Sample records for ctcf binding sites

  1. CTCF Binding Sites in the Herpes Simplex Virus 1 Genome Display Site-Specific CTCF Occupation, Protein Recruitment, and Insulator Function.

    PubMed

    Washington, Shannan D; Musarrat, Farhana; Ertel, Monica K; Backes, Gregory L; Neumann, Donna M

    2018-04-15

    There are seven conserved CTCF binding domains in the herpes simplex virus 1 (HSV-1) genome. These binding sites individually flank the latency-associated transcript (LAT) and the immediate early (IE) gene regions, suggesting that CTCF insulators differentially control transcriptional domains in HSV-1 latency. In this work, we show that two CTCF binding motifs in HSV-1 display enhancer blocking in a cell-type-specific manner. We found that CTCF binding to the latent HSV-1 genome was LAT dependent and that the quantity of bound CTCF was site specific. Following reactivation, CTCF eviction was dynamic, suggesting that each CTCF site was independently regulated. We explored whether CTCF sites recruit the polycomb-repressive complex 2 (PRC2) to establish repressive domains through a CTCF-Suz12 interaction and found that Suz12 colocalized to the CTCF insulators flanking the ICP0 and ICP4 regions and, conversely, was removed at early times postreactivation. Collectively, these data support the idea that CTCF sites in HSV-1 are independently regulated and may contribute to lytic-latent HSV-1 control in a site-specific manner. IMPORTANCE The role of chromatin insulators in DNA viruses is an area of interest. It has been shown in several beta- and gammaherpesviruses that insulators likely control the lytic transcriptional profile through protein recruitment and through the formation of three-dimensional (3D) chromatin loops. The ability of insulators to regulate alphaherpesviruses has been understudied to date. The alphaherpesvirus HSV-1 has seven conserved insulator binding motifs that flank regions of the genome known to contribute to the establishment of latency. Our work presented here contributes to the understanding of how insulators control transcription of HSV-1. Copyright © 2018 American Society for Microbiology.

  2. Mediation of CTCF transcriptional insulation by DEAD-box RNA-binding protein p68 and steroid receptor RNA activator SRA

    PubMed Central

    Yao, Hongjie; Brick, Kevin; Evrard, Yvonne; Xiao, Tiaojiang; Camerini-Otero, R. Daniel; Felsenfeld, Gary

    2010-01-01

    CCCTC-binding factor (CTCF) is a DNA-binding protein that plays important roles in chromatin organization, although the mechanism by which CTCF carries out these functions is not fully understood. Recent studies show that CTCF recruits the cohesin complex to insulator sites and that cohesin is required for insulator activity. Here we showed that the DEAD-box RNA helicase p68 (DDX5) and its associated noncoding RNA, steroid receptor RNA activator (SRA), form a complex with CTCF that is essential for insulator function. p68 was detected at CTCF sites in the IGF2/H19 imprinted control region (ICR) as well as other genomic CTCF sites. In vivo depletion of SRA or p68 reduced CTCF-mediated insulator activity at the IGF2/H19 ICR, increased levels of IGF2 expression, and increased interactions between the endodermal enhancer and IGF2 promoter. p68/SRA also interacts with members of the cohesin complex. Depletion of either p68 or SRA does not affect CTCF binding to its genomic sites, but does reduce cohesin binding. The results suggest that p68/SRA stabilizes the interaction of cohesin with CTCF by binding to both, and is required for proper insulator function. PMID:20966046

  3. CCCTC-Binding Factor Acts as a Heterochromatin Barrier on Herpes Simplex Viral Latent Chromatin and Contributes to Poised Latent Infection

    PubMed Central

    2018-01-01

    ABSTRACT Herpes simplex virus 1 (HSV-1) establishes latent infection in neurons via a variety of epigenetic mechanisms that silence its genome. The cellular CCCTC-binding factor (CTCF) functions as a mediator of transcriptional control and chromatin organization and has binding sites in the HSV-1 genome. We constructed an HSV-1 deletion mutant that lacked a pair of CTCF-binding sites (CTRL2) within the latency-associated transcript (LAT) coding sequences and found that loss of these CTCF-binding sites did not alter lytic replication or levels of establishment of latent infection, but their deletion reduced the ability of the virus to reactivate from latent infection. We also observed increased heterochromatin modifications on viral chromatin over the LAT promoter and intron. We therefore propose that CTCF binding at the CTRL2 sites acts as a chromatin insulator to keep viral chromatin in a form that is poised for reactivation, a state which we call poised latency. PMID:29437926

  4. Does CTCF mediate between nuclear organization and gene expression?

    PubMed

    Ohlsson, Rolf; Lobanenkov, Victor; Klenova, Elena

    2010-01-01

    The multifunctional zinc-finger protein CCCTC-binding factor (CTCF) is a very strong candidate for the role of coordinating the expression level of coding sequences with their three-dimensional position in the nucleus, apparently responding to a "code" in the DNA itself. Dynamic interactions between chromatin fibers in the context of nuclear architecture have been implicated in various aspects of genome functions. However, the molecular basis of these interactions still remains elusive and is a subject of intense debate. Here we discuss the nature of CTCF-DNA interactions, the CTCF-binding specificity to its binding sites and the relationship between CTCF and chromatin, and we examine data linking CTCF with gene regulation in the three-dimensional nuclear space. We discuss why these features render CTCF a very strong candidate for the role and propose a unifying model, the "CTCF code," explaining the mechanistic basis of how the information encrypted in DNA may be interpreted by CTCF into diverse nuclear functions.

  5. The retrovirus HTLV-1 inserts an ectopic CTCF-binding site into the human genome.

    PubMed

    Satou, Yorifumi; Miyazato, Paola; Ishihara, Ko; Yaguchi, Hiroko; Melamed, Anat; Miura, Michi; Fukuda, Asami; Nosaka, Kisato; Watanabe, Takehisa; Rowan, Aileen G; Nakao, Mitsuyoshi; Bangham, Charles R M

    2016-03-15

    Human T-lymphotropic virus type 1 (HTLV-1) is a retrovirus that causes malignant and inflammatory diseases in ∼10% of infected people. A typical host has between 10(4) and 10(5) clones of HTLV-1-infected T lymphocytes, each clone distinguished by the genomic integration site of the single-copy HTLV-1 provirus. The HTLV-1 bZIP (HBZ) factor gene is constitutively expressed from the minus strand of the provirus, whereas plus-strand expression, required for viral propagation to uninfected cells, is suppressed or intermittent in vivo, allowing escape from host immune surveillance. It remains unknown what regulates this pattern of proviral transcription and latency. Here, we show that CTCF, a key regulator of chromatin structure and function, binds to the provirus at a sharp border in epigenetic modifications in the pX region of the HTLV-1 provirus in T cells naturally infected with HTLV-1. CTCF is a zinc-finger protein that binds to an insulator region in genomic DNA and plays a fundamental role in controlling higher order chromatin structure and gene expression in vertebrate cells. We show that CTCF bound to HTLV-1 acts as an enhancer blocker, regulates HTLV-1 mRNA splicing, and forms long-distance interactions with flanking host chromatin. CTCF-binding sites (CTCF-BSs) have been propagated throughout the genome by transposons in certain primate lineages, but CTCF binding has not previously been described in present-day exogenous retroviruses. The presence of an ectopic CTCF-BS introduced by the retrovirus in tens of thousands of genomic locations has the potential to cause widespread abnormalities in host cell chromatin structure and gene expression.

  6. Selective inhibition of CTCF binding by iAs directs TET-mediated reprogramming of 5-hydroxymethylation patterns in iAs-transformed cells

    PubMed Central

    Rea, Matthew; Gripshover, Tyler; Fondufe-Mittendorf, Yvonne

    2017-01-01

    Methylation at cytosine (5mC) is a fundamental epigenetic DNA modification recently associated with iAs-mediated carcinogenesis. In contrast, the role of 5-hydroxymethylcytosine (5hmC), the oxidation product of 5mC in iAs-mediated carcinogenesis is unknown. Here we assess the hydroxymethylome in iAs-transformed cells, showing that dynamic modulation of hydroxymethylated DNA is associated with specific transcriptional networks. Moreover, this pathologic iAs-mediated carcinogenesis is characterized by a shift toward a higher hydroxymethylation pattern genome-wide. At specific promoters, hydroxymethylation correlated with increased gene expression. Furthermore, this increase in hydroxymethylation occurs concurrently with an upregulation of ten-eleven translocation (TET) enzymes that oxidize 5-methylcytosine (5mC) in DNA. To gain an understanding into how iAs might impact TET expression, we found that iAs inhibits the binding of CTCF at the proximal, weak CTCF binding sites of the TET1 and TET2 gene promoters and enhances CTCF binding at the stronger distal binding site. Further analyses suggest that this distal site acts as an enhancer, thus high CTCF occupancy at the enhancer region of TET1 and TET2 possibly drives their high expression in iAs-transformed cells. These results have major implications in understanding the impact of differential CTCF binding, genome architecture and its consequences in iAs-mediated pathogenesis. PMID:29175454

  7. Comparative analyses of CTCF and BORIS occupancies uncover two distinct classes of CTCF binding genomic regions.

    PubMed

    Pugacheva, Elena M; Rivero-Hinojosa, Samuel; Espinoza, Celso A; Méndez-Catalá, Claudia Fabiola; Kang, Sungyun; Suzuki, Teruhiko; Kosaka-Suzuki, Natsuki; Robinson, Susan; Nagarajan, Vijayaraj; Ye, Zhen; Boukaba, Abdelhalim; Rasko, John E J; Strunnikov, Alexander V; Loukinov, Dmitri; Ren, Bing; Lobanenkov, Victor V

    2015-08-14

    CTCF and BORIS (CTCFL), two paralogous mammalian proteins sharing nearly identical DNA binding domains, are thought to function in a mutually exclusive manner in DNA binding and transcriptional regulation. Here we show that these two proteins co-occupy a specific subset of regulatory elements consisting of clustered CTCF binding motifs (termed 2xCTSes). BORIS occupancy at 2xCTSes is largely invariant in BORIS-positive cancer cells, with the genomic pattern recapitulating the germline-specific BORIS binding to chromatin. In contrast to the single-motif CTCF target sites (1xCTSes), the 2xCTS elements are preferentially found at active promoters and enhancers, both in cancer and germ cells. 2xCTSes are also enriched in genomic regions that escape histone to protamine replacement in human and mouse sperm. Depletion of the BORIS gene leads to altered transcription of a large number of genes and the differentiation of K562 cells, while the ectopic expression of this CTCF paralog leads to specific changes in transcription in MCF7 cells. We discover two functionally and structurally different classes of CTCF binding regions, 2xCTSes and 1xCTSes, revealed by their predisposition to bind BORIS. We propose that 2xCTSes play key roles in the transcriptional program of cancer and germ cells.

  8. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin

    PubMed Central

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K.; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga

    2015-01-01

    Insulators are multiprotein–DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. PMID:25342723

  9. Cohesin regulates tissue-specific expression by stabilizing highly occupied cis-regulatory modules

    PubMed Central

    Faure, Andre J.; Schmidt, Dominic; Watt, Stephen; Schwalie, Petra C.; Wilson, Michael D.; Xu, Huiling; Ramsay, Robert G.; Odom, Duncan T.; Flicek, Paul

    2012-01-01

    The cohesin protein complex contributes to transcriptional regulation in a CTCF-independent manner by colocalizing with master regulators at tissue-specific loci. The regulation of transcription involves the concerted action of multiple transcription factors (TFs) and cohesin's role in this context of combinatorial TF binding remains unexplored. To investigate cohesin-non-CTCF (CNC) binding events in vivo we mapped cohesin and CTCF, as well as a collection of tissue-specific and ubiquitous transcriptional regulators using ChIP-seq in primary mouse liver. We observe a positive correlation between the number of distinct TFs bound and the presence of CNC sites. In contrast to regions of the genome where cohesin and CTCF colocalize, CNC sites coincide with the binding of master regulators and enhancer-markers and are significantly associated with liver-specific expressed genes. We also show that cohesin presence partially explains the commonly observed discrepancy between TF motif score and ChIP signal. Evidence from these statistical analyses in wild-type cells, and comparisons to maps of TF binding in Rad21-cohesin haploinsufficient mouse liver, suggests that cohesin helps to stabilize large protein–DNA complexes. Finally, we observe that the presence of mirrored CTCF binding events at promoters and their nearby cohesin-bound enhancers is associated with elevated expression levels. PMID:22780989

  10. CTCF Mediates Effect of Insulin On Glucagon Expression

    PubMed Central

    Tsui, Shanli; Gao, Jie; Wang, Charles; Lu, Luo

    2013-01-01

    Pancreatic islet α-cell development and glucagon production are mainly regulated by Pax6 in the homeobox gene families. However, the molecular mechanism fine-tuning the regulation of these events in α-cell still remains unclear. In ocular cells, Pax6 transcription is regulated by CTCF through its binding to specific sites in Pax6 promoter. In this study, CTCF-mediated regulations of islet α-cell development and glucagon production were investigated in both CTCF transgenic mice and α-TC-1-6 cells. Over-expression of CTCF in transgenic mice affected development of pancreatic islets by significantly suppressing α-cell population in both embryonic and adult pancreases. The effect of CTCF on Pax6 gene expression and subsequently, on pro-glucagon production was however, examined in pancreatic islet α-cells. Over-expression and knock-down of CTCF directly affected Pax6 expression. More importantly, the CTCF binding sites upstream from Pax6 p0 promoter were required for regulating p0 promoter activity in islet α-cells. Stimulation of α-cells with insulin resulted in a significant increase in CTCF expression and a decrease in Pax6 expression, and consequently suppressed pro-glucagon expression. In contrast, these insulin-induced effects were blocked by knockdown of CTCF mRNA with specific siRNA in α-cells. Altogether, our results demonstrated for the first time that CTCF functions as a switch-like molecule between the insulin signaling and the regulations of Pax6 and glucagon expression in pancreatic islet α-cells. PMID:22426149

  11. Two new insulator proteins, Pita and ZIPIC, target CP190 to chromatin.

    PubMed

    Maksimenko, Oksana; Bartkuhn, Marek; Stakhov, Viacheslav; Herold, Martin; Zolotarev, Nickolay; Jox, Theresa; Buxa, Melanie K; Kirsch, Ramona; Bonchuk, Artem; Fedotova, Anna; Kyrchanova, Olga; Renkawitz, Rainer; Georgiev, Pavel

    2015-01-01

    Insulators are multiprotein-DNA complexes that regulate the nuclear architecture. The Drosophila CP190 protein is a cofactor for the DNA-binding insulator proteins Su(Hw), CTCF, and BEAF-32. The fact that CP190 has been found at genomic sites devoid of either of the known insulator factors has until now been unexplained. We have identified two DNA-binding zinc-finger proteins, Pita, and a new factor named ZIPIC, that interact with CP190 in vivo and in vitro at specific interaction domains. Genomic binding sites for these proteins are clustered with CP190 as well as with CTCF and BEAF-32. Model binding sites for Pita or ZIPIC demonstrate a partial enhancer-blocking activity and protect gene expression from PRE-mediated silencing. The function of the CTCF-bound MCP insulator sequence requires binding of Pita. These results identify two new insulator proteins and emphasize the unifying function of CP190, which can be recruited by many DNA-binding insulator proteins. © 2015 Maksimenko et al.; Published by Cold Spring Harbor Laboratory Press.

  12. TSA-induced DNMT1 down-regulation represses hTERT expression via recruiting CTCF into demethylated core promoter region of hTERT in HCT116.

    PubMed

    Choi, Jee-Hye; Min, Na Young; Park, Jina; Kim, Jin Hong; Park, Soo Hyun; Ko, Young Jong; Kang, Yoonsung; Moon, Young Joon; Rhee, Sangmyung; Ham, Seung Wook; Park, Ae Ja; Lee, Kwang-Ho

    2010-01-01

    Trichostatin A (TSA), an inhibitor of histone deacetylase, is a well-known antitumor agent that effectively and selectively induces tumor growth arrest and apoptosis. Recently, it was reported that hTERT is one of the primary targets for TSA-induced apoptosis in cancer cells but the mechanism of which has not yet been elucidated. In the present study, to better understand the epigenetic regulation mechanism responsible for the repression of hTERT by TSA, we examined expression of hTERT in the HCT116 colon cancer cell line after treatment with TSA and performed site-specific CpG methylation analysis of the hTERT promoter. We found that TSA-induced the demethylation of site-specific CpGs on the promoter of hTERT, which was caused by down-regulation of DNA methyltransferase 1 (DNMT1). Among the demethylated region, the 31st-33rd CpGs contained a binding site for CTCF, an inhibitor of hTERT transcription. ChIP analysis revealed that TSA-induced demethylation of the 31st-33rd CpGs promoted CTCF binding on hTERT promoter, leading to repression of hTERT. Taken together, down-regulation of DNMT1 by TSA caused demethylation of a CTCF binding site on the hTERT promoter, the result of which was repression of hTERT via recruitment of CTCF to the promoter. Copyright 2009 Elsevier Inc. All rights reserved.

  13. A TAD boundary is preserved upon deletion of the CTCF-rich Firre locus.

    PubMed

    Barutcu, A Rasim; Maass, Philipp G; Lewandowski, Jordan P; Weiner, Catherine L; Rinn, John L

    2018-04-13

    The binding of the transcriptional regulator CTCF to the genome has been implicated in the formation of topologically associated domains (TADs). However, the general mechanisms of folding the genome into TADs are not fully understood. Here we test the effects of deleting a CTCF-rich locus on TAD boundary formation. Using genome-wide chromosome conformation capture (Hi-C), we focus on one TAD boundary on chromosome X harboring ~ 15 CTCF binding sites and located at the long non-coding RNA (lncRNA) locus Firre. Specifically, this TAD boundary is invariant across evolution, tissues, and temporal dynamics of X-chromosome inactivation. We demonstrate that neither the deletion of this locus nor the ectopic insertion of Firre cDNA or its ectopic expression are sufficient to alter TADs in a sex-specific or allele-specific manner. In contrast, Firre's deletion disrupts the chromatin super-loop formation of the inactive X-chromosome. Collectively, our findings suggest that apart from CTCF binding, additional mechanisms may play roles in establishing TAD boundary formation.

  14. CTCF and cohesin regulate chromatin loop stability with distinct dynamics

    PubMed Central

    Hansen, Anders S; Pustova, Iryna; Cattoglio, Claudia; Tjian, Robert; Darzacq, Xavier

    2017-01-01

    Folding of mammalian genomes into spatial domains is critical for gene regulation. The insulator protein CTCF and cohesin control domain location by folding domains into loop structures, which are widely thought to be stable. Combining genomic and biochemical approaches we show that CTCF and cohesin co-occupy the same sites and physically interact as a biochemically stable complex. However, using single-molecule imaging we find that CTCF binds chromatin much more dynamically than cohesin (~1–2 min vs. ~22 min residence time). Moreover, after unbinding, CTCF quickly rebinds another cognate site unlike cohesin for which the search process is long (~1 min vs. ~33 min). Thus, CTCF and cohesin form a rapidly exchanging 'dynamic complex' rather than a typical stable complex. Since CTCF and cohesin are required for loop domain formation, our results suggest that chromatin loops are dynamic and frequently break and reform throughout the cell cycle. DOI: http://dx.doi.org/10.7554/eLife.25776.001 PMID:28467304

  15. Analysis of neonatal brain lacking ATRX or MeCP2 reveals changes in nucleosome density, CTCF binding and chromatin looping

    PubMed Central

    Kernohan, Kristin D.; Vernimmen, Douglas; Gloor, Gregory B.; Bérubé, Nathalie G.

    2014-01-01

    ATRX and MeCP2 belong to an expanding group of chromatin-associated proteins implicated in human neurodevelopmental disorders, although their gene-regulatory activities are not fully resolved. Loss of ATRX prevents full repression of an imprinted gene network in the postnatal brain and in this study we address the mechanistic aspects of this regulation. We show that ATRX binds many imprinted domains individually but that transient co-localization between imprinted domains in the nuclei of neurons does not require ATRX. We demonstrate that MeCP2 is required for ATRX recruitment and that deficiency of either ATRX or MeCP2 causes decreased frequency of long-range chromatin interactions associated with altered nucleosome density at CTCF-binding sites and reduced CTCF occupancy. These findings indicate that MeCP2 and ATRX regulate gene expression at a subset of imprinted domains by maintaining a nucleosome configuration conducive to CTCF binding and to the maintenance of higher order chromatin structure. PMID:24990380

  16. Transcriptional Dysregulation of MYC Reveals Common Enhancer-Docking Mechanism.

    PubMed

    Schuijers, Jurian; Manteiga, John Colonnese; Weintraub, Abraham Selby; Day, Daniel Sindt; Zamudio, Alicia Viridiana; Hnisz, Denes; Lee, Tong Ihn; Young, Richard Allen

    2018-04-10

    Transcriptional dysregulation of the MYC oncogene is among the most frequent events in aggressive tumor cells, and this is generally accomplished by acquisition of a super-enhancer somewhere within the 2.8 Mb TAD where MYC resides. We find that these diverse cancer-specific super-enhancers, differing in size and location, interact with the MYC gene through a common and conserved CTCF binding site located 2 kb upstream of the MYC promoter. Genetic perturbation of this enhancer-docking site in tumor cells reduces CTCF binding, super-enhancer interaction, MYC gene expression, and cell proliferation. CTCF binding is highly sensitive to DNA methylation, and this enhancer-docking site, which is hypomethylated in diverse cancers, can be inactivated through epigenetic editing with dCas9-DNMT. Similar enhancer-docking sites occur at other genes, including genes with prominent roles in multiple cancers, suggesting a mechanism by which tumor cell oncogenes can generally hijack enhancers. These results provide insights into mechanisms that allow a single target gene to be regulated by diverse enhancer elements in different cell types. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  17. Long-Range Chromosome Interactions Mediated by Cohesin Shape Circadian Gene Expression

    PubMed Central

    Xu, Yichi; Guo, Weimin; Li, Ping; Zhang, Yan; Zhao, Meng; Fan, Zenghua; Zhao, Zhihu; Yan, Jun

    2016-01-01

    Mammalian circadian rhythm is established by the negative feedback loops consisting of a set of clock genes, which lead to the circadian expression of thousands of downstream genes in vivo. As genome-wide transcription is organized under the high-order chromosome structure, it is largely uncharted how circadian gene expression is influenced by chromosome architecture. We focus on the function of chromatin structure proteins cohesin as well as CTCF (CCCTC-binding factor) in circadian rhythm. Using circular chromosome conformation capture sequencing, we systematically examined the interacting loci of a Bmal1-bound super-enhancer upstream of a clock gene Nr1d1 in mouse liver. These interactions are largely stable in the circadian cycle and cohesin binding sites are enriched in the interactome. Global analysis showed that cohesin-CTCF co-binding sites tend to insulate the phases of circadian oscillating genes while cohesin-non-CTCF sites are associated with high circadian rhythmicity of transcription. A model integrating the effects of cohesin and CTCF markedly improved the mechanistic understanding of circadian gene expression. Further experiments in cohesin knockout cells demonstrated that cohesin is required at least in part for driving the circadian gene expression by facilitating the enhancer-promoter looping. This study provided a novel insight into the relationship between circadian transcriptome and the high-order chromosome structure. PMID:27135601

  18. Widespread Site-Dependent Buffering of Human Regulatory Polymorphism

    PubMed Central

    Kutyavin, Tanya; Stamatoyannopoulos, John A.

    2012-01-01

    The average individual is expected to harbor thousands of variants within non-coding genomic regions involved in gene regulation. However, it is currently not possible to interpret reliably the functional consequences of genetic variation within any given transcription factor recognition sequence. To address this, we comprehensively analyzed heritable genome-wide binding patterns of a major sequence-specific regulator (CTCF) in relation to genetic variability in binding site sequences across a multi-generational pedigree. We localized and quantified CTCF occupancy by ChIP-seq in 12 related and unrelated individuals spanning three generations, followed by comprehensive targeted resequencing of the entire CTCF–binding landscape across all individuals. We identified hundreds of variants with reproducible quantitative effects on CTCF occupancy (both positive and negative). While these effects paralleled protein–DNA recognition energetics when averaged, they were extensively buffered by striking local context dependencies. In the significant majority of cases buffering was complete, resulting in silent variants spanning every position within the DNA recognition interface irrespective of level of binding energy or evolutionary constraint. The prevalence of complex partial or complete buffering effects severely constrained the ability to predict reliably the impact of variation within any given binding site instance. Surprisingly, 40% of variants that increased CTCF occupancy occurred at positions of human–chimp divergence, challenging the expectation that the vast majority of functional regulatory variants should be deleterious. Our results suggest that, even in the presence of “perfect” genetic information afforded by resequencing and parallel studies in multiple related individuals, genomic site-specific prediction of the consequences of individual variation in regulatory DNA will require systematic coupling with empirical functional genomic measurements. PMID:22457641

  19. Computational prediction of CTCF/cohesin-based intra-TAD loops that insulate chromatin contacts and gene expression in mouse liver

    PubMed Central

    2018-01-01

    CTCF and cohesin are key drivers of 3D-nuclear organization, anchoring the megabase-scale Topologically Associating Domains (TADs) that segment the genome. Here, we present and validate a computational method to predict cohesin-and-CTCF binding sites that form intra-TAD DNA loops. The intra-TAD loop anchors identified are structurally indistinguishable from TAD anchors regarding binding partners, sequence conservation, and resistance to cohesin knockdown; further, the intra-TAD loops retain key functional features of TADs, including chromatin contact insulation, blockage of repressive histone mark spread, and ubiquity across tissues. We propose that intra-TAD loops form by the same loop extrusion mechanism as the larger TAD loops, and that their shorter length enables finer regulatory control in restricting enhancer-promoter interactions, which enables selective, high-level expression of gene targets of super-enhancers and genes located within repressive nuclear compartments. These findings elucidate the role of intra-TAD cohesin-and-CTCF binding in nuclear organization associated with widespread insulation of distal enhancer activity. PMID:29757144

  20. Computational prediction of CTCF/cohesin-based intra-TAD loops that insulate chromatin contacts and gene expression in mouse liver.

    PubMed

    Matthews, Bryan J; Waxman, David J

    2018-05-14

    CTCF and cohesin are key drivers of 3D-nuclear organization, anchoring the megabase-scale Topologically Associating Domains (TADs) that segment the genome. Here, we present and validate a computational method to predict cohesin-and-CTCF binding sites that form intra-TAD DNA loops. The intra-TAD loop anchors identified are structurally indistinguishable from TAD anchors regarding binding partners, sequence conservation, and resistance to cohesin knockdown; further, the intra-TAD loops retain key functional features of TADs, including chromatin contact insulation, blockage of repressive histone mark spread, and ubiquity across tissues. We propose that intra-TAD loops form by the same loop extrusion mechanism as the larger TAD loops, and that their shorter length enables finer regulatory control in restricting enhancer-promoter interactions, which enables selective, high-level expression of gene targets of super-enhancers and genes located within repressive nuclear compartments. These findings elucidate the role of intra-TAD cohesin-and-CTCF binding in nuclear organization associated with widespread insulation of distal enhancer activity. © 2018, Matthews et al.

  1. CTCF Occupation of the Herpes Simplex Virus 1 Genome Is Disrupted at Early Times Postreactivation in a Transcription-Dependent Manner

    PubMed Central

    Ertel, Monica K.; Cammarata, Amy L.; Hron, Rebecca J.

    2012-01-01

    In herpes simplex virus 1 (HSV-1), binding clusters enriched in CTCF during latency have been previously identified. We hypothesized that CTCF binding to CTCF clusters in HSV-1 would be disrupted in a reactivation event. To investigate, CTCF occupation of three CTCF binding clusters in HSV-1 was analyzed following sodium butyrate (NaB)- and explant-induced reactivation in the mouse. Our data show that the CTCF domains positioned within the HSV-1 genome, specifically around the latency-associated transcript (LAT) and ICP0 and ICP4 regions of the genome, lose CTCF occupancy following the application of reactivation stimuli in wild-type virus. We also found that CTCF binding clusters upstream of the ICP0 and ICP4 promoters both function as classical insulators capable of acting as enhancer blockers of the LAT enhancer. Finally, our results suggest that CTCF occupation of domains in HSV-1 may be differentially regulated both during latency and at early times following reactivation by the presence of lytic transcripts and further implicate epigenetic regulation of HSV-1 as a critical component of the latency-reactivation transition. PMID:22973047

  2. CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

    PubMed Central

    Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

    2014-01-01

    The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

  3. The evolution of epigenetic regulators CTCF and BORIS/CTCFL in amniotes.

    PubMed

    Hore, Timothy A; Deakin, Janine E; Marshall Graves, Jennifer A

    2008-08-29

    CTCF is an essential, ubiquitously expressed DNA-binding protein responsible for insulator function, nuclear architecture, and transcriptional control within vertebrates. The gene CTCF was proposed to have duplicated in early mammals, giving rise to a paralogue called "brother of regulator of imprinted sites" (BORIS or CTCFL) with DNA binding capabilities similar to CTCF, but testis-specific expression in humans and mice. CTCF and BORIS have opposite regulatory effects on human cancer-testis genes, the anti-apoptotic BAG1 gene, the insulin-like growth factor 2/H19 imprint control region (IGF2/H19 ICR), and show mutually exclusive expression in humans and mice, suggesting that they are antagonistic epigenetic regulators. We discovered orthologues of BORIS in at least two reptilian species and found traces of its sequence in the chicken genome, implying that the duplication giving rise to BORIS occurred much earlier than previously thought. We analysed the expression of CTCF and BORIS in a range of amniotes by conventional and quantitative PCR. BORIS, as well as CTCF, was found widely expressed in monotremes (platypus) and reptiles (bearded dragon), suggesting redundancy or cooperation between these genes in a common amniote ancestor. However, we discovered that BORIS expression was gonad-specific in marsupials (tammar wallaby) and eutherians (cattle), implying that a functional change occurred in BORIS during the early evolution of therian mammals. Since therians show imprinting of IGF2 but other vertebrate taxa do not, we speculate that CTCF and BORIS evolved specialised functions along with the evolution of imprinting at this and other loci, coinciding with the restriction of BORIS expression to the germline and potential antagonism with CTCF.

  4. Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements.

    PubMed

    Kyrchanova, Olga; Chetverina, Darya; Maksimenko, Oksana; Kullyev, Andrey; Georgiev, Pavel

    2008-12-01

    Insulators are defined as a class of regulatory elements that delimit independent transcriptional domains within eukaryotic genomes. According to previous data, an interaction (pairing) between some Drosophila insulators can support distant activation of a promoter by an enhancer. Here, we have demonstrated that pairs of well-studied insulators such as scs-scs, scs'-scs', 1A2-1A2 and Wari-Wari support distant activation of the white promoter by the yeast GAL4 activator in an orientation-dependent manner. The same is true for the efficiency of the enhancer that stimulates white expression in the eyes. In all insulator pairs tested, stimulation of the white gene was stronger when insulators were inserted between the eye enhancer or GAL4 and the white promoter in opposite orientations relative to each other. As shown previously, Zw5, Su(Hw) and dCTCF proteins are required for the functioning of different insulators that do not interact with each other. Here, strong functional interactions have been revealed between DNA fragments containing binding sites for either Zw5 or Su(Hw) or dCTCF protein but not between heterologous binding sites [Zw5-Su(Hw), dCTCF-Su(Hw), or dCTCF-Zw5]. These results suggest that insulator proteins can support selective interactions between distant regulatory elements.

  5. Putative bovine topological association domains and CTCF binding motifs can reduce the search space for causative regulatory variants of complex traits.

    PubMed

    Wang, Min; Hancock, Timothy P; Chamberlain, Amanda J; Vander Jagt, Christy J; Pryce, Jennie E; Cocks, Benjamin G; Goddard, Mike E; Hayes, Benjamin J

    2018-05-24

    Topological association domains (TADs) are chromosomal domains characterised by frequent internal DNA-DNA interactions. The transcription factor CTCF binds to conserved DNA sequence patterns called CTCF binding motifs to either prohibit or facilitate chromosomal interactions. TADs and CTCF binding motifs control gene expression, but they are not yet well defined in the bovine genome. In this paper, we sought to improve the annotation of bovine TADs and CTCF binding motifs, and assess whether the new annotation can reduce the search space for cis-regulatory variants. We used genomic synteny to map TADs and CTCF binding motifs from humans, mice, dogs and macaques to the bovine genome. We found that our mapped TADs exhibited the same hallmark properties of those sourced from experimental data, such as housekeeping genes, transfer RNA genes, CTCF binding motifs, short interspersed elements, H3K4me3 and H3K27ac. We showed that runs of genes with the same pattern of allele-specific expression (ASE) (either favouring paternal or maternal allele) were often located in the same TAD or between the same conserved CTCF binding motifs. Analyses of variance showed that when averaged across all bovine tissues tested, TADs explained 14% of ASE variation (standard deviation, SD: 0.056), while CTCF explained 27% (SD: 0.078). Furthermore, we showed that the quantitative trait loci (QTLs) associated with gene expression variation (eQTLs) or ASE variation (aseQTLs), which were identified from mRNA transcripts from 141 lactating cows' white blood and milk cells, were highly enriched at putative bovine CTCF binding motifs. The linearly-furthermost, and most-significant aseQTL and eQTL for each genic target were located within the same TAD as the gene more often than expected (Chi-Squared test P-value < 0.001). Our results suggest that genomic synteny can be used to functionally annotate conserved transcriptional components, and provides a tool to reduce the search space for causative regulatory variants in the bovine genome.

  6. PARP1 restricts Epstein Barr Virus lytic reactivation by binding the BZLF1 promoter.

    PubMed

    Lupey-Green, Lena N; Moquin, Stephanie A; Martin, Kayla A; McDevitt, Shane M; Hulse, Michael; Caruso, Lisa B; Pomerantz, Richard T; Miranda, Jj L; Tempera, Italo

    2017-07-01

    The Epstein Barr virus (EBV) genome persists in infected host cells as a chromatinized episome and is subject to chromatin-mediated regulation. Binding of the host insulator protein CTCF to the EBV genome has an established role in maintaining viral latency type, and in other herpesviruses, loss of CTCF binding at specific regions correlates with viral reactivation. Here, we demonstrate that binding of PARP1, an important cofactor of CTCF, at the BZLF1 lytic switch promoter restricts EBV reactivation. Knockdown of PARP1 in the Akata-EBV cell line significantly increases viral copy number and lytic protein expression. Interestingly, CTCF knockdown has no effect on viral reactivation, and CTCF binding across the EBV genome is largely unchanged following reactivation. Moreover, EBV reactivation attenuates PARP activity, and Zta expression alone is sufficient to decrease PARP activity. Here we demonstrate a restrictive function of PARP1 in EBV lytic reactivation. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Computational characterization of chromatin domain boundary-associated genomic elements

    PubMed Central

    Hong, Seungpyo

    2017-01-01

    Abstract Topologically associated domains (TADs) are 3D genomic structures with high internal interactions that play important roles in genome compaction and gene regulation. Their genomic locations and their association with CCCTC-binding factor (CTCF)-binding sites and transcription start sites (TSSs) were recently reported. However, the relationship between TADs and other genomic elements has not been systematically evaluated. This was addressed in the present study, with a focus on the enrichment of these genomic elements and their ability to predict the TAD boundary region. We found that consensus CTCF-binding sites were strongly associated with TAD boundaries as well as with the transcription factors (TFs) Zinc finger protein (ZNF)143 and Yin Yang (YY)1. TAD boundary-associated genomic elements include DNase I-hypersensitive sites, H3K36 trimethylation, TSSs, RNA polymerase II, and TFs such as Specificity protein 1, ZNF274 and SIX homeobox 5. Computational modeling with these genomic elements suggests that they have distinct roles in TAD boundary formation. We propose a structural model of TAD boundaries based on these findings that provides a basis for studying the mechanism of chromatin structure formation and gene regulation. PMID:28977568

  8. Targeting CTCF to Control Virus Gene Expression: A Common Theme amongst Diverse DNA Viruses.

    PubMed

    Pentland, Ieisha; Parish, Joanna L

    2015-07-06

    All viruses target host cell factors for successful life cycle completion. Transcriptional control of DNA viruses by host cell factors is important in the temporal and spatial regulation of virus gene expression. Many of these factors are recruited to enhance virus gene expression and thereby increase virus production, but host cell factors can also restrict virus gene expression and productivity of infection. CCCTC binding factor (CTCF) is a host cell DNA binding protein important for the regulation of genomic chromatin boundaries, transcriptional control and enhancer element usage. CTCF also functions in RNA polymerase II regulation and in doing so can influence co-transcriptional splicing events. Several DNA viruses, including Kaposi's sarcoma-associated herpesvirus (KSHV), Epstein-Barr virus (EBV) and human papillomavirus (HPV) utilize CTCF to control virus gene expression and many studies have highlighted a role for CTCF in the persistence of these diverse oncogenic viruses. CTCF can both enhance and repress virus gene expression and in some cases CTCF increases the complexity of alternatively spliced transcripts. This review article will discuss the function of CTCF in the life cycle of DNA viruses in the context of known host cell CTCF functions.

  9. CCCTC-binding Factor Mediates Effects of Glucose On Beta Cell Survival

    PubMed Central

    Tsui, Shanli; Dai, Wei; Lu, Luo

    2013-01-01

    Objectives Pancreatic islet β-cell survival is important in regulating insulin activities and maintaining glucose homeostasis. Recently, Pax6 has been shown to be essential for many vital functions in β-cells, though the molecular mechanisms of its regulation in β-cells remain unclear. The present study investigates the novel effects of glucose- and insulin-induced CTCF activity on Pax6 gene expression as well as the subsequent effects of insulin-activated signaling pathways on β-cell proliferation. Material and methods Pancreatic β-TC-1-6 cells were cultured in DMEM medium and stimulated with high concentrations of glucose (5 to 125 mM) and cell viability was assessed by MTT assays. The effect of CTCF on Pax6 was evaluated in high glucose-induced and CCCTC-binding Factor (CTCF)/Erk suppressed cells by promoter reporter and Western analyses. Results Increases in glucose and insulin concentrations up-regulated CTCF and consequently down-regulated Pax6 in β-cell survival and proliferation. Knocking-down CTCF directly affected Pax6 transcription through CTCF binding and blocked the response to glucose. Altered Erk activity mediated the effects of CTCF on controlling Pax6 expression, which partially regulates β-cell proliferation. Conclusions CTCF functions as a molecular mediator between insulin-induced upstream Erk signaling and Pax6 expression in pancreatic β-cells. This pathway may contribute to regulation of β-cell survival and proliferation. PMID:24354619

  10. CRISPR Inversion of CTCF Sites Alters Genome Topology and Enhancer/Promoter Function

    PubMed Central

    Guo, Ya; Xu, Quan; Canzio, Daniele; Shou, Jia; Li, Jinhuan; Gorkin, David U.; Jung, Inkyung; Wu, Haiyang; Zhai, Yanan; Tang, Yuanxiao; Lu, Yichao; Wu, Yonghu; Jia, Zhilian; Li, Wei; Zhang, Michael Q.; Ren, Bing; Krainer, Adrian R.; Maniatis, Tom; Wu, Qiang

    2015-01-01

    SUMMARY CTCF/cohesin play a central role in insulator function and higher-order chromatin organization of mammalian genomes. Recent studies identified a correlation between the orientation of CTCF-binding sites (CBSs) and chromatin loops. To test the functional significance of this observation, we combined CRISPR/Cas9-based genomic-DNA-fragment editing with chromosome-conformation-capture experiments to show that the location and relative orientations of CBSs determine the specificity of long-range chromatin looping in mammalian genomes, using protocadherin (Pcdh) and β-globin as model genes. Inversion of CBS elements within the Pcdh enhancer reconfigures the topology of chromatin loops between the distal enhancer and target promoters, and alters gene-expression patterns. Thus, although enhancers can function in an orientation-independent manner in reporter assays, in the native chromosome context the orientation of at least some enhancers carrying CBSs can determine both the architecture of topological chromatin domains and enhancer/promoter specificity. The findings reveal how 3D chromosome architecture can be encoded by genome sequence. PMID:26276636

  11. Restraint of angiogenesis by zinc finger transcription factor CTCF-dependent chromatin insulation

    PubMed Central

    Tang, Ming; Chen, Bo; Pardo, Carolina; Pampo, Christine; Chen, Jing; Lien, Ching-Ling; Wu, Lizi; Wang, Heiman; Yao, Kai; Oh, S. Paul; Seto, Edward; Smith, Lois E. H.; Siemann, Dietmar W.; Kladde, Michael P.; Cepko, Constance L.; Lu, Jianrong

    2011-01-01

    Angiogenesis is meticulously controlled by a fine balance between positive and negative regulatory activities. Vascular endothelial growth factor (VEGF) is a predominant angiogenic factor and its dosage is precisely regulated during normal vascular formation. In cancer, VEGF is commonly overproduced, resulting in abnormal neovascularization. VEGF is induced in response to various stimuli including hypoxia; however, very little is known about the mechanisms that confine its induction to ensure proper angiogenesis. Chromatin insulation is a key transcription mechanism that prevents promiscuous gene activation by interfering with the action of enhancers. Here we show that the chromatin insulator-binding factor CTCF binds to the proximal promoter of VEGF. Consistent with the enhancer-blocking mode of chromatin insulators, CTCF has little effect on basal expression of VEGF but specifically affects its activation by enhancers. CTCF knockdown cells are sensitized for induction of VEGF and exhibit elevated proangiogenic potential. Cancer-derived CTCF missense mutants are mostly defective in blocking enhancers at the VEGF locus. Moreover, during mouse retinal development, depletion of CTCF causes excess angiogenesis. Therefore, CTCF-mediated chromatin insulation acts as a crucial safeguard against hyperactivation of angiogenesis. PMID:21896759

  12. Remote Memory and Cortical Synaptic Plasticity Require Neuronal CCCTC-Binding Factor (CTCF).

    PubMed

    Kim, Somi; Yu, Nam-Kyung; Shim, Kyu-Won; Kim, Ji-Il; Kim, Hyopil; Han, Dae Hee; Choi, Ja Eun; Lee, Seung-Woo; Choi, Dong Il; Kim, Myung Won; Lee, Dong-Sung; Lee, Kyungmin; Galjart, Niels; Lee, Yong-Seok; Lee, Jae-Hyung; Kaang, Bong-Kiun

    2018-05-30

    The molecular mechanism of long-term memory has been extensively studied in the context of the hippocampus-dependent recent memory examined within several days. However, months-old remote memory maintained in the cortex for long-term has not been investigated much at the molecular level yet. Various epigenetic mechanisms are known to be important for long-term memory, but how the 3D chromatin architecture and its regulator molecules contribute to neuronal plasticity and systems consolidation is still largely unknown. CCCTC-binding factor (CTCF) is an 11-zinc finger protein well known for its role as a genome architecture molecule. Male conditional knock-out mice in which CTCF is lost in excitatory neurons during adulthood showed normal recent memory in the contextual fear conditioning and spatial water maze tasks. However, they showed remarkable impairments in remote memory in both tasks. Underlying the remote memory-specific phenotypes, we observed that female CTCF conditional knock-out mice exhibit disrupted cortical LTP, but not hippocampal LTP. Similarly, we observed that CTCF deletion in inhibitory neurons caused partial impairment of remote memory. Through RNA sequencing, we observed that CTCF knockdown in cortical neuron culture caused altered expression of genes that are highly involved in cell adhesion, synaptic plasticity, and memory. These results suggest that remote memory storage in the cortex requires CTCF-mediated gene regulation in neurons, whereas recent memory formation in the hippocampus does not. SIGNIFICANCE STATEMENT CCCTC-binding factor (CTCF) is a well-known 3D genome architectural protein that regulates gene expression. Here, we use two different CTCF conditional knock-out mouse lines and reveal, for the first time, that CTCF is critically involved in the regulation of remote memory. We also show that CTCF is necessary for appropriate expression of genes, many of which we found to be involved in the learning- and memory-related processes. Our study provides behavioral and physiological evidence for the involvement of CTCF-mediated gene regulation in the remote long-term memory and elucidates our understanding of systems consolidation mechanisms. Copyright © 2018 the authors 0270-6474/18/385042-11$15.00/0.

  13. Genome Organization Drives Chromosome Fragility.

    PubMed

    Canela, Andres; Maman, Yaakov; Jung, Seolkyoung; Wong, Nancy; Callen, Elsa; Day, Amanda; Kieffer-Kwon, Kyong-Rim; Pekowska, Aleksandra; Zhang, Hongliang; Rao, Suhas S P; Huang, Su-Chen; Mckinnon, Peter J; Aplan, Peter D; Pommier, Yves; Aiden, Erez Lieberman; Casellas, Rafael; Nussenzweig, André

    2017-07-27

    In this study, we show that evolutionarily conserved chromosome loop anchors bound by CCCTC-binding factor (CTCF) and cohesin are vulnerable to DNA double strand breaks (DSBs) mediated by topoisomerase 2B (TOP2B). Polymorphisms in the genome that redistribute CTCF/cohesin occupancy rewire DNA cleavage sites to novel loop anchors. While transcription- and replication-coupled genomic rearrangements have been well documented, we demonstrate that DSBs formed at loop anchors are largely transcription-, replication-, and cell-type-independent. DSBs are continuously formed throughout interphase, are enriched on both sides of strong topological domain borders, and frequently occur at breakpoint clusters commonly translocated in cancer. Thus, loop anchors serve as fragile sites that generate DSBs and chromosomal rearrangements. VIDEO ABSTRACT. Published by Elsevier Inc.

  14. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  15. Comparative anatomy of chromosomal domains with imprinted and non-imprinted allele-specific DNA methylation.

    PubMed

    Paliwal, Anupam; Temkin, Alexis M; Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-08-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM.

  16. Comparative Anatomy of Chromosomal Domains with Imprinted and Non-Imprinted Allele-Specific DNA Methylation

    PubMed Central

    Kerkel, Kristi; Yale, Alexander; Yotova, Iveta; Drost, Natalia; Lax, Simon; Nhan-Chang, Chia-Ling; Powell, Charles; Borczuk, Alain; Aviv, Abraham; Wapner, Ronald; Chen, Xiaowei; Nagy, Peter L.; Schork, Nicholas; Do, Catherine; Torkamani, Ali; Tycko, Benjamin

    2013-01-01

    Allele-specific DNA methylation (ASM) is well studied in imprinted domains, but this type of epigenetic asymmetry is actually found more commonly at non-imprinted loci, where the ASM is dictated not by parent-of-origin but instead by the local haplotype. We identified loci with strong ASM in human tissues from methylation-sensitive SNP array data. Two index regions (bisulfite PCR amplicons), one between the C3orf27 and RPN1 genes in chromosome band 3q21 and the other near the VTRNA2-1 vault RNA in band 5q31, proved to be new examples of imprinted DMRs (maternal alleles methylated) while a third, between STEAP3 and C2orf76 in chromosome band 2q14, showed non-imprinted haplotype-dependent ASM. Using long-read bisulfite sequencing (bis-seq) in 8 human tissues we found that in all 3 domains the ASM is restricted to single differentially methylated regions (DMRs), each less than 2kb. The ASM in the C3orf27-RPN1 intergenic region was placenta-specific and associated with allele-specific expression of a long non-coding RNA. Strikingly, the discrete DMRs in all 3 regions overlap with binding sites for the insulator protein CTCF, which we found selectively bound to the unmethylated allele of the STEAP3-C2orf76 DMR. Methylation mapping in two additional genes with non-imprinted haplotype-dependent ASM, ELK3 and CYP2A7, showed that the CYP2A7 DMR also overlaps a CTCF site. Thus, two features of imprinted domains, highly localized DMRs and allele-specific insulator occupancy by CTCF, can also be found in chromosomal domains with non-imprinted ASM. Arguing for biological importance, our analysis of published whole genome bis-seq data from hES cells revealed multiple genome-wide association study (GWAS) peaks near CTCF binding sites with ASM. PMID:24009515

  17. CTCF genetic alterations in endometrial carcinoma are pro-tumorigenic

    PubMed Central

    Marshall, A D; Bailey, C G; Champ, K; Vellozzi, M; O'Young, P; Metierre, C; Feng, Y; Thoeng, A; Richards, A M; Schmitz, U; Biro, M; Jayasinghe, R; Ding, L; Anderson, L; Mardis, E R; Rasko, J E J

    2017-01-01

    CTCF is a haploinsufficient tumour suppressor gene with diverse normal functions in genome structure and gene regulation. However the mechanism by which CTCF haploinsufficiency contributes to cancer development is not well understood. CTCF is frequently mutated in endometrial cancer. Here we show that most CTCF mutations effectively result in CTCF haploinsufficiency through nonsense-mediated decay of mutant transcripts, or loss-of-function missense mutation. Conversely, we identified a recurrent CTCF mutation K365T, which alters a DNA binding residue, and acts as a gain-of-function mutation enhancing cell survival. CTCF genetic deletion occurs predominantly in poor prognosis serous subtype tumours, and this genetic deletion is associated with poor overall survival. In addition, we have shown that CTCF haploinsufficiency also occurs in poor prognosis endometrial clear cell carcinomas and has some association with endometrial cancer relapse and metastasis. Using shRNA targeting CTCF to recapitulate CTCF haploinsufficiency, we have identified a novel role for CTCF in the regulation of cellular polarity of endometrial glandular epithelium. Overall, we have identified two novel pro-tumorigenic roles (promoting cell survival and altering cell polarity) for genetic alterations of CTCF in endometrial cancer. PMID:28319062

  18. A Chromatin Insulator-Like Element in the Herpes Simplex Virus Type 1 Latency-Associated Transcript Region Binds CCCTC-Binding Factor and Displays Enhancer-Blocking and Silencing Activities

    PubMed Central

    Amelio, Antonio L.; McAnany, Peterjon K.; Bloom, David C.

    2006-01-01

    A previous study demonstrated that the latency-associated transcript (LAT) promoter and the LAT enhancer/reactivation critical region (rcr) are enriched in acetyl histone H3 (K9, K14) during herpes simplex virus type 1 (HSV-1) latency, whereas all lytic genes analyzed (ICP0, UL54, ICP4, and DNA polymerase) are not (N. J. Kubat, R. K. Tran, P. McAnany, and D. C. Bloom, J. Virol. 78:1139-1149, 2004). This suggests that the HSV-1 latent genome is organized into histone H3 (K9, K14) hyperacetylated and hypoacetylated regions corresponding to transcriptionally permissive and transcriptionally repressed chromatin domains, respectively. Such an organization implies that chromatin insulators, similar to those of cellular chromosomes, may separate distinct transcriptional domains of the HSV-1 latent genome. In the present study, we sought to identify cis elements that could partition the HSV-1 genome into distinct chromatin domains. Sequence analysis coupled with chromatin immunoprecipitation and luciferase reporter assays revealed that (i) the long and short repeats and the unique-short region of the HSV-1 genome contain clustered CTCF (CCCTC-binding factor) motifs, (ii) CTCF motif clusters similar to those in HSV-1 are conserved in other alphaherpesviruses, (iii) CTCF binds to these motifs on latent HSV-1 genomes in vivo, and (iv) a 1.5-kb region containing the CTCF motif cluster in the LAT region possesses insulator activities, specifically, enhancer blocking and silencing. The finding that CTCF, a cellular protein associated with chromatin insulators, binds to motifs on the latent genome and insulates the LAT enhancer suggests that CTCF may facilitate the formation of distinct chromatin boundaries during herpesvirus latency. PMID:16474142

  19. Disruption of a -35kb enhancer impairs CTCF binding and MLH1 expression in colorectal cells.

    PubMed

    Liu, Qing; Thoms, Julie A; Nunez, Andrea C; Huang, Yizhou; Knezevic, Kathy; Packham, Deborah; Poulos, Rebecca C; Williams, Rachel; Beck, Dominik; Hawkins, Nicholas J; Ward, Robyn L; Wong, Jason W H; Hesson, Luke B; Sloane, Mathew A; Pimanda, John

    2018-06-13

    MLH1 is a major tumour suppressor gene involved in the pathogenesis of Lynch syndrome and various sporadic cancers. Despite their potential pathogenic importance, genomic regions capable of regulating MLH1 expression over long distances have yet to be identified. Here we use chromosome conformation capture (3C) to screen a 650-kb region flanking the MLH1 locus to identify interactions between the MLH1 promoter and distal regions in MLH1 expressing and non-expressing cells. Putative enhancers were functionally validated using luciferase reporter assays, chromatin immunoprecipitation and CRISPR-Cas9 mediated deletion of endogenous regions. To evaluate whether germline variants in the enhancer might contribute to impaired MLH1 expression in patients with suspected Lynch syndrome, we also screened germline DNA from a cohort of 74 patients with no known coding mutations or epimutations at the MLH1 promoter. A 1.8kb DNA fragment, 35kb upstream of the MLH1 transcription start site enhances MLH1 gene expression in colorectal cells. The enhancer was bound by CTCF and CRISPR-Cas9 mediated deletion of a core binding region impairs endogenous MLH1 expression. 5.4% of suspected Lynch syndrome patients have a rare single nucleotide variant (G>A; rs143969848; 2.5% in gnomAD European, non-Finnish) within a highly conserved CTCF binding motif, which disrupts enhancer activity in SW620 colorectal carcinoma cells. A CTCF bound region within the MLH1 -35 enhancer regulates MLH1 expression in colorectal cells and is worthy of scrutiny in future genetic screening strategies for suspected Lynch syndrome associated with loss of MLH1 expression. Copyright ©2018, American Association for Cancer Research.

  20. EAST Organizes Drosophila Insulator Proteins in the Interchromosomal Nuclear Compartment and Modulates CP190 Binding to Chromatin

    PubMed Central

    Golovnin, Anton; Melnikova, Larisa; Shapovalov, Igor; Kostyuchenko, Margarita; Georgiev, Pavel

    2015-01-01

    Recent data suggest that insulators organize chromatin architecture in the nucleus. The best studied Drosophila insulator proteins, dCTCF (a homolog of the vertebrate insulator protein CTCF) and Su(Hw), are DNA-binding zinc finger proteins. Different isoforms of the BTB-containing protein Mod(mdg4) interact with Su(Hw) and dCTCF. The CP190 protein is a cofactor for the dCTCF and Su(Hw) insulators. CP190 is required for the functional activity of insulator proteins and is involved in the aggregation of the insulator proteins into specific structures named nuclear speckles. Here, we have shown that the nuclear distribution of CP190 is dependent on the level of EAST protein, an essential component of the interchromatin compartment. EAST interacts with CP190 and Mod(mdg4)-67.2 proteins in vitro and in vivo. Over-expression of EAST in S2 cells leads to an extrusion of the CP190 from the insulator bodies containing Su(Hw), Mod(mdg4)-67.2, and dCTCF. In consistent with the role of the insulator bodies in assembly of protein complexes, EAST over-expression led to a striking decrease of the CP190 binding with the dCTCF and Su(Hw) dependent insulators and promoters. These results suggest that EAST is involved in the regulation of CP190 nuclear localization. PMID:26489095

  1. Euchromatin islands in large heterochromatin domains are enriched for CTCF binding and differentially DNA-methylated regions

    PubMed Central

    2012-01-01

    Background The organization of higher order chromatin is an emerging epigenetic mechanism for understanding development and disease. We and others have previously observed dynamic changes during differentiation and oncogenesis in large heterochromatin domains such as Large Organized Chromatin K (lysine) modifications (LOCKs), of histone H3 lysine-9 dimethylation (H3K9me2) or other repressive histone posttranslational modifications. The microstructure of these regions has not previously been explored. Results We analyzed the genome-wide distribution of H3K9me2 in two human pluripotent stem cell lines and three differentiated cells lines. We identified > 2,500 small regions with very low H3K9me2 signals in the body of LOCKs, which were termed as euchromatin islands (EIs). EIs are 6.5-fold enriched for DNase I Hypersensitive Sites and 8-fold enriched for the binding of CTCF, the major organizer of higher-order chromatin. Furthermore, EIs are 2–6 fold enriched for differentially DNA-methylated regions associated with tissue types (T-DMRs), reprogramming (R-DMRs) and cancer (C-DMRs). Gene ontology (GO) analysis suggests that EI-associated genes are functionally related to organ system development, cell adhesion and cell differentiation. Conclusions We identify the existence of EIs as a finer layer of epigenomic architecture within large heterochromatin domains. Their enrichment for CTCF sites and DNAse hypersensitive sites, as well as association with DMRs, suggest that EIs play an important role in normal epigenomic architecture and its disruption in disease. PMID:23102236

  2. The effect of preconception paternal alcohol exposure on epigenetic remodeling of the h19 and rasgrf1 imprinting control regions in mouse offspring.

    PubMed

    Knezovich, Jaysen Gregory; Ramsay, Michèle

    2012-01-01

    Imprinted loci play a critical role in fetal development. Their expression is often regulated by CCCTC-binding factor (CTCF) protein binding at imprinting control regions (ICRs). Prenatal alcohol exposure has been shown to reduce global DNA methylation in the developing mouse fetus. This study explored the effect of preconception paternal alcohol exposure on DNA methylation at two paternally methylated ICRs (H19 and Rasgrf1) in the sperm of exposed males and somatic DNA of sired offspring. Significant reductions at the H19 CTCF 1 (p = 0.0027) and CTCF 2 (p = 0.0009) binding sites were observed in the offspring of ethanol-treated sires, which was significantly correlated with reduced weight at postnatal days 35-42 (p < 0.05). As birth weight was unaffected and growth was only delayed during the postnatal weaning period, with subsequent re-convergence, we hypothesize that this may be the result of a mental deficit causing delayed establishment of independent feeding following weaning and would explain why this effect is transient. No difference in DNA methylation was observed in the sperm of alcohol-exposed males, indicating that the transmission of the epigenetic signal at conception is not due to altered methylation, but may be the result of an RNA-mediated mechanism or altered chromatin remodeling.

  3. Complete Biallelic Insulation at the H19/Igf2 Imprinting Control Region Position Results in Fetal Growth Retardation and Perinatal Lethality

    PubMed Central

    Lee, Dong-Hoon; Singh, Purnima; Tsark, Walter M. K.; Szabó, Piroska E.

    2010-01-01

    Background The H19/Igf2 imprinting control region (ICR) functions as an insulator exclusively in the unmethylated maternal allele, where enhancer-blocking by CTCF protein prevents the interaction between the Igf2 promoter and the distant enhancers. DNA methylation inhibits CTCF binding in the paternal ICR allele. Two copies of the chicken β-globin insulator (ChβGI)2 are capable of substituting for the enhancer blocking function of the ICR. Insulation, however, now also occurs upon paternal inheritance, because unlike the H19 ICR, the (ChβGI)2 does not become methylated in fetal male germ cells. The (ChβGI)2 is a composite insulator, exhibiting enhancer blocking by CTCF and chromatin barrier functions by USF1 and VEZF1. We asked the question whether these barrier proteins protected the (ChβGI)2 sequences from methylation in the male germ line. Methodology/Principal Findings We genetically dissected the ChβGI in the mouse by deleting the binding sites USF1 and VEZF1. The methylation of the mutant versus normal (ChβGI)2 significantly increased from 11% to 32% in perinatal male germ cells, suggesting that the barrier proteins did have a role in protecting the (ChβGI)2 from methylation in the male germ line. Contrary to the H19 ICR, however, the mutant (mChβGI)2 lacked the potential to attain full de novo methylation in the germ line and to maintain methylation in the paternal allele in the soma, where it consequently functioned as a biallelic insulator. Unexpectedly, a stricter enhancer blocking was achieved by CTCF alone than by a combination of the CTCF, USF1 and VEZF1 sites, illustrated by undetectable Igf2 expression upon paternal transmission. Conclusions/Significance In this in vivo model, hypomethylation at the ICR position together with fetal growth retardation mimicked the human Silver-Russell syndrome. Importantly, late fetal/perinatal death occurred arguing that strict biallelic insulation at the H19/Igf2 ICR position is not tolerated in development. PMID:20838620

  4. Mechanisms and Disease Associations of Haplotype-Dependent Allele-Specific DNA Methylation

    PubMed Central

    Do, Catherine; Lang, Charles F.; Lin, John; Darbary, Huferesh; Krupska, Izabela; Gaba, Aulona; Petukhova, Lynn; Vonsattel, Jean-Paul; Gallagher, Mary P.; Goland, Robin S.; Clynes, Raphael A.; Dwork, Andrew; Kral, John G.; Monk, Catherine; Christiano, Angela M.; Tycko, Benjamin

    2016-01-01

    Haplotype-dependent allele-specific methylation (hap-ASM) can impact disease susceptibility, but maps of this phenomenon using stringent criteria in disease-relevant tissues remain sparse. Here we apply array-based and Methyl-Seq approaches to multiple human tissues and cell types, including brain, purified neurons and glia, T lymphocytes, and placenta, and identify 795 hap-ASM differentially methylated regions (DMRs) and 3,082 strong methylation quantitative trait loci (mQTLs), most not previously reported. More than half of these DMRs have cell type-restricted ASM, and among them are 188 hap-ASM DMRs and 933 mQTLs located near GWAS signals for immune and neurological disorders. Targeted bis-seq confirmed hap-ASM in 12/13 loci tested, including CCDC155, CD69, FRMD1, IRF1, KBTBD11, and S100A∗-ILF2, associated with immune phenotypes, MYT1L, PTPRN2, CMTM8 and CELF2, associated with neurological disorders, NGFR and HLA-DRB6, associated with both immunological and brain disorders, and ZFP57, a trans-acting regulator of genomic imprinting. Polymorphic CTCF and transcription factor (TF) binding sites were over-represented among hap-ASM DMRs and mQTLs, and analysis of the human data, supplemented by cross-species comparisons to macaques, indicated that CTCF and TF binding likelihood predicts the strength and direction of the allelic methylation asymmetry. These results show that hap-ASM is highly tissue specific; an important trans-acting regulator of genomic imprinting is regulated by this phenomenon; and variation in CTCF and TF binding sites is an underlying mechanism, and maps of hap-ASM and mQTLs reveal regulatory sequences underlying supra- and sub-threshold GWAS peaks in immunological and neurological disorders. PMID:27153397

  5. Epigenetic Alterations Associated With CCCTC-Binding Factor Deregulation in Prostate Cancer

    DTIC Science & Technology

    2011-07-01

    HPV16 E6 and/or E7 prostate cell lines. We have established stable cell lines containing inducible CTCF shRNA in pTRIPZ vector in PPC-1, LNCaPs, 293T...and non-tumorigenic HPV16 E6 and/or E7 prostate cell lines. We are in process of conducting CTCF knockdown experiments using transient transfection...which express high levels of endogenous CTCF and in non- tumorigenic HPV16 E6 and/or E7 prostate cell lines. We see efficient knockdown of CTCF

  6. CCCTC-Binding Factor Locks Premature IgH Germline Transcription and Restrains Class Switch Recombination

    PubMed Central

    Marina-Zárate, Ester; Pérez-García, Arantxa; Ramiro, Almudena R.

    2017-01-01

    In response to antigenic stimulation B cells undergo class switch recombination (CSR) at the immunoglobulin heavy chain (IgH) to replace the primary IgM/IgD isotypes by IgG, IgE, or IgA. CSR is initiated by activation-induced cytidine deaminase (AID) through the deamination of cytosine residues at the switch (S) regions of IgH. B cell stimulation promotes germline transcription (GLT) of specific S regions, a necessary event prior to CSR because it facilitates AID access to S regions. Here, we show that CCCTC-binding factor (CTCF)-deficient mice are severely impaired in the generation of germinal center B cells and plasma cells after immunization in vivo, most likely due to impaired cell survival. Importantly, we find that CTCF-deficient B cells have an increased rate of CSR under various stimulation conditions in vitro. This effect is not secondary to altered cell proliferation or AID expression in CTCF-deficient cells. Instead, we find that CTCF-deficient B cells harbor an increased mutation frequency at switch regions, probably reflecting an increased accessibility of AID to IgH in the absence of CTCF. Moreover, CTCF deficiency triggers premature GLT of S regions in naïve B cells. Our results indicate that CTCF restricts CSR by enforcing GLT silencing and limiting AID access to IgH. PMID:28928744

  7. Changes in the DNA methylation profile of the rat H19 gene upstream region during development and transgenic hepatocarcinogenesis and its role in the imprinted transcriptional regulation of the H19 gene.

    PubMed

    Manoharan, Herbert; Babcock, Karlee; Pitot, Henry C

    2004-09-01

    Monoallelic expression of the imprinted H19 and insulin-like growth factor-2 (Igf2) genes depends on the hypomethylation of the maternal allele and hypermethylation of the paternal allele of the H19 upstream region. Previous studies from our laboratory on liver carcinogenesis in the F1 hybrid of Fischer 344 (F344) and Sprague-Dawley Alb SV40 T Ag transgenic rat (SD) strains revealed the biallelic expression of H19 in hepatomas. We undertook a comparative study of the DNA methylation status of the upstream region of H19 in fetal, adult, and neoplastic liver. Bisulfite DNA sequencing analysis of a 3.745-kb DNA segment extending from 2950 to 6695 bp of the H19 upstream region revealed marked variations in the methylation patterns in fetal, adult, and neoplastic liver. In the fetal liver, equal proportions of hyper- and hypomethylated strands revealed the differentially methylated status of the parental alleles, but in neoplastic liver a pronounced change in the pattern of methylation was observed with a distinct change to hypomethylation in the short segments between 2984 and 3301 bp, 6033-6123 bp, and 6518-6548 bp. These results indicated that methylation of all cytosines in this region may contribute to the imprinting status of the rat H19 gene. This phenomenon of differential methylation-related epigenetic alteration in the key cis-regulatory domains of the H19 promoter influences switching to biallelic expression in hepatocellular carcinogenesis. Similar to mouse and human, we showed that the zinc-finger CCTCC binding factor (CTCF) binds to the unmethylated CTCF binding site in the upstream region to influence monoallelic imprinted expression in fetal liver. CTCF does not appear to be rate limiting in fetal, normal, and neoplastic liver. 3' to the CTCF binding sites, another DNA region exhibits methylation of CpG's in both DNA strands in adult liver, retention of the imprint in fetal liver, and complete demethylation in neoplastic liver. In this region is also a putative binding site for a basic helix-loop-helix leucine-zipper transcription factor, TFEB. The differential CpG methylation seen in the adult that involves the TFEB binding site may explain the lack of expression of the H19 gene in adult normal liver. Furthermore, these findings demonstrate that the loss of imprinting of the H19 gene in hepatic neoplasms of the SD Alb SV40 T Ag transgenic rat is directly correlated with and probably the result of differential methylation of CpG dinucleotides in two distinct regions of the gene that are within 4 kb 5' of the transcription start site. Cytogenetic analysis of hepatocytes in the transgenic animal prior to the appearance of nodules or neoplasms indicates a role of such loss of imprinting in the very early period of neoplastic development, possibly the transition from the stage of promotion to that of progression. Copyright 2004 Wiley-Liss, Inc.

  8. The Evolution of Epigenetic Regulators CTCF and BORIS/CTCFL in Amniotes

    PubMed Central

    Hore, Timothy A.; Deakin, Janine E.; Marshall Graves, Jennifer A.

    2008-01-01

    CTCF is an essential, ubiquitously expressed DNA-binding protein responsible for insulator function, nuclear architecture, and transcriptional control within vertebrates. The gene CTCF was proposed to have duplicated in early mammals, giving rise to a paralogue called “brother of regulator of imprinted sites” (BORIS or CTCFL) with DNA binding capabilities similar to CTCF, but testis-specific expression in humans and mice. CTCF and BORIS have opposite regulatory effects on human cancer-testis genes, the anti-apoptotic BAG1 gene, the insulin-like growth factor 2/H19 imprint control region (IGF2/H19 ICR), and show mutually exclusive expression in humans and mice, suggesting that they are antagonistic epigenetic regulators. We discovered orthologues of BORIS in at least two reptilian species and found traces of its sequence in the chicken genome, implying that the duplication giving rise to BORIS occurred much earlier than previously thought. We analysed the expression of CTCF and BORIS in a range of amniotes by conventional and quantitative PCR. BORIS, as well as CTCF, was found widely expressed in monotremes (platypus) and reptiles (bearded dragon), suggesting redundancy or cooperation between these genes in a common amniote ancestor. However, we discovered that BORIS expression was gonad-specific in marsupials (tammar wallaby) and eutherians (cattle), implying that a functional change occurred in BORIS during the early evolution of therian mammals. Since therians show imprinting of IGF2 but other vertebrate taxa do not, we speculate that CTCF and BORIS evolved specialised functions along with the evolution of imprinting at this and other loci, coinciding with the restriction of BORIS expression to the germline and potential antagonism with CTCF. PMID:18769711

  9. Loss of the insulator protein CTCF during nematode evolution

    PubMed Central

    Heger, Peter; Marin, Birger; Schierenberg, Einhard

    2009-01-01

    Background The zinc finger (ZF) protein CTCF (CCCTC-binding factor) is highly conserved in Drosophila and vertebrates where it has been shown to mediate chromatin insulation at a genomewide level. A mode of genetic regulation that involves insulators and insulator binding proteins to establish independent transcriptional units is currently not known in nematodes including Caenorhabditis elegans. We therefore searched in nematodes for orthologs of proteins that are involved in chromatin insulation. Results While orthologs for other insulator proteins were absent in all 35 analysed nematode species, we find orthologs of CTCF in a subset of nematodes. As an example for these we cloned the Trichinella spiralis CTCF-like gene and revealed a genomic structure very similar to the Drosophila counterpart. To investigate the pattern of CTCF occurrence in nematodes, we performed phylogenetic analysis with the ZF protein sets of completely sequenced nematodes. We show that three ZF proteins from three basal nematodes cluster together with known CTCF proteins whereas no zinc finger protein of C. elegans and other derived nematodes does so. Conclusion Our findings show that CTCF and possibly chromatin insulation are present in basal nematodes. We suggest that the insulator protein CTCF has been secondarily lost in derived nematodes like C. elegans. We propose a switch in the regulation of gene expression during nematode evolution, from the common vertebrate and insect type involving distantly acting regulatory elements and chromatin insulation to a so far poorly characterised mode present in more derived nematodes. Here, all or some of these components are missing. Instead operons, polycistronic transcriptional units common in derived nematodes, seemingly adopted their function. PMID:19712444

  10. Transposable Elements and DNA Methylation Create in Embryonic Stem Cells Human-Specific Regulatory Sequences Associated with Distal Enhancers and Noncoding RNAs

    PubMed Central

    Glinsky, Gennadi V.

    2015-01-01

    Despite significant progress in the structural and functional characterization of the human genome, understanding of the mechanisms underlying the genetic basis of human phenotypic uniqueness remains limited. Here, I report that transposable element-derived sequences, most notably LTR7/HERV-H, LTR5_Hs, and L1HS, harbor 99.8% of the candidate human-specific regulatory loci (HSRL) with putative transcription factor-binding sites in the genome of human embryonic stem cells (hESC). A total of 4,094 candidate HSRL display selective and site-specific binding of critical regulators (NANOG [Nanog homeobox], POU5F1 [POU class 5 homeobox 1], CCCTC-binding factor [CTCF], Lamin B1), and are preferentially located within the matrix of transcriptionally active DNA segments that are hypermethylated in hESC. hESC-specific NANOG-binding sites are enriched near the protein-coding genes regulating brain size, pluripotency long noncoding RNAs, hESC enhancers, and 5-hydroxymethylcytosine-harboring regions immediately adjacent to binding sites. Sequences of only 4.3% of hESC-specific NANOG-binding sites are present in Neanderthals’ genome, suggesting that a majority of these regulatory elements emerged in Modern Humans. Comparisons of estimated creation rates of novel TF-binding sites revealed that there was 49.7-fold acceleration of creation rates of NANOG-binding sites in genomes of Chimpanzees compared with the mouse genomes and further 5.7-fold acceleration in genomes of Modern Humans compared with the Chimpanzees genomes. Preliminary estimates suggest that emergence of one novel NANOG-binding site detectable in hESC required 466 years of evolution. Pathway analysis of coding genes that have hESC-specific NANOG-binding sites within gene bodies or near gene boundaries revealed their association with physiological development and functions of nervous and cardiovascular systems, embryonic development, behavior, as well as development of a diverse spectrum of pathological conditions such as cancer, diseases of cardiovascular and reproductive systems, metabolic diseases, multiple neurological and psychological disorders. A proximity placement model is proposed explaining how a 33–47% excess of NANOG, CTCF, and POU5F1 proteins immobilized on a DNA scaffold may play a functional role at distal regulatory elements. PMID:25956794

  11. CTCF orchestrates the germinal centre transcriptional program and prevents premature plasma cell differentiation

    PubMed Central

    Pérez-García, Arantxa; Marina-Zárate, Ester; Álvarez-Prado, Ángel F.; Ligos, Jose M.; Galjart, Niels; Ramiro, Almudena R.

