carbonate). Sequence scrambling of the nonphosphorylated VTK peptide enhanced its specificity for the bone-like mineral, but scrambled phosphorylated VTK peptide (pVTK) did not significantly alter mineral-binding suggesting that despite the importance of sequence order and/or charge distribution to mineral-binding, the enhanced binding after phosphorylation exceeds any further enhancement by altered sequence order. Osteoblast culture mineralization was dose-dependently inhibited by pVTK and to a significantly lesser extent by scrambled pVTK, while the nonphosphorylated and scrambled forms had no effect, indicating that inhibition of osteoblast mineralization is dependent on both peptide sequence and charge. Computational modeling of peptide-mineral interactions indicated a favorable change in binding energy upon phosphorylation that was unaffected by scrambling. In conclusion, phosphorylation of serine residues increases peptide specificity for bone-like mineral, whose adsorption is determined primarily by sequence composition and net charge as opposed to sequence order. However, sequence order in addition to net charge modulates the mineralization of osteoblast cultures. The ability of such peptides to inhibit mineralization has potential utility in the management of pathologic calcification. Copyright © 2010 Elsevier Ltd. All rights reserved.

A conserved mechanism for replication origin recognition and binding in archaea.

PubMed

Majerník, Alan I; Chong, James P J

2008-01-15

To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

DOE Office of Scientific and Technical Information (OSTI.GOV)

Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

2010-02-19

Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

PubMed

Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

2017-07-01

FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

Position specific variation in the rate of evolution in transcription factor binding sites

PubMed Central

Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

2003-01-01

Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

PubMed

Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

2000-12-01

The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

PubMed

Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

2009-08-13

Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

PubMed Central

Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

2013-01-01

The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

PubMed Central

Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

1995-01-01

Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

PubMed

Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

2002-12-01

There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

Sequestration of cAMP response element-binding proteins by transcription factor decoys causes collateral elaboration of regenerating Aplysia motor neuron axons.

PubMed

Dash, P K; Tian, L M; Moore, A N

1998-07-07

Axonal injury increases intracellular Ca2+ and cAMP and has been shown to induce gene expression, which is thought to be a key event for regeneration. Increases in intracellular Ca2+ and/or cAMP can alter gene expression via activation of a family of transcription factors that bind to and modulate the expression of CRE (Ca2+/cAMP response element) sequence-containing genes. We have used Aplysia motor neurons to examine the role of CRE-binding proteins in axonal regeneration after injury. We report that axonal injury increases the binding of proteins to a CRE sequence-containing probe. In addition, Western blot analysis revealed that the level of ApCREB2, a CRE sequence-binding repressor, was enhanced as a result of axonal injury. The sequestration of CRE-binding proteins by microinjection of CRE sequence-containing plasmids enhanced axon collateral formation (both number and length) as compared with control plasmid injections. These findings show that Ca2+/cAMP-mediated gene expression via CRE-binding transcription factors participates in the regeneration of motor neuron axons.

DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

PubMed

Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

2017-10-01

Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

In vitro selection using a dual RNA library that allows primerless selection

PubMed Central

Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

2006-01-01

High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-08-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

PubMed Central

Sasaki, H; Yokoyama, E; Kuroiwa, A

1990-01-01

The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

PubMed Central

Naz, Sadia; Ngo, Tony; Farooq, Umar

2017-01-01

Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

PubMed

Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

2017-01-01

The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

2012-06-28

mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

PubMed

Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

2016-01-01

The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material.

Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies

PubMed Central

Rickert, Keith W.; Grinberg, Luba; Woods, Robert M.; Wilson, Susan; Bowen, Michael A.; Baca, Manuel

2016-01-01

ABSTRACT The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3–5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

MutaBind estimates and interprets the effects of sequence variants on protein-protein interactions.

PubMed

Li, Minghui; Simonetti, Franco L; Goncearenco, Alexander; Panchenko, Anna R

2016-07-08

Proteins engage in highly selective interactions with their macromolecular partners. Sequence variants that alter protein binding affinity may cause significant perturbations or complete abolishment of function, potentially leading to diseases. There exists a persistent need to develop a mechanistic understanding of impacts of variants on proteins. To address this need we introduce a new computational method MutaBind to evaluate the effects of sequence variants and disease mutations on protein interactions and calculate the quantitative changes in binding affinity. The MutaBind method uses molecular mechanics force fields, statistical potentials and fast side-chain optimization algorithms. The MutaBind server maps mutations on a structural protein complex, calculates the associated changes in binding affinity, determines the deleterious effect of a mutation, estimates the confidence of this prediction and produces a mutant structural model for download. MutaBind can be applied to a large number of problems, including determination of potential driver mutations in cancer and other diseases, elucidation of the effects of sequence variants on protein fitness in evolution and protein design. MutaBind is available at http://www.ncbi.nlm.nih.gov/projects/mutabind/. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

PubMed Central

Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

1995-01-01

The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

PubMed

Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

2014-07-01

Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

Targeted sequencing identifies associations between IL7R-JAK mutations and epigenetic modulators in T-cell acute lymphoblastic leukemia

PubMed Central

Vicente, Carmen; Schwab, Claire; Broux, Michaël; Geerdens, Ellen; Degryse, Sandrine; Demeyer, Sofie; Lahortiga, Idoya; Elliott, Alannah; Chilton, Lucy; La Starza, Roberta; Mecucci, Cristina; Vandenberghe, Peter; Goulden, Nicholas; Vora, Ajay; Moorman, Anthony V.; Soulier, Jean; Harrison, Christine J.; Clappier, Emmanuelle; Cools, Jan

2015-01-01

T-cell acute lymphoblastic leukemia is caused by the accumulation of multiple oncogenic lesions, including chromosomal rearrangements and mutations. To determine the frequency and co-occurrence of mutations in T-cell acute lymphoblastic leukemia, we performed targeted re-sequencing of 115 genes across 155 diagnostic samples (44 adult and 111 childhood cases). NOTCH1 and CDKN2A/B were mutated/deleted in more than half of the cases, while an additional 37 genes were mutated/deleted in 4% to 20% of cases. We found that IL7R-JAK pathway genes were mutated in 27.7% of cases, with JAK3 mutations being the most frequent event in this group. Copy number variations were also detected, including deletions of CREBBP or CTCF and duplication of MYB. FLT3 mutations were rare, but a novel extracellular mutation in FLT3 was detected and confirmed to be transforming. Furthermore, we identified complex patterns of pairwise associations, including a significant association between mutations in IL7R-JAK genes and epigenetic regulators (WT1, PRC2, PHF6). Our analyses showed that IL7R-JAK genetic lesions did not confer adverse prognosis in T-cell acute lymphoblastic leukemia cases enrolled in the UK ALL2003 trial. Overall, these results identify interconnections between the T-cell acute lymphoblastic leukemia genome and disease biology, and suggest a potential clinical application for JAK inhibitors in a significant proportion of patients with T-cell acute lymphoblastic leukemia. PMID:26206799

DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

PubMed Central

de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

2015-01-01

Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

Fibronectin tetrapeptide is target for syphilis spirochete cytadherence

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thomas, D.D.; Baseman, J.B.; Alderete, J.F.

1985-11-01

The syphilis bacterium, Treponema pallidum, parasitizes host cells through recognition of fibronectin (Fn) on cell surfaces. The active site of the Fn molecule has been identified as a four-amino acid sequence, arg-gly-asp-ser (RGDS), located on each monomer of the cell-binding domain. The synthetic heptapeptide gly-arg-gly-asp-ser-pro-cys (GRGDSPC), with the active site sequence RGDS, specifically competed with SVI-labeled cell-binding domain acquisition by T. pallidum. Additionally, the same heptapeptide with the RGDS sequence diminished treponemal attachment to HEp-2 and HT1080 cell monolayers. Related heptapeptides altered in one key amino acid within the RGDS sequence failed to inhibit Fn cell-binding domain acquisition or parasitismmore » of host cells by T. pallidum. The data support the view that T. pallidum cytadherence of host cells is through recognition of the RGDS sequence also important for eukaryotic cell-Fn binding.« less

Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

PubMed

Schneider, T D

2001-12-01

The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

DOE Office of Scientific and Technical Information (OSTI.GOV)

Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

2004-08-06

Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

Divalent Metal-Ion Complexes with Dipeptide Ligands Having Phe and His Side-Chain Anchors: Effects of Sequence, Metal Ion, and Anchor.

PubMed

Dunbar, Robert C; Berden, Giel; Martens, Jonathan K; Oomens, Jos

2015-09-24

Conformational preferences have been surveyed for divalent metal cation complexes with the dipeptide ligands AlaPhe, PheAla, GlyHis, and HisGly. Density functional theory results for a full set of complexes are presented, and previous experimental infrared spectra, supplemented by a number of newly recorded spectra obtained with infrared multiple photon dissociation spectroscopy, provide experimental verification of the preferred conformations in most cases. The overall structural features of these complexes are shown, and attention is given to comparisons involving peptide sequence, nature of the metal ion, and nature of the side-chain anchor. A regular progression is observed as a function of binding strength, whereby the weakly binding metal ions (Ba(2+) to Ca(2+)) transition from carboxylate zwitterion (ZW) binding to charge-solvated (CS) binding, while the stronger binding metal ions (Ca(2+) to Mg(2+) to Ni(2+)) transition from CS binding to metal-ion-backbone binding (Iminol) by direct metal-nitrogen bonds to the deprotonated amide nitrogens. Two new sequence-dependent reversals are found between ZW and CS binding modes, such that Ba(2+) and Ca(2+) prefer ZW binding in the GlyHis case but prefer CS binding in the HisGly case. The overall binding strength for a given metal ion is not strongly dependent on the sequence, but the histidine peptides are significantly more strongly bound (by 50-100 kJ mol(-1)) than the phenylalanine peptides.

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

PubMed

Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

2007-02-27

Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

Genome-wide localization of exosome components to active promoters and chromatin insulators in Drosophila

PubMed Central

Lim, Su Jun; Boyle, Patrick J.; Chinen, Madoka; Dale, Ryan K.; Lei, Elissa P.

2013-01-01

Chromatin insulators are functionally conserved DNA–protein complexes situated throughout the genome that organize independent transcriptional domains. Previous work implicated RNA as an important cofactor in chromatin insulator activity, although the precise mechanisms are not yet understood. Here we identify the exosome, the highly conserved major cellular 3′ to 5′ RNA degradation machinery, as a physical interactor of CP190-dependent chromatin insulator complexes in Drosophila. Genome-wide profiling of exosome by ChIP-seq in two different embryonic cell lines reveals extensive and specific overlap with the CP190, BEAF-32 and CTCF insulator proteins. Colocalization occurs mainly at promoters but also boundary elements such as Mcp, Fab-8, scs and scs′, which overlaps with a promoter. Surprisingly, exosome associates primarily with promoters but not gene bodies of active genes, arguing against simple cotranscriptional recruitment to RNA substrates. Similar to insulator proteins, exosome is also significantly enriched at divergently transcribed promoters. Directed ChIP of exosome in cell lines depleted of insulator proteins shows that CTCF is required specifically for exosome association at Mcp and Fab-8 but not other sites, suggesting that alternate mechanisms must also contribute to exosome chromatin recruitment. Taken together, our results reveal a novel positive relationship between exosome and chromatin insulators throughout the genome. PMID:23358822

TIA-1 RRM23 binding and recognition of target oligonucleotides

PubMed Central

Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

2017-01-01

Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

TIA-1 RRM23 binding and recognition of target oligonucleotides.

PubMed

Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

2017-05-05

TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

PubMed

Gold, Nicola D; Jackson, Richard M

2006-02-03

The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

A TATA binding protein mutant with increased affinity for DNA directs transcription from a reversed TATA sequence in vivo.

PubMed

Spencer, J Vaughn; Arndt, Karen M

2002-12-01

The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.

SSMART: Sequence-structure motif identification for RNA-binding proteins.

PubMed

Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

2018-06-11

RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

PubMed

Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

2017-11-01

DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

PubMed

Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

2015-01-01

Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

PubMed Central

Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

1987-01-01

To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

Investigating intermolecular forces associated with thrombus initiation using optical tweezers

NASA Astrophysics Data System (ADS)

Arya, Maneesh; Lopez, Jose A.; Romo, Gabriel M.; Dong, Jing-Fei; McIntire, Larry V.; Moake, Joel L.; Anvari, Bahman

2002-05-01

Thrombus formation occurs when a platelet membrane receptor, glycoprotein (GP) Ib-IX-V complex, binds to its ligand, von Willebrand factor (vWf), in the subendothelium or plasma. To determine which GP Ib-IX-V amino acid sequences are critical for bond formation, we have used optical tweezers to measure forces involved in the binding of vWf to GP Ib-IX-V variants. Inasmuch as GP Ib(alpha) subunit is the primary component in human GP Ib-IX-V complex that binds to vWf, and that canine GP Ib(alpha) , on the other hand, does not bind to human vWf, we progressively replaced human GP Ib(alpha) amino acid sequences with canine GP Ib(alpha) sequences to determine the sequences essential for vWf/GP Ib(alpha) binding. After measuring the adhesive forces between optically trapped, vWf-coated beads and GP Ib(alpha) variants expressed on mammalian cells, we determined that leucine- rich repeat 2 of GP Ib(alpha) was necessary for vWf/GP Ib-IX- V bond formation. We also found that deletion of the N- terminal flanking sequence and leucine-rich repeat 1 reduced adhesion strength to vWf but did not abolish binding. While divalent cations are known to influence binding of vWf, addition of 1mM CaCl2 had no effect on measured vWf/GP Ib(alpha) bond strengths.

Understanding the mechanisms of protein-DNA interactions

NASA Astrophysics Data System (ADS)

Lavery, Richard

2004-03-01

Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

PubMed

Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

2014-06-01

RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

The Liverwort Contains a Lectin That Is Structurally and Evolutionary Related to the Monocot Mannose-Binding Lectins1

PubMed Central

Peumans, Willy J.; Barre, Annick; Bras, Julien; Rougé, Pierre; Proost, Paul; Van Damme, Els J.M.

2002-01-01

A mannose (Man)-binding lectin has been isolated and characterized from the thallus of the liverwort Marchantia polymorpha. N-terminal sequencing indicated that the M. polymorpha agglutinin (Marpola) shares sequence similarity with the superfamily of monocot Man-binding lectins. Searches in the databases yielded expressed sequence tags encoding Marpola. Sequence analysis, molecular modeling, and docking experiments revealed striking structural similarities between Marpola and the monocot Man-binding lectins. Activity and specificity studies further indicated that Marpola is a much stronger agglutinin than the Galanthus nivalis agglutinin and exhibits a preference for methylated Man and glucose, which is unprecedented within the family of monocot Man-binding lectins. The discovery of Marpola allows us, for the first time, to corroborate the evolutionary relationship between a lectin from a lower plant and a well-established lectin family from flowering plants. In addition, the identification of Marpola sheds a new light on the molecular evolution of the superfamily of monocot Man-binding lectins. Beside evolutionary considerations, the occurrence of a G. nivalis agglutinin homolog in a lower plant necessitates the rethinking of the physiological role of the whole family of monocot Man-binding lectins. PMID:12114560

TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

PubMed

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

TFBSshape: a motif database for DNA shape features of transcription factor binding sites

PubMed Central

Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

2014-01-01

Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

Polycomb repressive complex 2 epigenomic signature defines age-associated hypermethylation and gene expression changes

PubMed Central

Dozmorov, Mikhail G

2015-01-01

Although age-associated gene expression and methylation changes have been reported throughout the literature, the unifying epigenomic principles of aging remain poorly understood. Recent explosion in availability and resolution of functional/regulatory genome annotation data (epigenomic data), such as that provided by the ENCODE and Roadmap Epigenomics projects, provides an opportunity for the identification of epigenomic mechanisms potentially altered by age-associated differentially methylated regions (aDMRs) and regulatory signatures in the promoters of age-associated genes (aGENs). In this study we found that aDMRs and aGENs identified in multiple independent studies share a common Polycomb Repressive Complex 2 signature marked by EZH2, SUZ12, CTCF binding sites, repressive H3K27me3, and activating H3K4me1 histone modification marks, and a “poised promoter” chromatin state. This signature is depleted in RNA Polymerase II-associated transcription factor binding sites, activating H3K79me2, H3K36me3, H3K27ac marks, and an “active promoter” chromatin state. The PRC2 signature was shown to be generally stable across cell types. When considering the directionality of methylation changes, we found the PRC2 signature to be associated with aDMRs hypermethylated with age, while hypomethylated aDMRs were associated with enhancers. In contrast, aGENs were associated with the PRC2 signature independently of the directionality of gene expression changes. In this study we demonstrate that the PRC2 signature is the common epigenomic context of genomic regions associated with hypermethylation and gene expression changes in aging. PMID:25880792

Predicting RNA-protein binding sites and motifs through combining local and global deep convolutional neural networks.

PubMed

Pan, Xiaoyong; Shen, Hong-Bin

2018-05-02

RNA-binding proteins (RBPs) take over 5∼10% of the eukaryotic proteome and play key roles in many biological processes, e.g. gene regulation. Experimental detection of RBP binding sites is still time-intensive and high-costly. Instead, computational prediction of the RBP binding sites using pattern learned from existing annotation knowledge is a fast approach. From the biological point of view, the local structure context derived from local sequences will be recognized by specific RBPs. However, in computational modeling using deep learning, to our best knowledge, only global representations of entire RNA sequences are employed. So far, the local sequence information is ignored in the deep model construction process. In this study, we present a computational method iDeepE to predict RNA-protein binding sites from RNA sequences by combining global and local convolutional neural networks (CNNs). For the global CNN, we pad the RNA sequences into the same length. For the local CNN, we split a RNA sequence into multiple overlapping fixed-length subsequences, where each subsequence is a signal channel of the whole sequence. Next, we train deep CNNs for multiple subsequences and the padded sequences to learn high-level features, respectively. Finally, the outputs from local and global CNNs are combined to improve the prediction. iDeepE demonstrates a better performance over state-of-the-art methods on two large-scale datasets derived from CLIP-seq. We also find that the local CNN run 1.8 times faster than the global CNN with comparable performance when using GPUs. Our results show that iDeepE has captured experimentally verified binding motifs. https://github.com/xypan1232/iDeepE. xypan172436@gmail.com or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online.

Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

PubMed

Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

2017-09-27

Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

2004-04-16

2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

Cancer.gov

A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of

MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

PubMed

Ozaki, Haruka; Iwasaki, Wataru

2016-08-01

As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

PubMed

de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

2015-11-16

Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

PubMed

Rohs, Remo; Sklenar, Heinz

2004-04-01

The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Q Zhai; M Landesman; H Robinson

2011-12-31

Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Q.; Robinson, H.; Landesman, M. B.

2011-01-01

Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

PubMed

Landini, P; Volkert, M R

1995-04-07

The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

Ancestry-Shift Refinement Mapping of the C6orf97-ESR1 Breast Cancer Susceptibility Locus

PubMed Central

Stacey, Simon N.; Sulem, Patrick; Zanon, Carlo; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Helgason, Agnar; Jonasdottir, Aslaug; Besenbacher, Soren; Kostic, Jelena P.; Fackenthal, James D.; Huo, Dezheng; Adebamowo, Clement; Ogundiran, Temidayo; Olson, Janet E.; Fredericksen, Zachary S.; Wang, Xianshu; Look, Maxime P.; Sieuwerts, Anieta M.; Martens, John W. M.; Pajares, Isabel; Garcia-Prats, Maria D.; Ramon-Cajal, Jose M.; de Juan, Ana; Panadero, Angeles; Ortega, Eugenia; Aben, Katja K. H.; Vermeulen, Sita H.; Asadzadeh, Fatemeh; van Engelenburg, K. C. Anton; Margolin, Sara; Shen, Chen-Yang; Wu, Pei-Ei; Försti, Asta; Lenner, Per; Henriksson, Roger; Johansson, Robert; Enquist, Kerstin; Hallmans, Göran; Jonsson, Thorvaldur; Sigurdsson, Helgi; Alexiusdottir, Kristin; Gudmundsson, Julius; Sigurdsson, Asgeir; Frigge, Michael L.; Gudmundsson, Larus; Kristjansson, Kristleifur; Halldorsson, Bjarni V.; Styrkarsdottir, Unnur; Gulcher, Jeffrey R.; Hemminki, Kari; Lindblom, Annika; Kiemeney, Lambertus A.; Mayordomo, Jose I.; Foekens, John A.; Couch, Fergus J.; Olopade, Olufunmilayo I.; Gudbjartsson, Daniel F.; Thorsteinsdottir, Unnur; Rafnar, Thorunn; Johannsson, Oskar T.; Stefansson, Kari

2010-01-01

We used an approach that we term ancestry-shift refinement mapping to investigate an association, originally discovered in a GWAS of a Chinese population, between rs2046210[T] and breast cancer susceptibility. The locus is on 6q25.1 in proximity to the C6orf97 and estrogen receptor α (ESR1) genes. We identified a panel of SNPs that are correlated with rs2046210 in Chinese, but not necessarily so in other ancestral populations, and genotyped them in breast cancer case∶control samples of Asian, European, and African origin, a total of 10,176 cases and 13,286 controls. We found that rs2046210[T] does not confer substantial risk of breast cancer in Europeans and Africans (OR = 1.04, P = 0.099, and OR = 0.98, P = 0.77, respectively). Rather, in those ancestries, an association signal arises from a group of less common SNPs typified by rs9397435. The rs9397435[G] allele was found to confer risk of breast cancer in European (OR = 1.15, P = 1.2×10−3), African (OR = 1.35, P = 0.014), and Asian (OR = 1.23, P = 2.9×10−4) population samples. Combined over all ancestries, the OR was 1.19 (P = 3.9×10−7), was without significant heterogeneity between ancestries (Phet = 0.36) and the SNP fully accounted for the association signal in each ancestry. Haplotypes bearing rs9397435[G] are well tagged by rs2046210[T] only in Asians. The rs9397435[G] allele showed associations with both estrogen receptor positive and estrogen receptor negative breast cancer. Using early-draft data from the 1,000 Genomes project, we found that the risk allele of a novel SNP (rs77275268), which is closely correlated with rs9397435, disrupts a partially methylated CpG sequence within a known CTCF binding site. These studies demonstrate that shifting the analysis among ancestral populations can provide valuable resolution in association mapping. PMID:20661439

The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

PubMed Central

Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

2009-01-01

PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

PubMed Central

Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2016-01-01

Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

BiPPred: Combined sequence- and structure-based prediction of peptide binding to the Hsp70 chaperone BiP.

PubMed

Schneider, Markus; Rosam, Mathias; Glaser, Manuel; Patronov, Atanas; Shah, Harpreet; Back, Katrin Christiane; Daake, Marina Angelika; Buchner, Johannes; Antes, Iris

2016-10-01

Substrate binding to Hsp70 chaperones is involved in many biological processes, and the identification of potential substrates is important for a comprehensive understanding of these events. We present a multi-scale pipeline for an accurate, yet efficient prediction of peptides binding to the Hsp70 chaperone BiP by combining sequence-based prediction with molecular docking and MMPBSA calculations. First, we measured the binding of 15mer peptides from known substrate proteins of BiP by peptide array (PA) experiments and performed an accuracy assessment of the PA data by fluorescence anisotropy studies. Several sequence-based prediction models were fitted using this and other peptide binding data. A structure-based position-specific scoring matrix (SB-PSSM) derived solely from structural modeling data forms the core of all models. The matrix elements are based on a combination of binding energy estimations, molecular dynamics simulations, and analysis of the BiP binding site, which led to new insights into the peptide binding specificities of the chaperone. Using this SB-PSSM, peptide binders could be predicted with high selectivity even without training of the model on experimental data. Additional training further increased the prediction accuracies. Subsequent molecular docking (DynaDock) and MMGBSA/MMPBSA-based binding affinity estimations for predicted binders allowed the identification of the correct binding mode of the peptides as well as the calculation of nearly quantitative binding affinities. The general concept behind the developed multi-scale pipeline can readily be applied to other protein-peptide complexes with linearly bound peptides, for which sufficient experimental binding data for the training of classical sequence-based prediction models is not available. Proteins 2016; 84:1390-1407. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

PubMed Central

Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

2012-01-01

In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

PubMed Central

Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

1994-01-01

We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

Binding Site Turnover Produces Pervasive Quantitative Changes in Transcription Factor Binding between Closely Related Drosophila Species

PubMed Central

Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.

2010-01-01

Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773

MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

PubMed

Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

2012-03-01

Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

PubMed

Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

2016-11-02

Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

PubMed Central

Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

2011-01-01

DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

PubMed

Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

1989-11-01

Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

PubMed

Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

2016-04-20

DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

Molecular dynamics studies on the DNA-binding process of ERG.

PubMed

Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

2016-11-15

The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

PubMed

Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

2014-09-25

In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

Bioinformatic Analysis of the Contribution of Primer Sequences to Aptamer Structures

PubMed Central

Ellington, Andrew D.

2009-01-01

Aptamers are nucleic acid molecules selected in vitro to bind a particular ligand. While numerous experimental studies have examined the sequences, structures, and functions of individual aptamers, considerably fewer studies have applied bioinformatics approaches to try to infer more general principles from these individual studies. We have used a large Aptamer Database to parse the contributions of both random and constant regions to the secondary structures of more than 2000 aptamers. We find that the constant, primer-binding regions do not, in general, contribute significantly to aptamer structures. These results suggest that (a) binding function is not contributed to nor constrained by constant regions; (b) in consequence, the landscape of functional binding sequences is sparse but robust, favoring scenarios for short, functional nucleic acid sequences near origins; and (c) many pool designs for the selection of aptamers are likely to prove robust. PMID:18594898

Localization and characterization of an alpha-thrombin-binding site on platelet glycoprotein Ib alpha.

PubMed

De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M

1994-03-04

Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.

DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

PubMed

Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

1995-09-05

Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

PubMed

Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

2012-11-01

The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

PubMed Central

Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

2007-01-01

Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

PubMed

Isalan, M; Klug, A; Choo, Y

2001-07-01

DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

PubMed Central

Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

2016-01-01

Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

PubMed Central

Evers, R; Grummt, I

1995-01-01

Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

NASA Astrophysics Data System (ADS)

Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

2017-01-01

Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

PubMed Central

Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

2014-01-01

The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

Chromatin looping defines expression of TAL1, its flanking genes, and regulation in T-ALL.

PubMed

Zhou, Yan; Kurukuti, Sreenivasulu; Saffrey, Peter; Vukovic, Milica; Michie, Alison M; Strogantsev, Ruslan; West, Adam G; Vetrie, David

2013-12-19

TAL1 is an important regulator of hematopoiesis and its expression is tightly controlled despite complexities in its genomic organization. It is frequently misregulated in T-cell acute lymphoblastic leukemia (T-ALL), often due to deletions between TAL1 and the neighboring STIL gene. To better understand the events that lead to TAL1 expression in hematopoiesis and in T-ALL, we studied looping interactions at the TAL1 locus. In TAL1-expressing erythroid cells, the locus adopts a looping "hub" which brings into close physical proximity all known TAL1 cis-regulatory elements including CTCF-bound insulators. Loss of GATA1 results in disassembly of the hub and loss of CTCF/RAD21 from one of its insulators. Genes flanking TAL1 are partly dependent on hub integrity for their transcriptional regulation. We identified looping patterns unique to TAL1-expressing T-ALL cells, and, intriguingly, loops occurring between the TAL1 and STIL genes at the common TAL1/STIL breakpoints found in T-ALL. These findings redefine how TAL1 and neighboring genes communicate within the nucleus, and indicate that looping facilitates both normal and aberrant TAL1 expression and may predispose to structural rearrangements in T-ALL. We also propose that GATA1-dependent looping mechanisms may facilitate the conservation of TAL1 regulation despite cis-regulatory remodeling during vertebrate evolution.

Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

PubMed Central

Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

2016-01-01

Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

PubMed Central

Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

1998-01-01

Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

PubMed

Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

2014-01-01

T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain

PubMed Central

Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

2014-01-01

T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein–nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5′ TOPs (5′ terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations. PMID:24824036

Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

PubMed Central

Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

2018-01-01

Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

PubMed

Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

2014-01-01

microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

Non-B-DNA structures on the interferon-beta promoter?

PubMed

Robbe, K; Bonnefoy, E

1998-01-01

The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes.