    2017-01-01

    In germinal centres (GC) mature B cells undergo intense proliferation and immunoglobulin gene modification before they differentiate into memory B cells or long-lived plasma cells (PC). GC B-cell-to-PC transition involves a major transcriptional switch that promotes a halt in cell proliferation and the production of secreted immunoglobulins. Here we show that the CCCTC-binding factor (CTCF) is required for the GC reaction in vivo, whereas in vitro the requirement for CTCF is not universal and instead depends on the pathways used for B-cell activation. CTCF maintains the GC transcriptional programme, allows a high proliferation rate, and represses the expression of Blimp-1, the master regulator of PC differentiation. Restoration of Blimp-1 levels partially rescues the proliferation defect of CTCF-deficient B cells. Thus, our data reveal an essential function of CTCF in maintaining the GC transcriptional programme and preventing premature PC differentiation. PMID:28677680

  12. Multiple Nucleosome Positioning Sites Regulate the CTCF-Mediated Insulator Function of the H19 Imprinting Control Region†

    PubMed Central

    Kanduri, Meena; Kanduri, Chandrasekhar; Mariano, Piero; Vostrov, Alexander A.; Quitschke, Wolfgang; Lobanenkov, Victor; Ohlsson, Rolf

    2002-01-01

    The 5′ region of the H19 gene harbors a methylation-sensitive chromatin insulator within an imprinting control region (ICR). Insertional mutagenesis in combination with episomal assays identified nucleosome positioning sequences (NPSs) that set the stage for the remarkably precise distribution of the four target sites for the chromatin insulator protein CTCF to nucleosome linker sequences in the H19 ICR. Changing positions of the NPSs resulted in loss of both CTCF target site occupancy and insulator function, suggesting that the NPSs optimize the fidelity of the insulator function. We propose that the NPSs ensure the fidelity of the repressed status of the maternal Igf2 allele during development by constitutively maintaining availability of the CTCF target sites. PMID:11971967

  13. Targeted Degradation of CTCF Decouples Local Insulation of Chromosome Domains from Genomic Compartmentalization.

    PubMed

    Nora, Elphège P; Goloborodko, Anton; Valton, Anne-Laure; Gibcus, Johan H; Uebersohn, Alec; Abdennur, Nezar; Dekker, Job; Mirny, Leonid A; Bruneau, Benoit G

    2017-05-18

    The molecular mechanisms underlying folding of mammalian chromosomes remain poorly understood. The transcription factor CTCF is a candidate regulator of chromosomal structure. Using the auxin-inducible degron system in mouse embryonic stem cells, we show that CTCF is absolutely and dose-dependently required for looping between CTCF target sites and insulation of topologically associating domains (TADs). Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding. CTCF remains essential for TAD organization in non-dividing cells. Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs. Furthermore, our data support that CTCF mediates transcriptional insulator function through enhancer blocking but not as a direct barrier to heterochromatin spreading. Beyond defining the functions of CTCF in chromosome folding, these results provide new fundamental insights into the rules governing mammalian genome organization. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Targeted degradation of CTCF decouples local insulation of chromosome domains from genomic compartmentalization

    PubMed Central

    Nora, Elphège P.; Goloborodko, Anton; Valton, Anne-Laure; Gibcus, Johan H.; Uebersohn, Alec; Abdennur, Nezar; Dekker, Job; Mirny, Leonid A.; Bruneau, Benoit G.

    2017-01-01

    Summary The molecular mechanisms underlying folding of mammalian chromosomes remain poorly understood. The transcription factor CTCF is a candidate regulator of chromosomal structure. Using the auxin-inducible degron system in mouse embryonic stem cells, we show that CTCF is absolutely and dose-dependently required for looping between CTCF target sites and insulation of topologically associating domains (TADs). Restoring CTCF reinstates proper architecture on altered chromosomes, indicating a powerful instructive function for CTCF in chromatin folding. CTCF remains essential for TAD organization in non-dividing cells. Surprisingly, active and inactive genome compartments remain properly segregated upon CTCF depletion, revealing that compartmentalization of mammalian chromosomes emerges independently of proper insulation of TADs. Further, our data support that CTCF mediates transcriptional insulator function through enhancer-blocking but not as a direct barrier to heterochromatin spreading. Beyond defining the functions of CTCF in chromosome folding these results provide new fundamental insights into the rules governing mammalian genome organization. PMID:28525758

  15. Fred Hutchinson Cancer Research Center (FHCRC1): Genetic Disruption of CTCF Destabilizes DNA Methylation | Office of Cancer Genomics

    Cancer.gov

    The CTD2 Center at Fred Hutchinson Cancer Research Center identified the DNA binding protein CTCF as a tumor suppressor and regulator of DNA methylation. Read the abstract Experimental Approaches Read the detailed Experimental Approaches

  16. Fred Hutchinson Cancer Research Center (FHCRC-1): Genetic Disruption of CTCF Destabilizes DNA Methylation | Office of Cancer Genomics

    Cancer.gov

    The CTD2 Center at Fred Hutchinson Cancer Research Center identified the DNA binding protein CTCF as a tumor suppressor and regulator of DNA methylation. Read the abstract Experimental Approaches Read the detailed Experimental Approaches

  17. Nonequilibrium Chromosome Looping via Molecular Slip Links

    NASA Astrophysics Data System (ADS)

    Brackley, C. A.; Johnson, J.; Michieletto, D.; Morozov, A. N.; Nicodemi, M.; Cook, P. R.; Marenduzzo, D.

    2017-09-01

    We propose a model for the formation of chromatin loops based on the diffusive sliding of molecular slip links. These mimic the behavior of molecules like cohesin, which, along with the CTCF protein, stabilize loops which contribute to organizing the genome. By combining 3D Brownian dynamics simulations and 1D exactly solvable nonequilibrium models, we show that diffusive sliding is sufficient to account for the strong bias in favor of convergent CTCF-mediated chromosome loops observed experimentally. We also find that the diffusive motion of multiple slip links along chromatin is rectified by an intriguing ratchet effect that arises if slip links bind to the chromatin at a preferred "loading site." This emergent collective behavior favors the extrusion of loops which are much larger than the ones formed by single slip links.

  18. Open chromatin defined by DNaseI and FAIRE identifies regulatory elements that shape cell-type identity

    PubMed Central

    Song, Lingyun; Zhang, Zhancheng; Grasfeder, Linda L.; Boyle, Alan P.; Giresi, Paul G.; Lee, Bum-Kyu; Sheffield, Nathan C.; Gräf, Stefan; Huss, Mikael; Keefe, Damian; Liu, Zheng; London, Darin; McDaniell, Ryan M.; Shibata, Yoichiro; Showers, Kimberly A.; Simon, Jeremy M.; Vales, Teresa; Wang, Tianyuan; Winter, Deborah; Zhang, Zhuzhu; Clarke, Neil D.; Birney, Ewan; Iyer, Vishwanath R.; Crawford, Gregory E.; Lieb, Jason D.; Furey, Terrence S.

    2011-01-01

    The human body contains thousands of unique cell types, each with specialized functions. Cell identity is governed in large part by gene transcription programs, which are determined by regulatory elements encoded in DNA. To identify regulatory elements active in seven cell lines representative of diverse human cell types, we used DNase-seq and FAIRE-seq (Formaldehyde Assisted Isolation of Regulatory Elements) to map “open chromatin.” Over 870,000 DNaseI or FAIRE sites, which correspond tightly to nucleosome-depleted regions, were identified across the seven cell lines, covering nearly 9% of the genome. The combination of DNaseI and FAIRE is more effective than either assay alone in identifying likely regulatory elements, as judged by coincidence with transcription factor binding locations determined in the same cells. Open chromatin common to all seven cell types tended to be at or near transcription start sites and to be coincident with CTCF binding sites, while open chromatin sites found in only one cell type were typically located away from transcription start sites and contained DNA motifs recognized by regulators of cell-type identity. We show that open chromatin regions bound by CTCF are potent insulators. We identified clusters of open regulatory elements (COREs) that were physically near each other and whose appearance was coordinated among one or more cell types. Gene expression and RNA Pol II binding data support the hypothesis that COREs control gene activity required for the maintenance of cell-type identity. This publicly available atlas of regulatory elements may prove valuable in identifying noncoding DNA sequence variants that are causally linked to human disease. PMID:21750106

  19. The nucleotides responsible for the direct physical contact between the chromatin insulator protein CTCF and the H19 imprinting control region manifest parent of origin-specific long-distance insulation and methylation-free domains

    PubMed Central

    Pant, Vinod; Mariano, Piero; Kanduri, Chandrasekhar; Mattsson, Anita; Lobanenkov, Victor; Heuchel, Rainer; Ohlsson, Rolf

    2003-01-01

    The repression of the maternally inherited Igf2 allele has been proposed to depend on a methylation-sensitive chromatin insulator organized by the 11 zinc finger protein CTCF at the H19 imprinting control region (ICR). Here we document that point mutations of the nucleotides in physical contact with CTCF within the endogenous H19 ICR lead to loss of CTCF binding and Igf2 imprinting only when passaged through the female germline. This effect is accompanied by a significant loss of methylation protection of the maternally derived H19 ICR. Because CTCF interacts with other imprinting control regions, it emerges as a central factor responsible for interpreting and propagating gamete-derived epigenetic marks and for organizing epigenetically controlled expression domains. PMID:12629040

  20. MeCP2 regulates Tet1-catalyzed demethylation, CTCF binding, and learning-dependent alternative splicing of the BDNF gene in Turtle

    PubMed Central

    Zheng, Zhaoqing; Ambigapathy, Ganesh; Keifer, Joyce

    2017-01-01

    MECP2 mutations underlying Rett syndrome cause widespread misregulation of gene expression. Functions for MeCP2 other than transcriptional are not well understood. In an ex vivo brain preparation from the pond turtle Trachemys scripta elegans, an intraexonic splicing event in the brain-derived neurotrophic factor (BDNF) gene generates a truncated mRNA transcript in naïve brain that is suppressed upon classical conditioning. MeCP2 and its partners, splicing factor Y-box binding protein 1 (YB-1) and methylcytosine dioxygenase 1 (Tet1), bind to BDNF chromatin in naïve but dissociate during conditioning; the dissociation correlating with decreased DNA methylation. Surprisingly, conditioning results in new occupancy of BDNF chromatin by DNA insulator protein CCCTC-binding factor (CTCF), which is associated with suppression of splicing in conditioning. Knockdown of MeCP2 shows it is instrumental for splicing and inhibits Tet1 and CTCF binding thereby negatively impacting DNA methylation and conditioning-dependent splicing regulation. Thus, mutations in MECP2 can have secondary effects on DNA methylation and alternative splicing. DOI: http://dx.doi.org/10.7554/eLife.25384.001 PMID:28594324

  1. CTCF-Mediated and Pax6-Associated Gene Expression in Corneal Epithelial Cell-Specific Differentiation

    PubMed Central

    Tsui, Shanli; Wang, Jie; Wang, Ling; Dai, Wei; Lu, Luo

    2016-01-01

    Background The purpose of the study is to elicit the epigenetic mechanism involving CCCTC binding factor (CTCF)-mediated chromatin remodeling that regulates PAX6 gene interaction with differentiation-associated genes to control corneal epithelial differentiation. Methods Cell cycle progression and specific keratin expressions were measured to monitor changes of differentiation-induced primary human limbal stem/progenitor (HLS/P), human corneal epithelial (HCE) and human telomerase-immortalized corneal epithelial (HTCE) cells. PAX6-interactive and differentiation-associated genes in chromatin remodeling mediated by the epigenetic factor CTCF were detected by circular chromosome conformation capture (4C) and ChIP (Chromatin immunoprecipitation)-on-chip approaches, and verified by FISH (Fluorescent in situ hybridization). Furthermore, CTCF activities were altered by CTCF-shRNA to study the effect of CTCF on mediating interaction of Pax6 and differentiation-associated genes in corneal epithelial cell fate. Results Our results demonstrated that differentiation-induced human corneal epithelial cells expressed typical corneal epithelial characteristics including morphological changes, increased keratin12 expression and G0/G1 accumulations. Expressions of CTCF and PAX6 were suppressed and elevated following the process of differentiation, respectively. During corneal epithelial cell differentiation, differentiation-induced RCN1 and ADAM17 were found interacting with PAX6 in the process of CTCF-mediated chromatin remodeling detected by 4C and verified by ChIP-on-chip and FISH. Diminished CTCF mRNA with CTCF-shRNA in HTCE cells weakened the interaction of PAX6 gene in controlling RCN1/ADAM17 and enhanced early onset of the genes in cell differentiation. Conclusion Our results explain how epigenetic factor CTCF-mediated chromatin remodeling regulates interactions between eye-specific PAX6 and those genes that are induced/associated with cell differentiation to modulate corneal epithelial cell-specific differentiation. PMID:27583466

  2. Insulated Foamy Viral Vectors

    PubMed Central

    Browning, Diana L.; Collins, Casey P.; Hocum, Jonah D.; Leap, David J.; Rae, Dustin T.; Trobridge, Grant D.

    2016-01-01

    Retroviral vector-mediated gene therapy is promising, but genotoxicity has limited its use in the clinic. Genotoxicity is highly dependent on the retroviral vector used, and foamy viral (FV) vectors appear relatively safe. However, internal promoters may still potentially activate nearby genes. We developed insulated FV vectors, using four previously described insulators: a version of the well-studied chicken hypersensitivity site 4 insulator (650cHS4), two synthetic CCCTC-binding factor (CTCF)-based insulators, and an insulator based on the CCAAT box-binding transcription factor/nuclear factor I (7xCTF/NF1). We directly compared these insulators for enhancer-blocking activity, effect on FV vector titer, and fidelity of transfer to both proviral long terminal repeats. The synthetic CTCF-based insulators had the strongest insulating activity, but reduced titers significantly. The 7xCTF/NF1 insulator did not reduce titers but had weak insulating activity. The 650cHS4-insulated FV vector was identified as the overall most promising vector. Uninsulated and 650cHS4-insulated FV vectors were both significantly less genotoxic than gammaretroviral vectors. Integration sites were evaluated in cord blood CD34+ cells and the 650cHS4-insulated FV vector had fewer hotspots compared with an uninsulated FV vector. These data suggest that insulated FV vectors are promising for hematopoietic stem cell gene therapy. PMID:26715244

  3. Long noncoding RNA HOTTIP cooperates with CCCTC-binding factor to coordinate HOXA gene expression.

    PubMed

    Wang, Feng; Tang, Zhongqiong; Shao, Honglian; Guo, Jun; Tan, Tao; Dong, Yang; Lin, Lianbing

    2018-06-12

    The spatiotemporal control of HOX gene expression is dependent on positional identity and often correlated to their genomic location within each loci. Maintenance of HOX expression patterns is under complex transcriptional and epigenetic regulation, which is not well understood. Here we demonstrate that HOTTIP, a lincRNA transcribed from the 5' edge of the HOXA locus, physically associates with the CCCTC-binding factor (CTCF) that serves as an insulator by organizing HOXA cluster into disjoint domains, to cooperatively maintain the chromatin modifications of HOXA genes and thus coordinate the transcriptional activation of distal HOXA genes in human foreskin fibroblasts. Our results reveal the functional connection of HOTTIP and CTCF, and shed light on lincRNAs in gene activation and CTCF mediated chromatin organization. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription.

    PubMed

    Tang, Zhonghui; Luo, Oscar Junhong; Li, Xingwang; Zheng, Meizhen; Zhu, Jacqueline Jufen; Szalaj, Przemyslaw; Trzaskoma, Pawel; Magalska, Adriana; Wlodarczyk, Jakub; Ruszczycki, Blazej; Michalski, Paul; Piecuch, Emaly; Wang, Ping; Wang, Danjuan; Tian, Simon Zhongyuan; Penrad-Mobayed, May; Sachs, Laurent M; Ruan, Xiaoan; Wei, Chia-Lin; Liu, Edison T; Wilczynski, Grzegorz M; Plewczynski, Dariusz; Li, Guoliang; Ruan, Yijun

    2015-12-17

    Spatial genome organization and its effect on transcription remains a fundamental question. We applied an advanced chromatin interaction analysis by paired-end tag sequencing (ChIA-PET) strategy to comprehensively map higher-order chromosome folding and specific chromatin interactions mediated by CCCTC-binding factor (CTCF) and RNA polymerase II (RNAPII) with haplotype specificity and nucleotide resolution in different human cell lineages. We find that CTCF/cohesin-mediated interaction anchors serve as structural foci for spatial organization of constitutive genes concordant with CTCF-motif orientation, whereas RNAPII interacts within these structures by selectively drawing cell-type-specific genes toward CTCF foci for coordinated transcription. Furthermore, we show that haplotype variants and allelic interactions have differential effects on chromosome configuration, influencing gene expression, and may provide mechanistic insights into functions associated with disease susceptibility. 3D genome simulation suggests a model of chromatin folding around chromosomal axes, where CTCF is involved in defining the interface between condensed and open compartments for structural regulation. Our 3D genome strategy thus provides unique insights in the topological mechanism of human variations and diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

  5. De novo mutations in the genome organizer CTCF cause intellectual disability.

    PubMed

    Gregor, Anne; Oti, Martin; Kouwenhoven, Evelyn N; Hoyer, Juliane; Sticht, Heinrich; Ekici, Arif B; Kjaergaard, Susanne; Rauch, Anita; Stunnenberg, Hendrik G; Uebe, Steffen; Vasileiou, Georgia; Reis, André; Zhou, Huiqing; Zweier, Christiane

    2013-07-11

    An increasing number of genes involved in chromatin structure and epigenetic regulation has been implicated in a variety of developmental disorders, often including intellectual disability. By trio exome sequencing and subsequent mutational screening we now identified two de novo frameshift mutations and one de novo missense mutation in CTCF in individuals with intellectual disability, microcephaly, and growth retardation. Furthermore, an individual with a larger deletion including CTCF was identified. CTCF (CCCTC-binding factor) is one of the most important chromatin organizers in vertebrates and is involved in various chromatin regulation processes such as higher order of chromatin organization, enhancer function, and maintenance of three-dimensional chromatin structure. Transcriptome analyses in all three individuals with point mutations revealed deregulation of genes involved in signal transduction and emphasized the role of CTCF in enhancer-driven expression of genes. Our findings indicate that haploinsufficiency of CTCF affects genomic interaction of enhancers and their regulated gene promoters that drive developmental processes and cognition. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  6. The insulation of genes from external enhancers and silencing chromatin

    PubMed Central

    Burgess-Beusse, Bonnie; Farrell, Catherine; Gaszner, Miklos; Litt, Michael; Mutskov, Vesco; Recillas-Targa, Felix; Simpson, Melanie; West, Adam; Felsenfeld, Gary

    2002-01-01

    Insulators are DNA sequence elements that can serve in some cases as barriers to protect a gene against the encroachment of adjacent inactive condensed chromatin. Some insulators also can act as blocking elements to protect against the activating influence of distal enhancers associated with other genes. Although most of the insulators identified so far derive from Drosophila, they also are found in vertebrates. An insulator at the 5′ end of the chicken β-globin locus marks a boundary between an open chromatin domain and a region of constitutively condensed chromatin. Detailed analysis of this element shows that it possesses both enhancer blocking activity and the ability to screen reporter genes against position effects. Enhancer blocking is associated with binding of the protein CTCF; sites that bind CTCF are found at other critical points in the genome. Protection against position effects involves other properties that appear to be associated with control of histone acetylation and methylation. Insulators thus are complex elements that can help to preserve the independent function of genes embedded in a genome in which they are surrounded by regulatory signals they must ignore. PMID:12154228

  7. Transcription factor profiling reveals molecular choreography and key regulators of human retrotransposon expression

    PubMed Central

    Sun, Xiaoji; Wang, Xuya; Tang, Zuojian; Grivainis, Mark; Kahler, David; Yun, Chi; Mita, Paolo; Fenyö, David

    2018-01-01

    Transposable elements (TEs) represent a substantial fraction of many eukaryotic genomes, and transcriptional regulation of these factors is important to determine TE activities in human cells. However, due to the repetitive nature of TEs, identifying transcription factor (TF)-binding sites from ChIP-sequencing (ChIP-seq) datasets is challenging. Current algorithms are focused on subtle differences between TE copies and thus bias the analysis to relatively old and inactive TEs. Here we describe an approach termed “MapRRCon” (mapping repeat reads to a consensus) which allows us to identify proteins binding to TE DNA sequences by mapping ChIP-seq reads to the TE consensus sequence after whole-genome alignment. Although this method does not assign binding sites to individual insertions in the genome, it provides a landscape of interacting TFs by capturing factors that bind to TEs under various conditions. We applied this method to screen TFs’ interaction with L1 in human cells/tissues using ENCODE ChIP-seq datasets and identified 178 of the 512 TFs tested as bound to L1 in at least one biological condition with most of them (138) localized to the promoter. Among these L1-binding factors, we focused on Myc and CTCF, as they play important roles in cancer progression and 3D chromatin structure formation. Furthermore, we explored the transcriptomes of The Cancer Genome Atlas breast and ovarian tumor samples in which a consistent anti-/correlation between L1 and Myc/CTCF expression was observed, suggesting that these two factors may play roles in regulating L1 transcription during the development of such tumors. PMID:29802231

  8. Successive gain of insulator proteins in arthropod evolution.

    PubMed

    Heger, Peter; George, Rebecca; Wiehe, Thomas

    2013-10-01

    Alteration of regulatory DNA elements or their binding proteins may have drastic consequences for morphological evolution. Chromatin insulators are one example of such proteins and play a fundamental role in organizing gene expression. While a single insulator protein, CTCF (CCCTC-binding factor), is known in vertebrates, Drosophila melanogaster utilizes six additional factors. We studied the evolution of these proteins and show here that-in contrast to the bilaterian-wide distribution of CTCF-all other D. melanogaster insulators are restricted to arthropods. The full set is present exclusively in the genus Drosophila whereas only two insulators, Su(Hw) and CTCF, existed at the base of the arthropod clade and all additional factors have been acquired successively at later stages. Secondary loss of factors in some lineages further led to the presence of different insulator subsets in arthropods. Thus, the evolution of insulator proteins within arthropods is an ongoing and dynamic process that reshapes and supplements the ancient CTCF-based system common to bilaterians. Expansion of insulator systems may therefore be a general strategy to increase an organism's gene regulatory repertoire and its potential for morphological plasticity. © 2013 The Authors. Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  9. CTCF knockout reveals an essential role for this protein during the zebrafish development.

    PubMed

    Carmona-Aldana, Francisco; Zampedri, Cecilia; Suaste-Olmos, Fernando; Murillo-de-Ozores, Adrián; Guerrero, Georgina; Arzate-Mejía, Rodrigo; Maldonado, Ernesto; Navarro, Rosa; Chimal-Monroy, Jesús; Recillas-Targa, Félix

    2018-05-01

    Chromatin regulation and organization are essential processes that regulate gene activity. The CCCTC-binding factor (CTCF) is a protein with different and important molecular functions related with chromatin dynamics. It is conserved since invertebrates to vertebrates, posing it as a factor with an important role in the physiology. In this work, we aimed to understand the distribution and functional relevance of CTCF during the embryonic development of the zebrafish (Danio rerio). We generated a zebrafish specific anti-Ctcf antibody, and found this protein to be ubiquitous, through different stages and tissues. We used the CRISPR-Cas9 system to induce molecular alterations in the locus. This resulted in early lethality. We delayed the lethality performing knockdown morpholino experiments, and found an aberrant embryo morphology involving malformations in structures through all the length of the embryo. These phenotypes were rescued with human CTCF mRNA injections, showing the specificity of the morpholinos and a partial functional conservation between the fish and the human proteins. Lastly, we found that the pro-apoptotic genes p53 and bbc3/PUMA are deregulated in the ctcf morpholino-injected embryos. In conclusion, CTCF is a ubiquitous factor during the zebrafish development, which regulates the correct formation of different structures of the embryo, and its deregulation impacts on essential cell survival genes. Overall, this work provides a basis to look for the particular functions of CTCF in the different developing tissues and organs of the zebrafish. Copyright © 2018. Published by Elsevier B.V.

  10. Genome-wide DNase hypersensitivity, and occupancy of RUNX2 and CTCF reveal a highly dynamic gene regulome during MC3T3 pre-osteoblast differentiation.

    PubMed

    Tai, Phillip W L; Wu, Hai; van Wijnen, André J; Stein, Gary S; Stein, Janet L; Lian, Jane B

    2017-01-01

    The ability to discover regulatory sequences that control bone-related genes during development has been greatly improved by massively parallel sequencing methodologies. To expand our understanding of cis-regulatory regions critical to the control of gene expression during osteoblastogenesis, we probed the presence of open chromatin states across the osteoblast genome using global DNase hypersensitivity (DHS) mapping. Our profiling of MC3T3 mouse pre-osteoblasts during differentiation has identified more than 224,000 unique DHS sites. Approximately 65% of these sites are dynamic during temporal stages of osteoblastogenesis, and a majority of them are located within non-promoter (intergenic and intronic) regions. Nearly half of all DHS sites (both constitutive and dynamic) overlap binding events of the bone-essential RUNX2 and/or the chromatin-related CTCF transcription factors. This finding reinforces the role of these regulatory proteins as essential components of the bone gene regulome. We observe a reduction in chromatin accessibility throughout the genome between pre-osteoblast and early osteoblasts. Our analysis also defined a class of differentially expressed genes that harbor DHS peaks centered within 1 kb downstream of transcriptional end sites (TES). These DHSs at the 3'-flanks of genes exhibit dynamic changes during differentiation that may impact regulation of the osteoblast genome. Taken together, the distribution of DHS regions within non-promoter locations harboring osteoblast and chromatin related transcription factor binding motifs, reflect novel cis-regulatory requirements to support temporal gene expression in differentiating osteoblasts.

  11. Orientation-dependent interaction between Drosophila insulators is a property of this class of regulatory elements

    PubMed Central

    Kyrchanova, Olga; Chetverina, Darya; Maksimenko, Oksana; Kullyev, Andrey; Georgiev, Pavel

    2008-01-01

    Insulators are defined as a class of regulatory elements that delimit independent transcriptional domains within eukaryotic genomes. According to previous data, an interaction (pairing) between some Drosophila insulators can support distant activation of a promoter by an enhancer. Here, we have demonstrated that pairs of well-studied insulators such as scs–scs, scs’–scs’, 1A2–1A2 and Wari–Wari support distant activation of the white promoter by the yeast GAL4 activator in an orientation-dependent manner. The same is true for the efficiency of the enhancer that stimulates white expression in the eyes. In all insulator pairs tested, stimulation of the white gene was stronger when insulators were inserted between the eye enhancer or GAL4 and the white promoter in opposite orientations relative to each other. As shown previously, Zw5, Su(Hw) and dCTCF proteins are required for the functioning of different insulators that do not interact with each other. Here, strong functional interactions have been revealed between DNA fragments containing binding sites for either Zw5 or Su(Hw) or dCTCF protein but not between heterologous binding sites [Zw5–Su(Hw), dCTCF–Su(Hw), or dCTCF–Zw5]. These results suggest that insulator proteins can support selective interactions between distant regulatory elements. PMID:18987002

  12. Architectural roles of multiple chromatin insulators at the human apolipoprotein gene cluster

    PubMed Central

    Mishiro, Tsuyoshi; Ishihara, Ko; Hino, Shinjiro; Tsutsumi, Shuichi; Aburatani, Hiroyuki; Shirahige, Katsuhiko; Kinoshita, Yoshikazu; Nakao, Mitsuyoshi

    2009-01-01

    Long-range regulatory elements and higher-order chromatin structure coordinate the expression of multiple genes in cluster, and CTCF/cohesin-mediated chromatin insulator may be a key in this regulation. The human apolipoprotein (APO) A1/C3/A4/A5 gene region, whose alterations increase the risk of dyslipidemia and atherosclerosis, is partitioned at least by three CTCF-enriched sites and three cohesin protein RAD21-enriched sites (two overlap with the CTCF sites), resulting in the formation of two transcribed chromatin loops by interactions between insulators. The C3 enhancer and APOC3/A4/A5 promoters reside in the same loop, where the APOC3/A4 promoters are pointed towards the C3 enhancer, whereas the APOA1 promoter is present in the different loop. The depletion of either CTCF or RAD21 disrupts the chromatin loop structure, together with significant changes in the APO expression and the localization of transcription factor hepatocyte nuclear factor (HNF)-4α and transcriptionally active form of RNA polymerase II at the APO promoters. Thus, CTCF/cohesin-mediated insulators maintain the chromatin loop formation and the localization of transcriptional apparatus at the promoters, suggesting an essential role of chromatin insulation in controlling the expression of clustered genes. PMID:19322193

  13. CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart.

    PubMed

    Gomez-Velazquez, Melisa; Badia-Careaga, Claudio; Lechuga-Vieco, Ana Victoria; Nieto-Arellano, Rocio; Tena, Juan J; Rollan, Isabel; Alvarez, Alba; Torroja, Carlos; Caceres, Eva F; Roy, Anna R; Galjart, Niels; Delgado-Olguin, Paul; Sanchez-Cabo, Fatima; Enriquez, Jose Antonio; Gomez-Skarmeta, Jose Luis; Manzanares, Miguel

    2017-08-01

    Cardiac progenitors are specified early in development and progressively differentiate and mature into fully functional cardiomyocytes. This process is controlled by an extensively studied transcriptional program. However, the regulatory events coordinating the progression of such program from development to maturation are largely unknown. Here, we show that the genome organizer CTCF is essential for cardiogenesis and that it mediates genomic interactions to coordinate cardiomyocyte differentiation and maturation in the developing heart. Inactivation of Ctcf in cardiac progenitor cells and their derivatives in vivo during development caused severe cardiac defects and death at embryonic day 12.5. Genome wide expression analysis in Ctcf mutant hearts revealed that genes controlling mitochondrial function and protein production, required for cardiomyocyte maturation, were upregulated. However, mitochondria from mutant cardiomyocytes do not mature properly. In contrast, multiple development regulatory genes near predicted heart enhancers, including genes in the IrxA cluster, were downregulated in Ctcf mutants, suggesting that CTCF promotes cardiomyocyte differentiation by facilitating enhancer-promoter interactions. Accordingly, loss of CTCF disrupts gene expression and chromatin interactions as shown by chromatin conformation capture followed by deep sequencing. Furthermore, CRISPR-mediated deletion of an intergenic CTCF site within the IrxA cluster alters gene expression in the developing heart. Thus, CTCF mediates local regulatory interactions to coordinate transcriptional programs controlling transitions in morphology and function during heart development.

  14. CTCF counter-regulates cardiomyocyte development and maturation programs in the embryonic heart

    PubMed Central

    Gomez-Velazquez, Melisa; Badia-Careaga, Claudio; Lechuga-Vieco, Ana Victoria; Nieto-Arellano, Rocio; Rollan, Isabel; Alvarez, Alba; Torroja, Carlos; Caceres, Eva F.; Roy, Anna R.; Galjart, Niels; Sanchez-Cabo, Fatima; Enriquez, Jose Antonio; Gomez-Skarmeta, Jose Luis

    2017-01-01

    Cardiac progenitors are specified early in development and progressively differentiate and mature into fully functional cardiomyocytes. This process is controlled by an extensively studied transcriptional program. However, the regulatory events coordinating the progression of such program from development to maturation are largely unknown. Here, we show that the genome organizer CTCF is essential for cardiogenesis and that it mediates genomic interactions to coordinate cardiomyocyte differentiation and maturation in the developing heart. Inactivation of Ctcf in cardiac progenitor cells and their derivatives in vivo during development caused severe cardiac defects and death at embryonic day 12.5. Genome wide expression analysis in Ctcf mutant hearts revealed that genes controlling mitochondrial function and protein production, required for cardiomyocyte maturation, were upregulated. However, mitochondria from mutant cardiomyocytes do not mature properly. In contrast, multiple development regulatory genes near predicted heart enhancers, including genes in the IrxA cluster, were downregulated in Ctcf mutants, suggesting that CTCF promotes cardiomyocyte differentiation by facilitating enhancer-promoter interactions. Accordingly, loss of CTCF disrupts gene expression and chromatin interactions as shown by chromatin conformation capture followed by deep sequencing. Furthermore, CRISPR-mediated deletion of an intergenic CTCF site within the IrxA cluster alters gene expression in the developing heart. Thus, CTCF mediates local regulatory interactions to coordinate transcriptional programs controlling transitions in morphology and function during heart development. PMID:28846746

  15. Ectopically tethered CP190 induces large-scale chromatin decondensation

    NASA Astrophysics Data System (ADS)

    Ahanger, Sajad H.; Günther, Katharina; Weth, Oliver; Bartkuhn, Marek; Bhonde, Ramesh R.; Shouche, Yogesh S.; Renkawitz, Rainer

    2014-01-01

    Insulator mediated alteration in higher-order chromatin and/or nucleosome organization is an important aspect of epigenetic gene regulation. Recent studies have suggested a key role for CP190 in such processes. In this study, we analysed the effects of ectopically tethered insulator factors on chromatin structure and found that CP190 induces large-scale decondensation when targeted to a condensed lacO array in mammalian and Drosophila cells. In contrast, dCTCF alone, is unable to cause such a decondensation, however, when CP190 is present, dCTCF recruits it to the lacO array and mediates chromatin unfolding. The CP190 induced opening of chromatin may not be correlated with transcriptional activation, as binding of CP190 does not enhance luciferase activity in reporter assays. We propose that CP190 may mediate histone modification and chromatin remodelling activity to induce an open chromatin state by its direct recruitment or targeting by a DNA binding factor such as dCTCF.

  16. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    NASA Astrophysics Data System (ADS)

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf, Yvonne N.

    2017-02-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin.

  17. Genome-wide DNA methylation reprogramming in response to inorganic arsenic links inhibition of CTCF binding, DNMT expression and cellular transformation

    PubMed Central

    Rea, Matthew; Eckstein, Meredith; Eleazer, Rebekah; Smith, Caroline; Fondufe-Mittendorf , Yvonne N.

    2017-01-01

    Chronic low dose inorganic arsenic (iAs) exposure leads to changes in gene expression and epithelial-to-mesenchymal transformation. During this transformation, cells adopt a fibroblast-like phenotype accompanied by profound gene expression changes. While many mechanisms have been implicated in this transformation, studies that focus on the role of epigenetic alterations in this process are just emerging. DNA methylation controls gene expression in physiologic and pathologic states. Several studies show alterations in DNA methylation patterns in iAs-mediated pathogenesis, but these studies focused on single genes. We present a comprehensive genome-wide DNA methylation analysis using methyl-sequencing to measure changes between normal and iAs-transformed cells. Additionally, these differential methylation changes correlated positively with changes in gene expression and alternative splicing. Interestingly, most of these differentially methylated genes function in cell adhesion and communication pathways. To gain insight into how genomic DNA methylation patterns are regulated during iAs-mediated carcinogenesis, we show that iAs probably targets CTCF binding at the promoter of DNA methyltransferases, regulating their expression. These findings reveal how CTCF binding regulates DNA methyltransferase to reprogram the methylome in response to an environmental toxin. PMID:28150704

  18. Bioinformatics Identification of Modules of Transcription Factor Binding Sites in Alzheimer's Disease-Related Genes by In Silico Promoter Analysis and Microarrays

    PubMed Central

    Augustin, Regina; Lichtenthaler, Stefan F.; Greeff, Michael; Hansen, Jens; Wurst, Wolfgang; Trümbach, Dietrich

    2011-01-01

    The molecular mechanisms and genetic risk factors underlying Alzheimer's disease (AD) pathogenesis are only partly understood. To identify new factors, which may contribute to AD, different approaches are taken including proteomics, genetics, and functional genomics. Here, we used a bioinformatics approach and found that distinct AD-related genes share modules of transcription factor binding sites, suggesting a transcriptional coregulation. To detect additional coregulated genes, which may potentially contribute to AD, we established a new bioinformatics workflow with known multivariate methods like support vector machines, biclustering, and predicted transcription factor binding site modules by using in silico analysis and over 400 expression arrays from human and mouse. Two significant modules are composed of three transcription factor families: CTCF, SP1F, and EGRF/ZBPF, which are conserved between human and mouse APP promoter sequences. The specific combination of in silico promoter and multivariate analysis can identify regulation mechanisms of genes involved in multifactorial diseases. PMID:21559189

  19. Tissue- and age-specific DNA replication patterns at the CTG/CAG-expanded human myotonic dystrophy type 1 locus.

    PubMed

    Cleary, John D; Tomé, Stéphanie; López Castel, Arturo; Panigrahi, Gagan B; Foiry, Laurent; Hagerman, Katharine A; Sroka, Hana; Chitayat, David; Gourdon, Geneviève; Pearson, Christopher E

    2010-09-01

    Myotonic dystrophy, caused by DM1 CTG/CAG repeat expansions, shows varying instability levels between tissues and across ages within patients. We determined DNA replication profiles at the DM1 locus in patient fibroblasts and tissues from DM1 transgenic mice of various ages showing different instability. In patient cells, the repeat is flanked by two replication origins demarcated by CTCF sites, with replication diminished at the expansion. In mice, the expansion replicated from only the downstream origin (CAG as lagging template). In testes from mice of three different ages, replication toward the repeat paused at the earliest age and was relieved at later ages-coinciding with increased instability. Brain, pancreas and thymus replication varied with CpG methylation at DM1 CTCF sites. CTCF sites between progressing forks and repeats reduced replication depending on chromatin. Thus, varying replication progression may affect tissue- and age-specific repeat instability.

  20. A Novel Pathway Links Oxidative Stress to Loss of Insulin Growth Factor-2 (IGF2) Imprinting through NF-κB Activation

    PubMed Central

    Yang, Bing; Wagner, Jennifer; Damaschke, Nathan; Yao, Tianyu; Wuerzberger-Davis, Shelly M.; Lee, Moon-Hee; Svaren, John; Miyamoto, Shigeki; Jarrard, David F.

    2014-01-01

    Genomic imprinting is the allele-specific expression of a gene based on parental origin. Loss of imprinting(LOI) of Insulin-like Growth Factor 2 (IGF2) during aging is important in tumorigenesis, yet the regulatory mechanisms driving this event are largely unknown. In this study oxidative stress, measured by increased NF-κB activity, induces LOI in both cancerous and noncancerous human prostate cells. Decreased expression of the enhancer-blocking element CCCTC-binding factor(CTCF) results in reduced binding of CTCF to the H19-ICR (imprint control region), a major factor in the allelic silencing of IGF2. This ICR then develops increased DNA methylation. Assays identify a recruitment of the canonical pathway proteins NF-κB p65 and p50 to the CTCF promoter associated with the co-repressor HDAC1 explaining gene repression. An IκBα super-repressor blocks oxidative stress-induced activation of NF-κB and IGF2 imprinting is maintained. In vivo experiments using IκBα mutant mice with continuous NF-κB activation demonstrate increased IGF2 LOI further confirming a central role for canonical NF-κB signaling. We conclude CTCF plays a central role in mediating the effects of NF-κB activation that result in altered imprinting both in vitro and in vivo. This novel finding connects inflammation found in aging prostate tissues with the altered epigenetic landscape. PMID:24558376

  1. Characteristics of functional enrichment and gene expression level of human putative transcriptional target genes.

    PubMed

    Osato, Naoki

    2018-01-19

    Transcriptional target genes show functional enrichment of genes. However, how many and how significantly transcriptional target genes include functional enrichments are still unclear. To address these issues, I predicted human transcriptional target genes using open chromatin regions, ChIP-seq data and DNA binding sequences of transcription factors in databases, and examined functional enrichment and gene expression level of putative transcriptional target genes. Gene Ontology annotations showed four times larger numbers of functional enrichments in putative transcriptional target genes than gene expression information alone, independent of transcriptional target genes. To compare the number of functional enrichments of putative transcriptional target genes between cells or search conditions, I normalized the number of functional enrichment by calculating its ratios in the total number of transcriptional target genes. With this analysis, native putative transcriptional target genes showed the largest normalized number of functional enrichments, compared with target genes including 5-60% of randomly selected genes. The normalized number of functional enrichments was changed according to the criteria of enhancer-promoter interactions such as distance from transcriptional start sites and orientation of CTCF-binding sites. Forward-reverse orientation of CTCF-binding sites showed significantly higher normalized number of functional enrichments than the other orientations. Journal papers showed that the top five frequent functional enrichments were related to the cellular functions in the three cell types. The median expression level of transcriptional target genes changed according to the criteria of enhancer-promoter assignments (i.e. interactions) and was correlated with the changes of the normalized number of functional enrichments of transcriptional target genes. Human putative transcriptional target genes showed significant functional enrichments. Functional enrichments were related to the cellular functions. The normalized number of functional enrichments of human putative transcriptional target genes changed according to the criteria of enhancer-promoter assignments and correlated with the median expression level of the target genes. These analyses and characters of human putative transcriptional target genes would be useful to examine the criteria of enhancer-promoter assignments and to predict the novel mechanisms and factors such as DNA binding proteins and DNA sequences of enhancer-promoter interactions.

  2. Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes

    PubMed Central

    Thybert, David; Roller, Maša; Navarro, Fábio C.P.; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C.; Laukaitis, Christina M.; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A.; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J.; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M.; Odom, Duncan T.; Flicek, Paul

    2018-01-01

    Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli, which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. PMID:29563166

  3. An integrated model for detecting significant chromatin interactions from high-resolution Hi-C data

    PubMed Central

    Carty, Mark; Zamparo, Lee; Sahin, Merve; González, Alvaro; Pelossof, Raphael; Elemento, Olivier; Leslie, Christina S.

    2017-01-01

    Here we present HiC-DC, a principled method to estimate the statistical significance (P values) of chromatin interactions from Hi-C experiments. HiC-DC uses hurdle negative binomial regression account for systematic sources of variation in Hi-C read counts—for example, distance-dependent random polymer ligation and GC content and mappability bias—and model zero inflation and overdispersion. Applied to high-resolution Hi-C data in a lymphoblastoid cell line, HiC-DC detects significant interactions at the sub-topologically associating domain level, identifying potential structural and regulatory interactions supported by CTCF binding sites, DNase accessibility, and/or active histone marks. CTCF-associated interactions are most strongly enriched in the middle genomic distance range (∼700 kb–1.5 Mb), while interactions involving actively marked DNase accessible elements are enriched both at short (<500 kb) and longer (>1.5 Mb) genomic distances. There is a striking enrichment of longer-range interactions connecting replication-dependent histone genes on chromosome 6, potentially representing the chromatin architecture at the histone locus body. PMID:28513628

  4. Spatial enhancer clustering and regulation of enhancer-proximal genes by cohesin

    PubMed Central

    Ing-Simmons, Elizabeth; Seitan, Vlad C.; Faure, Andre J.; Flicek, Paul; Carroll, Thomas; Dekker, Job; Fisher, Amanda G.; Lenhard, Boris

    2015-01-01

    In addition to mediating sister chromatid cohesion during the cell cycle, the cohesin complex associates with CTCF and with active gene regulatory elements to form long-range interactions between its binding sites. Genome-wide chromosome conformation capture had shown that cohesin's main role in interphase genome organization is in mediating interactions within architectural chromosome compartments, rather than specifying compartments per se. However, it remains unclear how cohesin-mediated interactions contribute to the regulation of gene expression. We have found that the binding of CTCF and cohesin is highly enriched at enhancers and in particular at enhancer arrays or “super-enhancers” in mouse thymocytes. Using local and global chromosome conformation capture, we demonstrate that enhancer elements associate not just in linear sequence, but also in 3D, and that spatial enhancer clustering is facilitated by cohesin. The conditional deletion of cohesin from noncycling thymocytes preserved enhancer position, H3K27ac, H4K4me1, and enhancer transcription, but weakened interactions between enhancers. Interestingly, ∼50% of deregulated genes reside in the vicinity of enhancer elements, suggesting that cohesin regulates gene expression through spatial clustering of enhancer elements. We propose a model for cohesin-dependent gene regulation in which spatial clustering of enhancer elements acts as a unified mechanism for both enhancer-promoter “connections” and “insulation.” PMID:25677180

  5. Distinct Roles of Chromatin Insulator Proteins in Control of the Drosophila Bithorax Complex

    PubMed Central

    Savitsky, Mikhail; Kim, Maria; Kravchuk, Oksana; Schwartz, Yuri B.

    2016-01-01

    Chromatin insulators are remarkable regulatory elements that can bring distant genomic sites together and block unscheduled enhancer–promoter communications. Insulators act via associated insulator proteins of two classes: sequence-specific DNA binding factors and “bridging” proteins. The latter are required to mediate interactions between distant insulator elements. Chromatin insulators are critical for correct expression of complex loci; however, their mode of action is poorly understood. Here, we use the Drosophila bithorax complex as a model to investigate the roles of the bridging proteins Cp190 and Mod(mdg4). The bithorax complex consists of three evolutionarily conserved homeotic genes Ubx, abd-A, and Abd-B, which specify anterior–posterior identity of the last thoracic and all abdominal segments of the fly. Looking at effects of CTCF, mod(mdg4), and Cp190 mutations on expression of the bithorax complex genes, we provide the first functional evidence that Mod(mdg4) acts in concert with the DNA binding insulator protein CTCF. We find that Mod(mdg4) and Cp190 are not redundant and may have distinct functional properties. We, for the first time, demonstrate that Cp190 is critical for correct regulation of the bithorax complex and show that Cp190 is required at an exceptionally strong Fub insulator to partition the bithorax complex into two topological domains. PMID:26715665

  6. Luminal lncRNAs Regulation by ERα-Controlled Enhancers in a Ligand-Independent Manner in Breast Cancer Cells

    PubMed Central

    Miano, Valentina; Rosti, Valentina; Manitta, Eleonora; Elhasnaoui, Jamal; Basile, Giulia

    2018-01-01

    Estrogen receptor-α (ERα) is a ligand-inducible protein which mediates estrogenic hormones signaling and defines the luminal BC phenotype. Recently, we demonstrated that even in absence of ligands ERα (apoERα) binds chromatin sites where it regulates transcription of several protein-coding and lncRNA genes. Noteworthy, apoERα-regulated lncRNAs marginally overlap estrogen-induced transcripts, thus representing a new signature of luminal BC genes. By the analysis of H3K27ac enrichment in hormone-deprived MCF-7 cells, we defined a set of Super Enhancers (SEs) occupied by apoERα, including one mapped in proximity of the DSCAM-AS1 lncRNA gene. This represents a paradigm of apoERα activity since its expression is largely unaffected by estrogenic treatment, despite the fact that E2 increases ERα binding on DSCAM-AS1 promoter. We validated the enrichment of apoERα, p300, GATA3, FoxM1 and CTCF at both DSCAM-AS1 TSS and at its associated SE by ChIP-qPCR. Furthermore, by analyzing MCF-7 ChIA-PET data and by 3C assays, we confirmed long range chromatin interaction between the SE and the DSCAM-AS1 TSS. Interestingly, CTCF and p300 binding showed an enrichment in hormone-depleted medium and in the presence of ERα, elucidating the dynamics of the estrogen-independent regulation of DSCAM-AS1 expression. The analysis of this lncRNA provides a paradigm of transcriptional regulation of a luminal specific apoERα regulated lncRNA. PMID:29462945

  7. Repeat associated mechanisms of genome evolution and function revealed by the Mus caroli and Mus pahari genomes.

    PubMed

    Thybert, David; Roller, Maša; Navarro, Fábio C P; Fiddes, Ian; Streeter, Ian; Feig, Christine; Martin-Galvez, David; Kolmogorov, Mikhail; Janoušek, Václav; Akanni, Wasiu; Aken, Bronwen; Aldridge, Sarah; Chakrapani, Varshith; Chow, William; Clarke, Laura; Cummins, Carla; Doran, Anthony; Dunn, Matthew; Goodstadt, Leo; Howe, Kerstin; Howell, Matthew; Josselin, Ambre-Aurore; Karn, Robert C; Laukaitis, Christina M; Jingtao, Lilue; Martin, Fergal; Muffato, Matthieu; Nachtweide, Stefanie; Quail, Michael A; Sisu, Cristina; Stanke, Mario; Stefflova, Klara; Van Oosterhout, Cock; Veyrunes, Frederic; Ward, Ben; Yang, Fengtang; Yazdanifar, Golbahar; Zadissa, Amonida; Adams, David J; Brazma, Alvis; Gerstein, Mark; Paten, Benedict; Pham, Son; Keane, Thomas M; Odom, Duncan T; Flicek, Paul

    2018-04-01

    Understanding the mechanisms driving lineage-specific evolution in both primates and rodents has been hindered by the lack of sister clades with a similar phylogenetic structure having high-quality genome assemblies. Here, we have created chromosome-level assemblies of the Mus caroli and Mus pahari genomes. Together with the Mus musculus and Rattus norvegicus genomes, this set of rodent genomes is similar in divergence times to the Hominidae (human-chimpanzee-gorilla-orangutan). By comparing the evolutionary dynamics between the Muridae and Hominidae, we identified punctate events of chromosome reshuffling that shaped the ancestral karyotype of Mus musculus and Mus caroli between 3 and 6 million yr ago, but that are absent in the Hominidae. Hominidae show between four- and sevenfold lower rates of nucleotide change and feature turnover in both neutral and functional sequences, suggesting an underlying coherence to the Muridae acceleration. Our system of matched, high-quality genome assemblies revealed how specific classes of repeats can play lineage-specific roles in related species. Recent LINE activity has remodeled protein-coding loci to a greater extent across the Muridae than the Hominidae, with functional consequences at the species level such as reproductive isolation. Furthermore, we charted a Muridae-specific retrotransposon expansion at unprecedented resolution, revealing how a single nucleotide mutation transformed a specific SINE element into an active CTCF binding site carrier specifically in Mus caroli , which resulted in thousands of novel, species-specific CTCF binding sites. Our results show that the comparison of matched phylogenetic sets of genomes will be an increasingly powerful strategy for understanding mammalian biology. © 2018 Thybert et al.; Published by Cold Spring Harbor Laboratory Press.

  8. Identification and analysis of pig chimeric mRNAs using RNA sequencing data

    PubMed Central

    2012-01-01

    Background Gene fusion is ubiquitous over the course of evolution. It is expected to increase the diversity and complexity of transcriptomes and proteomes through chimeric sequence segments or altered regulation. However, chimeric mRNAs in pigs remain unclear. Here we identified some chimeric mRNAs in pigs and analyzed the expression of them across individuals and breeds using RNA-sequencing data. Results The present study identified 669 putative chimeric mRNAs in pigs, of which 251 chimeric candidates were detected in a set of RNA-sequencing data. The 618 candidates had clear trans-splicing sites, 537 of which obeyed the canonical GU-AG splice rule. Only two putative pig chimera variants whose fusion junction was overlapped with that of a known human chimeric mRNA were found. A set of unique chimeric events were considered middle variances in the expression across individuals and breeds, and revealed non-significant variance between sexes. Furthermore, the genomic region of the 5′ partner gene shares a similar DNA sequence with that of the 3′ partner gene for 458 putative chimeric mRNAs. The 81 of those shared DNA sequences significantly matched the known DNA-binding motifs in the JASPAR CORE database. Four DNA motifs shared in parental genomic regions had significant similarity with known human CTCF binding sites. Conclusions The present study provided detailed information on some pig chimeric mRNAs. We proposed a model that trans-acting factors, such as CTCF, induced the spatial organisation of parental genes to the same transcriptional factory so that parental genes were coordinatively transcribed to give birth to chimeric mRNAs. PMID:22925561

  9. The active enhancer network operated by liganded RXR supports angiogenic activity in macrophages

    PubMed Central

    Daniel, Bence; Hah, Nasun; Horvath, Attila; Czimmerer, Zsolt; Poliska, Szilard; Gyuris, Tibor; Keirsse, Jiri; Gysemans, Conny; Van Ginderachter, Jo A.; Balint, Balint L.; Evans, Ronald M.; Barta, Endre; Nagy, Laszlo

    2014-01-01

    RXR signaling is predicted to have a major impact in macrophages, but neither the biological consequence nor the genomic basis of its ligand activation is known. Comprehensive genome-wide studies were carried out to map liganded RXR-mediated transcriptional changes, active binding sites, and cistromic interactions in the context of the macrophage genome architecture. The macrophage RXR cistrome has 5200 genomic binding sites, which are not impacted by ligand. Active enhancers are characterized by PU.1 binding, an increase of enhancer RNA, and P300 recruitment. Using these features, 387 liganded RXR-bound enhancers were linked to 226 genes, which predominantly reside in CTCF/cohesin-limited functional domains. These findings were molecularly validated using chromosome conformation capture (3C) and 3C combined with sequencing (3C-seq), and we show that selected long-range enhancers communicate with promoters via stable or RXR-induced loops and that some of the enhancers interact with each other, forming an interchromosomal network. A set of angiogenic genes, including Vegfa, has liganded RXR-controlled enhancers and provides the macrophage with a novel inducible program. PMID:25030696

  10. Loss of maternal CTCF is associated with peri-implantation lethality of Ctcf null embryos.

    PubMed

    Moore, James M; Rabaia, Natalia A; Smith, Leslie E; Fagerlie, Sara; Gurley, Kay; Loukinov, Dmitry; Disteche, Christine M; Collins, Steven J; Kemp, Christopher J; Lobanenkov, Victor V; Filippova, Galina N

    2012-01-01

    CTCF is a highly conserved, multifunctional zinc finger protein involved in critical aspects of gene regulation including transcription regulation, chromatin insulation, genomic imprinting, X-chromosome inactivation, and higher order chromatin organization. Such multifunctional properties of CTCF suggest an essential role in development. Indeed, a previous report on maternal depletion of CTCF suggested that CTCF is essential for pre-implantation development. To distinguish between the effects of maternal and zygotic expression of CTCF, we studied pre-implantation development in mice harboring a complete loss of function Ctcf knockout allele. Although we demonstrated that homozygous deletion of Ctcf is early embryonically lethal, in contrast to previous observations, we showed that the Ctcf nullizygous embryos developed up to the blastocyst stage (E3.5) followed by peri-implantation lethality (E4.5-E5.5). Moreover, one-cell stage Ctcf nullizygous embryos cultured ex vivo developed to the 16-32 cell stage with no obvious abnormalities. Using a single embryo assay that allowed both genotype and mRNA expression analyses of the same embryo, we demonstrated that pre-implantation development of the Ctcf nullizygous embryos was associated with the retention of the maternal wild type Ctcf mRNA. Loss of this stable maternal transcript was temporally associated with loss of CTCF protein expression, apoptosis of the developing embryo, and failure to further develop an inner cell mass and trophoectoderm ex vivo. This indicates that CTCF expression is critical to early embryogenesis and loss of its expression rapidly leads to apoptosis at a very early developmental stage. This is the first study documenting the presence of the stable maternal Ctcf transcript in the blastocyst stage embryos. Furthermore, in the presence of maternal CTCF, zygotic CTCF expression does not seem to be required for pre-implantation development.

  11. Functional Dissection of the Blocking and Bypass Activities of the Fab-8 Boundary in the Drosophila Bithorax Complex.

    PubMed

    Kyrchanova, Olga; Mogila, Vladic; Wolle, Daniel; Deshpande, Girish; Parshikov, Alexander; Cléard, Fabienne; Karch, Francois; Schedl, Paul; Georgiev, Pavel

    2016-07-01

    Functionally autonomous regulatory domains direct the parasegment-specific expression of the Drosophila Bithorax complex (BX-C) homeotic genes. Autonomy is conferred by boundary/insulator elements that separate each regulatory domain from its neighbors. For six of the nine parasegment (PS) regulatory domains in the complex, at least one boundary is located between the domain and its target homeotic gene. Consequently, BX-C boundaries must not only block adventitious interactions between neighboring regulatory domains, but also be permissive (bypass) for regulatory interactions between the domains and their gene targets. To elucidate how the BX-C boundaries combine these two contradictory activities, we have used a boundary replacement strategy. We show that a 337 bp fragment spanning the Fab-8 boundary nuclease hypersensitive site and lacking all but 83 bp of the 625 bp Fab-8 PTS (promoter targeting sequence) fully rescues a Fab-7 deletion. It blocks crosstalk between the iab-6 and iab-7 regulatory domains, and has bypass activity that enables the two downstream domains, iab-5 and iab-6, to regulate Abdominal-B (Abd-B) transcription in spite of two intervening boundary elements. Fab-8 has two dCTCF sites and we show that they are necessary both for blocking and bypass activity. However, CTCF sites on their own are not sufficient for bypass. While multimerized dCTCF (or Su(Hw)) sites have blocking activity, they fail to support bypass. Moreover, this bypass defect is not rescued by the full length PTS. Finally, we show that orientation is critical for the proper functioning the Fab-8 replacement. Though the inverted Fab-8 boundary still blocks crosstalk, it disrupts the topology of the Abd-B regulatory domains and does not support bypass. Importantly, altering the orientation of the Fab-8 dCTCF sites is not sufficient to disrupt bypass, indicating that orientation dependence is conferred by other factors.

  12. Functional Dissection of the Blocking and Bypass Activities of the Fab-8 Boundary in the Drosophila Bithorax Complex

    PubMed Central

    Wolle, Daniel; Deshpande, Girish; Parshikov, Alexander; Cléard, Fabienne; Karch, Francois; Schedl, Paul; Georgiev, Pavel

    2016-01-01

    Functionally autonomous regulatory domains direct the parasegment-specific expression of the Drosophila Bithorax complex (BX-C) homeotic genes. Autonomy is conferred by boundary/insulator elements that separate each regulatory domain from its neighbors. For six of the nine parasegment (PS) regulatory domains in the complex, at least one boundary is located between the domain and its target homeotic gene. Consequently, BX-C boundaries must not only block adventitious interactions between neighboring regulatory domains, but also be permissive (bypass) for regulatory interactions between the domains and their gene targets. To elucidate how the BX-C boundaries combine these two contradictory activities, we have used a boundary replacement strategy. We show that a 337 bp fragment spanning the Fab-8 boundary nuclease hypersensitive site and lacking all but 83 bp of the 625 bp Fab-8 PTS (promoter targeting sequence) fully rescues a Fab-7 deletion. It blocks crosstalk between the iab-6 and iab-7 regulatory domains, and has bypass activity that enables the two downstream domains, iab-5 and iab-6, to regulate Abdominal-B (Abd-B) transcription in spite of two intervening boundary elements. Fab-8 has two dCTCF sites and we show that they are necessary both for blocking and bypass activity. However, CTCF sites on their own are not sufficient for bypass. While multimerized dCTCF (or Su(Hw)) sites have blocking activity, they fail to support bypass. Moreover, this bypass defect is not rescued by the full length PTS. Finally, we show that orientation is critical for the proper functioning the Fab-8 replacement. Though the inverted Fab-8 boundary still blocks crosstalk, it disrupts the topology of the Abd-B regulatory domains and does not support bypass. Importantly, altering the orientation of the Fab-8 dCTCF sites is not sufficient to disrupt bypass, indicating that orientation dependence is conferred by other factors. PMID:27428541

  13. Genomic binding profiles of functionally distinct RNA polymerase III transcription complexes in human cells.

    PubMed

    Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

    2010-05-01

    Genome-wide occupancy profiles of five components of the RNA polymerase III (Pol III) machinery in human cells identified the expected tRNA and noncoding RNA targets and revealed many additional Pol III-associated loci, mostly near short interspersed elements (SINEs). Several genes are targets of an alternative transcription factor IIIB (TFIIIB) containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike nonexpressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner.

  14. Genomic Binding Profiles of Functionally Distinct RNA Polymerase III Transcription Complexes in Human Cells

    PubMed Central

    Moqtaderi, Zarmik; Wang, Jie; Raha, Debasish; White, Robert J.; Snyder, Michael; Weng, Zhiping; Struhl, Kevin

    2012-01-01

    Genome-wide occupancy profiles of five components of the RNA Polymerase III (Pol III) machinery in human cells identified the expected tRNA and non-coding RNA targets and revealed many additional Pol III-associated loci, mostly near SINEs. Several genes are targets of an alternative TFIIIB containing Brf2 instead of Brf1 and have extremely low levels of TFIIIC. Strikingly, expressed Pol III genes, unlike non-expressed Pol III genes, are situated in regions with a pattern of histone modifications associated with functional Pol II promoters. TFIIIC alone associates with numerous ETC loci, via the B box or a novel motif. ETCs are often near CTCF binding sites, suggesting a potential role in chromosome organization. Our results suggest that human Pol III complexes associate preferentially with regions near functional Pol II promoters and that TFIIIC-mediated recruitment of TFIIIB is regulated in a locus-specific manner. PMID:20418883

  15. The connection between BRG1, CTCF and topoisomerases at TAD boundaries.

    PubMed

    Barutcu, A Rasim; Lian, Jane B; Stein, Janet L; Stein, Gary S; Imbalzano, Anthony N

    2017-03-04

    The eukaryotic genome is partitioned into topologically associating domains (TADs). Despite recent advances characterizing TADs and TAD boundaries, the organization of these structures is an important dimension of genome architecture and function that is not well understood. Recently, we demonstrated that knockdown of BRG1, an ATPase driving the chromatin remodeling activity of mammalian SWI/SNF enzymes, globally alters long-range genomic interactions and results in a reduction of TAD boundary strength. We provided evidence suggesting that this effect may be due to BRG1 affecting nucleosome occupancy around CTCF sites present at TAD boundaries. In this review, we elaborate on our findings and speculate that BRG1 may contribute to the regulation of the structural and functional properties of chromatin at TAD boundaries by affecting the function or the recruitment of CTCF and DNA topoisomerase complexes.

  16. Developmental Control of NRAMP1 (SLC11A1) Expression in Professional Phagocytes.

    PubMed

    Cellier, Mathieu F M

    2017-05-03

    NRAMP1 (SLC11A1) is a professional phagocyte membrane importer of divalent metals that contributes to iron recycling at homeostasis and to nutritional immunity against infection. Analyses of data generated by several consortia and additional studies were integrated to hypothesize mechanisms restricting NRAMP1 expression to mature phagocytes. Results from various epigenetic and transcriptomic approaches were collected for mesodermal and hematopoietic cell types and compiled for combined analysis with results of genetic studies associating single nucleotide polymorphisms (SNPs) with variations in NRAMP1 expression (eQTLs). Analyses establish that NRAMP1 is part of an autonomous topologically associated domain delimited by ubiquitous CCCTC-binding factor (CTCF) sites. NRAMP1 locus contains five regulatory regions: a predicted super-enhancer (S-E) key to phagocyte-specific expression; the proximal promoter; two intronic areas, including 3' inhibitory elements that restrict expression during development; and a block of upstream sites possibly extending the S-E domain. Also the downstream region adjacent to the 3' CTCF locus boundary may regulate expression during hematopoiesis. Mobilization of the locus 14 predicted transcriptional regulatory elements occurs in three steps, beginning with hematopoiesis; at the onset of myelopoiesis and through myelo-monocytic differentiation. Basal expression level in mature phagocytes is further influenced by genetic variation, tissue environment, and in response to infections that induce various epigenetic memories depending on microorganism nature. Constitutively associated transcription factors (TFs) include CCAAT enhancer binding protein beta (C/EBPb), purine rich DNA binding protein (PU.1), early growth response 2 (EGR2) and signal transducer and activator of transcription 1 (STAT1) while hypoxia-inducible factors (HIFs) and interferon regulatory factor 1 (IRF1) may stimulate iron acquisition in pro-inflammatory conditions. Mouse orthologous locus is generally conserved; chromatin patterns typify a de novo myelo-monocytic gene whose expression is tightly controlled by TFs Pu.1, C/ebps and Irf8; Irf3 and nuclear factor NF-kappa-B p 65 subunit (RelA) regulate expression in inflammatory conditions. Functional differences in the determinants identified at these orthologous loci imply that species-specific mechanisms control gene expression.

  17. High-resolution mapping of chromatin packaging in mouse embryonic stem cells and sperm.

    PubMed

    Carone, Benjamin R; Hung, Jui-Hung; Hainer, Sarah J; Chou, Min-Te; Carone, Dawn M; Weng, Zhiping; Fazzio, Thomas G; Rando, Oliver J

    2014-07-14

    Mammalian embryonic stem cells (ESCs) and sperm exhibit unusual chromatin packaging that plays important roles in cellular function. Here, we extend a recently developed technique, based on deep paired-end sequencing of lightly digested chromatin, to assess footprints of nucleosomes and other DNA-binding proteins genome-wide in murine ESCs and sperm. In ESCs, we recover well-characterized features of chromatin such as promoter nucleosome depletion and further identify widespread footprints of sequence-specific DNA-binding proteins such as CTCF, which we validate in knockdown studies. We document global differences in nuclease accessibility between ESCs and sperm, finding that the majority of histone retention in sperm preferentially occurs in large gene-poor genomic regions, with only a small subset of nucleosomes being retained over promoters of developmental regulators. Finally, we describe evidence that CTCF remains associated with the genome in mature sperm, where it could play a role in organizing the sperm genome. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Transcription forms and remodels supercoiling domains unfolding large-scale chromatin structures

    PubMed Central

    Naughton, Catherine; Avlonitis, Nicolaos; Corless, Samuel; Prendergast, James G.; Mati, Ioulia K.; Eijk, Paul P.; Cockroft, Scott L.; Bradley, Mark; Ylstra, Bauke; Gilbert, Nick

    2013-01-01

    DNA supercoiling is an inherent consequence of twisting DNA and is critical for regulating gene expression and DNA replication. However, DNA supercoiling at a genomic scale in human cells is uncharacterized. To map supercoiling we used biotinylated-trimethylpsoralen as a DNA structure probe to show the genome is organized into supercoiling domains. Domains are formed and remodeled by RNA polymerase and topoisomerase activities and are flanked by GC-AT boundaries and CTCF binding sites. Under-wound domains are transcriptionally active, enriched in topoisomerase I, “open” chromatin fibers and DNaseI sites, but are depleted of topoisomerase II. Furthermore DNA supercoiling impacts on additional levels of chromatin compaction as under-wound domains are cytologically decondensed, topologically constrained, and decompacted by transcription of short RNAs. We suggest that supercoiling domains create a topological environment that facilitates gene activation providing an evolutionary purpose for clustering genes along chromosomes. PMID:23416946

  19. Lineage-specific evolution of the vertebrate Otopetrin gene family revealed by comparative genomic analyses

    PubMed Central

    2011-01-01

    Background Mutations in the Otopetrin 1 gene (Otop1) in mice and fish produce an unusual bilateral vestibular pathology that involves the absence of otoconia without hearing impairment. The encoded protein, Otop1, is the only functionally characterized member of the Otopetrin Domain Protein (ODP) family; the extended sequence and structural preservation of ODP proteins in metazoans suggest a conserved functional role. Here, we use the tools of sequence- and cytogenetic-based comparative genomics to study the Otop1 and the Otop2-Otop3 genes and to establish their genomic context in 25 vertebrates. We extend our evolutionary study to include the gene mutated in Usher syndrome (USH) subtype 1G (Ush1g), both because of the head-to-tail clustering of Ush1g with Otop2 and because Otop1 and Ush1g mutations result in inner ear phenotypes. Results We established that OTOP1 is the boundary gene of an inversion polymorphism on human chromosome 4p16 that originated in the common human-chimpanzee lineage more than 6 million years ago. Other lineage-specific evolutionary events included a three-fold expansion of the Otop genes in Xenopus tropicalis and of Ush1g in teleostei fish. The tight physical linkage between Otop2 and Ush1g is conserved in all vertebrates. To further understand the functional organization of the Ushg1-Otop2 locus, we deduced a putative map of binding sites for CCCTC-binding factor (CTCF), a mammalian insulator transcription factor, from genome-wide chromatin immunoprecipitation-sequencing (ChIP-seq) data in mouse and human embryonic stem (ES) cells combined with detection of CTCF-binding motifs. Conclusions The results presented here clarify the evolutionary history of the vertebrate Otop and Ush1g families, and establish a framework for studying the possible interaction(s) of Ush1g and Otop in developmental pathways. PMID:21261979

  20. Enhanced B Cell Alloantigen Presentation and Its Epigenetic Dysregulation in Liver Transplant Rejection.

    PubMed

    Ningappa, M; Ashokkumar, C; Higgs, B W; Sun, Q; Jaffe, R; Mazariegos, G; Li, D; Weeks, D E; Subramaniam, S; Ferrell, R; Hakonarson, H; Sindhi, R

    2016-02-01

    T cell suppression prevents acute cellular rejection but causes life-threatening infections and malignancies. Previously, liver transplant (LTx) rejection in children was associated with the single-nucleotide polymorphism (SNP) rs9296068 upstream of the HLA-DOA gene. HLA-DOA inhibits B cell presentation of antigen, a potentially novel antirejection drug target. Using archived samples from 122 white pediatric LTx patients (including 77 described previously), we confirmed the association between rs9296068 and LTx rejection (p = 0.001, odds ratio [OR] 2.55). Next-generation sequencing revealed that the putative transcription factor (CCCTC binding factor [CTCF]) binding SNP locus rs2395304, in linkage disequilibrium with rs9296068 (D' 0.578, r(2) = 0.4), is also associated with LTx rejection (p = 0.008, OR 2.34). Furthermore, LTx rejection is associated with enhanced B cell presentation of donor antigen relative to HLA-nonidentical antigen in a novel cell-based assay and with a downregulated HLA-DOA gene in a subset of these children. In lymphoblastoid B (Raji) cells, rs2395304 coimmunoprecipitates with CTCF, and CTCF knockdown with morpholino antisense oligonucleotides enhances alloantigen presentation and downregulates the HLA-DOA gene, reproducing observations made with HLA-DOA knockdown and clinical rejection. Alloantigen presentation is suppressed by inhibitors of methylation and histone deacetylation, reproducing observations made during resolution of rejection. Enhanced donor antigen presentation by B cells and its epigenetic dysregulation via the HLA-DOA gene represent novel opportunities for surveillance and treatment of transplant rejection. © Copyright 2015 The American Society of Transplantation and the American Society of Transplant Surgeons.

  1. Predictive Computational Modeling of Chromatin Folding

    NASA Astrophysics Data System (ADS)

    di Pierro, Miichele; Zhang, Bin; Wolynes, Peter J.; Onuchic, Jose N.

    In vivo, the human genome folds into well-determined and conserved three-dimensional structures. The mechanism driving the folding process remains unknown. We report a theoretical model (MiChroM) for chromatin derived by using the maximum entropy principle. The proposed model allows Molecular Dynamics simulations of the genome using as input the classification of loci into chromatin types and the presence of binding sites of loop forming protein CTCF. The model was trained to reproduce the Hi-C map of chromosome 10 of human lymphoblastoid cells. With no additional tuning the model was able to predict accurately the Hi-C maps of chromosomes 1-22 for the same cell line. Simulations show unknotted chromosomes, phase separation of chromatin types and a preference of chromatin of type A to sit at the periphery of the chromosomes.

  2. The Ubx Polycomb response element bypasses an unpaired Fab-8 insulator via cis transvection in Drosophila.

    PubMed

    Lu, Danfeng; Li, Zhuoran; Li, Lingling; Yang, Liping; Chen, Guijun; Yang, Deying; Zhang, Yue; Singh, Vikrant; Smith, Sheryl; Xiao, Yu; Wang, Erlin; Ye, Yunshuang; Zhang, Wei; Zhou, Lei; Rong, Yikang; Zhou, Jumin

    2018-01-01

    Chromatin insulators or boundary elements protect genes from regulatory activities from neighboring genes or chromatin domains. In the Drosophila Abdominal-B (Abd-B) locus, the deletion of such elements, such as Frontabdominal-7 (Fab-7) or Fab-8 led to dominant gain of function phenotypes, presumably due to the loss of chromatin barriers. Homologous chromosomes are paired in Drosophila, creating a number of pairing dependent phenomena including transvection, and whether transvection may affect the function of Polycomb response elements (PREs) and thus contribute to the phenotypes are not known. Here, we studied the chromatin barrier activity of Fab-8 and how it is affected by the zygosity of the transgene, and found that Fab-8 is able to block the silencing effect of the Ubx PRE on the DsRed reporter gene in a CTCF binding sites dependent manner. However, the blocking also depends on the zygosity of the transgene in that the barrier activity is present when the transgene is homozygous, but absent when the transgene is heterozygous. To analyze this effect, we performed chromatin immunoprecipitation and quantitative PCR (ChIP-qPCR) experiments on homozygous transgenic embryos, and found that H3K27me3 and H3K9me3 marks are restricted by Fab-8, but they spread beyond Fab-8 into the DsRed gene when the two CTCF binding sites within Fab-8 were mutated. Consistent with this, the mutation reduced H3K4me3 and RNA Pol II binding to the DsRed gene, and consequently, DsRed expression. Importantly, in heterozygous embryos, Fab-8 is unable to prevent the spread of H3K27me3 and H3K9me3 marks from crossing Fab-8 into DsRed, suggesting an insulator bypass. These results suggest that in the Abd-B locus, deletion of the insulator in one copy of the chromosome could lead to the loss of insulator activity on the homologous chromosome, and in other loci where chromosomal deletion created hemizygous regions of the genome, the chromatin barrier could be compromised. This study highlights a role of homologous chromosome pairing in the regulation of gene expression in the Drosophila genome.