PubMed

Hamula, Camille L A; Peng, Hanyong; Wang, Zhixin; Tyrrell, Gregory J; Li, Xing-Fang; Le, X Chris

2016-03-15

Streptococcus pyogenes is a clinically important pathogen consisting of various serotypes determined by different M proteins expressed on the cell surface. The M type is therefore a useful marker to monitor the spread of invasive S. pyogenes in a population. Serotyping and nucleic acid amplification/sequencing methods for the identification of M types are laborious, inconsistent, and usually confined to reference laboratories. The primary objective of this work is to develop a technique that enables generation of aptamers binding to specific M-types of S. pyogenes. We describe here an in vitro technique that directly used live bacterial cells and the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) strategy. Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences. Those sequences that bound to the cells were separated, amplified using polymerase chain reaction (PCR), purified using gel electrophoresis, and served as the input DNA pool for the next round of SELEX selection. A specially designed forward primer containing extended polyA20/5Sp9 facilitated gel electrophoresis purification of ssDNA after PCR amplification. A counter-selection step using non-target cells was introduced to improve selectivity. DNA libraries of different starting sequence diversity (10(16) and 10(14)) were compared. Aptamer pools from each round of selection were tested for their binding to the target and non-target cells using flow cytometry. Selected aptamer pools were then cloned and sequenced. Individual aptamer sequences were screened on the basis of their binding to the 10 M-types that were used as targets. Aptamer pools obtained from SELEX rounds 5-8 showed high affinity to the target S. pyogenes cells. Tests against non-target Streptococcus bovis, Streptococcus pneumoniae, and Enterococcus species demonstrated selectivity of these aptamers for binding to S. pyogenes. Several aptamer sequences were found to bind preferentially to the M11 M-type of S. pyogenes. Estimated binding dissociation constants (Kd) were in the low nanomolar range for the M11 specific sequences; for example, sequence E-CA20 had a Kd of 7±1 nM. These affinities are comparable to those of a monoclonal antibody. The improved bacterial cell-SELEX technique is successful in generating aptamers selective for S. pyogenes and some of its M-types. These aptamers are potentially useful for detecting S. pyogenes, achieving binding profiles of the various M-types, and developing new M-typing technologies for non-specialized laboratories or point-of-care testing. Copyright © 2015 Elsevier Inc. All rights reserved.

Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

NASA Astrophysics Data System (ADS)

Niranjani, G.; Murugan, R.

2016-08-01

The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

PubMed Central

Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

2003-01-01

Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

GuiTope: an application for mapping random-sequence peptides to protein sequences.

PubMed

Halperin, Rebecca F; Stafford, Phillip; Emery, Jack S; Navalkar, Krupa Arun; Johnston, Stephen Albert

2012-01-03

Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC) at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

PubMed Central

Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

2013-01-01

A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

Wld S protein requires Nmnat activity and a short N-terminal sequence to protect axons in mice.

PubMed

Conforti, Laura; Wilbrey, Anna; Morreale, Giacomo; Janeckova, Lucie; Beirowski, Bogdan; Adalbert, Robert; Mazzola, Francesca; Di Stefano, Michele; Hartley, Robert; Babetto, Elisabetta; Smith, Trevor; Gilley, Jonathan; Billington, Richard A; Genazzani, Armando A; Ribchester, Richard R; Magni, Giulio; Coleman, Michael

2009-02-23

The slow Wallerian degeneration (Wld(S)) protein protects injured axons from degeneration. This unusual chimeric protein fuses a 70-amino acid N-terminal sequence from the Ube4b multiubiquitination factor with the nicotinamide adenine dinucleotide-synthesizing enzyme nicotinamide mononucleotide adenylyl transferase 1. The requirement for these components and the mechanism of Wld(S)-mediated neuroprotection remain highly controversial. The Ube4b domain is necessary for the protective phenotype in mice, but precisely which sequence is essential and why are unclear. Binding to the AAA adenosine triphosphatase valosin-containing protein (VCP)/p97 is the only known biochemical property of the Ube4b domain. Using an in vivo approach, we show that removing the VCP-binding sequence abolishes axon protection. Replacing the Wld(S) VCP-binding domain with an alternative ataxin-3-derived VCP-binding sequence restores its protective function. Enzyme-dead Wld(S) is unable to delay Wallerian degeneration in mice. Thus, neither domain is effective without the function of the other. Wld(S) requires both of its components to protect axons from degeneration.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

PubMed

Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

PubMed Central

Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

2016-01-01

A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

PubMed

Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

2018-02-01

Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation

PubMed Central

Huska, Matthew R.; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R.; Schwahn, Kevin; Cooper, Samantha B.; Yamamoto, Keith R.; Thomas-Chollier, Morgane; Vingron, Martin

2017-01-01

Abstract The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter–proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. PMID:27903902

The 1.3 A resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): metal ion binding correlates with base unstacking and groove contraction.

PubMed

Timsit, Youri; Bombard, Sophie

2007-12-01

Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction.

Sequence- and Interactome-Based Prediction of Viral Protein Hotspots Targeting Host Proteins: A Case Study for HIV Nef

PubMed Central

Sarmady, Mahdi; Dampier, William; Tozeren, Aydin

2011-01-01

Virus proteins alter protein pathways of the host toward the synthesis of viral particles by breaking and making edges via binding to host proteins. In this study, we developed a computational approach to predict viral sequence hotspots for binding to host proteins based on sequences of viral and host proteins and literature-curated virus-host protein interactome data. We use a motif discovery algorithm repeatedly on collections of sequences of viral proteins and immediate binding partners of their host targets and choose only those motifs that are conserved on viral sequences and highly statistically enriched among binding partners of virus protein targeted host proteins. Our results match experimental data on binding sites of Nef to host proteins such as MAPK1, VAV1, LCK, HCK, HLA-A, CD4, FYN, and GNB2L1 with high statistical significance but is a poor predictor of Nef binding sites on highly flexible, hoop-like regions. Predicted hotspots recapture CD8 cell epitopes of HIV Nef highlighting their importance in modulating virus-host interactions. Host proteins potentially targeted or outcompeted by Nef appear crowding the T cell receptor, natural killer cell mediated cytotoxicity, and neurotrophin signaling pathways. Scanning of HIV Nef motifs on multiple alignments of hepatitis C protein NS5A produces results consistent with literature, indicating the potential value of the hotspot discovery in advancing our understanding of virus-host crosstalk. PMID:21738584

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

PubMed

Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

2013-07-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

PubMed Central

Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

2013-01-01

The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

PubMed

Ma, Xin; Guo, Jing; Sun, Xiao

2016-01-01

DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

Contacts between the factor TUF and RPG sequences.

PubMed

Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

1990-08-25

The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Structure and Function of Lipopolysaccharide Binding Protein

NASA Astrophysics Data System (ADS)

Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

1990-09-01

The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

PubMed

Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

2016-06-15

Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

p53 Specifically Binds Triplex DNA In Vitro and in Cells

PubMed Central

Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

2016-01-01

Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

Characterization of the Organic Component of Low-Molecular-Weight Chromium-Binding Substance and Its Binding of Chromium123

PubMed Central

Chen, Yuan; Watson, Heather M.; Gao, Junjie; Sinha, Sarmistha Halder; Cassady, Carolyn J.; Vincent, John B.

2011-01-01

Chromium was proposed to be an essential element over 50 y ago and was shown to have therapeutic potential in treating the symptoms of type 2 diabetes; however, its mechanism of action at a molecular level is unknown. One chromium-binding biomolecule, low-molecular weight chromium-binding substance (LMWCr or chromodulin), has been found to be biologically active in in vitro assays and proposed as a potential candidate for the in vivo biologically active form of chromium. Characterization of the organic component of LMWCr has proven difficult. Treating bovine LMWCr with trifluoroacetic acid followed by purification on a graphite powder micro-column generates a heptapeptide fragment of LMWCr. The peptide sequence of the fragment was analyzed by MS and tandem MS (MS/MS and MS/MS/MS) using collision-induced dissociation and post-source decay. Two candidate sequences, pEEEEGDD and pEEEGEDD (where pE is pyroglutamate), were identified from the MS/MS experiments; additional tandem MS suggests the sequence is pEEEEGDD. The N-terminal glutamate residues explain the inability to sequence LMWCr by the Edman method. Langmuir isotherms and Hill plots were used to analyze the binding constants of chromic ions to synthetic peptides similar in composition to apoLMWCr. The sequence pEEEEGDD was found to bind 4 chromic ions per peptide with nearly identical cooperativity and binding constants to those of apoLMWCr. This work should lead to further studies elucidating or eliminating a potential role for LMWCr in treating the symptoms of type 2 diabetes and other conditions resulting from improper carbohydrate and lipid metabolism. PMID:21593351

Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

PubMed Central

Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

2009-01-01

Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

PubMed Central

Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

2018-01-01

Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

Recombinant soluble adenovirus receptor

DOEpatents

Freimuth, Paul I.

2002-01-01

Disclosed are isolated polypeptides from human CAR (coxsackievirus and adenovirus receptor) protein which bind adenovirus. Specifically disclosed are amino acid sequences which corresponds to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2. In other aspects, the disclosure relates to nucleic acid sequences encoding these domains as well as expression vectors which encode the domains and bacterial cells containing such vectors. Also disclosed is an isolated fusion protein comprised of the D1 polypeptide sequence fused to a polypeptide sequence which facilitates folding of D1 into a functional, soluble domain when expressed in bacteria. The functional D1 domain finds application for example in a therapeutic method for treating a patient infected with a virus which binds to D1, and also in a method for identifying an antiviral compound which interferes with viral attachment. Also included is a method for specifically targeting a cell for infection by a virus which binds to D1.

[Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

PubMed

Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

2016-07-25

RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

Changes in tau phosphorylation in hibernating rodents.

PubMed

León-Espinosa, Gonzalo; García, Esther; García-Escudero, Vega; Hernández, Félix; Defelipe, Javier; Avila, Jesús

2013-07-01

Tau is a cytoskeletal protein present mainly in the neurons of vertebrates. By comparing the sequence of tau molecule among different vertebrates, it was found that the variability of the N-terminal sequence in tau protein is higher than that of the C-terminal region. The N-terminal region is involved mainly in the binding of tau to cellular membranes, whereas the C-terminal region of the tau molecule contains the microtubule-binding sites. We have compared the sequence of Syrian hamster tau with the sequences of other hibernating and nonhibernating rodents and investigated how differences in the N-terminal region of tau could affect the phosphorylation level and tau binding to cell membranes. We also describe a change, in tau phosphorylation, on a casein kinase 1 (ck1)-dependent site that is found only in hibernating rodents. This ck1 site seems to play an important role in the regulation of tau binding to membranes. Copyright © 2013 Wiley Periodicals, Inc.

A multiscale approach to simulating the conformational properties of unbound multi-C₂H₂ zinc finger proteins.

PubMed

Liu, Lei; Wade, Rebecca C; Heermann, Dieter W

2015-09-01

The conformational properties of unbound multi-Cys2 His2 (mC2H2) zinc finger proteins, in which zinc finger domains are connected by flexible linkers, are studied by a multiscale approach. Three methods on different length scales are utilized. First, atomic detail molecular dynamics simulations of one zinc finger and its adjacent flexible linker confirmed that the zinc finger is more rigid than the flexible linker. Second, the end-to-end distance distributions of mC2H2 zinc finger proteins are computed using an efficient atomistic pivoting algorithm, which only takes excluded volume interactions into consideration. The end-to-end distance distribution gradually changes its profile, from left-tailed to right-tailed, as the number of zinc fingers increases. This is explained by using a worm-like chain model. For proteins of a few zinc fingers, an effective bending constraint favors an extended conformation. Only for proteins containing more than nine zinc fingers, is a somewhat compacted conformation preferred. Third, a mesoscale model is modified to study both the local and the global conformational properties of multi-C2H2 zinc finger proteins. Simulations of the CCCTC-binding factor (CTCF), an important mC2H2 zinc finger protein for genome spatial organization, are presented. © 2015 Wiley Periodicals, Inc.

MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

PubMed Central

Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

2016-01-01

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

Selection of peptides binding to metallic borides by screening M13 phage display libraries.

PubMed

Ploss, Martin; Facey, Sandra J; Bruhn, Carina; Zemel, Limor; Hofmann, Kathrin; Stark, Robert W; Albert, Barbara; Hauer, Bernhard

2014-02-10

Metal borides are a class of inorganic solids that is much less known and investigated than for example metal oxides or intermetallics. At the same time it is a highly versatile and interesting class of compounds in terms of physical and chemical properties, like semiconductivity, ferromagnetism, or catalytic activity. This makes these substances attractive for the generation of new materials. Very little is known about the interaction between organic materials and borides. To generate nanostructured and composite materials which consist of metal borides and organic modifiers it is necessary to develop new synthetic strategies. Phage peptide display libraries are commonly used to select peptides that bind specifically to metals, metal oxides, and semiconductors. Further, these binding peptides can serve as templates to control the nucleation and growth of inorganic nanoparticles. Additionally, the combination of two different binding motifs into a single bifunctional phage could be useful for the generation of new composite materials. In this study, we have identified a unique set of sequences that bind to amorphous and crystalline nickel boride (Ni3B) nanoparticles, from a random peptide library using the phage display technique. Using this technique, strong binders were identified that are selective for nickel boride. Sequence analysis of the peptides revealed that the sequences exhibit similar, yet subtle different patterns of amino acid usage. Although a predominant binding motif was not observed, certain charged amino acids emerged as essential in specific binding to both substrates. The 7-mer peptide sequence LGFREKE, isolated on amorphous Ni3B emerged as the best binder for both substrates. Fluorescence microscopy and atomic force microscopy confirmed the specific binding affinity of LGFREKE expressing phage to amorphous and crystalline Ni3B nanoparticles. This study is, to our knowledge, the first to identify peptides that bind specifically to amorphous and to crystalline Ni3B nanoparticles. We think that the identified strong binding sequences described here could potentially serve for the utilisation of M13 phage as a viable alternative to other methods to create tailor-made boride composite materials or new catalytic surfaces by a biologically driven nano-assembly synthesis and structuring.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Improved pan-specific MHC class I peptide-binding predictions using a novel representation of the MHC-binding cleft environment.

PubMed

Carrasco Pro, S; Zimic, M; Nielsen, M

2014-02-01

Major histocompatibility complex (MHC) molecules play a key role in cell-mediated immune responses presenting bounded peptides for recognition by the immune system cells. Several in silico methods have been developed to predict the binding affinity of a given peptide to a specific MHC molecule. One of the current state-of-the-art methods for MHC class I is NetMHCpan, which has a core ingredient for the representation of the MHC class I molecule using a pseudo-sequence representation of the binding cleft amino acid environment. New and large MHC-peptide-binding data sets are constantly being made available, and also new structures of MHC class I molecules with a bound peptide have been published. In order to test if the NetMHCpan method can be improved by integrating this novel information, we created new pseudo-sequence definitions for the MHC-binding cleft environment from sequence and structural analyses of different MHC data sets including human leukocyte antigen (HLA), non-human primates (chimpanzee, macaque and gorilla) and other animal alleles (cattle, mouse and swine). From these constructs, we showed that by focusing on MHC sequence positions found to be polymorphic across the MHC molecules used to train the method, the NetMHCpan method achieved a significant increase in the predictive performance, in particular, of non-human MHCs. This study hence showed that an improved performance of MHC-binding methods can be achieved not only by the accumulation of more MHC-peptide-binding data but also by a refined definition of the MHC-binding environment including information from non-human species. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Cysteine-containing peptide tag for site-specific conjugation of proteins

DOEpatents

Backer, Marina V.; Backer, Joseph M.

2008-04-08

The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.

Cysteine-containing peptide tag for site-specific conjugation of proteins

DOEpatents

Backer, Marina V.; Backer, Joseph M.

2010-10-05

The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.

Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

PubMed

Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

2018-05-01

Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

PubMed Central

Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

2016-01-01

DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

DOEpatents

McCutchen-Maloney, Sandra L.

2002-01-01

DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

PubMed Central

Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

2016-01-01

A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins.

PubMed

Walia, Rasna R; Xue, Li C; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

2014-01-01

Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence-derived features of RNA-binding proteins. A webserver implementation of both methods is freely available at http://einstein.cs.iastate.edu/RNABindRPlus/.

Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain

PubMed Central

de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

2014-01-01

The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163

Degenerate Pax2 and Senseless binding motifs improve detection of low-affinity sites required for enhancer specificity

PubMed Central

Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.

2018-01-01

Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378

Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

PubMed

Schumann, Marcel; Armen, Roger S

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

PubMed Central

Schumann, Marcel; Armen, Roger S.

2013-01-01

Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

PubMed

Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

2004-11-15

Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes.

PubMed

Srinivasulu, Yerukala Sathipati; Wang, Jyun-Rong; Hsu, Kai-Ti; Tsai, Ming-Ju; Charoenkwan, Phasit; Huang, Wen-Lin; Huang, Hui-Ling; Ho, Shinn-Ying

2015-01-01

Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes.

Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes

PubMed Central

2015-01-01

Background Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. Results This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. Conclusions The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes. PMID:26681483

Identification of hierarchical chromatin domains

PubMed Central

Weinreb, Caleb; Raphael, Benjamin J.

2016-01-01

Motivation: The three-dimensional structure of the genome is an important regulator of many cellular processes including differentiation and gene regulation. Recently, technologies such as Hi-C that combine proximity ligation with high-throughput sequencing have revealed domains of self-interacting chromatin, called topologically associating domains (TADs), in many organisms. Current methods for identifying TADs using Hi-C data assume that TADs are non-overlapping, despite evidence for a nested structure in which TADs and sub-TADs form a complex hierarchy. Results: We introduce a model for decomposition of contact frequencies into a hierarchy of nested TADs. This model is based on empirical distributions of contact frequencies within TADs, where positions that are far apart have a greater enrichment of contacts than positions that are close together. We find that the increase in contact enrichment with distance is stronger for the inner TAD than for the outer TAD in a TAD/sub-TAD pair. Using this model, we develop the TADtree algorithm for detecting hierarchies of nested TADs. TADtree compares favorably with previous methods, finding TADs with a greater enrichment of chromatin marks such as CTCF at their boundaries. Availability and implementation: A python implementation of TADtree is available at http://compbio.cs.brown.edu/software/ Contact: braphael@cs.brown.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26315910

TAD-free analysis of architectural proteins and insulators.

PubMed

Mourad, Raphaël; Cuvier, Olivier

2018-03-16

The three-dimensional (3D) organization of the genome is intimately related to numerous key biological functions including gene expression and DNA replication regulations. The mechanisms by which molecular drivers functionally organize the 3D genome, such as topologically associating domains (TADs), remain to be explored. Current approaches consist in assessing the enrichments or influences of proteins at TAD borders. Here, we propose a TAD-free model to directly estimate the blocking effects of architectural proteins, insulators and DNA motifs on long-range contacts, making the model intuitive and biologically meaningful. In addition, the model allows analyzing the whole Hi-C information content (2D information) instead of only focusing on TAD borders (1D information). The model outperforms multiple logistic regression at TAD borders in terms of parameter estimation accuracy and is validated by enhancer-blocking assays. In Drosophila, the results support the insulating role of simple sequence repeats and suggest that the blocking effects depend on the number of repeats. Motif analysis uncovered the roles of the transcriptional factors pannier and tramtrack in blocking long-range contacts. In human, the results suggest that the blocking effects of the well-known architectural proteins CTCF, cohesin and ZNF143 depend on the distance between loci, where each protein may participate at different scales of the 3D chromatin organization.

Large scale genomic reorganization of topological domains at the HoxD locus.

PubMed

Fabre, Pierre J; Leleu, Marion; Mormann, Benjamin H; Lopez-Delisle, Lucille; Noordermeer, Daan; Beccari, Leonardo; Duboule, Denis

2017-08-07

The transcriptional activation of HoxD genes during mammalian limb development involves dynamic interactions with two topologically associating domains (TADs) flanking the HoxD cluster. In particular, the activation of the most posterior HoxD genes in developing digits is controlled by regulatory elements located in the centromeric TAD (C-DOM) through long-range contacts. To assess the structure-function relationships underlying such interactions, we measured compaction levels and TAD discreteness using a combination of chromosome conformation capture (4C-seq) and DNA FISH. We assessed the robustness of the TAD architecture by using a series of genomic deletions and inversions that impact the integrity of this chromatin domain and that remodel long-range contacts. We report multi-partite associations between HoxD genes and up to three enhancers. We find that the loss of native chromatin topology leads to the remodeling of TAD structure following distinct parameters. Our results reveal that the recomposition of TAD architectures after large genomic re-arrangements is dependent on a boundary-selection mechanism in which CTCF mediates the gating of long-range contacts in combination with genomic distance and sequence specificity. Accordingly, the building of a recomposed TAD at this locus depends on distinct functional and constitutive parameters.

Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

PubMed

Subrahmanyam, S; Cronan, J E

1999-01-21

We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

PubMed

Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

1999-02-05

We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

Sequence-specific binding of counterions to B-DNA

PubMed Central

Denisov, Vladimir P.; Halle, Bertil

2000-01-01

Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

Identification of a p53-response element in the promoter of the proline oxidase gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Maxwell, Steve A.; Kochevar, Gerald J.

2008-05-02

Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

Frequency of the first feature in action sequences influences feature binding.

PubMed

Mattson, Paul S; Fournier, Lisa R; Behmer, Lawrence P

2012-10-01

We investigated whether binding among perception and action feature codes is a preliminary step toward creating a more durable memory trace of an action event. If so, increasing the frequency of a particular event (e.g., a stimulus requiring a movement with the left or right hand in an up or down direction) should increase the strength and speed of feature binding for this event. The results from two experiments, using a partial-repetition paradigm, confirmed that feature binding increased in strength and/or occurred earlier for a high-frequency (e.g., left hand moving up) than for a low-frequency (e.g., right hand moving down) event. Moreover, increasing the frequency of the first-specified feature in the action sequence alone (e.g., "left" hand) increased the strength and/or speed of action feature binding (e.g., between the "left" hand and movement in an "up" or "down" direction). The latter finding suggests an update to the theory of event coding, as not all features in the action sequence equally determine binding strength. We conclude that action planning involves serial binding of features in the order of action feature execution (i.e., associations among features are not bidirectional but are directional), which can lead to a more durable memory trace. This is consistent with physiological evidence suggesting that serial order is preserved in an action plan executed from memory and that the first feature in the action sequence may be critical in preserving this serial order.

Mass Spectrometric Determination of ILPR G-quadruplex Binding Sites in Insulin and IGF-2

PubMed Central

Xiao, JunFeng

2009-01-01

The insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region forms G-quadruplex structures in vitro. Previous studies show that insulin and insulin-like growth factor-2 (IGF-2) exhibit high affinity binding in vitro to 2-repeat sequences of ILPR variants a and h, but negligible binding to variant i. Two-repeat sequences of variants a and h form intramolecular G-quadruplex structures that are not evidenced for variant i. Here we report on the use of protein digestion combined with affinity capture and MALDI-MS detection to pinpoint ILPR binding sites in insulin and IGF-2. Peptides captured by ILPR variants a and h were sequenced by MALDI-MS/MS, LC-MS and in silico digestion. On-bead digestion of insulin-ILPR variant a complexes supported the conclusions. The results indicate that the sequence VCG(N)RGF is generally present in the captured peptides and is likely involved in the affinity binding interactions of the proteins with the ILPR G-quadruplexes. The significance of arginine in the interactions was studied by comparing the affinities of synthesized peptides VCGERGF and VCGEAGF with ILPR variant a. Peptides from other regions of the proteins that are connected through disulfide linkages were also detected in some capture experiments. Identification of binding sites could facilitate design of DNA binding ligands for capture and detection of insulin and IGF-2. The interactions may have biological significance as well. PMID:19747845

Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

PubMed Central

Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

2012-01-01

The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

Motif discovery with data mining in 3D protein structure databases: discovery, validation and prediction of the U-shape zinc binding ("Huf-Zinc") motif.

PubMed

Maurer-Stroh, Sebastian; Gao, He; Han, Hao; Baeten, Lies; Schymkowitz, Joost; Rousseau, Frederic; Zhang, Louxin; Eisenhaber, Frank

2013-02-01

Data mining in protein databases, derivatives from more fundamental protein 3D structure and sequence databases, has considerable unearthed potential for the discovery of sequence motif--structural motif--function relationships as the finding of the U-shape (Huf-Zinc) motif, originally a small student's project, exemplifies. The metal ion zinc is critically involved in universal biological processes, ranging from protein-DNA complexes and transcription regulation to enzymatic catalysis and metabolic pathways. Proteins have evolved a series of motifs to specifically recognize and bind zinc ions. Many of these, so called zinc fingers, are structurally independent globular domains with discontinuous binding motifs made up of residues mostly far apart in sequence. Through a systematic approach starting from the BRIX structure fragment database, we discovered that there exists another predictable subset of zinc-binding motifs that not only have a conserved continuous sequence pattern but also share a characteristic local conformation, despite being included in totally different overall folds. While this does not allow general prediction of all Zn binding motifs, a HMM-based web server, Huf-Zinc, is available for prediction of these novel, as well as conventional, zinc finger motifs in protein sequences. The Huf-Zinc webserver can be freely accessed through this URL (http://mendel.bii.a-star.edu.sg/METHODS/hufzinc/).

PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

PubMed Central

Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

2016-01-01

Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

Selection and Screening of DNA Aptamers for Inorganic Nanomaterials.

PubMed

Zhou, Yibo; Huang, Zhicheng; Yang, Ronghua; Liu, Juewen

2018-02-21

Searching for DNA sequences that can strongly and selectively bind to inorganic surfaces is a long-standing topic in bionanotechnology, analytical chemistry and biointerface research. This can be achieved either by aptamer selection starting with a very large library of ≈10 14 random DNA sequences, or by careful screening of a much smaller library (usually from a few to a few hundred) with rationally designed sequences. Unlike typical molecular targets, inorganic surfaces often have quite strong DNA adsorption affinities due to polyvalent binding and even chemical interactions. This leads to a very high background binding making aptamer selection difficult. Screening, on the other hand, can be designed to compare relative binding affinities of different DNA sequences and could be more appropriate for inorganic surfaces. The resulting sequences have been used for DNA-directed assembly, sorting of carbon nanotubes, and DNA-controlled growth of inorganic nanomaterials. It was recently discovered that poly-cytosine (C) DNA can strongly bind to a diverse range of nanomaterials including nanocarbons (graphene oxide and carbon nanotubes), various metal oxides and transition-metal dichalcogenides. In this Concept article, we articulate the need for screening and potential artifacts associated with traditional aptamer selection methods for inorganic surfaces. Representative examples of application are discussed, and a few future research opportunities are proposed towards the end of this article. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

PubMed

Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

1993-11-11

Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

2015-02-01

The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

SARNAclust: Semi-automatic detection of RNA protein binding motifs from immunoprecipitation data

PubMed Central

Dotu, Ivan; Adamson, Scott I.; Coleman, Benjamin; Fournier, Cyril; Ricart-Altimiras, Emma; Eyras, Eduardo

2018-01-01

RNA-protein binding is critical to gene regulation, controlling fundamental processes including splicing, translation, localization and stability, and aberrant RNA-protein interactions are known to play a role in a wide variety of diseases. However, molecular understanding of RNA-protein interactions remains limited; in particular, identification of RNA motifs that bind proteins has long been challenging, especially when such motifs depend on both sequence and structure. Moreover, although RNA binding proteins (RBPs) often contain more than one binding domain, algorithms capable of identifying more than one binding motif simultaneously have not been developed. In this paper we present a novel pipeline to determine binding peaks in crosslinking immunoprecipitation (CLIP) data, to discover multiple possible RNA sequence/structure motifs among them, and to experimentally validate such motifs. At the core is a new semi-automatic algorithm SARNAclust, the first unsupervised method to identify and deconvolve multiple sequence/structure motifs simultaneously. SARNAclust computes similarity between sequence/structure objects using a graph kernel, providing the ability to isolate the impact of specific features through the bulge graph formalism. Application of SARNAclust to synthetic data shows its capability of clustering 5 motifs at once with a V-measure value of over 0.95, while GraphClust achieves only a V-measure of 0.083 and RNAcontext cannot detect any of the motifs. When applied to existing eCLIP sets, SARNAclust finds known motifs for SLBP and HNRNPC and novel motifs for several other RBPs such as AGGF1, AKAP8L and ILF3. We demonstrate an experimental validation protocol, a targeted Bind-n-Seq-like high-throughput sequencing approach that relies on RNA inverse folding for oligo pool design, that can validate the components within the SLBP motif. Finally, we use this protocol to experimentally interrogate the SARNAclust motif predictions for protein ILF3. Our results support a newly identified partially double-stranded UUUUUGAGA motif similar to that known for the splicing factor HNRNPC. PMID:29596423

DNA sequencing using polymerase substrate-binding kinetics

PubMed Central

Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

2015-01-01

Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

A pH-sensitive heparin-binding sequence from Baculovirus gp64 protein is important for binding to mammalian cells but not to Sf9 insect cells.

PubMed

Wu, Chunxiao; Wang, Shu

2012-01-01

Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.

Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

PubMed Central

Das, Sourav; Kokardekar, Arshad

2009-01-01

Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation.