  3. Activation of the alpha-globin gene expression correlates with dramatic upregulation of nearby non-globin genes and changes in local and large-scale chromatin spatial structure.

    PubMed

    Ulianov, Sergey V; Galitsyna, Aleksandra A; Flyamer, Ilya M; Golov, Arkadiy K; Khrameeva, Ekaterina E; Imakaev, Maxim V; Abdennur, Nezar A; Gelfand, Mikhail S; Gavrilov, Alexey A; Razin, Sergey V

    2017-07-11

    In homeotherms, the alpha-globin gene clusters are located within permanently open genome regions enriched in housekeeping genes. Terminal erythroid differentiation results in dramatic upregulation of alpha-globin genes making their expression comparable to the rRNA transcriptional output. Little is known about the influence of the erythroid-specific alpha-globin gene transcription outburst on adjacent, widely expressed genes and large-scale chromatin organization. Here, we have analyzed the total transcription output, the overall chromatin contact profile, and CTCF binding within the 2.7 Mb segment of chicken chromosome 14 harboring the alpha-globin gene cluster in cultured lymphoid cells and cultured erythroid cells before and after induction of terminal erythroid differentiation. We found that, similarly to mammalian genome, the chicken genomes is organized in TADs and compartments. Full activation of the alpha-globin gene transcription in differentiated erythroid cells is correlated with upregulation of several adjacent housekeeping genes and the emergence of abundant intergenic transcription. An extended chromosome region encompassing the alpha-globin cluster becomes significantly decompacted in differentiated erythroid cells, and depleted in CTCF binding and CTCF-anchored chromatin loops, while the sub-TAD harboring alpha-globin gene cluster and the upstream major regulatory element (MRE) becomes highly enriched with chromatin interactions as compared to lymphoid and proliferating erythroid cells. The alpha-globin gene domain and the neighboring loci reside within the A-like chromatin compartment in both lymphoid and erythroid cells and become further segregated from the upstream gene desert upon terminal erythroid differentiation. Our findings demonstrate that the effects of tissue-specific transcription activation are not restricted to the host genomic locus but affect the overall chromatin structure and transcriptional output of the encompassing topologically associating domain.

  4. Exhaustive methylation analysis revealed uneven profiles of methylation at IGF2/ICR1/H19 11p15 loci in Russell Silver syndrome.

    PubMed

    Azzi, Salah; Steunou, Virginie; Tost, Jörg; Rossignol, Sylvie; Thibaud, Nathalie; Das Neves, Cristina; Le Jule, Marilyne; Habib, Walid Abi; Blaise, Annick; Koudou, Yves; Busato, Florence; Le Bouc, Yves; Netchine, Irène

    2015-01-01

    The structural organisation of the human IGF2/ICR1/H19 11p15 domain is very complex, and the mechanisms underlying its regulation are poorly understood. The Imprinted Center Region 1 (ICR1) contains seven binding sites for the zinc-finger protein CTCF (CBS: CTCF Binding Sites); three additional differentially methylated regions (DMR) are located at the H19 promoter (H19DMR) and two in the IGF2 gene (DMR0 and DMR2), respectively. Loss of imprinting at the IGF2/ICR1/H19 domain results in two growth disorders with opposite phenotypes: Beckwith-Wiedemann syndrome and Russell Silver syndrome (RSS). Despite the IGF2/ICR1/H19 locus being widely studied, the extent of hypomethylation across the domain remains not yet addressed in patients with RSS. We assessed a detailed investigation of the methylation status of the 11p15 ICR1 CBS1-7, IGF2DMR0 and H19DMR (H19 promoter) in a population of controls (n=50) and RSS carrying (n=104) or not (n=65) carrying a hypomethylation at the 11p15 ICR1 region. The methylation indexes (MI) were balanced at all regions in the control population and patients with RSS without any as yet identified molecular anomaly. Interestingly, patients with RSS with ICR1 hypomethylation showed uneven profiles of methylation among the CBSs and DMRs. Furthermore, normal MIs at CBS1 and CBS7 were identified in 9% of patients. The hypomethylation does not spread equally throughout the IGF2/ICR1/H19 locus, and some loci could have normal MI, which may lead to underdiagnosis of patients with RSS with ICR1 hypomethylation. The uneven pattern of methylation suggests that some CBSs may play different roles in the tridimensional chromosomal looping regulation of this locus. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  5. Changes of the nucleolus architecture in absence of the nuclear factor CTCF.

    PubMed

    Hernández-Hernández, A; Soto-Reyes, E; Ortiz, R; Arriaga-Canon, C; Echeverría-Martinez, O M; Vázquez-Nin, G H; Recillas-Targa, F

    2012-01-01

    CTCF is a multifunctional nuclear factor involved in many cellular processes like gene regulation, chromatin insulation and genomic organization. Recently, CTCF has been shown to be involved in the transcriptional regulation of ribosomal genes and nucleolar organization in Drosophila cells and different murine cell types, including embryonic stem cells. Moreover, it has been suggested that CTCF could be associated to the nucleolus of human erythroleukemic K562 cells. In the present work, we took advantage of efficient small hairpin RNA interference against human CTCF to analyze nucleolar organization in HeLa cells. We have found that key components of the nucleolar architecture are altered. As a consequence of such alterations, an upregulation of ribosomal gene transcription was observed. We propose that CTCF contributes to the structural organization of the nucleolus and, through epigenetic mechanisms, to the regulation of the ribosomal gene expression. Copyright © 2012 S. Karger AG, Basel.

  6. Regulatory polymorphisms modulate the expression of HLA class II molecules and promote autoimmunity

    PubMed Central

    Raj, Prithvi; Rai, Ekta; Song, Ran; Khan, Shaheen; Wakeland, Benjamin E; Viswanathan, Kasthuribai; Arana, Carlos; Liang, Chaoying; Zhang, Bo; Dozmorov, Igor; Carr-Johnson, Ferdicia; Mitrovic, Mitja; Wiley, Graham B; Kelly, Jennifer A; Lauwerys, Bernard R; Olsen, Nancy J; Cotsapas, Chris; Garcia, Christine K; Wise, Carol A; Harley, John B; Nath, Swapan K; James, Judith A; Jacob, Chaim O; Tsao, Betty P; Pasare, Chandrashekhar; Karp, David R; Li, Quan Zhen; Gaffney, Patrick M; Wakeland, Edward K

    2016-01-01

    Targeted sequencing of sixteen SLE risk loci among 1349 Caucasian cases and controls produced a comprehensive dataset of the variations causing susceptibility to systemic lupus erythematosus (SLE). Two independent disease association signals in the HLA-D region identified two regulatory regions containing 3562 polymorphisms that modified thirty-seven transcription factor binding sites. These extensive functional variations are a new and potent facet of HLA polymorphism. Variations modifying the consensus binding motifs of IRF4 and CTCF in the XL9 regulatory complex modified the transcription of HLA-DRB1, HLA-DQA1 and HLA-DQB1 in a chromosome-specific manner, resulting in a 2.5-fold increase in the surface expression of HLA-DR and DQ molecules on dendritic cells with SLE risk genotypes, which increases to over 4-fold after stimulation. Similar analyses of fifteen other SLE risk loci identified 1206 functional variants tightly linked with disease-associated SNPs and demonstrated that common disease alleles contain multiple causal variants modulating multiple immune system genes. DOI: http://dx.doi.org/10.7554/eLife.12089.001 PMID:26880555

  7. Drosophila CTCF tandemly aligns with other insulator proteins at the borders of H3K27me3 domains.

    PubMed

    Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Yang, Jingping; Wahi, Jessica E; Corces, Victor G

    2012-11-01

    Several multiprotein DNA complexes capable of insulator activity have been identified in Drosophila melanogaster, yet only CTCF, a highly conserved zinc finger protein, and the transcription factor TFIIIC have been shown to function in mammals. CTCF is involved in diverse nuclear activities, and recent studies suggest that the proteins with which it associates and the DNA sequences that it targets may underlie these various roles. Here we show that the Drosophila homolog of CTCF (dCTCF) aligns in the genome with other Drosophila insulator proteins such as Suppressor of Hairy wing [SU(HW)] and Boundary Element Associated Factor of 32 kDa (BEAF-32) at the borders of H3K27me3 domains, which are also enriched for associated insulator proteins and additional cofactors. RNAi depletion of dCTCF and combinatorial knockdown of gene expression for other Drosophila insulator proteins leads to a reduction in H3K27me3 levels within repressed domains, suggesting that insulators are important for the maintenance of appropriate repressive chromatin structure in Polycomb (Pc) domains. These results shed new insights into the roles of insulators in chromatin domain organization and support recent models suggesting that insulators underlie interactions important for Pc-mediated repression. We reveal an important relationship between dCTCF and other Drosophila insulator proteins and speculate that vertebrate CTCF may also align with other nuclear proteins to accomplish similar functions.

  8. Drosophila CTCF tandemly aligns with other insulator proteins at the borders of H3K27me3 domains

    PubMed Central

    Van Bortle, Kevin; Ramos, Edward; Takenaka, Naomi; Yang, Jingping; Wahi, Jessica E.; Corces, Victor G.

    2012-01-01

    Several multiprotein DNA complexes capable of insulator activity have been identified in Drosophila melanogaster, yet only CTCF, a highly conserved zinc finger protein, and the transcription factor TFIIIC have been shown to function in mammals. CTCF is involved in diverse nuclear activities, and recent studies suggest that the proteins with which it associates and the DNA sequences that it targets may underlie these various roles. Here we show that the Drosophila homolog of CTCF (dCTCF) aligns in the genome with other Drosophila insulator proteins such as Suppressor of Hairy wing [SU(HW)] and Boundary Element Associated Factor of 32 kDa (BEAF-32) at the borders of H3K27me3 domains, which are also enriched for associated insulator proteins and additional cofactors. RNAi depletion of dCTCF and combinatorial knockdown of gene expression for other Drosophila insulator proteins leads to a reduction in H3K27me3 levels within repressed domains, suggesting that insulators are important for the maintenance of appropriate repressive chromatin structure in Polycomb (Pc) domains. These results shed new insights into the roles of insulators in chromatin domain organization and support recent models suggesting that insulators underlie interactions important for Pc-mediated repression. We reveal an important relationship between dCTCF and other Drosophila insulator proteins and speculate that vertebrate CTCF may also align with other nuclear proteins to accomplish similar functions. PMID:22722341

  9. Functional and topological characteristics of mammalian regulatory domains

    PubMed Central

    Symmons, Orsolya; Uslu, Veli Vural; Tsujimura, Taro; Ruf, Sandra; Nassari, Sonya; Schwarzer, Wibke; Ettwiller, Laurence; Spitz, François

    2014-01-01

    Long-range regulatory interactions play an important role in shaping gene-expression programs. However, the genomic features that organize these activities are still poorly characterized. We conducted a large operational analysis to chart the distribution of gene regulatory activities along the mouse genome, using hundreds of insertions of a regulatory sensor. We found that enhancers distribute their activities along broad regions and not in a gene-centric manner, defining large regulatory domains. Remarkably, these domains correlate strongly with the recently described TADs, which partition the genome into distinct self-interacting blocks. Different features, including specific repeats and CTCF-binding sites, correlate with the transition zones separating regulatory domains, and may help to further organize promiscuously distributed regulatory influences within large domains. These findings support a model of genomic organization where TADs confine regulatory activities to specific but large regulatory domains, contributing to the establishment of specific gene expression profiles. PMID:24398455

  10. Wt1 Flip-Flops Chromatin in a CTCF Domain

    PubMed Central

    Gurudatta, B. V.; Corces, Victor G.

    2011-01-01

    CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. PMID:21920307

  11. Wt1 flip-flops chromatin in a CTCF domain.

    PubMed

    Gurudatta, B V; Corces, Victor G

    2011-09-13

    CTCF plays diverse roles in nuclear organization and transcriptional regulation. In this issue of Developmental Cell, Essafi et al. (2011) report a mechanism by which the repressive or active state of chromatin in a domain defined by CTCF can be switched by the Wt1 transcription factor to regulate gene expression. Copyright © 2011 Elsevier Inc. All rights reserved.

  12. CUDR promotes liver cancer stem cell growth through upregulating TERT and C-Myc

    PubMed Central

    Pu, Hu; Zheng, Qidi; Li, Haiyan; Wu, Mengying; An, Jiahui; Gui, Xin; Li, Tianming; Lu, Dongdong

    2015-01-01

    Cancer up-regulated drug resistant (CUDR) is a novel non-coding RNA gene. Herein, we demonstrate excessive CUDR cooperates with excessive CyclinD1 or PTEN depletion to accelerate liver cancer stem cells growth and liver stem cell malignant transformation in vitro and in vivo. Mechanistically, we reveal the decrease of PTEN in cells may lead to increase binding capacity of CUDR to CyclinD1. Therefore, CUDR-CyclinD1 complex loads onto the long noncoding RNA H19 promoter region that may lead to reduce the DNA methylation on H19 promoter region and then to enhance the H19 expression. Strikingly, the overexpression of H19 increases the binding of TERT to TERC and reduces the interplay between TERT with TERRA, thus enhancing the cell telomerase activity and extending the telomere length. On the other hand, insulator CTCF recruits the CUDR-CyclinD1 complx to form the composite CUDR-CyclinD1-insulator CTCF complex which occupancied on the C-myc gene promoter region, increasing the outcome of oncogene C-myc. Ultimately, excessive TERT and C-myc lead to liver cancer stem cell and hepatocyte-like stem cell malignant proliferation. To understand the novel functions of long noncoding RNA CUDR will help in the development of new liver cancer therapeutic and diagnostic approaches. PMID:26513297

  13. Genomic positional conservation identifies topological anchor point RNAs linked to developmental loci.

    PubMed

    Amaral, Paulo P; Leonardi, Tommaso; Han, Namshik; Viré, Emmanuelle; Gascoigne, Dennis K; Arias-Carrasco, Raúl; Büscher, Magdalena; Pandolfini, Luca; Zhang, Anda; Pluchino, Stefano; Maracaja-Coutinho, Vinicius; Nakaya, Helder I; Hemberg, Martin; Shiekhattar, Ramin; Enright, Anton J; Kouzarides, Tony

    2018-03-15

    The mammalian genome is transcribed into large numbers of long noncoding RNAs (lncRNAs), but the definition of functional lncRNA groups has proven difficult, partly due to their low sequence conservation and lack of identified shared properties. Here we consider promoter conservation and positional conservation as indicators of functional commonality. We identify 665 conserved lncRNA promoters in mouse and human that are preserved in genomic position relative to orthologous coding genes. These positionally conserved lncRNA genes are primarily associated with developmental transcription factor loci with which they are coexpressed in a tissue-specific manner. Over half of positionally conserved RNAs in this set are linked to chromatin organization structures, overlapping binding sites for the CTCF chromatin organiser and located at chromatin loop anchor points and borders of topologically associating domains (TADs). We define these RNAs as topological anchor point RNAs (tapRNAs). Characterization of these noncoding RNAs and their associated coding genes shows that they are functionally connected: they regulate each other's expression and influence the metastatic phenotype of cancer cells in vitro in a similar fashion. Furthermore, we find that tapRNAs contain conserved sequence domains that are enriched in motifs for zinc finger domain-containing RNA-binding proteins and transcription factors, whose binding sites are found mutated in cancers. This work leverages positional conservation to identify lncRNAs with potential importance in genome organization, development and disease. The evidence that many developmental transcription factors are physically and functionally connected to lncRNAs represents an exciting stepping-stone to further our understanding of genome regulation.

  14. RNAi-independent role for Argonaute2 in CTCF/CP190 chromatin insulator function

    PubMed Central

    Moshkovich, Nellie; Nisha, Parul; Boyle, Patrick J.; Thompson, Brandi A.; Dale, Ryan K.; Lei, Elissa P.

    2011-01-01

    A major role of the RNAi pathway in Schizosaccharomyces pombe is to nucleate heterochromatin, but it remains unclear whether this mechanism is conserved. To address this question in Drosophila, we performed genome-wide localization of Argonaute2 (AGO2) by chromatin immunoprecipitation (ChIP)-seq in two different embryonic cell lines and found that AGO2 localizes to euchromatin but not heterochromatin. This localization pattern is further supported by immunofluorescence staining of polytene chromosomes and cell lines, and these studies also indicate that a substantial fraction of AGO2 resides in the nucleus. Intriguingly, AGO2 colocalizes extensively with CTCF/CP190 chromatin insulators but not with genomic regions corresponding to endogenous siRNA production. Moreover, AGO2, but not its catalytic activity or Dicer-2, is required for CTCF/CP190-dependent Fab-8 insulator function. AGO2 interacts physically with CTCF and CP190, and depletion of either CTCF or CP190 results in genome-wide loss of AGO2 chromatin association. Finally, mutation of CTCF, CP190, or AGO2 leads to reduction of chromosomal looping interactions, thereby altering gene expression. We propose that RNAi-independent recruitment of AGO2 to chromatin by insulator proteins promotes the definition of transcriptional domains throughout the genome. PMID:21852534

  15. 3D chromosome rendering from Hi-C data using virtual reality

    NASA Astrophysics Data System (ADS)

    Zhu, Yixin; Selvaraj, Siddarth; Weber, Philip; Fang, Jennifer; Schulze, Jürgen P.; Ren, Bing

    2015-01-01

    Most genome browsers display DNA linearly, using single-dimensional depictions that are useful to examine certain epigenetic mechanisms such as DNA methylation. However, these representations are insufficient to visualize intrachromosomal interactions and relationships between distal genome features. Relationships between DNA regions may be difficult to decipher or missed entirely if those regions are distant in one dimension but could be spatially proximal when mapped to three-dimensional space. For example, the visualization of enhancers folding over genes is only fully expressed in three-dimensional space. Thus, to accurately understand DNA behavior during gene expression, a means to model chromosomes is essential. Using coordinates generated from Hi-C interaction frequency data, we have created interactive 3D models of whole chromosome structures and its respective domains. We have also rendered information on genomic features such as genes, CTCF binding sites, and enhancers. The goal of this article is to present the procedure, findings, and conclusions of our models and renderings.

  16. Parental origin of sequence variants associated with complex diseases.

    PubMed

    Kong, Augustine; Steinthorsdottir, Valgerdur; Masson, Gisli; Thorleifsson, Gudmar; Sulem, Patrick; Besenbacher, Soren; Jonasdottir, Aslaug; Sigurdsson, Asgeir; Kristinsson, Kari Th; Jonasdottir, Adalbjorg; Frigge, Michael L; Gylfason, Arnaldur; Olason, Pall I; Gudjonsson, Sigurjon A; Sverrisson, Sverrir; Stacey, Simon N; Sigurgeirsson, Bardur; Benediktsdottir, Kristrun R; Sigurdsson, Helgi; Jonsson, Thorvaldur; Benediktsson, Rafn; Olafsson, Jon H; Johannsson, Oskar Th; Hreidarsson, Astradur B; Sigurdsson, Gunnar; Ferguson-Smith, Anne C; Gudbjartsson, Daniel F; Thorsteinsdottir, Unnur; Stefansson, Kari

    2009-12-17

    Effects of susceptibility variants may depend on from which parent they are inherited. Although many associations between sequence variants and human traits have been discovered through genome-wide associations, the impact of parental origin has largely been ignored. Here we show that for 38,167 Icelanders genotyped using single nucleotide polymorphism (SNP) chips, the parental origin of most alleles can be determined. For this we used a combination of genealogy and long-range phasing. We then focused on SNPs that associate with diseases and are within 500 kilobases of known imprinted genes. Seven independent SNP associations were examined. Five-one with breast cancer, one with basal-cell carcinoma and three with type 2 diabetes-have parental-origin-specific associations. These variants are located in two genomic regions, 11p15 and 7q32, each harbouring a cluster of imprinted genes. Furthermore, we observed a novel association between the SNP rs2334499 at 11p15 and type 2 diabetes. Here the allele that confers risk when paternally inherited is protective when maternally transmitted. We identified a differentially methylated CTCF-binding site at 11p15 and demonstrated correlation of rs2334499 with decreased methylation of that site.

  17. RNA polymerase III transcription - regulated by chromatin structure and regulator of nuclear chromatin organization.

    PubMed

    Pascali, Chiara; Teichmann, Martin

    2013-01-01

    RNA polymerase III (Pol III) transcription is regulated by modifications of the chromatin. DNA methylation and post-translational modifications of histones, such as acetylation, phosphorylation and methylation have been linked to Pol III transcriptional activity. In addition to being regulated by modifications of DNA and histones, Pol III genes and its transcription factors have been implicated in the organization of nuclear chromatin in several organisms. In yeast, the ability of the Pol III transcription system to contribute to nuclear organization seems to be dependent on direct interactions of Pol III genes and/or its transcription factors TFIIIC and TFIIIB with the structural maintenance of chromatin (SMC) protein-containing complexes cohesin and condensin. In human cells, Pol III genes and transcription factors have also been shown to colocalize with cohesin and the transcription regulator and genome organizer CCCTC-binding factor (CTCF). Furthermore, chromosomal sites have been identified in yeast and humans that are bound by partial Pol III machineries (extra TFIIIC sites - ETC; chromosome organizing clamps - COC). These ETCs/COC as well as Pol III genes possess the ability to act as boundary elements that restrict spreading of heterochromatin.

  18. Protein Self-Assembly and Protein-Induced DNA Morphologies

    NASA Astrophysics Data System (ADS)

    Mawhinney, Matthew T.

    The ability of biomolecules to associate into various structural configurations has a substantial impact on human physiology. The synthesis of protein polypeptide chains using the information encoded by DNA is mediated through the use of regulatory proteins, known as transcription factors. Some transcription factors perform function by inducing local curvature in deoxyribonucleic acid (DNA) strands, the mechanisms of which are not entirely known. An important architectural protein, eleven zinc finger CTCF (11 ZF CTCF) is involved in genome organization and hypothesized to mediate DNA loop formation. Direct evidence for these CTCF-induced DNA loops has yet to be observed. In this thesis, the effect of 11 ZF CTCF on DNA morphology is examined using atomic force microscopy, a powerful technique for visualizing biomolecules with nanometer resolution. The presence of CTCF is revealed to induce a variety of morphologies deviating from the relaxed state of control DNA samples, including compact circular complexes, meshes, and networks. Images reveal quasi-circular DNA/CTCF complexes consistent with a single DNA molecule twice wrapped around the protein. The structures of DNA and proteins are highly important for operations in the cell. Structural irregularities may lead to a variety of issues, including more than twenty human pathologies resulting from aberrant protein misfolding into amyloid aggregates of elongated fibrils. Insulin deficiency and resistance characterizing type 2 diabetes often requires administration of insulin. Injectable and inhalable delivery methods have been documented to result in the deposition of amyloid fibrils. Oligomers, soluble multiprotein assemblies, are believed to play an important role in this process. Insulin aggregation under physiological conditions is not well understood and oligomers have not yet been fully characterized. In this thesis, in vitro insulin aggregation at acidic and neutral pH is explored using a variety of techniques, including kinetic thioflavin T fluorescence, circular dichroism spectroscopy, atomic force and electron microscopy imaging. The size distribution of insulin oligomers at different assembly stages is characterized through covalent cross-linking and gel electrophoresis. Results show that at the earliest assembly stage, oligomers comprise up to 40% and 70% of soluble insulin at acidic and neutral pH, respectively. While the highest oligomer order increases with insulin concentration at acidic pH, the opposite tendency is observed at neutral pH, with heptamers formed in 10 muM insulin. These findings suggest that oligomers may be on- and off- pathway assemblies for insulin at acidic and neutral pH, respectively. Agitation, required to induce insulin aggregation at neutral pH, increases fibril formation rate and fibrillar mass by an order of magnitude each. Insulin incubated under agitated conditions at neutral pH rapidly aggregates into large micrometer-sized aggregates, which provides insight into injection-site amyloidosis and toxic pulmonary aggregates induced by administration of extraneous insulin.

  19. Prenatal arsenic exposure and the epigenome: identifying sites of 5-methylcytosine alterations that predict functional changes in gene expression in newborn cord blood and subsequent birth outcomes.

    PubMed

    Rojas, Daniel; Rager, Julia E; Smeester, Lisa; Bailey, Kathryn A; Drobná, Zuzana; Rubio-Andrade, Marisela; Stýblo, Miroslav; García-Vargas, Gonzalo; Fry, Rebecca C

    2015-01-01

    Prenatal exposure to inorganic arsenic (iAs) is detrimental to the health of newborns and increases the risk of disease development later in life. Here we examined a subset of newborn cord blood leukocyte samples collected from subjects enrolled in the Biomarkers of Exposure to ARsenic (BEAR) pregnancy cohort in Gómez Palacio, Mexico, who were exposed to a range of drinking water arsenic concentrations (0.456-236 µg/l). Changes in iAs-associated DNA 5-methylcytosine methylation were assessed across 424,935 CpG sites representing 18,761 genes and compared with corresponding mRNA expression levels and birth outcomes. In the context of arsenic exposure, a total of 2919 genes were identified with iAs-associated differences in DNA methylation. Site-specific analyses identified DNA methylation changes that were most predictive of gene expression levels where CpG methylation within CpG islands positioned within the first exon, the 5' untranslated region and 200 bp upstream of the transcription start site yielded the most significant association with gene expression levels. A set of 16 genes was identified with correlated iAs-associated changes in DNA methylation and mRNA expression and all were highly enriched for binding sites of the early growth response (EGR) and CCCTC-binding factor (CTCF) transcription factors. Furthermore, DNA methylation levels of 7 of these genes were associated with differences in birth outcomes including gestational age and head circumference.These data highlight the complex interplay between DNA methylation, functional changes in gene expression and health outcomes and underscore the need for functional analyses coupled to epigenetic assessments. © The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  20. CTCF-KDM4A complex correlates with histone modifications that negatively regulate CHD5 gene expression in cancer cell lines

    PubMed Central

    Guerra-Calderas, Lissania; González-Barrios, Rodrigo; Patiño, Carlos César; Alcaraz, Nicolás; Salgado-Albarrán, Marisol; de León, David Cantú; Hernández, Clementina Castro; Sánchez-Pérez, Yesennia; Maldonado-Martínez, Héctor Aquiles; De la Rosa-Velazquez, Inti A.; Vargas-Romero, Fernanda; Herrera, Luis A.; García-Carrancá, Alejandro; Soto-Reyes, Ernesto

    2018-01-01

    Histone demethylase KDM4A is involved in H3K9me3 and H3K36me3 demethylation, which are epigenetic modifications associated with gene silencing and RNA Polymerase II elongation, respectively. KDM4A is abnormally expressed in cancer, affecting the expression of multiple targets, such as the CHD5 gene. This enzyme localizes at the first intron of CHD5, and the dissociation of KDM4A increases gene expression. In vitro assays showed that KDM4A-mediated demethylation is enhanced in the presence of CTCF, suggesting that CTCF could increase its enzymatic activity in vivo, however the specific mechanism by which CTCF and KDM4A might be involved in the CHD5 gene repression is poorly understood. Here, we show that CTCF and KDM4A form a protein complex, which is recruited into the first intron of CHD5. This is related to a decrease in H3K36me3/2 histone marks and is associated with its transcriptional downregulation. Depletion of CTCF or KDM4A by siRNA, triggered the reactivation of CHD5 expression, suggesting that both proteins are involved in the negative regulation of this gene. Furthermore, the knockout of KDM4A restored the CHD5 expression and H3K36me3 and H3K36me2 histone marks. Such mechanism acts independently of CHD5 promoter DNA methylation. Our findings support a novel mechanism of epigenetic repression at the gene body that does not involve promoter silencing. PMID:29682202

  1. Quantification of Retinogenesis in 3D Cultures Reveals Epigenetic Memory and Higher Efficiency in iPSCs Derived from Rod Photoreceptors.

    PubMed

    Hiler, Daniel; Chen, Xiang; Hazen, Jennifer; Kupriyanov, Sergey; Carroll, Patrick A; Qu, Chunxu; Xu, Beisi; Johnson, Dianna; Griffiths, Lyra; Frase, Sharon; Rodriguez, Alberto R; Martin, Greg; Zhang, Jiakun; Jeon, Jongrye; Fan, Yiping; Finkelstein, David; Eisenman, Robert N; Baldwin, Kristin; Dyer, Michael A

    2015-07-02

    Cell-based therapies to treat retinal degeneration are now being tested in clinical trials. However, it is not known whether the source of stem cells is important for the production of differentiated cells suitable for transplantation. To test this, we generated induced pluripotent stem cells (iPSCs) from murine rod photoreceptors (r-iPSCs) and scored their ability to make retinae by using a standardized quantitative protocol called STEM-RET. We discovered that r-iPSCs more efficiently produced differentiated retinae than did embryonic stem cells (ESCs) or fibroblast-derived iPSCs (f-iPSCs). Retinae derived from f-iPSCs had fewer amacrine cells and other inner nuclear layer cells. Integrated epigenetic analysis showed that DNA methylation contributes to the defects in f-iPSC retinogenesis and that rod-specific CTCF insulator protein-binding sites may promote r-iPSC retinogenesis. Together, our data suggest that the source of stem cells is important for producing retinal neurons in three-dimensional (3D) organ cultures. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Simultaneous measurement of chromatin accessibility, DNA methylation, and nucleosome phasing in single cells

    PubMed Central

    Pott, Sebastian

    2017-01-01

    Gaining insights into the regulatory mechanisms that underlie the transcriptional variation observed between individual cells necessitates the development of methods that measure chromatin organization in single cells. Here I adapted Nucleosome Occupancy and Methylome-sequencing (NOMe-seq) to measure chromatin accessibility and endogenous DNA methylation in single cells (scNOMe-seq). scNOMe-seq recovered characteristic accessibility and DNA methylation patterns at DNase hypersensitive sites (DHSs). An advantage of scNOMe-seq is that sequencing reads are sampled independently of the accessibility measurement. scNOMe-seq therefore controlled for fragment loss, which enabled direct estimation of the fraction of accessible DHSs within individual cells. In addition, scNOMe-seq provided high resolution of chromatin accessibility within individual loci which was exploited to detect footprints of CTCF binding events and to estimate the average nucleosome phasing distances in single cells. scNOMe-seq is therefore well-suited to characterize the chromatin organization of single cells in heterogeneous cellular mixtures. DOI: http://dx.doi.org/10.7554/eLife.23203.001 PMID:28653622

  3. Flanking HS-62.5 and 3' HS1, and regions upstream of the LCR, are not required for beta-globin transcription.

    PubMed

    Bender, M A; Byron, Rachel; Ragoczy, Tobias; Telling, Agnes; Bulger, Michael; Groudine, Mark

    2006-08-15

    The locus control region (LCR) was thought to be necessary and sufficient for establishing and maintaining an open beta-globin locus chromatin domain in the repressive environment of the developing erythrocyte. However, deletion of the LCR from the endogenous locus had no significant effect on chromatin structure and did not silence transcription. Thus, the cis-regulatory elements that confer the open domain remain unidentified. The conserved DNaseI hypersensitivity sites (HSs) HS-62.5 and 3'HS1 that flank the locus, and the region upstream of the LCR have been implicated in globin gene regulation. The flanking HSs bind CCCTC binding factor (CTCF) and are thought to interact with the LCR to form a "chromatin hub" involved in beta-globin gene activation. Hispanic thalassemia, a deletion of the LCR and 27 kb upstream, leads to heterochromatinization and silencing of the locus. Thus, the region upstream of the LCR deleted in Hispanic thalassemia (upstream Hispanic region [UHR]) may be required for expression. To determine the importance of the UHR and flanking HSs for beta-globin expression, we generated and analyzed mice with targeted deletions of these elements. We demonstrate deletion of these regions alone, and in combination, do not affect transcription, bringing into question current models for the regulation of the beta-globin locus.

  4. Extrusion without a motor: a new take on the loop extrusion model of genome organization

    PubMed Central

    Johnson, J.; Michieletto, D.; Morozov, A. N.; Nicodemi, M.; Cook, P. R.; Marenduzzo, D.

    2018-01-01

    ABSTRACT Chromatin loop extrusion is a popular model for the formation of CTCF loops and topological domains. Recent HiC data have revealed a strong bias in favour of a particular arrangement of the CTCF binding motifs that stabilize loops, and extrusion is the only model to date which can explain this. However, the model requires a motor to generate the loops, and although cohesin is a strong candidate for the extruding factor, a suitable motor protein (or a motor activity in cohesin itself) has yet to be found. Here we explore a new hypothesis: that there is no motor, and thermal motion within the nucleus drives extrusion. Using theoretical modelling and computer simulations we ask whether such diffusive extrusion could feasibly generate loops. Our simulations uncover an interesting ratchet effect (where an osmotic pressure promotes loop growth), and suggest, by comparison to recent in vitro and in vivo measurements, that diffusive extrusion can in principle generate loops of the size observed in the data. Extra View on : C. A. Brackley, J. Johnson, D. Michieletto, A. N. Morozov, M. Nicodemi, P. R. Cook, and D. Marenduzzo “Non-equilibrium chromosome looping via molecular slip-links”, Physical Review Letters 119 138101 (2017) PMID:29300120

  5. Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens

    PubMed Central

    Glinsky, Gennadi V.

    2016-01-01

    Abstract Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8–10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. PMID:27503290

  6. Polycomb repressive complex 2 epigenomic signature defines age-associated hypermethylation and gene expression changes

    PubMed Central

    Dozmorov, Mikhail G

    2015-01-01

    Although age-associated gene expression and methylation changes have been reported throughout the literature, the unifying epigenomic principles of aging remain poorly understood. Recent explosion in availability and resolution of functional/regulatory genome annotation data (epigenomic data), such as that provided by the ENCODE and Roadmap Epigenomics projects, provides an opportunity for the identification of epigenomic mechanisms potentially altered by age-associated differentially methylated regions (aDMRs) and regulatory signatures in the promoters of age-associated genes (aGENs). In this study we found that aDMRs and aGENs identified in multiple independent studies share a common Polycomb Repressive Complex 2 signature marked by EZH2, SUZ12, CTCF binding sites, repressive H3K27me3, and activating H3K4me1 histone modification marks, and a “poised promoter” chromatin state. This signature is depleted in RNA Polymerase II-associated transcription factor binding sites, activating H3K79me2, H3K36me3, H3K27ac marks, and an “active promoter” chromatin state. The PRC2 signature was shown to be generally stable across cell types. When considering the directionality of methylation changes, we found the PRC2 signature to be associated with aDMRs hypermethylated with age, while hypomethylated aDMRs were associated with enhancers. In contrast, aGENs were associated with the PRC2 signature independently of the directionality of gene expression changes. In this study we demonstrate that the PRC2 signature is the common epigenomic context of genomic regions associated with hypermethylation and gene expression changes in aging. PMID:25880792

  7. High-Resolution Mapping of Chromatin Conformation in Cardiac Myocytes Reveals Structural Remodeling of the Epigenome in Heart Failure

    PubMed Central

    Rosa-Garrido, Manuel; Chapski, Douglas J.; Schmitt, Anthony D.; Kimball, Todd H.; Karbassi, Elaheh; Monte, Emma; Balderas, Enrique; Pellegrini, Matteo; Shih, Tsai-Ting; Soehalim, Elizabeth; Liem, David; Ping, Peipei; Galjart, Niels J.; Ren, Shuxun; Wang, Yibin; Ren, Bing

    2017-01-01

    Background: Cardiovascular disease is associated with epigenomic changes in the heart; however, the endogenous structure of cardiac myocyte chromatin has never been determined. Methods: To investigate the mechanisms of epigenomic function in the heart, genome-wide chromatin conformation capture (Hi-C) and DNA sequencing were performed in adult cardiac myocytes following development of pressure overload–induced hypertrophy. Mice with cardiac-specific deletion of CTCF (a ubiquitous chromatin structural protein) were generated to explore the role of this protein in chromatin structure and cardiac phenotype. Transcriptome analyses by RNA-seq were conducted as a functional readout of the epigenomic structural changes. Results: Depletion of CTCF was sufficient to induce heart failure in mice, and human patients with heart failure receiving mechanical unloading via left ventricular assist devices show increased CTCF abundance. Chromatin structural analyses revealed interactions within the cardiac myocyte genome at 5-kb resolution, enabling examination of intra- and interchromosomal events, and providing a resource for future cardiac epigenomic investigations. Pressure overload or CTCF depletion selectively altered boundary strength between topologically associating domains and A/B compartmentalization, measurements of genome accessibility. Heart failure involved decreased stability of chromatin interactions around disease-causing genes. In addition, pressure overload or CTCF depletion remodeled long-range interactions of cardiac enhancers, resulting in a significant decrease in local chromatin interactions around these functional elements. Conclusions: These findings provide a high-resolution chromatin architecture resource for cardiac epigenomic investigations and demonstrate that global structural remodeling of chromatin underpins heart failure. The newly identified principles of endogenous chromatin structure have key implications for epigenetic therapy. PMID:28802249

  8. High-Resolution Mapping of Chromatin Conformation in Cardiac Myocytes Reveals Structural Remodeling of the Epigenome in Heart Failure.

    PubMed

    Rosa-Garrido, Manuel; Chapski, Douglas J; Schmitt, Anthony D; Kimball, Todd H; Karbassi, Elaheh; Monte, Emma; Balderas, Enrique; Pellegrini, Matteo; Shih, Tsai-Ting; Soehalim, Elizabeth; Liem, David; Ping, Peipei; Galjart, Niels J; Ren, Shuxun; Wang, Yibin; Ren, Bing; Vondriska, Thomas M

    2017-10-24

    Cardiovascular disease is associated with epigenomic changes in the heart; however, the endogenous structure of cardiac myocyte chromatin has never been determined. To investigate the mechanisms of epigenomic function in the heart, genome-wide chromatin conformation capture (Hi-C) and DNA sequencing were performed in adult cardiac myocytes following development of pressure overload-induced hypertrophy. Mice with cardiac-specific deletion of CTCF (a ubiquitous chromatin structural protein) were generated to explore the role of this protein in chromatin structure and cardiac phenotype. Transcriptome analyses by RNA-seq were conducted as a functional readout of the epigenomic structural changes. Depletion of CTCF was sufficient to induce heart failure in mice, and human patients with heart failure receiving mechanical unloading via left ventricular assist devices show increased CTCF abundance. Chromatin structural analyses revealed interactions within the cardiac myocyte genome at 5-kb resolution, enabling examination of intra- and interchromosomal events, and providing a resource for future cardiac epigenomic investigations. Pressure overload or CTCF depletion selectively altered boundary strength between topologically associating domains and A/B compartmentalization, measurements of genome accessibility. Heart failure involved decreased stability of chromatin interactions around disease-causing genes. In addition, pressure overload or CTCF depletion remodeled long-range interactions of cardiac enhancers, resulting in a significant decrease in local chromatin interactions around these functional elements. These findings provide a high-resolution chromatin architecture resource for cardiac epigenomic investigations and demonstrate that global structural remodeling of chromatin underpins heart failure. The newly identified principles of endogenous chromatin structure have key implications for epigenetic therapy. © 2017 The Authors.

  9. Aberrant methylation patterns affect the molecular pathogenesis of rheumatoid arthritis.

    PubMed

    Lin, Yang; Luo, Zhengqiang

    2017-05-01

    This study aims to investigate DNA methylation signatures in fibroblast-like synoviocytes (FLS) from patients with rheumatoid arthritis (RA), and to explore the relationship with transcription factors (TFs) that help to distinguish RA from osteoarthritis (OA). Microarray dataset of GSE46346, including six FLS samples from patients with RA and five FLS samples from patients with OA, was downloaded from the Gene Expression Omnibus database. RA and OA samples were screened for differentially methylated loci (DMLs). The corresponding differentially methylated genes (DMGs) were identified, followed by Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway and Gene Ontology (GO) enrichment analysis. A transcriptional regulatory network was built with TFs and their corresponding DMGs. Overall, 280 hypomethylated loci and 561 hypermethylated loci were screened. Genes containing hypermethylated loci were enriched in pathways in cancer, ECM-receptor interaction, focal adhesion and neurotrophin signaling pathways. Genes containing hypomethylated loci were enriched in the neurotrophin signaling pathway. Moreover, we found that CCCTC-binding factor (CTCF), Yin Yang 1 (YY1), v-myc avian myelocytomatosis viral oncogene homolog (c-MYC), and early growth response 1 (EGR1) were important TFs in the transcriptional regulatory network. Therefore, DMGs might participate in the neurotrophin signaling pathway, pathways in cancer, ECM-receptor interaction and focal adhesion pathways in RA. Furthermore, CTCF, c-MYC, YY1, and EGR1 may play important roles in RA through regulating DMGs. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Principles of Chromosome Architecture Revealed by Hi-C.

    PubMed

    Eagen, Kyle P

    2018-06-01

    Chromosomes are folded and compacted in interphase nuclei, but the molecular basis of this folding is poorly understood. Chromosome conformation capture methods, such as Hi-C, combine chemical crosslinking of chromatin with fragmentation, DNA ligation, and high-throughput DNA sequencing to detect neighboring loci genome-wide. Hi-C has revealed the segregation of chromatin into active and inactive compartments and the folding of DNA into self-associating domains and loops. Depletion of CTCF, cohesin, or cohesin-associated proteins was recently shown to affect the majority of domains and loops in a manner that is consistent with a model of DNA folding through extrusion of chromatin loops. Compartmentation was not dependent on CTCF or cohesin. Hi-C contact maps represent the superimposition of CTCF/cohesin-dependent and -independent folding states. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Formation of chromosomal domains in interphase by loop extrusion

    NASA Astrophysics Data System (ADS)

    Fudenberg, Geoffrey

    While genomes are often considered as one-dimensional sequences, interphase chromosomes are organized in three dimensions with an essential role for regulating gene expression. Recent studies have shown that Topologically Associating Domains (TADs) are fundamental structural and functional building blocks of human interphase chromosomes. Despite observations that architectural proteins, including CTCF, demarcate and maintain the borders of TADs, the mechanisms underlying TAD formation remain unknown. Here we propose that loop extrusion underlies the formation TADs. In this process, cis-acting loop-extruding factors, likely cohesins, form progressively larger loops, but stall at TAD boundaries due to interactions with boundary proteins, including CTCF. This process dynamically forms loops of various sizes within but not between TADs. Using polymer simulations, we find that loop extrusion can produce TADs as determined by our analyses of the highest-resolution experimental data. Moreover, we find that loop extrusion can explain many diverse experimental observations, including: the preferential orientation of CTCF motifs and enrichments of architectural proteins at TAD boundaries; TAD boundary deletion experiments; and experiments with knockdown or depletion of CTCF, cohesin, and cohesin-loading factors. Together, the emerging picture from our work is that TADs are formed by rapidly associating, growing, and dissociating loops, presenting a clear framework for understanding interphase chromosomal organization.

  12. Structural organization of the inactive X chromosome in the mouse

    PubMed Central

    Giorgetti, Luca; Lajoie, Bryan R.; Carter, Ava C.; Attia, Mikael; Zhan, Ye; Xu, Jin; Chen, Chong Jian; Kaplan, Noam; Chang, Howard Y.; Heard, Edith; Dekker, Job

    2017-01-01

    X-chromosome inactivation (XCI) involves major reorganization of the X chromosome as it becomes silent and heterochromatic. During female mammalian development, XCI is triggered by upregulation of the non-coding Xist RNA from one of the two X chromosomes. Xist coats the chromosome in cis and induces silencing of almost all genes via its A-repeat region1,2, although some genes (constitutive escapees) avoid silencing in most cell types, and others (facultative escapees) escape XCI only in specific contexts3. A role for Xist in organizing the inactive X (Xi) chromosome has been proposed4–6. Recent chromosome conformation capture approaches have revealed global loss of local structure on the Xi chromosome and formation of large mega-domains, separated by a region containing the DXZ4 macrosatellite7–10. However, the molecular architecture of the Xi chromosome, in both the silent and expressed regions, remains unclear. Here we investigate the structure, chromatin accessibility and expression status of the mouse Xi chromosome in highly polymorphic clonal neural progenitors (NPCs) and embryonic stem cells. We demonstrate a crucial role for Xist and the DXZ4-containing boundary in shaping Xi chromosome structure using allele-specific genome-wide chromosome conformation capture (Hi-C) analysis, an assay for transposase-accessible chromatin with high throughput sequencing (ATAC–seq) and RNA sequencing. Deletion of the boundary disrupts mega-domain formation, and induction of Xist RNA initiates formation of the boundary and the loss of DNA accessibility. We also show that in NPCs, the Xi chromosome lacks active/inactive compartments and topologically associating domains (TADs), except around genes that escape XCI. Escapee gene clusters display TAD-like structures and retain DNA accessibility at promoter-proximal and CTCF-binding sites. Furthermore, altered patterns of facultative escape genes in different neural progenitor clones are associated with the presence of different TAD-like structures after XCI. These findings suggest a key role for transcription and CTCF in the formation of TADs in the context of the Xi chromosome in neural progenitors. PMID:27437574

  13. miRNA-122 Protects Mice and Human Hepatocytes from Acetaminophen Toxicity by Regulating Cytochrome P450 Family 1 Subfamily A Member 2 and Family 2 Subfamily E Member 1 Expression.

    PubMed

    Chowdhary, Vivek; Teng, Kun-Yu; Thakral, Sharda; Zhang, Bo; Lin, Cho-Hao; Wani, Nissar; Bruschweiler-Li, Lei; Zhang, Xiaoli; James, Laura; Yang, Dakai; Junge, Norman; Brüschweiler, Rafael; Lee, William M; Ghoshal, Kalpana

    2017-12-01

    Acetaminophen toxicity is a leading cause of acute liver failure (ALF). We found that miRNA-122 (miR-122) is down-regulated in liver biopsy specimens of patients with ALF and in acetaminophen-treated mice. A marked decrease in the primary miR-122 expression occurs in mice on acetaminophen overdose because of suppression of its key transactivators, hepatocyte nuclear factor (HNF)-4α and HNF6. More importantly, the mortality rates of male and female liver-specific miR-122 knockout (LKO) mice were significantly higher than control mice when injected i.p. with an acetaminophen dose not lethal to the control. LKO livers exhibited higher basal expression of cytochrome P450 family 2 subfamily E member 1 (CYP2E1) and cytochrome P450 family 1 subfamily A member 2 (CYP1A2) that convert acetaminophen to highly reactive N-acetyl-p-benzoquinone imine. Upregulation of Cyp1a2 primary transcript and mRNA in LKO mice correlated with the elevation of aryl hydrocarbon receptor (AHR) and mediator 1 (MED1), two transactivators of Cyp1a2. Analysis of ChIP-seq data in the ENCODE (Encyclopedia of DNA Element) database identified association of CCCTC-binding factor (CTCF) with Ahr promoter in mouse livers. Both MED1 and CTCF are validated conserved miR-122 targets. Furthermore, depletion of Ahr, Med1, or Ctcf in Mir122 -/- hepatocytes reduced Cyp1a2 expression. Pulse-chase studies found that CYP2E1 protein level is upregulated in LKO hepatocytes. Notably, miR-122 depletion sensitized differentiated human HepaRG cells to acetaminophen toxicity that correlated with upregulation of AHR, MED1, and CYP1A2 expression. Collectively, these results reveal a critical role of miR-122 in acetaminophen detoxification and implicate its therapeutic potential in patients with ALF. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  14. Path-preference cellular-automaton model for traffic flow through transit points and its application to the transcription process in human cells.

    PubMed

    Ohta, Yoshihiro; Nishiyama, Akinobu; Wada, Yoichiro; Ruan, Yijun; Kodama, Tatsuhiko; Tsuboi, Takashi; Tokihiro, Tetsuji; Ihara, Sigeo

    2012-08-01

    We all use path routing everyday as we take shortcuts to avoid traffic jams, or by using faster traffic means. Previous models of traffic flow of RNA polymerase II (RNAPII) during transcription, however, were restricted to one dimension along the DNA template. Here we report the modeling and application of traffic flow in transcription that allows preferential paths of different dimensions only restricted to visit some transit points, as previously introduced between the 5' and 3' end of the gene. According to its position, an RNAPII protein molecule prefers paths obeying two types of time-evolution rules. One is an asymmetric simple exclusion process (ASEP) along DNA, and the other is a three-dimensional jump between transit points in DNA where RNAPIIs are staying. Simulations based on our model, and comparison experimental results, reveal how RNAPII molecules are distributed at the DNA-loop-formation-related protein binding sites as well as CTCF insulator proteins (or exons). As time passes after the stimulation, the RNAPII density at these sites becomes higher. Apparent far-distance jumps in one dimension are realized by short-range three-dimensional jumps between DNA loops. We confirm the above conjecture by applying our model calculation to the SAMD4A gene by comparing the experimental results. Our probabilistic model provides possible scenarios for assembling RNAPII molecules into transcription factories, where RNAPII and related proteins cooperatively transcribe DNA.

  15. CTCF and Cohesin in Genome Folding and Transcriptional Gene Regulation.

    PubMed

    Merkenschlager, Matthias; Nora, Elphège P

    2016-08-31

    Genome function, replication, integrity, and propagation rely on the dynamic structural organization of chromosomes during the cell cycle. Genome folding in interphase provides regulatory segmentation for appropriate transcriptional control, facilitates ordered genome replication, and contributes to genome integrity by limiting illegitimate recombination. Here, we review recent high-resolution chromosome conformation capture and functional studies that have informed models of the spatial and regulatory compartmentalization of mammalian genomes, and discuss mechanistic models for how CTCF and cohesin control the functional architecture of mammalian chromosomes.

  16. Mechanistically Distinct Pathways of Divergent Regulatory DNA Creation Contribute to Evolution of Human-Specific Genomic Regulatory Networks Driving Phenotypic Divergence of Homo sapiens.

    PubMed

    Glinsky, Gennadi V

    2016-09-19

    Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8-10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Genome-wide localization of exosome components to active promoters and chromatin insulators in Drosophila

    PubMed Central

    Lim, Su Jun; Boyle, Patrick J.; Chinen, Madoka; Dale, Ryan K.; Lei, Elissa P.

    2013-01-01

    Chromatin insulators are functionally conserved DNA–protein complexes situated throughout the genome that organize independent transcriptional domains. Previous work implicated RNA as an important cofactor in chromatin insulator activity, although the precise mechanisms are not yet understood. Here we identify the exosome, the highly conserved major cellular 3′ to 5′ RNA degradation machinery, as a physical interactor of CP190-dependent chromatin insulator complexes in Drosophila. Genome-wide profiling of exosome by ChIP-seq in two different embryonic cell lines reveals extensive and specific overlap with the CP190, BEAF-32 and CTCF insulator proteins. Colocalization occurs mainly at promoters but also boundary elements such as Mcp, Fab-8, scs and scs′, which overlaps with a promoter. Surprisingly, exosome associates primarily with promoters but not gene bodies of active genes, arguing against simple cotranscriptional recruitment to RNA substrates. Similar to insulator proteins, exosome is also significantly enriched at divergently transcribed promoters. Directed ChIP of exosome in cell lines depleted of insulator proteins shows that CTCF is required specifically for exosome association at Mcp and Fab-8 but not other sites, suggesting that alternate mechanisms must also contribute to exosome chromatin recruitment. Taken together, our results reveal a novel positive relationship between exosome and chromatin insulators throughout the genome. PMID:23358822

  18. Early de novo DNA methylation and prolonged demethylation in the muscle lineage.

    PubMed

    Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M; Song, Lingyun; Crawford, Gregory E; Myers, Richard M; Lacey, Michelle; Ehrlich, Melanie

    2013-03-01

    Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues.

  19. Early de novo DNA methylation and prolonged demethylation in the muscle lineage

    PubMed Central

    Tsumagari, Koji; Baribault, Carl; Terragni, Jolyon; Varley, Katherine E.; Gertz, Jason; Pradhan, Sirharsa; Badoo, Melody; Crain, Charlene M.; Song, Lingyun; Crawford, Gregory E.; Myers, Richard M.; Lacey, Michelle; Ehrlich, Melanie

    2013-01-01

    Myogenic cell cultures derived from muscle biopsies are excellent models for human cell differentiation. We report the first comprehensive analysis of myogenesis-specific DNA hyper- and hypo-methylation throughout the genome for human muscle progenitor cells (both myoblasts and myotubes) and skeletal muscle tissue vs. 30 non-muscle samples using reduced representation bisulfite sequencing. We also focused on four genes with extensive hyper- or hypo-methylation in the muscle lineage (PAX3, TBX1, MYH7B/MIR499 and OBSCN) to compare DNA methylation, DNaseI hypersensitivity, histone modification, and CTCF binding profiles. We found that myogenic hypermethylation was strongly associated with homeobox or T-box genes and muscle hypomethylation with contractile fiber genes. Nonetheless, there was no simple relationship between differential gene expression and myogenic differential methylation, rather only for subsets of these genes, such as contractile fiber genes. Skeletal muscle retained ~30% of the hypomethylated sites but only ~3% of hypermethylated sites seen in myogenic progenitor cells. By enzymatic assays, skeletal muscle was 2-fold enriched globally in genomic 5-hydroxymethylcytosine (5-hmC) vs. myoblasts or myotubes and was the only sample type enriched in 5-hmC at tested myogenic hypermethylated sites in PAX3/CCDC140 andTBX1. TET1 and TET2 RNAs, which are involved in generation of 5-hmC and DNA demethylation, were strongly upregulated in myoblasts and myotubes. Our findings implicate de novo methylation predominantly before the myoblast stage and demethylation before and after the myotube stage in control of transcription and co-transcriptional RNA processing. They also suggest that, in muscle, TET1 or TET2 are involved in active demethylation and in formation of stable 5-hmC residues. PMID:23417056

  20. A mechanistic link between gene regulation and genome architecture in mammalian development.

    PubMed

    Bonora, Giancarlo; Plath, Kathrin; Denholtz, Matthew

    2014-08-01

    The organization of chromatin within the nucleus and the regulation of transcription are tightly linked. Recently, mechanisms underlying this relationship have been uncovered. By defining the organizational hierarchy of the genome, determining changes in chromatin organization associated with changes in cell identity, and describing chromatin organization within the context of linear genomic features (such as chromatin modifications and transcription factor binding) and architectural proteins (including Cohesin, CTCF, and Mediator), a new paradigm in genome biology was established wherein genomes are organized around gene regulatory factors that govern cell identity. As such, chromatin organization plays a central role in establishing and maintaining cell state during development, with gene regulation and genome organization being mutually dependent effectors of cell identity. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells

    PubMed Central

    Malashchuk, Igor; Lajoie, Brian R.; Mardaryev, Andrei N.; Gdula, Michal R.; Sharov, Andrey A.; Kohwi-Shigematsu, Terumi; Fessing, Michael Y.

    2017-01-01

    Mammalian genomes contain several dozens of large (>0.5 Mbp) lineage-specific gene loci harbouring functionally related genes. However, spatial chromatin folding, organization of the enhancer-promoter networks and their relevance to Topologically Associating Domains (TADs) in these loci remain poorly understood. TADs are principle units of the genome folding and represents the DNA regions within which DNA interacts more frequently and less frequently across the TAD boundary. Here, we used Chromatin Conformation Capture Carbon Copy (5C) technology to characterize spatial chromatin interaction network in the 3.1 Mb Epidermal Differentiation Complex (EDC) locus harbouring 61 functionally related genes that show lineage-specific activation during terminal keratinocyte differentiation in the epidermis. 5C data validated by 3D-FISH demonstrate that the EDC locus is organized into several TADs showing distinct lineage-specific chromatin interaction networks based on their transcription activity and the gene-rich or gene-poor status. Correlation of the 5C results with genome-wide studies for enhancer-specific histone modifications (H3K4me1 and H3K27ac) revealed that the majority of spatial chromatin interactions that involves the gene-rich TADs at the EDC locus in keratinocytes include both intra- and inter-TAD interaction networks, connecting gene promoters and enhancers. Compared to thymocytes in which the EDC locus is mostly transcriptionally inactive, these interactions were found to be keratinocyte-specific. In keratinocytes, the promoter-enhancer anchoring regions in the gene-rich transcriptionally active TADs are enriched for the binding of chromatin architectural proteins CTCF, Rad21 and chromatin remodeler Brg1. In contrast to gene-rich TADs, gene-poor TADs show preferential spatial contacts with each other, do not contain active enhancers and show decreased binding of CTCF, Rad21 and Brg1 in keratinocytes. Thus, spatial interactions between gene promoters and enhancers at the multi-TAD EDC locus in skin epithelial cells are cell type-specific and involve extensive contacts within TADs as well as between different gene-rich TADs, forming the framework for lineage-specific transcription. PMID:28863138

  2. Robust k-mer frequency estimation using gapped k-mers

    PubMed Central

    Ghandi, Mahmoud; Mohammad-Noori, Morteza

    2013-01-01

    Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

  3. Robust k-mer frequency estimation using gapped k-mers.

    PubMed

    Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

    2014-08-01

    Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

  4. Enriching the international clinical nomenclature with Chinese daily used synonyms and concept recognition in physician notes.

    PubMed

    Zhang, Rui; Liu, Jialin; Huang, Yong; Wang, Miye; Shi, Qingke; Chen, Jun; Zeng, Zhi

    2017-05-02

    It has been shown that the entities in everyday clinical text are often expressed in a way that varies from how they are expressed in the nomenclature. Owing to lots of synonyms, abbreviations, medical jargons or even misspellings in the daily used physician notes in clinical information system (CIS), the terminology without enough synonyms may not be adequately suitable for the task of Chinese clinical term recognition. This paper demonstrates a validated system to retrieve the Chinese term of clinical finding (CTCF) from CIS and map them to the corresponding concepts of international clinical nomenclature, such as SNOMED CT. The system focuses on the SNOMED CT with Chinese synonyms enrichment (SCCSE). The literal similarity and the diagnosis-related similarity metrics were used for concept mapping. Two CTCF recognition methods, the rule- and terminology-based approach (RTBA) and the conditional random field machine learner (CRF), were adopted to identify the concepts in physician notes. The system was validated against the history of present illness annotated by clinical experts. The RTBA and CRF could be combined to predict new CTCFs besides SCCSE persistently. Around 59,000 CTCF candidates were accepted as valid and 39,000 of them occurred at least once in the history of present illness. 3,729 of them were accordant with the description in referenced Chinese clinical nomenclature, which could cross map to other international nomenclature such as SNOMED CT. With the hybrid similarity metrics, another 7,454 valid CTCFs (synonyms) were succeeded in concept mapping. For CTCF recognition in physician notes, a series of experiments were performed to find out the best CRF feature set, which gained an F-score of 0.887. The RTBA achieved a better F-score of 0.919 by the CTCF dictionary created in this research. This research demonstrated that it is feasible to help the SNOMED CT with Chinese synonyms enrichment based on physician notes in CIS. With continuous maintenance of SCCSE, the CTCFs could be precisely retrieved from free text, and the CTCFs arranged in semantic hierarchy of SNOMED CT could greatly improve the meaningful use of electronic health record in China. The methodology is also useful for clinical synonyms enrichment in other languages.

  5. Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains

    PubMed Central

    Ulianov, Sergey V.; Khrameeva, Ekaterina E.; Gavrilov, Alexey A.; Flyamer, Ilya M.; Kos, Pavel; Mikhaleva, Elena A.; Penin, Aleksey A.; Logacheva, Maria D.; Imakaev, Maxim V.; Chertovich, Alexander; Gelfand, Mikhail S.; Shevelyov, Yuri Y.; Razin, Sergey V.

    2016-01-01

    Recent advances enabled by the Hi-C technique have unraveled many principles of chromosomal folding that were subsequently linked to disease and gene regulation. In particular, Hi-C revealed that chromosomes of animals are organized into topologically associating domains (TADs), evolutionary conserved compact chromatin domains that influence gene expression. Mechanisms that underlie partitioning of the genome into TADs remain poorly understood. To explore principles of TAD folding in Drosophila melanogaster, we performed Hi-C and poly(A)+ RNA-seq in four cell lines of various origins (S2, Kc167, DmBG3-c2, and OSC). Contrary to previous studies, we find that regions between TADs (i.e., the inter-TADs and TAD boundaries) in Drosophila are only weakly enriched with the insulator protein dCTCF, while another insulator protein Su(Hw) is preferentially present within TADs. However, Drosophila inter-TADs harbor active chromatin and constitutively transcribed (housekeeping) genes. Accordingly, we find that binding of insulator proteins dCTCF and Su(Hw) predicts TAD boundaries much worse than active chromatin marks do. Interestingly, inter-TADs correspond to decompacted inter-bands of polytene chromosomes, whereas TADs mostly correspond to densely packed bands. Collectively, our results suggest that TADs are condensed chromatin domains depleted in active chromatin marks, separated by regions of active chromatin. We propose the mechanism of TAD self-assembly based on the ability of nucleosomes from inactive chromatin to aggregate, and lack of this ability in acetylated nucleosomal arrays. Finally, we test this hypothesis by polymer simulations and find that TAD partitioning may be explained by different modes of inter-nucleosomal interactions for active and inactive chromatin. PMID:26518482

  6. Normal breast tissue DNA methylation differences at regulatory elements are associated with the cancer risk factor age.

    PubMed

    Johnson, Kevin C; Houseman, E Andres; King, Jessica E; Christensen, Brock C

    2017-07-10

    The underlying biological mechanisms through which epidemiologically defined breast cancer risk factors contribute to disease risk remain poorly understood. Identification of the molecular changes associated with cancer risk factors in normal tissues may aid in determining the earliest events of carcinogenesis and informing cancer prevention strategies. Here we investigated the impact cancer risk factors have on the normal breast epigenome by analyzing DNA methylation genome-wide (Infinium 450 K array) in cancer-free women from the Susan G. Komen Tissue Bank (n = 100). We tested the relation of established breast cancer risk factors, age, body mass index, parity, and family history of disease, with DNA methylation adjusting for potential variation in cell-type proportions. We identified 787 cytosine-guanine dinucleotide (CpG) sites that demonstrated significant associations (Q value <0.01) with subject age. Notably, DNA methylation was not strongly associated with the other evaluated breast cancer risk factors. Age-related DNA methylation changes are primarily increases in methylation enriched at breast epithelial cell enhancer regions (P = 7.1E-20), and binding sites of chromatin remodelers (MYC and CTCF). We validated the age-related associations in two independent populations, using normal breast tissue samples (n = 18) and samples of normal tissue adjacent to tumor tissue (n = 97). The genomic regions classified as age-related were more likely to be regions altered in both pre-invasive (n = 40, P = 3.0E-03) and invasive breast tumors (n = 731, P = 1.1E-13). DNA methylation changes with age occur at regulatory regions, and are further exacerbated in cancer, suggesting that age influences breast cancer risk in part through its contribution to epigenetic dysregulation in normal breast tissue.

  7. Chromatin insulator elements: establishing barriers to set heterochromatin boundaries.

    PubMed

    Barkess, Gráinne; West, Adam G

    2012-02-01

    Epigenomic profiling has revealed that substantial portions of genomes in higher eukaryotes are organized into extensive domains of transcriptionally repressive chromatin. The boundaries of repressive chromatin domains can be fixed by DNA elements known as barrier insulators, to both shield neighboring gene expression and to maintain the integrity of chromosomal silencing. Here, we examine the current progress in identifying vertebrate barrier elements and their binding factors. We overview the design of the reporter assays used to define enhancer-blocking and barrier insulators. We look at the mechanisms vertebrate barrier proteins, such as USF1 and VEZF1, employ to counteract Polycomb- and heterochromatin-associated repression. We also undertake a critical analysis of whether CTCF could also act as a barrier protein. There is good evidence that barrier elements in vertebrates can form repressive chromatin domain boundaries. Future studies will determine whether barriers are frequently used to define repressive domain boundaries in vertebrates.

  8. Epigenetics of the myotonic dystrophy-associated DMPK gene neighborhood

    PubMed Central

    Buckley, Lauren; Lacey, Michelle; Ehrlich, Melanie

    2016-01-01

    Aim: Identify epigenetic marks in the vicinity of DMPK (linked to myotonic dystrophy, DM1) that help explain tissue-specific differences in its expression. Materials & methods: At DMPK and its flanking genes (DMWD, SIX5, BHMG1 and RSPH6A), we analyzed many epigenetic and transcription profiles from myoblasts, myotubes, skeletal muscle, heart and 30 nonmuscle samples. Results: In the DMPK gene neighborhood, muscle-associated DNA hypermethylation and hypomethylation, enhancer chromatin, and CTCF binding were seen. Myogenic DMPK hypermethylation correlated with high expression and decreased alternative promoter usage. Testis/sperm hypomethylation of BHMG1 and RSPH6A was associated with testis-specific expression. G-quadruplex (G4) motifs and sperm-specific hypomethylation were found near the DM1-linked CTG repeats within DMPK. Conclusion: Tissue-specific epigenetic features in DMPK and neighboring genes help regulate its expression. G4 motifs in DMPK DNA and RNA might contribute to DM1 pathology. PMID:26756355

  9. Gender specific association of TP53 polymorphisms (EX4 215G>C Arg72Pro, IVS3+40-41ins16, and IVS6+62G>A), with risk of oral cancer subtypes and overall survival of the patients.

    PubMed

    Nagam, Srivani L S S; Katta, Saritha; Prasad, Vidudala V T S

    2017-03-01

    Reports on the association of TP53 polymorphisms with oral cancer are not only limited but also not specific to site and/or gender. Hence, we examined the effect of TP53 polymorphisms (EX4 215G>C, IVS3+40-41ins16 and IVS6+62G>A) on buccal mucosa cancer (BMC) and tongue cancer (TC) risk, survival of patients in relation to risk and clinical factors, gender wise (excepting for estimating hazards ratio [HR]), using Fisher's Exact Test, Kaplan-Meier analysis, and Cox-proportional hazards models. The exonic polymorphism increased BMC and TC risk in males by 2-4-fold. The IVS3+40-41ins16 was protective against BMC and TC in both genders, whereas IVS6+62G>A protected only males against TC. Genotype combinations and haplotypes which altered the risk of cancers in males and females were different. TC males, aged 40-44 years and females, aged 55-59 years survived better than BMC patients. The IVS3+40-41ins16 polymorphism differentially impacted survival of female patients exposed to tobacco. TC patients with EX4 215GC with lymphovascular spread (LVS) and metastasis exhibited higher HR while, patients with EX4 215CC and perineural invasion (PNI) showed lower HR. Impact of the intronic variants along with clinical parameters on survival and HR estimates varied between BMC and TC. Our bioinformatics analysis revealed the presence of CTCF binding site within TP53 gene. In conclusion, the polymorphisms altered risk and survival of BMC and TC in a gender specific manner, which varied with mode of tobacco and/or alcohol use. The current study, therefore underscores strong need for research, stratified by tumor site and gender. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  10. Links between DNA methylation and nucleosome occupancy in the human genome.

    PubMed

    Collings, Clayton K; Anderson, John N

    2017-01-01

    DNA methylation is an epigenetic modification that is enriched in heterochromatin but depleted at active promoters and enhancers. However, the debate on whether or not DNA methylation is a reliable indicator of high nucleosome occupancy has not been settled. For example, the methylation levels of DNA flanking CTCF sites are higher in linker DNA than in nucleosomal DNA, while other studies have shown that the nucleosome core is the preferred site of methylation. In this study, we make progress toward understanding these conflicting phenomena by implementing a bioinformatics approach that combines MNase-seq and NOMe-seq data and by comprehensively profiling DNA methylation and nucleosome occupancy throughout the human genome. The results demonstrated that increasing methylated CpG density is correlated with nucleosome occupancy in the total genome and within nearly all subgenomic regions. Features with elevated methylated CpG density such as exons, SINE-Alu sequences, H3K36-trimethylated peaks, and methylated CpG islands are among the highest nucleosome occupied elements in the genome, while some of the lowest occupancies are displayed by unmethylated CpG islands and unmethylated transcription factor binding sites. Additionally, outside of CpG islands, the density of CpGs within nucleosomes was shown to be important for the nucleosomal location of DNA methylation with low CpG frequencies favoring linker methylation and high CpG frequencies favoring core particle methylation. Prominent exceptions to the correlations between methylated CpG density and nucleosome occupancy include CpG islands marked by H3K27me3 and CpG-poor heterochromatin marked by H3K9me3, and these modifications, along with DNA methylation, distinguish the major silencing mechanisms of the human epigenome. Thus, the relationship between DNA methylation and nucleosome occupancy is influenced by the density of methylated CpG dinucleotides and by other epigenomic components in chromatin.

  11. A pooling-based approach to mapping genetic variants associated with DNA methylation

    PubMed Central

    Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.; McEwen, Lisa M.; Kobor, Michael S.; Fraser, Hunter B.

    2015-01-01

    DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a truly genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. We found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data. PMID:25910490

  12. A pooling-based approach to mapping genetic variants associated with DNA methylation

    DOE PAGES

    Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.; ...

    2015-04-24

    DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a trulymore » genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. Here we found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data.« less

  13. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaplow, Irene M.; MacIsaac, Julia L.; Mah, Sarah M.

    DNA methylation is an epigenetic modification that plays a key role in gene regulation. Previous studies have investigated its genetic basis by mapping genetic variants that are associated with DNA methylation at specific sites, but these have been limited to microarrays that cover <2% of the genome and cannot account for allele-specific methylation (ASM). Other studies have performed whole-genome bisulfite sequencing on a few individuals, but these lack statistical power to identify variants associated with DNA methylation. We present a novel approach in which bisulfite-treated DNA from many individuals is sequenced together in a single pool, resulting in a trulymore » genome-wide map of DNA methylation. Compared to methods that do not account for ASM, our approach increases statistical power to detect associations while sharply reducing cost, effort, and experimental variability. As a proof of concept, we generated deep sequencing data from a pool of 60 human cell lines; we evaluated almost twice as many CpGs as the largest microarray studies and identified more than 2000 genetic variants associated with DNA methylation. Here we found that these variants are highly enriched for associations with chromatin accessibility and CTCF binding but are less likely to be associated with traits indirectly linked to DNA, such as gene expression and disease phenotypes. In summary, our approach allows genome-wide mapping of genetic variants associated with DNA methylation in any tissue of any species, without the need for individual-level genotype or methylation data.« less

  14. Long range epigenetic silencing is a trans-species mechanism that results in cancer specific deregulation by overriding the chromatin domains of normal cells.

    PubMed

    Forn, Marta; Muñoz, Mar; Tauriello, Daniele V F; Merlos-Suárez, Anna; Rodilla, Verónica; Bigas, Anna; Batlle, Eduard; Jordà, Mireia; Peinado, Miguel A

    2013-12-01

    DNA methylation and chromatin remodeling are frequently implicated in the silencing of genes involved in carcinogenesis. Long Range Epigenetic Silencing (LRES) is a mechanism of gene inactivation that affects multiple contiguous CpG islands and has been described in different human cancer types. However, it is unknown whether there is a coordinated regulation of the genes embedded in these regions in normal cells and in early stages of tumor progression. To better characterize the molecular events associated with the regulation and remodeling of these regions we analyzed two regions undergoing LRES in human colon cancer in the mouse model. We demonstrate that LRES also occurs in murine cancer in vivo and mimics the molecular features of the human phenomenon, namely, downregulation of gene expression, acquisition of inactive histone marks, and DNA hypermethylation of specific CpG islands. The genes embedded in these regions showed a dynamic and autonomous regulation during mouse intestinal cell differentiation, indicating that, in the framework considered here, the coordinated regulation in LRES is restricted to cancer. Unexpectedly, benign adenomas in Apc(Min/+) mice showed overexpression of most of the genes affected by LRES in cancer, which suggests that the repressive remodeling of the region is a late event. Chromatin immunoprecipitation analysis of the transcriptional insulator CTCF in mouse colon cancer cells revealed disrupted chromatin domain boundaries as compared with normal cells. Malignant regression of cancer cells by in vitro differentiation resulted in partial reversion of LRES and gain of CTCF binding. We conclude that genes in LRES regions are plastically regulated in cell differentiation and hyperproliferation, but are constrained to a coordinated repression by abolishing boundaries and the autonomous regulation of chromatin domains in cancer cells. Copyright © 2013 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  15. The nucleoplasmin homolog NLP mediates centromere clustering and anchoring to the nucleolus.