PubMed

Love, Michael I; Huska, Matthew R; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R; Schwahn, Kevin; Cooper, Samantha B; Yamamoto, Keith R; Thomas-Chollier, Morgane; Vingron, Martin; Meijsing, Sebastiaan H

2017-02-28

The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter-proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

DTIC Science & Technology

2008-01-01

C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

PubMed Central

Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

1999-01-01

Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

Sequence-Based Prediction of RNA-Binding Proteins Using Random Forest with Minimum Redundancy Maximum Relevance Feature Selection.

PubMed

Ma, Xin; Guo, Jing; Sun, Xiao

2015-01-01

The prediction of RNA-binding proteins is one of the most challenging problems in computation biology. Although some studies have investigated this problem, the accuracy of prediction is still not sufficient. In this study, a highly accurate method was developed to predict RNA-binding proteins from amino acid sequences using random forests with the minimum redundancy maximum relevance (mRMR) method, followed by incremental feature selection (IFS). We incorporated features of conjoint triad features and three novel features: binding propensity (BP), nonbinding propensity (NBP), and evolutionary information combined with physicochemical properties (EIPP). The results showed that these novel features have important roles in improving the performance of the predictor. Using the mRMR-IFS method, our predictor achieved the best performance (86.62% accuracy and 0.737 Matthews correlation coefficient). High prediction accuracy and successful prediction performance suggested that our method can be a useful approach to identify RNA-binding proteins from sequence information.

Biological Nanoplatforms for Self-Assembled Electronics

DTIC Science & Technology

2015-03-24

as M13 , a virus that infects Escherichia coli. Approximately one billion different amino acid sequences are displayed on different viruses in the...sequence when contained within a phage M13 coat protein sequence, not chemically linked to the surface of phage MS2 VLPs. Thus, binding properties may...gallium arsenide in a bacteriophage M13 phage display library, MS2 VLPs modified with the metal binding peptides do not display the same activity

Nonparametric Combinatorial Sequence Models

NASA Astrophysics Data System (ADS)

Wauthier, Fabian L.; Jordan, Michael I.; Jojic, Nebojsa

This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This paper presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three sequence datasets which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution induced by the prior. By integrating out the posterior our method compares favorably to leading binding predictors.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

PubMed Central

Wozniak, Christopher E.; Hughes, Kelly T.

2008-01-01

Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

PubMed

Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

2018-05-23

Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

PubMed

Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

2013-06-14

Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

PubMed

Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

2006-12-01

Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.

Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

PubMed Central

Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

2005-01-01

Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin.

PubMed

Rooijakkers, Bart J M; Ikonen, Martina S; Linder, Markus B

2018-01-01

Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain's sequence-function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed.

Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy

PubMed Central

Matkovich, Scot J.; Dorn, Gerald W.

2018-01-01

Summary MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicates purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses. PMID:25836573

Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

PubMed

Matkovich, Scot J; Dorn, Gerald W

2015-01-01

MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

An RNA motif that binds ATP

NASA Technical Reports Server (NTRS)

Sassanfar, M.; Szostak, J. W.

1993-01-01

RNAs that contain specific high-affinity binding sites for small molecule ligands immobilized on a solid support are present at a frequency of roughly one in 10(10)-10(11) in pools of random sequence RNA molecules. Here we describe a new in vitro selection procedure designed to ensure the isolation of RNAs that bind the ligand of interest in solution as well as on a solid support. We have used this method to isolate a remarkably small RNA motif that binds ATP, a substrate in numerous biological reactions and the universal biological high-energy intermediate. The selected ATP-binding RNAs contain a consensus sequence, embedded in a common secondary structure. The binding properties of ATP analogues and modified RNAs show that the binding interaction is characterized by a large number of close contacts between the ATP and RNA, and by a change in the conformation of the RNA.

BIPAD: A web server for modeling bipartite sequence elements

PubMed Central

Bi, Chengpeng; Rogan, Peter K

2006-01-01

Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of Rat Liver-Derived Cell Lines

DTIC Science & Technology

2010-05-22

member B8 Blue 1370939_at Acsl1 acyl-CoA synthetase long-chain family member 1 Yellow 1372006_at --- --- Blue 1372101_at Ppap2b phosphatidic acid ...Stress L-ascorbic Acid Binding Cation Binding Identical Protein Binding Protein Dimerization Activity Dioxygenase Activity Oxidoreductase...Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts, and proteins. Nucleic Acid Research. 35: D61-65. Ryter SW

Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

USDA-ARS?s Scientific Manuscript database

Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

Trichoderma genes

DOEpatents

Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

2012-06-19

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

From synthetic coiled coils to functional proteins: automated design of a receptor for the calmodulin-binding domain of calcineurin.

PubMed

Ghirlanda, G; Lear, J D; Lombardi, A; DeGrado, W F

1998-08-14

A series of synthetic receptors capable of binding to the calmodulin-binding domain of calcineurin (CN393-414) was designed, synthesized and characterized. The design was accomplished by docking CN393-414 against a two-helix receptor, using an idealized three-stranded coiled coil as a starting geometry. The sequence of the receptor was chosen using a side-chain re-packing program, which employed a genetic algorithm to select potential binders from a total of 7.5x10(6) possible sequences. A total of 25 receptors were prepared, representing 13 sequences predicted by the algorithm as well as 12 related sequences that were not predicted. The receptors were characterized by CD spectroscopy, analytical ultracentrifugation, and binding assays. The receptors predicted by the algorithm bound CN393-414 with apparent dissociation constants ranging from 0.2 microM to >50 microM. Many of the receptors that were not predicted by the algorithm also bound to CN393-414. Methods to circumvent this problem and to improve the automated design of functional proteins are discussed. Copyright 1998 Academic Press

Predicting the binding preference of transcription factors to individual DNA k-mers.

PubMed

Alleyne, Trevis M; Peña-Castillo, Lourdes; Badis, Gwenael; Talukder, Shaheynoor; Berger, Michael F; Gehrke, Andrew R; Philippakis, Anthony A; Bulyk, Martha L; Morris, Quaid D; Hughes, Timothy R

2009-04-15

Recognition of specific DNA sequences is a central mechanism by which transcription factors (TFs) control gene expression. Many TF-binding preferences, however, are unknown or poorly characterized, in part due to the difficulty associated with determining their specificity experimentally, and an incomplete understanding of the mechanisms governing sequence specificity. New techniques that estimate the affinity of TFs to all possible k-mers provide a new opportunity to study DNA-protein interaction mechanisms, and may facilitate inference of binding preferences for members of a given TF family when such information is available for other family members. We employed a new dataset consisting of the relative preferences of mouse homeodomains for all eight-base DNA sequences in order to ask how well we can predict the binding profiles of homeodomains when only their protein sequences are given. We evaluated a panel of standard statistical inference techniques, as well as variations of the protein features considered. Nearest neighbour among functionally important residues emerged among the most effective methods. Our results underscore the complexity of TF-DNA recognition, and suggest a rational approach for future analyses of TF families.

Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

PubMed Central

Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

2018-01-01

Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

Role of indirect readout mechanism in TATA box binding protein-DNA interaction.

PubMed

Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

2015-03-01

Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

Specificity determinants for the abscisic acid response element.

PubMed

Sarkar, Aditya Kumar; Lahiri, Ansuman

2013-01-01

Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

PubMed

Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

2008-06-01

The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

PubMed

Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

2017-01-01

The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

PubMed

Lerner, D R; Raikhel, N V

1992-06-05

Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain.

PubMed

de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

2014-06-01

The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The NH2-terminal php domain of the alpha subunit of the Escherichia coli replicase binds the epsilon proofreading subunit.

PubMed

Wieczorek, Anna; McHenry, Charles S

2006-05-05

The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.

Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

PubMed Central

Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

2014-01-01

Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

Characterization of monocarboxylate transporter 1 (MCT1) binding affinity for Basigin gene products and L1cam.

PubMed

Howard, John; Finch, Nicole A; Ochrietor, Judith D

2010-07-01

The purpose of this study was to determine the binding affinities of Basigin gene products and neural cell adhesion molecule L1cam for monocarboxylate transporter-1 (MCT1). ELISA binding assays were performed in which recombinant proteins of the transmembrane domains of Basigin gene products and L1cam were incubated with MCT1 captured from mouse brain. It was determined that Basigin gene products bind MCT1 with moderate affinity, but L1cam does not bind MCT1. Despite a high degree of sequence conservation between Basigin gene products and L1cam, the sequences are different enough to prevent L1cam from interacting with MCT1.

Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

PubMed Central

Sun, W; O'Connell, M; Speck, N A

1993-01-01

Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA. Images PMID:8445719

A Feature-Based Approach to Modeling Protein–DNA Interactions

PubMed Central

Segal, Eran

2008-01-01

Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

Discovery of 12-mer peptides that bind to wood lignin

PubMed Central

Yamaguchi, Asako; Isozaki, Katsuhiro; Nakamura, Masaharu; Takaya, Hikaru; Watanabe, Takashi

2016-01-01

Lignin, an abundant terrestrial polymer, is the only large-volume renewable feedstock composed of an aromatic skeleton. Lignin has been used mostly as an energy source during paper production; however, recent interest in replacing fossil fuels with renewable resources has highlighted its potential value in providing aromatic chemicals. Highly selective degradation of lignin is pivotal for industrial production of paper, biofuels, chemicals, and materials. However, few studies have examined natural and synthetic molecular components recognizing the heterogeneous aromatic polymer. Here, we report the first identification of lignin-binding peptides possessing characteristic sequences using a phage display technique. The consensus sequence HFPSP was found in several lignin-binding peptides, and the outer amino acid sequence affected the binding affinity of the peptides. Substitution of phenylalanine7 with Ile in the lignin-binding peptide C416 (HFPSPIFQRHSH) decreased the affinity of the peptide for softwood lignin without changing its affinity for hardwood lignin, indicating that C416 recognised structural differences between the lignins. Circular dichroism spectroscopy demonstrated that this peptide adopted a highly flexible random coil structure, allowing key residues to be appropriately arranged in relation to the binding site in lignin. These results provide a useful platform for designing synthetic and biological catalysts selectively bind to lignin. PMID:26903196

Crystal Structures of the Scaffolding Protein LGN Reveal the General Mechanism by Which GoLoco Binding Motifs Inhibit the Release of GDP from Gαi *

PubMed Central

Jia, Min; Li, Jianchao; Zhu, Jinwei; Wen, Wenyu; Zhang, Mingjie; Wang, Wenning

2012-01-01

GoLoco (GL) motif-containing proteins regulate G protein signaling by binding to Gα subunit and acting as guanine nucleotide dissociation inhibitors. GLs of LGN are also known to bind the GDP form of Gαi/o during asymmetric cell division. Here, we show that the C-terminal GL domain of LGN binds four molecules of Gαi·GDP. The crystal structures of Gαi·GDP in complex with LGN GL3 and GL4, respectively, reveal distinct GL/Gαi interaction features when compared with the only high resolution structure known with GL/Gαi interaction between RGS14 and Gαi1. Only a few residues C-terminal to the conserved GL sequence are required for LGN GLs to bind to Gαi·GDP. A highly conserved “double Arg finger” sequence (RΨ(D/E)(D/E)QR) is responsible for LGN GL to bind to GDP bound to Gαi. Together with the sequence alignment, we suggest that the LGN GL/Gαi interaction represents a general binding mode between GL motifs and Gαi. We also show that LGN GLs are potent guanine nucleotide dissociation inhibitors. PMID:22952234

Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhattacharya, Monolekha; Das, Amit Kumar, E-mail: amitk@hijli.iitkgp.ernet.in

Highlights: Black-Right-Pointing-Pointer The regulatory sequences recognized by TcrX have been identified. Black-Right-Pointing-Pointer The regulatory region comprises of inverted repeats segregated by 30 bp region. Black-Right-Pointing-Pointer The mode of binding of TcrX with regulatory sequence is unique. Black-Right-Pointing-Pointer In silico TcrX-DNA docked model binds one of the inverted repeats. Black-Right-Pointing-Pointer Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has notmore » been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by {approx}30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.« less

NMR studies of DNA oligomers and their interactions with minor groove binding ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fagan, Patricia A.

1996-05-01

The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

VEZF1 Elements Mediate Protection from DNA Methylation

PubMed Central

Strogantsev, Ruslan; Gaszner, Miklos; Hair, Alan; Felsenfeld, Gary; West, Adam G.

2010-01-01

There is growing consensus that genome organization and long-range gene regulation involves partitioning of the genome into domains of distinct epigenetic chromatin states. Chromatin insulator or barrier elements are key components of these processes as they can establish boundaries between chromatin states. The ability of elements such as the paradigm β-globin HS4 insulator to block the range of enhancers or the spread of repressive histone modifications is well established. Here we have addressed the hypothesis that a barrier element in vertebrates should be capable of defending a gene from silencing by DNA methylation. Using an established stable reporter gene system, we find that HS4 acts specifically to protect a gene promoter from de novo DNA methylation. Notably, protection from methylation can occur in the absence of histone acetylation or transcription. There is a division of labor at HS4; the sequences that mediate protection from methylation are separable from those that mediate CTCF-dependent enhancer blocking and USF-dependent histone modification recruitment. The zinc finger protein VEZF1 was purified as the factor that specifically interacts with the methylation protection elements. VEZF1 is a candidate CpG island protection factor as the G-rich sequences bound by VEZF1 are frequently found at CpG island promoters. Indeed, we show that VEZF1 elements are sufficient to mediate demethylation and protection of the APRT CpG island promoter from DNA methylation. We propose that many barrier elements in vertebrates will prevent DNA methylation in addition to blocking the propagation of repressive histone modifications, as either process is sufficient to direct the establishment of an epigenetically stable silent chromatin state. PMID:20062523

Early Targets of miR-34a in Neuroblastoma*

PubMed Central

De Antonellis, Pasqualino; Carotenuto, Marianeve; Vandenbussche, Jonathan; De Vita, Gennaro; Ferrucci, Veronica; Medaglia, Chiara; Boffa, Iolanda; Galiero, Alessandra; Di Somma, Sarah; Magliulo, Daniela; Aiese, Nadia; Alonzi, Alessandro; Spano, Daniela; Liguori, Lucia; Chiarolla, Cristina; Verrico, Antonio; Schulte, Johannes H.; Mestdagh, Pieter; Vandesompele, Jo; Gevaert, Kris; Zollo, Massimo

2014-01-01

Several genes encoding for proteins involved in proliferation, invasion, and apoptosis are known to be direct miR-34a targets. Here, we used proteomics to screen for targets of miR-34a in neuroblastoma (NBL), a childhood cancer that originates from precursor cells of the sympathetic nervous system. We examined the effect of miR-34a overexpression using a tetracycline inducible system in two NBL cell lines (SHEP and SH-SY5Y) at early time points of expression (6, 12, and 24 h). Proteome analysis using post-metabolic labeling led to the identification of 2,082 proteins, and among these 186 were regulated (112 proteins down-regulated and 74 up-regulated). Prediction of miR-34a targets via bioinformatics showed that 32 transcripts held miR-34a seed sequences in their 3′-UTR. By combining the proteomics data with Kaplan Meier gene-expression studies, we identified seven new gene products (ALG13, TIMM13, TGM2, ABCF2, CTCF, Ki67, and LYAR) that were correlated with worse clinical outcomes. These were further validated in vitro by 3′-UTR seed sequence regulation. In addition, Michigan Molecular Interactions searches indicated that together these proteins affect signaling pathways that regulate cell cycle and proliferation, focal adhesions, and other cellular properties that overall enhance tumor progression (including signaling pathways such as TGF-β, WNT, MAPK, and FAK). In conclusion, proteome analysis has here identified early targets of miR-34a with relevance to NBL tumorigenesis. Along with the results of previous studies, our data strongly suggest miR-34a as a useful tool for improving the chance of therapeutic success with NBL. PMID:24912852

A novel progesterone receptor membrane component (PGRMC) in the human and swine parasite Taenia solium: implications to the host-parasite relationship.

PubMed

Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge

2018-03-09

We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.

Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

PubMed

Palumbo, Michael J; Newberg, Lee A

2010-07-01

The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

Expression cloning and characterization of a novel gene that encodes the RNA-binding protein FAU-1 from Pyrococcus furiosus.

PubMed Central

Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi

2003-01-01

We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195

Definition of IgG- and albumin-binding regions of streptococcal protein G.

PubMed

Akerström, B; Nielsen, E; Björck, L

1987-10-05

Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.

PubMed

Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M

1992-02-01

The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs. The presence in shark liver of an FABP which differs substantially in primary structure from mammalian liver FABP, while being closely related to the FABP expressed in mammalian heart muscle, peripheral nerve myelin and adipocytes, opens a further dimension regarding the question of the existence of structure-dependent and tissue-specific specialization of FABP function in lipid metabolism.

Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

PubMed

Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

2017-09-01

Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

PubMed

Wei, Yulong; Silke, Jordan R; Xia, Xuhua

2017-12-15

Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

Accurate and sensitive quantification of protein-DNA binding affinity.

PubMed

Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

2018-04-17

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

Accurate and sensitive quantification of protein-DNA binding affinity

PubMed Central

Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

2018-01-01

Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

Context influences on TALE–DNA binding revealed by quantitative profiling

PubMed Central

Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

2015-01-01

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

Context influences on TALE-DNA binding revealed by quantitative profiling.

PubMed

Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

2015-06-11

Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

Sequence-Based Prediction of RNA-Binding Residues in Proteins.

PubMed

Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

2017-01-01

Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

Sequence-Based Prediction of RNA-Binding Residues in Proteins

PubMed Central

Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

2017-01-01

Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE PAGES

Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

2016-02-04

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

NASA Astrophysics Data System (ADS)

Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

2017-04-01

Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paugh, Steven W.; Coss, David R.; Bao, Ju

MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

PubMed Central

Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

2010-01-01

Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

PubMed

Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

2010-06-01

Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

PubMed

Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

2008-01-01

This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

Protein sequences bound to mineral surfaces persist into deep time

PubMed Central

Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa; Freeman, Colin L; Woolley, Jos; Crisp, Molly K; Wilson, Julie; Fotakis, Anna; Fischer, Roman; Kessler, Benedikt M; Rakownikow Jersie-Christensen, Rosa; Olsen, Jesper V; Haile, James; Thomas, Jessica; Marean, Curtis W; Parkington, John; Presslee, Samantha; Lee-Thorp, Julia; Ditchfield, Peter; Hamilton, Jacqueline F; Ward, Martyn W; Wang, Chunting Michelle; Shaw, Marvin D; Harrison, Terry; Domínguez-Rodrigo, Manuel; MacPhee, Ross DE; Kwekason, Amandus; Ecker, Michaela; Kolska Horwitz, Liora; Chazan, Michael; Kröger, Roland; Thomas-Oates, Jane; Harding, John H; Cappellini, Enrico; Penkman, Kirsty; Collins, Matthew J

2016-01-01

Proteins persist longer in the fossil record than DNA, but the longevity, survival mechanisms and substrates remain contested. Here, we demonstrate the role of mineral binding in preserving the protein sequence in ostrich (Struthionidae) eggshell, including from the palaeontological sites of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated sequence (equivalent to ~16 Ma at a constant 10°C). DOI: http://dx.doi.org/10.7554/eLife.17092.001 PMID:27668515

Preferential binding of daunomycin to 5'ATCG and 5'ATGC sequences revealed by footprinting titration experiments.

PubMed

Chaires, J B; Herrera, J E; Waring, M J

1990-07-03

Results from a high-resolution deoxyribonuclease I (DNase I) footprinting titration procedure are described that identify preferred daunomycin binding sites within the 160 bp tyr T DNA fragment. We have obtained single-bond resolution at 65 of the 160 potential binding sites within the tyr T fragment and have examined the effect of 0-3.0 microM total daunomycin concentration on the susceptibility of these sites toward digestion by DNase I. Four types of behavior are observed: (i) protection from DNase I cleavage; (ii) protection, but only after reaching a critical total daunomycin concentration; (iii) enhanced cleavage; (iv) no effect of added drug. Ten sites were identified as the most strongly protected on the basis of the magnitude of the reduction of their digestion product band areas in the presence of daunomycin. These were identified as the preferred daunomycin binding sites. Seven of these 10 sites are found at the end of the triplet sequences 5'ATGC and 5'ATCG, where the notation AT indicates that either A or T may occupy the position. The remaining three strongly protected sites are found at the ends of the triplet sequence 5'ATCAT. Of the preferred daunomycin binding sites we identify in this study, the sequence 5'ATCG is consistent with the specificity predicted by the theoretical studies of Chen et al. [Chen, K.-X., Gresh, N., & Pullman, B. (1985) J. Biomol. Struct. Dyn. 3, 445-466] and is the very sequence to which daunomycin is observed to be bound in two recent X-ray crystallographic studies. Solution studies, theoretical studies, and crystallographic studies have thus converged to provide a consistent and coherent picture of the sequence preference of this important anticancer antibiotic.

Homologous kappa-neurotoxins exhibit residue-specific interactions with the alpha 3 subunit of the nicotinic acetylcholine receptor: a comparison of the structural requirements for kappa-bungarotoxin and kappa-flavitoxin binding.

PubMed

McLane, K E; Weaver, W R; Lei, S; Chiappinelli, V A; Conti-Tronconi, B M

1993-07-13

kappa-Flavotoxin (kappa-FTX), a snake neurotoxin that is a selective antagonist of certain neuronal nicotinic acetylcholine receptors (AChRs), has recently been isolated and characterized [Grant, G. A., Frazier, M. W., & Chiappinelli, V. A. (1988) Biochemistry 27, 1532-1537]. Like the related snake toxin kappa-bungarotoxin (kappa-BTX), kappa-FTX binds with high affinity to alpha 3 subtypes of neuronal AChRs, even though there are distinct sequence differences between the two toxins. To further characterize the sequence regions of the neuronal AChR alpha 3 subunit involved in formation of the binding site for this family of kappa-neurotoxins, we investigated kappa-FTX binding to overlapping synthetic peptides screening the alpha 3 subunit sequence. A sequence region forming a "prototope" for kappa-FTX was identified within residues alpha 3 (51-70), confirming the suggestions of previous studies on the binding of kappa-BTX to the alpha 3 subunit [McLane, K. E., Tang, F., & Conti-Tronconi, B. M. (1990) J. Biol. Chem. 265, 1537-1544] and alpha-bungarotoxin to the Torpedo AChR alpha subunit [Conti-Tronconi, B. M., Tang, F., Diethelm, B. M., Spencer, S. R., Reinhardt-Maelicke, S., & Maelicke, A. (1990) Biochemistry 29, 6221-6230] that this sequence region is involved in formation of a cholinergic site. Single residue substituted analogues, where each residue of the sequence alpha 3 (51-70) was sequentially replaced by a glycine, were used to identify the amino acid side chains involved in the interaction of this prototope with kappa-FTX.(ABSTRACT TRUNCATED AT 250 WORDS)

De novo design and engineering of functional metal and porphyrin-binding protein domains

NASA Astrophysics Data System (ADS)

Everson, Bernard H.

In this work, I describe an approach to the rational, iterative design and characterization of two functional cofactor-binding protein domains. First, a hybrid computational/experimental method was developed with the aim of algorithmically generating a suite of porphyrin-binding protein sequences with minimal mutual sequence information. This method was explored by generating libraries of sequences, which were then expressed and evaluated for function. One successful sequence is shown to bind a variety of porphyrin-like cofactors, and exhibits light- activated electron transfer in mixed hemin:chlorin e6 and hemin:Zn(II)-protoporphyrin IX complexes. These results imply that many sophisticated functions such as cofactor binding and electron transfer require only a very small number of residue positions in a protein sequence to be fixed. Net charge and hydrophobic content are important in determining protein solubility and stability. Accordingly, rational modifications were made to the aforementioned design procedure in order to improve its overall success rate. The effects of these modifications are explored using two `next-generation' sequence libraries, which were separately expressed and evaluated. Particular modifications to these design parameters are demonstrated to effectively double the purification success rate of the procedure. Finally, I describe the redesign of the artificial di-iron protein DF2 into CDM13, a single chain di-Manganese four-helix bundle. CDM13 acts as a functional model of natural manganese catalase, exhibiting a kcat of 0.08s-1 under steady-state conditions. The bound manganese cofactors have a reduction potential of +805 mV vs NHE, which is too high for efficient dismutation of hydrogen peroxide. These results indicate that as a high-potential manganese complex, CDM13 may represent a promising first step toward a polypeptide model of the Oxygen Evolving Complex of the photosynthetic enzyme Photosystem II.

Use of eluted peptide sequence data to identify the binding characteristics of peptides to the insulin-dependent diabetes susceptibility allele HLA-DQ8 (DQ 3.2).

PubMed

Godkin, A; Friede, T; Davenport, M; Stevanovic, S; Willis, A; Jewell, D; Hill, A; Rammensee, H G

1997-06-01

HLA-DQ8 (A1*0301, B1*0302) and -DQ2 (A1*0501, B1*0201) are both associated with diseases such as insulin-dependent diabetes mellitus and coeliac disease. We used the technique of pool sequencing to look at the requirements of peptides binding to HLA-DQ8, and combined these data with naturally sequenced ligands and in vitro binding assays to describe a novel motif for HLA-DQ8. The motif, which has the same basic format as many HLA-DR molecules, consists of four or five anchor regions, in the positions from the N-terminus of the binding core of n, n + 3, n + 5/6 and n + 8, i.e. P1, P4, P6/7 and P9. P1 and P9 require negative or polar residues, with mainly aliphatic residues at P4 and P6/7. The features of the HLA-DQ8 motif were then compared to a pool sequence of peptides eluted from HLA-DQ2. A consensus motif for the binding of a common peptide which may be involved in disease pathogenesis is described. Neither of the disease-associated alleles HLA-DQ2 and -DQ8 have Asp at position 57 of the beta-chain. This Asp, if present, may form a salt bridge with an Arg at position 79 of the alpha-chain and so alter the binding specificity of P9. HLA-DQ2 and -DQ8 both appear to prefer negatively charged amino acids at P9. In contrast, HLA-DQ7 (A1*0301, B1*0301), which is not associated with diabetes, has Asp at beta 57, allowing positively charged amino acids at P9. This analysis of the sequence features of DQ-binding peptides suggests molecular characteristics which may be useful to predict epitopes involved in disease pathogenesis.

Plasma proteins of rainbow trout (Oncorhynchus mykiss) isolated by binding to lipopolysaccharide from Aeromonas salmonicida.

PubMed

Hoover, G J; el-Mowafi, A; Simko, E; Kocal, T E; Ferguson, H W; Hayes, M A

1998-07-01

In an attempt to find plasma proteins that might be involved in the constitutive resistance of rainbow trout to furunculosis, a disease caused by Aeromonas salmonicida (AS), we purified serum and plasma proteins based on their calcium- and carbohydrate-dependent affinity for A. salmonicida lipopolysaccharide (LPS) coupled to an epoxy-activated synthetic matrix (Toyopearl AF Epoxy 650M). A multimeric family of high molecular weight (96 to 200-kDa) LPS-binding proteins exhibiting both calcium and mannose dependent binding was isolated. Upon reduction the multimers collapsed to subunits of approximately 16-kDa as estimated by 1D-PAGE and exhibited pI values of 5.30 and 5.75 as estimated from 2D-PAGE. Their N-terminal sequences were related to rainbow trout ladderlectin (RT-LL), a Sepharose-binding protein. Polyclonal antibodies to the LPS-purified 16-kDa subunits recognized both the reduced 16-kDa subunits and the non-reduced multimeric forms. A calcium- and N-acetylglucosamine (GlcNAc)-dependent LPS-binding multimeric protein (approximately 207-kDa) composed of 34.5-kDa subunits was purified and found to be identical to trout serum amyloid P (SAP) by N-terminal sequence (DLQDLSGKVFV). A protein of 24-kDa, in reduced and non-reduced conditions, was isolated and had N-terminal sequence identity with a known C-reactive protein (CRP) homologue, C-polysaccharide-binding protein 2 (TCBP2) of rainbow trout. A novel calcium-dependent LPS-binding protein was purified and termed rainbow trout lectin 37 (RT-L37). This protein, composed of dimers, tetramers and pentamers of 37 kDa subunits (pI 5.50-6.10) with N-terminal sequence (IQE(D/N)GHAEAPGATTVLNEILR) showed no close homology to proteins known or predicted from cDNA sequences. These findings demonstrate that rainbow trout have several blood proteins with lectin properties for the LPS of A. salmonicida; the biological functions of these proteins in resistance to furunculosis are still unknown.

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

PubMed Central

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-01-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

PubMed

Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

2013-08-01

Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

PubMed

Means, A L; Farnham, P J

1990-02-01

We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

PubMed Central

Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

2013-01-01

Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

PubMed

Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

1997-03-01

The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

PubMed

Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

2015-01-01

Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Rapamycin (Sirolimus) alters mechanistic target of rapamycin pathway regulation and microRNA expression in mouse meiotic spermatocytes.