    PubMed

    Padeken, Jan; Mendiburo, María José; Chlamydas, Sarantis; Schwarz, Hans-Jürgen; Kremmer, Elisabeth; Heun, Patrick

    2013-04-25

    Centromere clustering during interphase is a phenomenon known to occur in many different organisms and cell types, yet neither the factors involved nor their physiological relevance is well understood. Using Drosophila tissue culture cells and flies, we identified a network of proteins, including the nucleoplasmin-like protein (NLP), the insulator protein CTCF, and the nucleolus protein Modulo, to be essential for the positioning of centromeres. Artificial targeting further demonstrated that NLP and CTCF are sufficient for clustering, while Modulo serves as the anchor to the nucleolus. Centromere clustering was found to depend on centric chromatin rather than specific DNA sequences. Moreover, unclustering of centromeres results in the spatial destabilization of pericentric heterochromatin organization, leading to partial defects in the silencing of repetitive elements, defects during chromosome segregation, and genome instability. Copyright © 2013 Elsevier Inc. All rights reserved.

  16. FMR1 Epigenetic Silencing Commonly Occurs in Undifferentiated Fragile X-Affected Embryonic Stem Cells

    PubMed Central

    Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

    2014-01-01

    Summary Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5′-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases. PMID:25418717

  17. FMR1 epigenetic silencing commonly occurs in undifferentiated fragile X-affected embryonic stem cells.

    PubMed

    Avitzour, Michal; Mor-Shaked, Hagar; Yanovsky-Dagan, Shira; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Eldar-Geva, Talia; Schonberger, Oshrat; Levy-Lahad, Ephrat; Epsztejn-Litman, Silvina; Eiges, Rachel

    2014-11-11

    Fragile X syndrome (FXS) is the most common heritable form of cognitive impairment. It results from epigenetic silencing of the X-linked FMR1 gene by a CGG expansion in its 5'-untranslated region. Taking advantage of a large set of FXS-affected human embryonic stem cell (HESC) lines and isogenic subclones derived from them, we show that FMR1 hypermethylation commonly occurs in the undifferentiated state (six of nine lines, ranging from 24% to 65%). In addition, we demonstrate that hypermethylation is tightly linked with FMR1 transcriptional inactivation in undifferentiated cells, coincides with loss of H3K4me2 and gain of H3K9me3, and is unrelated to CTCF binding. Taken together, these results demonstrate that FMR1 epigenetic gene silencing takes place in FXS HESCs and clearly highlights the importance of examining multiple cell lines when investigating FXS and most likely other epigenetically regulated diseases.

  18. An integrated 3-Dimensional Genome Modeling Engine for data-driven simulation of spatial genome organization.

    PubMed

    Szałaj, Przemysław; Tang, Zhonghui; Michalski, Paul; Pietal, Michal J; Luo, Oscar J; Sadowski, Michał; Li, Xingwang; Radew, Kamen; Ruan, Yijun; Plewczynski, Dariusz

    2016-12-01

    ChIA-PET is a high-throughput mapping technology that reveals long-range chromatin interactions and provides insights into the basic principles of spatial genome organization and gene regulation mediated by specific protein factors. Recently, we showed that a single ChIA-PET experiment provides information at all genomic scales of interest, from the high-resolution locations of binding sites and enriched chromatin interactions mediated by specific protein factors, to the low resolution of nonenriched interactions that reflect topological neighborhoods of higher-order chromosome folding. This multilevel nature of ChIA-PET data offers an opportunity to use multiscale 3D models to study structural-functional relationships at multiple length scales, but doing so requires a structural modeling platform. Here, we report the development of 3D-GNOME (3-Dimensional Genome Modeling Engine), a complete computational pipeline for 3D simulation using ChIA-PET data. 3D-GNOME consists of three integrated components: a graph-distance-based heat map normalization tool, a 3D modeling platform, and an interactive 3D visualization tool. Using ChIA-PET and Hi-C data derived from human B-lymphocytes, we demonstrate the effectiveness of 3D-GNOME in building 3D genome models at multiple levels, including the entire genome, individual chromosomes, and specific segments at megabase (Mb) and kilobase (kb) resolutions of single average and ensemble structures. Further incorporation of CTCF-motif orientation and high-resolution looping patterns in 3D simulation provided additional reliability of potential biologically plausible topological structures. © 2016 Szałaj et al.; Published by Cold Spring Harbor Laboratory Press.

  19. BORIS/CTCFL mRNA isoform expression and epigenetic regulation in epithelial ovarian cancer

    PubMed Central

    Link, Petra A.; Zhang, Wa; Odunsi, Kunle; Karpf, Adam R.

    2013-01-01

    Cancer germline (CG) genes are normally expressed in germ cells and aberrantly expressed in a variety of cancers; their immunogenicity has led to the widespread development of cancer vaccines targeting these antigens. BORIS/CTCFL is an autosomal CG antigen and promising cancer vaccine target. BORIS is the only known paralog of CTCF, a gene intimately involved in genomic imprinting, chromatin insulation, and nuclear regulation. We have previously shown that BORIS is expressed in epithelial ovarian cancer (EOC) and that its expression coincides with promoter and global DNA hypomethylation. Recently, 23 different BORIS mRNA variants have been described, and have been functionally grouped into six BORIS isoform families (sf1–sf6). In the present study, we have characterized the expression of BORIS isoform families in normal ovary (NO) and EOC, the latter of which were selected to include two groups with widely varying global DNA methylation status. We find selective expression of BORIS isoform families in NO, which becomes altered in EOC, primarily by the activation of BORIS sf1 in EOC. When comparing EOC samples based on methylation status, we find that BORIS sf1 and sf2 isoform families are selectively activated in globally hypomethylated tumors. In contrast, CTCF is downregulated in EOC, and the ratio of BORIS sf1, sf2, and sf6 isoform families as a function of CTCF is elevated in hypomethylated tumors. Finally, the expression of all BORIS isoform families was induced to varying extents by epigenetic modulatory drugs in EOC cell lines, particularly when DNMT and HDAC inhibitors were used in combination. PMID:23390377

  20. Integrated pathway-based approach identifies association between genomic regions at CTCF and CACNB2 and schizophrenia.

    PubMed

    Juraeva, Dilafruz; Haenisch, Britta; Zapatka, Marc; Frank, Josef; Witt, Stephanie H; Mühleisen, Thomas W; Treutlein, Jens; Strohmaier, Jana; Meier, Sandra; Degenhardt, Franziska; Giegling, Ina; Ripke, Stephan; Leber, Markus; Lange, Christoph; Schulze, Thomas G; Mössner, Rainald; Nenadic, Igor; Sauer, Heinrich; Rujescu, Dan; Maier, Wolfgang; Børglum, Anders; Ophoff, Roel; Cichon, Sven; Nöthen, Markus M; Rietschel, Marcella; Mattheisen, Manuel; Brors, Benedikt

    2014-06-01

    In the present study, an integrated hierarchical approach was applied to: (1) identify pathways associated with susceptibility to schizophrenia; (2) detect genes that may be potentially affected in these pathways since they contain an associated polymorphism; and (3) annotate the functional consequences of such single-nucleotide polymorphisms (SNPs) in the affected genes or their regulatory regions. The Global Test was applied to detect schizophrenia-associated pathways using discovery and replication datasets comprising 5,040 and 5,082 individuals of European ancestry, respectively. Information concerning functional gene-sets was retrieved from the Kyoto Encyclopedia of Genes and Genomes, Gene Ontology, and the Molecular Signatures Database. Fourteen of the gene-sets or pathways identified in the discovery dataset were confirmed in the replication dataset. These include functional processes involved in transcriptional regulation and gene expression, synapse organization, cell adhesion, and apoptosis. For two genes, i.e. CTCF and CACNB2, evidence for association with schizophrenia was available (at the gene-level) in both the discovery study and published data from the Psychiatric Genomics Consortium schizophrenia study. Furthermore, these genes mapped to four of the 14 presently identified pathways. Several of the SNPs assigned to CTCF and CACNB2 have potential functional consequences, and a gene in close proximity to CACNB2, i.e. ARL5B, was identified as a potential gene of interest. Application of the present hierarchical approach thus allowed: (1) identification of novel biological gene-sets or pathways with potential involvement in the etiology of schizophrenia, as well as replication of these findings in an independent cohort; (2) detection of genes of interest for future follow-up studies; and (3) the highlighting of novel genes in previously reported candidate regions for schizophrenia.

  1. Architectural protein subclasses shape 3-D organization of genomes during lineage commitment

    PubMed Central

    Phillips-Cremins, Jennifer E.; Sauria, Michael E. G.; Sanyal, Amartya; Gerasimova, Tatiana I.; Lajoie, Bryan R.; Bell, Joshua S. K.; Ong, Chin-Tong; Hookway, Tracy A.; Guo, Changying; Sun, Yuhua; Bland, Michael J.; Wagstaff, William; Dalton, Stephen; McDevitt, Todd C.; Sen, Ranjan; Dekker, Job; Taylor, James; Corces, Victor G.

    2013-01-01

    Summary Understanding the topological configurations of chromatin may reveal valuable insights into how the genome and epigenome act in concert to control cell fate during development. Here we generate high-resolution architecture maps across seven genomic loci in embryonic stem cells and neural progenitor cells. We observe a hierarchy of 3-D interactions that undergo marked reorganization at the sub-Mb scale during differentiation. Distinct combinations of CTCF, Mediator, and cohesin show widespread enrichment in looping interactions at different length scales. CTCF/cohesin anchor long-range constitutive interactions that form the topological basis for invariant sub-domains. Conversely, Mediator/cohesin together with pioneer factors bridge shortrange enhancer-promoter interactions within and between larger sub-domains. Knockdown of Smc1 or Med12 in ES cells results in disruption of spatial architecture and down-regulation of genes found in cohesin-mediated interactions. We conclude that cell type-specific chromatin organization occurs at the sub-Mb scale and that architectural proteins shape the genome in hierarchical length scales. PMID:23706625

  2. Sub-kb Hi-C in D. melanogaster reveals conserved characteristics of TADs between insect and mammalian cells.

    PubMed

    Wang, Qi; Sun, Qiu; Czajkowsky, Daniel M; Shao, Zhifeng

    2018-01-15

    Topologically associating domains (TADs) are fundamental elements of the eukaryotic genomic structure. However, recent studies suggest that the insulating complexes, CTCF/cohesin, present at TAD borders in mammals are absent from those in Drosophila melanogaster, raising the possibility that border elements are not conserved among metazoans. Using in situ Hi-C with sub-kb resolution, here we show that the D. melanogaster genome is almost completely partitioned into >4000 TADs, nearly sevenfold more than previously identified. The overwhelming majority of these TADs are demarcated by the insulator complexes, BEAF-32/CP190, or BEAF-32/Chromator, indicating that these proteins may play an analogous role in flies as that of CTCF/cohesin in mammals. Moreover, extended regions previously thought to be unstructured are shown to consist of small contiguous TADs, a property also observed in mammals upon re-examination. Altogether, our work demonstrates that fundamental features associated with the higher-order folding of the genome are conserved from insects to mammals.

  3. Investigation of fusion gene expression in HCT116 cells.

    PubMed

    Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

    2017-12-01

    Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2) , EIF3E(e1)-RSPO2(e3) , PTPRK(e1)-RSPO3(e2) , PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E , RSPO2 , PTPRK , RSPO3 , TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma.

  4. Investigation of fusion gene expression in HCT116 cells

    PubMed Central

    Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

    2017-01-01

    Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2), EIF3E(e1)-RSPO2(e3), PTPRK(e1)-RSPO3(e2), PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E, RSPO2, PTPRK, RSPO3, TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma. PMID:29181107

  5. Long-lasting alterations to DNA methylation and ncRNAs could underlie the effects of fetal alcohol exposure in mice

    PubMed Central

    Laufer, Benjamin I.; Mantha, Katarzyna; Kleiber, Morgan L.; Diehl, Eric J.; Addison, Sean M. F.; Singh, Shiva M.

    2013-01-01

    SUMMARY Fetal alcohol spectrum disorders (FASDs) are characterized by life-long changes in gene expression, neurodevelopment and behavior. What mechanisms initiate and maintain these changes are not known, but current research suggests a role for alcohol-induced epigenetic changes. In this study we assessed alterations to adult mouse brain tissue by assaying DNA cytosine methylation and small noncoding RNA (ncRNA) expression, specifically the microRNA (miRNA) and small nucleolar RNA (snoRNA) subtypes. We found long-lasting alterations in DNA methylation as a result of fetal alcohol exposure, specifically in the imprinted regions of the genome harboring ncRNAs and sequences interacting with regulatory proteins. A large number of major nodes from the identified networks, such as Pten signaling, contained transcriptional repressor CTCF-binding sites in their promoters, illustrating the functional consequences of alcohol-induced changes to DNA methylation. Next, we assessed ncRNA expression using two independent array platforms and quantitative PCR. The results identified 34 genes that are targeted by the deregulated miRNAs. Of these, four (Pten, Nmnat1, Slitrk2 and Otx2) were viewed as being crucial in the context of FASDs given their roles in the brain. Furthermore, ∼20% of the altered ncRNAs mapped to three imprinted regions (Snrpn-Ube3a, Dlk1-Dio3 and Sfmbt2) that showed differential methylation and have been previously implicated in neurodevelopmental disorders. The findings of this study help to expand on the mechanisms behind the long-lasting changes in the brain transcriptome of FASD individuals. The observed changes could contribute to the initiation and maintenance of the long-lasting effect of alcohol. PMID:23580197

  6. ClusterTAD: an unsupervised machine learning approach to detecting topologically associated domains of chromosomes from Hi-C data.

    PubMed

    Oluwadare, Oluwatosin; Cheng, Jianlin

    2017-11-14

    With the development of chromosomal conformation capturing techniques, particularly, the Hi-C technique, the study of the spatial conformation of a genome is becoming an important topic in bioinformatics and computational biology. The Hi-C technique can generate genome-wide chromosomal interaction (contact) data, which can be used to investigate the higher-level organization of chromosomes, such as Topologically Associated Domains (TAD), i.e., locally packed chromosome regions bounded together by intra chromosomal contacts. The identification of the TADs for a genome is useful for studying gene regulation, genomic interaction, and genome function. Here, we formulate the TAD identification problem as an unsupervised machine learning (clustering) problem, and develop a new TAD identification method called ClusterTAD. We introduce a novel method to represent chromosomal contacts as features to be used by the clustering algorithm. Our results show that ClusterTAD can accurately predict the TADs on a simulated Hi-C data. Our method is also largely complementary and consistent with existing methods on the real Hi-C datasets of two mouse cells. The validation with the chromatin immunoprecipitation (ChIP) sequencing (ChIP-Seq) data shows that the domain boundaries identified by ClusterTAD have a high enrichment of CTCF binding sites, promoter-related marks, and enhancer-related histone modifications. As ClusterTAD is based on a proven clustering approach, it opens a new avenue to apply a large array of clustering methods developed in the machine learning field to the TAD identification problem. The source code, the results, and the TADs generated for the simulated and real Hi-C datasets are available here: https://github.com/BDM-Lab/ClusterTAD .

  7. Transcriptomic data from panarthropods shed new light on the evolution of insulator binding proteins in insects : Insect insulator proteins.

    PubMed

    Pauli, Thomas; Vedder, Lucia; Dowling, Daniel; Petersen, Malte; Meusemann, Karen; Donath, Alexander; Peters, Ralph S; Podsiadlowski, Lars; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Heger, Peter; Wiehe, Thomas; Hering, Lars; Mayer, Georg; Misof, Bernhard; Niehuis, Oliver

    2016-11-03

    Body plan development in multi-cellular organisms is largely determined by homeotic genes. Expression of homeotic genes, in turn, is partially regulated by insulator binding proteins (IBPs). While only a few enhancer blocking IBPs have been identified in vertebrates, the common fruit fly Drosophila melanogaster harbors at least twelve different enhancer blocking IBPs. We screened recently compiled insect transcriptomes from the 1KITE project and genomic and transcriptomic data from public databases, aiming to trace the origin of IBPs in insects and other arthropods. Our study shows that the last common ancestor of insects (Hexapoda) already possessed a substantial number of IBPs. Specifically, of the known twelve insect IBPs, at least three (i.e., CP190, Su(Hw), and CTCF) already existed prior to the evolution of insects. Furthermore we found GAF orthologs in early branching insect orders, including Zygentoma (silverfish and firebrats) and Diplura (two-pronged bristletails). Mod(mdg4) is most likely a derived feature of Neoptera, while Pita is likely an evolutionary novelty of holometabolous insects. Zw5 appears to be restricted to schizophoran flies, whereas BEAF-32, ZIPIC and the Elba complex, are probably unique to the genus Drosophila. Selection models indicate that insect IBPs evolved under neutral or purifying selection. Our results suggest that a substantial number of IBPs either pre-date the evolution of insects or evolved early during insect evolution. This suggests an evolutionary history of insulator binding proteins in insects different to that previously thought. Moreover, our study demonstrates the versatility of the 1KITE transcriptomic data for comparative analyses in insects and other arthropods.

  8. Effect of alcohol consumption on CpG methylation in the differentially methylated regions of H19 and IG-DMR in male gametes: implications for fetal alcohol spectrum disorders.

    PubMed

    Ouko, Lillian A; Shantikumar, Katpaham; Knezovich, Jaysen; Haycock, Philip; Schnugh, Desmond J; Ramsay, Michèle

    2009-09-01

    Exposure to alcohol in utero is the main attributable cause of fetal alcohol spectrum disorders (FASD) which in its most severe form is characterized by irreversible behavioral and cognitive disability. Paternal preconception drinking is not considered to be a significant risk factor, even though animal studies have demonstrated that chronic paternal alcohol consumption has a detrimental effect on the physical and mental development of offspring even in the absence of in utero alcohol exposure. It has been documented that alcohol can reduce the levels and activity of DNA methyltransferases resulting in DNA hypomethylation and that reduced methyltransferase activity can cause activation of normally silenced genes. The aim of this study was to establish a link between alcohol use in men and hypomethylation of paternally imprinted loci in sperm DNA in genomic regions critical for embryonic development, thus providing a mechanism for paternal effects in the aetiology of FASD. Sperm DNA from male volunteers was bisulfite treated and the methylation patterns of 2 differentially methylated regions (DMRs), H19 and IG-DMR, analyzed following sequencing of individual clones. The methylation patterns were correlated with the alcohol consumption levels of the volunteer males. There was a pattern of increased demethylation with alcohol consumption at the 2 imprinted loci with a significant difference observed at the IG-DMR between the nondrinking and heavy alcohol consuming groups. Greater inter-individual variation in average methylation was observed at the H19 DMR and individual clones were more extensively demethylated than those of the IG-DMR. CpG site #4 in the IG-DMR was preferentially demethylated among all individuals and along with the H19 DMR CpG site #7 located within the CTCF binding site 6 showed significant demethylation in the alcohol consuming groups compared with the control group. This study demonstrates a correlation between chronic alcohol use and demethylation of normally hypermethylated imprinted regions in sperm DNA. We hypothesize that, should these epigenetic changes in imprinted genes be transmitted through fertilization, they would alter the critical gene expression dosages required for normal prenatal development resulting in offspring with features of FASD.

  9. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription

    PubMed Central

    Stefanovsky, Victor Y.; Tremblay, Michel G.; Lindsay, Helen; Robinson, Mark D.

    2017-01-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes. PMID:28715449

  10. A unique enhancer boundary complex on the mouse ribosomal RNA genes persists after loss of Rrn3 or UBF and the inactivation of RNA polymerase I transcription.

    PubMed

    Herdman, Chelsea; Mars, Jean-Clement; Stefanovsky, Victor Y; Tremblay, Michel G; Sabourin-Felix, Marianne; Lindsay, Helen; Robinson, Mark D; Moss, Tom

    2017-07-01

    Transcription of the several hundred of mouse and human Ribosomal RNA (rRNA) genes accounts for the majority of RNA synthesis in the cell nucleus and is the determinant of cytoplasmic ribosome abundance, a key factor in regulating gene expression. The rRNA genes, referred to globally as the rDNA, are clustered as direct repeats at the Nucleolar Organiser Regions, NORs, of several chromosomes, and in many cells the active repeats are transcribed at near saturation levels. The rDNA is also a hotspot of recombination and chromosome breakage, and hence understanding its control has broad importance. Despite the need for a high level of rDNA transcription, typically only a fraction of the rDNA is transcriptionally active, and some NORs are permanently silenced by CpG methylation. Various chromatin-remodelling complexes have been implicated in counteracting silencing to maintain rDNA activity. However, the chromatin structure of the active rDNA fraction is still far from clear. Here we have combined a high-resolution ChIP-Seq protocol with conditional inactivation of key basal factors to better understand what determines active rDNA chromatin. The data resolve questions concerning the interdependence of the basal transcription factors, show that preinitiation complex formation is driven by the architectural factor UBF (UBTF) independently of transcription, and that RPI termination and release corresponds with the site of TTF1 binding. They further reveal the existence of an asymmetric Enhancer Boundary Complex formed by CTCF and Cohesin and flanked upstream by phased nucleosomes and downstream by an arrested RNA Polymerase I complex. We find that the Enhancer Boundary Complex is the only site of active histone modification in the 45kbp rDNA repeat. Strikingly, it not only delimits each functional rRNA gene, but also is stably maintained after gene inactivation and the re-establishment of surrounding repressive chromatin. Our data define a poised state of rDNA chromatin and place the Enhancer Boundary Complex as the likely entry point for chromatin remodelling complexes.

  11. Gamma-aminobutyric acid-modulated benzodiazepine binding sites in bacteria

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lummis, S.C.R.; Johnston, G.A.R.; Nicoletti, G.

    1991-01-01

    Benzodiazepine binding sites, which were once considered to exist only in higher vertebrates, are here demonstrated in the bacteria E. coli. The bacterial ({sup 3}H)diazepam binding sites are modulated by GABA; the modulation is dose dependent and is reduced at high concentrations. The most potent competitors of E.Coli ({sup 3}H)diazepam binding are those that are active in displacing ({sup 3}H)benzodiazepines from vertebrate peripheral benzodiazepine binding sites. These vertebrate sites are not modulated by GABA, in contrast to vertebrate neuronal benzodiazepine binding sites. The E.coli benzodiazepine binding sites therefore differ from both classes of vertebrate benzodiazepine binding sites; however the ligandmore » spectrum and GABA-modulatory properties of the E.coli sites are similar to those found in insects. This intermediate type of receptor in lower species suggests a precursor for at least one class of vertebrate benzodiazepine binding sites may have existed.« less

  12. Multiple binding sites for transcriptional repressors can produce regular bursting and enhance noise suppression

    NASA Astrophysics Data System (ADS)

    Lengyel, Iván M.; Morelli, Luis G.

    2017-04-01

    Cells may control fluctuations in protein levels by means of negative autoregulation, where transcription factors bind DNA sites to repress their own production. Theoretical studies have assumed a single binding site for the repressor, while in most species it is found that multiple binding sites are arranged in clusters. We study a stochastic description of negative autoregulation with multiple binding sites for the repressor. We find that increasing the number of binding sites induces regular bursting of gene products. By tuning the threshold for repression, we show that multiple binding sites can also suppress fluctuations. Our results highlight possible roles for the presence of multiple binding sites of negative autoregulators.

  13. CTCF, a Novel Regulator of Alternative Splicing | Center for Cancer Research

    Cancer.gov

    Alternative splicing, or the inclusion of different patterns of exons from the same gene, plays an important role in expanding the coding possibilities of a limited genome. The immune system is an ideal system to study this since alternative splicing is used to generate an almost unlimited number of antibodies against any pathogen we might encounter.

  14. Characterization of nicotine binding to the rat brain P/sub 2/ preparation: the identification of multiple binding sites which include specific up-regulatory site(s)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sloan, J.W.

    1984-01-01

    These studies show that nicotine binds to the rat brain P/sub 2/ preparation by saturable and reversible processes. Multiple binding sites were revealed by the configuration of saturation, kinetic and Scatchard plots. A least squares best fit of Scatchard data using nonlinear curve fitting programs confirmed the presence of a very high affinity site, an up-regulatory site, a high affinity site and one or two low affinity sites. Stereospecificity was demonstrated for the up-regulatory site where (+)-nicotine was more effective and for the high affinity site where (-)-nicotine had a higher affinity. Drugs which selectively up-regulate nicotine binding site(s) havemore » been identified. Further, separate very high and high affinity sites were identified for (-)- and (+)-(/sup 3/H)nicotine, based on evidence that the site density for the (-)-isomer is 10 times greater than that for the (+)-isomer at these sites. Enhanced nicotine binding has been shown to be a statistically significant phenomenon which appears to be a consequence of drugs binding to specific site(s) which up-regulate binding at other site(s). Although Scatchard and Hill plots indicate positive cooperatively, up-regulation more adequately describes the function of these site(s). A separate up-regulatory site is suggested by the following: (1) Drugs vary markedly in their ability to up-regulate binding. (2) Both the affinity and the degree of up-regulation can be altered by structural changes in ligands. (3) Drugs with specificity for up-regulation have been identified. (4) Some drugs enhance binding in a dose-related manner. (5) Competition studies employing cold (-)- and (+)-nicotine against (-)- and (+)-(/sup 3/H)nicotine show that the isomers bind to separate sites which up-regulate binding at the (-)- and (+)-nicotine high affinity sites and in this regard (+)-nicotine is more specific and efficacious than (-)-nicotine.« less

  15. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  16. Deconvoluting AMP-activated protein kinase (AMPK) adenine nucleotide binding and sensing

    PubMed Central

    Gu, Xin; Yan, Yan; Novick, Scott J.; Kovach, Amanda; Goswami, Devrishi; Ke, Jiyuan; Tan, M. H. Eileen; Wang, Lili; Li, Xiaodan; de Waal, Parker W.; Webb, Martin R.; Griffin, Patrick R.; Xu, H. Eric

    2017-01-01

    AMP-activated protein kinase (AMPK) is a central cellular energy sensor that adapts metabolism and growth to the energy state of the cell. AMPK senses the ratio of adenine nucleotides (adenylate energy charge) by competitive binding of AMP, ADP, and ATP to three sites (CBS1, CBS3, and CBS4) in its γ-subunit. Because these three binding sites are functionally interconnected, it remains unclear how nucleotides bind to individual sites, which nucleotides occupy each site under physiological conditions, and how binding to one site affects binding to the other sites. Here, we comprehensively analyze nucleotide binding to wild-type and mutant AMPK protein complexes by quantitative competition assays and by hydrogen-deuterium exchange MS. We also demonstrate that NADPH, in addition to the known AMPK ligand NADH, directly and competitively binds AMPK at the AMP-sensing CBS3 site. Our findings reveal how AMP binding to one site affects the conformation and adenine nucleotide binding at the other two sites and establish CBS3, and not CBS1, as the high affinity exchangeable AMP/ADP/ATP-binding site. We further show that AMP binding at CBS4 increases AMP binding at CBS3 by 2 orders of magnitude and reverses the AMP/ATP preference of CBS3. Together, these results illustrate how the three CBS sites collaborate to enable highly sensitive detection of cellular energy states to maintain the tight ATP homeostastis required for cellular metabolism. PMID:28615457

  17. An Electrostatic Funnel in the GABA-Binding Pathway

    PubMed Central

    Lightstone, Felice C.

    2016-01-01

    The γ-aminobutyric acid type A receptor (GABAA-R) is a major inhibitory neuroreceptor that is activated by the binding of GABA. The structure of the GABAA-R is well characterized, and many of the binding site residues have been identified. However, most of these residues are obscured behind the C-loop that acts as a cover to the binding site. Thus, the mechanism by which the GABA molecule recognizes the binding site, and the pathway it takes to enter the binding site are both unclear. Through the completion and detailed analysis of 100 short, unbiased, independent molecular dynamics simulations, we have investigated this phenomenon of GABA entering the binding site. In each system, GABA was placed quasi-randomly near the binding site of a GABAA-R homology model, and atomistic simulations were carried out to observe the behavior of the GABA molecules. GABA fully entered the binding site in 19 of the 100 simulations. The pathway taken by these molecules was consistent and non-random; the GABA molecules approach the binding site from below, before passing up behind the C-loop and into the binding site. This binding pathway is driven by long-range electrostatic interactions, whereby the electrostatic field acts as a ‘funnel’ that sweeps the GABA molecules towards the binding site, at which point more specific atomic interactions take over. These findings define a nuanced mechanism whereby the GABAA-R uses the general zwitterionic features of the GABA molecule to identify a potential ligand some 2 nm away from the binding site. PMID:27119953

  18. Modeling Complex Equilibria in ITC Experiments: Thermodynamic Parameters Estimation for a Three Binding Site Model

    PubMed Central

    Le, Vu H.; Buscaglia, Robert; Chaires, Jonathan B.; Lewis, Edwin A.

    2013-01-01

    Isothermal Titration Calorimetry, ITC, is a powerful technique that can be used to estimate a complete set of thermodynamic parameters (e.g. Keq (or ΔG), ΔH, ΔS, and n) for a ligand binding interaction described by a thermodynamic model. Thermodynamic models are constructed by combination of equilibrium constant, mass balance, and charge balance equations for the system under study. Commercial ITC instruments are supplied with software that includes a number of simple interaction models, for example one binding site, two binding sites, sequential sites, and n-independent binding sites. More complex models for example, three or more binding sites, one site with multiple binding mechanisms, linked equilibria, or equilibria involving macromolecular conformational selection through ligand binding need to be developed on a case by case basis by the ITC user. In this paper we provide an algorithm (and a link to our MATLAB program) for the non-linear regression analysis of a multiple binding site model with up to four overlapping binding equilibria. Error analysis demonstrates that fitting ITC data for multiple parameters (e.g. up to nine parameters in the three binding site model) yields thermodynamic parameters with acceptable accuracy. PMID:23262283

  19. A tool for calculating binding-site residues on proteins from PDB structures.

    PubMed

    Hu, Jing; Yan, Changhui

    2009-08-03

    In the research on protein functional sites, researchers often need to identify binding-site residues on a protein. A commonly used strategy is to find a complex structure from the Protein Data Bank (PDB) that consists of the protein of interest and its interacting partner(s) and calculate binding-site residues based on the complex structure. However, since a protein may participate in multiple interactions, the binding-site residues calculated based on one complex structure usually do not reveal all binding sites on a protein. Thus, this requires researchers to find all PDB complexes that contain the protein of interest and combine the binding-site information gleaned from them. This process is very time-consuming. Especially, combing binding-site information obtained from different PDB structures requires tedious work to align protein sequences. The process becomes overwhelmingly difficult when researchers have a large set of proteins to analyze, which is usually the case in practice. In this study, we have developed a tool for calculating binding-site residues on proteins, TCBRP http://yanbioinformatics.cs.usu.edu:8080/ppbindingsubmit. For an input protein, TCBRP can quickly find all binding-site residues on the protein by automatically combining the information obtained from all PDB structures that consist of the protein of interest. Additionally, TCBRP presents the binding-site residues in different categories according to the interaction type. TCBRP also allows researchers to set the definition of binding-site residues. The developed tool is very useful for the research on protein binding site analysis and prediction.

  20. Mutation of the C/EBP binding sites in the Rous sarcoma virus long terminal repeat and gag enhancers.

    PubMed Central

    Ryden, T A; de Mars, M; Beemon, K

    1993-01-01

    Several C/EBP binding sites within the Rous sarcoma virus (RSV) long terminal repeat (LTR) and gag enhancers were mutated, and the effect of these mutations on viral gene expression was assessed. Minimal site-specific mutations in each of three adjacent C/EBP binding sites in the LTR reduced steady-state viral RNA levels. Double mutation of the two 5' proximal LTR binding sites resulted in production of 30% of wild-type levels of virus. DNase I footprinting analysis of mutant DNAs indicated that the mutations blocked C/EBP binding at the affected sites. Additional C/EBP binding sites were identified upstream of the 3' LTR and within the 5' end of the LTRs. Point mutations in the RSV gag intragenic enhancer region, which blocked binding of C/EBP at two of three adjacent C/EBP sites, also reduced virus production significantly. Nuclear extracts prepared from both chicken embryo fibroblasts (CEFs) and chicken muscle contained proteins binding to the same RSV DNA sites as did C/EBP, and mutations that prevented C/EBP binding also blocked binding of these chicken proteins. It appears that CEFs and chicken muscle contain distinct proteins binding to these RSV DNA sites; the CEF binding protein was heat stable, as is C/EBP, while the chicken muscle protein was heat sensitive. Images PMID:8386280

  1. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    PubMed

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p in 3'UTRs, 5'UTRs and CDSs are conservative in the orthologous mammalian genes.

  2. Developmental regulation of collagenase-3 mRNA in normal, differentiating osteoblasts through the activator protein-1 and the runt domain binding sites

    NASA Technical Reports Server (NTRS)

    Winchester, S. K.; Selvamurugan, N.; D'Alonzo, R. C.; Partridge, N. C.

    2000-01-01

    Collagenase-3 mRNA is initially detectable when osteoblasts cease proliferation, increasing during differentiation and mineralization. We showed that this developmental expression is due to an increase in collagenase-3 gene transcription. Mutation of either the activator protein-1 or the runt domain binding site decreased collagenase-3 promoter activity, demonstrating that these sites are responsible for collagenase-3 gene transcription. The activator protein-1 and runt domain binding sites bind members of the activator protein-1 and core-binding factor family of transcription factors, respectively. We identified core-binding factor a1 binding to the runt domain binding site and JunD in addition to a Fos-related antigen binding to the activator protein-1 site. Overexpression of both c-Fos and c-Jun in osteoblasts or core-binding factor a1 increased collagenase-3 promoter activity. Furthermore, overexpression of c-Fos, c-Jun, and core-binding factor a1 synergistically increased collagenase-3 promoter activity. Mutation of either the activator protein-1 or the runt domain binding site resulted in the inability of c-Fos and c-Jun or core-binding factor a1 to increase collagenase-3 promoter activity, suggesting that there is cooperative interaction between the sites and the proteins. Overexpression of Fra-2 and JunD repressed core-binding factor a1-induced collagenase-3 promoter activity. Our results suggest that members of the activator protein-1 and core-binding factor families, binding to the activator protein-1 and runt domain binding sites are responsible for the developmental regulation of collagenase-3 gene expression in osteoblasts.

  3. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase

    NASA Astrophysics Data System (ADS)

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-01

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2‧,3‧-O-(2,4,6-trinitrophenyl)adenosine 5‧-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase.

  4. New insight into the binding modes of TNP-AMP to human liver fructose-1,6-bisphosphatase.

    PubMed

    Han, Xinya; Huang, Yunyuan; Zhang, Rui; Xiao, San; Zhu, Shuaihuan; Qin, Nian; Hong, Zongqin; Wei, Lin; Feng, Jiangtao; Ren, Yanliang; Feng, Lingling; Wan, Jian

    2016-08-05

    Human liver fructose-1,6-bisphosphatase (FBPase) contains two binding sites, a substrate fructose-1,6-bisphosphate (FBP) active site and an adenosine monophosphate (AMP) allosteric site. The FBP active site works by stabilizing the FBPase, and the allosteric site impairs the activity of FBPase through its binding of a nonsubstrate molecule. The fluorescent AMP analogue, 2',3'-O-(2,4,6-trinitrophenyl)adenosine 5'-monophosphate (TNP-AMP) has been used as a fluorescent probe as it is able to competitively inhibit AMP binding to the AMP allosteric site and, therefore, could be used for exploring the binding modes of inhibitors targeted on the allosteric site. In this study, we have re-examined the binding modes of TNP-AMP to FBPase. However, our present enzyme kinetic assays show that AMP and FBP both can reduce the fluorescence from the bound TNP-AMP through competition for FBPase, suggesting that TNP-AMP binds not only to the AMP allosteric site but also to the FBP active site. Mutagenesis assays of K274L (located in the FBP active site) show that the residue K274 is very important for TNP-AMP to bind to the active site of FBPase. The results further prove that TNP-AMP is able to bind individually to the both sites. Our present study provides a new insight into the binding mechanism of TNP-AMP to the FBPase. The TNP-AMP fluorescent probe can be used to exam the binding site of an inhibitor (the active site or the allosteric site) using FBPase saturated by AMP and FBP, respectively, or the K247L mutant FBPase. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    NASA Astrophysics Data System (ADS)

    D'Aquino, J. Alejandro; Ringe, Dagmar

    2006-08-01

    The diphtheria toxin repressor, DtxR, is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear (1 - 3). Calorimetric techniques have demonstrated that while binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 × 10-7, binding site 2 (primary) is a low affinity binding site with a binding constant of 6.3 × 10-4. These two binding sites act independently and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A,C102D), reported here and the previously reported DtxR(H79A) (4) has allowed us to propose a mechanism of metal ion activation for DtxR.

  6. Allosteric binding sites in Rab11 for potential drug candidates

    PubMed Central

    2018-01-01

    Rab11 is an important protein subfamily in the RabGTPase family. These proteins physiologically function as key regulators of intracellular membrane trafficking processes. Pathologically, Rab11 proteins are implicated in many diseases including cancers, neurodegenerative diseases and type 2 diabetes. Although they are medically important, no previous study has found Rab11 allosteric binding sites where potential drug candidates can bind to. In this study, by employing multiple clustering approaches integrating principal component analysis, independent component analysis and locally linear embedding, we performed structural analyses of Rab11 and identified eight representative structures. Using these representatives to perform binding site mapping and virtual screening, we identified two novel binding sites in Rab11 and small molecules that can preferentially bind to different conformations of these sites with high affinities. After identifying the binding sites and the residue interaction networks in the representatives, we computationally showed that these binding sites may allosterically regulate Rab11, as these sites communicate with switch 2 region that binds to GTP/GDP. These two allosteric binding sites in Rab11 are also similar to two allosteric pockets in Ras that we discovered previously. PMID:29874286

  7. Laminar and regional distribution of galanin binding sites in cat and monkey visual cortex determined by in vitro receptor autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rosier, A.M.; Vandesande, F.; Orban, G.A.

    1991-03-08

    The distribution of galanin (GAL) binding sites in the visual cortex of cat and monkey was determined by autoradiographic visualization of ({sup 125}I)-GAL binding to tissue sections. Binding conditions were optimized and, as a result, the binding was saturable and specific. In cat visual cortex, GAL binding sites were concentrated in layers I, IVc, V, and VI. Areas 17, 18, and 19 exhibited a similar distribution pattern. In monkey primary visual cortex, the highest density of GAL binding sites was observed in layers II/III, lower IVc, and upper V. Layers IVA and VI contained moderate numbers of GAL binding sites,more » while layer I and the remaining parts of layer IV displayed the lowest density. In monkey secondary visual cortex, GAL binding sites were mainly concentrated in layers V-VI. Layer IV exhibited a moderate density, while the supragranular layers contained the lowest proportion of GAL binding sites. In both cat and monkey, we found little difference between regions subserving central and those subserving peripheral vision. Similarities in the distribution of GAL and acetylcholine binding sites are discussed.« less

  8. Identification and characterization of a novel high affinity metal-binding site in the hammerhead ribozyme.

    PubMed Central

    Hansen, M R; Simorre, J P; Hanson, P; Mokler, V; Bellon, L; Beigelman, L; Pardi, A

    1999-01-01

    A novel metal-binding site has been identified in the hammerhead ribozyme by 31P NMR. The metal-binding site is associated with the A13 phosphate in the catalytic core of the hammerhead ribozyme and is distinct from any previously identified metal-binding sites. 31P NMR spectroscopy was used to measure the metal-binding affinity for this site and leads to an apparent dissociation constant of 250-570 microM at 25 degrees C for binding of a single Mg2+ ion. The NMR data also show evidence of a structural change at this site upon metal binding and these results are compared with previous data on metal-induced structural changes in the core of the hammerhead ribozyme. These NMR data were combined with the X-ray structure of the hammerhead ribozyme (Pley HW, Flaherty KM, McKay DB. 1994. Nature 372:68-74) to model RNA ligands involved in binding the metal at this A13 site. In this model, the A13 metal-binding site is structurally similar to the previously identified A(g) metal-binding site and illustrates the symmetrical nature of the tandem G x A base pairs in domain 2 of the hammerhead ribozyme. These results demonstrate that 31P NMR represents an important method for both identification and characterization of metal-binding sites in nucleic acids. PMID:10445883

  9. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations.

    PubMed

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  10. Identification of the quinolinedione inhibitor binding site in Cdc25 phosphatase B through docking and molecular dynamics simulations

    NASA Astrophysics Data System (ADS)

    Ge, Yushu; van der Kamp, Marc; Malaisree, Maturos; Liu, Dan; Liu, Yi; Mulholland, Adrian J.

    2017-11-01

    Cdc25 phosphatase B, a potential target for cancer therapy, is inhibited by a series of quinones. The binding site and mode of quinone inhibitors to Cdc25B remains unclear, whereas this information is important for structure-based drug design. We investigated the potential binding site of NSC663284 [DA3003-1 or 6-chloro-7-(2-morpholin-4-yl-ethylamino)-quinoline-5, 8-dione] through docking and molecular dynamics simulations. Of the two main binding sites suggested by docking, the molecular dynamics simulations only support one site for stable binding of the inhibitor. Binding sites in and near the Cdc25B catalytic site that have been suggested previously do not lead to stable binding in 50 ns molecular dynamics (MD) simulations. In contrast, a shallow pocket between the C-terminal helix and the catalytic site provides a favourable binding site that shows high stability. Two similar binding modes featuring protein-inhibitor interactions involving Tyr428, Arg482, Thr547 and Ser549 are identified by clustering analysis of all stable MD trajectories. The relatively flexible C-terminal region of Cdc25B contributes to inhibitor binding. The binding mode of NSC663284, identified through MD simulation, likely prevents the binding of protein substrates to Cdc25B. The present results provide useful information for the design of quinone inhibitors and their mechanism of inhibition.

  11. ATP and AMP Mutually Influence Their Interaction with the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) at Separate Binding Sites*

    PubMed Central

    Randak, Christoph O.; Dong, Qian; Ver Heul, Amanda R.; Elcock, Adrian H.; Welsh, Michael J.

    2013-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) is an anion channel in the ATP-binding cassette (ABC) transporter protein family. In the presence of ATP and physiologically relevant concentrations of AMP, CFTR exhibits adenylate kinase activity (ATP + AMP ⇆ 2 ADP). Previous studies suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for this activity. Two other ABC proteins, Rad50 and a structural maintenance of chromosome protein, also have adenylate kinase activity. All three ABC adenylate kinases bind and hydrolyze ATP in the absence of other nucleotides. However, little is known about how an ABC adenylate kinase interacts with ATP and AMP when both are present. Based on data from non-ABC adenylate kinases, we hypothesized that ATP and AMP mutually influence their interaction with CFTR at separate binding sites. We further hypothesized that only one of the two CFTR ATP-binding sites is involved in the adenylate kinase reaction. We found that 8-azidoadenosine 5′-triphosphate (8-N3-ATP) and 8-azidoadenosine 5′-monophosphate (8-N3-AMP) photolabeled separate sites in CFTR. Labeling of the AMP-binding site with 8-N3-AMP required the presence of ATP. Conversely, AMP enhanced photolabeling with 8-N3-ATP at ATP-binding site 2. The adenylate kinase active center probe P1,P5-di(adenosine-5′) pentaphosphate interacted simultaneously with an AMP-binding site and ATP-binding site 2. These results show that ATP and AMP interact with separate binding sites but mutually influence their interaction with the ABC adenylate kinase CFTR. They further indicate that the active center of the adenylate kinase comprises ATP-binding site 2. PMID:23921386

  12. Chromatin-Specific Regulation of Mammalian rDNA Transcription by Clustered TTF-I Binding Sites

    PubMed Central

    Diermeier, Sarah D.; Németh, Attila; Rehli, Michael; Grummt, Ingrid; Längst, Gernot

    2013-01-01

    Enhancers and promoters often contain multiple binding sites for the same transcription factor, suggesting that homotypic clustering of binding sites may serve a role in transcription regulation. Here we show that clustering of binding sites for the transcription termination factor TTF-I downstream of the pre-rRNA coding region specifies transcription termination, increases the efficiency of transcription initiation and affects the three-dimensional structure of rRNA genes. On chromatin templates, but not on free rDNA, clustered binding sites promote cooperative binding of TTF-I, loading TTF-I to the downstream terminators before it binds to the rDNA promoter. Interaction of TTF-I with target sites upstream and downstream of the rDNA transcription unit connects these distal DNA elements by forming a chromatin loop between the rDNA promoter and the terminators. The results imply that clustered binding sites increase the binding affinity of transcription factors in chromatin, thus influencing the timing and strength of DNA-dependent processes. PMID:24068958

  13. A ternary metal binding site in the C2 domain of phosphoinositide-specific phospholipase C-delta1.

    PubMed

    Essen, L O; Perisic, O; Lynch, D E; Katan, M; Williams, R L

    1997-03-11

    We have determined the crystal structures of complexes of phosphoinositide-specific phospholipase C-delta1 from rat with calcium, barium, and lanthanum at 2.5-2.6 A resolution. Binding of these metal ions is observed in the active site of the catalytic TIM barrel and in the calcium binding region (CBR) of the C2 domain. The C2 domain of PLC-delta1 is a circularly permuted topological variant (P-variant) of the synaptotagmin I C2A domain (S-variant). On the basis of sequence analysis, we propose that both the S-variant and P-variant topologies are present among other C2 domains. Multiple adjacent binding sites in the C2 domain were observed for calcium and the other metal/enzyme complexes. The maximum number of binding sites observed was for the calcium analogue lanthanum. This complex shows an array-like binding of three lanthanum ions (sites I-III) in a crevice on one end of the C2 beta-sandwich. Residues involved in metal binding are contained in three loops, CBR1, CBR2, and CBR3. Sites I and II are maintained in the calcium and barium complexes, whereas sites II and III coincide with a binary calcium binding site in the C2A domain of synaptotagmin I. Several conformers for CBR1 are observed. The conformation of CBR1 does not appear to be strictly dependent on metal binding; however, metal binding may stabilize certain conformers. No significant structural changes are observed for CBR2 or CBR3. The surface of this ternary binding site provides a cluster of freely accessible liganding positions for putative phospholipid ligands of the C2 domain. It may be that the ternary metal binding site is also a feature of calcium-dependent phospholipid binding in solution. A ternary metal binding site might be a conserved feature among C2 domains that contain the critical calcium ligands in their CBR's. The high cooperativity of calcium-mediated lipid binding by C2 domains described previously is explained by this novel type of calcium binding site.

  14. Molecular investigation of active binding site of isoniazid (INH) and insight into resistance mechanism of S315T-MtKatG in Mycobacterium tuberculosis.

    PubMed

    Srivastava, Gaurava; Tripathi, Shubhandra; Kumar, Akhil; Sharma, Ashok

    2017-07-01

    Multi drug resistant tuberculosis is a major threat for mankind. Resistance against Isoniazid (INH), targeting MtKatG protein, is one of the most commonly occurring resistances in MDR TB strains. S315T-MtKatG mutation is widely reported for INH resistance. Despite having knowledge about the mechanism of INH, exact binding site of INH to MtKatG is still uncertain and proposed to have three presumable binding sites (site-1, site-2, and site-3). In the current study docking, molecular dynamics simulation, binding free energy estimation, principal component analysis and free energy landscape analysis were performed to get molecular level details of INH binding site on MtKatG, and to probe the effect of S315T mutation on INH binding. Molecular docking and MD analysis suggested site-1 as active binding site of INH, where the effects of S315T mutation were observed on both access tunnel as well as molecular interaction between INH and its neighboring residues. MMPBSA also supported site-1 as potential binding site with lowest binding energy of -44.201 kJ/mol. Moreover, PCA and FEL revealed that S315T mutation not only reduces the dimension of heme access tunnel but also showed that extra methyl group at 315 position altered heme cavity, enforcing heme group distantly from INH, and thus preventing INH activation. The present study not only investigated the active binding site of INH but also provides a new insight about the conformational changes in the binding site of S315T-MtKatG. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Mechanism of Metal Ion Activation of the Diphtheria Toxin Repressor DtxR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Aquino,J.; Tetenbaum-Novatt, J.; White, A.

    2005-01-01

    The diphtheria toxin repressor (DtxR) is a metal ion-activated transcriptional regulator that has been linked to the virulence of Corynebacterium diphtheriae. Structure determination has shown that there are two metal ion binding sites per repressor monomer, and site-directed mutagenesis has demonstrated that binding site 2 (primary) is essential for recognition of the target DNA repressor, leaving the role of binding site 1 (ancillary) unclear. Calorimetric techniques have demonstrated that although binding site 1 (ancillary) has high affinity for metal ion with a binding constant of 2 x 10{sup -7}, binding site 2 (primary) is a low-affinity binding site with amore » binding constant of 6.3 x 10{sup -4}. These two binding sites act in an independent fashion, and their contribution can be easily dissected by traditional mutational analysis. Our results clearly demonstrate that binding site 1 (ancillary) is the first one to be occupied during metal ion activation, playing a critical role in stabilization of the repressor. In addition, structural data obtained for the mutants Ni-DtxR(H79A, C102D), reported here, and the previously reported DtxR(H79A) have allowed us to propose a mechanism of metal activation for DtxR.« less

  16. Identification of a Second Substrate-binding Site in Solute-Sodium Symporters*

    PubMed Central

    Li, Zheng; Lee, Ashley S. E.; Bracher, Susanne; Jung, Heinrich; Paz, Aviv; Kumar, Jay P.; Abramson, Jeff; Quick, Matthias; Shi, Lei

    2015-01-01

    The structure of the sodium/galactose transporter (vSGLT), a solute-sodium symporter (SSS) from Vibrio parahaemolyticus, shares a common structural fold with LeuT of the neurotransmitter-sodium symporter family. Structural alignments between LeuT and vSGLT reveal that the crystallographically identified galactose-binding site in vSGLT is located in a more extracellular location relative to the central substrate-binding site (S1) in LeuT. Our computational analyses suggest the existence of an additional galactose-binding site in vSGLT that aligns to the S1 site of LeuT. Radiolabeled galactose saturation binding experiments indicate that, like LeuT, vSGLT can simultaneously bind two substrate molecules under equilibrium conditions. Mutating key residues in the individual substrate-binding sites reduced the molar substrate-to-protein binding stoichiometry to ∼1. In addition, the related and more experimentally tractable SSS member PutP (the Na+/proline transporter) also exhibits a binding stoichiometry of 2. Targeting residues in the proposed sites with mutations results in the reduction of the binding stoichiometry and is accompanied by severely impaired translocation of proline. Our data suggest that substrate transport by SSS members requires both substrate-binding sites, thereby implying that SSSs and neurotransmitter-sodium symporters share common mechanistic elements in substrate transport. PMID:25398883

  17. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  18. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  19. Evolution of Metal(Loid) Binding Sites in Transcriptional Regulators

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ordonez, E.; Thiyagarajan, S.; Cook, J.D.

    2009-05-22

    Expression of the genes for resistance to heavy metals and metalloids is transcriptionally regulated by the toxic ions themselves. Members of the ArsR/SmtB family of small metalloregulatory proteins respond to transition metals, heavy metals, and metalloids, including As(III), Sb(III), Cd(II), Pb(II), Zn(II), Co(II), and Ni(II). These homodimeric repressors bind to DNA in the absence of inducing metal(loid) ion and dissociate from the DNA when inducer is bound. The regulatory sites are often three- or four-coordinate metal binding sites composed of cysteine thiolates. Surprisingly, in two different As(III)-responsive regulators, the metalloid binding sites were in different locations in the repressor, andmore » the Cd(II) binding sites were in two different locations in two Cd(II)-responsive regulators. We hypothesize that ArsR/SmtB repressors have a common backbone structure, that of a winged helix DNA-binding protein, but have considerable plasticity in the location of inducer binding sites. Here we show that an As(III)-responsive member of the family, CgArsR1 from Corynebacterium glutamicum, binds As(III) to a cysteine triad composed of Cys{sup 15}, Cys{sup 16}, and Cys{sup 55}. This binding site is clearly unrelated to the binding sites of other characterized ArsR/SmtB family members. This is consistent with our hypothesis that metal(loid) binding sites in DNA binding proteins evolve convergently in response to persistent environmental pressures.« less

  20. Combining fragment homology modeling with molecular dynamics aims at prediction of Ca2+ binding sites in CaBPs

    NASA Astrophysics Data System (ADS)

    Pang, ChunLi; Cao, TianGuang; Li, JunWei; Jia, MengWen; Zhang, SuHua; Ren, ShuXi; An, HaiLong; Zhan, Yong

    2013-08-01

    The family of calcium-binding proteins (CaBPs) consists of dozens of members and contributes to all aspects of the cell's function, from homeostasis to learning and memory. However, the Ca2+-binding mechanism is still unclear for most of CaBPs. To identify the Ca2+-binding sites of CaBPs, this study presented a computational approach which combined the fragment homology modeling with molecular dynamics simulation. For validation, we performed a two-step strategy as follows: first, the approach is used to identify the Ca2+-binding sites of CaBPs, which have the EF-hand Ca2+-binding site and the detailed binding mechanism. To accomplish this, eighteen crystal structures of CaBPs with 49 Ca2+-binding sites are selected to be analyzed including calmodulin. The computational method identified 43 from 49 Ca2+-binding sites. Second, we performed the approach to large-conductance Ca2+-activated K+ (BK) channels which don't have clear Ca2+-binding mechanism. The simulated results are consistent with the experimental data. The computational approach may shed some light on the identification of Ca2+-binding sites in CaBPs.

  1. Autoradiographic evidence for two classes of mu opioid binding sites in rat brain using (/sup 125/I)FK33824

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Jacobson, A.E.; Rice, K.C.

    1987-11-01

    Previous studies demonstrated that pretreatment of brain membranes with the irreversible mu antagonist, beta-funaltrexamine (beta-FNA), partially eliminated mu binding sites (25,35), consistent with the existence of two mu binding sites distinguished by beta-FNA. This paper tests the hypothesis that the FNA-sensitive and FNA-insensitive mu binding sites have different anatomical distributions in rat brain. Prior to autoradiographic visualization of mu binding sites, (/sup 3/H)oxymorphone, (/sup 3/H)D-ala2-MePhe4, Gly-ol5-enkephalin (DAGO), and (/sup 125/I)D-ala2-Me-Phe4-met(o)-ol)enkephalin (FK33824) were shown to selectively label mu binding sites using slide mounted sections of molded minced rat brain. As found using membranes, beta-FNA eliminated only a portion of mu bindingmore » sites. Autoradiographic visualization of mu binding sites using the mu-selective ligand (/sup 125/I)FK33824 in control and FNA-treated sections of rat brain demonstrated that the proportion of mu binding sites sensitive to beta-FNA varied across regions of the brain, particularly the dorsal thalamus, ventrobasal complex and the hypothalamus, providing anatomical data supporting the existence of two classes of mu binding sites in rat brain.« less

  2. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development

    PubMed Central

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A.; Brodsky, Michael H.; Sinha, Saurabh

    2013-01-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein–protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action. PMID:23847101

  3. Widespread evidence of cooperative DNA binding by transcription factors in Drosophila development.

    PubMed

    Kazemian, Majid; Pham, Hannah; Wolfe, Scot A; Brodsky, Michael H; Sinha, Saurabh

    2013-09-01

    Regulation of eukaryotic gene transcription is often combinatorial in nature, with multiple transcription factors (TFs) regulating common target genes, often through direct or indirect mutual interactions. Many individual examples of cooperative binding by directly interacting TFs have been identified, but it remains unclear how pervasive this mechanism is during animal development. Cooperative TF binding should be manifest in genomic sequences as biased arrangements of TF-binding sites. Here, we explore the extent and diversity of such arrangements related to gene regulation during Drosophila embryogenesis. We used the DNA-binding specificities of 322 TFs along with chromatin accessibility information to identify enriched spacing and orientation patterns of TF-binding site pairs. We developed a new statistical approach for this task, specifically designed to accurately assess inter-site spacing biases while accounting for the phenomenon of homotypic site clustering commonly observed in developmental regulatory regions. We observed a large number of short-range distance preferences between TF-binding site pairs, including examples where the preference depends on the relative orientation of the binding sites. To test whether these binding site patterns reflect physical interactions between the corresponding TFs, we analyzed 27 TF pairs whose binding sites exhibited short distance preferences. In vitro protein-protein binding experiments revealed that >65% of these TF pairs can directly interact with each other. For five pairs, we further demonstrate that they bind cooperatively to DNA if both sites are present with the preferred spacing. This study demonstrates how DNA-binding motifs can be used to produce a comprehensive map of sequence signatures for different mechanisms of combinatorial TF action.

  4. Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

    2017-03-28

    Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

  5. Understanding the physical and chemical nature of the warfarin drug binding site in human serum albumin: experimental and theoretical studies.

    PubMed

    Abou-Zied, Osama K

    2015-01-01

    Human serum albumin (HSA) is one of the major carrier proteins in the body and constitutes approximately half of the protein found in blood plasma. It plays an important role in lipid metabolism, and its ability to reversibly bind a large variety of pharmaceutical compounds makes it a crucial determinant of drug pharmacokinetics and pharmacodynamics. This review deals with one of the protein's major binding sites "Sudlow I" which includes a binding pocket for the drug warfarin (WAR). The binding nature of this important site can be characterized by measuring the spectroscopic changes when a ligand is bound. Using several drugs, including WAR, and other drug-like molecules as ligands, the results emphasize the nature of Sudlow I as a flexible binding site, capable of binding a variety of ligands by adapting its binding pockets. The high affinity of the WAR pocket for binding versatile molecular structures stems from the flexibility of the amino acids forming the pocket. The binding site is shown to have an ionization ability which is important to consider when using drugs that are known to bind in Sudlow I. Several studies point to the important role of water molecules trapped inside the binding site in molecular recognition and ligand binding. Water inside the protein's cavity is crucial in maintaining the balance between the hydrophobic and hydrophilic nature of the binding site. Upon the unfolding and refolding of HSA, more water molecules are trapped inside the binding site which cause some swelling that prevents a full recovery from the denatured state. Better understanding of the mechanism of binding in macromolecules such as HSA and other proteins can be achieved by combining experimental and theoretical studies which produce significant synergies in studying complex biochemical phenomena.

  6. Nuclear binding of progesterone in hen oviduct. Binding to multiple sites in vitro.

    PubMed Central

    Pikler, G M; Webster, R A; Spelsberg, T C

    1976-01-01

    Steroid hormones, including progesterone, are known to bind with high affinity (Kd approximately 1x10(-10)M) to receptor proteins once they enter target cells. This complex (the progesterone-receptor) then undergoes a temperature-and/or salt-dependent activation which allows it to migrate to the cell nucleus and to bind to the deoxyribonucleoproteins. The present studies demonstrate that binding the hormone-receptor complex in vitro to isolated nuclei from the oviducts of laying hens required the same conditions as do other studies of bbinding in vitro reported previously, e.g. the hormone must be complexed to intact and activated receptor. The assay of the nuclear binding by using multiple concentrations of progesterone receptor reveals the presence of more than one class of binding site in the oviduct nuclei. The affinity of each of these classes of binding sites range from Kd approximately 1x10(-9)-1x10(-8)M. Assays using free steroid (not complexed with receptor) show no binding to these sites. The binding to each of the classes of sites, displays a differential stability to increasing ionic concentrations, suggesting primarily an ionic-type interaction for all classes. Only the highest-affinity class of binding site is capable of binding progesterone receptor under physioligical-saline conditions. This class represent 6000-10000 sites per cell nucleus and resembles the sites detected in vivo (Spelsberg, 1976, Biochem. J. 156, 391-398) which cause maximal transcriptional response when saturated with the progesterone receptor. The multiple binding sites for the progesterone receptor either are not present or are found in limited numbers in the nuclei of non-target organs. Differences in extent of binding to the nuclear material between a target tissue (oviduct) and other tissues (spleen or erythrocyte) are markedly dependent on the ionic conditions, and are probably due to binding to different classes of sites in the nuclei. PMID:182147

  7. Nicotinic Cholinergic Receptor Binding Sites in the Brain: Regulation in vivo

    NASA Astrophysics Data System (ADS)

    Schwartz, Rochelle D.; Kellar, Kenneth J.

    1983-04-01

    Tritiated acetylcholine was used to measure binding sites with characteristics of nicotinic cholinergic receptors in rat brain. Regulation of the binding sites in vivo was examined by administering two drugs that stimulate nicotinic receptors directly or indirectly. After 10 days of exposure to the cholinesterase inhibitor diisopropyl fluorophosphate, binding of tritiated acetylcholine in the cerebral cortex was decreased. However, after repeated administration of nicotine for 10 days, binding of tritiated acetylcholine in the cortex was increased. Saturation analysis of tritiated acetylcholine binding in the cortices of rats treated with diisopropyl fluorophosphate or nicotine indicated that the number of binding sites decreased and increased, respectively, while the affinity of the sites was unaltered.

  8. Substance P binding sites in the nucleus tractus solitarius of the cat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maley, B.E.; Sasek, C.A.; Seybold, V.S.

    1988-11-01

    Substance P binding sites in the nucleus tractus solitarius were visualized with receptor autoradiography using Bolton-Hunter (/sup 125/I)substance P. Substance P binding sites were found to have distinct patterns within the cat nucleus tractus solitarius. The majority of substance P binding sites were present in the medial, intermediate and the peripheral rim of the parvocellular subdivisions. Lower amounts of substance P binding sites were present in the commissural, ventrolateral, interstitial and dorsolateral subdivisions. No substance P binding sites were present in the central region of the parvocellular subdivision or the solitary tract. The localization of substance P binding sites inmore » the nucleus tractus solitarius is very similar to the patterns of substance P immunoreactive fibers previously described for this region. Results of this study add further support for a functional role of substance P in synaptic circuits of the nucleus tractus solitarius.« less

  9. Structural analysis of substrate recognition by glucose isomerase in Mn2+ binding mode at M2 site in S. rubiginosus.

    PubMed

    Bae, Ji-Eun; Hwang, Kwang Yeon; Nam, Ki Hyun

    2018-06-16

    Glucose isomerase (GI) catalyzes the reversible enzymatic isomerization of d-glucose and d-xylose to d-fructose and d-xylulose, respectively. This is one of the most important enzymes in the production of high-fructose corn syrup (HFCS) and biofuel. We recently determined the crystal structure of GI from S. rubiginosus (SruGI) complexed with a xylitol inhibitor in one metal binding mode. Although we assessed inhibitor binding at the M1 site, the metal binding at the M2 site and the substrate recognition mechanism for SruGI remains the unclear. Here, we report the crystal structure of the two metal binding modes of SruGI and its complex with glucose. This study provides a snapshot of metal binding at the SruGI M2 site in the presence of Mn 2+ , but not in the presence of Mg 2+ . Metal binding at the M2 site elicits a configuration change at the M1 site. Glucose molecule can only bind to the M1 site in presence of Mn 2+ at the M2 site. Glucose and Mn 2+ at the M2 site were bridged by water molecules using a hydrogen bonding network. The metal binding geometry of the M2 site indicates a distorted octahedral coordination with an angle of 55-110°, whereas the M1 site has a relatively stable octahedral coordination with an angle of 85-95°. We suggest a two-step sequential process for SruGI substrate recognition, in Mn 2+ binding mode, at the M2 site. Our results provide a better understanding of the molecular role of the M2 site in GI substrate recognition. Copyright © 2018. Published by Elsevier Inc.

  10. Characterization of diadenosine tetraphosphate (Ap4A) binding sites in cultured chromaffin cells: evidence for a P2y site.

    PubMed Central

    Pintor, J.; Torres, M.; Castro, E.; Miras-Portugal, M. T.

    1991-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide, which is stored in secretory granules, presents two types of high affinity binding sites in chromaffin cells. A Kd value of 8 +/- 0.65 x 10(-11) M and Bmax value of 5420 +/- 450 sites per cell were obtained for the high affinity binding site. A Kd value of 5.6 +/- 0.53 x 10(-9) M and a Bmax value close to 70,000 sites per cell were obtained for the second binding site with high affinity. 2. The diadenosine polyphosphates, Ap3A, Ap4A, Ap5A and Ap6A, displaced [3H]-Ap4A from the two binding sites, the Ki values being 1.0 nM, 0.013 nM, 0.013 nM and 0.013 nM for the very high affinity binding site and 0.5 microM, 0.13 microM, 0.062 microM and 0.75 microM for the second binding site. 3. The ATP analogues displaced [3H]-Ap4A with the potency order of the P2y receptors, adenosine 5'-O-(2 thiodiphosphate) (ADP-beta-S) greater than 5'-adenylyl imidodiphosphate (AMP-PNP) greater than alpha, beta-methylene ATP (alpha, beta-MeATP), in both binding sites. The Ki values were respectively 0.075 nM, 0.2 nM and 0.75 nM for the very high affinity binding site and 0.125 microM, 0.5 microM and 0.9 microM for the second binding site. PMID:1912985

  11. Distinct roles of beta1 metal ion-dependent adhesion site (MIDAS), adjacent to MIDAS (ADMIDAS), and ligand-associated metal-binding site (LIMBS) cation-binding sites in ligand recognition by integrin alpha2beta1.

    PubMed

    Valdramidou, Dimitra; Humphries, Martin J; Mould, A Paul

    2008-11-21

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as alpha2beta1, ligand recognition takes place exclusively at the alpha subunit I domain. However, activation of the alphaI domain depends on its interaction with a structurally similar domain in the beta subunit known as the I-like or betaI domain. The top face of the betaI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS), and LIMBS (ligand-associated metal-binding site). The role of these sites in controlling ligand binding to the alphaI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to alpha2beta1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating monoclonal antibody TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between alphaI and betaI, whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of betaI. An activating mutation in the alpha2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca(2+), Mg(2+), and Mn(2+) on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn(2+) stimulates ligand binding, whereas the LIMBS is a stimulatory Ca(2+)-binding site, occupancy of which increases the affinity of Mg(2+) for the MIDAS.

  12. Identification and partial characterization of a low affinity metal-binding site in the light chain of tetanus toxin.

    PubMed

    Wright, J F; Pernollet, M; Reboul, A; Aude, C; Colomb, M G

    1992-05-05

    Tetanus toxin was shown to contain a metal-binding site for zinc and copper. Equilibrium dialysis binding experiments using 65Zn indicated an association constant of 9-15 microM, with one zinc-binding site/toxin molecule. The zinc-binding site was localized to the toxin light chain as determined by binding of 65Zn to the light chain but not to the heavy chain after separation by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transfer to Immobilon membranes. Copper was an efficient inhibitor of 65Zn binding to tetanus toxin and caused two peptide bond cleavages in the toxin light chain in the presence of ascorbate. These metal-catalyzed oxidative cleavages were inhibited by the presence of zinc. Partial characterization of metal-catalyzed oxidative modifications of a peptide based on a putative metal-binding site (HELIH) in the toxin light chain was used to map the metal-binding site in the protein.

  13. CORE_TF: a user-friendly interface to identify evolutionary conserved transcription factor binding sites in sets of co-regulated genes

    PubMed Central

    Hestand, Matthew S; van Galen, Michiel; Villerius, Michel P; van Ommen, Gert-Jan B; den Dunnen, Johan T; 't Hoen, Peter AC

    2008-01-01

    Background The identification of transcription factor binding sites is difficult since they are only a small number of nucleotides in size, resulting in large numbers of false positives and false negatives in current approaches. Computational methods to reduce false positives are to look for over-representation of transcription factor binding sites in a set of similarly regulated promoters or to look for conservation in orthologous promoter alignments. Results We have developed a novel tool, "CORE_TF" (Conserved and Over-REpresented Transcription Factor binding sites) that identifies common transcription factor binding sites in promoters of co-regulated genes. To improve upon existing binding site predictions, the tool searches for position weight matrices from the TRANSFACR database that are over-represented in an experimental set compared to a random set of promoters and identifies cross-species conservation of the predicted transcription factor binding sites. The algorithm has been evaluated with expression and chromatin-immunoprecipitation on microarray data. We also implement and demonstrate the importance of matching the random set of promoters to the experimental promoters by GC content, which is a unique feature of our tool. Conclusion The program CORE_TF is accessible in a user friendly web interface at . It provides a table of over-represented transcription factor binding sites in the users input genes' promoters and a graphical view of evolutionary conserved transcription factor binding sites. In our test data sets it successfully predicts target transcription factors and their binding sites. PMID:19036135

  14. [The role of glycine binding site in NMDA receptor--interactions between NMDA and D-serine in artificial anoxia/agycemia rat hippocampus].

    PubMed

    Kawasaki, Kazuyoshi; Ogawa, Seturou

    2003-01-01

    NMDA receptor contributes to cause neuronal death in anoxic condition. It is not known how a part of NMDA receptors, NMDA-binding site and/or glycine-binding site, influence neuronal damage in rats' hippocampus in vitro. Rats' hippocampus, labeled with norepinephrine (3H-NE), was incubated in artificial cerebrospinal fluid (aCSF) and we measured 3H-NE in superfusion solution and remaining tissue. Glucose was eliminated from aCSF and 95% N2 + 5% CO2 produced the anoxic state. The amount of 3H-NE release increased in anoxia with NMDA (NMDA-binding site agonist), while there was no influence on NMDA receptor in non-anoxic state even after D-serine (glycine-binding site agonist) has been administered. The 3H-NE was released more when D-serine (100 mu mM) and NMDA (100 mu mM) were administered together than when only D-serine (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia or NMDA (10 mu mM, 100 mu mM, 1000 mu mM) in anoxia was administered. Glycine-binding site agonist alone does not act significantly but ion channels in NMDA receptor open more and become more effective when both glycine-binding site agonist and NMDA-binding site agonist exist, suggesting that there are interactions between NMDA-binding site and glycine-binding site in NMDA-receptor during anoxia.

  15. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  16. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  17. Platelet binding sites for factor VIII in relation to fibrin and phosphatidylserine

    PubMed Central

    Novakovic, Valerie A.; Shi, Jialan; Rasmussen, Jan; Pipe, Steven W.

    2015-01-01

    Thrombin-stimulated platelets expose very little phosphatidylserine (PS) but express binding sites for factor VIII (fVIII), casting doubt on the role of exposed PS as the determinant of binding sites. We previously reported that fVIII binding sites are increased three- to sixfold when soluble fibrin (SF) binds the αIIbβ3 integrin. This study focuses on the hypothesis that platelet-bound SF is the major source of fVIII binding sites. Less than 10% of fVIII was displaced from thrombin-stimulated platelets by lactadherin, a PS-binding protein, and an fVIII mutant defective in PS-dependent binding retained platelet affinity. Therefore, PS is not the determinant of most binding sites. FVIII bound immobilized SF and paralleled platelet binding in affinity, dependence on separation from von Willebrand factor, and mediation by the C2 domain. SF also enhanced activity of fVIII in the factor Xase complex by two- to fourfold. Monoclonal antibody (mAb) ESH8, against the fVIII C2 domain, inhibited binding of fVIII to SF and platelets but not to PS-containing vesicles. Similarly, mAb ESH4 against the C2 domain, inhibited >90% of platelet-dependent fVIII activity vs 35% of vesicle-supported activity. These results imply that platelet-bound SF is a component of functional fVIII binding sites. PMID:26162408

  18. Differences between high-affinity forskolin binding sites in dopamine-riche and other regions of rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Poat, J.A.; Cripps, H.E.; Iversen, L.L.