PubMed

Mukherjee, A; Koli, S; Reddy, K V R

2015-09-01

Mechanistic target of rapamycin (mTOR) is a signal transduction pathway that modulates translation initiation in several animals including mammals. Rapamaycin, an allosteric inhibitor of mTOR pathway, is often used as an immunosuppressive drug following kidney transplantation and causes gonadal dysfunction and defects in spermatogenesis. The molecular mechanism behind rapamycin-mediated testicular dysfunction is not known. We have therefore explored the contribution of rapamycin in mTOR regulation and microRNA (miRNA) expression in mouse spermatocytes, the intermediate stage of spermatogenesis, where meiosis takes place. In the present study, we optimized the isolation of highly pure and viable spermatocytes by flow sorting, treated them with rapamycin, and investigated the expression of mTOR and downstream effector molecules. Western blot and immunocytochemical analysis confirm that rapamycin treatment suppresses mTOR and phopsphorylated P70S6 kinase activities in spermatocytes, but not that of phosphorylated 4E-binding protein 1. Also, rapamycin treatment modulates the expression of several spermatocyte-specific miRNAs. To complement these finding an in vivo study was also performed. In silico prediction of target genes of these miRNAs and their functional pathway analysis revealed that, several of them are involved in crucial biological process, cellular process and catalytic activities. miRNA-transcription factor (TF) network analysis enlisted different TFs propelling the transcription machineries of these miRNAs. In silico prediction followed by quatitative real-time PCR revealed two of these TFs namely, PU.1 and CCCTC binding factor (CTCF) are down and upregulated, respectively, which may be the reason of the altered expression of miRNAs following rapamycin treatment. In conclusion, for the first time, the present study provides insight into how rapamycin regulates mTOR pathway and spermatocyte-specific miRNA expression which in turn, regulate expression of target genes post-transcriptionally. © 2015 American Society of Andrology and European Academy of Andrology.

CIP1 polypeptides and their uses

DOEpatents

Foreman, Pamela [Los Altos, CA; Van Solingen, Pieter [Naaldwijk, NL; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA

2011-04-12

Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

A homolog of an Escherichia coli phosphate-binding protein gene from Xanthomonas oryzae pv. oryzae

NASA Technical Reports Server (NTRS)

Hopkins, C. M.; White, F. F.; Heaton, L. A.; Guikema, J. A.; Leach, J. E.; Spooner, B. S. (Principal Investigator)

1995-01-01

A Xanthomonas oryzae pv. oryzae gene with sequence similarity to an Escherichia coli phosphate-binding protein gene (phoS) produces a periplasmic protein of apparent M(r) 35,000 when expressed in E. coli. Amino terminal sequencing revealed that a signal peptide is removed during transport to the periplasm in E. coli.

Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

DOEpatents

Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

2007-03-13

The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data

PubMed Central

Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa

2017-01-01

Abstract RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM’s model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. PMID:28977546

Structure-affinity relationships for the binding of actinomycin D to DNA

NASA Astrophysics Data System (ADS)

Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

1997-03-01

Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

PubMed Central

Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

2014-01-01

Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

PubMed

Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

1997-02-28

The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

Incorporating evolution of transcription factor binding sites into annotated alignments.

PubMed

Bais, Abha S; Grossmann, Stefen; Vingron, Martin

2007-08-01

Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.

Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

PubMed

Sakumi, K; Sekiguchi, M

1989-01-20

The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

PubMed Central

Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

2011-01-01

Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

Violation of an Evolutionarily Conserved Immunoglobulin Diversity Gene Sequence Preference Promotes Production of dsDNA-Specific IgG Antibodies

PubMed Central

Silva-Sanchez, Aaron; Liu, Cun Ren; Vale, Andre M.; Khass, Mohamed; Kapoor, Pratibha; Elgavish, Ada; Ivanov, Ivaylo I.; Ippolito, Gregory C.; Schelonka, Robert L.; Schoeb, Trenton R.; Burrows, Peter D.; Schroeder, Harry W.

2015-01-01

Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3), which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH) gene segment sequence content by reading frame (RF) is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1), which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies. PMID:25706374

Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

PubMed

Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

2018-01-01

Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

PubMed

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

Structure-based Analysis to Hu-DNA Binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swinger,K.; Rice, P.

2007-01-01

HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

NASA Astrophysics Data System (ADS)

Smith, Jarrod Anson

2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

Inadequate Reference Datasets Biased toward Short Non-epitopes Confound B-cell Epitope Prediction*

PubMed Central

Rahman, Kh. Shamsur; Chowdhury, Erfan Ullah; Sachse, Konrad; Kaltenboeck, Bernhard

2016-01-01

X-ray crystallography has shown that an antibody paratope typically binds 15–22 amino acids (aa) of an epitope, of which 2–5 randomly distributed amino acids contribute most of the binding energy. In contrast, researchers typically choose for B-cell epitope mapping short peptide antigens in antibody binding assays. Furthermore, short 6–11-aa epitopes, and in particular non-epitopes, are over-represented in published B-cell epitope datasets that are commonly used for development of B-cell epitope prediction approaches from protein antigen sequences. We hypothesized that such suboptimal length peptides result in weak antibody binding and cause false-negative results. We tested the influence of peptide antigen length on antibody binding by analyzing data on more than 900 peptides used for B-cell epitope mapping of immunodominant proteins of Chlamydia spp. We demonstrate that short 7–12-aa peptides of B-cell epitopes bind antibodies poorly; thus, epitope mapping with short peptide antigens falsely classifies many B-cell epitopes as non-epitopes. We also show in published datasets of confirmed epitopes and non-epitopes a direct correlation between length of peptide antigens and antibody binding. Elimination of short, ≤11-aa epitope/non-epitope sequences improved datasets for evaluation of in silico B-cell epitope prediction. Achieving up to 86% accuracy, protein disorder tendency is the best indicator of B-cell epitope regions for chlamydial and published datasets. For B-cell epitope prediction, the most effective approach is plotting disorder of protein sequences with the IUPred-L scale, followed by antibody reactivity testing of 16–30-aa peptides from peak regions. This strategy overcomes the well known inaccuracy of in silico B-cell epitope prediction from primary protein sequences. PMID:27189949

A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors.

PubMed

van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

2008-04-01

PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.

BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

PubMed Central

Wang, Junbai; Batmanov, Kirill

2015-01-01

Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

Normalization of a chromosomal contact map.

PubMed

Cournac, Axel; Marie-Nelly, Hervé; Marbouty, Martial; Koszul, Romain; Mozziconacci, Julien

2012-08-30

Chromatin organization has been increasingly studied in relation with its important influence on DNA-related metabolic processes such as replication or regulation of gene expression. Since its original design ten years ago, capture of chromosome conformation (3C) has become an essential tool to investigate the overall conformation of chromosomes. It relies on the capture of long-range trans and cis interactions of chromosomal segments whose relative proportions in the final bank reflect their frequencies of interactions, hence their spatial proximity in a population of cells. The recent coupling of 3C with deep sequencing approaches now allows the generation of high resolution genome-wide chromosomal contact maps. Different protocols have been used to generate such maps in various organisms. This includes mammals, drosophila and yeast. The massive amount of raw data generated by the genomic 3C has to be carefully processed to alleviate the various biases and byproducts generated by the experiments. Our study aims at proposing a simple normalization procedure to minimize the influence of these unwanted but inevitable events on the final results. Careful analysis of the raw data generated previously for budding yeast S. cerevisiae led to the identification of three main biases affecting the final datasets, including a previously unknown bias resulting from the circularization of DNA molecules. We then developed a simple normalization procedure to process the data and allow the generation of a normalized, highly contrasted, chromosomal contact map for S. cerevisiae. The same method was then extended to the first human genome contact map. Using the normalized data, we revisited the preferential interactions originally described between subsets of discrete chromosomal features. Notably, the detection of preferential interactions between tRNA in yeast and CTCF, PolII binding sites in human can vary with the normalization procedure used. We quantitatively reanalyzed the genomic 3C data obtained for S. cerevisiae, identified some of the biases inherent to the technique and proposed a simple normalization procedure to analyse them. Such an approach can be easily generalized for genomic 3C experiments in other organisms. More experiments and analysis will be necessary to reach optimal resolution and accuracies of the maps generated through these approaches. Working with cell population presenting highest levels of homogeneity will prove useful in this regards.

Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

PubMed

Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

2009-09-01

Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

bfr1+, a novel gene of Schizosaccharomyces pombe which confers brefeldin A resistance, is structurally related to the ATP-binding cassette superfamily.

PubMed Central

Nagao, K; Taguchi, Y; Arioka, M; Kadokura, H; Takatsuki, A; Yoda, K; Yamasaki, M

1995-01-01

We have isolated a Schizosaccharomyces pombe gene, bfr1+, which on a multicopy plasmid vector, pDB248', confers resistance to brefeldin A (BFA), an inhibitor of intracellular protein transport. This gene encodes a novel protein of 1,531 amino acids with an intramolecular duplicated structure, each half containing a single ATP-binding consensus sequence and a set of six transmembrane sequences. This structural characteristic of bfr1+ protein resembles that of mammalian P-glycoprotein, which, by exporting a variety of anticancer drugs, has been shown to be responsible for multidrug resistance in tumor cells. Consistent with this is that S. pombe cells harboring bfr1+ on pDB248' are resistant to actinomycin D, cerulenin, and cytochalasin B, as well as to BFA. The relative positions of the ATP-binding sequences and the clusters of transmembrane sequences within the bfr1+ protein are, however, transposed in comparison with those in P-glycoprotein; the bfr1+ protein has N-terminal ATP-binding sequence followed by transmembrane segments in each half of the molecule. The bfr1+ protein exhibited significant homology in primary and secondary structures with two recently identified multidrug resistance gene products of Saccharomyces cerevisiae, Snq2 and Sts1/Pdr5/Ydr1. The bfr1+ gene is not essential for cell growth or mating, but a delta bfr1 mutant exhibited hypersensitivity to BFA. We propose that the bfr1+ protein is another member of the ATP-binding cassette superfamily and serves as an efflux pump of various antibiotics. PMID:7883711

Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

PubMed

Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

2001-08-17

Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

GenProBiS: web server for mapping of sequence variants to protein binding sites.

PubMed

Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

2017-07-03

Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

PubMed Central

Yang, Yu; Hebron, Haroun R.; Hang, Jun

2009-01-01

A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

NASA Astrophysics Data System (ADS)

Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

2014-03-01

Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each case.

Binding properties of SUMO-interacting motifs (SIMs) in yeast.

PubMed

Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

2015-03-01

Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

Prediction of small molecule binding property of protein domains with Bayesian classifiers based on Markov chains.

PubMed

Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland

2009-12-01

Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.

Sequence information gain based motif analysis.

PubMed

Maynou, Joan; Pairó, Erola; Marco, Santiago; Perera, Alexandre

2015-11-09

The detection of regulatory regions in candidate sequences is essential for the understanding of the regulation of a particular gene and the mechanisms involved. This paper proposes a novel methodology based on information theoretic metrics for finding regulatory sequences in promoter regions. This methodology (SIGMA) has been tested on genomic sequence data for Homo sapiens and Mus musculus. SIGMA has been compared with different publicly available alternatives for motif detection, such as MEME/MAST, Biostrings (Bioconductor package), MotifRegressor, and previous work such Qresiduals projections or information theoretic based detectors. Comparative results, in the form of Receiver Operating Characteristic curves, show how, in 70% of the studied Transcription Factor Binding Sites, the SIGMA detector has a better performance and behaves more robustly than the methods compared, while having a similar computational time. The performance of SIGMA can be explained by its parametric simplicity in the modelling of the non-linear co-variability in the binding motif positions. Sequence Information Gain based Motif Analysis is a generalisation of a non-linear model of the cis-regulatory sequences detection based on Information Theory. This generalisation allows us to detect transcription factor binding sites with maximum performance disregarding the covariability observed in the positions of the training set of sequences. SIGMA is freely available to the public at http://b2slab.upc.edu.

Sequence Alignment to Predict Across Species Susceptibility ...

EPA Pesticide Factsheets

Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev

footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

PubMed

Sebastian, Alvaro; Contreras-Moreira, Bruno

2014-01-15

Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed Central

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-01-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

PubMed

Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

1998-11-01

The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-11-11

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

PubMed Central

Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

1995-01-01

The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

PubMed

Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

2018-06-01

Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

PubMed Central

Grange, T; de Sa, C M; Oddos, J; Pictet, R

1987-01-01

We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

Engineered proteins with PUF scaffold to manipulate RNA metabolism

PubMed Central

Wang, Yang; Wang, Zefeng; Tanaka Hall, Traci M.

2013-01-01

Pumilio/fem-3 mRNA binding factor (FBF) proteins are characterized by a sequence-specific RNA-binding domain. This unique single-stranded RNA recognition module, whose sequence specificity can be reprogrammed, has been fused with functional modules to engineer protein factors with various functions. Here we summarize the advancement in developing RNA regulatory tools and opportunities for the future. PMID:23731364

Evaluation of DNA Binding Drugs as Inhibitors of ESX, and ETS Domain Transcription Factor Associated With Breast Cancer: Effects of ESX/DNA Complex Disruption

DTIC Science & Technology

2000-08-01

4). Sequence recognition of all four DNA bases is achieved by positioning an N- methylimidazole opposite guanine or N-methylpyrrole opposite...unique sequences of DNA based upon selective binding motifs to all four DNA bases , although relatively little is known about the ability of these agents to

Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

PubMed Central

SivaRaman, L; Subramanian, S; Thimmappaya, B

1986-01-01

Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

In vitro fluorescence studies of transcription factor IIB-DNA interaction.

PubMed

Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

2015-01-01

General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

Predicting DNA binding proteins using support vector machine with hybrid fractal features.

PubMed

Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

2014-02-21

DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

A coarse-grained biophysical model of sequence evolution and the population size dependence of the speciation rate

PubMed Central

Khatri, Bhavin S.; Goldstein, Richard A.

2015-01-01

Speciation is fundamental to understanding the huge diversity of life on Earth. Although still controversial, empirical evidence suggests that the rate of speciation is larger for smaller populations. Here, we explore a biophysical model of speciation by developing a simple coarse-grained theory of transcription factor-DNA binding and how their co-evolution in two geographically isolated lineages leads to incompatibilities. To develop a tractable analytical theory, we derive a Smoluchowski equation for the dynamics of binding energy evolution that accounts for the fact that natural selection acts on phenotypes, but variation arises from mutations in sequences; the Smoluchowski equation includes selection due to both gradients in fitness and gradients in sequence entropy, which is the logarithm of the number of sequences that correspond to a particular binding energy. This simple consideration predicts that smaller populations develop incompatibilities more quickly in the weak mutation regime; this trend arises as sequence entropy poises smaller populations closer to incompatible regions of phenotype space. These results suggest a generic coarse-grained approach to evolutionary stochastic dynamics, allowing realistic modelling at the phenotypic level. PMID:25936759

Diversity of Functionally Permissive Sequences in the Receptor-Binding Site of Influenza Hemagglutinin.