    1988-05-01

    Forskolin labelled with (/sup 3/H) bound to high- and low-affinity sites in the rat brain. The high-affinity site was discretely located, with highest densities in the striatum, nucleus accumbens, olfactory tubercule, substantia nigra, hippocampus, and the molecular layers of the cerebellum. This site did not correlate well with the distribution of adenylate cyclase. The high-affinity striatal binding site may be associated with a stimulatory guanine nucleotide-binding protein. Thus, the number of sites was increased by the addition of Mg/sup 2 +/ and guanylyl imidodiphosphate. Cholera toxin stereotaxically injected into rat striatum increased the number of binding sites, and no furthermore » increase was noted following the subsequent addition of guanyl nucleotide. High-affinity forskolin binding sites in non-dopamine-rich brain areas (hippocampus and cerebullum) were modulated in a qualitatively different manner by guanyl nucleotides. In these areas the number of binding sites was significantly reduced by the addition of guanyl nucleotide. These results suggest that forskolin may have a potential role in identifying different functional/structural guanine nucleotide-binding proteins.« less

  19. Solubilization and characterization of haloperidol-sensitive (+)-( sup 3 H)SKF-10,047 binding sites (sigma sites) from rat liver membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McCann, D.J.; Su, T.P.

    1991-05-01

    The zwitterionic detergent 3-((3-cholamidopropyl)dimethylamino)-1-propanesulfonate (CHAPS) produced optimal solubilization of (+)-({sup 3}H)SKF-10,047 binding sites from rat liver membranes at a concentration of 0.2%, well below the critical micellular concentration of the detergent. The pharmacological selectivity of the liver (+)-({sup 3}H)SKF-10,047 binding sites corresponds to that of sigma sites from rat and guinea pig brain. When the affinities of 18 different drugs at (+)-({sup 3}H)SKF-10,047 binding sites in membranes and solubilized preparations were compared, a correlation coefficient of 0.99 and a slope of 1.03 were obtained, indicating that the pharmacological selectivity of rat liver sigma sites is retained after solubilization. In addition,more » the binding of 20 nM ({sup 3}H)progesterone to solubilized rat liver preparations was found to exhibit a pharmacological selectivity appropriate for sigma sites. A stimulatory effect of phenytoin on (+)-({sup 3}H)SKF-10,047 binding to sigma sites persisted after solubilization. When the solubilized preparation was subjected to molecular sizing chromatography, a single peak exhibiting specific (+)-({sup 3}H)SKF-10,047 binding was obtained. The binding activity of this peak was stimulated symmetrically when assays were performed in the presence of 300 microM phenytoin. The molecular weight of the CHAPS-solubilized sigma site complex was estimated to be 450,000 daltons. After solubilization with CHAPS, rat liver sigma sites were enriched to 12 pmol/mg of protein. The present results demonstrate a successful solubilization of sigma sites from rat liver membranes and provide direct evidence that the gonadal steroid progesterone binds to sigma sites. The results also suggest that the anticonvulsant phenytoin binds to an associated allosteric site on the sigma site complex.« less

  20. Binding mode of cytochalasin B to F-actin is altered by lateral binding of regulatory proteins.

    PubMed

    Suzuki, N; Mihashi, K

    1991-01-01

    The binding of cytochalasin B (CB) to F-actin was studied using a trace amount of [3H]-cytochalasin B. F-Actin-bound CB was separated from free CB by ultracentrifugation and the amount of F-actin-bound CB was determined by comparing the radioactivity both in the supernatant and in the precipitate. A filament of pure F-actin possessed one high-affinity binding site for CB (Kd = 5.0 nM) at the B-end. When the filament was bound to native tropomyosin (complex of tropomyosin and troponin), two low-affinity binding sites for CB (Kd = 230 nM) were created, while the high-affinity binding site was reserved (Kd = 3.4 nM). It was concluded that the creation of low-affinity binding sites was primarily due to binding of tropomyosin to F-actin, as judged from the following two observations: (1) a filament of F-actin/tropomyosin complex possessed one high-affinity binding site (Kd = 3.9 nM) plus two low-affinity binding sites (Kd = 550 nM); (2) the Ca2(+)-receptive state of troponin C in F-actin/native tropomyosin complex did not affect CB binding.

  1. Comparison of (/sup 3/H)pirenzepine and (/sup 3/H)quinuclidinylbenzilate binding to muscarinic cholinergic receptors in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luthin, G.R.; Wolfe, B.B.

    The properties of (/sup 3/H)quinuclidinylbenzilate ( (/sup 3/H)QNB) binding and (/sup 3/H)pirenzepine ( (/sup 3/H)PZ) binding to various regions of rat brain were compared. (/sup 3/H)PZ appeared to bind with high affinity to a single site, with a Kd value of approximately 15 nM in the cerebral cortex. The rank order of potencies of muscarinic drugs to inhibit binding of either (/sup 3/H)QNB or (/sup 3/H)PZ was QNB greater than atropine . scopolamine greater than pirenzepine greater than oxotremorine greater than bethanechol. Muscarinic antagonists (except PZ) inhibited both (/sup 3/H)PZ and (/sup 3/H)QNB binding with Hill coefficients of approximately 1.more » PZ inhibited (/sup 3/H)QNB binding in cortex with a Hill coefficient of 0.7, but inhibited (/sup 3/H)PZ binding with a Hill coefficient of 1.0. Hill coefficients for agonists were less than 1. The density of (/sup 3/H)PZ binding sites was approximately half the density of (/sup 3/H)QNB binding sites in cortex, striatum and hippocampus. In pons-medulla and cerebellum, the densities of (/sup 3/H)PZ binding sites were 20 and 0%, respectively, relative to the densities of (/sup 3/H)QNB binding sites. When unlabeled PZ was used to compete for (/sup 3/H)QNB binding, the relative number of high-affinity PZ binding sites in cortex, pons and cerebellum agreed with the relative number of (/sup 3/H)PZ binding sites in those regions. The binding of (/sup 3/H)PZ and (/sup 3/H)QNB was nonadditive in cortex. GTP inhibited high-affinity oxotremorine binding, but not PZ binding. Together, these data suggest that (/sup 3/H)PZ binds to a subset of (/sup 3/H)QNB binding sites. Whether this subset reflects the existence of subtypes of muscarinic receptors or is a consequence of coupling to another membrane protein remains to be seen.« less

  2. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  3. The spacing between adjacent binding sites in the family of repeats affects the functions of Epstein-Barr nuclear antigen 1 in transcription activation and stable plasmid maintenance.

    PubMed

    Hebner, Christy; Lasanen, Julie; Battle, Scott; Aiyar, Ashok

    2003-07-05

    Epstein-Barr virus (EBV) and the closely related Herpesvirus papio (HVP) are stably replicated as episomes in proliferating latently infected cells. Maintenance and partitioning of these viral plasmids requires a viral sequence in cis, termed the family of repeats (FR), that is bound by a viral protein, Epstein-Barr nuclear antigen 1 (EBNA1). Upon binding FR, EBNA1 maintains viral genomes in proliferating cells and activates transcription from viral promoters required for immortalization. FR from either virus encodes multiple binding sites for the viral maintenance protein, EBNA1, with the FR from the prototypic B95-8 strain of EBV containing 20 binding sites, and FR from HVP containing 8 binding sites. In addition to differences in the number of EBNA1-binding sites, adjacent binding sites in the EBV FR are typically separated by 14 base pairs (bp), but are separated by 10 bp in HVP. We tested whether the number of binding sites, as well as the distance between adjacent binding sites, affects the function of EBNA1 in transcription activation or plasmid maintenance. Our results indicate that EBNA1 activates transcription more efficiently when adjacent binding sites are separated by 10 bp, the spacing observed in HVP. In contrast, using two separate assays, we demonstrate that plasmid maintenance is greatly augmented when adjacent EBNA1-binding sites are separated by 14 bp, and therefore, presumably lie on the same face of the DNA double helix. These results provide indication that the functions of EBNA1 in transcription activation and plasmid maintenance are separable.

  4. Existence of three subtypes of bradykinin B2 receptors in guinea pig.

    PubMed

    Seguin, L; Widdowson, P S; Giesen-Crouse, E

    1992-12-01

    We describe the binding of [3H]bradykinin to homogenates of guinea pig brain, lung, and ileum. Analysis of [3H]bradykinin binding kinetics in guinea pig brain, lung, and ileum suggests the existence of two binding sites in each tissue. The finding of two binding sites for [3H]bradykinin in ileum, lung, and brain was further supported by Scatchard analysis of equilibrium binding in each tissue. [3H]Bradykinin binds to a high-affinity site in brain, lung, and ileum (KD = 70-200 pM), which constitutes approximately 20% of the bradykinin binding, and to a second, lower-affinity site (0.63-0.95 nM), which constitutes the remaining 80% of binding. Displacement studies with various bradykinin analogues led us to subdivide the high- and lower-affinity sites in each tissue and to suggest the existence of three subtypes of B2 receptors in the guinea pig, which we classify as B2a, B2b, and B2c. Binding of [3H]bradykinin is largely to a B2b receptor subtype, which constitutes the majority of binding in brain, lung, and ileum and represents the lower-affinity site in our binding studies. Receptor subtype B2c constitutes approximately 20% of binding sites in the brain and lung and is equivalent to the high-affinity site in brain and lung. We suggest that a third subtype of B2 receptor (high-affinity site in ileum), B2a, is found only in the ileum. All three subtypes of B2 receptors display a high affinity for bradykinin, whereas they show different affinities for various bradykinin analogues displaying agonist or antagonist activities.(ABSTRACT TRUNCATED AT 250 WORDS)

  5. Involvement of two classes of binding sites in the interactions of cyclophilin B with peripheral blood T-lymphocytes.

    PubMed

    Denys, A; Allain, F; Carpentier, M; Spik, G

    1998-12-15

    Cyclophilin B (CyPB) is a cyclosporin A (CsA)-binding protein, mainly associated with the secretory pathway, and is released in biological fluids. We recently reported that CyPB specifically binds to T-lymphocytes and promotes enhanced incorporation of CsA. The interactions with cellular binding sites involved, at least in part, the specific N-terminal extension of the protein. In this study, we intended to specify further the nature of the CyPB-binding sites on peripheral blood T-lymphocytes. We first provide evidence that the CyPB binding to heparin-Sepharose is prevented by soluble sulphated glycosaminoglycans (GAG), raising the interesting possibility that such interactions may occur on the T-cell surface. We then characterized CyPB binding to T-cell surface GAG and found that these interactions involved the N-terminal extension of CyPB, but not its conserved CsA-binding domain. In addition, we determined the presence of a second CyPB binding site, which we termed a type I site, in contrast with type II for GAG interactions. The two binding sites exhibit a similar affinity but the expression of the type I site was 3-fold lower. The conclusion that CyPB binding to the type I site is distinct from the interactions with GAG was based on the findings that it was (1) resistant to NaCl wash and GAG-degrading enzyme treatments, (2) reduced in the presence of CsA or cyclophilin C, and (3) unmodified in the presence of either the N-terminal peptide of CyPB or protamine. Finally, we showed that the type I binding sites were involved in an endocytosis process, supporting the hypothesis that they may correspond to a functional receptor for CyPB.

  6. Down-regulation of tryptamine binding sites following chronic molindone administration. A comparison with responses of dopamine and 5-hydroxytryptamine receptors.

    PubMed

    Nguyen, T V; Juorio, A V

    1989-10-01

    The present study assessed changes of tryptamine, dopamine D2, 5-HT1 and 5-HT2 binding sites in rat brain following chronic treatment with low (5 mg/kg/day) and high (40 mg/kg/day) doses of molindone, a clinically effective psychotropic drug. The high-dose molindone treatment produced a decrease in the number of tryptamine binding sites while both high and low doses caused an increase in the number of dopamine D2 binding sites in the striatum. No significant changes were observed in either 5-HT1 or 5-HT2 binding sites in the cerebral cortex. Competition binding experiments showed that molindone was a potent inhibitor at dopamine D2 but less effective at tryptamine, 5-HT1 and 5-HT2 binding sites. The inhibition activity of molindone towards type A monoamine oxidase produced a significant increase in endogenous tryptamine accumulation rate which was much higher than that of dopamine and 5-HT. These findings suggest that the reduction in the number of tryptamine binding sites produced by chronic molindone administration is related to monoamine oxidase inhibition and that the increase in the number of dopamine D2 binding sites is correlated to receptor blocking activity of the drug.

  7. Impact of germline and somatic missense variations on drug binding sites.

    PubMed

    Yan, C; Pattabiraman, N; Goecks, J; Lam, P; Nayak, A; Pan, Y; Torcivia-Rodriguez, J; Voskanian, A; Wan, Q; Mazumder, R

    2017-03-01

    Advancements in next-generation sequencing (NGS) technologies are generating a vast amount of data. This exacerbates the current challenge of translating NGS data into actionable clinical interpretations. We have comprehensively combined germline and somatic nonsynonymous single-nucleotide variations (nsSNVs) that affect drug binding sites in order to investigate their prevalence. The integrated data thus generated in conjunction with exome or whole-genome sequencing can be used to identify patients who may not respond to a specific drug because of alterations in drug binding efficacy due to nsSNVs in the target protein's gene. To identify the nsSNVs that may affect drug binding, protein-drug complex structures were retrieved from Protein Data Bank (PDB) followed by identification of amino acids in the protein-drug binding sites using an occluded surface method. Then, the germline and somatic mutations were mapped to these amino acids to identify which of these alter protein-drug binding sites. Using this method we identified 12 993 amino acid-drug binding sites across 253 unique proteins bound to 235 unique drugs. The integration of amino acid-drug binding sites data with both germline and somatic nsSNVs data sets revealed 3133 nsSNVs affecting amino acid-drug binding sites. In addition, a comprehensive drug target discovery was conducted based on protein structure similarity and conservation of amino acid-drug binding sites. Using this method, 81 paralogs were identified that could serve as alternative drug targets. In addition, non-human mammalian proteins bound to drugs were used to identify 142 homologs in humans that can potentially bind to drugs. In the current protein-drug pairs that contain somatic mutations within their binding site, we identified 85 proteins with significant differential gene expression changes associated with specific cancer types. Information on protein-drug binding predicted drug target proteins and prevalence of both somatic and germline nsSNVs that disrupt these binding sites can provide valuable knowledge for personalized medicine treatment. A web portal is available where nsSNVs from individual patient can be checked by scanning against DrugVar to determine whether any of the SNVs affect the binding of any drug in the database.

  8. Alterations in expression of imprinted genes from the H19/IGF2 loci in a multigenerational model of intrauterine growth restriction (IUGR).

    PubMed

    Gonzalez-Rodriguez, Pablo; Cantu, Jessica; O'Neil, Derek; Seferovic, Maxim D; Goodspeed, Danielle M; Suter, Melissa A; Aagaard, Kjersti M

    2016-05-01

    The H19/IGF2 imprinted loci have attracted recent attention because of their role in cellular differentiation and proliferation, heritable gene regulation, and in utero or early postnatal growth and development. Expression from the imprinted H19/IGF2 locus involves a complex interplay of 3 means of epigenetic regulation: proper establishment of DNA methylation, promoter occupancy of CTCF, and expression of microRNA-675. We have demonstrated previously in a multigenerational rat model of intrauterine growth restriction the epigenetic heritability of adult metabolic syndrome in a F2 generation. We have further demonstrated abrogation of the F2 adult metabolic syndrome phenotype with essential nutrient supplementation of intermediates along the 1-carbon pathway and shown that alterations in the metabolome precede the adult onset of metabolic syndrome. The upstream molecular and epigenomic mediators underlying these observations, however, have yet to be elucidated fully. In the current study, we sought to characterize the impact of the intrauterine growth-restricted lineage and essential nutrient supplementation on both levels and molecular mediators of H19 and IGF2 gene expression in the F2 generation. F2 intrauterine growth-restricted and sham lineages were obtained by exposing P1 (grandmaternal) pregnant dams to bilateral uterine artery ligation or sham surgery at gestational day 19.5. F1 pups were allocated to the essential nutrient supplemented or control diet at postnatal day 21, and bred at 6-7 weeks of age. Hepatic tissues from the resultant F2 offspring at birth and at weaning (day 21) were obtained. Bisulfite modification and sequencing was employed for methylation analysis. H19 and IGF2 expression was measured by quantitative polymerase chain reaction. Promoter occupancy was quantified by the use of chromatin immunoprecipitation, or ChIP, against CTCF insulator proteins. Growth-restricted F2 on control diet demonstrated significant down-regulation in H19 expression compared with sham lineage (0.7831 vs 1.287; P < .05); however, essential nutrient supplementation diet abrogates this difference (4.995 vs 5.100; P > .05). Conversely, Igf2 was up-regulated by essential nutrient supplemented diet on the sham lineage (2.0 fold, P = .01), an effect that was not observed in the growth restricted offspring. A significant differential methylation was observed in the promoter region of region H19 among the intrauterine growth-restricted lineage (18% vs 25%; P < .05) on a control diet, whereas the essential nutrient supplemented diet was alternately associated with hypermethylation in both lineages (sham: 50%; intrauterine growth restriction: 84%, P < .05). Consistent with essential nutrient supplementation impacting the epigenome, a decrease of CTCF promoter occupancy was observed in CTCF4 of the growth restricted lineage (2.45% vs 0.56%; P < .05) on the control diet, an effect that was repressed with essential nutrient supplementation. Heritable growth restriction is associated with changes in H19 gene expression; these changes are reversible with diet supplementation to favorably impact adult metabolic syndrome. Copyright © 2016. Published by Elsevier Inc.

  9. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  10. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin.

    PubMed

    Treuheit, Nicholas A; Beach, Muneera A; Komives, Elizabeth A

    2011-05-31

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethyl ketone to the active site serine, as well as noncovalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1; however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-l-arginine-(3-methyl-1,5-pantanediyl)amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause a similar reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or exosite 1.

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dissanayake, V.U.; Hughes, J.; Hunter, J.C.

    The specific binding of the selective {mu}-, {delta}-, and {kappa}-opioid ligands (3H)(D-Ala2,MePhe4,Gly-ol5)enkephalin ((3H) DAGOL), (3H)(D-Pen2,D-Pen5)enkephalin ((3H)DPDPE), and (3H)U69593, respectively, to crude membranes of the guinea pig and rat whole kidney, kidney cortex, and kidney medulla was investigated. In addition, the distribution of specific 3H-opioid binding sites in the guinea pig and rat kidney was visualized by autoradiography. Homogenate binding and autoradiography demonstrated the absence of {mu}- and {kappa}-opioid binding sites in the guinea pig kidney. No opioid binding sites were demonstrable in the rat kidney. In the guinea pig whole kidney, cortex, and medulla, saturation studies demonstrated that (3H)DPDPE boundmore » with high affinity (KD = 2.6-3.5 nM) to an apparently homogeneous population of binding sites (Bmax = 8.4-30 fmol/mg of protein). Competition studies using several opioid compounds confirmed the nature of the {delta}-opioid binding site. Autoradiography experiments demonstrated that specific (3H)DPDPE binding sites were distributed radially in regions of the inner and outer medulla and at the corticomedullary junction of the guinea pig kidney. Computer-assisted image analysis of saturation data yielded KD values (4.5-5.0 nM) that were in good agreement with those obtained from the homogenate binding studies. Further investigation of the {delta}-opioid binding site in medulla homogenates, using agonist ((3H)DPDPE) and antagonist ((3H)diprenorphine) binding in the presence of Na+, Mg2+, and nucleotides, suggested that the {delta}-opioid site is linked to a second messenger system via a GTP-binding protein. Further studies are required to establish the precise localization of the {delta} binding site in the guinea pig kidney and to determine the nature of the second messenger linked to the GTP-binding protein in the medulla.« less

  12. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  13. Distinct p53 genomic binding patterns in normal and cancer-derived human cells

    PubMed Central

    McCorkle, Sean R; McCombie, WR; Dunn, John J

    2011-01-01

    Here, we report genome-wide analysis of the tumor suppressor p53 binding sites in normal human cells. 743 high-confidence ChIP-seq peaks representing putative genomic binding sites were identified in normal IMR90 fibroblasts using a reference chromatin sample. More than 40% were located within 2 kb of a transcription start site (TSS), a distribution similar to that documented for individually studied, functional p53 binding sites and, to date, not observed by previous p53 genome-wide studies. Nearly half of the high-confidence binding sites in the IMR90 cells reside in CpG islands in marked contrast to sites reported in cancer-derived cells. The distinct genomic features of the IMR90 binding sites do not reflect a distinct preference for specific sequences, since the de novo developed p53 motif based on our study is similar to those reported by genome-wide studies of cancer cells. More likely, the different chromatin landscape in normal, compared with cancer-derived cells, influences p53 binding via modulating availability of the sites. We compared the IMR90 ChIP-seq peaks to the recently published IMR90 methylome1 and demonstrated that they are enriched at hypomethylated DNA. Our study represents the first genome-wide, de novo mapping of p53 binding sites in normal human cells and reveals that p53 binding sites reside in distinct genomic landscapes in normal and cancer-derived human cells. PMID:22127205

  14. Ethylene binding site affinity in ripening apples

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Blankenship, S.M.; Sisler, E.C.

    1993-09-01

    Scatchard plots for ethylene binding in apples (Malus domestica Borkh.), which were harvested weekly for 5 weeks to include the ethylene climacteric rise, showed C[sub 50] values (concentration of ethylene needed to occupy 50% of the ethylene binding sites) of 0.10, 0.11, 0.34, 0.40, and 0.57 [mu]l ethylene/liter[sup [minus]1], respectively, for each of the 5 weeks. Higher ethylene concentrations were required to saturate the binding sites during the climacteric rise than at other times. Diffusion of [sup 14]C-ethylene from the binding sites was curvilinear and did not show any indication of multiple binding sites. Ethylene was not metabolized by applemore » tissue.« less

  15. Physical interaction of the activator protein-1 factors c-Fos and c-Jun with Cbfa1 for collagenase-3 promoter activation

    NASA Technical Reports Server (NTRS)

    D'Alonzo, Richard C.; Selvamurugan, Nagarajan; Karsenty, Gerard; Partridge, Nicola C.

    2002-01-01

    Previously, we determined that the activator protein-1 (AP-1)-binding site and the runt domain (RD)-binding site and their binding proteins, c-Fos.c-Jun and Cbfa, regulate the collagenase-3 promoter in parathyroid hormone-treated and differentiating osteoblasts. Here we show that Cbfa1 and c-Fos.c-Jun appear to cooperatively bind the RD- and AP-1-binding sites and form ternary structures in vitro. Both in vitro and in vivo co-immunoprecipitation and yeast two-hybrid studies further demonstrate interaction between Cbfa1 with c-Fos and c-Jun in the absence of phosphorylation and without binding to DNA. Additionally, only the runt domain of Cbfa1 was required for interaction with c-Jun and c-Fos. In mammalian cells, overexpression of Cbfa1 enhanced c-Jun activation of AP-1-binding site promoter activity, demonstrating functional interaction. Finally, insertion of base pairs that disrupted the helical phasing between the AP-1- and RD-binding sites also inhibited collagenase-3 promoter activation. Thus, we provide direct evidence that Cbfa1 and c-Fos.c-Jun physically interact and cooperatively bind the AP-1- and RD-binding sites in the collagenase-3 promoter. Moreover, the AP-1- and RD-binding sites appear to be organized in a specific required helical arrangement that facilitates transcription factor interaction and enables promoter activation.

  16. Functional identification and characterization of sodium binding sites in Na symporters

    PubMed Central

    Loo, Donald D. F.; Jiang, Xuan; Gorraitz, Edurne; Hirayama, Bruce A.; Wright, Ernest M.

    2013-01-01

    Sodium cotransporters from several different gene families belong to the leucine transporter (LeuT) structural family. Although the identification of Na+ in binding sites is beyond the resolution of the structures, two Na+ binding sites (Na1 and Na2) have been proposed in LeuT. Na2 is conserved in the LeuT family but Na1 is not. A biophysical method has been used to measure sodium dissociation constants (Kd) of wild-type and mutant human sodium glucose cotransport (hSGLT1) proteins to identify the Na+ binding sites in hSGLT1. The Na1 site is formed by residues in the sugar binding pocket, and their mutation influences sodium binding to Na1 but not to Na2. For the canonical Na2 site formed by two –OH side chains, S392 and S393, and three backbone carbonyls, mutation of S392 to cysteine increased the sodium Kd by sixfold. This was accompanied by a dramatic reduction in the apparent sugar and phlorizin affinities. We suggest that mutation of S392 in the Na2 site produces a structural rearrangement of the sugar binding pocket to disrupt both the binding of the second Na+ and the binding of sugar. In contrast, the S393 mutations produce no significant changes in sodium, sugar, and phlorizin affinities. We conclude that the Na2 site is conserved in hSGLT1, the side chain of S392 and the backbone carbonyl of S393 are important in the first Na+ binding, and that Na+ binding to Na2 promotes binding to Na1 and also sugar binding. PMID:24191006

  17. Inactivation by Phenylglyoxal of the Specific Binding of 1-Naphthyl Acetic Acid with Membrane-Bound Auxin Binding Sites from Maize Coleoptiles

    PubMed Central

    Navé, Jean-François; Benveniste, Pierre

    1984-01-01

    The specific binding of 1-[3H]naphthyl acetic acid (NAA) to membrane-bound binding sites from maize (Zea mays cv INRA 258) coleoptiles is inactivated by phenylglyoxal. The inactivation obeys pseudo first-order kinetics. The rate of inactivation is proportional to phenylglyoxal concentration. Under conditions at which significant binding occurs, NAA, R and S-1-naphthyl 2-propionic acids protect the auxin binding site against inactivation by phenylglyoxal. Scatchard analysis shows that the inhibition of binding corresponds to a decrease in the concentration of sites but not in the affinity. The results of the present chemical modification study indicate that at least one arginyl residue is involved in the positively charged recognition site of the carboxylate anion of NAA. PMID:16663499

  18. Molecular blueprint of allosteric binding sites in a homologue of the agonist-binding domain of the α7 nicotinic acetylcholine receptor

    PubMed Central

    Spurny, Radovan; Debaveye, Sarah; Farinha, Ana; Veys, Ken; Vos, Ann M.; Gossas, Thomas; Atack, John; Bertrand, Sonia; Bertrand, Daniel; Danielson, U. Helena; Tresadern, Gary; Ulens, Chris

    2015-01-01

    The α7 nicotinic acetylcholine receptor (nAChR) belongs to the family of pentameric ligand-gated ion channels and is involved in fast synaptic signaling. In this study, we take advantage of a recently identified chimera of the extracellular domain of the native α7 nicotinic acetylcholine receptor and acetylcholine binding protein, termed α7-AChBP. This chimeric receptor was used to conduct an innovative fragment-library screening in combination with X-ray crystallography to identify allosteric binding sites. One allosteric site is surface-exposed and is located near the N-terminal α-helix of the extracellular domain. Ligand binding at this site causes a conformational change of the α-helix as the fragment wedges between the α-helix and a loop homologous to the main immunogenic region of the muscle α1 subunit. A second site is located in the vestibule of the receptor, in a preexisting intrasubunit pocket opposite the agonist binding site and corresponds to a previously identified site involved in positive allosteric modulation of the bacterial homolog ELIC. A third site is located at a pocket right below the agonist binding site. Using electrophysiological recordings on the human α7 nAChR we demonstrate that the identified fragments, which bind at these sites, can modulate receptor activation. This work presents a structural framework for different allosteric binding sites in the α7 nAChR and paves the way for future development of novel allosteric modulators with therapeutic potential. PMID:25918415

  19. Muscarinic binding sites in cultured bovine pulmonary arterial endothelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aronstam, R.S.; Catravas, J.D.; Ryan, U.S.

    The authors have previously reported a) the presence of muscarinic binding sites on cultured bovine pulmonary arterial endothelial cells (BPAE; 2,000 sites/cell) and b) that acetylcholine inhibits the release of thromboxane B/sub 2/ fro BPAE. Since the authors findings could reflect muscarinic receptors (mAChR) on BPAE, they have further investigated the nature of BPAE muscarinic binding sites and contrast them to those of known functional mAChR. Muscarinic binding sites on BPAE resembled mAChR in that a) the binding of 3 nM /sup 3/H QNB was inhibited by muscarinic agonists and antagonists; b) /sup 3/H QNB binding was 30 times moremore » sensitive to R(-)- than to S(+)-QNB; c) carbamylcholine binding was resolved into high and low affinity components (IC50's = 0.04 and 2 ..mu..M; d) 5'-guanylylimidodiphosphate (100 ..mu..M) shifted agonist binding curves to the right by a factor of 3; 4) the atropine-sensitive binding of /sup 3/H oxotremorine-M (/sup 3/H-OXO-M) was depressed by the guanine nucleotide (IC50 + 60 ..mu..M). However, although gallamine allosterically regulates mAChR binding in other tissues, it did not affect the rates of dissociation of /sup 3/H QNB, /sup 3/H methylscopolamine or /sup 3/H OXO-M from BPAE binding sites. Thus, BPAE muscarinic binding sites posses many but not all of the properties associated with functional mAChR.« less

  20. Autoradiographic localization of endothelin-1 binding sites in porcine skin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhao, Y.D.; Springall, D.R.; Wharton, J.

    Autoradiographic techniques and {sup 125}I-labeled endothelin-1 were used to study the distribution of endothelin-1 binding sites in porcine skin. Specific endothelin-1 binding sites were localized to blood vessels (capillaries, deep cutaneous vascular plexus, arteries, and arterioles), the deep dermal and connective tissue sheath of hair follicles, sebaceous and sweat glands, and arrector pili muscle. Specific binding was inhibited by endothelin-2 and endothelin-3 as well as endothelin-1. Non-specific binding was found in the epidermis and the medulla of hair follicles. No binding was found in connective tissue or fat. These vascular binding sites may represent endothelin receptors, in keeping with themore » known cutaneous vasoconstrictor actions of the peptide. If all binding sites are receptors, the results suggest that endothelin could also regulate the function of sweat glands and may have trophic effects in the skin.« less

  1. Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

    PubMed

    Withey, Jeffrey H; DiRita, Victor J

    2005-05-01

    The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp insertions between the two ToxT binding sites indicate that both binding sites are occupied by ToxT regardless of their positions relative to each other. Based on these results, we propose that ToxT binds independently to two DNA sites between acfA and acfD to activate transcription of both genes.

  2. MONKEY: Identifying conserved transcription-factor binding sitesin multiple alignments using a binding site-specific evolutionarymodel

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Moses, Alan M.; Chiang, Derek Y.; Pollard, Daniel A.

    2004-10-28

    We introduce a method (MONKEY) to identify conserved transcription-factor binding sites in multispecies alignments. MONKEY employs probabilistic models of factor specificity and binding site evolution, on which basis we compute the likelihood that putative sites are conserved and assign statistical significance to each hit. Using genomes from the genus Saccharomyces, we illustrate how the significance of real sites increases with evolutionary distance and explore the relationship between conservation and function.

  3. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  4. Prediction of Carbohydrate Binding Sites on Protein Surfaces with 3-Dimensional Probability Density Distributions of Interacting Atoms

    PubMed Central

    Tsai, Keng-Chang; Jian, Jhih-Wei; Yang, Ei-Wen; Hsu, Po-Chiang; Peng, Hung-Pin; Chen, Ching-Tai; Chen, Jun-Bo; Chang, Jeng-Yih; Hsu, Wen-Lian; Yang, An-Suei

    2012-01-01

    Non-covalent protein-carbohydrate interactions mediate molecular targeting in many biological processes. Prediction of non-covalent carbohydrate binding sites on protein surfaces not only provides insights into the functions of the query proteins; information on key carbohydrate-binding residues could suggest site-directed mutagenesis experiments, design therapeutics targeting carbohydrate-binding proteins, and provide guidance in engineering protein-carbohydrate interactions. In this work, we show that non-covalent carbohydrate binding sites on protein surfaces can be predicted with relatively high accuracy when the query protein structures are known. The prediction capabilities were based on a novel encoding scheme of the three-dimensional probability density maps describing the distributions of 36 non-covalent interacting atom types around protein surfaces. One machine learning model was trained for each of the 30 protein atom types. The machine learning algorithms predicted tentative carbohydrate binding sites on query proteins by recognizing the characteristic interacting atom distribution patterns specific for carbohydrate binding sites from known protein structures. The prediction results for all protein atom types were integrated into surface patches as tentative carbohydrate binding sites based on normalized prediction confidence level. The prediction capabilities of the predictors were benchmarked by a 10-fold cross validation on 497 non-redundant proteins with known carbohydrate binding sites. The predictors were further tested on an independent test set with 108 proteins. The residue-based Matthews correlation coefficient (MCC) for the independent test was 0.45, with prediction precision and sensitivity (or recall) of 0.45 and 0.49 respectively. In addition, 111 unbound carbohydrate-binding protein structures for which the structures were determined in the absence of the carbohydrate ligands were predicted with the trained predictors. The overall prediction MCC was 0.49. Independent tests on anti-carbohydrate antibodies showed that the carbohydrate antigen binding sites were predicted with comparable accuracy. These results demonstrate that the predictors are among the best in carbohydrate binding site predictions to date. PMID:22848404

  5. Selective labeling of serotonin uptake sites in rat brain by (/sup 3/H)citalopram contrasted to labeling of multiple sites by (/sup 3/H)imipramine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    D'Amato, R.J.; Largent, B.L.; Snowman, A.M.

    1987-07-01

    Citalopram is a potent and selective inhibitor of neuronal serotonin uptake. In rat brain membranes (/sup 3/H)citalopram demonstrates saturable and reversible binding with a KD of 0.8 nM and a maximal number of binding sites (Bmax) of 570 fmol/mg of protein. The drug specificity for (/sup 3/H)citalopram binding and synaptosomal serotonin uptake are closely correlated. Inhibition of (/sup 3/H)citalopram binding by both serotonin and imipramine is consistent with a competitive interaction in both equilibrium and kinetic analyses. The autoradiographic pattern of (/sup 3/H)citalopram binding sites closely resembles the distribution of serotonin. By contrast, detailed equilibrium-saturation analysis of (/sup 3/H)imipramine bindingmore » reveals two binding components, i.e., high affinity (KD = 9 nM, Bmax = 420 fmol/mg of protein) and low affinity (KD = 553 nM, Bmax = 8560 fmol/mg of protein) sites. Specific (/sup 3/H)imipramine binding, defined as the binding inhibited by 100 microM desipramine, is displaced only partially by serotonin. Various studies reveal that the serotonin-sensitive portion of binding corresponds to the high affinity sites of (/sup 3/H)imipramine binding whereas the serotonin-insensitive binding corresponds to the low affinity sites. Lesioning of serotonin neurons with p-chloroamphetamine causes a large decrease in (/sup 3/H)citalopram and serotonin-sensitive (/sup 3/H)imipramine binding with only a small effect on serotonin-insensitive (/sup 3/H)imipramine binding. The dissociation rate of (/sup 3/H)imipramine or (/sup 3/H)citalopram is not altered by citalopram, imipramine or serotonin up to concentrations of 10 microM. The regional distribution of serotonin sensitive (/sup 3/H)imipramine high affinity binding sites closely resembles that of (/sup 3/H)citalopram binding.« less

  6. Computational assessment of the cooperativity between RNA binding proteins and MicroRNAs in Transcript Decay.

    PubMed

    Jiang, Peng; Singh, Mona; Coller, Hilary A

    2013-01-01

    Transcript degradation is a widespread and important mechanism for regulating protein abundance. Two major regulators of transcript degradation are RNA Binding Proteins (RBPs) and microRNAs (miRNAs). We computationally explored whether RBPs and miRNAs cooperate to promote transcript decay. We defined five RBP motifs based on the evolutionary conservation of their recognition sites in 3'UTRs as the binding motifs for Pumilio (PUM), U1A, Fox-1, Nova, and UAUUUAU. Recognition sites for some of these RBPs tended to localize at the end of long 3'UTRs. A specific group of miRNA recognition sites were enriched within 50 nts from the RBP recognition sites for PUM and UAUUUAU. The presence of both a PUM recognition site and a recognition site for preferentially co-occurring miRNAs was associated with faster decay of the associated transcripts. For PUM and its co-occurring miRNAs, binding of the RBP to its recognition sites was predicted to release nearby miRNA recognition sites from RNA secondary structures. The mammalian miRNAs that preferentially co-occur with PUM binding sites have recognition seeds that are reverse complements to the PUM recognition motif. Their binding sites have the potential to form hairpin secondary structures with proximal PUM binding sites that would normally limit RISC accessibility, but would be more accessible to miRNAs in response to the binding of PUM. In sum, our computational analyses suggest that a specific set of RBPs and miRNAs work together to affect transcript decay, with the rescue of miRNA recognition sites via RBP binding as one possible mechanism of cooperativity.

  7. Zn(II) stimulation of Fe(II)-activated repression in the iron-dependent repressor from Mycobacterium tuberculosis.

    PubMed

    Stapleton, Brian; Walker, Lawrence R; Logan, Timothy M

    2013-03-19

    Thermodynamic measurements of Fe(II) binding and activation of repressor function in the iron-dependent repressor from Mycobacterium tuberculosis (IdeR) are reported. IdeR, a member of the diphtheria toxin repressor family of proteins, regulates iron homeostasis and contributes to the virulence response in M. tuberculosis. Although iron is the physiological ligand, this is the first detailed analysis of iron binding and activation in this protein. The results showed that IdeR binds 2 equiv of Fe(II) with dissociation constants that differ by a factor of 25. The high- and low-affinity iron binding sites were assigned to physical binding sites I and II, respectively, using metal binding site mutants. IdeR was also found to contain a high-affinity Zn(II) binding site that was assigned to physical metal binding site II through the use of binding site mutants and metal competition assays. Fe(II) binding was modestly weaker in the presence of Zn(II), but the coupled metal binding-DNA binding affinity was significantly stronger, requiring 30-fold less Fe(II) to activate DNA binding compared to Fe(II) alone. Together, these results suggest that IdeR is a mixed-metal repressor, where Zn(II) acts as a structural metal and Fe(II) acts to trigger the physiologically relevant promoter binding. This new model for IdeR activation provides a better understanding of IdeR and the biology of iron homeostasis in M. tuberculosis.

  8. Sigma opiates and certain antipsychotic drugs mutually inhibit (+)-[3H] SKF 10,047 and [3H]haloperidol binding in guinea pig brain membranes.

    PubMed Central

    Tam, S W; Cook, L

    1984-01-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-[3H]SKF 10,047 (N-allylnormetazocine) and to dopamine D2 sites was investigated. In guinea pig brain membranes, (+)-[3H]SKF 10,047 bound to a single class of sites with a Kd of 4 X 10(-8) M and a Bmax of 333 fmol/mg of protein. This binding was different from mu, kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-[3H]SKF 10,047 binding with high to moderate affinities in the following order of potency: haloperidol greater than perphenazine greater than fluphenazine greater than acetophenazine greater than trifluoperazine greater than molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-[3H]SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-[3H]SKF 10,047 binding sites did not correlate with those for [3H]spiperone (dopamine D2) sites. [3H]-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-SKF 10,047. In the striatum, about half of the saturable [3H]haloperidol binding was to [3H]spiperone (D2) sites and the other half was to sites similar to (+)-[3H]SKF 10,047 binding sites. PMID:6147851

  9. Uncoupling metallonuclease metal ion binding sites via nudge mutagenesis.

    PubMed

    Papadakos, Grigorios A; Nastri, Horacio; Riggs, Paul; Dupureur, Cynthia M

    2007-05-01

    The hydrolysis of phosphodiester bonds by nucleases is critical to nucleic acid processing. Many nucleases utilize metal ion cofactors, and for a number of these enzymes two active-site metal ions have been detected. Testing proposed mechanistic roles for individual bound metal ions has been hampered by the similarity between the sites and cooperative behavior. In the homodimeric PvuII restriction endonuclease, the metal ion dependence of DNA binding is sigmoidal and consistent with two classes of coupled metal ion binding sites. We reasoned that a conservative active-site mutation would perturb the ligand field sufficiently to observe the titration of individual metal ion binding sites without significantly disturbing enzyme function. Indeed, mutation of a Tyr residue 5.5 A from both metal ions in the enzyme-substrate crystal structure (Y94F) renders the metal ion dependence of DNA binding biphasic: two classes of metal ion binding sites become distinct in the presence of DNA. The perturbation in metal ion coordination is supported by 1H-15N heteronuclear single quantum coherence spectra of enzyme-Ca(II) and enzyme-Ca(II)-DNA complexes. Metal ion binding by free Y94F is basically unperturbed: through multiple experiments with different metal ions, the data are consistent with two alkaline earth metal ion binding sites per subunit of low millimolar affinity, behavior which is very similar to that of the wild type. The results presented here indicate a role for the hydroxyl group of Tyr94 in the coupling of metal ion binding sites in the presence of DNA. Its removal causes the affinities for the two metal ion binding sites to be resolved in the presence of substrate. Such tuning of metal ion affinities will be invaluable to efforts to ascertain the contributions of individual bound metal ions to metallonuclease function.

  10. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S., E-mail: chapmami@ohsu.edu

    2012-02-05

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  11. Identification of the heparin binding site on adeno-associated virus serotype 3B (AAV-3B)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lerch, Thomas F.; Chapman, Michael S.

    2012-05-24

    Adeno-associated virus is a promising vector for gene therapy. In the current study, the binding site on AAV serotype 3B for the heparan sulfate proteoglycan (HSPG) receptor has been characterized. X-ray diffraction identified a disaccharide binding site at the most positively charged region on the virus surface. The contributions of basic amino acids at this and other sites were characterized using site-directed mutagenesis. Both heparin and cell binding are correlated to positive charge at the disaccharide binding site, and transduction is significantly decreased in AAV-3B vectors mutated at this site to reduce heparin binding. While the receptor attachment sites ofmore » AAV-3B and AAV-2 are both in the general vicinity of the viral spikes, the exact amino acids that participate in electrostatic interactions are distinct. Diversity in the mechanisms of cell attachment by AAV serotypes will be an important consideration for the rational design of improved gene therapy vectors.« less

  12. Location of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg white lysozyme from salt solutions. Previous studies employing X-ray crystallography had found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystal grown in bromide and chloride solutions. Five possible anion binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four of these sites corresponded to four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion binding sites in lysozyme remain unchanged, even when different anions and different crystal forms of lysozyme are employed.

  13. Locations of Bromide Ions in Tetragonal Lysozyme Crystals

    NASA Technical Reports Server (NTRS)

    Lim, Kap; Nadarajah, Arunan; Forsythe, Elizabeth L.; Pusey, Marc L.

    1998-01-01

    Anions have been shown to play a dominant role in the crystallization of chicken egg-white lysozyme from salt solutions. Previous studies employing X-ray crystallography have found one chloride ion binding site in the tetragonal crystal form of the protein and four nitrate ion binding sites in the monoclinic form. In this study the anion positions in the tetragonal form were determined from the difference Fourier map obtained from lysozyme crystals grown in bromide and chloride solutions. Five possible anion-binding sites were found in this manner. Some of these sites were in pockets containing basic residues while others were near neutral, but polar, residues. The sole chloride ion binding site found in previous studies was confirmed, while four further sites were found which corresponded to the four binding sites found for nitrate ions in monoclinic crystals. The study suggests that most of the anion-binding sites in lysozyme remain unchanged even when different anions and different crystal forms of lysozyme are employed.

  14. Discovering amino acid patterns on binding sites in protein complexes

    PubMed Central

    Kuo, Huang-Cheng; Ong, Ping-Lin; Lin, Jung-Chang; Huang, Jen-Peng

    2011-01-01

    Discovering amino acid (AA) patterns on protein binding sites has recently become popular. We propose a method to discover the association relationship among AAs on binding sites. Such knowledge of binding sites is very helpful in predicting protein-protein interactions. In this paper, we focus on protein complexes which have protein-protein recognition. The association rule mining technique is used to discover geographically adjacent amino acids on a binding site of a protein complex. When mining, instead of treating all AAs of binding sites as a transaction, we geographically partition AAs of binding sites in a protein complex. AAs in a partition are treated as a transaction. For the partition process, AAs on a binding site are projected from three-dimensional to two-dimensional. And then, assisted with a circular grid, AAs on the binding site are placed into grid cells. A circular grid has ten rings: a central ring, the second ring with 6 sectors, the third ring with 12 sectors, and later rings are added to four sectors in order. As for the radius of each ring, we examined the complexes and found that 10Å is a suitable range, which can be set by the user. After placing these recognition complexes on the circular grid, we obtain mining records (i.e. transactions) from each sector. A sector is regarded as a record. Finally, we use the association rule to mine these records for frequent AA patterns. If the support of an AA pattern is larger than the predetermined minimum support (i.e. threshold), it is called a frequent pattern. With these discovered patterns, we offer the biologists a novel point of view, which will improve the prediction accuracy of protein-protein recognition. In our experiments, we produced the AA patterns by data mining. As a result, we found that arginine (arg) most frequently appears on the binding sites of two proteins in the recognition protein complexes, while cysteine (cys) appears the fewest. In addition, if we discriminate the shape of binding sites between concave and convex further, we discover that patterns {arg, glu, asp} and {arg, ser, asp} on the concave shape of binding sites in a protein more frequently (i.e. higher probability) make contact with {lys} or {arg} on the convex shape of binding sites in another protein. Thus, we can confidently achieve a rate of at least 78%. On the other hand {val, gly, lys} on the convex surface of binding sites in proteins is more frequently in contact with {asp} on the concave site of another protein, and the confidence achieved is over 81%. Applying data mining in biology can reveal more facts that may otherwise be ignored or not easily discovered by the naked eye. Furthermore, we can discover more relationships among AAs on binding sites by appropriately rotating these residues on binding sites from a three-dimension to two-dimension perspective. We designed a circular grid to deposit the data, which total to 463 records consisting of AAs. Then we used the association rules to mine these records for discovering relationships. The proposed method in this paper provides an insight into the characteristics of binding sites for recognition complexes. PMID:21464838

  15. A complex mechanism determines polarity of DNA replication fork arrest by the replication terminator complex of Bacillus subtilis.

    PubMed

    Duggin, Iain G; Matthews, Jacqueline M; Dixon, Nicholas E; Wake, R Gerry; Mackay, Joel P

    2005-04-01

    Two dimers of the replication terminator protein (RTP) of Bacillus subtilis bind to a chromosomal DNA terminator site to effect polar replication fork arrest. Cooperative binding of the dimers to overlapping half-sites within the terminator is essential for arrest. It was suggested previously that polarity of fork arrest is the result of the RTP dimer at the blocking (proximal) side within the complex binding very tightly and the permissive-side RTP dimer binding relatively weakly. In order to investigate this "differential binding affinity" model, we have constructed a series of mutant terminators that contain half-sites of widely different RTP binding affinities in various combinations. Although there appeared to be a correlation between binding affinity at the proximal half-site and fork arrest efficiency in vivo for some terminators, several deviated significantly from this correlation. Some terminators exhibited greatly reduced binding cooperativity (and therefore have reduced affinity at each half-site) but were highly efficient in fork arrest, whereas one terminator had normal affinity over the proximal half-site, yet had low fork arrest efficiency. The results show clearly that there is no direct correlation between the RTP binding affinity (either within the full complex or at the proximal half-site within the full complex) and the efficiency of replication fork arrest in vivo. Thus, the differential binding affinity over the proximal and distal half-sites cannot be solely responsible for functional polarity of fork arrest. Furthermore, efficient fork arrest relies on features in addition to the tight binding of RTP to terminator DNA.

  16. Principal component analysis of chemical shift perturbation data of a multiple-ligand-binding system for elucidation of respective binding mechanism.

    PubMed

    Konuma, Tsuyoshi; Lee, Young-Ho; Goto, Yuji; Sakurai, Kazumasa

    2013-01-01

    Chemical shift perturbations (CSPs) in NMR spectra provide useful information about the interaction of a protein with its ligands. However, in a multiple-ligand-binding system, determining quantitative parameters such as a dissociation constant (K(d) ) is difficult. Here, we used a method we named CS-PCA, a principal component analysis (PCA) of chemical shift (CS) data, to analyze the interaction between bovine β-lactoglobulin (βLG) and 1-anilinonaphthalene-8-sulfonate (ANS), which is a multiple-ligand-binding system. The CSP on the binding of ANS involved contributions from two distinct binding sites. PCA of the titration data successfully separated the CSP pattern into contributions from each site. Docking simulations based on the separated CSP patterns provided the structures of βLG-ANS complexes for each binding site. In addition, we determined the K(d) values as 3.42 × 10⁻⁴ M² and 2.51 × 10⁻³ M for Sites 1 and 2, respectively. In contrast, it was difficult to obtain reliable K(d) values for respective sites from the isothermal titration calorimetry experiments. Two ANS molecules were found to bind at Site 1 simultaneously, suggesting that the binding occurs cooperatively with a partial unfolding of the βLG structure. On the other hand, the binding of ANS to Site 2 was a simple attachment without a significant conformational change. From the present results, CS-PCA was confirmed to provide not only the positions and the K(d) values of binding sites but also information about the binding mechanism. Thus, it is anticipated to be a general method to investigate protein-ligand interactions. Copyright © 2012 Wiley Periodicals, Inc.

  17. Thermodynamic compensation upon binding to exosite 1 and the active site of thrombin

    PubMed Central

    Treuheit, Nicholas A.; Beach, Muneera A.; Komives, Elizabeth A.

    2011-01-01

    Several lines of experimental evidence including amide exchange and NMR suggest that ligands binding to thrombin cause reduced backbone dynamics. Binding of the covalent inhibitor dPhe-Pro-Arg chloromethylketone to the active site serine, as well as non-covalent binding of a fragment of the regulatory protein, thrombomodulin, to exosite 1 on the back side of the thrombin molecule both cause reduced dynamics. However, the reduced dynamics do not appear to be accompanied by significant conformational changes. In addition, binding of ligands to the active site does not change the affinity of thrombomodulin fragments binding to exosite 1, however, the thermodynamic coupling between exosite 1 and the active site has not been fully explored. We present isothermal titration calorimetry experiments that probe changes in enthalpy and entropy upon formation of binary ligand complexes. The approach relies on stringent thrombin preparation methods and on the use of dansyl-L-arginine-(3-methyl-1,5-pantanediyl) amide and a DNA aptamer as ligands with ideal thermodynamic signatures for binding to the active site and to exosite 1. Using this approach, the binding thermodynamic signatures of each ligand alone as well as the binding signatures of each ligand when the other binding site was occupied were measured. Different exosite 1 ligands with widely varied thermodynamic signatures cause the same reduction in ΔH and a concomitantly lower entropy cost upon DAPA binding at the active site. The results suggest a general phenomenon of enthalpy-entropy compensation consistent with reduction of dynamics/increased folding of thrombin upon ligand binding to either the active site or to exosite 1. PMID:21526769

  18. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes.

    PubMed

    Cockburn, Darrell; Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data.

  19. Using Carbohydrate Interaction Assays to Reveal Novel Binding Sites in Carbohydrate Active Enzymes

    PubMed Central

    Wilkens, Casper; Dilokpimol, Adiphol; Nakai, Hiroyuki; Lewińska, Anna; Abou Hachem, Maher; Svensson, Birte

    2016-01-01

    Carbohydrate active enzymes often contain auxiliary binding sites located either on independent domains termed carbohydrate binding modules (CBMs) or as so-called surface binding sites (SBSs) on the catalytic module at a certain distance from the active site. The SBSs are usually critical for the activity of their cognate enzyme, though they are not readily detected in the sequence of a protein, but normally require a crystal structure of a complex for their identification. A variety of methods, including affinity electrophoresis (AE), insoluble polysaccharide pulldown (IPP) and surface plasmon resonance (SPR) have been used to study auxiliary binding sites. These techniques are complementary as AE allows monitoring of binding to soluble polysaccharides, IPP to insoluble polysaccharides and SPR to oligosaccharides. Here we show that these methods are useful not only for analyzing known binding sites, but also for identifying new ones, even without structural data available. We further verify the chosen assays discriminate between known SBS/CBM containing enzymes and negative controls. Altogether 35 enzymes are screened for the presence of SBSs or CBMs and several novel binding sites are identified, including the first SBS ever reported in a cellulase. This work demonstrates that combinations of these methods can be used as a part of routine enzyme characterization to identify new binding sites and advance the study of SBSs and CBMs, allowing them to be detected in the absence of structural data. PMID:27504624

  20. Volatile anesthetics compete for common binding sites on bovine serum albumin: a 19F-NMR study.

    PubMed Central

    Dubois, B W; Cherian, S F; Evers, A S

    1993-01-01

    There is controversy as to the molecular nature of volatile anesthetic target sites. One proposal is that volatile anesthetics bind directly to hydrophobic binding sites on certain sensitive target proteins. Consistent with this hypothesis, we have previously shown that a fluorinated volatile anesthetic, isoflurane, binds saturably [Kd (dissociation constant) = 1.4 +/- 0.2 mM, Bmax = 4.2 +/- 0.3 sites] to fatty acid-displaceable domains on serum albumin. In the current study, we used 19F-NMR T2 relaxation to examine whether other volatile anesthetics bind to the same sites on albumin and, if so, whether they vary in their affinity for these sites. We show that three other fluorinated volatile anesthetics bind with varying affinity to fatty acid-displaceable domains on serum albumin: halothane, Kd = 1.3 +/- 0.2 mM; methoxyflurane, Kd = 2.6 +/- 0.3 mM; and sevoflurane, Kd = 4.5 +/- 0.6 mM. These three anesthetics inhibit isoflurane binding in a competitive manner: halothane, K(i) (inhibition constant) = 1.3 +/- 0.2 mM; methoxyflurane, K(i) = 2.5 +/- 0.4 mM; and sevoflurane, K(i) = 5.4 +/- 0.7 mM--similar to each anesthetic's respective Kd of binding to fatty acid displaceable sites. These results illustrate that a variety of volatile anesthetics can compete for binding to specific sites on a protein. PMID:8341659

  1. Characterization of melatonin binding sites in the Harderian gland and median eminence of the rat

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lopez-Gonzalez, M.A.; Calvo, J.R.; Rubio, A.

    The characterization of specific melatonin binding sites in the Harderian gland (HG) and median eminence (ME) of the rat was studied using ({sup 125}I)melatonin. Binding of melatonin to membrane crude preparations of both tissues was dependent on time and temperature. Thus, maximal binding was obtained at 37{degree}C after 30-60 min incubation. Binding was also dependent on protein concentration. The specific binding of ({sup 125}I)melatonin was saturable, exhibiting only the class of binding sites in both tissues. The dissociation constants (Kd) were 170 and 190 pM for ME and HG, respectively. The concentration of the binding sites in ME was 8more » fmol/mg protein, and in the HG 4 fmol/mg protein. In competition studies, binding of ({sup 125}I)melatonin to ME or HG was inhibited by increasing concentration of native melatonin; 50% inhibition was observed at about 702 and 422 nM for ME and HG, respectively. Additionally, the ({sup 125}I)melatonin binding to the crude membranes was not affected by the addition of different drugs such as norepinephrine, isoproterenol, phenylephrine, propranolol, or prazosin. The results confirm the presence of melatonin binding sites in median eminence and show, for the first time, the existence of melatonin binding sites in the Harderian gland.« less

  2. Localization and characterization of (/sup 3/H)desmethylimipramine binding sites in rat brain by quantitative autoradiography

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Biegon, A.; Rainbow, T.C.

    1983-05-01

    The high affinity binding sites for the antidepressant desmethlyimipramine (DMI) have been localized in rat brain by quantitative autoradiography. There are high concentrations of binding sites in the locus ceruleus, the anterior ventral thalamus, the ventral portion of the bed nucleus of the stria terminalis, the paraventricular and the dorsomedial nuclei of the hypothalamus. The distribution of DMI binding sites is in striking accord with the distribution of norepinephrine terminals. Pretreatment of rats with the neurotoxin 6-hydroxydopamine, which causes a selective degeneration of catecholamine terminals, results in 60 to 90% decrease in DMI binding. These data support the idea thatmore » high affinity binding sites for DMI are located on presynaptic noradrenergic terminals.« less

  3. Structural and functional dissection reveals distinct roles of Ca2+-binding sites in the giant adhesin SiiE of Salmonella enterica

    PubMed Central

    Klingl, Stefan; Sandmann, Achim; Taccardi, Nicola; Sticht, Heinrich; Muller, Yves A.; Hensel, Michael

    2017-01-01

    The giant non-fimbrial adhesin SiiE of Salmonella enterica mediates the first contact to the apical site of epithelial cells and enables subsequent invasion. SiiE is a 595 kDa protein composed of 53 repetitive bacterial immunoglobulin (BIg) domains and the only known substrate of the SPI4-encoded type 1 secretion system (T1SS). The crystal structure of BIg50-52 of SiiE revealed two distinct Ca2+-binding sites per BIg domain formed by conserved aspartate or glutamate residues. In a mutational analysis Ca2+-binding sites were disrupted by aspartate to serine exchange at various positions in the BIg domains of SiiE. Amounts of secreted SiiE diminish with a decreasing number of intact Ca2+-binding sites. BIg domains of SiiE contain distinct Ca2+-binding sites, with type I sites being similar to other T1SS-secreted proteins and type II sites newly identified in SiiE. We functionally and structurally dissected the roles of type I and type II Ca2+-binding sites in SiiE, as well as the importance of Ca2+-binding sites in various positions of SiiE. Type I Ca2+-binding sites were critical for efficient secretion of SiiE and a decreasing number of type I sites correlated with reduced secretion. Type II sites were less important for secretion, stability and surface expression of SiiE, however integrity of type II sites in the C-terminal portion was required for the function of SiiE in mediating adhesion and invasion. PMID:28558023

  4. Binding of N-methylscopolamine to the extracellular domain of muscarinic acetylcholine receptors

    NASA Astrophysics Data System (ADS)

    Jakubík, Jan; Randáková, Alena; Zimčík, Pavel; El-Fakahany, Esam E.; Doležal, Vladimír

    2017-01-01

    Interaction of orthosteric ligands with extracellular domain was described at several aminergic G protein-coupled receptors, including muscarinic acetylcholine receptors. The orthosteric antagonists quinuclidinyl benzilate (QNB) and N-methylscopolamine (NMS) bind to the binding pocket of the muscarinic acetylcholine receptor formed by transmembrane α-helices. We show that high concentrations of either QNB or NMS slow down dissociation of their radiolabeled species from all five subtypes of muscarinic acetylcholine receptors, suggesting allosteric binding. The affinity of NMS at the allosteric site is in the micromolar range for all receptor subtypes. Using molecular modelling of the M2 receptor we found that E172 and E175 in the second extracellular loop and N419 in the third extracellular loop are involved in allosteric binding of NMS. Mutation of these amino acids to alanine decreased affinity of NMS for the allosteric binding site confirming results of molecular modelling. The allosteric binding site of NMS overlaps with the binding site of some allosteric, ectopic and bitopic ligands. Understanding of interactions of NMS at the allosteric binding site is essential for correct analysis of binding and action of these ligands.

  5. STUDIES OF VERAPAMIL BINDING TO HUMAN SERUM ALBUMIN BY HIGH-PERFORMANCE AFFINITY CHROMATOGRAPHY

    PubMed Central

    Mallik, Rangan; Yoo, Michelle J.; Chen, Sike; Hage, David S.

    2008-01-01

    The binding of verapamil to the protein human serum albumin (HSA) was examined by using high-performance affinity chromatography. Many previous reports have investigated the binding of verapamil with HSA, but the exact strength and nature of this interaction (e.g., the number and location of binding sites) is still unclear. In this study, frontal analysis indicated that at least one major binding site was present for R- and S-verapamil on HSA, with estimated association equilibrium constants on the order of 104 M−1 and a 1.4-fold difference in these values for the verapamil enantiomers at pH 7.4 and 37°C. The presence of a second, weaker group of binding sites on HSA was also suggested by these results. Competitive binding studies using zonal elution were carried out between verapamil and various probe compounds that have known interactions with several major and minor sites on HSA. R/S-Verapamil was found to have direct competition with S-warfarin, indicating that verapamil was binding to Sudlow site I (i.e., the warfarin-azapropazone site of HSA). The average association equilibrium constant for R- and S-verapamil at this site was 1.4 (±0.1) × 104 M−1. Verapamil did not have any notable binding to Sudlow site II of HSA but did appear to have some weak allosteric interactions with L-tryptophan, a probe for this site. An allosteric interaction between verapamil and tamoxifen (a probe for the tamoxifen site) was also noted, which was consistent with the binding of verapamil at Sudlow site I. No interaction was seen between verapamil and digitoxin, a probe for the digitoxin site of HSA. These results gave good agreement with previous observations made in the literature and help provide a more detailed description of how verapamil is transported in blood and of how it may interact with other drugs in the body. PMID:18980867

  6. Neurotensin receptor binding levels in basal ganglia are not altered in Huntington's chorea or schizophrenia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Palacios, J.M.; Chinaglia, G.; Rigo, M.

    1991-02-01

    Autoradiographic techniques were used to examine the distribution and levels of neurotensin receptor binding sites in the basal ganglia and related regions of the human brain. Monoiodo ({sup 125}I-Tyr3)neurotensin was used as a ligand. High amounts of neurotensin receptor binding sites were found in the substantia nigra pars compacta. Lower but significant quantities of neurotensin receptor binding sites characterized the caudate, putamen, and nucleus accumbens, while very low quantities were seen in both medial and lateral segments of the globus pallidus. In Huntington's chorea, the levels of neurotensin receptor binding sites were found to be comparable to those of controlmore » cases. Only slight but not statistically significant decreases in amounts of receptor binding sites were detected in the dorsal part of the head and in the body of caudate nucleus. No alterations in the levels of neurotensin receptor binding sites were observed in the substantia nigra pars compacta and reticulata. These results suggest that a large proportion of neurotensin receptor binding sites in the basal ganglia are located on intrinsic neurons and on extrinsic afferent fibers that do not degenerate in Huntington's disease.« less

  7. n-Dodecyl β-D-maltoside specifically competes with general anesthetics for anesthetic binding sites.

    PubMed

    Xu, Longhe; Matsunaga, Felipe; Xi, Jin; Li, Min; Ma, Jingyuan; Liu, Renyu

    2014-01-01

    We recently demonstrated that the anionic detergent sodium dodecyl sulfate (SDS) specifically interacts with the anesthetic binding site in horse spleen apoferritin, a soluble protein which models anesthetic binding sites in receptors. This raises the possibility of other detergents similarly interacting with and occluding such sites from anesthetics, thereby preventing the proper identification of novel anesthetic binding sites. n-Dodecyl β-D-maltoside (DDM) is a non-ionic detergent commonly used during protein-anesthetic studies because of its mild and non-denaturing properties. In this study, we demonstrate that SDS and DDM occupy anesthetic binding sites in the model proteins human serum albumin (HSA) and horse spleen apoferritin and thereby inhibit the binding of the general anesthetics propofol and isoflurane. DDM specifically interacts with HSA (Kd = 40 μM) with a lower affinity than SDS (Kd = 2 μM). DDM exerts all these effects while not perturbing the native structures of either model protein. Computational calculations corroborated the experimental results by demonstrating that the binding sites for DDM and both anesthetics on the model proteins overlapped. Collectively, our results indicate that DDM and SDS specifically interact with anesthetic binding sites and may thus prevent the identification of novel anesthetic sites. Special precaution should be taken when undertaking and interpreting results from protein-anesthetic investigations utilizing detergents like SDS and DDM.

  8. High-Affinity Quasi-Specific Sites in the Genome: How the DNA-Binding Proteins Cope with Them

    PubMed Central

    Chakrabarti, J.; Chandra, Navin; Raha, Paromita; Roy, Siddhartha

    2011-01-01

    Many prokaryotic transcription factors home in on one or a few target sites in the presence of a huge number of nonspecific sites. Our analysis of λ-repressor in the Escherichia coli genome based on single basepair substitution experiments shows the presence of hundreds of sites having binding energy within 3 Kcal/mole of the OR1 binding energy, and thousands of sites with binding energy above the nonspecific binding energy. The effect of such sites on DNA-based processes has not been fully explored. The presence of such sites dramatically lowers the occupation probability of the specific site far more than if the genome were composed of nonspecific sites only. Our Brownian dynamics studies show that the presence of quasi-specific sites results in very significant kinetic effects as well. In contrast to λ-repressor, the E. coli genome has orders of magnitude lower quasi-specific sites for GalR, an integral transcription factor, thus causing little competition for the specific site. We propose that GalR and perhaps repressors of the same family have evolved binding modes that lead to much smaller numbers of quasi-specific sites to remove the untoward effects of genomic DNA. PMID:21889449

  9. Pharmacological characterization of CCKB receptors in human brain: no evidence for receptor heterogeneity.

    PubMed

    Kinze, S; Schöneberg, T; Meyer, R; Martin, H; Kaufmann, R

    1996-10-11

    In this paper, cholecystokinin (CCK) B-type binding sites were characterized with receptor binding studies in different human brain regions (various parts of cerebral cortex, basal ganglia, hippocampus, thalamus, cerebellar cortex) collected from 22 human postmortem brains. With the exception of the thalamus, where no specific CCK binding sites were found, a pharmacological characterization demonstrated a single class of high affinity CCK sites in all brain areas investigated. Receptor densities ranged from 0.5 fmol/mg protein (hippocampus) to 8.4 fmol/mg protein (nucleus caudatus). These CCK binding sites displayed a typical CCKA binding profile as shown in competition studies by using different CCK-related compounds and non peptide CCK antagonists discriminating between CCKA and CCKB sites. The rank order of agonist or antagonist potency in inhibiting specific sulphated [propionyl-3H]cholecystokinin octapeptide binding was similar and highly correlated for the brain regions investigated as demonstrated by a computer-assisted analysis. Therefore it is concluded that CCKB binding sites in human cerebral cortex, basal ganglia, cerebellar cortex share identical ligand binding characteristics.

  10. Six independent fucose-binding sites in the crystal structure of Aspergillus oryzae lectin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Makyio, Hisayoshi; Shimabukuro, Junpei; Suzuki, Tatsuya

    The crystal structure of AOL (a fucose-specific lectin of Aspergillus oryzae) has been solved by SAD (single-wavelength anomalous diffraction) and MAD (multi-wavelength anomalous diffraction) phasing of seleno-fucosides. The overall structure is a six-bladed β-propeller similar to that of other fucose-specific lectins. The fucose moieties of the seleno-fucosides are located in six fucose-binding sites. Although the Arg and Glu/Gln residues bound to the fucose moiety are common to all fucose-binding sites, the amino-acid residues involved in fucose binding at each site are not identical. The varying peak heights of the seleniums in the electron density map suggest that each fucose-binding sitemore » has a different carbohydrate binding affinity. - Highlights: • The six-bladed β-propeller structure of AOL was solved by seleno-sugar phasing. • The mode of fucose binding is essentially conserved at all six binding sites. • The seleno-fucosides exhibit slightly different interactions and electron densities. • These findings suggest that the affinity for fucose is not identical at each site.« less

  11. Binding Leverage as a Molecular Basis for Allosteric Regulation

    PubMed Central

    Mitternacht, Simon; Berezovsky, Igor N.

    2011-01-01

    Allosteric regulation involves conformational transitions or fluctuations between a few closely related states, caused by the binding of effector molecules. We introduce a quantity called binding leverage that measures the ability of a binding site to couple to the intrinsic motions of a protein. We use Monte Carlo simulations to generate potential binding sites and either normal modes or pairs of crystal structures to describe relevant motions. We analyze single catalytic domains and multimeric allosteric enzymes with complex regulation. For the majority of the analyzed proteins, we find that both catalytic and allosteric sites have high binding leverage. Furthermore, our analysis of the catabolite activator protein, which is allosteric without conformational change, shows that its regulation involves other types of motion than those modulated at sites with high binding leverage. Our results point to the importance of incorporating dynamic information when predicting functional sites. Because it is possible to calculate binding leverage from a single crystal structure it can be used for characterizing proteins of unknown function and predicting latent allosteric sites in any protein, with implications for drug design. PMID:21935347

  12. Spectroscopic and Thermodynamic Characterization of the Metal-Binding Sites in the LH1-RC Complex from Thermophilic Photosynthetic Bacterium Thermochromatium tepidum.

    PubMed

    Kimura, Yukihiro; Yura, Yuki; Hayashi, Yusuke; Li, Yong; Onoda, Moe; Yu, Long-Jiang; Wang-Otomo, Zheng-Yu; Ohno, Takashi

    2016-12-15

    The light-harvesting 1 reaction center (LH1-RC) complex from thermophilic photosynthetic bacterium Thermochromatium (Tch.) tepidum exhibits enhanced thermostability and an unusual LH1 Q y transition, both induced by Ca 2+ binding. In this study, metal-binding sites and metal-protein interactions in the LH1-RC complexes from wild-type (B915) and biosynthetically Sr 2+ -substituted (B888) Tch. tepidum were investigated by isothermal titration calorimetry (ITC), atomic absorption (AA), and attenuated total reflection (ATR) Fourier transform infrared (FTIR) spectroscopies. The ITC measurements revealed stoichiometric ratios of approximately 1:1 for binding of Ca 2+ , Sr 2+ , or Ba 2+ to the LH1 αβ-subunit, indicating the presence of 16 binding sites in both B915 and B888. The AA analysis provided direct evidence for Ca 2+ and Sr 2+ binding to B915 and B888, respectively, in their purified states. Metal-binding experiments supported that Ca 2+ and Sr 2+ (or Ba 2+ ) competitively associate with the binding sites in both species. The ATR-FTIR difference spectra upon Ca 2+ depletion and Sr 2+ substitution demonstrated that dissociation and binding of Ca 2+ are predominantly responsible for metal-dependent conformational changes of B915 and B888. The present results are largely compatible with the recent structural evidence that another binding site for Sr 2+ (or Ba 2+ ) exists in the vicinity of the Ca 2+ -binding site, a part of which is shared in both metal-binding sites.

  13. Characterizing low affinity epibatidine binding to α4β2 nicotinic acetylcholine receptors with ligand depletion and nonspecific binding

    PubMed Central

    2011-01-01

    Background Along with high affinity binding of epibatidine (Kd1≈10 pM) to α4β2 nicotinic acetylcholine receptor (nAChR), low affinity binding of epibatidine (Kd2≈1-10 nM) to an independent binding site has been reported. Studying this low affinity binding is important because it might contribute understanding about the structure and synthesis of α4β2 nAChR. The binding behavior of epibatidine and α4β2 AChR raises a question about interpreting binding data from two independent sites with ligand depletion and nonspecific binding, both of which can affect equilibrium binding of [3H]epibatidine and α4β2 nAChR. If modeled incorrectly, ligand depletion and nonspecific binding lead to inaccurate estimates of binding constants. Fitting total equilibrium binding as a function of total ligand accurately characterizes a single site with ligand depletion and nonspecific binding. The goal of this study was to determine whether this approach is sufficient with two independent high and low affinity sites. Results Computer simulations of binding revealed complexities beyond fitting total binding for characterizing the second, low affinity site of α4β2 nAChR. First, distinguishing low-affinity specific binding from nonspecific binding was a potential problem with saturation data. Varying the maximum concentration of [3H]epibatidine, simultaneously fitting independently measured nonspecific binding, and varying α4β2 nAChR concentration were effective remedies. Second, ligand depletion helped identify the low affinity site when nonspecific binding was significant in saturation or competition data, contrary to a common belief that ligand depletion always is detrimental. Third, measuring nonspecific binding without α4β2 nAChR distinguished better between nonspecific binding and low-affinity specific binding under some circumstances of competitive binding than did presuming nonspecific binding to be residual [3H]epibatidine binding after adding a large concentration of cold competitor. Fourth, nonspecific binding of a heterologous competitor changed estimates of high and low inhibition constants but did not change the ratio of those estimates. Conclusions Investigating the low affinity site of α4β2 nAChR with equilibrium binding when ligand depletion and nonspecific binding are present likely needs special attention to experimental design and data interpretation beyond fitting total binding data. Manipulation of maximum ligand and receptor concentrations and intentionally increasing ligand depletion are potentially helpful approaches. PMID:22112852

  14. Evaluation of the Significance of Starch Surface Binding Sites on Human Pancreatic α-Amylase.

    PubMed

    Zhang, Xiaohua; Caner, Sami; Kwan, Emily; Li, Chunmin; Brayer, Gary D; Withers, Stephen G

    2016-11-01

    Starch provides the major source of caloric intake in many diets. Cleavage of starch into malto-oligosaccharides in the gut is catalyzed by pancreatic α-amylase. These oligosaccharides are then further cleaved by gut wall α-glucosidases to release glucose, which is absorbed into the bloodstream. Potential surface binding sites for starch on the pancreatic amylase, distinct from the active site of the amylase, have been identified through X-ray crystallographic analyses. The role of these sites in the degradation of both starch granules and soluble starch was probed by the generation of a series of surface variants modified at each site to disrupt binding. Kinetic analysis of the binding and/or cleavage of substrates ranging from simple maltotriosides to soluble starch and insoluble starch granules has allowed evaluation of the potential role of each such surface site. In this way, two key surface binding sites, on the same face as the active site, are identified. One site, containing a pair of aromatic residues, is responsible for attachment to starch granules, while a second site featuring a tryptophan residue around which a malto-oligosaccharide wraps is shown to heavily influence soluble starch binding and hydrolysis. These studies provide insights into the mechanisms by which enzymes tackle the degradation of largely insoluble polymers and also present some new approaches to the interrogation of the binding sites involved.

  15. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  16. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  17. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  18. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zoghbi, M. E.; Altenberg, G. A.

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we usedmore » luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.« less

  19. Functional asymmetry in the lysyl-tRNA synthetase explored by molecular dynamics, free energy calculations and experiment

    PubMed Central

    Hughes, Samantha J; Tanner, Julian A; Hindley, Alison D; Miller, Andrew D; Gould, Ian R

    2003-01-01

    Background Charging of transfer-RNA with cognate amino acid is accomplished by the aminoacyl-tRNA synthetases, and proceeds through an aminoacyl adenylate intermediate. The lysyl-tRNA synthetase has evolved an active site that specifically binds lysine and ATP. Previous molecular dynamics simulations of the heat-inducible Escherichia coli lysyl-tRNA synthetase, LysU, have revealed differences in the binding of ATP and aspects of asymmetry between the nominally equivalent active sites of this dimeric enzyme. The possibility that this asymmetry results in different binding affinities for the ligands is addressed here by a parallel computational and biochemical study. Results Biochemical experiments employing isothermal calorimetry, steady-state fluorescence and circular dichroism are used to determine the order and stoichiometries of the lysine and nucleotide binding events, and the associated thermodynamic parameters. An ordered mechanism of substrate addition is found, with lysine having to bind prior to the nucleotide in a magnesium dependent process. Two lysines are found to bind per dimer, and trigger a large conformational change. Subsequent nucleotide binding causes little structural rearrangement and crucially only occurs at a single catalytic site, in accord with the simulations. Molecular dynamics based free energy calculations of the ATP binding process are used to determine the binding affinities of each site. Significant differences in ATP binding affinities are observed, with only one active site capable of realizing the experimental binding free energy. Half-of-the-sites models in which the nucleotide is only present at one active site achieve their full binding potential irrespective of the subunit choice. This strongly suggests the involvement of an anti-cooperative mechanism. Pathways for relaying information between the two active sites are proposed. Conclusions The asymmetry uncovered here appears to be a common feature of oligomeric aminoacyl-tRNA synthetases, and may play an important functional role. We suggest a manner in which catalytic efficiency could be improved by LysU operating in an alternating sites mechanism. PMID:12787471

  20. Carbohydrate binding properties of the stinging nettle (Urtica dioica) rhizome lectin.

    PubMed

    Shibuya, N; Goldstein, I J; Shafer, J A; Peumans, W J; Broekaert, W F

    1986-08-15

    The interaction of the stinging nettle rhizome lectin (UDA) with carbohydrates was studied by using the techniques of quantitative precipitation, hapten inhibition, equilibrium dialysis, and uv difference spectroscopy. The Carbohydrate binding site of UDA was determined to be complementary to an N,N',N"-triacetylchitotriose unit and proposed to consist of three subsites, each of which has a slightly different binding specificity. UDA also has a hydrophobic interacting region adjacent to the carbohydrate binding site. Equilibrium dialysis and uv difference spectroscopy revealed that UDA has two carbohydrate binding sites per molecule consisting of a single polypeptide chain. These binding sites either have intrinsically different affinities for ligand molecules, or they may display negative cooperativity toward ligand binding.

  1. Statistical Profiling of One Promiscuous Protein Binding Site: Illustrated by Urokinase Catalytic Domain.

    PubMed

    Cerisier, Natacha; Regad, Leslie; Triki, Dhoha; Petitjean, Michel; Flatters, Delphine; Camproux, Anne-Claude

    2017-10-01

    While recent literature focuses on drug promiscuity, the characterization of promiscuous binding sites (ability to bind several ligands) remains to be explored. Here, we present a proteochemometric modeling approach to analyze diverse ligands and corresponding multiple binding sub-pockets associated with one promiscuous binding site to characterize protein-ligand recognition. We analyze both geometrical and physicochemical profile correspondences. This approach was applied to examine the well-studied druggable urokinase catalytic domain inhibitor binding site, which results in a large number of complex structures bound to various ligands. This approach emphasizes the importance of jointly characterizing pocket and ligand spaces to explore the impact of ligand diversity on sub-pocket properties and to establish their main profile correspondences. This work supports an interest in mining available 3D holo structures associated with a promiscuous binding site to explore its main protein-ligand recognition tendency. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. RBind: computational network method to predict RNA binding sites.

    PubMed

    Wang, Kaili; Jian, Yiren; Wang, Huiwen; Zeng, Chen; Zhao, Yunjie

    2018-04-26

    Non-coding RNA molecules play essential roles by interacting with other molecules to perform various biological functions. However, it is difficult to determine RNA structures due to their flexibility. At present, the number of experimentally solved RNA-ligand and RNA-protein structures is still insufficient. Therefore, binding sites prediction of non-coding RNA is required to understand their functions. Current RNA binding site prediction algorithms produce many false positive nucleotides that are distance away from the binding sites. Here, we present a network approach, RBind, to predict the RNA binding sites. We benchmarked RBind in RNA-ligand and RNA-protein datasets. The average accuracy of 0.82 in RNA-ligand and 0.63 in RNA-protein testing showed that this network strategy has a reliable accuracy for binding sites prediction. The codes and datasets are available at https://zhaolab.com.cn/RBind. yjzhaowh@mail.ccnu.edu.cn. Supplementary data are available at Bioinformatics online.

  3. Insulation and wiring specificity of BceR-like response regulators and their target promoters in Bacillus subtilis.

    PubMed

    Fang, Chong; Nagy-Staroń, Anna; Grafe, Martin; Heermann, Ralf; Jung, Kirsten; Gebhard, Susanne; Mascher, Thorsten

    2017-04-01

    BceRS and PsdRS are paralogous two-component systems in Bacillus subtilis controlling the response to antimicrobial peptides. In the presence of extracellular bacitracin and nisin, respectively, the two response regulators (RRs) bind their target promoters, P bceA or P psdA , resulting in a strong up-regulation of target gene expression and ultimately antibiotic resistance. Despite high sequence similarity between the RRs BceR and PsdR and their known binding sites, no cross-regulation has been observed between them. We therefore investigated the specificity determinants of P bceA and P psdA that ensure the insulation of these two paralogous pathways at the RR-promoter interface. In vivo and in vitro analyses demonstrate that the regulatory regions within these two promoters contain three important elements: in addition to the known (main) binding site, we identified a linker region and a secondary binding site that are crucial for functionality. Initial binding to the high-affinity, low-specificity main binding site is a prerequisite for the subsequent highly specific binding of a second RR dimer to the low-affinity secondary binding site. In addition to this hierarchical cooperative binding, discrimination requires a competition of the two RRs for their respective binding site mediated by only slight differences in binding affinities. © 2016 John Wiley & Sons Ltd.

  4. A novel substance P binding site in bovine adrenal medulla.

    PubMed

    Geraghty, D P; Livett, B G; Rogerson, F M; Burcher, E

    1990-05-04

    Radioligand binding techniques were used to characterize the substance P (SP) binding site on membranes prepared from bovine adrenal medullae. 125I-labelled Bolton-Hunter substance P (BHSP), which recognises the C-terminally directed, SP-preferring NK1 receptor, showed no specific binding. In contrast, binding of [3H]SP was saturable (at 6 nM) and reversible, with an equilibrium dissociation constant (Kd) 1.46 +/- 0.73 nM, Bmax 0.73 +/- 0.06 pmol/g wet weight and Hill coefficient 0.98 +/- 0.01. Specific binding of [3H]SP was displaced by SP greater than neurokinin A (NKA) greater than SP(3-11) approximately SP(1-9) greater than SP(1-7) approximately SP(1-4) approximately SP(1-6), with neurokinin B (NKB) and SP(1-3) very weak competitors and SP(5-11), SP(7-11) and SP(9-11) causing negligible inhibition (up to 10 microM). This potency order is quite distinct from that seen with binding to an NK1 site, a conclusion confirmed by the lack of BHSP binding. It appears that Lys3 and/or Pro4 are critical for binding, suggesting an anionic binding site. These data suggest the existence of an unusual binding site which may represent a novel SP receptor. This site appears to require the entire sequence of the SP molecule for full recognition.

  5. sigma opiates and certain antipsychotic drugs mutually inhibit (+)-(/sup 3/H)SKF 10,047 and (/sup 3/H)haloperidol binding in guinea pig brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tam, S.W.; Cook, L.

    1984-09-01

    The relationship between binding of antipsychotic drugs and sigma psychotomimetic opiates to binding sites for the sigma agonist (+)-(/sup 3/H)SKF 10,047 (N-allylnormetazocine) and to dopamine D/sub 2/ sites was investigated. In guinea pig brain membranes, (+)-(/sup 3/H)SKF 10,047 bound to single class of sites with a K/sub d/ of 4 x 10/sup -8/ M and a B/sub max/ of 333 fmol/mg of protein. This binding was different from ..mu.., kappa, or delta opiate receptor binding. It was inhibited by opiates that produce psychotomimetic activities but not by opiates that lack such activities. Some antipsychotic drugs inhibited (+)-(/sup 3/H)SKF 10,047 bindingmore » with high to moderate affinities in the following order of potency: haloperidol > perphenazine > fluphenazine > acetophenazine > trifluoperazine > molindone greater than or equal to pimozide greater than or equal to thioridazine greater than or equal to chlorpromazine greater than or equal to triflupromazine. However, there were other antipsychotic drugs such as spiperone and clozapine that showed low affinity for the (+)-(/sup 3/H)SKF 10,047 binding sites. Affinities of antipsychotic drugs for (+)-(/sup 3/H)SKF 10,047 binding sites did not correlate with those for (/sup 3/H)spiperone (dopamine D/sub 2/) sites. (/sup 3/H)-Haloperidol binding in whole brain membranes was also inhibited by the sigma opiates pentazocine, cyclazocine, and (+)-(/sup 3/H)SKF 10,047. In the striatum, about half of the saturable (/sup 3/H)haloperidol binding was to (/sup 3/H)spiperone (D/sub 2/) sites and the other half was to sites similar to (+)-(/sup 3/H)SKF 10,047 binding sites. 15 references, 4 figures, 1 table.« less

  6. Clotrimazole and efaroxan inhibit red cell Gardos channel independently of imidazoline I1 and I2 binding sites.

    PubMed

    Coupry, I; Armsby, C C; Alper, S L; Brugnara, C; Parini, A

    1996-01-04

    In the present report, we investigated the potential involvement of imidazoline I1 and I2 binding sites in the inhibition of the Ca(2+)-activated K+ channel (Gardos channel) by clotrimazole in human red cells. Ca(2+)-activated 86Rb influx was inhibited by clotrimazole and efaroxan but not by the imidazoline binding site ligands clonidine, moxonidine, cirazoline and idazoxan (100 microM). Binding studies with [3H]idazoxan and [3H]p-aminoclonidine did not reveal the expression of I1 and I2 binding sites in erythrocytes. These data indicate that the effects of clotrimazole and efaroxan on the erythrocyte Ca(2+)-activated K+ channel may be mediated by a 'non-I1/non-I2' binding site.

  7. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  8. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  9. DISTINCT ROLES OF β1 MIDAS, ADMIDAS AND LIMBS CATION-BINDING SITES IN LIGAND RECOGNITION BY INTEGRIN α2β1*

    PubMed Central

    Valdramidou, Dimitra; Humphries, Martin J.; Mould, A. Paul

    2012-01-01

    Integrin-ligand interactions are regulated in a complex manner by divalent cations, and previous studies have identified ligand-competent, stimulatory, and inhibitory cation-binding sites. In collagen-binding integrins, such as α2β1, ligand recognition takes place exclusively at the α subunit I domain. However, activation of the αI domain depends on its interaction with a structurally similar domain in the β subunit known as the I-like or βI domain. The top face of the βI domain contains three cation-binding sites: the metal-ion dependent adhesion site (MIDAS), the ADMIDAS (adjacent to MIDAS) and LIMBS (ligand-associated metal binding site). The role of these sites in controlling ligand binding to the αI domain has yet to be elucidated. Mutation of the MIDAS or LIMBS completely blocked collagen binding to α2β1; in contrast mutation of the ADMIDAS reduced ligand recognition but this effect could be overcome by the activating mAb TS2/16. Hence, the MIDAS and LIMBS appear to be essential for the interaction between αI and βI whereas occupancy of the ADMIDAS has an allosteric effect on the conformation of βI. An activating mutation in the α2 I domain partially restored ligand binding to the MIDAS and LIMBS mutants. Analysis of the effects of Ca2+, Mg2+ and Mn2+ on ligand binding to these mutants showed that the MIDAS is a ligand-competent site through which Mn2+ stimulates ligand binding, whereas the LIMBS is a stimulatory Ca2+-binding site, occupancy of which increases the affinity of Mg2+ for the MIDAS. PMID:18820259

  10. Insight into the binding mechanism of imipenem to human serum albumin by spectroscopic and computational approaches.

    PubMed

    Rehman, Md Tabish; Shamsi, Hira; Khan, Asad U

    2014-06-02

    The mechanism of interaction between imipenem and HSA was investigated by various techniques like fluorescence, UV.vis absorbance, FRET, circular dichroism, urea denaturation, enzyme kinetics, ITC, and molecular docking. We found that imipenem binds to HSA at a high affinity site located in subdomain IIIA (Sudlow's site I) and a low affinity site located in subdomain IIA.IIB. Electrostatic interactions played a vital role along with hydrogen bonding and hydrophobic interactions in stabilizing the imipenem.HSA complex at subdomain IIIA, while only electrostatic and hydrophobic interactions were present at subdomain IIA.IIB. The binding and thermodynamic parameters obtained by ITC showed that the binding of imipenem to HSA was a spontaneous process (ΔGD⁰(D)= -32.31 kJ mol(-1) for high affinity site and ΔGD⁰(D) = -23.02 kJ mol(-1) for low affinity site) with binding constants in the range of 10(4)-10(5) M(-1). Spectroscopic investigation revealed only one binding site of imipenem on HSA (Ka∼10(4) M(-1)). FRET analysis showed that the binding distance between imipenem and HSA (Trp-214) was optimal (r = 4.32 nm) for quenching to occur. Decrease in esterase-like activity of HSA in the presence of imipenem showed that Arg-410 and Tyr-411 of subdomain IIIA (Sudlow's site II) were directly involved in the binding process. CD spectral analysis showed altered conformation of HSA upon imipenem binding. Moreover, the binding of imipenem to subdomain IIIA (Sudlow's site II) of HSA also affected its folding pathway as clear from urea-induced denaturation studies.

  11. Direct optical mapping of transcription factor binding sites on field-stretched λ-DNA in nanofluidic devices

    PubMed Central

    Sriram, K. K.; Yeh, Jia-Wei; Lin, Yii-Lih; Chang, Yi-Ren; Chou, Chia-Fu

    2014-01-01

    Mapping transcription factor (TF) binding sites along a DNA backbone is crucial in understanding the regulatory circuits that control cellular processes. Here, we deployed a method adopting bioconjugation, nanofluidic confinement and fluorescence single molecule imaging for direct mapping of TF (RNA polymerase) binding sites on field-stretched single DNA molecules. Using this method, we have mapped out five of the TF binding sites of E. coli RNA polymerase to bacteriophage λ-DNA, where two promoter sites and three pseudo-promoter sites are identified with the corresponding binding frequency of 45% and 30%, respectively. Our method is quick, robust and capable of resolving protein-binding locations with high accuracy (∼ 300 bp), making our system a complementary platform to the methods currently practiced. It is advantageous in parallel analysis and less prone to false positive results over other single molecule mapping techniques such as optical tweezers, atomic force microscopy and molecular combing, and could potentially be extended to general mapping of protein–DNA interaction sites. PMID:24753422

  12. Follicle-stimulating hormone (FSH) unmasks specific high affinity FSH-binding sites in cell-free membrane preparations of porcine granulosa cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ford, K.A.; LaBarbera, A.R.

    1988-11-01

    The purpose of these studies was to determine whether changes in FSH receptors correlated with FSH-induced attenuation of FSH-responsive adenylyl cyclase in immature porcine granulosa cells. Cells were incubated with FSH (1-1000 ng/ml) for up to 24 h, treated with acidified medium (pH 3.5) to remove FSH bound to cells, and incubated with (125I)iodo-porcine FSH to quantify FSH-binding sites. FSH increased binding of FSH in a time-, temperature-, and FSH concentration-dependent manner. FSH (200 ng/ml) increased binding approximately 4-fold within 16 h. Analysis of equilibrium saturation binding data indicated that the increase in binding sites reflected a 2.3-fold increase inmore » receptor number and a 5.4-fold increase in apparent affinity. The increase in binding did not appear to be due to 1) a decrease in receptor turnover, since the basal rate of turnover appeared to be very slow; 2) an increase in receptor synthesis, since agents that inhibit protein synthesis and glycosylation did not block the increase in binding; or 3) an increase in intracellular receptors, since agents that inhibit cytoskeletal components had no effect. Agents that increase intracellular cAMP did not affect FSH binding. The increase in binding appeared to result from unmasking of cryptic FSH-binding sites, since FSH increased binding in cell-free membrane preparations to the same extent as in cells. Unmasking of cryptic sites was hormone specific, and the sites bound FSH specifically. Unmasking of sites was reversible in a time- and temperature-dependent manner after removal of bound FSH. The similarity between the FSH dose-response relationships for unmasking of FSH-binding sites and attenuation of FSH-responsive cAMP production suggests that the two processes are functionally linked.« less

  13. Molecular simulations and Markov state modeling reveal the structural diversity and dynamics of a theophylline-binding RNA aptamer in its unbound state

    PubMed Central

    Warfield, Becka M.

    2017-01-01

    RNA aptamers are oligonucleotides that bind with high specificity and affinity to target ligands. In the absence of bound ligand, secondary structures of RNA aptamers are generally stable, but single-stranded and loop regions, including ligand binding sites, lack defined structures and exist as ensembles of conformations. For example, the well-characterized theophylline-binding aptamer forms a highly stable binding site when bound to theophylline, but the binding site is unstable and disordered when theophylline is absent. Experimental methods have not revealed at atomic resolution the conformations that the theophylline aptamer explores in its unbound state. Consequently, in the present study we applied 21 microseconds of molecular dynamics simulations to structurally characterize the ensemble of conformations that the aptamer adopts in the absence of theophylline. Moreover, we apply Markov state modeling to predict the kinetics of transitions between unbound conformational states. Our simulation results agree with experimental observations that the theophylline binding site is found in many distinct binding-incompetent states and show that these states lack a binding pocket that can accommodate theophylline. The binding-incompetent states interconvert with binding-competent states through structural rearrangement of the binding site on the nanosecond to microsecond timescale. Moreover, we have simulated the complete theophylline binding pathway. Our binding simulations supplement prior experimental observations of slow theophylline binding kinetics by showing that the binding site must undergo a large conformational rearrangement after the aptamer and theophylline form an initial complex, most notably, a major rearrangement of the C27 base from a buried to solvent-exposed orientation. Theophylline appears to bind by a combination of conformational selection and induced fit mechanisms. Finally, our modeling indicates that when Mg2+ ions are present the population of binding-competent aptamer states increases more than twofold. This population change, rather than direct interactions between Mg2+ and theophylline, accounts for altered theophylline binding kinetics. PMID:28437473

  14. The gammaPE complex contains both SATB1 and HOXB2 and has positive and negative roles in human gamma-globin gene regulation.

    PubMed

    Case, S S; Huber, P; Lloyd, J A

    1999-11-01

    A large nuclear protein complex, termed gammaPE (for gamma-globin promoter and enhancer binding factor), binds to five sites located 5' and 3' of the human y-globin gene. Two proteins, SATB1 (special A-T-rich binding protein 1) and HOXB2, can bind to yPE binding sites. SATB1 binds to nuclear matrix-attachment sites, and HOXB2 is a homeodomain protein important in neural development that is also expressed during erythropoiesis. The present work showed that antisera directed against either SATB1 or HOXB2 reacted specifically with the entire gammaPE complex in electrophoretic mobility shift assays (EMSAs), suggesting that the two proteins can bind to the gammaPE binding site simultaneously. When SATB1 or HOXB2 was expressed in vitro, they could bind independently to gammaPE binding sites in EMSA. Interestingly, the proteins expressed in vitro competed effectively with each other for the gammaPE binding site, suggesting that this may occur under certain conditions in vivo. Transient cotransfections of a HOXB2 cDNA and a y-globin-luciferase reporter gene construct into cells expressing SATB1 suggested that SATB1 has a positive and HOXB2 a negative regulatory effect on transcription. Taking into account their potentially opposing effects and binding activities, SATB1 and HOXB2 may modulate the amount of gamma-globin mRNA expressed during development and differentiation.

  15. Antagonism of human CC-chemokine receptor 4 can be achieved through three distinct binding sites on the receptor

    PubMed Central

    Slack, Robert J; Russell, Linda J; Barton, Nick P; Weston, Cathryn; Nalesso, Giovanna; Thompson, Sally-Anne; Allen, Morven; Chen, Yu Hua; Barnes, Ashley; Hodgson, Simon T; Hall, David A

    2013-01-01

    Chemokine receptor antagonists appear to access two distinct binding sites on different members of this receptor family. One class of CCR4 antagonists has been suggested to bind to a site accessible from the cytoplasm while a second class did not bind to this site. In this report, we demonstrate that antagonists representing a variety of structural classes bind to two distinct allosteric sites on CCR4. The effects of pairs of low-molecular weight and/or chemokine CCR4 antagonists were evaluated on CCL17- and CCL22-induced responses of human CCR4+ T cells. This provided an initial grouping of the antagonists into sets which appeared to bind to distinct binding sites. Binding studies were then performed with radioligands from each set to confirm these groupings. Some novel receptor theory was developed to allow the interpretation of the effects of the antagonist combinations. The theory indicates that, generally, the concentration-ratio of a pair of competing allosteric modulators is maximally the sum of their individual effects while that of two modulators acting at different sites is likely to be greater than their sum. The low-molecular weight antagonists could be grouped into two sets on the basis of the functional and binding experiments. The antagonistic chemokines formed a third set whose behaviour was consistent with that of simple competitive antagonists. These studies indicate that there are two allosteric regulatory sites on CCR4. PMID:25505571

  16. BindML/BindML+: Detecting Protein-Protein Interaction Interface Propensity from Amino Acid Substitution Patterns.

    PubMed

    Wei, Qing; La, David; Kihara, Daisuke

    2017-01-01

    Prediction of protein-protein interaction sites in a protein structure provides important information for elucidating the mechanism of protein function and can also be useful in guiding a modeling or design procedures of protein complex structures. Since prediction methods essentially assess the propensity of amino acids that are likely to be part of a protein docking interface, they can help in designing protein-protein interactions. Here, we introduce BindML and BindML+ protein-protein interaction sites prediction methods. BindML predicts protein-protein interaction sites by identifying mutation patterns found in known protein-protein complexes using phylogenetic substitution models. BindML+ is an extension of BindML for distinguishing permanent and transient types of protein-protein interaction sites. We developed an interactive web-server that provides a convenient interface to assist in structural visualization of protein-protein interactions site predictions. The input data for the web-server are a tertiary structure of interest. BindML and BindML+ are available at http://kiharalab.org/bindml/ and http://kiharalab.org/bindml/plus/ .

  17. Computational Optimization and Characterization of Molecularly Imprinted Polymers

    NASA Astrophysics Data System (ADS)

    Terracina, Jacob J.

    Molecularly imprinted polymers (MIPs) are a class of materials containing sites capable of selectively binding to the imprinted target molecule. Computational chemistry techniques were used to study the effect of different fabrication parameters (the monomer-to-target ratios, pre-polymerization solvent, temperature, and pH) on the formation of the MIP binding sites. Imprinted binding sites were built in silico for the purposes of better characterizing the receptor - ligand interactions. Chiefly, the sites were characterized with respect to their selectivities and the heterogeneity between sites. First, a series of two-step molecular mechanics (MM) and quantum mechanics (QM) computational optimizations of monomer -- target systems was used to determine optimal monomer-to-target ratios for the MIPs. Imidazole- and xanthine-derived target molecules were studied. The investigation included both small-scale models (one-target) and larger scale models (five-targets). The optimal ratios differed between the small and larger scales. For the larger models containing multiple targets, binding-site surface area analysis was used to evaluate the heterogeneity of the sites. The more fully surrounded sites had greater binding energies. Molecular docking was then used to measure the selectivities of the QM-optimized binding sites by comparing the binding energies of the imprinted target to that of a structural analogue. Selectivity was also shown to improve as binding sites become more fully encased by the monomers. For internal sites, docking consistently showed selectivity favoring the molecules that had been imprinted via QM geometry optimizations. The computationally imprinted sites were shown to exhibit size-, shape-, and polarity-based selectivity. This represented a novel approach to investigate the selectivity and heterogeneity of imprinted polymer binding sites, by applying the rapid orientation screening of MM docking to the highly accurate QM-optimized geometries. Next, we sought to computationally construct and investigate binding sites for their enantioselectivity. Again, a two-step MM [special characters removed] QM optimization scheme was used to "computationally imprint" chiral molecules. Using docking techniques, the imprinted binding sites were shown to exhibit an enantioselective preference for the imprinted molecule over its enantiomer. Docking of structurally similar chiral molecules showed that the sites computationally imprinted with R- or S-tBOC-tyrosine were able to differentiate between R- and S-forms of other tyrosine derivatives. The cross-enantioselectivity did not hold for chiral molecules that did not share the tyrosine H-bonding functional group orientations. Further analysis of the individual monomer - target interactions within the binding site led us to conclude that H-bonding functional groups that are located immediately next to the target's chiral center, and therefore spatially fixed relative to the chiral center, will have a stronger contribution to the enantioselectivity of the site than those groups separated from the chiral center by two or more rotatable bonds. These models were the first computationally imprinted binding sites to exhibit this enantioselective preference for the imprinted target molecules. Finally, molecular dynamics (MD) was used to quantify H-bonding interactions between target molecules, monomers, and solvents representative of the pre-polymerization matrix. It was found that both target dimerization and solvent interference decrease the number of monomer - target H-bonds present. Systems were optimized via simulated annealing to create binding sites that were then subjected to molecular docking analysis. Docking showed that the presence of solvent had a detrimental effect on the sensitivity and selectivity of the sites, and that solvents with more H-bonding capabilities were more disruptive to the binding properties of the site. Dynamic simulations also showed that increasing the temperature of the solution can significantly decrease the number of H-bonds formed between the targets and monomers. It is believed that the monomer - target complexes formed within the pre-polymerization matrix are translated into the selective binding cavities formed during polymerization. Elucidating the nature of these interactions in silico improves our understanding of MIPs, ultimately allowing for more optimized sensing materials.

  18. Hydration in drug design. 3. Conserved water molecules at the ligand-binding sites of homologous proteins

    NASA Astrophysics Data System (ADS)

    Poornima, C. S.; Dean, P. M.

    1995-12-01

    Water molecules are known to play an important rôle in mediating protein-ligand interactions. If water molecules are conserved at the ligand-binding sites of homologous proteins, such a finding may suggest the structural importance of water molecules in ligand binding. Structurally conserved water molecules change the conventional definition of `binding sites' by changing the shape and complementarity of these sites. Such conserved water molecules can be important for site-directed ligand/drug design. Therefore, five different sets of homologous protein/protein-ligand complexes have been examined to identify the conserved water molecules at the ligand-binding sites. Our analysis reveals that there are as many as 16 conserved water molecules at the FAD binding site of glutathione reductase between the crystal structures obtained from human and E. coli. In the remaining four sets of high-resolution crystal structures, 2-4 water molecules have been found to be conserved at the ligand-binding sites. The majority of these conserved water molecules are either bound in deep grooves at the protein-ligand interface or completely buried in cavities between the protein and the ligand. All these water molecules, conserved between the protein/protein-ligand complexes from different species, have identical or similar apolar and polar interactions in a given set. The site residues interacting with the conserved water molecules at the ligand-binding sites have been found to be highly conserved among proteins from different species; they are more conserved compared to the other site residues interacting with the ligand. These water molecules, in general, make multiple polar contacts with protein-site residues.

  19. Altered binding of thioflavin t to the peripheral anionic site of acetylcholinesterase after phosphorylation of the active site by chlorpyrifos oxon or dichlorvos

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sultatos, L.G.; Kaushik, R.

    2008-08-01

    The peripheral anionic site of acetylcholinesterase, when occupied by a ligand, is known to modulate reaction rates at the active site of this important enzyme. The current report utilized the peripheral anionic site specific fluorogenic probe thioflavin t to determine if the organophosphates chlorpyrifos oxon and dichlorvos bind to the peripheral anionic site of human recombinant acetylcholinesterase, since certain organophosphates display concentration-dependent kinetics when inhibiting this enzyme. Incubation of 3 nM acetylcholinesterase active sites with 50 nM or 2000 nM inhibitor altered both the B{sub max} and K{sub d} for thioflavin t binding to the peripheral anionic site. However, thesemore » changes resulted from phosphorylation of Ser203 since increasing either inhibitor from 50 nM to 2000 nM did not alter further thioflavin t binding kinetics. Moreover, the organophosphate-induced decrease in B{sub max} did not represent an actual reduction in binding sites, but instead likely resulted from conformational interactions between the acylation and peripheral anionic sites that led to a decrease in the rigidity of bound thioflavin t. A drop in fluorescence quantum yield, leading to an apparent decrease in B{sub max}, would accompany the decreased rigidity of bound thioflavin t molecules. The organophosphate-induced alterations in K{sub d} represented changes in binding affinity of thioflavin t, with diethylphosphorylation of Ser203 increasing K{sub d}, and dimethylphosphorylation of Ser203 decreasing K{sub d}. These results indicate that chlorpyrifos oxon and dichlorvos do not bind directly to the peripheral anionic site of acetylcholinesterase, but can affect binding to that site through phosphorylation of Ser203.« less

  20. The Binding of Silibinin, the Main Constituent of Silymarin, to Site I on Human Serum Albumin.

    PubMed

    Yamasaki, Keishi; Sato, Hiroki; Minagoshi, Saori; Kyubun, Karin; Anraku, Makoto; Miyamura, Shigeyuki; Watanabe, Hiroshi; Taguchi, Kazuaki; Seo, Hakaru; Maruyama, Toru; Otagiri, Masaki

    2017-01-01

    Silibinin is the main constituent of silymarin, an extract from the seeds of milk thistle (Silybum marianum). Because silibinin has many pharmacological activities, extending its clinical use in the treatment of a wider variety of diseases would be desirable. In this study, we report on the binding of silibinin to plasma proteins, an issue that has not previously been extensively studied. The findings indicated that silibinin mainly binds to human serum albumin (HSA). Mutual displacement experiments using ligands that primarily bind to sites I and II clearly revealed that silibinin binds tightly and selectively to site I (subsites Ia and/or Ic) of HSA, which is located in subdomain IIA. Thermodynamic analyses suggested that hydrogen bonding and van der Waals interactions are major contributors to silibinin-HSA interactions. Furthermore, the binding of silibinin to HSA was found to be decreased with increasing ionic strength and detergent concentration of the media, suggesting that electrostatic and hydrophobic interactions are involved in the binding. Trp214 and Arg218 were identified as being involved in the binding of silibinin to site I, based on binding experiments using chemically modified- and mutant-HSAs. In conclusion, the available evidence indicates that silibinin binds to the region close to Trp214 and Arg218 in site I of HSA with assistance by multiple forces and can displace site I drugs (e.g., warfarin or iodipamide), but not site II drugs (e.g., ibuprofen).

  1. Characterization and localization of arginine vasotocin receptors in the brain and kidney of an amphibian

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boyd, S.K.

    1987-01-01

    Because arginine vasotocin (AVT) activates male sexual behaviors in the rough-skinned newt (Taricha granulosa), quantitative autoradiography with radiolabeled arginine vasopressin (/sup 3/H-AVP) was used to localize and characterize putative AVT receptors in the brain of this amphibian. Binding of /sup 3/H-AVP to sites within the medial pallium was saturable, specific, reversible, of high affinity and low capacity. These binding sites appear to represent authentic central nervous system receptors for AVT. Furthermore, ligand specificity for the binding sites in this amphibian differs from that reported for AVP binding sites in rat brains. Dense concentrations of specific binding sites were located inmore » the olfactory nerve as it entered the olfactory bulb within the medial pallium, dorsal pallium, and amygdala pars lateralis of the telencephalon, and in the tegmental region of the medulla. Concentrations of binding sites differed significantly among various brain regions. A comparison of male and female newts collected during the breeding season revealed no sexual dimorphism. These areas may represent site(s) of action where AVT elicits sexual behaviors in male T. granulosa.« less

  2. sc-PDB: a database for identifying variations and multiplicity of 'druggable' binding sites in proteins.

    PubMed

    Meslamani, Jamel; Rognan, Didier; Kellenberger, Esther

    2011-05-01

    The sc-PDB database is an annotated archive of druggable binding sites extracted from the Protein Data Bank. It contains all-atoms coordinates for 8166 protein-ligand complexes, chosen for their geometrical and physico-chemical properties. The sc-PDB provides a functional annotation for proteins, a chemical description for ligands and the detailed intermolecular interactions for complexes. The sc-PDB now includes a hierarchical classification of all the binding sites within a functional class. The sc-PDB entries were first clustered according to the protein name indifferent of the species. For each cluster, we identified dissimilar sites (e.g. catalytic and allosteric sites of an enzyme). SCOPE AND APPLICATIONS: The classification of sc-PDB targets by binding site diversity was intended to facilitate chemogenomics approaches to drug design. In ligand-based approaches, it avoids comparing ligands that do not share the same binding site. In structure-based approaches, it permits to quantitatively evaluate the diversity of the binding site definition (variations in size, sequence and/or structure). The sc-PDB database is freely available at: http://bioinfo-pharma.u-strasbg.fr/scPDB.

  3. Screening Mixtures of Small Molecules for Binding to Multiple Sites on the Surface Tetanus Toxin C Fragment by Bioaffinity NMR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cosman, M; Zeller, L; Lightstone, F C

    2002-01-01

    The clostridial neurotoxins include the closely related tetanus (TeNT) and botulinum (BoNT) toxins. Botulinum toxin is used to treat severe muscle disorders and as a cosmetic wrinkle reducer. Large quantities of botulinum toxin have also been produced by terrorists for use as a biological weapon. Because there are no known antidotes for these toxins, they thus pose a potential threat to human health whether by an accidental overdose or by a hostile deployment. Thus, the discovery of high specificity and affinity compounds that can inhibit their binding to neural cells can be used as antidotes or in the design ofmore » chemical detectors. Using the crystal structure of the C fragment of the tetanus toxin (TetC), which is the cell recognition and cell surface binding domain, and the computational program DOCK, sets of small molecules have been predicted to bind to two different sites located on the surface of this protein. While Site-1 is common to the TeNT and BoNTs, Site-2 is unique to TeNT. Pairs of these molecules from each site can then be linked together synthetically to thereby increase the specificity and affinity for this toxin. Electrospray ionization mass spectroscopy was used to experimentally screen each compound for binding. Mixtures containing binders were further screened for activity under biologically relevant conditions using nuclear magnetic resonance (NMR) methods. The screening of mixtures of compounds offers increased efficiency and throughput as compared to testing single compounds and can also evaluate how possible structural changes induced by the binding of one ligand can influence the binding of the second ligand. In addition, competitive binding experiments with mixtures containing ligands predicted to bind the same site could identify the best binder for that site. NMR transfer nuclear Overhauser effect (trNOE) confirm that TetC binds doxorubicin but that this molecule is displaced by N-acetylneuraminic acid (sialic acid) in a mixture that also contains 3-sialyllactose (another predicted site 1 binder) and bisbenzimide 33342 (non-binder). A series of five predicted Site-2 binders were then screened sequentially in the presence of the Site-1 binder doxorubicin. These experiments showed that the compounds lavendustin A and naphthofluorescein-di-({beta}-D-galactopyranoside) binds along with doxorubicin to TetC. Further experiments indicate that doxorubicin and lavendustin are potential candidates to use in preparing a bidendate inhibitor specific for TetC. The simultaneous binding of two different predicted Site-2 ligands to TetC suggests that they may bind multiple sites. Another possibility is that the conformations of the binding sites are dynamic and can bind multiple diverse ligands at a single site depending on the pre-existing conformation of the protein, especially when doxorubicin is already bound.« less

  4. Ap4A and ADP-beta-S binding to P2 purinoceptors present on rat brain synaptic terminals.

    PubMed Central

    Pintor, J.; Díaz-Rey, M. A.; Miras-Portugal, M. T.

    1993-01-01

    1. Diadenosine tetraphosphate (Ap4A) a dinucleotide stored and released from rat brain synaptic terminals presents two types of affinity binding sites in synaptosomes. When [3H]-Ap4A was used for binding studies a Kd value of 0.10 +/- 0.014 nM and a Bmax value of 16.6 +/- 1.2 fmol mg-1 protein were obtained for the high affinity binding site from the Scatchard analysis. The second binding site, obtained by displacement studies, showed a Ki value of 0.57 +/- 0.09 microM. 2. Displacement of [3H]-Ap4A by non-labelled Ap4A and P2-purinoceptor ligands showed a displacement order of Ap4A > adenosine 5'-O-(2-thiodiphosphate) (ADP-beta-S) > 5'-adenylyl-imidodiphosphate (AMP-PNP) > alpha,beta-methylene adenosine 5'-triphosphate (alpha,beta-MeATP) in both sites revealed by the Ki values of 0.017 nM, 0.030 nM, 0.058 nM and 0.147 nM respectively for the high affinity binding site and values of 0.57 microM, 0.87 microM, 2.20 microM and 4.28 microM respectively for the second binding site. 3. Studies of the P2-purinoceptors present in synaptosomes were also performed with [35S]-ADP-beta-S. This radioligand showed two binding sites the first with Kd and Bmax values of 0.11 +/- 0.022 nM and 3.9 +/- 2.1 fmol mg-1 of protein respectively for the high affinity binding site obtained from the Scatchard plot. The second binding site showed a Ki of 0.018 +/- 0.0035 microM obtained from displacement curves. 4. Competition studies with diadenosine polyphosphates of [35S]-ADP-beta-S binding showed a displacement order of Ap4A > Ap5A > Ap6A in the high affinity binding site and Ki values of 0.023 nM, 0.081 nM and 5.72 nM respectively.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:8485620

  5. Influence of sulfhydryl sites on metal binding by bacteria

    NASA Astrophysics Data System (ADS)

    Nell, Ryan M.; Fein, Jeremy B.

    2017-02-01

    The role of sulfhydryl sites within bacterial cell envelopes is still unknown, but the sites may control the fate and bioavailability of metals. Organic sulfhydryl compounds are important complexing ligands in aqueous systems and they can influence metal speciation in natural waters. Though representing only approximately 5-10% of the total available binding sites on bacterial surfaces, sulfhydryl sites exhibit high binding affinities for some metals. Due to the potential importance of bacterial sulfhydryl sites in natural systems, metal-bacterial sulfhydryl site binding constants must be determined in order to construct accurate models of the fate and distribution of metals in these systems. To date, only Cd-sulfhydryl binding has been quantified. In this study, the thermodynamic stabilities of Mn-, Co-, Ni-, Zn-, Sr- and Pb-sulfhydryl bacterial cell envelope complexes were determined for the bacterial species Shewanella oneidensis MR-1. Metal adsorption experiments were conducted as a function of both pH, ranging from 5.0 to 7.0, and metal loading, from 0.5 to 40.0 μmol/g (wet weight) bacteria, in batch experiments in order to determine if metal-sulfhydryl binding occurs. Initially, the data were used to calculate the value of the stability constants for the important metal-sulfhydryl bacterial complexes for each metal-loading condition studied, assuming a single binding reaction for the dominant metal-binding site type under the pH conditions of the experiments. For most of the metals that we studied, these calculated stability constant values increased significantly with decreasing metal loading, strongly suggesting that our initial assumption was not valid and that more than one type of binding occurs at the assumed binding site. We then modeled each dataset with two distinct site types with identical acidity constants: one site with a high metal-site stability constant value, which we take to represent metal-sulfhydryl binding and which dominates under low metal loading conditions, and another more abundant site that we term non-sulfhydryl sites that becomes important at high metal loadings. The resulting calculated stability constants do not vary significantly as a function of metal loading and yield reasonable fits to the observed adsorption behaviors as a function of both pH and metal loading. We use the results to calculate the speciation of metals bound by the bacterial envelope in realistic bacteria-bearing, heavy metal contaminated systems in order to demonstrate the potential importance of metal-sulfhydryl binding in the budget of bacterially-adsorbed metals under low metal-loading conditions.

  6. Discovery of the ammonium substrate site on glutamine synthetase, a third cation binding site.

    PubMed Central

    Liaw, S. H.; Kuo, I.; Eisenberg, D.

    1995-01-01

    Glutamine synthetase (GS) catalyzes the ATP-dependent condensation of ammonia and glutamate to yield glutamine, ADP, and inorganic phosphate in the presence of divalent cations. Bacterial GS is an enzyme of 12 identical subunits, arranged in two rings of 6, with the active site between each pair of subunits in a ring. In earlier work, we have reported the locations within the funnel-shaped active site of the substrates glutamate and ATP and of the two divalent cations, but the site for ammonia (or ammonium) has remained elusive. Here we report the discovery by X-ray crystallography of a binding site on GS for monovalent cations, Tl+ and Cs+, which is probably the binding site for the substrate ammonium ion. Fourier difference maps show the following. (1) Tl+ and Cs+ bind at essentially the same site, with ligands being Glu 212, Tyr 179, Asp 50', Ser 53' of the adjacent subunit, and the substrate glutamate. From its position adjacent to the substrate glutamate and the cofactor ADP, we propose that this monovalent cation site is the substrate ammonium ion binding site. This proposal is supported by enzyme kinetics. Our kinetic measurements show that Tl+, Cs+, and NH4+ are competitive inhibitors to NH2OH in the gamma-glutamyl transfer reaction. (2) GS is a trimetallic enzyme containing two divalent cation sites (n1, n2) and one monovalent cation site per subunit. These three closely spaced ions are all at the active site: the distance between n1 and n2 is 6 A, between n1 and Tl+ is 4 A, and between n2 and Tl+ is 7 A. Glu 212 and the substrate glutamate are bridging ligands for the n1 ion and Tl+. (3) The presence of a monovalent cation in this site may enhance the structural stability of GS, because of its effect of balancing the negative charges of the substrate glutamate and its ligands and because of strengthening the "side-to-side" intersubunit interaction through the cation-protein bonding. (4) The presence of the cofactor ADP increases the Tl+ binding to GS because ADP binding induces movement of Asp 50' toward this monovalent cation site, essentially forming the site. This observation supports a two-step mechanism with ordered substrate binding: ATP first binds to GS, then Glu binds and attacks ATP to form gamma-glutamyl phosphate and ADP, which complete the ammonium binding site. The third substrate, an ammonium ion, then binds to GS, and then loses a proton to form the more active species ammonia, which attacks the gamma-glutamyl phosphate to yield Gln. (5) Because the products (Glu or Gln) of the reactions catalyzed by GS are determined by the molecule (water or ammonium) attacking the intermediate gamma-glutamyl phosphate, this negatively charged ammonium binding pocket has been designed naturally for high affinity of ammonium to GS, permitting glutamine synthesis to proceed in aqueous solution. PMID:8563633

  7. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen P.

    2006-10-17

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  8. RNA binding protein and binding site useful for expression of recombinant molecules

    DOEpatents

    Mayfield, Stephen

    2000-01-01

    The present invention relates to a gene expression system in eukaryotic and prokaryotic cells, preferably plant cells and intact plants. In particular, the invention relates to an expression system having a RB47 binding site upstream of a translation initiation site for regulation of translation mediated by binding of RB47 protein, a member of the poly(A) binding protein family. Regulation is further effected by RB60, a protein disulfide isomerase. The expression system is capable of functioning in the nuclear/cytoplasm of cells and in the chloroplast of plants. Translation regulation of a desired molecule is enhanced approximately 100 fold over that obtained without RB47 binding site activation.

  9. Chromatin looping defines expression of TAL1, its flanking genes, and regulation in T-ALL.

    PubMed

    Zhou, Yan; Kurukuti, Sreenivasulu; Saffrey, Peter; Vukovic, Milica; Michie, Alison M; Strogantsev, Ruslan; West, Adam G; Vetrie, David

    2013-12-19

    TAL1 is an important regulator of hematopoiesis and its expression is tightly controlled despite complexities in its genomic organization. It is frequently misregulated in T-cell acute lymphoblastic leukemia (T-ALL), often due to deletions between TAL1 and the neighboring STIL gene. To better understand the events that lead to TAL1 expression in hematopoiesis and in T-ALL, we studied looping interactions at the TAL1 locus. In TAL1-expressing erythroid cells, the locus adopts a looping "hub" which brings into close physical proximity all known TAL1 cis-regulatory elements including CTCF-bound insulators. Loss of GATA1 results in disassembly of the hub and loss of CTCF/RAD21 from one of its insulators. Genes flanking TAL1 are partly dependent on hub integrity for their transcriptional regulation. We identified looping patterns unique to TAL1-expressing T-ALL cells, and, intriguingly, loops occurring between the TAL1 and STIL genes at the common TAL1/STIL breakpoints found in T-ALL. These findings redefine how TAL1 and neighboring genes communicate within the nucleus, and indicate that looping facilitates both normal and aberrant TAL1 expression and may predispose to structural rearrangements in T-ALL. We also propose that GATA1-dependent looping mechanisms may facilitate the conservation of TAL1 regulation despite cis-regulatory remodeling during vertebrate evolution.

  10. Acceleration of Binding Site Comparisons by Graph Partitioning.

    PubMed

    Krotzky, Timo; Klebe, Gerhard

    2015-08-01

    The comparison of protein binding sites is a prominent task in computational chemistry and has been studied in many different ways. For the automatic detection and comparison of putative binding cavities the Cavbase system has been developed which uses a coarse-grained set of pseudocenters to represent the physicochemical properties of a binding site and employs a graph-based procedure to calculate similarities between two binding sites. However, the comparison of two graphs is computationally quite demanding which makes large-scale studies such as the rapid screening of entire databases hardly feasible. In a recent work, we proposed the method Local Cliques (LC) for the efficient comparison of Cavbase binding sites. It employs a clique heuristic to detect the maximum common subgraph of two binding sites and an extended graph model to additionally compare the shape of individual surface patches. In this study, we present an alternative to further accelerate the LC method by partitioning the binding-site graphs into disjoint components prior to their comparisons. The pseudocenter sets are split with regard to their assigned phyiscochemical type, which leads to seven much smaller graphs than the original one. Applying this approach on the same test scenarios as in the former comprehensive way results in a significant speed-up without sacrificing accuracy. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Determination of structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC

    PubMed Central

    Wu, Wei; Park, Kyung-Tae; Holyoak, Todd; Lutkenhaus, Joe

    2011-01-01

    Summary The three Min proteins spatially regulate Z ring positioning in E. coli and are dynamically associated with the membrane. MinD binds to vesicles in the presence of ATP and can recruit MinC or MinE. Biochemical and genetic evidence indicate the binding sites for these two proteins on MinD overlap. Here we solved the structure of a hydrolytic-deficient mutant of MinD truncated for the C-terminal amphipathic helix involved in binding to the membrane. The structure solved in the presence of ATP is a dimer and reveals the face of MinD abutting the membrane. Using a combination of random and extensive site-directed mutagenesis additional residues important for MinE and MinC binding were identified. The location of these residues on the MinD structure confirms that the binding sites overlap and reveals that the binding sites are at the dimer interface and exposed to the cytosol. The location of the binding sites at the dimer interface offers a simple explanation for the ATP-dependency of MinC and MinE binding to MinD. PMID:21231967

  13. Interaction between phloretin and the red blood cell membrane

    PubMed Central

    1976-01-01

    Phloretin binding to red blood cell components has been characterized at pH6, where binding and inhibitory potency are maximal. Binding to intact red cells and to purified hemoglobin are nonsaturated processes approximately equal in magnitude, which strongly suggests that most of the red cell binding may be ascribed to hemoglobin. This conclusion is supported by the fact that homoglobin-free red cell ghosts can bind only 10% as much phloretin as an equivalent number of red cells. The permeability of the red cell membrane to phloretin has been determined by a direct measurement at the time-course of the phloretin uptake. At a 2% hematocrit, the half time for phloretin uptake is 8.7s, corresponding to a permeability coefficient of 2 x 10(-4) cm/s. The concentration dependence of the binding to ghosts reveals two saturable components. Phloretin binds with high affinity (K diss = 1.5 muM) to about 2.5 x 10(6) sites per cell; it also binds with lower affinity (Kdiss = 54 muM) to a second (5.5 x 10(7) per cell) set of sites. In sonicated total lipid extracts of red cell ghosts, phloretin binding consists of a single, saturable component. Its affinity and total number of sites are not significantly different from those of the low affinity binding process in ghosts. No high affinity binding of phloretin is exhibited by the red cell lipid extracts. Therefore, the high affinity phloretin binding sites are related to membrane proteins, and the low affinity sites result from phloretin binding to lipid. The identification of these two types of binding sites allows phloretin effects on protein-mediated transport processes to be distinguished from effects on the lipid region of the membrane. PMID:5575

  14. A peek into tropomyosin binding and unfolding on the actin filament.

    PubMed

    Singh, Abhishek; Hitchcock-Degregori, Sarah E

    2009-07-24

    Tropomyosin is a prototypical coiled coil along its length with subtle variations in structure that allow interactions with actin and other proteins. Actin binding globally stabilizes tropomyosin. Tropomyosin-actin interaction occurs periodically along the length of tropomyosin. However, it is not well understood how tropomyosin binds actin. Tropomyosin's periodic binding sites make differential contributions to two components of actin binding, cooperativity and affinity, and can be classified as primary or secondary sites. We show through mutagenesis and analysis of recombinant striated muscle alpha-tropomyosins that primary actin binding sites have a destabilizing coiled-coil interface, typically alanine-rich, embedded within a non-interface recognition sequence. Introduction of an Ala cluster in place of the native, more stable interface in period 2 and/or period 3 sites (of seven) increased the affinity or cooperativity of actin binding, analysed by cosedimentation and differential scanning calorimetry. Replacement of period 3 with period 5 sequence, an unstable region of known importance for cooperative actin binding, increased the cooperativity of binding. Introduction of the fluorescent probe, pyrene, near the mutation sites in periods 2 and 3 reported local instability, stabilization by actin binding, and local unfolding before or coincident with dissociation from actin (measured using light scattering), and chain dissociation (analyzed using circular dichroism). This, and previous work, suggests that regions of tropomyosin involved in binding actin have non-interface residues specific for interaction with actin and an unstable interface that is locally stabilized upon binding. The destabilized interface allows residues on the coiled-coil surface to obtain an optimal conformation for interaction with actin by increasing the number of local substates that the side chains can sample. We suggest that local disorder is a property typical of coiled coil binding sites and proteins that have multiple binding partners, of which tropomyosin is one type.

  15. sc-PDB: a 3D-database of ligandable binding sites--10 years on.

    PubMed

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. Piracetam defines a new binding site for allosteric modulators of alpha-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors.

    PubMed

    Ahmed, Ahmed H; Oswald, Robert E

    2010-03-11

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators.

  17. Piracetam Defines a New Binding Site for Allosteric Modulators of α-amino-3-hydroxy-5-methyl-4-isoxazole-propionic acid (AMPA) receptors§

    PubMed Central

    Ahmed, Ahmed H.; Oswald, Robert E.

    2010-01-01

    Glutamate receptors are the most prevalent excitatory neurotransmitter receptors in the vertebrate central nervous system and are important potential drug targets for cognitive enhancement and the treatment of schizophrenia. Allosteric modulators of AMPA receptors promote dimerization by binding to a dimer interface and reducing desensitization and deactivation. The pyrrolidine allosteric modulators, piracetam and aniracetam, were among the first of this class of drugs to be discovered. We have determined the structure of the ligand binding domain of the AMPA receptor subtypes GluA2 and GluA3 with piracetam and a corresponding structure of GluA3 with aniracetam. Both drugs bind to both GluA2 and GluA3 in a very similar manner, suggesting little subunit specificity. However, the binding sites for piracetam and aniracetam differ considerably. Aniracetam binds to a symmetrical site at the center of the dimer interface. Piracetam binds to multiple sites along the dimer interface with low occupation, one of which is a unique binding site for potential allosteric modulators. This new site may be of importance in the design of new allosteric regulators. PMID:20163115

  18. Amyloid tracers detect multiple binding sites in Alzheimer's disease brain tissue.

    PubMed

    Ni, Ruiqing; Gillberg, Per-Göran; Bergfors, Assar; Marutle, Amelia; Nordberg, Agneta

    2013-07-01

    Imaging fibrillar amyloid-β deposition in the human brain in vivo by positron emission tomography has improved our understanding of the time course of amyloid-β pathology in Alzheimer's disease. The most widely used amyloid-β imaging tracer so far is (11)C-Pittsburgh compound B, a thioflavin derivative but other (11)C- and (18)F-labelled amyloid-β tracers have been studied in patients with Alzheimer's disease and cognitively normal control subjects. However, it has not yet been established whether different amyloid tracers bind to identical sites on amyloid-β fibrils, offering the same ability to detect the regional amyloid-β burden in the brains. In this study, we characterized (3)H-Pittsburgh compound B binding in autopsied brain regions from 23 patients with Alzheimer's disease and 20 control subjects (aged 50 to 88 years). The binding properties of the amyloid tracers FDDNP, AV-45, AV-1 and BF-227 were also compared with those of (3)H-Pittsburgh compound B in the frontal cortices of patients with Alzheimer's disease. Saturation binding studies revealed the presence of high- and low-affinity (3)H-Pittsburgh compound B binding sites in the frontal cortex (K(d1): 3.5 ± 1.6 nM; K(d2): 133 ± 30 nM) and hippocampus (K(d1):5.6 ± 2.2 nM; K(d2): 181 ± 132 nM) of Alzheimer's disease brains. The relative proportion of high-affinity to low-affinity sites was 6:1 in the frontal cortex and 3:1 in the hippocampus. One control showed both high- and low-affinity (3)H-Pittsburgh compound B binding sites (K(d1): 1.6 nM; K(d2): 330 nM) in the cortex while the others only had a low-affinity site (K(d2): 191 ± 70 nM). (3)H-Pittsburgh compound B binding in Alzheimer's disease brains was higher in the frontal and parietal cortices than in the caudate nucleus and hippocampus, and negligible in the cerebellum. Competitive binding studies with (3)H-Pittsburgh compound B in the frontal cortices of Alzheimer's disease brains revealed high- and low-affinity binding sites for BTA-1 (Ki: 0.2 nM, 70 nM), florbetapir (1.8 nM, 53 nM) and florbetaben (1.0 nM, 65 nM). BF-227 displaced 83% of (3)H-Pittsburgh compound B binding, mainly at a low-affinity site (311 nM), whereas FDDNP only partly displaced (40%). We propose a multiple binding site model for the amyloid tracers (binding sites 1, 2 and 3), where AV-45 (florbetapir), AV-1 (florbetaben), and Pittsburgh compound B, all show nanomolar affinity for the high-affinity site (binding site 1), as visualized by positron emission tomography. BF-227 shows mainly binding to site 3 and FDDNP shows only some binding to site 2. Different amyloid tracers may provide new insight into the pathophysiological mechanisms in the progression of Alzheimer's disease.

  19. Role of Electrostatics in Protein-RNA Binding: The Global vs the Local Energy Landscape.

    PubMed

    Ghaemi, Zhaleh; Guzman, Irisbel; Gnutt, David; Luthey-Schulten, Zaida; Gruebele, Martin

    2017-09-14

    U1A protein-stem loop 2 RNA association is a basic step in the assembly of the spliceosomal U1 small nuclear ribonucleoprotein. Long-range electrostatic interactions due to the positive charge of U1A are thought to provide high binding affinity for the negatively charged RNA. Short range interactions, such as hydrogen bonds and contacts between RNA bases and protein side chains, favor a specific binding site. Here, we propose that electrostatic interactions are as important as local contacts in biasing the protein-RNA energy landscape toward a specific binding site. We show by using molecular dynamics simulations that deletion of two long-range electrostatic interactions (K22Q and K50Q) leads to mutant-specific alternative RNA bound states. One of these states preserves short-range interactions with aromatic residues in the original binding site, while the other one does not. We test the computational prediction with experimental temperature-jump kinetics using a tryptophan probe in the U1A-RNA binding site. The two mutants show the distinct predicted kinetic behaviors. Thus, the stem loop 2 RNA has multiple binding sites on a rough RNA-protein binding landscape. We speculate that the rough protein-RNA binding landscape, when biased to different local minima by electrostatics, could be one way that protein-RNA interactions evolve toward new binding sites and novel function.

  20. CavityPlus: a web server for protein cavity detection with pharmacophore modelling, allosteric site identification and covalent ligand binding ability prediction.

    PubMed

    Xu, Youjun; Wang, Shiwei; Hu, Qiwan; Gao, Shuaishi; Ma, Xiaomin; Zhang, Weilin; Shen, Yihang; Chen, Fangjin; Lai, Luhua; Pei, Jianfeng

    2018-05-10

    CavityPlus is a web server that offers protein cavity detection and various functional analyses. Using protein three-dimensional structural information as the input, CavityPlus applies CAVITY to detect potential binding sites on the surface of a given protein structure and rank them based on ligandability and druggability scores. These potential binding sites can be further analysed using three submodules, CavPharmer, CorrSite, and CovCys. CavPharmer uses a receptor-based pharmacophore modelling program, Pocket, to automatically extract pharmacophore features within cavities. CorrSite identifies potential allosteric ligand-binding sites based on motion correlation analyses between cavities. CovCys automatically detects druggable cysteine residues, which is especially useful to identify novel binding sites for designing covalent allosteric ligands. Overall, CavityPlus provides an integrated platform for analysing comprehensive properties of protein binding cavities. Such analyses are useful for many aspects of drug design and discovery, including target selection and identification, virtual screening, de novo drug design, and allosteric and covalent-binding drug design. The CavityPlus web server is freely available at http://repharma.pku.edu.cn/cavityplus or http://www.pkumdl.cn/cavityplus.

  1. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  2. LHRH-pituitary plasma membrane binding: the presence of specific binding sites in other tissues.

    PubMed

    Marshall, J C; Shakespear, R A; Odell, W D

    1976-11-01

    Two specific binding sites for LHRH are present on plasma membranes prepared from rat and bovine anterior pituitary glands. One site is of high affinity (K = 2X108 1/MOL) and the second is of lower affinity (8-5X105 1/mol) and much greater capacity. Studies on membrane fractions prepared from other tissues showed the presence of a single specific site for LHRH. The kinetics and specificity of this site were similar to those of the lower affinity pituitary receptor. These results indicate that only pituitary membranes possess the higher affinity binding site and suggest that the low affinity site is not of physiological importance in the regulation of gonadotrophin secretion. After dissociation from membranes of non-pituitary tissues 125I-LHRH rebound to pituitary membrane preparations. Thus receptor binding per se does not result in degradation of LHRH and the function of these peripheral receptors remains obscure.

  3. Computational design of trimeric influenza-neutralizing proteins targeting the hemagglutinin receptor binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Strauch, Eva-Maria; Bernard, Steffen M.; La, David

    Many viral surface glycoproteins and cell surface receptors are homo-oligomers1, 2, 3, 4, and thus can potentially be targeted by geometrically matched homo-oligomers that engage all subunits simultaneously to attain high avidity and/or lock subunits together. The adaptive immune system cannot generally employ this strategy since the individual antibody binding sites are not arranged with appropriate geometry to simultaneously engage multiple sites in a single target homo-oligomer. We describe a general strategy for the computational design of homo-oligomeric protein assemblies with binding functionality precisely matched to homo-oligomeric target sites5, 6, 7, 8. In the first step, a small protein ismore » designed that binds a single site on the target. In the second step, the designed protein is assembled into a homo-oligomer such that the designed binding sites are aligned with the target sites. We use this approach to design high-avidity trimeric proteins that bind influenza A hemagglutinin (HA) at its conserved receptor binding site. The designed trimers can both capture and detect HA in a paper-based diagnostic format, neutralizes influenza in cell culture, and completely protects mice when given as a single dose 24 h before or after challenge with influenza.« less

  4. An alternate binding site for PPARγ ligands

    PubMed Central

    Hughes, Travis S.; Giri, Pankaj Kumar; de Vera, Ian Mitchelle S.; Marciano, David P.; Kuruvilla, Dana S.; Shin, Youseung; Blayo, Anne-Laure; Kamenecka, Theodore M.; Burris, Thomas P.; Griffin, Patrick R.; Kojetin, Douglas J.

    2014-01-01

    PPARγ is a target for insulin sensitizing drugs such as glitazones, which improve plasma glucose maintenance in patients with diabetes. Synthetic ligands have been designed to mimic endogenous ligand binding to a canonical ligand-binding pocket to hyperactivate PPARγ. Here we reveal that synthetic PPARγ ligands also bind to an alternate site, leading to unique receptor conformational changes that impact coregulator binding, transactivation and target gene expression. Using structure-function studies we show that alternate site binding occurs at pharmacologically relevant ligand concentrations, and is neither blocked by covalently bound synthetic antagonists nor by endogenous ligands indicating non-overlapping binding with the canonical pocket. Alternate site binding likely contributes to PPARγ hyperactivation in vivo, perhaps explaining why PPARγ full and partial or weak agonists display similar adverse effects. These findings expand our understanding of PPARγ activation by ligands and suggest that allosteric modulators could be designed to fine tune PPARγ activity without competing with endogenous ligands. PMID:24705063

  5. Concerted formation of macromolecular Suppressor–mutator transposition complexes

    PubMed Central

    Raina, Ramesh; Schläppi, Michael; Karunanandaa, Balasulojini; Elhofy, Adam; Fedoroff, Nina

    1998-01-01

    Transposition of the maize Suppressor–mutator (Spm) transposon requires two element-encoded proteins, TnpA and TnpD. Although there are multiple TnpA binding sites near each element end, binding of TnpA to DNA is not cooperative, and the binding affinity is not markedly affected by the number of binding sites per DNA fragment. However, intermolecular complexes form cooperatively between DNA fragments with three or more TnpA binding sites. TnpD, itself not a sequence-specific DNA-binding protein, binds to TnpA and stabilizes the TnpA–DNA complex. The high redundancy of TnpA binding sites at both element ends and the protein–protein interactions between DNA-bound TnpA complexes and between these and TnpD imply a concerted transition of the element from a linear to a protein crosslinked transposition complex within a very narrow protein concentration range. PMID:9671711

  6. Accelerated molecular dynamics simulations of ligand binding to a muscarinic G-protein-coupled receptor.

    PubMed

    Kappel, Kalli; Miao, Yinglong; McCammon, J Andrew

    2015-11-01

    Elucidating the detailed process of ligand binding to a receptor is pharmaceutically important for identifying druggable binding sites. With the ability to provide atomistic detail, computational methods are well poised to study these processes. Here, accelerated molecular dynamics (aMD) is proposed to simulate processes of ligand binding to a G-protein-coupled receptor (GPCR), in this case the M3 muscarinic receptor, which is a target for treating many human diseases, including cancer, diabetes and obesity. Long-timescale aMD simulations were performed to observe the binding of three chemically diverse ligand molecules: antagonist tiotropium (TTP), partial agonist arecoline (ARc) and full agonist acetylcholine (ACh). In comparison with earlier microsecond-timescale conventional MD simulations, aMD greatly accelerated the binding of ACh to the receptor orthosteric ligand-binding site and the binding of TTP to an extracellular vestibule. Further aMD simulations also captured binding of ARc to the receptor orthosteric site. Additionally, all three ligands were observed to bind in the extracellular vestibule during their binding pathways, suggesting that it is a metastable binding site. This study demonstrates the applicability of aMD to protein-ligand binding, especially the drug recognition of GPCRs.

  7. Oligomycin frames a common drug-binding site in the ATP synthase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Symersky, Jindrich; Osowski, Daniel; Walters, D. Eric

    We report the high-resolution (1.9 {angstrom}) crystal structure of oligomycin bound to the subunit c10 ring of the yeast mitochondrial ATP synthase. Oligomycin binds to the surface of the c10 ring making contact with two neighboring molecules at a position that explains the inhibitory effect on ATP synthesis. The carboxyl side chain of Glu59, which is essential for proton translocation, forms an H-bond with oligomycin via a bridging water molecule but is otherwise shielded from the aqueous environment. The remaining contacts between oligomycin and subunit c are primarily hydrophobic. The amino acid residues that form the oligomycin-binding site are 100%more » conserved between human and yeast but are widely different from those in bacterial homologs, thus explaining the differential sensitivity to oligomycin. Prior genetics studies suggest that the oligomycin-binding site overlaps with the binding site of other antibiotics, including those effective against Mycobacterium tuberculosis, and thereby frames a common 'drug-binding site.' We anticipate that this drug-binding site will serve as an effective target for new antibiotics developed by rational design.« less

  8. Alignment-independent comparison of binding sites based on DrugScore potential fields encoded by 3D Zernike descriptors.

    PubMed

    Nisius, Britta; Gohlke, Holger

    2012-09-24

    Analyzing protein binding sites provides detailed insights into the biological processes proteins are involved in, e.g., into drug-target interactions, and so is of crucial importance in drug discovery. Herein, we present novel alignment-independent binding site descriptors based on DrugScore potential fields. The potential fields are transformed to a set of information-rich descriptors using a series expansion in 3D Zernike polynomials. The resulting Zernike descriptors show a promising performance in detecting similarities among proteins with low pairwise sequence identities that bind identical ligands, as well as within subfamilies of one target class. Furthermore, the Zernike descriptors are robust against structural variations among protein binding sites. Finally, the Zernike descriptors show a high data compression power, and computing similarities between binding sites based on these descriptors is highly efficient. Consequently, the Zernike descriptors are a useful tool for computational binding site analysis, e.g., to predict the function of novel proteins, off-targets for drug candidates, or novel targets for known drugs.

  9. Analysis of the reaction of carbachol with acetylcholinesterase using thioflavin T as a coupled fluorescence reporter.

    PubMed

    Rosenberry, Terrone L; Sonoda, Leilani K; Dekat, Sarah E; Cusack, Bernadette; Johnson, Joseph L

    2008-12-09

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC), which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here, we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analogue of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site.

  10. Analysis of the reaction of carbachol with acetylcholinesterase with thioflavin T as a coupled fluorescence reporter†

    PubMed Central

    Rosenberry, Terrone L.; Sonoda, Leilani K.; Dekat, Sarah E.; Cusack, Bernadette; Johnson, Joseph L.

    2009-01-01

    Acetylcholinesterase (AChE) contains a narrow and deep active site gorge with two sites of ligand binding, an acylation site (or A-site) at the base of the gorge and a peripheral site (or P-site) near the gorge entrance. The P-site contributes to catalytic efficiency by transiently binding substrates on their way to the acylation site, where a short-lived acylated enzyme intermediate is produced. Carbamates are very poor substrates that, like other AChE substrates, form an initial enzyme-substrate complex with free AChE (E) and proceed to an acylated enzyme intermediate (EC) which is then hydrolyzed. However, the hydrolysis of EC is slow enough to resolve the acylation and deacylation steps on the catalytic pathway. Here we focus on the reaction of carbachol (carbamoylcholine) with AChE. The kinetics and thermodynamics of this reaction are of special interest because carbachol is an isosteric analog of the physiological substrate acetylcholine. We show that the reaction can be monitored with thioflavin T as a fluorescent reporter group. The fluorescence of thioflavin T is strongly enhanced when it binds to the P-site of AChE, and this fluorescence is partially quenched when a second ligand binds to the A-site to form a ternary complex. Analysis of the fluorescence reaction profiles was challenging, because four thermodynamic parameters and two fluorescence coefficients were fitted from the combined data both for E and for EC. Respective equilibrium dissociation constants of 6 and 26 mM were obtained for carbachol binding to the A- and P-sites in E and of 2 and 32 mM for carbachol binding to the A- and P-sites in EC. These constants for the binding of carbachol to the P-site are about an order of magnitude larger (i.e., indicating lower affinity) than previous estimates for the binding of acetylthiocholine to the P-site. PMID:19006330

  11. Drug Promiscuity in PDB: Protein Binding Site Similarity Is Key.

    PubMed

    Haupt, V Joachim; Daminelli, Simone; Schroeder, Michael

    2013-01-01

    Drug repositioning applies established drugs to new disease indications with increasing success. A pre-requisite for drug repurposing is drug promiscuity (polypharmacology) - a drug's ability to bind to several targets. There is a long standing debate on the reasons for drug promiscuity. Based on large compound screens, hydrophobicity and molecular weight have been suggested as key reasons. However, the results are sometimes contradictory and leave space for further analysis. Protein structures offer a structural dimension to explain promiscuity: Can a drug bind multiple targets because the drug is flexible or because the targets are structurally similar or even share similar binding sites? We present a systematic study of drug promiscuity based on structural data of PDB target proteins with a set of 164 promiscuous drugs. We show that there is no correlation between the degree of promiscuity and ligand properties such as hydrophobicity or molecular weight but a weak correlation to conformational flexibility. However, we do find a correlation between promiscuity and structural similarity as well as binding site similarity of protein targets. In particular, 71% of the drugs have at least two targets with similar binding sites. In order to overcome issues in detection of remotely similar binding sites, we employed a score for binding site similarity: LigandRMSD measures the similarity of the aligned ligands and uncovers remote local similarities in proteins. It can be applied to arbitrary structural binding site alignments. Three representative examples, namely the anti-cancer drug methotrexate, the natural product quercetin and the anti-diabetic drug acarbose are discussed in detail. Our findings suggest that global structural and binding site similarity play a more important role to explain the observed drug promiscuity in the PDB than physicochemical drug properties like hydrophobicity or molecular weight. Additionally, we find ligand flexibility to have a minor influence.

  12. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  13. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  14. [3H]MK-801 binding sites in post-mortem human frontal cortex.

    PubMed

    Kornhuber, J; Mack-Burkhardt, F; Kornhuber, M E; Riederer, P

    1989-03-29

    The binding of [3H]MK-801 ((+)-5-methyl-10,11-dihydro-5H-dibenzo[a,d]cyclohepten-5,10-imine maleate) was investigated in extensively washed homogenates of post-mortem human frontal cortex. The association of [3H]MK-801 proceeded slowly (t1/2 = 553 min) and reached equilibrium only after a prolonged incubation (greater than 24 h). The dissociation of [3H]MK-801 from the binding site was also slow (t1/2 = 244 min). Glutamate, glycine and magnesium markedly increased the rate of association (t1/2 = 14.8 min) and dissociation (t1/2 = 36.5 min). At equilibrium, the binding was not altered by these substances. Specific binding was linear with protein concentration, was saturable, reversible, stereoselective, heat-labile and was nearly absent in the white matter. Scatchard analysis of the saturation curves obtained at equilibrium indicated that there was a high-affinity (Kd1 1.39 +/- 0.21 nM, Bmax1 0.483 +/- 0.084 pmol/mg protein) and a low-affinity (Kd2 116.25 +/- 50.79 nM, Bmax2 3.251 +/- 0.991 pmol/mg protein) binding site. All competition curves obtained with (+)-MK-801, (-)-MK-801, phencyclidine and ketamine had Hill coefficients of less than unity and were best explained by a two-site model. Thus, our results demonstrate the presence of binding sites for MK-801 in post-mortem human brains and provide evidence for binding site heterogeneity. Furthermore, glutamate, glycine and magnesium accelerate the association and dissociation of [3H]MK-801 to and from its binding sites. The results add support to the hypothesis that MK-801, glutamate, glycine and magnesium all bind to different sites on the NMDA receptor-ion channel complex.