PubMed

Wu, Nicholas C; Xie, Jia; Zheng, Tianqing; Nycholat, Corwin M; Grande, Geramie; Paulson, James C; Lerner, Richard A; Wilson, Ian A

2017-06-14

Influenza A virus hemagglutinin (HA) initiates viral entry by engaging host receptor sialylated glycans via its receptor-binding site (RBS). The amino acid sequence of the RBS naturally varies across avian and human influenza virus subtypes and is also evolvable. However, functional sequence diversity in the RBS has not been fully explored. Here, we performed a large-scale mutational analysis of the RBS of A/WSN/33 (H1N1) and A/Hong Kong/1/1968 (H3N2) HAs. Many replication-competent mutants not yet observed in nature were identified, including some that could escape from an RBS-targeted broadly neutralizing antibody. This functional sequence diversity is made possible by pervasive epistasis in the RBS 220-loop and can be buffered by avidity in viral receptor binding. Overall, our study reveals that the HA RBS can accommodate a much greater range of sequence diversity than previously thought, which has significant implications for the complex evolutionary interrelationships between receptor specificity and immune escape. Copyright © 2017 Elsevier Inc. All rights reserved.

An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

PubMed

Lee, C K; Knipe, D M

1985-06-01

An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

Improve the prediction of RNA-binding residues using structural neighbours.

PubMed

Li, Quan; Cao, Zanxia; Liu, Haiyan

2010-03-01

The interactions between RNA-binding proteins (RBPs) with RNA play key roles in managing some of the cell's basic functions. The identification and prediction of RNA binding sites is important for understanding the RNA-binding mechanism. Computational approaches are being developed to predict RNA-binding residues based on the sequence- or structure-derived features. To achieve higher prediction accuracy, improvements on current prediction methods are necessary. We identified that the structural neighbors of RNA-binding and non-RNA-binding residues have different amino acid compositions. Combining this structure-derived feature with evolutionary (PSSM) and other structural information (secondary structure and solvent accessibility) significantly improves the predictions over existing methods. Using a multiple linear regression approach and 6-fold cross validation, our best model can achieve an overall correct rate of 87.8% and MCC of 0.47, with a specificity of 93.4%, correctly predict 52.4% of the RNA-binding residues for a dataset containing 107 non-homologous RNA-binding proteins. Compared with existing methods, including the amino acid compositions of structure neighbors lead to clearly improvement. A web server was developed for predicting RNA binding residues in a protein sequence (or structure),which is available at http://mcgill.3322.org/RNA/.

Path-preference cellular-automaton model for traffic flow through transit points and its application to the transcription process in human cells.

PubMed

Ohta, Yoshihiro; Nishiyama, Akinobu; Wada, Yoichiro; Ruan, Yijun; Kodama, Tatsuhiko; Tsuboi, Takashi; Tokihiro, Tetsuji; Ihara, Sigeo

2012-08-01

We all use path routing everyday as we take shortcuts to avoid traffic jams, or by using faster traffic means. Previous models of traffic flow of RNA polymerase II (RNAPII) during transcription, however, were restricted to one dimension along the DNA template. Here we report the modeling and application of traffic flow in transcription that allows preferential paths of different dimensions only restricted to visit some transit points, as previously introduced between the 5' and 3' end of the gene. According to its position, an RNAPII protein molecule prefers paths obeying two types of time-evolution rules. One is an asymmetric simple exclusion process (ASEP) along DNA, and the other is a three-dimensional jump between transit points in DNA where RNAPIIs are staying. Simulations based on our model, and comparison experimental results, reveal how RNAPII molecules are distributed at the DNA-loop-formation-related protein binding sites as well as CTCF insulator proteins (or exons). As time passes after the stimulation, the RNAPII density at these sites becomes higher. Apparent far-distance jumps in one dimension are realized by short-range three-dimensional jumps between DNA loops. We confirm the above conjecture by applying our model calculation to the SAMD4A gene by comparing the experimental results. Our probabilistic model provides possible scenarios for assembling RNAPII molecules into transcription factories, where RNAPII and related proteins cooperatively transcribe DNA.

Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

PubMed

Malhotra, Sony; Sowdhamini, Ramanathan

2013-08-01

The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

PubMed

Pessler, Frank; Hernandez, Nouria

2003-08-01

POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

The binding modes of carbazole derivatives with telomere G-quadruplex

NASA Astrophysics Data System (ADS)

Zhang, Xiu-feng; Zhang, Hui-juan; Xiang, Jun-feng; Li, Qian; Yang, Qian-fan; Shang, Qian; Zhang, Yan-xia; Tang, Ya-lin

2010-10-01

It is reported that carbazole derivatives can stabilize G-quadruplex DNA structure formed by human telomeric sequence, and therefore, they have the potential to serve as anti-cancer agents. In this present study, in order to further explore the binding mode between carbazole derivatives and G-quadruplex formed by human telomeric sequence, two carbazole iodides (BMVEC, MVEC) molecules were synthesized and used to investigate the interaction with the human telomeric parallel and antiparallel G-quadruplex structures by NMR, CD and molecular modeling study. Interestingly, it is the pivotal the cationic charge pendant groups of pyridinium rings of carbazole that plays an essential role in the stabilizing and binding mode of the human telomeric sequences G-quadruplex structure. It was found that BMVEC with two cationic charge pendant groups of pyridinium rings of 9-ethylcarbazole cannot only stabilize parallel G-quadruple of Hum6 by groove binding and G-tetrad stacking modes and antiparallel G-quadruplex of Hum22 by groove binding, but also induce the formation of mixed G-quadruplex of Hum22. While MVEC with one cationic charge pendant groups of pyridinium ring only can bind with the parallel G-quadruplex of Hum6 by the stacking onto the G4 G-tetrad and could not interact with the G-quadruplex of Hum22.

Informative priors based on transcription factor structural class improve de novo motif discovery.

PubMed

Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

2006-07-15

An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

PubMed Central

Robinson, Clifford R.; Sligar, Stephen G.

1998-01-01

Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

PubMed

Raghav, Sunil Kumar; Deplancke, Bart

2012-01-01

Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

PubMed

Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

2016-02-24

Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

cAMP-Mediated Stimulation of Tyrosine Hydroxylase mRNA Translation Is Mediated by Polypyrimidine-Rich Sequences within Its 3′-Untranslated Region and Poly(C)-Binding Protein 2

PubMed Central

Xu, Lu; Sterling, Carol R.

2009-01-01

Tyrosine hydroxylase (TH) plays a critical role in maintaining the appropriate concentrations of catecholamine neurotransmitters in brain and periphery, particularly during long-term stress, long-term drug treatment, or neurodegenerative diseases. Its expression is controlled by both transcriptional and post-transcriptional mechanisms. In a previous report, we showed that treatment of rat midbrain slice explant cultures or mouse MN9D cells with cAMP analog or forskolin leads to induction of TH protein without concomitant induction of TH mRNA. We further showed that cAMP activates mechanisms that regulate TH mRNA translation via cis-acting sequences within its 3′-untranslated region (UTR). In the present report, we extend these studies to show that MN9D cytoplasmic proteins bind to the same TH mRNA 3′-UTR domain that is required for the cAMP response. RNase T1 mapping demonstrates binding of proteins to a 27-nucleotide polypyrimidine-rich sequence within this domain. A specific mutation within the polypyrimidine-rich sequence inhibits protein binding and cAMP-mediated translational activation. UV-cross-linking studies identify a ∼44-kDa protein as a major TH mRNA 3′-UTR binding factor, and cAMP induces the 40- to 42-kDa poly(C)-binding protein-2 (PCBP2) in MN9D cells. We show that PCBP2 binds to the TH mRNA 3′-UTR domain that participates in the cAMP response. Overexpression of PCBP2 induces TH protein without concomitant induction of TH mRNA. These results support a model in which cAMP induces PCBP2, leading to increased interaction with its cognate polypyrimidine binding site in the TH mRNA 3′-UTR. This increased interaction presumably plays a role in the activation of TH mRNA translation by cAMP in dopaminergic neurons. PMID:19620256

The Interaction of Integrin αIIbβ3 with Fibrin Occurs through Multiple Binding Sites in the αIIb β-Propeller Domain*

PubMed Central

Podolnikova, Nataly P.; Yakovlev, Sergiy; Yakubenko, Valentin P.; Wang, Xu; Gorkun, Oleg V.; Ugarova, Tatiana P.

2014-01-01

The currently available antithrombotic agents target the interaction of platelet integrin αIIbβ3 (GPIIb-IIIa) with fibrinogen during platelet aggregation. Platelets also bind fibrin formed early during thrombus growth. It was proposed that inhibition of platelet-fibrin interactions may be a necessary and important property of αIIbβ3 antagonists; however, the mechanisms by which αIIbβ3 binds fibrin are uncertain. We have previously identified the γ370–381 sequence (P3) in the γC domain of fibrinogen as the fibrin-specific binding site for αIIbβ3 involved in platelet adhesion and platelet-mediated fibrin clot retraction. In the present study, we have demonstrated that P3 can bind to several discontinuous segments within the αIIb β-propeller domain of αIIbβ3 enriched with negatively charged and aromatic residues. By screening peptide libraries spanning the sequence of the αIIb β-propeller, several sequences were identified as candidate contact sites for P3. Synthetic peptides duplicating these segments inhibited platelet adhesion and clot retraction but not platelet aggregation, supporting the role of these regions in fibrin recognition. Mutant αIIbβ3 receptors in which residues identified as critical for P3 binding were substituted for homologous residues in the I-less integrin αMβ2 exhibited reduced cell adhesion and clot retraction. These residues are different from those that are involved in the coordination of the fibrinogen γ404–411 sequence and from auxiliary sites implicated in binding of soluble fibrinogen. These results map the binding of fibrin to multiple sites in the αIIb β-propeller and further indicate that recognition specificity of αIIbβ3 for fibrin differs from that for soluble fibrinogen. PMID:24338009

Integrin-Using Rotaviruses Bind α2β1 Integrin α2 I Domain via VP4 DGE Sequence and Recognize αXβ2 and αVβ3 by Using VP7 during Cell Entry

PubMed Central

Graham, Kate L.; Halasz, Peter; Tan, Yan; Hewish, Marilyn J.; Takada, Yoshikazu; Mackow, Erich R.; Robinson, Martyn K.; Coulson, Barbara S.

2003-01-01

Integrins α2β1, αXβ2, and αVβ3 have been implicated in rotavirus cell attachment and entry. The virus spike protein VP4 contains the α2β1 ligand sequence DGE at amino acid positions 308 to 310, and the outer capsid protein VP7 contains the αXβ2 ligand sequence GPR. To determine the viral proteins and sequences involved and to define the roles of α2β1, αXβ2, and αVβ3, we analyzed the ability of rotaviruses and their reassortants to use these integrins for cell binding and infection and the effect of peptides DGEA and GPRP on these events. Many laboratory-adapted human, monkey, and bovine viruses used integrins, whereas all porcine viruses were integrin independent. The integrin-using rotavirus strains each interacted with all three integrins. Integrin usage related to VP4 serotype independently of sialic acid usage. Analysis of rotavirus reassortants and assays of virus binding and infectivity in integrin-transfected cells showed that VP4 bound α2β1, and VP7 interacted with αXβ2 and αVβ3 at a postbinding stage. DGEA inhibited rotavirus binding to α2β1 and infectivity, whereas GPRP binding to αXβ2 inhibited infectivity but not binding. The truncated VP5* subunit of VP4, expressed as a glutathione S-transferase fusion protein, bound the expressed α2 I domain. Alanine mutagenesis of D308 and G309 in VP5* eliminated VP5* binding to the α2 I domain. In a novel process, integrin-using viruses bind the α2 I domain of α2β1 via DGE in VP4 and interact with αXβ2 (via GPR) and αVβ3 by using VP7 to facilitate cell entry and infection. PMID:12941907

Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

EPA Science Inventory

The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

Targeted binding of the M13 bacteriophage to thiamethoxam organic crystals.

PubMed

Cho, Whirang; Fowler, Jeffrey D; Furst, Eric M

2012-04-10

Phage display screening with a combinatorial library was used to identify M13-type bacteriophages that express peptides with selective binding to organic crystals of thiamethoxam. The six most strongly binding phages exhibit at least 1000 times the binding affinity of wild-type M13 and express heptapeptide sequences that are rich in hydrophobic, hydrogen-bonding amino acids and proline. Among the peptide sequences identified, M13 displaying the pIII domain heptapeptide ASTLPKA exhibits the strongest binding to thiamethoxam in competitive binding assays. Electron and confocal microscopy confirm the specific binding affinity of ASTLPKA to thiamethoxam. Using atomic force microscope (AFM) probes functionalized with ASTLPKA expressing phage, we found that the average adhesion force between the bacteriophage and a thiamethoxam surface is 1.47 ± 0.80 nN whereas the adhesion force of wild-type M13KE phage is 0.18 ± 0.07 nN. Such a strongly binding bacteriophage could be used to modify the surface chemistry of thiamethoxam crystals and other organic solids with a high degree of specificity. © 2012 American Chemical Society

Scanpath memory binding: multiple read-out experiments

NASA Astrophysics Data System (ADS)

Stark, Lawrence W.; Privitera, Claudio M.; Yang, Huiyang; Azzariti, Michela; Ho, Yeuk F.; Chan, Angie; Krischer, Christof; Weinberger, Adam

1999-05-01

The scanpath theory proposed that an internal spatial- cognitive model controls perception and the active looking eye movements, EMs, of the scanpath sequence. Evidence for this came from new quantitative methods, experiments with ambiguous figures and visual imagery and from MRI studies, all on cooperating human subjects. Besides recording EMs, we introduce other experimental techniques wherein the subject must depend upon memory bindings as in visual imagery, but may call upon other motor behaviors than EMs to read-out the remembered patterns. How is the internal model distributed and operationally assembled. The concept of binding speaks to the assigning of values for the model and its execution in various parts of the brain. Current neurological information helps to localize different aspects of the spatial-cognitive model in the brain. We suppose that there are several levels of 'binding' -- semantic or symbolic binding, structural binding for the spatial locations of the regions-of-interest and sequential binding for the dynamic execution program that yields the sequence of EMs. Our aim is to dissect out respective contributions of these different forms of binding.