  15. The binding sites of inhibitory monoclonal antibodies on acetylcholinesterase. Identification of a novel regulatory site at the putative "back door".

    PubMed

    Simon, S; Le Goff, A; Frobert, Y; Grassi, J; Massoulié, J

    1999-09-24

    We investigated the target sites of three inhibitory monoclonal antibodies on Electrophorus acetylcholinesterase (AChE). Previous studies showed that Elec-403 and Elec-410 are directed to overlapping but distinct epitopes in the peripheral site, at the entrance of the catalytic gorge, whereas Elec-408 binds to a different region. Using Electrophorus/rat AChE chimeras, we identified surface residues that differed between sensitive and insensitive AChEs: the replacement of a single Electrophorus residue by its rat homolog was able to abolish binding and inhibition, for each antibody. Reciprocally, binding and inhibition by Elec-403 and by Elec-410 could be conferred to rat AChE by the reverse mutation. Elec-410 appears to bind to one side of the active gorge, whereas Elec-403 covers its opening, explaining why the AChE-Elec-410 complex reacts faster than the AChE-Elec-403 or AChE-fasciculin complexes with two active site inhibitors, m-(N,N, N-trimethyltammonio)trifluoro-acetophenone and echothiophate. Elec-408 binds to the region of the putative "back door," distant from the peripheral site, and does not interfere with the access of inhibitors to the active site. The binding of an antibody to this novel regulatory site may inhibit the enzyme by blocking the back door or by inducing a conformational distortion within the active site.

  16. Searching for putative binding sites of the bispyridinium compound MB327 in the nicotinic acetylcholine receptor.

    PubMed

    Wein, Thomas; Höfner, Georg; Rappenglück, Sebastian; Sichler, Sonja; Niessen, Karin V; Seeger, Thomas; Worek, Franz; Thiermann, Horst; Wanner, Klaus T

    2018-09-01

    Irreversible inhibition of the acetylcholine esterase upon intoxication with organophosphorus compounds leads to an accumulation of acetylcholine in the synaptic cleft and a subsequent desensitization of nicotinic acetylcholine receptors which may ultimately result in respiratory failure. The bispyridinium compound MB327 has been found to restore functional activity of nAChR thus representing a promising starting point for the development of new drugs for the treatment of organophosphate poisoning. In order to optimize the resensitizing effect of MB327 on nAChR, it would be very helpful to know the MB327 specific binding site to apply structure based molecular modeling. The binding site for MB327 at the nAChR is not known and so far goal of speculations, but it has been shown that MB327 does not bind to the orthosteric acetylcholine binding site. We have used docking calculations to screen the surface of nAChR for possible binding sites of MB327. The results indicate that at least two potential binding sites for MB327 at nAChR are present inside the channel pore. In these binding sites, MB327 intercalates between the γ-α and β-δ subunits of nAChR, respectively. Both putative MB327 binding sites show an unsymmetrical distribution of surrounding hydrophilic and lipophilic amino acids. This suggests that substitution of MB327-related bispyridinium compounds on one of the two pyridinium rings with polar substituents should have a favorable effect on the pharmacological function. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-03-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction.

  18. Comparison of the fibrin-binding activities in the N- and C-termini of fibronectin.

    PubMed Central

    Rostagno, A A; Schwarzbauer, J E; Gold, L I

    1999-01-01

    Fibronectin (Fn) binds to fibrin in clots by covalent and non-covalent interactions. The N- and C-termini of Fn each contain one non-covalent fibrin-binding site, which are composed of type 1 (F1) structural repeats. We have previously localized the N-terminal site to the fourth and fifth F1 repeats (4F1.5F1). In the current studies, using proteolytic and recombinant proteins representing both the N- and C-terminal fibrin-binding regions, we localized and characterized the C-terminal fibrin-binding site, compared the relative fibrin-binding activities of both sites and determined the contribution of each site to the fibrin-binding activity of intact Fn. By fibrin-affinity chromatography, a protein composed of the 10F1 repeat through to the C-terminus of Fn (10F1-COOH), expressed in COS-1 cells, and 10F1-12F1, produced in Saccharomyces cerevisiae, displayed fibrin-binding activity. However, since 10F1 and 10F1.11F1 were not active, the presence of 12F1 is required for fibrin binding. A proteolytic fragment of 14.4 kDa, beginning 14 residues N-terminal to 10F1, was isolated from the fibrin-affinity matrix. Radio-iodinated 14.4 kDa fibrin-binding peptide/protein (FBP) demonstrated a dose-dependent and saturable binding to fibrin-coated wells that was both competitively inhibited and reversed by unlabelled 14.4 kDa FBP. Comparison of the fibrin-binding affinities of proteolytic FBPs from the N-terminus (25.9 kDa FBP), the C-terminus (14.4 kDa) and intact Fn by ELISA yielded estimated Kd values of 216, 18 and 2.1 nM, respectively. The higher fibrin-binding affinity of the N-terminus was substantiated by the ability of both a recombinant 4F1.5F1 and a monoclonal antibody (mAb) to this site to maximally inhibit biotinylated Fn binding to fibrin by 80%, and by blocking the 90% inhibitory activity of a polyclonal anti-Fn, by absorption with the 25.9 kDa FBP. We propose that whereas the N-terminal site appears to contribute to most of the binding activity of native Fn to fibrin, the specific binding of the C-terminal site may strengthen this interaction. PMID:10024513

  19. sc-PDB: a 3D-database of ligandable binding sites—10 years on

    PubMed Central

    Desaphy, Jérémy; Bret, Guillaume; Rognan, Didier; Kellenberger, Esther

    2015-01-01

    The sc-PDB database (available at http://bioinfo-pharma.u-strasbg.fr/scPDB/) is a comprehensive and up-to-date selection of ligandable binding sites of the Protein Data Bank. Sites are defined from complexes between a protein and a pharmacological ligand. The database provides the all-atom description of the protein, its ligand, their binding site and their binding mode. Currently, the sc-PDB archive registers 9283 binding sites from 3678 unique proteins and 5608 unique ligands. The sc-PDB database was publicly launched in 2004 with the aim of providing structure files suitable for computational approaches to drug design, such as docking. During the last 10 years we have improved and standardized the processes for (i) identifying binding sites, (ii) correcting structures, (iii) annotating protein function and ligand properties and (iv) characterizing their binding mode. This paper presents the latest enhancements in the database, specifically pertaining to the representation of molecular interaction and to the similarity between ligand/protein binding patterns. The new website puts emphasis in pictorial analysis of data. PMID:25300483

  20. Allosteric Coupling of CARMIL and V-1 Binding to Capping Protein Revealed by Hydrogen-Deuterium Exchange.

    PubMed

    Johnson, Britney; McConnell, Patrick; Kozlov, Alex G; Mekel, Marlene; Lohman, Timothy M; Gross, Michael L; Amarasinghe, Gaya K; Cooper, John A

    2018-05-29

    Actin assembly is important for cell motility. The ability of actin subunits to join or leave filaments via the barbed end is critical to actin dynamics. Capping protein (CP) binds to barbed ends to prevent subunit gain and loss and is regulated by proteins that include V-1 and CARMIL. V-1 inhibits CP by sterically blocking one binding site for actin. CARMILs bind at a distal site and decrease the affinity of CP for actin, suggested to be caused by conformational changes. We used hydrogen-deuterium exchange with mass spectrometry (HDX-MS) to probe changes in structural dynamics induced by V-1 and CARMIL binding to CP. V-1 and CARMIL induce changes in both proteins' binding sites on the surface of CP, along with a set of internal residues. Both also affect the conformation of CP's ββ subunit "tentacle," a second distal actin-binding site. Concerted regulation of actin assembly by CP occurs through allosteric couplings between CP modulator and actin binding sites. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Elucidation of the Human Serum Albumin (HSA) Binding Site for the Cu-PTSM and Cu-ATSM Radiopharmaceuticals

    PubMed Central

    Basken, Nathan E.; Mathias, Carla J.; Green, Mark A.

    2008-01-01

    The Cu-PTSM (pyruvaldehyde bis(N4-methylthiosemicarbazonato)copper(II)) and Cu-ATSM (diacetyl bis(N4-methylthiosemicarbazonato)copper(II)) radiopharmaceuticals exhibit strong, species-dependent binding to human serum albumin (HSA), while Cu-ETS (ethylglyoxal bis(thiosemicarbazonato)copper(II)) appears to only exhibit non-specific binding to human and animal serum albumins. This study examines the structural basis for HSA binding of Cu-PTSM and Cu-ATSM via competition with drugs having known albumin binding sites. Warfarin, furosemide, ibuprofen, phenylbutazone, benzylpenicillin, and cephmandole were added to HSA solutions at drug:HSA mole ratios from 0 to 8:1, followed by quantification of radiopharmaceutical binding to HSA by ultrafiltration. Warfarin, a site IIA drug, progressively displaced both [64Cu]Cu-PTSM and [64Cu]Cu-ATSM from HSA. At 8:1 warfarin:HSA mole ratios, free [64Cu]Cu-PTSM and [64Cu]Cu-ATSM levels increased 300–500%. This was in contrast to solutions containing ibuprofen, a site IIIA drug; no increase in free [64Cu]Cu-PTSM or [64Cu]Cu-ATSM was observed except at high ibuprofen:HSA ratios, where secondary ibuprofen binding to the IIA site may cause modest radiopharmaceutical displacement. By contrast, and consistent with earlier findings suggesting Cu-ETS exhibits only non-specific associations, [64Cu]Cu-ETS binding to HSA was unaffected by the addition of drugs that bind in either site. We conclude that the species-dependence of Cu-PTSM and Cu-ATSM albumin binding arises from interaction(s) with the IIA site of HSA. PMID:18937368

  2. Binding and Translocation of Termination Factor Rho Studied at the Single-Molecule Level

    PubMed Central

    Koslover, Daniel J.; Fazal, Furqan M.; Mooney, Rachel A.; Landick, Robert; Block, Steven M.

    2012-01-01

    Rho termination factor is an essential hexameric helicase responsible for terminating 20–50% of all mRNA synthesis in E. coli. We used single- molecule force spectroscopy to investigate Rho-RNA binding interactions at the Rho- utilization (rut) site of the ? tR1 terminator. Our results are consistent with Rho complexes adopting two states, one that binds 57 ±2 nucleotides of RNA across all six of the Rho primary binding sites, and another that binds 85 ±2 nucleotides at the six primary sites plus a single secondary site situated at the center of the hexamer. The single-molecule data serve to establish that Rho translocates 5′-to-3′ towards RNA polymerase (RNAP) by a tethered-tracking mechanism, looping out the intervening RNA between the rut site and RNAP. These findings lead to a general model for Rho binding and translocation, and establish a novel experimental approach that should facilitate additional single- molecule studies of RNA-binding proteins. PMID:22885804

  3. OnTheFly: a database of Drosophila melanogaster transcription factors and their binding sites.

    PubMed

    Shazman, Shula; Lee, Hunjoong; Socol, Yakov; Mann, Richard S; Honig, Barry

    2014-01-01

    We present OnTheFly (http://bhapp.c2b2.columbia.edu/OnTheFly/index.php), a database comprising a systematic collection of transcription factors (TFs) of Drosophila melanogaster and their DNA-binding sites. TFs predicted in the Drosophila melanogaster genome are annotated and classified and their structures, obtained via experiment or homology models, are provided. All known preferred TF DNA-binding sites obtained from the B1H, DNase I and SELEX methodologies are presented. DNA shape parameters predicted for these sites are obtained from a high throughput server or from crystal structures of protein-DNA complexes where available. An important feature of the database is that all DNA-binding domains and their binding sites are fully annotated in a eukaryote using structural criteria and evolutionary homology. OnTheFly thus provides a comprehensive view of TFs and their binding sites that will be a valuable resource for deciphering non-coding regulatory DNA.

  4. Zampanolide Binding to Tubulin Indicates Cross-Talk of Taxane Site with Colchicine and Nucleotide Sites.

    PubMed

    Field, Jessica J; Pera, Benet; Gallego, Juan Estévez; Calvo, Enrique; Rodríguez-Salarichs, Javier; Sáez-Calvo, Gonzalo; Zuwerra, Didier; Jordi, Michel; Andreu, José M; Prota, Andrea E; Ménchon, Grégory; Miller, John H; Altmann, Karl-Heinz; Díaz, J Fernando

    2018-03-23

    The marine natural product zampanolide and analogues thereof constitute a new chemotype of taxoid site microtubule-stabilizing agents with a covalent mechanism of action. Zampanolide-ligated tubulin has the switch-activation loop (M-loop) in the assembly prone form and, thus, represents an assembly activated state of the protein. In this study, we have characterized the biochemical properties of the covalently modified, activated tubulin dimer, and we have determined the effect of zampanolide on tubulin association and the binding of tubulin ligands at other binding sites. Tubulin activation by zampanolide does not affect its longitudinal oligomerization but does alter its lateral association properties. The covalent binding of zampanolide to β-tubulin affects both the colchicine site, causing a change of the quantum yield of the bound ligand, and the exchangeable nucleotide binding site, reducing the affinity for the nucleotide. While these global effects do not change the binding affinity of 2-methoxy-5-(2,3,4-trimethoxyphenyl)-2,4,6-cycloheptatrien-1-one (MTC) (a reversible binder of the colchicine site), the binding affinity of a fluorescent analogue of GTP (Mant-GTP) at the nucleotide E-site is reduced from 12 ± 2 × 10 5 M -1 in the case of unmodified tubulin to 1.4 ± 0.3 × 10 5 M -1 in the case of the zampanolide tubulin adduct, indicating signal transmission between the taxane site and the colchicine and nucleotide sites of β-tubulin.

  5. Binding Pathway of Opiates to μ-Opioid Receptors Revealed by Machine Learning

    NASA Astrophysics Data System (ADS)

    Barati Farimani, Amir; Feinberg, Evan; Pande, Vijay

    2018-02-01

    Many important analgesics relieve pain by binding to the $\\mu$-Opioid Receptor ($\\mu$OR), which makes the $\\mu$OR among the most clinically relevant proteins of the G Protein Coupled Receptor (GPCR) family. Despite previous studies on the activation pathways of the GPCRs, the mechanism of opiate binding and the selectivity of $\\mu$OR are largely unknown. We performed extensive molecular dynamics (MD) simulation and analysis to find the selective allosteric binding sites of the $\\mu$OR and the path opiates take to bind to the orthosteric site. In this study, we predicted that the allosteric site is responsible for the attraction and selection of opiates. Using Markov state models and machine learning, we traced the pathway of opiates in binding to the orthosteric site, the main binding pocket. Our results have important implications in designing novel analgesics.

  6. Stability and Sugar Recognition Ability of Ricin-Like Carbohydrate Binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yao, Jianzhuang; Nellas, Ricky B; Glover, Mary M

    2011-01-01

    Lectins are a class of proteins known for their novel binding to saccharides. Understanding this sugar recognition process can be crucial in creating structure-based designs of proteins with various biological roles. We focus on the sugar binding of a particular lectin, ricin, which has two -trefoil carbohydrate-binding domains (CRDs) found in several plant protein toxins. The binding ability of possible sites of ricin-like CRD has been puzzling. The apo and various (multiple) ligand-bound forms of the sugar-binding domains of ricin were studied by molecular dynamics simulations. By evaluating structural stability, hydrogen bond dynamics, flexibility, and binding energy, we obtained amore » detailed picture of the sugar recognition of the ricin-like CRD. Unlike what was previously believed, we found that the binding abilities of the two known sites are not independent of each other. The binding ability of one site is positively affected by the other site. While the mean positions of different binding scenarios are not altered significantly, the flexibility of the binding pockets visibly decreases upon multiple ligand binding. This change in flexibility seems to be the origin of the binding cooperativity. All the hydrogen bonds that are strong in the monoligand state are also strong in the double-ligand complex, although the stability is much higher in the latter form due to cooperativity. These strong hydrogen bonds in a monoligand state are deemed to be the essential hydrogen bonds. Furthermore, by examining the structural correlation matrix, the two domains are structurally one entity. Galactose hydroxyl groups, OH4 and OH3, are the most critical parts in both site 1 and site 2 recognition.« less

  7. Identification of new 2,5-diketopiperazine derivatives as simultaneous effective inhibitors of αβ-tubulin and BCRP proteins: Molecular docking, Structure-Activity Relationships and virtual consensus docking studies

    NASA Astrophysics Data System (ADS)

    Fani, Najmeh; Sattarinezhad, Elham; Bordbar, Abdol-Khalegh

    2017-06-01

    In the first part of this paper, docking method was employed in order to study the binding mechanism of breast cancer resistance protein (BCRP) with a group of previously synthesized TPS-A derivatives which known as potent inhibitors of this protein to get insight into drug binding site of BCRP and to explore structure-activity relationship of these compounds. Molecular docking results showed that most of these compounds bind in the binding site of BCRP at the interface between the membrane and outer environment. In the second part, a group of designed TPS-A derivatives which showed good binding energies in the binding site of αβ-tubulin in the previous study were chosen to study their binding energies in the binding site of BCRP to investigate their simultaneous inhibitory effect on both αβ-tubulin and BCRP. The results showed that all of these compounds bind to the binding site of BCRP with relatively suitable binding energies and therefore could be potential inhibitors of both αβ-tubulin and BCRP proteins. Finally, virtual consensus docking method was utilized with the aim of design of new 2,5-diketopiperazine derivatives with significant inhibitory effect on both αβ-tubulin and BCRP proteins. For this purpose binding energies of a library of 2,5-diketopiperazine derivatives in the binding sites of αβ-tubulin and BCRP was investigated by using AutoDock and AutoDock vina tools. Molecular docking results revealed that a group of 36 compounds among them exhibit strong anti-tubulin and anti-BCRP activity.

  8. A deep learning framework for modeling structural features of RNA-binding protein targets

    PubMed Central

    Zhang, Sai; Zhou, Jingtian; Hu, Hailin; Gong, Haipeng; Chen, Ligong; Cheng, Chao; Zeng, Jianyang

    2016-01-01

    RNA-binding proteins (RBPs) play important roles in the post-transcriptional control of RNAs. Identifying RBP binding sites and characterizing RBP binding preferences are key steps toward understanding the basic mechanisms of the post-transcriptional gene regulation. Though numerous computational methods have been developed for modeling RBP binding preferences, discovering a complete structural representation of the RBP targets by integrating their available structural features in all three dimensions is still a challenging task. In this paper, we develop a general and flexible deep learning framework for modeling structural binding preferences and predicting binding sites of RBPs, which takes (predicted) RNA tertiary structural information into account for the first time. Our framework constructs a unified representation that characterizes the structural specificities of RBP targets in all three dimensions, which can be further used to predict novel candidate binding sites and discover potential binding motifs. Through testing on the real CLIP-seq datasets, we have demonstrated that our deep learning framework can automatically extract effective hidden structural features from the encoded raw sequence and structural profiles, and predict accurate RBP binding sites. In addition, we have conducted the first study to show that integrating the additional RNA tertiary structural features can improve the model performance in predicting RBP binding sites, especially for the polypyrimidine tract-binding protein (PTB), which also provides a new evidence to support the view that RBPs may own specific tertiary structural binding preferences. In particular, the tests on the internal ribosome entry site (IRES) segments yield satisfiable results with experimental support from the literature and further demonstrate the necessity of incorporating RNA tertiary structural information into the prediction model. The source code of our approach can be found in https://github.com/thucombio/deepnet-rbp. PMID:26467480

  9. Functional Characterization of the Mannitol Promoter of Pseudomonas fluorescens DSM 50106 and Its Application for a Mannitol-Inducible Expression System for Pseudomonas putida KT2440

    PubMed Central

    Hoffmann, Jana; Altenbuchner, Josef

    2015-01-01

    A new pBBR1MCS-2-derived vector containing the Pseudomonas fluorescens DSM10506 mannitol promoter PmtlE and mtlR encoding its AraC/XylS type transcriptional activator was constructed and optimized for low basal expression. Mannitol, arabitol, and glucitol-inducible gene expression was demonstrated with Pseudomonas putida and eGFP as reporter gene. The new vector was applied for functional characterization of PmtlE. Identification of the DNA binding site of MtlR was achieved by in vivo eGFP measurement with PmtlE wild type and mutants thereof. Moreover, purified MtlR was applied for detailed in vitro investigations using electrophoretic mobility shift assays and DNaseI footprinting experiments. The obtained data suggest that MtlR binds to PmtlE as a dimer. The proposed DNA binding site of MtlR is AGTGC-N5-AGTAT-N7-AGTGC-N5-AGGAT. The transcription activation mechanism includes two binding sites with different binding affinities, a strong upstream binding site and a weaker downstream binding site. The presence of the weak downstream binding site was shown to be necessary to sustain mannitol-inducibility of PmtlE. Two possible functions of mannitol are discussed; the effector might stabilize binding of the second monomer to the downstream half site or promote transcription activation by inducing a conformational change of the regulator that influences the contact to the RNA polymerase. PMID:26207762

  10. The structure of binding curves and practical identifiability of equilibrium ligand-binding parameters

    PubMed Central

    Middendorf, Thomas R.

    2017-01-01

    A critical but often overlooked question in the study of ligands binding to proteins is whether the parameters obtained from analyzing binding data are practically identifiable (PI), i.e., whether the estimates obtained from fitting models to noisy data are accurate and unique. Here we report a general approach to assess and understand binding parameter identifiability, which provides a toolkit to assist experimentalists in the design of binding studies and in the analysis of binding data. The partial fraction (PF) expansion technique is used to decompose binding curves for proteins with n ligand-binding sites exactly and uniquely into n components, each of which has the form of a one-site binding curve. The association constants of the PF component curves, being the roots of an n-th order polynomial, may be real or complex. We demonstrate a fundamental connection between binding parameter identifiability and the nature of these one-site association constants: all binding parameters are identifiable if the constants are all real and distinct; otherwise, at least some of the parameters are not identifiable. The theory is used to construct identifiability maps from which the practical identifiability of binding parameters for any two-, three-, or four-site binding curve can be assessed. Instructions for extending the method to generate identifiability maps for proteins with more than four binding sites are also given. Further analysis of the identifiability maps leads to the simple rule that the maximum number of structurally identifiable binding parameters (shown in the previous paper to be equal to n) will also be PI only if the binding curve line shape contains n resolved components. PMID:27993951

  11. Super-high-affinity binding site for [3H]diazepam in the presence of Co2+, Ni2+, Cu2+, or Zn2+.

    PubMed

    Mizuno, S; Ogawa, N; Mori, A

    1982-12-01

    Chloride salts of Li+, Na+, K+, Mg2+, Ca2+, Cr3+, Mn2+, Fe2+, and Fe3+ had no effect on [3H]diazepam binding. Chloride salts of Co2+, Ni2+, Cu2+, and Zn2+ increased [3H]diazepam binding by 34 to 68% in a concentration-dependent fashion. Since these divalent cations potentiated the GABA-enhanced [3H]diazepam binding and the effect of each divalent cation was nearly additive with GABA, these cations probably act at a site different from the GABA recognition site in the benzodiazepine-receptor complex. Scatchard plots of [3H]diazepam binding without an effective divalent cation showed a single class of binding, with a Kd value of 5.3 nM. In the presence of 1 mM Co2+, Ni2+, Cu2+, or Zn2+, two distinct binding sites were evident with apparent Kd values of 1.0 nM and 5.7 nM. The higher-affinity binding was not detected in the absence of an effective divalent cation and is probably a novel, super-high-affinity binding site.

  12. Point mutations abolishing the mannose-binding capability of boar spermadhesin AQN-1.

    PubMed

    Ekhlasi-Hundrieser, Mahnaz; Calvete, Juan J; Von Rad, Bettina; Hettel, Christiane; Nimtz, Manfred; Töpfer-Petersen, Edda

    2008-05-01

    The mannose-binding capability of recombinant wild-type boar spermadhesin AQN-1 and of its site-directed mutants in the highly-conserved region around of the single glycosylation site (asparagine 50) of some spermadhesins, where the carbohydrate binding site has been proposed to be located, was checked using a solid-phase assay and a biotinylated mannose ligand. Substitution of glycine 54 by amino acids bearing an unipolar side chain did not cause significant decrease in the mannose-binding activity. However, amino acids with uncharged polar side chains or having a charged polar side chain abolished the binding of biotinylated mannose to the corresponding AQN-1 mutants. The results suggest that the higher surface accessibility of amino acids possessing polar side chains compared to those bearing nonpolar groups may sterically interfere with monosaccharide binding. The location of the mannose-binding site in AQN-1 appears to be topologically conserved in other heparin-binding boar spermadhesins, i.e., AQN-3 and AWN, but departs from the location of the mannose-6-phosphate-recognition site of PSP-II. This indicates that different spermadhesin molecules have evolved non-equivalent carbohydrate-binding capabilities, which may underlie their distinct patterns of biological activities.

  13. Virtual screening of potential inhibitors from TCM for the CPSF30 binding site on the NS1A protein of influenza A virus.

    PubMed

    Ai, Haixin; Zhang, Li; Chang, Alan K; Wei, Hongyun; Che, Yuchen; Liu, Hongsheng

    2014-03-01

    Inhibition of CPSF30 function by the effector domain of influenza A virus of non-structural protein 1 (NS1A) protein plays a critical role in the suppression of host key antiviral response. The CPSF30-binding site of NS1A appears to be a very attractive target for the development of new drugs against influenza A virus. In this study, structure-based molecular docking was utilized to screen more than 30,000 compounds from a Traditional Chinese Medicine (TCM) database. Four drug-like compounds were selected as potential inhibitors for the CPSF30-binding site of NS1A. Docking conformation analysis results showed that these potential inhibitors could bind to the CPSF30-binding site with strong hydrophobic interactions and weak hydrogen bonds. Molecular dynamics simulations and MM-PBSA calculations suggested that two of the inhibitors, compounds 32056 and 31674, could stably bind to the CPSF30-binding site with high binding free energy. These two compounds could be modified to achieve higher binding affinity, so that they may be used as potential leads in the development of new anti-influenza drugs.

  14. Expression and GTP sensitivity of peptide histidine isoleucine high-affinity-binding sites in rat.

    PubMed

    Debaigt, Colin; Meunier, Annie-Claire; Goursaud, Stephanie; Montoni, Alicia; Pineau, Nicolas; Couvineau, Alain; Laburthe, Marc; Muller, Jean-Marc; Janet, Thierry

    2006-07-01

    High-affinity-binding sites for the vasoactive intestinal peptide (VIP) analogs peptide histidine/isoleucine-amide (PHI)/carboxyterminal methionine instead of isoleucine (PHM) are expressed in numerous tissues in the body but the nature of their receptors remains to be elucidated. The data presented indicate that PHI discriminated a high-affinity guanosine 5'-triphosphate (GTP)-insensitive-binding subtype that represented the totality of the PHI-binding sites in newborn rat tissues but was differentially expressed in adult animals. The GTP-insensitive PHI/PHM-binding sites were also observed in CHO cells over expressing the VPAC2 but not the VPAC1 VIP receptor.

  15. Selectivity of externally facing ion-binding sites in the Na/K pump to alkali metals and organic cations

    PubMed Central

    Ratheal, Ian M.; Virgin, Gail K.; Yu, Haibo; Roux, Benoît; Gatto, Craig; Artigas, Pablo

    2010-01-01

    The Na/K pump is a P-type ATPase that exchanges three intracellular Na+ ions for two extracellular K+ ions through the plasmalemma of nearly all animal cells. The mechanisms involved in cation selection by the pump's ion-binding sites (site I and site II bind either Na+ or K+; site III binds only Na+) are poorly understood. We studied cation selectivity by outward-facing sites (high K+ affinity) of Na/K pumps expressed in Xenopus oocytes, under voltage clamp. Guanidinium+, methylguanidinium+, and aminoguanidinium+ produced two phenomena possibly reflecting actions at site III: (i) voltage-dependent inhibition (VDI) of outwardly directed pump current at saturating K+, and (ii) induction of pump-mediated, guanidinium-derivative–carried inward current at negative potentials without Na+ and K+. In contrast, formamidinium+ and acetamidinium+ induced K+-like outward currents. Measurement of ouabain-sensitive ATPase activity and radiolabeled cation uptake confirmed that these cations are external K+ congeners. Molecular dynamics simulations indicate that bound organic cations induce minor distortion of the binding sites. Among tested metals, only Li+ induced Na+-like VDI, whereas all metals tested except Na+ induced K+-like outward currents. Pump-mediated K+-like organic cation transport challenges the concept of rigid structural models in which ion specificity at site I and site II arises from a precise and unique arrangement of coordinating ligands. Furthermore, actions by guanidinium+ derivatives suggest that Na+ binds to site III in a hydrated form and that the inward current observed without external Na+ and K+ represents cation transport when normal occlusion at sites I and II is impaired. These results provide insights on external ion selectivity at the three binding sites. PMID:20937860

  16. Mechanistic Insight from Calorimetric Measurements of the Assembly of the Binuclear Metal Active Site of Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes.

    PubMed

    Pedroso, Marcelo M; Ely, Fernanda; Carpenter, Margaret C; Mitić, Nataša; Gahan, Lawrence R; Ollis, David L; Wilcox, Dean E; Schenk, Gerhard

    2017-07-05

    Glycerophosphodiesterase (GpdQ) from Enterobacter aerogenes is a binuclear metallohydrolase with a high affinity for metal ions at its α site but a lower affinity at its β site in the absence of a substrate. Isothermal titration calorimetry (ITC) has been used to quantify the Co(II) and Mn(II) binding affinities and thermodynamics of the two sites in wild-type GpdQ and two mutants, both in the absence and in the presence of phosphate. Metal ions bind to the six-coordinate α site in an entropically driven process with loss of a proton, while binding at the β site is not detected by ITC. Phosphate enhances the metal affinity of the α site by increasing the binding entropy and the metal affinity of the β site by enthalpic (Co) or entropic (Mn) contributions, but no additional loss of protons. Mutations of first- and second-coordination sphere residues at the β site increase the metal affinity of both sites by enhancing the binding enthalpy. In particular, loss of the hydrogen bond from second-sphere Ser127 to the metal-coordinating Asn80 has a significant effect on the metal binding thermodynamics that result in a resting binuclear active site with high catalytic activity. While structural and spectroscopic data with excess metal ions have indicated a bridging hydroxide in the binuclear GpdQ site, analysis of ITC data here reveals the loss of a single proton in the assembly of this site, indicating that the metal-bound hydroxide nucleophile is formed in the resting inactive mononuclear form, which becomes catalytically competent upon binding the second metal ion.

  17. Volatile anesthetic binding to proteins is influenced by solvent and aliphatic residues.

    PubMed

    Streiff, John H; Jones, Keith A

    2008-10-01

    The main objective of this work was to characterize VA binding sites in multiple anesthetic target proteins. A computational algorithm was used to quantify the solvent exclusion and aliphatic character of amphiphilic pockets in the structures of VA binding proteins. VA binding sites in the protein structures were defined as the pockets with solvent exclusion and aliphatic character that exceeded minimum values observed in the VA binding sites of serum albumin, firefly luciferase, and apoferritin. We found that the structures of VA binding proteins are enriched in these pockets and that the predicted binding sites were consistent with experimental determined binding locations in several proteins. Autodock3 was used to dock the simulated molecules of 1,1,1,2,2-pentafluoroethane, difluoromethyl 1,1,1,2-tetrafluoroethyl ether, and sevoflurane and the isomers of halothane and isoflurane into these potential binding sites. We found that the binding of the various VA molecules to the amphiphilic pockets is driven primarily by VDW interactions and to a lesser extent by weak hydrogen bonding and electrostatic interactions. In addition, the trend in Delta G binding values follows the Meyer-Overton rule. These results suggest that VA potencies are related to the VDW interactions between the VA ligand and protein target. It is likely that VA bind to sites with a high degree of solvent exclusion and aliphatic character because aliphatic residues provide favorable VDW contacts and weak hydrogen bond donors. Water molecules occupying these sites maintain pocket integrity, associate with the VA ligand, and diminish the unfavorable solvation enthalpy of the VA. Water molecules displaced into the bulk by the VA ligand may provide an additional favorable enthalpic contribution to VA binding. Anesthesia is a component of many health related procedures, the outcomes of which could be improved with a better understanding of the molecular targets and mechanisms of anesthetic action.

  18. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  19. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    PubMed

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  20. Regulation of CCL2 expression by an upstream TALE homeodomain protein-binding site that synergizes with the site created by the A-2578G SNP.

    PubMed

    Page, Stephen H; Wright, Edward K; Gama, Lucio; Clements, Janice E

    2011-01-01

    CC Chemokine Ligand 2 (CCL2) is a potent chemoattractant produced by macrophages and activated astrocytes during periods of inflammation within the central nervous system. Increased CCL2 expression is correlated with disease progression and severity, as observed in pulmonary tuberculosis, HCV-related liver disease, and HIV-associated dementia. The CCL2 distal promoter contains an A/G polymorphism at position -2578 and the homozygous -2578 G/G genotype is associated with increased CCL2 production and inflammation. However, the mechanisms that contribute to the phenotypic differences in CCL2 expression are poorly understood. We previously demonstrated that the -2578 G polymorphism creates a TALE homeodomain protein binding site (TALE binding site) for PREP1/PBX2 transcription factors. In this study, we identified the presence of an additional TALE binding site 22 bp upstream of the site created by the -2578 G polymorphism and demonstrated the synergistic effects of the two sites on the activation of the CCL2 promoter. Using chromatin immunoprecipitation (ChIP) assays, we demonstrated increased binding of the TALE proteins PREP1 and PBX2 to the -2578 G allele, and binding of IRF1 to both the A and G alleles. The presence of TALE binding sites that form inverted repeats within the -2578 G allele results in increased transcriptional activation of the CCL2 distal promoter while the presence of only the upstream TALE binding site within the -2578 A allele exerts repression of promoter activity.

  1. Factors governing the substitution of La3+ for Ca2+ and Mg2+ in metalloproteins: a DFT/CDM study.

    PubMed

    Dudev, Todor; Chang, Li-Ying; Lim, Carmay

    2005-03-23

    Trivalent lanthanide cations are extensively being used in biochemical experiments to probe various dication-binding sites in proteins; however, the factors governing the binding specificity of lanthanide cations for these binding sites remain unclear. Hence, we have performed systematic studies to evaluate the interactions between La3+ and model Ca2+ - and Mg2+ -binding sites using density functional theory combined with continuum dielectric methods. The calculations reveal the key factors and corresponding physical bases favoring the substitution of trivalent lanthanides for divalent Ca2+ and Mg2+ in holoproteins. Replacing Ca2+ or Mg2+ with La3+ is facilitated by (1) minimizing the solvent exposure and the flexibility of the metal-binding cavity, (2) freeing both carboxylate oxygen atoms of Asp/Glu side chains in the metal-binding site so that they could bind bidentately to La3+, (3) maximizing the number of metal-bound carboxylate groups in buried sites, but minimizing the number of metal-bound carboxylate groups in solvent-exposed sites, and (4) including an Asn/Gln side chain for sites lined with four Asp/Glu side chains. In proteins bound to both Mg2+ and Ca2+, La3+ would prefer to replace Ca2+, as compared to Mg2+. A second Mg2+-binding site with a net positive charge would hamper the Mg2+ --> La3+ exchange, as compared to the respective mononuclear site, although the La3+ substitution of the first native metal is more favorable than the second one. The findings of this work are in accord with available experimental data.

  2. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  3. Functional analysis of the EspR binding sites upstream of espR in Mycobacterium tuberculosis.

    PubMed

    Cao, Guangxiang; Howard, Susan T; Zhang, Peipei; Hou, Guihua; Pang, Xiuhua

    2013-11-01

    The ESX-1 secretion system exports substrate proteins into host cells and is crucial for the pathogenesis of Mycobacterium tuberculosis. EspR is one of the characterized transcriptional regulators that modulates the ESX-1 system by binding the conserved EspR binding sites in the promoter of espA, the encoding gene of EspA, which is also a substrate protein of the ESX-1 system and is required for the ESX-1 activity. EspR is autoregulatory and conserved EspR binding sites are present upstream of espR. In this study, we showed that these EspR sites had varying affinities for EspR, with site B being the strongest one. Point mutations of the DNA sequence at site B abolished binding of EspR to oligonucleotides containing site B alone or with other sites, further suggesting that site B is a major binding site for EspR. Complementation studies showed that constructs containing espR, and the upstream intergenic region fully restored espR expression in a ΔespR mutant strain. Although recombinant strains with mutations at more than one EspR site showed minimal differences in espR expression, reduced expression of other EspR target genes was observed, suggesting that slight changes in EspR levels can have downstream regulatory effects. These findings contribute to our understanding of the regulation of the ESX-1 system.

  4. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  5. Prostaglandin E and F2 alpha receptors in human myometrium during the menstrual cycle and in pregnancy and labor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Giannopoulos, G.; Jackson, K.; Kredentser, J.

    The binding of prostaglandins E1 and F2 alpha has been studied in the human myometrium and cervix during the menstrual cycle and in the myometrium of pregnant patients at term before and during labor. Tritium-labeled prostaglandin E1 and F2 alpha binding was saturable and reversible. Scatchard analysis of tritium-labeled prostaglandin E1 binding was linear, which suggests a single class of high-affinity binding sites with an estimated apparent equilibrium dissociation constant of 2.5 to 5.4 nmol/L and inhibitor affinities of 0.9, 273, 273, and 217 nmol/L for prostaglandins E2, A1, B1, and F2 alpha, respectively. Scatchard analysis of tritium-labeled prostaglandin F2more » alpha, binding was also linear, but the affinity of these binding sites was much lower, with an average dissociation constant of 50 nmol/L and inhibitor affinities of 1.6, 2.2, and 11.2 nmol/L for prostaglandins E1, E2, and A1, respectively. In nonpregnant patients, the concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were similar in the myometrium during the proliferative and secretory phases of the menstrual cycle, but the concentration of these sites was much lower in the cervix. The concentration of the tritium-labeled prostaglandin E1 binding sites was significantly lower in the myometrium of pregnant patients at term than in the myometrium of nonpregnant patients. The concentrations and affinities of tritium-labeled prostaglandin E1 binding sites were not significantly different in the upper and lower myometrium of pregnant patients at term or in the myometrium of such patients before and during labor. The concentrations of the tritium-labeled prostaglandin F2 alpha binding sites during the menstrual cycle and in pregnancy at term were similar to those of tritium-labeled prostaglandin E1 binding sites.« less

  6. A multiscale approach to simulating the conformational properties of unbound multi-C₂H₂ zinc finger proteins.

    PubMed

    Liu, Lei; Wade, Rebecca C; Heermann, Dieter W

    2015-09-01

    The conformational properties of unbound multi-Cys2 His2 (mC2H2) zinc finger proteins, in which zinc finger domains are connected by flexible linkers, are studied by a multiscale approach. Three methods on different length scales are utilized. First, atomic detail molecular dynamics simulations of one zinc finger and its adjacent flexible linker confirmed that the zinc finger is more rigid than the flexible linker. Second, the end-to-end distance distributions of mC2H2 zinc finger proteins are computed using an efficient atomistic pivoting algorithm, which only takes excluded volume interactions into consideration. The end-to-end distance distribution gradually changes its profile, from left-tailed to right-tailed, as the number of zinc fingers increases. This is explained by using a worm-like chain model. For proteins of a few zinc fingers, an effective bending constraint favors an extended conformation. Only for proteins containing more than nine zinc fingers, is a somewhat compacted conformation preferred. Third, a mesoscale model is modified to study both the local and the global conformational properties of multi-C2H2 zinc finger proteins. Simulations of the CCCTC-binding factor (CTCF), an important mC2H2 zinc finger protein for genome spatial organization, are presented. © 2015 Wiley Periodicals, Inc.

  7. Two classes of cholesterol binding sites for the β2AR revealed by thermostability and NMR.

    PubMed

    Gater, Deborah L; Saurel, Olivier; Iordanov, Iordan; Liu, Wei; Cherezov, Vadim; Milon, Alain

    2014-11-18

    Cholesterol binding to G protein-coupled receptors (GPCRs) and modulation of their activities in membranes is a fundamental issue for understanding their function. Despite the identification of cholesterol binding sites in high-resolution x-ray structures of the ?2 adrenergic receptor (β2AR) and other GPCRs, the binding affinity of cholesterol for this receptor and exchange rates between the free and bound cholesterol remain unknown. In this study we report the existence of two classes of cholesterol binding sites in β2AR. By analyzing the β2AR unfolding temperature in lipidic cubic phase (LCP) as a function of cholesterol concentration we observed high-affinity cooperative binding of cholesterol with sub-nM affinity constant. In contrast, saturation transfer difference (STD) NMR experiments revealed the existence of a second class of cholesterol binding sites, in fast exchange on the STD NMR timescale. Titration of the STD signal as a function of cholesterol concentration provided a lower limit of 100 mM for their dissociation constant. However, these binding sites are specific for both cholesterol and β2AR, as shown with control experiments using ergosterol and a control membrane protein (KpOmpA). We postulate that this specificity is mediated by the high-affinity bound cholesterol molecules and propose the formation of transient cholesterol clusters around the high-affinity binding sites.

  8. Prediction of the binding sites of huperzine A in acetylcholinesterase by docking studies

    NASA Astrophysics Data System (ADS)

    Pang, Yuan-Ping; Kozikowski, Alan P.

    1994-12-01

    We have performed docking studies with the SYSDOC program on acetylcholinesterase (AChE) to predict the binding sites in AChE of huperzine A (HA), which is a potent and selective, reversible inhibitor of AChE. The unique aspects of our docking studies include the following: (i) Molecular flexibility of the guest and the host is taken into account, which permits both to change their conformations upon binding. (ii) The binding energy is evaluated by a sum of energies of steric, electrostatic and hydrogen bonding interactions. In the energy calculation no grid approximation is used, and all hydrogen atoms of the system are treated explicitly. (iii) The energy of cation-π interactions between the guest and the host, which is important in the binding of AChE, is included in the calculated binding energy. (iv) Docking is performed in all regions of the host's binding cavity. Based on our docking studies and the pharmacological results reported for HA and its analogs, we predict that HA binds to the bottom of the binding cavity of AChE (the gorge) with its ammonium group interacting with Trp84, Phe330, Glu199 and Asp72 (catalytic site). At the the opening of the gorge with its ammonium group partially interacting with Trp279 (peripheral site). At the catalytic site, three partially overlapping subsites of HA were identified which might provide a dynamic view of binding of HA to the catalytic site.

  9. Stereoselective L-(3H)quinuclidinyl benzilate-binding sites in nervous tissue of Aplysia californica: evidence for muscarinic receptors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Murray, T.F.; Mpitsos, G.J.; Siebenaller, J.F.

    The muscarinic antagonist L-(/sup 3/H)quinuclidinyl benzilate (L-(/sup 3/H)QNB) binds with a high affinity (Kd = 0.77 nM) to a single population of specific sites (Bmax = 47 fmol/mg of protein) in nervous tissue of the gastropod mollusc, Aplysia. The specific L-(/sup 3/H)QNB binding is displaced stereoselectively by the enantiomers of benzetimide, dexetimide, and levetimide. The pharmacologically active enantiomer, dexetimide, is more potent than levetimide as an inhibitor of L-(/sup 3/H)QNB binding. Moreover, the muscarinic cholinergic ligands, scopolamine, atropine, oxotremorine, and pilocarpine are effective inhibitors of the specific L-(/sup 3/H)QNB binding, whereas nicotinic receptor antagonists, decamethonium and d-tubocurarine, are considerably lessmore » effective. These pharmacological characteristics of the L-(/sup 3/H)QNB-binding site provide evidence for classical muscarinic receptors in Aplysia nervous tissue. The physiological relevance of the dexetimide-displaceable L-(/sup 3/H)QNB-binding site was supported by the demonstration of the sensitivity of the specific binding to thermal denaturation. Specific binding of L-(/sup 3/H)QNB was also detected in nervous tissue of another marine gastropod, Pleurobranchaea californica. The characteristics of the Aplysia L-(/sup 3/H)QNB-binding site are in accordance with studies of numerous vertebrate and invertebrate tissues indicating that the muscarinic cholinergic receptor site has been highly conserved through evolution.« less

  10. Tyrosine411 and Arginine410 of Human Serum Albumin Play an Important Role in the Binding of Sodium 4-Phenylbutyrate to Site II.

    PubMed

    Enokida, Taisuke; Yamasaki, Keishi; Okamoto, Yuko; Taguchi, Kazuaki; Ishiguro, Takako; Maruyama, Toru; Seo, Hakaru; Otagiri, Masaki

    2016-06-01

    Sodium 4-phenylbutyrate (PB) has many pharmacological activities; therefore extending its clinical use to the treatment of a wider variety of diseases would be desirable. However, our knowledge of the binding of PB to plasma proteins is not extensive. To address this issue in more detail, we characterized the protein binding of PB. Binding experiments showed that PB mainly binds to human serum albumin (HSA) in plasma. PB was also found to bind to a single site on HSA, which was identified as site II by fluorescent probe displacement experiment. Furthermore, an appropriate alkyl chain length and a carboxylic group in the PB structure were required for PB binding to HSA, suggesting that hydrophobic (and van der Waals) and electrostatic interactions are involved as binding modes. The contributions of hydrogen bonding and/or van der Waals interactions were also indicated by thermodynamic analyses. Tyrosine411 and arginine410 were identified as being involved in the binding of PB to site II, based on binding experiments using chemically modified- and mutant-HSA preparations. In conclusion, the available evidence indicates that PB binds to site II of HSA with assistance by multiple forces and that tyrosine411 and arginine410 both play important roles in this phenomenon. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  11. Energetics and kinetics of cooperative cofilin-actin filament interactions.

    PubMed

    Cao, Wenxiang; Goodarzi, Jim P; De La Cruz, Enrique M

    2006-08-11

    We have evaluated the thermodynamic parameters associated with cooperative cofilin binding to actin filaments, accounting for contributions of ion-linked equilibria, and determined the kinetic basis of cooperative cofilin binding. Ions weaken non-contiguous (isolated, non-cooperative) cofilin binding to an actin filament without affecting cooperative filament interactions. Non-contiguous cofilin binding is coupled to the dissociation of approximately 1.7 thermodynamically bound counterions. Counterion dissociation contributes approximately 40% of the total cofilin binding free energy (in the presence of 50 mM KCl). The non-contiguous and cooperative binding free energies are driven entirely by large, positive entropy changes, consistent with a cofilin-mediated increase in actin filament structural dynamics. The rate constant for cofilin binding to an isolated site on an actin filament is slow and likely to be limited by filament breathing. Cooperative cofilin binding arises from an approximately tenfold more rapid association rate constant and an approximately twofold slower dissociation rate constant. The more rapid association rate constant is presumably a consequence of cofilin-dependent changes in the average orientation of subdomain 2, subunit angular disorder and filament twist, which increase the accessibility of a neighboring cofilin-binding site on an actin filament. Cooperative association is more rapid than binding to an isolated site, but still slow for a second-order reaction, suggesting that cooperative binding is limited also by binding site accessibility. We suggest that the dissociation of actin-associated ions weakens intersubunit interactions in the actin filament lattice that enhance cofilin-binding site accessibility, favor cooperative binding and promote filament severing.

  12. Structure, Function, and Evolution of Biogenic Amine-binding Proteins in Soft Ticks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mans, Ben J.; Ribeiro, Jose M.C.; Andersen, John F.

    2008-08-19

    Two highly abundant lipocalins, monomine and monotonin, have been isolated from the salivary gland of the soft tick Argas monolakensis and shown to bind histamine and 5-hydroxytryptamine (5-HT), respectively. The crystal structures of monomine and a paralog of monotonin were determined in the presence of ligands to compare the determinants of ligand binding. Both the structures and binding measurements indicate that the proteins have a single binding site rather than the two sites previously described for the female-specific histamine-binding protein (FS-HBP), the histamine-binding lipocalin of the tick Rhipicephalus appendiculatus. The binding sites of monomine and monotonin are similar to themore » lower, low affinity site of FS-HBP. The interaction of the protein with the aliphatic amine group of the ligand is very similar for the all of the proteins, whereas specificity is determined by interactions with the aromatic portion of the ligand. Interestingly, protein interaction with the imidazole ring of histamine differs significantly between the low affinity binding site of FS-HBP and monomine, suggesting that histamine binding has evolved independently in the two lineages. From the conserved features of these proteins, a tick lipocalin biogenic amine-binding motif could be derived that was used to predict biogenic amine-binding function in other tick lipocalins. Heterologous expression of genes from salivary gland libraries led to the discovery of biogenic amine-binding proteins in soft (Ornithodoros) and hard (Ixodes) tick genera. The data generated were used to reconstruct the most probable evolutionary pathway for the evolution of biogenic amine-binding in tick lipocalins.« less

  13. Anesthetic Binding in a Pentameric Ligand-Gated Ion Channel: GLIC

    PubMed Central

    Chen, Qiang; Cheng, Mary Hongying; Xu, Yan; Tang, Pei

    2010-01-01

    Cys-loop receptors are molecular targets of general anesthetics, but the knowledge of anesthetic binding to these proteins remains limited. Here we investigate anesthetic binding to the bacterial Gloeobacter violaceus pentameric ligand-gated ion channel (GLIC), a structural homolog of cys-loop receptors, using an experimental and computational hybrid approach. Tryptophan fluorescence quenching experiments showed halothane and thiopental binding at three tryptophan-associated sites in the extracellular (EC) domain, transmembrane (TM) domain, and EC-TM interface of GLIC. An additional binding site at the EC-TM interface was predicted by docking analysis and validated by quenching experiments on the N200W GLIC mutant. The binding affinities (KD) of 2.3 ± 0.1 mM and 0.10 ± 0.01 mM were derived from the fluorescence quenching data of halothane and thiopental, respectively. Docking these anesthetics to the original GLIC crystal structure and the structures relaxed by molecular dynamics simulations revealed intrasubunit sites for most halothane binding and intersubunit sites for thiopental binding. Tryptophans were within reach of both intra- and intersubunit binding sites. Multiple molecular dynamics simulations on GLIC in the presence of halothane at different sites suggested that anesthetic binding at the EC-TM interface disrupted the critical interactions for channel gating, altered motion of the TM23 linker, and destabilized the open-channel conformation that can lead to inhibition of GLIC channel current. The study has not only provided insights into anesthetic binding in GLIC, but also demonstrated a successful fusion of experiments and computations for understanding anesthetic actions in complex proteins. PMID:20858424

  14. ProBiS-ligands: a web server for prediction of ligands by examination of protein binding sites.

    PubMed

    Konc, Janez; Janežič, Dušanka

    2014-07-01

    The ProBiS-ligands web server predicts binding of ligands to a protein structure. Starting with a protein structure or binding site, ProBiS-ligands first identifies template proteins in the Protein Data Bank that share similar binding sites. Based on the superimpositions of the query protein and the similar binding sites found, the server then transposes the ligand structures from those sites to the query protein. Such ligand prediction supports many activities, e.g. drug repurposing. The ProBiS-ligands web server, an extension of the ProBiS web server, is open and free to all users at http://probis.cmm.ki.si/ligands. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. 1-3-A Resolution Structure of Human Glutathione S-Transferase With S-Hexyl Glutathione Bound Reveals Possible Extended Ligandin Binding Site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Trong, I.Le; Stenkamp, R.E.; Ibarra, C.

    2005-08-22

    Cytosolic glutathione S-transferases (GSTs) play a critical role in xenobiotic binding and metabolism, as well as in modulation of oxidative stress. Here, the high-resolution X-ray crystal structures of homodimeric human GSTA1-1 in the apo form and in complex with S-hexyl glutathione (two data sets) are reported at 1.8, 1.5, and 1.3A respectively. At this level of resolution, distinct conformations of the alkyl chain of S-hexyl glutathione are observed, reflecting the nonspecific nature of the hydrophobic substrate binding site (H-site). Also, an extensive network of ordered water, including 75 discrete solvent molecules, traverses the open subunit-subunit interface and connects the glutathionemore » binding sites in each subunit. In the highest-resolution structure, three glycerol moieties lie within this network and directly connect the amino termini of the glutathione molecules. A search for ligand binding sites with the docking program Molecular Operating Environment identified the ordered water network binding site, lined mainly with hydrophobic residues, suggesting an extended ligand binding surface for nonsubstrate ligands, the so-called ligandin site. Finally, detailed comparison of the structures reported here with previously published X-ray structures reveal a possible reaction coordinate for ligand-dependent conformational changes in the active site and the C-terminus.« less

  16. Characterizing multiple metal ion binding sites within a ribozyme by cadmium-induced EPR silencing

    PubMed Central

    Kisseleva, Natalia; Kraut, Stefanie; Jäschke, Andres; Schiemann, Olav

    2007-01-01

    In ribozyme catalysis, metal ions are generally known to make structural and∕or mechanistic contributions. The catalytic activity of a previously described Diels-Alderase ribozyme was found to depend on the concentration of divalent metal ions, and crystallographic data revealed multiple binding sites. Here, we elucidate the interactions of this ribozyme with divalent metal ions in solution using electron paramagnetic resonance (EPR) spectroscopy. Manganese ion titrations revealed five high-affinity Mn2+ binding sites with an upper Kd of 0.6±0.2 μM. In order to characterize each binding site individually, EPR-silent Cd2+ ions were used to saturate the other binding sites. This cadmium-induced EPR silencing showed that the Mn2+ binding sites possess different affinities. In addition, these binding sites could be assigned to three different types, including innersphere, outersphere, and a Mn2+ dimer. Based on simulations, the Mn2+-Mn2+ distance within the dimer was found to be ∼6 Å, which is in good agreement with crystallographic data. The EPR-spectroscopic characterization reveals no structural changes upon addition of a Diels-Alder product, supporting the concept of a preorganized catalytic pocket in the Diels-Alder ribozyme and the structural role of these ions. PMID:19404418

  17. Pharmacological characterization of the cloned kappa opioid receptor as a kappa 1b subtype.

    PubMed

    Lai, J; Ma, S W; Zhu, R H; Rothman, R B; Lentes, K U; Porreca, F

    1994-10-27

    Substantial pharmacological evidence in vitro and in vivo has suggested the existence of subtypes of the kappa opioid receptor. Quantitative radioligand binding techniques resolved the presence of two high affinity binding sites for the kappa 1 ligand [3H]U69,593 in mouse brain membranes, termed kappa 1a and kappa 1b, respectively. Whereas the kappa 1a site has high affinity for fedotozine and oxymorphindole and low affinity for bremazocine and alpha-neoendorphin, site kappa 1b has high affinity for bremazocine and alpha-neoendorphin and low affinity for fedotozine and oxymorphindole. CI-977 and U69,593 bind equally well at both sites. To determine the relationship between these kappa 1 receptor subtypes and the recently cloned mouse kappa 1 receptor (KOR), we examined [3H]U69,593 binding to the KOR in stably transfected cells (KORCHN-8). Competition of [3H]U69,593 binding to the KOR by bremazocine, alpha-neoendorphin, fedotozine and oxymorphindole resolved a single class of binding sites at which these agents had binding affinities similar to that of the kappa 1b site present in mouse brain. These results suggest that the cloned KOR corresponds to the kappa 1 site in mouse brain defined as kappa 1b.

  18. Anisotropic energy flow and allosteric ligand binding in albumin

    NASA Astrophysics Data System (ADS)

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  19. Anisotropic energy flow and allosteric ligand binding in albumin.

    PubMed

    Li, Guifeng; Magana, Donny; Dyer, R Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures.

  20. Anisotropic energy flow and allosteric ligand binding in albumin

    PubMed Central

    Li, Guifeng; Magana, Donny; Dyer, R. Brian

    2014-01-01

    Allosteric interactions in proteins generally involve propagation of local structural changes through the protein to a remote site. Anisotropic energy transport is thought to couple the remote sites, but the nature of this process is poorly understood. Here, we report the relationship between energy flow through the structure of bovine serum albumin and allosteric interactions between remote ligand binding sites of the protein. Ultrafast infrared spectroscopy is used to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic and anisotropic energy flow through the protein structure following input of thermal energy into the flexible ligand binding sites, without local heating of the rigid helix bundles that connect these sites. This efficient energy transport mechanism enables the allosteric propagation of binding energy through the connecting helix structures. PMID:24445265

  1. An Experimental and Theoretical Evaluation of Multi-site Cadmium(II) Exchange in Designed Three-Stranded Coiled Coil Peptides

    PubMed Central

    Chakraborty, Saumen; Iranzo, Olga; Zuiderweg, Erik R.P.; Pecoraro, Vincent L.

    2012-01-01

    An important factor that defines the toxicity of elements such as cadmium(II), mercury(II), and lead(II) with biological macromolecules is metal ion exchange dynamics. Intriguingly, little is known about the fundamental rates and mechanisms of metal ion exchange into proteins, especially helical bundles. Herein, we investigate the exchange kinetics of cadmium(II) using de novo designed three-stranded coiled coil peptides that contain metal complexing cysteine thiolates as a model for the incorporation of this ion into trimeric, parallel helical bundles. Peptides were designed containing both single cadmium(II) binding site, GrandL12AL16C [Grand=AcG-(LKALEEK)5-GNH2], GrandL26AL30C, and GrandL26AE28QL30C, as well as GrandL12AL16CL26AL30C with two cadmium(II) binding sites. The binding of cadmium(II) to any of these sites is of high affinity (KA > 3×107 M−1). Using 113Cd NMR spectroscopy, cadmium(II) binding to these designed peptides was monitored. While the cadmium(II) binding is in extreme slow exchange without showing any chemical shift changes, incremental line broadening for the bound 113cadmium(II) signal is observed when excess 113cadmium(II) is titrated into the peptides. Most dramatically, for one site, L26AL30C, all 113cadmium(II) NMR signals disappear once a 1.7:1 ratio of cadmium(II)/(peptide)3 is reached. The observed processes are not compatible with simple “free-bound” two-site exchange kinetics at any time regime. The experimental results can, however, be simulated in detail with a multi-site binding model, which features additional cadmium(II) binding site(s) which, once occupied, perturb the primary binding site. This model is expanded into differential equations for five-site NMR chemical exchange. The numerical integration of these equations exhibits progressive loss of the primary site NMR signal without a chemical shift change and with limited line broadening, in good agreement with the observed experimental data. The mathematical model is interpreted in molecular terms as representing binding of excess cadmium(II) to surface Glu residues located at the helical interfaces. In the absence of cadmium(II), the Glu residues stabilize the three-helical structure though salt bridge interactions with surface Lys residues. We hypothesize that cadmium(II) interferes with these surface ion pairs, destabilizing the helical structure, and perturbing the primary cadmium(II) binding site. This hypothesis is supported by the observation that the cadmium(II)-excess line broadening is attenuated in GrandL26AE28QL30C where a surface Glu(28), close to the metal binding site, was changed to Gln. The external binding site may function as an entry pathway for cadmium(II) to find its internal binding site following a molecular rearrangement which may serve as a basis for our understanding of metal complexation, transport and exchange in complex native systems containing α-helical bundles. PMID:22394049

  2. The crystal structure of the AgamOBP1•Icaridin complex reveals alternative binding modes and stereo-selective repellent recognition.

    PubMed

    Drakou, Christina E; Tsitsanou, Katerina E; Potamitis, Constantinos; Fessas, Dimitrios; Zervou, Maria; Zographos, Spyros E

    2017-01-01

    Anopheles gambiae Odorant Binding Protein 1 in complex with the most widely used insect repellent DEET, was the first reported crystal structure of an olfactory macromolecule with a repellent, and paved the way for OBP1-structure-based approaches for discovery of new host-seeking disruptors. In this work, we performed STD-NMR experiments to directly monitor and verify the formation of a complex between AgamOBP1 and Icaridin, an efficient DEET alternative. Furthermore, Isothermal Titration Calorimetry experiments provided evidence for two Icaridin-binding sites with different affinities (Kd = 0.034 and 0.714 mM) and thermodynamic profiles of ligand binding. To elucidate the binding mode of Icaridin, the crystal structure of AgamOBP1•Icaridin complex was determined at 1.75 Å resolution. We found that Icaridin binds to the DEET-binding site in two distinct orientations and also to a novel binding site located at the C-terminal region. Importantly, only the most active 1R,2S-isomer of Icaridin's equimolar diastereoisomeric mixture binds to the AgamOBP1 crystal, providing structural evidence for the possible contribution of OBP1 to the stereoselectivity of Icaridin perception in mosquitoes. Structural analysis revealed two ensembles of conformations differing mainly in spatial arrangement of their sec-butyl moieties. Moreover, structural comparison with DEET indicates a common recognition mechanism for these structurally related repellents. Ligand interactions with both sites and binding modes were further confirmed by 2D 1 H- 15 N HSQC NMR spectroscopy. The identification of a novel repellent-binding site in AgamOBP1 and the observed structural conservation and stereoselectivity of its DEET/Icaridin-binding sites open new perspectives for the OBP1-structure-based discovery of next-generation insect repellents.

  3. AF64A depletes hippocampal high-affinity choline uptake but does not alter the density of alpha-bungarotoxin binding sites or modify the effect of exogenous choline.

    PubMed

    Morley, B J; Garner, L L

    1990-06-11

    Sodium-dependent, high-affinity choline uptake (HACU) and the density of alpha-bungarotoxin (BuTX) receptor-binding sites were measured in the hippocampus following the intraventricular infusion of ethylcholine aziridinium ion (AF64A), a neurotoxin that competes with choline at high-affinity choline transport sites and may result in the degeneration of cholinergic axons. Eight days after the infusion of AF64A into the lateral ventricles (2.5 nmol/side), HACU was depleted by 60% in the hippocampus of experimental animals in comparison with controls, but the density of BuTX-binding sites was not altered. The administration of 15 mg/ml of choline chloride in the drinking water increased the density of BuTX-binding sites, as previously reported by this laboratory. The administration of AF64A did not prevent the effect of exogenous choline on the density of binding sites, nor did choline treatment alter the effect of AF64A on HACU. These data indicate that the density of BuTX-binding sites in the hippocampus is not altered following a substantial decrease in HACU and presumed degeneration of cholinergic axons. Since the effect of exogenous choline was not prevented by AF64A treatment, the data are interpreted to support the hypothesis that the increase in the density of BuTX-binding sites following dietary choline supplementation is attributable to a direct effect of choline on receptor sites.

  4. Circular dichroism study of the interaction between mutagens and bilirubin bound to different binding sites of serum albumins

    NASA Astrophysics Data System (ADS)

    Orlov, Sergey; Goncharova, Iryna; Urbanová, Marie

    Although recent investigations have shown that bilirubin not only has a negative role in the organism but also exhibits significant antimutagenic properties, the mechanisms of interactions between bilirubin and mutagens are not clear. In this study, interaction between bilirubin bound to different binding sites of mammalian serum albumins with structural analogues of the mutagens 2-aminofluorene, 2,7-diaminofluorene and mutagen 2,4,7-trinitrofluorenone were investigated by circular dichroism and absorption spectroscopy. Homological human and bovine serum albumins were used as chiral matrices, which preferentially bind different conformers of bilirubin in the primary binding sites and make it observable by circular dichroism. These molecular systems approximated a real system for the study of mutagens in blood serum. Differences between the interaction of bilirubin bound to primary and to secondary binding sites of serum albumins with mutagens were shown. For bilirubin bound to secondary binding sites with low affinity, partial displacement and the formation of self-associates were observed in all studied mutagens. The associates of bilirubin bound to primary binding sites of serum albumins are formed with 2-aminofluorene and 2,4,7-trinitrofluorenone. It was proposed that 2,7-diaminofluorene does not interact with bilirubin bound to primary sites of human and bovine serum albumins due to the spatial hindrance of the albumins binding domains. The spatial arrangement of the bilirubin bound to serum albumin along with the studied mutagens was modelled using ligand docking, which revealed a possibility of an arrangement of the both bilirubin and 2-aminofluorene and 2,4,7-trinitrofluorenone in the primary binding site of human serum albumin.

  5. Genome-Wide Motif Statistics are Shaped by DNA Binding Proteins over Evolutionary Time Scales

    NASA Astrophysics Data System (ADS)

    Qian, Long; Kussell, Edo

    The composition of genomes with respect to short DNA motifs impacts the ability of DNA binding proteins to locate and bind their target sites. Since nonfunctional DNA binding can be detrimental to cellular functions and ultimately to organismal fitness, organisms could benefit from reducing the number of nonfunctional binding sites genome wide. Using in vitro measurements of binding affinities for a large collection of DNA binding proteins, in multiple species, we detect a significant global avoidance of weak binding sites in genomes. The underlying evolutionary process leaves a distinct genomic hallmark in that similar words have correlated frequencies, which we detect in all species across domains of life. We hypothesize that natural selection against weak binding sites contributes to this process, and using an evolutionary model we show that the strength of selection needed to maintain global word compositions is on the order of point mutation rates. Alternative contributions may come from interference of protein-DNA binding with replication and mutational repair processes, which operates with similar rates. We conclude that genome-wide word compositions have been molded by DNA binding proteins through tiny evolutionary steps over timescales spanning millions of generations.

  6. Multi-Mode Binding of Cellobiohydrolase Cel7A from Trichoderma reesei to Cellulose

    PubMed Central

    Jalak, Jürgen; Väljamäe, Priit

    2014-01-01

    Enzymatic hydrolysis of recalcitrant polysaccharides like cellulose takes place on the solid-liquid interface. Therefore the adsorption of enzymes to the solid surface is a pre-requisite for catalysis. Here we used enzymatic activity measurements with fluorescent model-substrate 4-methyl-umbelliferyl-β-D-lactoside for sensitive monitoring of the binding of cellobiohydrolase TrCel7A from Trichoderma reesei to bacterial cellulose (BC). The binding at low nanomolar free TrCel7A concentrations was exclusively active site mediated and was consistent with Langmuir's one binding site model with K d and A max values of 2.9 nM and 126 nmol/g BC, respectively. This is the strongest binding observed with non-complexed cellulases and apparently represents the productive binding of TrCel7A to cellulose chain ends on the hydrophobic face of BC microfibril. With increasing free TrCel7A concentrations the isotherm gradually deviated from the Langmuir's one binding site model. This was caused by the increasing contribution of lower affinity binding modes that included both active site mediated binding and non-productive binding with active site free from cellulose chain. The binding of TrCel7A to BC was found to be only partially reversible. Furthermore, the isotherm was dependent on the concentration of BC with more efficient binding observed at lower BC concentrations. The phenomenon can be ascribed to the BC concentration dependent aggregation of BC microfibrils with concomitant reduction of specific surface area. PMID:25265511

  7. Concentration-Dependent Multiple Binding Sites on Saliva-Treated Hydroxyapatite for Streptococcus sanguis

    PubMed Central

    Gibbons, R. J.; Moreno, E. C.; Etherden, I.

    1983-01-01

    The influence of bacterial cell concentration on estimates of the number of binding sites and the affinity for the adsorption of a strain of Streptococcus sanguis to saliva-treated hydroxyapatite was determined, and the possible presence of multiple binding sites for this organism was tested. The range of concentrations of available bacteria varied from 4.7 × 106 to 5,960 × 106 cells per ml. The numbers of adsorbed bacteria increased over the entire range tested, but a suggestion of a break in an otherwise smooth adsorption isotherm was evident. Values for the number of binding sites and the affinity varied considerably depending upon the range of available bacterial concentrations used to estimate them; high correlation coefficients were obtained in all cases. The use of low bacterial cell concentrations yielded lower values for the number of sites and much higher values for the affinity constant than did the use of high bacterial cell concentrations. When data covering the entire range of bacterial concentrations were employed, values for the number of sites and the affinity were similar to those obtained by using only high bacterial cell concentrations. The simplest explanation for these results is that there are multiple binding sites for S. sanguis on saliva-treated hydroxyapatite surfaces. When present in low concentration, the streptococci evidently attach to more specific high-affinity sites which become saturated when higher bacterial concentrations are employed. The possibility of multiple binding sites was substantiated by comparing estimates of the adsorption parameters from a computer-simulated isotherm with those derived from the experimentally generated isotherm. A mathematical model describing bacterial adsorption to binary binding sites was further evidence for the existence of at least two classes of binding sites for S. sanguis. Far fewer streptococci adsorbed to experimental pellicles prepared from saliva depleted of bacterial aggregating activity when low numbers of streptococci were used, but the magnitude of this difference was considerably less when high streptococcal concentrations were employed. This suggests an association between salivary components which possess bacterial-aggregating activity and bacterial adsorption to high-affinity specific binding sites on saliva-treated hydroxyapatite surfaces. PMID:6822416

  8. Ropizine concurrently enhances and inhibits ( sup 3 H) dextromethorpan binding to different structures of the guinea pig brain: Autoradiographic evidence for multiple binding sites

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Canoll, P.D.; Smith, P.R.; and Musacchio, J.M.

    1990-01-01

    Ropizine produces a simultaneous enhancement and inhibition of ({sup 3}H) dextromethorphan (DM) high-affinity binding to different areas of the guinea pig brain. These results imply that there are two distinct types of high-affinity ({sup 3}H)DM binding sites, which are present in variable proportions in different brain structures. The ropizine-enhances ({sup 3}H)DM binding type was preferentially inhibited by (+)-pentazocine. This is consistent with the presumption that the (+)-pentazocine-sensitive site is identical with the common site for DM and 3-(-3-Hydroxphenyl)-N-(1-propyl)piperidine ((+)-3-PPP). The second binding type, which is inhibited by ropizine and is not so sensitive to (+){minus} pentazocine, has not been fullymore » characterized. This study demonstrates that the biphasic effects to ropizine are due, at least in part, to the effects of ropizine on two different types of ({sup 3}H)DM binding sites. However, this study does not rule out that the common DM/(+)-3-PPP site also might be inhibited by higher concentrations of ropizine.« less

  9. The Structural Basis of ATP as an Allosteric Modulator

    PubMed Central

    Wang, Qi; Shen, Qiancheng; Li, Shuai; Nussinov, Ruth; Zhang, Jian

    2014-01-01

    Adenosine-5’-triphosphate (ATP) is generally regarded as a substrate for energy currency and protein modification. Recent findings uncovered the allosteric function of ATP in cellular signal transduction but little is understood about this critical behavior of ATP. Through extensive analysis of ATP in solution and proteins, we found that the free ATP can exist in the compact and extended conformations in solution, and the two different conformational characteristics may be responsible for ATP to exert distinct biological functions: ATP molecules adopt both compact and extended conformations in the allosteric binding sites but conserve extended conformations in the substrate binding sites. Nudged elastic band simulations unveiled the distinct dynamic processes of ATP binding to the corresponding allosteric and substrate binding sites of uridine monophosphate kinase, and suggested that in solution ATP preferentially binds to the substrate binding sites of proteins. When the ATP molecules occupy the allosteric binding sites, the allosteric trigger from ATP to fuel allosteric communication between allosteric and functional sites is stemmed mainly from the triphosphate part of ATP, with a small number from the adenine part of ATP. Taken together, our results provide overall understanding of ATP allosteric functions responsible for regulation in biological systems. PMID:25211773

  10. Using 15N-Ammonium to Characterise and Map Potassium Binding Sites in Proteins by NMR Spectroscopy

    PubMed Central

    Werbeck, Nicolas D; Kirkpatrick, John; Reinstein, Jochen; Hansen, D Flemming

    2014-01-01

    A variety of enzymes are activated by the binding of potassium ions. The potassium binding sites of these enzymes are very specific, but ammonium ions can often replace potassium ions in vitro because of their similar ionic radii. In these cases, ammonium can be used as a proxy for potassium to characterise potassium binding sites in enzymes: the 1H,15N spin-pair of enzyme-bound 15NH4+ can be probed by 15N-edited heteronuclear NMR experiments. Here, we demonstrate the use of NMR spectroscopy to characterise binding of ammonium ions to two different enzymes: human histone deacetylase 8 (HDAC8), which is activated allosterically by potassium, and the bacterial Hsp70 homologue DnaK, for which potassium is an integral part of the active site. Ammonium activates both enzymes in a similar way to potassium, thus supporting this non-invasive approach. Furthermore, we present an approach to map the observed binding site onto the structure of HDAC8. Our method for mapping the binding site is general and does not require chemical shift assignment of the enzyme resonances. PMID:24520048

  11. Organizational requirements of the SaeR binding sites for a functional P1 promoter of the sae operon in Staphylococcus aureus.

    PubMed

    Cho, Hoonsik; Jeong, Do-Won; Li, Chunling; Bae, Taeok

    2012-06-01

    In Staphylococcus aureus, the SaeRS two-component system controls the expression of multiple virulence factors. Of the two promoters in the sae operon, P1 is autoinduced and has two binding sites for the response regulator SaeR. In this study, we examined the organizational requirements of the SaeR binding sites in P1 for transcription activation. Mutational studies showed that both binding sites are essential for binding to phosphorylated SaeR (P-SaeR) and transcription activation. When the 21-bp distance between the centers of the two SaeR binding sites was altered to 26 bp, 31 bp, 36 bp, or 41 bp, only the 31-bp mutant retained approximately 40% of the original promoter activity. When the -1-bp spacing (i.e.,1-bp overlap) between the primary SaeR binding site and the -35 promoter region was altered, all mutant P1 promoters failed to initiate transcription; however, when the first nucleotide of the -35 region was changed from A to T, the mutants with 0-bp or 22-bp spacing showed detectable promoter activity. Although P-SaeR was essential for the binding of RNA polymerase to P1, it was not essential for the binding of the enzyme to the alpha-hemolysin promoter. When the nonoptimal spacing between promoter elements in P1 or the coagulase promoter was altered to the optimal spacing of 17 bp, both promoters failed to initiate transcription. These results suggest that SaeR binding sites are under rather strict organizational restrictions and provide clues for understanding the molecular mechanism of sae-mediated transcription activation.

  12. Human antibody recognition of antigenic site IV on Pneumovirus fusion proteins.

    PubMed

    Mousa, Jarrod J; Binshtein, Elad; Human, Stacey; Fong, Rachel H; Alvarado, Gabriela; Doranz, Benjamin J; Moore, Martin L; Ohi, Melanie D; Crowe, James E

    2018-02-01

    Respiratory syncytial virus (RSV) is a major human pathogen that infects the majority of children by two years of age. The RSV fusion (F) protein is a primary target of human antibodies, and it has several antigenic regions capable of inducing neutralizing antibodies. Antigenic site IV is preserved in both the pre-fusion and post-fusion conformations of RSV F. Antibodies to antigenic site IV have been described that bind and neutralize both RSV and human metapneumovirus (hMPV). To explore the diversity of binding modes at antigenic site IV, we generated a panel of four new human monoclonal antibodies (mAbs) and competition-binding suggested the mAbs bind at antigenic site IV. Mutagenesis experiments revealed that binding and neutralization of two mAbs (3M3 and 6F18) depended on arginine (R) residue R429. We discovered two R429-independent mAbs (17E10 and 2N6) at this site that neutralized an RSV R429A mutant strain, and one of these mAbs (17E10) neutralized both RSV and hMPV. To determine the mechanism of cross-reactivity, we performed competition-binding, recombinant protein mutagenesis, peptide binding, and electron microscopy experiments. It was determined that the human cross-reactive mAb 17E10 binds to RSV F with a binding pose similar to 101F, which may be indicative of cross-reactivity with hMPV F. The data presented provide new concepts in RSV immune recognition and vaccine design, as we describe the novel idea that binding pose may influence mAb cross-reactivity between RSV and hMPV. Characterization of the site IV epitope bound by human antibodies may inform the design of a pan-Pneumovirus vaccine.

  13. Elimination of a ligand gating site generates a supersensitive olfactory receptor.

    PubMed

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I

    2016-06-21

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors.

  14. Elimination of a ligand gating site generates a supersensitive olfactory receptor

    PubMed Central

    Sharma, Kanika; Ahuja, Gaurav; Hussain, Ashiq; Balfanz, Sabine; Baumann, Arnd; Korsching, Sigrun I.

    2016-01-01

    Olfaction poses one of the most complex ligand-receptor matching problems in biology due to the unparalleled multitude of odor molecules facing a large number of cognate olfactory receptors. We have recently deorphanized an olfactory receptor, TAAR13c, as a specific receptor for the death-associated odor cadaverine. Here we have modeled the cadaverine/TAAR13c interaction, exchanged predicted binding residues by site-directed mutagenesis, and measured the activity of the mutant receptors. Unexpectedly we observed a binding site for cadaverine at the external surface of the receptor, in addition to an internal binding site, whose mutation resulted in complete loss of activity. In stark contrast, elimination of the external binding site generated supersensitive receptors. Modeling suggests this site to act as a gate, limiting access of the ligand to the internal binding site and thereby downregulating the affinity of the native receptor. This constitutes a novel mechanism to fine-tune physiological sensitivity to socially relevant odors. PMID:27323929

  15. An unexpected phosphate binding site in Glyceraldehyde 3-Phosphate Dehydrogenase: Crystal structures of apo, holo and ternary complex of Cryptosporidium parvum enzyme

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cook, William J; Senkovich, Olga; Chattopadhyay, Debasish

    2009-06-08

    The structure, function and reaction mechanism of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) have been extensively studied. Based on these studies, three anion binding sites have been identified, one 'Ps' site (for binding the C-3 phosphate of the substrate) and two sites, 'Pi' and 'new Pi', for inorganic phosphate. According to the original flip-flop model, the substrate phosphate group switches from the 'Pi' to the 'Ps' site during the multistep reaction. In light of the discovery of the 'new Pi' site, a modified flip-flop mechanism, in which the C-3 phosphate of the substrate binds to the 'new Pi' site and flips tomore » the 'Ps' site before the hydride transfer, was proposed. An alternative model based on a number of structures of B. stearothermophilus GAPDH ternary complexes (non-covalent and thioacyl intermediate) proposes that in the ternary Michaelis complex the C-3 phosphate binds to the 'Ps' site and flips from the 'Ps' to the 'new Pi' site during or after the redox step. We determined the crystal structure of Cryptosporidium parvum GAPDH in the apo and holo (enzyme + NAD) state and the structure of the ternary enzyme-cofactor-substrate complex using an active site mutant enzyme. The C. parvum GAPDH complex was prepared by pre-incubating the enzyme with substrate and cofactor, thereby allowing free movement of the protein structure and substrate molecules during their initial encounter. Sulfate and phosphate ions were excluded from purification and crystallization steps. The quality of the electron density map at 2{angstrom} resolution allowed unambiguous positioning of the substrate. In three subunits of the homotetramer the C-3 phosphate group of the non-covalently bound substrate is in the 'new Pi' site. A concomitant movement of the phosphate binding loop is observed in these three subunits. In the fourth subunit the C-3 phosphate occupies an unexpected site not seen before and the phosphate binding loop remains in the substrate-free conformation. Orientation of the substrate with respect to the active site histidine and serine (in the mutant enzyme) also varies in different subunits. The structures of the C. parvum GAPDH ternary complex and other GAPDH complexes demonstrate the plasticity of the substrate binding site. We propose that the active site of GAPDH can accommodate the substrate in multiple conformations at multiple locations during the initial encounter. However, the C-3 phosphate group clearly prefers the 'new Pi' site for initial binding in the active site.« less

  16. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  17. Kinetic and Spectroscopic Studies of Bicupin Oxalate Oxidase and Putative Active Site Mutants

    PubMed Central

    Moomaw, Ellen W.; Hoffer, Eric; Moussatche, Patricia; Salerno, John C.; Grant, Morgan; Immelman, Bridget; Uberto, Richard; Ozarowski, Andrew; Angerhofer, Alexander

    2013-01-01

    Ceriporiopsis subvermispora oxalate oxidase (CsOxOx) is the first bicupin enzyme identified that catalyzes manganese-dependent oxidation of oxalate. In previous work, we have shown that the dominant contribution to catalysis comes from the monoprotonated form of oxalate binding to a form of the enzyme in which an active site carboxylic acid residue must be unprotonated. CsOxOx shares greatest sequence homology with bicupin microbial oxalate decarboxylases (OxDC) and the 241-244DASN region of the N-terminal Mn binding domain of CsOxOx is analogous to the lid region of OxDC that has been shown to determine reaction specificity. We have prepared a series of CsOxOx mutants to probe this region and to identify the carboxylate residue implicated in catalysis. The pH profile of the D241A CsOxOx mutant suggests that the protonation state of aspartic acid 241 is mechanistically significant and that catalysis takes place at the N-terminal Mn binding site. The observation that the D241S CsOxOx mutation eliminates Mn binding to both the N- and C- terminal Mn binding sites suggests that both sites must be intact for Mn incorporation into either site. The introduction of a proton donor into the N-terminal Mn binding site (CsOxOx A242E mutant) does not affect reaction specificity. Mutation of conserved arginine residues further support that catalysis takes place at the N-terminal Mn binding site and that both sites must be intact for Mn incorporation into either site. PMID:23469254

  18. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  19. 2-(/sup 125/I)iodomelatonin binding sites in hamster brain membranes: pharmacological characteristics and regional distribution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Duncan, M.J.; Takahashi, J.S.; Dubocovich, M.L.

    1988-05-01

    Studies in a variety of seasonally breeding mammals have shown that melatonin mediates photoperiodic effects on reproduction. Relatively little is known, however, about the site(s) or mechanisms of action of this hormone for inducing reproductive effects. Although binding sites for (3H)melatonin have been reported previously in bovine, rat, and hamster brain, the pharmacological selectivity of these sites was never demonstrated. In the present study, we have characterized binding sites for a new radioligand, 2-(125I)iodomelatonin, in brains from a photoperiodic species, the Syrian hamster. 2-(125I)Iodomelatonin labels a high affinity binding site in hamster brain membranes. Specific binding of 2-(125I)iodomelatonin is rapid,more » stable, saturable, and reversible. Saturation studies demonstrated that 2-(125I)iodomelatonin binds to a single class of sites with an affinity constant (Kd) of 3.3 +/- 0.5 nM and a total binding capacity (Bmax) of 110.2 +/- 13.4 fmol/mg protein (n = 4). The Kd value determined from kinetic analysis (3.1 +/- 0.9 nM; n = 5) was very similar to that obtained from saturation experiments. Competition experiments showed that the relative order of potency of a variety of indoles for inhibition of 2-(125I)iodomelatonin binding site to hamster brain membranes was as follows: 6-chloromelatonin greater than or equal to 2-iodomelatonin greater than N-acetylserotonin greater than or equal to 6-methoxymelatonin greater than or equal to melatonin greater than 6-hydroxymelatonin greater than or equal to 6,7-dichloro-2-methylmelatonin greater than 5-methoxytryptophol greater than 5-methoxytryptamine greater than or equal to 5-methoxy-N,N-dimethyltryptamine greater than N-acetyltryptamine greater than serotonin greater than 5-methoxyindole (inactive).« less

  20. Purification of L-( sup 3 H) Nicotine eliminates low affinity binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Romm, E.; Marks, M.J.; Collins, A.C.

    1990-01-01

    Some studies of L-({sup 3}H) nicotine binding to rodent and human brain tissue have detected two binding sites as evidenced by nonlinear Scatchard plots. Evidence presented here indicated that the low affinity binding site is not stereospecific, is not inhibited by low concentrations of cholinergic agonists and is probably due to breakdown products of nicotine since purification of the L-({sup 3}H)nicotine eliminates the low affinity site.

  1. Binding of (/sup 3/H)Forskolin to rat brain membranes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Seamon, K.B.; Vaillancourt, R.; Edwards, M.

    1984-08-01

    (12-/sup 3/H)Forskolin (27 Ci/mmol) has been used to study binding sites in rat brain tissue by using both centrifugation and filtration assays. The binding isotherm measured in the presence of 5 mM MgCl/sub 2/ by using the centrifugation assay is described best by a two-site model: K/sub d1/ = 15 nM, B/sub max/sub 1// (maximal binding) = 270 fmol/mg of protein; K/sub d2/ = 1.1 ..mu..M; B/sub max/sub 2// = 4.2 pmol/mg of protein. Only the high-affinity binding sites are detected when the binding is determined by using a filtration assay; K/sub d/ = 26 nM, B/sub max/ = 400more » fmol/mg of protein. Analogs of forskolin that do not activate adenylate cyclase (EC 4.6.1.1) do not compete effectively for (/sup 3/H)forskolin binding sites. Analogs of forskolin that are less potent than forskolin in activating adenylate cyclase are also less potent in competing for forskolin binding sites. The presence of 5 mM MgCl/sub 2/ or MnCl/sub 2/ was found to enhance binding. In the presence of 1 mM EDTA the amount of high-affinity binding is reduced to 110 fmol/mg of protein with no change in K/sub d/. There is no effect of CaCl/sub 2/ (20 mM) or NaCl (100 mM) on the binding. No high-affinity binding can be detected in membranes from ram sperm, which contains an adenylate cyclase that is not activated by forskolin. It is proposed that the high-affinity binding sites for forskolin are associated with the activated complex of catalytic subunit and stimulatory guanine nucleotide binding protein. 23 references, 5 figures, 2 tables.« less

  2. Biophysical Fitness Landscapes for Transcription Factor Binding Sites

    PubMed Central

    Haldane, Allan; Manhart, Michael; Morozov, Alexandre V.

    2014-01-01

    Phenotypic states and evolutionary trajectories available to cell populations are ultimately dictated by complex interactions among DNA, RNA, proteins, and other molecular species. Here we study how evolution of gene regulation in a single-cell eukaryote S. cerevisiae is affected by interactions between transcription factors (TFs) and their cognate DNA sites. Our study is informed by a comprehensive collection of genomic binding sites and high-throughput in vitro measurements of TF-DNA binding interactions. Using an evolutionary model for monomorphic populations evolving on a fitness landscape, we infer fitness as a function of TF-DNA binding to show that the shape of the inferred fitness functions is in broad agreement with a simple functional form inspired by a thermodynamic model of two-state TF-DNA binding. However, the effective parameters of the model are not always consistent with physical values, indicating selection pressures beyond the biophysical constraints imposed by TF-DNA interactions. We find little statistical support for the fitness landscape in which each position in the binding site evolves independently, indicating that epistasis is common in the evolution of gene regulation. Finally, by correlating TF-DNA binding energies with biological properties of the sites or the genes they regulate, we are able to rule out several scenarios of site-specific selection, under which binding sites of the same TF would experience different selection pressures depending on their position in the genome. These findings support the existence of universal fitness landscapes which shape evolution of all sites for a given TF, and whose properties are determined in part by the physics of protein-DNA interactions. PMID:25010228

  3. SP transcription factor paralogs and DNA-binding sites coevolve and adaptively converge in mammals and birds.

    PubMed

    Yokoyama, Ken Daigoro; Pollock, David D

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins.

  4. SP Transcription Factor Paralogs and DNA-Binding Sites Coevolve and Adaptively Converge in Mammals and Birds

    PubMed Central

    Yokoyama, Ken Daigoro; Pollock, David D.

    2012-01-01

    Functional modification of regulatory proteins can affect hundreds of genes throughout the genome, and is therefore thought to be almost universally deleterious. This belief, however, has recently been challenged. A potential example comes from transcription factor SP1, for which statistical evidence indicates that motif preferences were altered in eutherian mammals. Here, we set out to discover possible structural and theoretical explanations, evaluate the role of selection in SP1 evolution, and discover effects on coregulatory proteins. We show that SP1 motif preferences were convergently altered in birds as well as mammals, inducing coevolutionary changes in over 800 regulatory regions. Structural and phylogenic evidence implicates a single causative amino acid replacement at the same SP1 position along both lineages. Furthermore, paralogs SP3 and SP4, which coregulate SP1 target genes through competitive binding to the same sites, have accumulated convergent replacements at the homologous position multiple times during eutherian and bird evolution, presumably to preserve competitive binding. To determine plausibility, we developed and implemented a simple model of transcription factor and binding site coevolution. This model predicts that, in contrast to prevailing beliefs, even small selective benefits per locus can drive concurrent fixation of transcription factor and binding site mutants under a broad range of conditions. Novel binding sites tend to arise de novo, rather than by mutation from ancestral sites, a prediction substantiated by SP1-binding site alignments. Thus, multiple lines of evidence indicate that selection has driven convergent evolution of transcription factors along with their binding sites and coregulatory proteins. PMID:23019068

  5. Nucleotide-dependent bisANS binding to tubulin.

    PubMed

    Chakraborty, S; Sarkar, N; Bhattacharyya, B

    1999-07-13

    Non-covalent hydrophobic probes such as 5, 5'-bis(8-anilino-1-naphthalenesulfonate) (bisANS) have become increasingly popular to gain information about protein structure and conformation. However, there are limitations as bisANS binds non-specifically at multiple sites of many proteins. Successful use of this probe depends upon the development of binding conditions where only specific dye-protein interaction will occur. In this report, we have shown that the binding of bisANS to tubulin occurs instantaneously, specifically at one high affinity site when 1 mM guanosine 5'-triphosphate (GTP) is included in the reaction medium. Substantial portions of protein secondary structure and colchicine binding activity of tubulin are lost upon bisANS binding in absence of GTP. BisANS binding increases with time and occurs at multiple sites in the absence of GTP. Like GTP, other analogs, guanosine 5'-diphosphate, guanosine 5'-monophosphate and adenosine 5'-triphosphate, also displace bisANS from the lower affinity sites of tubulin. We believe that these multiple binding sites are generated due to the bisANS-induced structural changes on tubulin and the presence of GTP and other nucleotides protect those structural changes.

  6. Ancestry-Shift Refinement Mapping of the C6orf97-ESR1 Breast Cancer Susceptibility Locus

    PubMed Central

    Stacey, Simon N.; Sulem, Patrick; Zanon, Carlo; Gudjonsson, Sigurjon A.; Thorleifsson, Gudmar; Helgason, Agnar; Jonasdottir, Aslaug; Besenbacher, Soren; Kostic, Jelena P.; Fackenthal, James D.; Huo, Dezheng; Adebamowo, Clement; Ogundiran, Temidayo; Olson, Janet E.; Fredericksen, Zachary S.; Wang, Xianshu; Look, Maxime P.; Sieuwerts, Anieta M.; Martens, John W. M.; Pajares, Isabel; Garcia-Prats, Maria D.; Ramon-Cajal, Jose M.; de Juan, Ana; Panadero, Angeles; Ortega, Eugenia; Aben, Katja K. H.; Vermeulen, Sita H.; Asadzadeh, Fatemeh; van Engelenburg, K. C. Anton; Margolin, Sara; Shen, Chen-Yang; Wu, Pei-Ei; Försti, Asta; Lenner, Per; Henriksson, Roger; Johansson, Robert; Enquist, Kerstin; Hallmans, Göran; Jonsson, Thorvaldur; Sigurdsson, Helgi; Alexiusdottir, Kristin; Gudmundsson, Julius; Sigurdsson, Asgeir; Frigge, Michael L.; Gudmundsson, Larus; Kristjansson, Kristleifur; Halldorsson, Bjarni V.; Styrkarsdottir, Unnur; Gulcher, Jeffrey R.; Hemminki, Kari; Lindblom, Annika; Kiemeney, Lambertus A.; Mayordomo, Jose I.; Foekens, John A.; Couch, Fergus J.; Olopade, Olufunmilayo I.; Gudbjartsson, Daniel F.; Thorsteinsdottir, Unnur; Rafnar, Thorunn; Johannsson, Oskar T.; Stefansson, Kari

    2010-01-01

    We used an approach that we term ancestry-shift refinement mapping to investigate an association, originally discovered in a GWAS of a Chinese population, between rs2046210[T] and breast cancer susceptibility. The locus is on 6q25.1 in proximity to the C6orf97 and estrogen receptor α (ESR1) genes. We identified a panel of SNPs that are correlated with rs2046210 in Chinese, but not necessarily so in other ancestral populations, and genotyped them in breast cancer case∶control samples of Asian, European, and African origin, a total of 10,176 cases and 13,286 controls. We found that rs2046210[T] does not confer substantial risk of breast cancer in Europeans and Africans (OR = 1.04, P = 0.099, and OR = 0.98, P = 0.77, respectively). Rather, in those ancestries, an association signal arises from a group of less common SNPs typified by rs9397435. The rs9397435[G] allele was found to confer risk of breast cancer in European (OR = 1.15, P = 1.2×10−3), African (OR = 1.35, P = 0.014), and Asian (OR = 1.23, P = 2.9×10−4) population samples. Combined over all ancestries, the OR was 1.19 (P = 3.9×10−7), was without significant heterogeneity between ancestries (Phet = 0.36) and the SNP fully accounted for the association signal in each ancestry. Haplotypes bearing rs9397435[G] are well tagged by rs2046210[T] only in Asians. The rs9397435[G] allele showed associations with both estrogen receptor positive and estrogen receptor negative breast cancer. Using early-draft data from the 1,000 Genomes project, we found that the risk allele of a novel SNP (rs77275268), which is closely correlated with rs9397435, disrupts a partially methylated CpG sequence within a known CTCF binding site. These studies demonstrate that shifting the analysis among ancestral populations can provide valuable resolution in association mapping. PMID:20661439

  7. Increased expression of brother of the regulator of imprinted sites in peripheral blood neutrophils is associated with both benign and malignant breast lesions.

    PubMed

    El-Sharkawy, Nahla M; Radwan, Wafaa M; Essa, Enas S; Kandeel, Eman Z; Abd El-Fattah, Eman K; Kandil, Samia H; Kamel, Azza M

    2017-09-01

    BORIS, a paralog of the multifunctional CCCTC-binding factor (CTCF) gene is restricted to testis and normally not present in females. It is aberrantly activated in various human cancers including cancer breast. Using immunohistochemistry, western blot and/or RT-PCR, significantly higher levels of BORIS expression were reported in the neutrophils of cancer breast patients. We hypothesized that Flow Cytometry might be a better technique for objective quantitative evaluation of BORIS in neutrophils and we wanted to investigate if BORIS would discriminate between benign and malignant breast lesions. The study included 85 females; 52 breast cancer, 13 benign breast lesions and 20 age-matched healthy controls. BORIS expression in the neutrophils was detected by Flow Cytometry. High level of BORIS was detected in all malignant (64.4 ± 16.6%) and benign cases (67 ± 12.3), mean florescent intensity ratio (MFIR) of 7.2 ± 4.1 and 7 ± 3.5, median 5.8 and 6.6%; and staining index (SI) 8.3 ± 3.9 and 8.2 ± 3.4, median 7.6 and 7.9 respectively vs.13.4 ± 11.5% MFI 1.8 ± 0.7, median1.6 and SI 2.6 ± 0.69, median 2.5 for the control. BORIS level was comparable in the malignant and benign group (P = 0.934) and significantly higher than control (P = 0.0001). There was no correlation between neutrophil BORIS expression and ER/PR status, HER-2/neu expression or tumor stage or size. Increased BORIS expression in peripheral blood neutrophils is associated with both benign and malignant breast lesions; apparently, increased proliferation of breast tissue is the determining factor. This excludes BORIS as a tumor marker but it does not jeopardize its value as a potential therapeutic target. © 2016 International Clinical Cytometry Society. © 2016 International Clinical Cytometry Society.

  8. Development of a Fluorescence Assay for the Characterization of Brevenal Binding to Rat Brain Synaptosomes

    PubMed Central

    2015-01-01

    The marine dinoflagellate Karenia brevis produces a family of neurotoxins known as brevetoxins. Brevetoxins elicit their effects by binding to and activating voltage-sensitive sodium channels (VSSCs) in cell membranes. K. brevis also produces brevenal, a brevetoxin antagonist, which is able to inhibit and/or negate many of the detrimental effects of brevetoxins. Brevenal binding to VSSCs has yet to be fully characterized, in part due to the difficulty and expense of current techniques. In this study, we have developed a novel fluorescence binding assay for the brevenal binding site. Several fluorescent compounds were conjugated to brevenal to assess their effects on brevenal binding. The assay was validated against the radioligand assay for the brevenal binding site and yielded comparable equilibrium inhibition constants. The fluorescence-based assay was shown to be quicker and far less expensive and did not generate radioactive waste or need facilities for handling radioactive materials. In-depth studies using the brevenal conjugates showed that, while brevenal conjugates do bind to a binding site in the VSSC protein complex, they are not displaced by known VSSC site specific ligands. As such, brevenal elicits its action through a novel mechanism and/or currently unknown receptor site on VSSCs. PMID:25226846

  9. Characterization of (/sup 3/H)forskolin binding sites in the iris-ciliary body of the albino rabbit

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goldman, M.E.; Mallorga, P.; Pettibone, D.J.

    1988-01-01

    (/sup 3/H)forskolin binding sites were identified using membranes prepared from the iris-ciliary body of adult, albino rabbits. Scatchard analysis of saturation binding experiments demonstrated that (/sup 3/H)forskolin bound to a single population of high affinity sites. The K/sub d/ and B/sub max/ values were 8.7 +- 0.9 nM and 119.0 +- 30.9 fmolmg prot. using membranes prepared from frozen tissue and 17.0 +- 6.2 nM and 184.4 +- 47.2 fmolmg prot. using fresh tissue. The binding of (/sup 3/H)forskolin was magnesium-dependent. The B/sub max/ was enhanced by sodium fluoride and Gpp(NH)p, a nonhydrolyzable guanine nucleotide analog. Forskolin was the mostmore » potent inhibitor of (/sup 3/H)forskolin binding; two commercially-available analogs were weaker inhibitors. In an adenylate cyclase assay, there was the same rank order of potency to enhance enzyme activity. Based upon binding affinities, magnesium-dependence, sensitivity to sodium fluoride and Gpp(NH)p, rank order of potencies of analogs and correlation of binding with adenylate cyclase activity, these studies suggest that the (/sup 3/H)forskolin binding site in the iris-ciliary body is similar to the binding site in other tissues« less

  10. Impact of disruption of secondary binding site S2 on dopamine transporter function.

    PubMed

    Zhen, Juan; Reith, Maarten E A

    2016-09-01

    The structures of the leucine transporter, drosophila dopamine transporter, and human serotonin transporter show a secondary binding site (designated S2 ) for drugs and substrate in the extracellular vestibule toward the membrane exterior in relation to the primary substrate recognition site (S1 ). The present experiments are aimed at disrupting S2 by mutating Asp476 and Ile159 to Ala. Both mutants displayed a profound decrease in [(3) H]DA uptake compared with wild-type associated with a reduced turnover rate kcat . This was not caused by a conformational bias as the mutants responded to Zn(2+) (10 μM) similarly as WT. The dopamine transporters with either the D476A or I159A mutation both displayed a higher Ki for dopamine for the inhibition of [3H](-)-2-β-carbomethoxy-3-β-(4-fluorophenyl)tropane binding than did the WT transporter, in accordance with an allosteric interaction between the S1 and S2 sites. The results provide evidence in favor of a general applicability of the two-site allosteric model of the Javitch/Weinstein group from LeuT to dopamine transporter and possibly other monoamine transporters. X-ray structures of transporters closely related to the dopamine (DA) transporter show a secondary binding site S2 in the extracellular vestibule proximal to the primary binding site S1 which is closely linked to one of the Na(+) binding sites. This work examines the relationship between S2 and S1 sites. We found that S2 site impairment severely reduced DA transport and allosterically reduced S1 site affinity for the cocaine analog [(3) H]CFT. Our results are the first to lend direct support for the application of the two-site allosteric model, advanced for bacterial LeuT, to the human DA transporter. The model states that, after binding of the first DA molecule (DA1 ) to the primary S1 site (along with Na(+) ), binding of a second DA (DA2 ) to the S2 site triggers, through an allosteric interaction, the release of DA1 and Na(+) into the cytoplasm. © 2016 International Society for Neurochemistry.

  11. Mössbauer properties of the diferric cluster and the differential iron(II)-binding affinity of the iron sites in protein R2 of class Ia Escherichia coli ribonucleotide reductase: a DFT/electrostatics study.

    PubMed

    Han, Wen-Ge; Sandala, Gregory M; Giammona, Debra Ann; Bashford, Donald; Noodleman, Louis

    2011-11-14

    The R2 subunit of class-Ia ribonucleotide reductase (RNR) from Escherichia coli (E. coli) contains a diiron active site. Starting from the apo-protein and Fe(II) in solution at low Fe(II)/apoR2 ratios, mononuclear Fe(II) binding is observed indicating possible different Fe(II) binding affinities for the two alternative sites. Further, based on their Mössbauer spectroscopy and two-iron-isotope reaction experiments, Bollinger et al. (J. Am. Chem. Soc., 1997, 119, 5976-5977) proposed that the site Fe1, which bonds to Asp84, should be associated with the higher observed (57)Fe Mössbauer quadrupole splitting (2.41 mm s(-1)) and lower isomer shift (0.45 mm s(-1)) in the Fe(III)Fe(III) state, site Fe2, which is further from Tyr122, should have a greater affinity for Fe(II) binding than site Fe1, and Fe(IV) in the intermediate X state should reside at site Fe2. In this paper, using density functional theory (DFT) incorporated with the conductor-like screening (COSMO) solvation model and with the finite-difference Poisson-Boltzmann self-consistent reaction field (PB-SCRF) methodologies, we have demonstrated that the observed large quadrupole splitting for the diferric state R2 does come from site Fe1(III) and it is mainly caused by the binding position of the carboxylate group of the Asp84 sidechain. Further, a series of active site clusters with mononuclear Fe(II) binding at either site Fe1 or Fe2 have been studied, which show that with a single dielectric medium outside the active site quantum region, there is no energetic preference for Fe(II) binding at one site over another. However, when including the explicit extended protein environment in the PB-SCRF model, the reaction field favors the Fe(II) binding at site Fe2 rather than at site Fe1 by ~9 kcal mol(-1). Therefore our calculations support the proposal of the previous Mössbauer spectroscopy and two-iron-isotope reaction experiments by Bollinger et al.

  12. Minute Virus of Mice Initiator Protein NS1 and a Host KDWK Family Transcription Factor Must Form a Precise Ternary Complex with Origin DNA for Nicking To Occur

    PubMed Central

    Christensen, Jesper; Cotmore, Susan F.; Tattersall, Peter

    2001-01-01

    Parvoviral rolling hairpin replication generates palindromic genomic concatemers whose junctions are resolved to give unit-length genomes by a process involving DNA replication initiated at origins derived from each viral telomere. The left-end origin of minute virus of mice (MVM), oriL, contains binding sites for the viral initiator nickase, NS1, and parvovirus initiation factor (PIF), a member of the emerging KDWK family of transcription factors. oriL is generated as an active form, oriLTC, and as an inactive form, oriLGAA, which contains a single additional nucleotide inserted between the NS1 and PIF sites. Here we examined the interactions on oriLTC which lead to activation of NS1 by PIF. The two subunits of PIF, p79 and p96, cooperatively bind two ACGT half-sites, which can be flexibly spaced. When coexpressed from recombinant baculoviruses, the PIF subunits preferentially form heterodimers which, in the presence of ATP, show cooperative binding with NS1 on oriL, but this interaction is preferentially enhanced on oriLTC compared to oriLGAA. Without ATP, NS1 is unable to bind stably to its cognate site, but PIF facilitates this interaction, rendering the NS1 binding site, but not the nick site, resistant to DNase I. Varying the spacing of the PIF half-sites shows that the distance between the NS1 binding site and the NS1-proximal half-site is critical for nickase activation, whereas the position of the distal half-site is unimportant. When expressed separately, both PIF subunits form homodimers that bind site specifically to oriL, but only complexes containing p79 activate the NS1 nickase function. PMID:11435581

  13. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  14. Autoradiographic demonstration of oxytocin-binding sites in the macula densa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Stoeckel, M.E.; Freund-Mercier, M.J.

    1989-08-01

    Specific oxytocin (OT)-binding sites were localized in the rat kidney with use of a selective {sup 125}I-labeled OT antagonist ({sup 125}I-OTA). High concentrations of OT binding sites were detected on the juxtaglomerular apparatus with use of the conventional film autoradiographic technique. No labeling occurred on other renal structures. The cellular localization of the OT binding sites within the juxtaglomerular apparatus was studied in light microscope autoradiography, on semithin sections from paraformaldehyde-fixed kidney slices incubated in the presence of {sup 125}I-OTA. These preparations revealed selective labeling of the macula densa, mainly concentrated at the basal pole of the cells. Control experimentsmore » showed first that {sup 125}I-OTA binding characteristics were not noticeably altered by prior paraformaldehyde fixation of the kidneys and second that autoradiographic detection of the binding sites was not impaired by histological treatments following binding procedures. In view of the role of the macula densa in the tubuloglomerular feedback, the putative OT receptors of this structure might mediate the stimulatory effect of OT on glomerular filtration.« less

  15. High-affinity cannabinoid binding site in brain: A possible marijuana receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nye, J.S.

    The mechanism by which delta{sup 9} tetrahydrocannabinol (delta{sup 9}THC), the major psychoactive component of marijuana or hashish, produces its potent psychological and physiological effects is unknown. To find receptor binding sites for THC, we designed a water-soluble analog for use as a radioligand. 5{prime}-Trimethylammonium-delta{sup 8}THC (TMA) is a positively charged analog of delta-{sup 8}THC modified on the 5{prime} carbon, a portion of the molecule not important for its psychoactivity. We have studied the binding of ({sup 3}H)-5{prime}-trimethylammonium-delta-{sup 8}THC (({sup 3}H)TMA) to rat neuronal membranes. ({sup 3}H)TMA binds saturably and reversibly to brain membranes with high affinity to apparently one classmore » of sites. Highest binding site density occurs in brain, but several peripheral organs also display specific binding. Detergent solubilizes the sites without affecting their pharmacologial properties. Molecular sieve chromatography reveals a bimodal peak of ({sup 3}H)TMA binding activity of approximately 60,000 daltons apparent molecular weight.« less

  16. Binding characteristics of levetiracetam to synaptic vesicle protein 2A (SV2A) in human brain and in CHO cells expressing the human recombinant protein.

    PubMed

    Gillard, Michel; Chatelain, Pierre; Fuks, Bruno

    2006-04-24

    A specific binding site for the antiepileptic drug levetiracetam (2S-(oxo-1-pyrrolidinyl)butanamide, Keppra) in rat brain, referred to as the levetiracetam binding site, was discovered several years ago. More recently, this binding site has been identified as the synaptic vesicle protein 2A (SV2A), a protein present in synaptic vesicles [Lynch, B., Lambeng, N., Nocka, K., Kensel-Hammes, P., Bajjalieh, S.M., Matagne, A., Fuks, B., 2004. The synaptic vesicle protein SV2A is the binding site for the antiepileptic drug levetiracetam. Proc. Natl. Acad. Sci. USA, 101, 9861-9866.]. In this study, we characterized the binding properties of levetiracetam in post-mortem human brain and compared them to human SV2A expressed in Chinese hamster ovary (CHO) cells. The results showed that the binding properties of levetiracetam and [3H]ucb 30889, an analogue that was previously characterized as a suitable ligand for levetiracetam binding site/SV2A in rat brain [Gillard, M., Fuks, B., Michel, P., Vertongen, P., Massingham, R. Chatelain, P., 2003. Binding characteristics of [3H]ucb 30889 to levetiracetam binding sites in rat brain. Eur. J. Pharmacol. 478, 1-9.], are almost identical in human brain samples (cerebral cortex, hippocampus and cerebellum) and in CHO cell membranes expressing the human SV2A protein. Moreover, the results are also similar to those previously obtained in rat brain. [3H]ucb 30889 binding in human brain and to SV2A was saturable and reversible. At 4 degrees C, its binding kinetics were best fitted assuming a two-phase model in all tissues. The half-times of association for the fast component ranged between 1 to 2 min and represent 30% to 36% of the sites whereas the half-times for the slow component ranged from 20 to 29 min. In dissociation experiments, the half-times were from 2 to 4 min for the fast component (33% to 49% of the sites) and 20 to 41 min for the slow component. Saturation binding curves led to Kd values for [3H]ucb 30889 of 53+/-7, 55+/-9, 70+/-11 and 75+/-33 nM in human cerebral cortex, hippocampus, cerebellum and CHO cells expressing SV2A respectively. Bmax values around 3-4 pmol/mg protein were calculated in all brain regions. Some of the saturation curves displayed curvilinear Scatchard plots indicating the presence of high and low affinity binding sites. When this was the case, Kd values from 25 to 30 nM for the high affinity sites (24% to 34% of total sites) and from 200 to 275 nM for the low affinity sites were calculated. This was observed in all brain regions and in CHO cell membranes expressing the SV2A protein. It cannot be explained by putative binding of [3H]ucb 30889 to SV2B or C isoforms but may reflect different patterns of SV2A glycosylation or the formation of SV2A oligomers. Competition experiments were performed to determine the affinities for SV2A of a variety of compounds including levetiracetam, some of its analogues and other molecules known to interact with levetiracetam binding sites in rat brain such as bemegride, pentylenetetrazol and chlordiazepoxide. We found an excellent correlation between the affinities of these compounds measured in human brain, rat brain and CHO cells expressing human SV2A. In conclusion, we report for the first time that the binding characteristics of native levetiracetam binding sites/SV2A in human brain and rat brain share very similar properties with human recombinant SV2A expressed in CHO cells.

  17. The Polar and Electrical Nature of Dye Binding Sites on Human Red Blood Cell Membranes.

    DTIC Science & Technology

    positive charges at the binding sites. By increasing the concentration of the anionic BPB (or by the addition of the anionic detergent sodium lauryl ... sulfate ) these positive charges appear to be successively titrated, rendering the membrane binding sites electrically neutral at this pH. The average

  18. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP

    PubMed Central

    Hafner, Markus; Landthaler, Markus; Burger, Lukas; Khorshid, Mohsen; Hausser, Jean; Berninger, Philipp; Rothballer, Andrea; Ascano, Manuel; Jungkamp, Anna-Carina; Munschauer, Mathias; Ulrich, Alexander; Wardle, Greg S.; Dewell, Scott; Zavolan, Mihaela; Tuschl, Thomas

    2010-01-01

    Summary RNA transcripts are subject to post-transcriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases. PMID:20371350

  19. Pharmacophore screening of the protein data bank for specific binding site chemistry.

    PubMed

    Campagna-Slater, Valérie; Arrowsmith, Andrew G; Zhao, Yong; Schapira, Matthieu

    2010-03-22

    A simple computational approach was developed to screen the Protein Data Bank (PDB) for putative pockets possessing a specific binding site chemistry and geometry. The method employs two commonly used 3D screening technologies, namely identification of cavities in protein structures and pharmacophore screening of chemical libraries. For each protein structure, a pocket finding algorithm is used to extract potential binding sites containing the correct types of residues, which are then stored in a large SDF-formatted virtual library; pharmacophore filters describing the desired binding site chemistry and geometry are then applied to screen this virtual library and identify pockets matching the specified structural chemistry. As an example, this approach was used to screen all human protein structures in the PDB and identify sites having chemistry similar to that of known methyl-lysine binding domains that recognize chromatin methylation marks. The selected genes include known readers of the histone code as well as novel binding pockets that may be involved in epigenetic signaling. Putative allosteric sites were identified on the structures of TP53BP1, L3MBTL3, CHEK1, KDM4A, and CREBBP.

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  1. The Role and Specificity of the Catalytic and Regulatory Cation-binding Sites of the Na+-pumping NADH:Quinone Oxidoreductase from Vibrio cholerae*

    PubMed Central

    Juárez, Oscar; Shea, Michael E.; Makhatadze, George I.; Barquera, Blanca

    2011-01-01

    The Na+-translocating NADH:quinone oxidoreductase is the entry site for electrons into the respiratory chain and the main sodium pump in Vibrio cholerae and many other pathogenic bacteria. In this work, we have employed steady-state and transient kinetics, together with equilibrium binding measurements to define the number of cation-binding sites and characterize their roles in the enzyme. Our results show that sodium and lithium ions stimulate enzyme activity, and that Na+-NQR enables pumping of Li+, as well as Na+ across the membrane. We also confirm that the enzyme is not able to translocate other monovalent cations, such as potassium or rubidium. Although potassium is not used as a substrate, Na+-NQR contains a regulatory site for this ion, which acts as a nonessential activator, increasing the activity and affinity for sodium. Rubidium can bind to the same site as potassium, but instead of being activated, enzyme turnover is inhibited. Activity measurements in the presence of both sodium and lithium indicate that the enzyme contains at least two functional sodium-binding sites. We also show that the binding sites are not exclusively responsible for ion selectivity, and other steps downstream in the mechanism also play a role. Finally, equilibrium-binding measurements with 22Na+ show that, in both its oxidized and reduced states, Na+-NQR binds three sodium ions, and that the affinity for sodium is the same for both of these states. PMID:21652714

  2. Characterization of [3H] oxymorphone binding sites in mouse brain: Quantitative autoradiography in opioid receptor knockout mice.

    PubMed

    Yoo, Ji Hoon; Borsodi, Anna; Tóth, Géza; Benyhe, Sándor; Gaspar, Robert; Matifas, Audrey; Kieffer, Brigitte L; Metaxas, Athanasios; Kitchen, Ian; Bailey, Alexis

    2017-03-16

    Oxymorphone, one of oxycodone's metabolic products, is a potent opioid receptor agonist which is thought to contribute to the analgesic effect of its parent compound and may have high potential abuse liability. Nonetheless, the in vivo pharmacological binding profile of this drug is still unclear. This study uses mice lacking mu (MOP), kappa (KOP) or delta (DOP) opioid receptors as well as mice lacking all three opioid receptors to provide full characterisation of oxymorphone binding sites in the brain. Saturation binding studies using [ 3 H]oxymorphone revealed high affinity binding sites in mouse brain displaying Kd of 1.7nM and Bmax of 147fmol/mg. Furthermore, we performed quantitative autoradiography binding studies using [ 3 H]oxymorphone in mouse brain. The distribution of [ 3 H]oxymorphone binding sites was found to be similar to the selective MOP agonist [ 3 H]DAMGO in the mouse brain. [ 3 H]Oxymorphone binding was completely abolished across the majority of the brain regions in mice lacking MOP as well as in mice lacking all three opioid receptors. DOP and KOP knockout mice retained [ 3 H]oxymorphone binding sites suggesting oxymorphone may not target DOP or KOP. These results confirm that the MOP, and not the DOP or the KOP is the main high affinity binding target for oxymorphone. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Autoradiographic localization of sigma receptor binding sites in guinea pig and rat central nervous system with (+)3H-3-(3-hydroxyphenyl)-N-(1-propyl)piperidine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gundlach, A.L.; Largent, B.L.; Snyder, S.H.

    1986-06-01

    (+)3H-3-PPP ((+)3H-3-(3-Hydroxyphenyl)-N-(1-propyl)-piperidine) binds with high affinity to brain membranes with a pharmacological profile consistent with that of sigma receptors. The distribution of (+)3H-3-PPP binding sites in brain and spinal cord of both guinea pig and rat has been determined by in vitro autoradiography with binding densities quantitated by computer-assisted densitometry. (+)3H-3-PPP binding to slide-mounted brain sections is saturable and displays high affinity and a pharmacological specificity very similar to sites labeled in homogenates. (+)3H-3-PPP binding sites are heterogeneously distributed. Highest concentrations of binding sites occur in spinal cord, particularly the ventral horn and dorsal root ganglia; the pons-medulla, associated withmore » the cranial nerve and pontine nuclei and throughout the brain stem reticular formation; the cerebellum, over the Purkinje cell layer; the midbrain, particularly the central gray and red nucleus; and hippocampus, over the pyramidal cell layer. Lowest levels are seen in the basal ganglia and parts of the thalamus, while all other areas, including hypothalamus and cerebral cortex, exhibit moderate grain densities. Quinolinic acid-induced lesions of the hippocampus indicate that (+)3H-3-PPP labels hippocampal pyramidal cells and granule cells in the dentate gyrus. Intrastriatal injection of ibotenic acid dramatically reduces (+)3H-3-PPP binding in this area, while injection of 6-hydroxydopamine produces a relatively slight decrease. The distribution of (+)3H-3-PPP binding sites does not correlate with the receptor distribution of any recognized neurotransmitter or neuropeptide, including dopamine. However, there is a notable similarity between the distribution of (+)3H-3-PPP sites and high-affinity binding sites for psychotomimetic opioids, such as the benzomorphan (+)SKF 10,047.« less

  4. DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.

    PubMed

    Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P

    2008-06-01

    In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.

  5. Modeling the Embrace of a Mutator: APOBEC Selection of Nucleic Acid Ligands.

    PubMed

    Salter, Jason D; Smith, Harold C

    2018-05-23

    The 11-member APOBEC (apolipoprotein B mRNA editing catalytic polypeptide-like) family of zinc-dependent cytidine deaminases bind to RNA and single-stranded DNA (ssDNA) and, in specific contexts, modify select (deoxy)cytidines to (deoxy)uridines. In this review, we describe advances made through high-resolution co-crystal structures of APOBECs bound to mono- or oligonucleotides that reveal potential substrate-specific binding sites at the active site and non-sequence-specific nucleic acid binding sites distal to the active site. We also discuss the effect of APOBEC oligomerization on functionality. Future structural studies will need to address how ssDNA binding away from the active site may enhance catalysis and the mechanism by which RNA binding may modulate catalytic activity on ssDNA. Copyright © 2018 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bidlack, J.M.; Frey, D.K.; Seyed-Mozaffari, A.

    The binding properties of 14{beta}-(bromoacetamido)morphine (BAM) and the ability of BAM to irreversibly inhibit opioid binding to rat brain membranes were examined to characterize the affinity and selectivity of BAM as an irreversible affinity ligand for opioid receptors. BAM had the same receptor selectivity as morphine, with a 3-5-fold decrease in affinity for the different types of opioid receptors. When brain membranes were incubated with BAM, followed by extensive washing, opioid binding was restored to control levels. However, when membranes were incubated with dithiothreitol (DTT), followed by BAM, and subsequently washed, 90% of the 0.25 nM ({sup 3}H)(D-Ala{sup 2},(Me)Phe{sup 4},Gly(ol){supmore » 5})enkephalin (DAGO) binding was irreversibly inhibited as a result of the specific alkylation of a sulfhydryl group at the {mu} binding site. This inhibition was dependent on the concentrations of both DTT and BAM. The {mu} receptor specificity of BAM alkylation was demonstrated by the ability of BAM alkylated membranes to still bind the {delta}-selective peptide ({sup 3}H)(D-penicillamine{sup 2},D-penicillamine{sup 5})enkephalin (DPDPE) and (-)-({sup 3}H)bremazocine in the presence of {mu} and {delta} blockers, selective for {kappa} binding sites. Morphine and naloxone partially protected the binding site from alkylation with BAM, while ligands that did not bind to the {mu}s site did not afford protection. These studies have demonstrated that when a disulfide bond at or near {mu} opioid binding sites was reduced, BAM could then alkylate this site, resulting in the specific irreversible labeling of {mu} opioid receptors.« less

  7. ( sup 3 H)RO15-4513 binding to cerebellar diazepam-sensitive and insensitive GABAA receptors is unchanged by one week of ethanol intake

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Martin, M.W.; Chen, J.P.; Wallis, C.

    1992-02-26

    ({sup 3}H)RO15-4513, a partial inverse agonist at GABAA receptors, binds to two sites in cerebellar membranes, one sensitive (DZ-S) and one insensitive (DZ-IS) to inhibition by diazepam. These binding sites may represent different isoforms of the GABAA receptor and may play a role in ethanol (EtOH) dependence. The authors tested the hypothesis that chronic intake of EtOH induces changes in the binding properties of one or both of these putative GABBA receptors. Rats were fed a liquid diet of 4.5% EtOH for 7 d, gavaged with a 3g/kg dose of EtOH, and then sacrificed after 2 h, 12 h, ormore » 4.5 d. Binding of ({sup 3}H)RO15-4513 to cerebellar membranes was performed in the absence or presence of 10{mu}M diazepam (DZ-IS binding); DZ-S binding was calculated as the difference between total and DZ-IS. Nonlinear regression analysis showed that each class of binding site fit a model of mass action binding to a single, noninteractive population of sites. No significant difference was observed between any of the treatment groups in the apparent affinity (Kd) for ({sup 3}H)RO15-4513 at total, DZ-S, or DZ-IS sites following chronic EtOH intake or withdrawal. In addition, no significant difference was observed in the apparent number of DZ-S or DZ-IS binding sites or the ratio of DZ-S to DZ-IS.« less

  8. High Structural Resolution Hydroxyl Radical Protein Footprinting Reveals an Extended Robo1-Heparin Binding Interface*

    PubMed Central

    Li, Zixuan; Moniz, Heather; Wang, Shuo; Ramiah, Annapoorani; Zhang, Fuming; Moremen, Kelley W.; Linhardt, Robert J.; Sharp, Joshua S.

    2015-01-01

    Interaction of transmembrane receptors of the Robo family and the secreted protein Slit provides important signals in the development of the central nervous system and regulation of axonal midline crossing. Heparan sulfate, a sulfated linear polysaccharide modified in a complex variety of ways, serves as an essential co-receptor in Slit-Robo signaling. Previous studies have shown that closely related heparin octasaccharides bind to Drosophila Robo directly, and surface plasmon resonance analysis revealed that Robo1 binds more tightly to full-length unfractionated heparin. For the first time, we utilized electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting to identify two separate binding sites for heparin interaction with Robo1: one binding site at the previously identified site for heparin dp8 and a second binding site at the N terminus of Robo1 that is disordered in the x-ray crystal structure. Mutagenesis of the identified N-terminal binding site exhibited a decrease in binding affinity as measured by surface plasmon resonance and heparin affinity chromatography. Footprinting also indicated that heparin binding induces a minor change in the conformation and/or dynamics of the Ig2 domain, but no major conformational changes were detected. These results indicate a second low affinity binding site in the Robo-Slit complex as well as suggesting the role of the Ig2 domain of Robo1 in heparin-mediated signal transduction. This study also marks the first use of electron transfer dissociation-based high spatial resolution hydroxyl radical protein footprinting, which shows great utility for the characterization of protein-carbohydrate complexes. PMID:25752613

  9. Point mutation increases a form of the NK1 receptor with high affinity for neurokinin A and B and septide

    PubMed Central

    Ciucci, Alessandra; Palma, Carla; Manzini, Stefano; Werge, Thomas M

    1998-01-01

    The binding modalities of substance P and neurokinin A on the wild type and Gly166 to-Cys mutant NK1 receptors expressed on CHO cells were investigated in homologous and heterologous binding experiments using both radiolabelled substance P and neurokinin A.On the wild type NK1 receptor NKA displaces radiolabelled substance P with very low apparent affinity, despite its high-affinity binding constant (determined in homologous binding experiments). The Gly166 to-Cys substitution in the NK1 tachykinin receptor greatly enhances the apparent affinity of neurokinin A in competition for radiolabelled substance P, but it does not change the binding constant of neurokinin A. The mutation, thereby, eliminates the discrepancy between the low apparent affinity and the high binding constant of neurokinin A.On the wild type receptor the binding capacity of neurokinin A is significantly smaller than that of substance P. In contrast, the two tachykinins bind to approximately the same number of sites on the mutant receptor.Simultaneous mass action law analysis of binding data in which multiple radioligands were employed in parallel demonstrated that a one-site model was unable to accommodate all the experimental data, whereas a two-site model provided a dramatically better description.These two receptor-sites display equally high affinity for substance P, while neurokinin A strongly discriminates between a high and a low affinity component. The binding affinities of neurokinin A are not affected by the mutation, which instead specifically alters the distribution between receptor sites in favour of a high affinity neurokinin A binding form.The low apparent affinity and binding capacity of neurokinin A on the wild type receptor results from neurokinin A binding with high affinity only to a fraction of the sites labelled by substance P. The mutation increases the proportion of this site, and consequently enhances the apparent affinity and binding capacity of neurokinin A.The binding modalities of septide-like ligands (i.e. neurokinin B, SP(6-11), SP-methyl ester) are affected similarly to neurokinin A and are better resolved into two sites. The mutation leaves the affinity of these ligands for the two receptor forms unchanged, but increases the fraction of high-affinity sites. On the other hand, the binding of non-peptide and peptide antagonists (SR140.333 and FK888) behaved similarly to substance P with a single high affinity site that is unaffected by the mutation.These findings may suggest that the NK1 receptor exists in two different forms with similar affinity for substance P and NK1 antagonists, but with a high and a low affinity for neurokinin A and septide-like ligands. Hence, the Gly166 in the NK1 receptor would seem to control the distribution between a pan-reactive form and a substance P-selective form of the receptor. PMID:9786514

  10. Denervation does not alter the number of neuronal bungarotoxin binding sites on autonomic neurons in the frog cardiac ganglion.

    PubMed

    Sargent, P B; Bryan, G K; Streichert, L C; Garrett, E N

    1991-11-01

    The binding of neuronal bungarotoxin (n-BuTX; also known as bungarotoxin 3.1, kappa-bungarotoxin, and toxin F) was analyzed in normal and denervated parasympathetic cardiac ganglia of the frog Rana pipiens, n-BuTX blocks both EPSPs and ACh potentials at 5-20 nM, as determined by intracellular recording techniques. Scatchard analysis on homogenates indicates that cardiac ganglia have two classes of binding sites for 125I-n-BuTX: a high-affinity site with an apparent dissociation constant (Kd,app) of 1.7 nM and a Bmax (number of binding sites) of 3.8 fmol/ganglion and a low-affinity site with a Kd,app of 12 microM and a Bmax of 14 pmol/ganglion. alpha-Bungarotoxin does not appear to interfere with the binding of 125I-n-BuTX to either site. The high-affinity binding site is likely to be the functional nicotinic ACh receptor (AChR), given the similarity between its affinity for 125I-n-BuTX and the concentration of n-BuTX required to block AChR function. Light microscopic autoradiographic analysis of 125I-n-BuTX binding to the ganglion cell surface reveals that toxin binding is concentrated at synaptic sites, which were identified using a synaptic vesicle-specific antibody. Scatchard analysis of autoradiographic data reveals that 125I-n-BuTX binding to the neuronal surface is saturable and has a Kd,app similar to that of the high-affinity binding site characterized in homogenates. Surface binding of 125I-n-BuTX is blocked by nicotine, carbachol, and d-tubocurarine (IC50 less than 20 microM), but not by atropine (IC50 greater than 10 mM). Denervation of the heart increases the ACh sensitivity of cardiac ganglion cells but has no effect upon the number of high-affinity binding sites for 125I-n-BuTX in tissue homogenates. Moreover, autoradiographic analysis indicates that denervation does not alter the number of 125I-n-BuTX binding sites on the ganglion cell surface. n-BuTX is as effective in reducing ganglion cell responses to ACh in denervated ganglia as it is in normally innervated ganglia. These results suggest that denervation alters neither the total number of nicotinic AChRs in the cardiac ganglion nor the number found on the surface of ganglion cells. These autonomic neurons thus respond differently to denervation than do skeletal myofibers. The increase in ACh sensitivity displayed by cardiac ganglion cells upon denervation cannot be explained by changes in AChR number.

  11. Calorimetric studies of the interactions of metalloenzyme active site mimetics with zinc-binding inhibitors.

    PubMed

    Robinson, Sophia G; Burns, Philip T; Miceli, Amanda M; Grice, Kyle A; Karver, Caitlin E; Jin, Lihua

    2016-07-19

    The binding of drugs to metalloenzymes is an intricate process that involves several interactions, including binding of the drug to the enzyme active site metal, as well as multiple interactions between the drug and the enzyme residues. In order to determine the free energy contribution of Zn(2+) binding by known metalloenzyme inhibitors without the other interactions, valid active site zinc structural mimetics must be formed and binding studies need to be performed in biologically relevant conditions. The potential of each of five ligands to form a structural mimetic with Zn(2+) was investigated in buffer using Isothermal Titration Calorimetry (ITC). All five ligands formed strong 1 : 1 (ligand : Zn(2+)) binary complexes. The complexes were used in further ITC experiments to study their interaction with 8-hydroxyquinoline (8-HQ) and/or acetohydroxamic acid (AHA), two bidentate anionic zinc-chelating enzyme inhibitors. It was found that tetradentate ligands were not suitable for creating zinc structural mimetics for inhibitor binding in solution due to insufficient coordination sites remaining on Zn(2+). A stable binary complex, [Zn(BPA)](2+), which was formed by a tridentate ligand, bis(2-pyridylmethyl)amine (BPA), was found to bind one AHA in buffer or a methanol : buffer mixture (60 : 40 by volume) at pH 7.25 or one 8-HQ in the methanol : buffer mixture at pH 6.80, making it an effective structural mimetic for the active site of zinc metalloenzymes. These results are consistent with the observation that metalloenzyme active site zinc ions have three residues coordinated to them, leaving one or two sites open for inhibitors to bind. Our findings indicate that Zn(BPA)X2 can be used as an active site structural mimetic for zinc metalloenzymes for estimating the free energy contribution of zinc binding to the overall inhibitor active site interactions. Such use will help aid in the rational design of inhibitors to a variety of zinc metalloenzymes.

  12. Identification of 50- and 23-/25-kDa HeLa cell membrane glycoproteins involved in poliovirus infection: occurrence of poliovirus specific binding sites on susceptible and nonsusceptible cells.

    PubMed

    Barnert, R H; Zeichhardt, H; Habermehl, K O

    1992-02-01

    Glycoproteins in the range 50 and 23/25 kDa were identified as poliovirus specific binding sites on HeLa cells with the monoclonal antibody mAb 122. mAb 122 is characterized by its partial inhibiting effect on poliovirus reproduction and adsorption when prebound to HeLa cells. The binding sites are endocytosed in native cells and specific for poliovirus as mAb 122 did not interfere with the adsorption of human rhinovirus type 14 (HRV 14). The poliovirus binding sites are present also on nonprimate so called nonsusceptible cells, e.g., mouse L-cells, as could be shown with sensitive ELISA based binding assays and performance of binding studies with fixed cells at 37 degrees.

  13. Cooperative interplay of let-7 mimic and HuR with MYC RNA.

    PubMed

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew C J; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites.

  14. The binding properties of cycloxaprid on insect native nAChRs partially explain the low cross-resistance with imidacloprid in Nilaparvata lugens.

    PubMed

    Zhang, Yixi; Xu, Xiaoyong; Bao, Haibo; Shao, Xusheng; Li, Zhong; Liu, Zewen

    2018-06-06

    Neonicotinoids, such as imidacloprid, are selective agonists of insect nicotinic acetylcholine receptors (nAChRs) to control Nilaparvata lugens, a major rice insect pest. High imidacloprid resistance has been reported in N. lugens in laboratory and in fields. Cycloxaprid, an oxabridged cis-nitromethylene neonicotinoid, showed high insecticidal activity against N. lugens and low cross-resistance in the imidacloprid resistant strains and field populations. Binding studies have demonstrated that imidacloprid had two binding sites with different affinities (Kd = 3.18 ± 0.43 pM and 1.78 ± 0.19 nM) in N. lugens nAChRs. Cycloxaprid was poor at displacing [ 3 H]imidacloprid at its high-affinity binding site (Ki = 159.38±20.43 nM), but quite efficient at the low-affinity binding site (Ki = 1.27±0.35 nM). These data showed that cycloxaprid had overlapping binding sites with imidacloprid only at its low-affinity binding site. Therefore, the low displacement ability of cycloxaprid against imidacloprid binding at its high affinity site could partially explain the low cross-resistance of cycloxaprid in the imidacloprid resistant populations. The high insecticidal activity, low cross-resistance and different binding properties on insect nAChRs of cycloxaprid demonstrating it a potential insecticide to control N. lugens and related insect pests, especially the ones with high resistance to neonicotinoids. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  15. CCL22-specific Antibodies Reveal That Engagement of Two Distinct Binding Domains on CCL22 Is Required for CCR4-mediated Function.

    PubMed

    Santulli-Marotto, Sandra; Wheeler, John; Lacy, Eilyn R; Boakye, Ken; Luongo, Jennifer; Wu, Sheng-Jiun; Ryan, Mary

    2015-12-01

    CCL22 inactivation in vivo occurs by cleavage at the N-terminus; however, it is unclear whether this encompasses the entire site of CCR4 interaction. CCL17 also binds CCR4 and its function requires binding via two discrete binding sites. Using monoclonal antibodies (MAbs), we report that there are two separate sites on CCL22 that are required for CCR4-mediated function. The CCL22-specific antibodies bind with affinities of 632 ± 297 pM (MC2B7) and 308 ± 43 pM (MAB4391) and neither exhibited detectable binding to CCL17. Both antibodies are comparable in their ability to inhibit CCL22-mediated calcium mobilization; however, competition binding studies demonstrate that MC2B7 and MAB4391 bind to distinct epitopes on CCL22. Both antibodies inhibit function through CCR4, which is demonstrated by loss of β-arrestin recruitment in a reporter cell line. In both assays, blocking either site independently abolished CCL22 function, suggesting that concurrent engagement of both sites with CCR4 is necessary for function. This is the first demonstration that CCL22 has two distinct binding sites that are required for CCR4 function. These antibodies are valuable tools for better understanding the interaction and function of CCL22 and CCR4 and will potentially help further understanding of the differential outcomes of CCL17 and CCL22 interaction with CCR4.

  16. FOLLITROPIN RECEPTORS CONTAIN CRYPTIC LIGAND BINDING SITES1

    PubMed Central

    Lin, Win; Bernard, Michael P.; Cao, Donghui; Myers, Rebecca V.; Kerrigan, John E.; Moyle, William R.

    2007-01-01

    Human choriogonadotropin (hCG) and follitropin (hFSH) have been shown to contact different regions of the extracellular domains of G-protein coupled lutropin (LHR) and follitropin (FSHR) receptors. We report here that hCG and hFSH analogs interact with an FSHR/LHR chimera having only two unique LHR residues similar to the manners in which they dock with LHR and FSHR, respectively. This shows that although the FSHR does not normally bind hCG, it contains a cryptic lutropin binding site that has the potential to recognize hCG in a manner similar to the LHR. The presence of this cryptic site may explain why equine lutropins bind many mammalian FSHR and why mutations in the transmembrane domain distant from the extracellular domain enable the FSHR to bind hCG. The leucine-rich repeat domain (LRD) of the FSHR also appears to contain a cryptic FSH binding site that is obscured by other parts of the extracellular domain. This will explain why contacts seen in crystals of hFSH complexed with an LRD fragment of the human FSHR are hard to reconcile with the abilities of FSH analogs to interact with membrane G-protein coupled FSHR. We speculate that cryptic lutropin binding sites in the FSHR, which are also likely to be present in thyrotropin receptors (TSHR), permit the physiological regulation of ligand binding specificity. Cryptic FSH binding sites in the LRD may enable alternate spliced forms of the FSHR to interact with FSH. PMID:17059863

  17. Investigation of glucose binding sites on insulin.

    PubMed

    Zoete, Vincent; Meuwly, Markus; Karplus, Martin

    2004-05-15

    Possible insulin binding sites for D-glucose have been investigated theoretically by docking and molecular dynamics (MD) simulations. Two different docking programs for small molecules were used; Multiple Copy Simultaneous Search (MCSS) and Solvation Energy for Exhaustive Docking (SEED) programs. The configurations resulting from the MCSS search were evaluated with a scoring function developed to estimate the binding free energy. SEED calculations were performed using various values for the dielectric constant of the solute. It is found that scores emphasizing non-polar interactions gave a preferential binding site in agreement with that inferred from recent fluorescence and NMR NOESY experiments. The calculated binding affinity of -1.4 to -3.5 kcal/mol is within the measured range of -2.0 +/- 0.5 kcal/mol. The validity of the binding site is suggested by the dynamical stability of the bound glucose when examined with MD simulations with explicit solvent. Alternative binding sites were found in the simulations and their relative stabilities were estimated. The motions of the bound glucose during molecular dynamics simulations are correlated with the motions of the insulin side chains that are in contact with it and with larger scale insulin motions. These results raise the question of whether glucose binding to insulin could play a role in its activity. The results establish the complementarity of molecular dynamics simulations and normal mode analyses with the search for binding sites proposed with small molecule docking programs. Copyright 2004 Wiley-Liss, Inc.

  18. Evidence that Chemical Chaperone 4-Phenylbutyric Acid Binds to Human Serum Albumin at Fatty Acid Binding Sites

    PubMed Central

    James, Joel; Shihabudeen, Mohamed Sham; Kulshrestha, Shweta; Goel, Varun; Thirumurugan, Kavitha

    2015-01-01

    Endoplasmic reticulum stress elicits unfolded protein response to counteract the accumulating unfolded protein load inside a cell. The chemical chaperone, 4-Phenylbutyric acid (4-PBA) is a FDA approved drug that alleviates endoplasmic reticulum stress by assisting protein folding. It is found efficacious to augment pathological conditions like type 2 diabetes, obesity and neurodegeneration. This study explores the binding nature of 4-PBA with human serum albumin (HSA) through spectroscopic and molecular dynamics approaches, and the results show that 4-PBA has high binding specificity to Sudlow Site II (Fatty acid binding site 3, subdomain IIIA). Ligand displacement studies, RMSD stabilization profiles and MM-PBSA binding free energy calculation confirm the same. The binding constant as calculated from fluorescence spectroscopic studies was found to be kPBA = 2.69 x 105 M-1. Like long chain fatty acids, 4-PBA induces conformational changes on HSA as shown by circular dichroism, and it elicits stable binding at Sudlow Site II (fatty acid binding site 3) by forming strong hydrogen bonding and a salt bridge between domain II and III of HSA. This minimizes the fluctuation of HSA backbone as shown by limited conformational space occupancy in the principal component analysis. The overall hydrophobicity of W214 pocket (located at subdomain IIA), increases upon occupancy of 4-PBA at any FA site. Descriptors of this pocket formed by residues from other subdomains largely play a role in compensating the dynamic movement of W214. PMID:26181488

  19. A Sequence in the loop domain of hepatitis C virus E2 protein identified in silico as crucial for the selective binding to human CD81

    PubMed Central

    Chang, Chun-Chun; Hsu, Hao-Jen; Yen, Jui-Hung; Lo, Shih-Yen

    2017-01-01

    Hepatitis C virus (HCV) is a species-specific pathogenic virus that infects only humans and chimpanzees. Previous studies have indicated that interactions between the HCV E2 protein and CD81 on host cells are required for HCV infection. To determine the crucial factors for species-specific interactions at the molecular level, this study employed in silico molecular docking involving molecular dynamic simulations of the binding of HCV E2 onto human and rat CD81s. In vitro experiments including surface plasmon resonance measurements and cellular binding assays were applied for simple validations of the in silico results. The in silico studies identified two binding regions on the HCV E2 loop domain, namely E2-site1 and E2-site2, as being crucial for the interactions with CD81s, with the E2-site2 as the determinant factor for human-specific binding. Free energy calculations indicated that the E2/CD81 binding process might follow a two-step model involving (i) the electrostatic interaction-driven initial binding of human-specific E2-site2, followed by (ii) changes in the E2 orientation to facilitate the hydrophobic and van der Waals interaction-driven binding of E2-site1. The sequence of the human-specific, stronger-binding E2-site2 could serve as a candidate template for the future development of HCV-inhibiting peptide drugs. PMID:28481946

  20. Desensitization of the nicotinic acetylcholine receptor by diisopropylfluorophosphate.

    PubMed

    Eldefrawi, M E; Schweizer, G; Bakry, N M; Valdes, J J

    1988-01-01

    The interaction of diisopropylfluorophosphate (DFP) with the nicotinic acetylcholine (ACh) receptor of Torpedo electric organ was studied, using [3H]-phencyclidine ([3H]-PCP) as a reporter probe. Phencyclidine binds with different kinetics to resting, activated, and desensitized receptor conformations. Although DFP did not inhibit binding of [3H]-ACh or 125I-alpha-bungarotoxin (BGT) to the receptor recognition sites and potentiated in a time-dependent manner [3H]-PCP binding to the receptor's high-affinity allosteric site, it inhibited the ACh- or carbamylcholine-stimulated [3H]-PCP binding. This suggested that DFP bound to a third kind of site on the receptor and affected receptor conformation. Preincubation of the membranes with DFP increased the receptor's affinity for carbamylcholine by eightfold and raised the pseudo-first-order rate of [3H]-PCP binding to that of an agonist-desensitized receptor. Accordingly, it is suggested that DFP induces receptor desensitization by binding to a site that is distinct from the recognition or high-affinity noncompetitive sites.

  1. Discovery and validation of information theory-based transcription factor and cofactor binding site motifs.

    PubMed

    Lu, Ruipeng; Mucaki, Eliseos J; Rogan, Peter K

    2017-03-17

    Data from ChIP-seq experiments can derive the genome-wide binding specificities of transcription factors (TFs) and other regulatory proteins. We analyzed 765 ENCODE ChIP-seq peak datasets of 207 human TFs with a novel motif discovery pipeline based on recursive, thresholded entropy minimization. This approach, while obviating the need to compensate for skewed nucleotide composition, distinguishes true binding motifs from noise, quantifies the strengths of individual binding sites based on computed affinity and detects adjacent cofactor binding sites that coordinate with the targets of primary, immunoprecipitated TFs. We obtained contiguous and bipartite information theory-based position weight matrices (iPWMs) for 93 sequence-specific TFs, discovered 23 cofactor motifs for 127 TFs and revealed six high-confidence novel motifs. The reliability and accuracy of these iPWMs were determined via four independent validation methods, including the detection of experimentally proven binding sites, explanation of effects of characterized SNPs, comparison with previously published motifs and statistical analyses. We also predict previously unreported TF coregulatory interactions (e.g. TF complexes). These iPWMs constitute a powerful tool for predicting the effects of sequence variants in known binding sites, performing mutation analysis on regulatory SNPs and predicting previously unrecognized binding sites and target genes. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Cone arrestin binding to JNK3 and Mdm2: conformational preference and localization of interaction sites

    PubMed Central

    Song, Xiufeng; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2008-01-01

    Arrestins are multi-functional regulators of G protein-coupled receptors. Receptor-bound arrestins interact with >30 remarkably diverse proteins and redirect the signaling to G protein-independent pathways. The functions of free arrestins are poorly understood, and the interaction sites of the non-receptor arrestin partners are largely unknown. In this study, we show that cone arrestin, the least studied member of the family, binds c-Jun N-terminal kinase (JNK3) and Mdm2 and regulates their subcellular distribution. Using arrestin mutants with increased or reduced structural flexibility, we demonstrate that arrestin in all conformations binds JNK3 comparably, whereas Mdm2 preferentially binds cone arrestin ‘frozen’ in the basal state. To localize the interaction sites, we expressed separate N- and C-domains of cone and rod arrestins and found that individual domains bind JNK3 and remove it from the nucleus as efficiently as full-length proteins. Thus, the arrestin binding site for JNK3 includes elements in both domains with the affinity of partial sites on individual domains sufficient for JNK3 relocalization. N-domain of rod arrestin binds Mdm2, which localizes its main interaction site to this region. Comparable binding of JNK3 and Mdm2 to four arrestin subtypes allowed us to identify conserved residues likely involved in these interactions. PMID:17680991

  3. An additional substrate binding site in a bacterial phenylalanine hydroxylase

    PubMed Central

    Ronau, Judith A.; Paul, Lake N.; Fuchs, Julian E.; Corn, Isaac R.; Wagner, Kyle T.; Liedl, Klaus R.; Abu-Omar, Mahdi M.; Das, Chittaranjan

    2014-01-01

    Phenylalanine hydroxylase (PAH) is a non-heme iron enzyme that catalyzes phenylalanine oxidation to tyrosine, a reaction that must be kept under tight regulatory control. Mammalian PAH features a regulatory domain where binding of the substrate leads to allosteric activation of the enzyme. However, existence of PAH regulation in evolutionarily distant organisms, such as certain bacteria in which it occurs, has so far been underappreciated. In an attempt to crystallographically characterize substrate binding by PAH from Chromobacterium violaceum (cPAH), a single-domain monomeric enzyme, electron density for phenylalanine was observed at a distal site, 15.7Å from the active site. Isothermal titration calorimetry (ITC) experiments revealed a dissociation constant of 24 ± 1.1 µM for phenylalanine. Under the same conditions, no detectable binding was observed in ITC for alanine, tyrosine, or isoleucine, indicating the distal site may be selective for phenylalanine. Point mutations of residues in the distal site that contact phenylalanine (F258A, Y155A, T254A) lead to impaired binding, consistent with the presence of distal site binding in solution. Kinetic analysis reveals that the distal site mutants suffer a discernible loss in their catalytic activity. However, x-ray structures of Y155A and F258A, two of the mutants showing more noticeable defect in their activity, show no discernible change in their active site structure, suggesting that the effect of distal binding may transpire through protein dynamics in solution. PMID:23860686

  4. Rate constants for proteins binding to substrates with multiple binding sites using a generalized forward flux sampling expression

    NASA Astrophysics Data System (ADS)

    Vijaykumar, Adithya; ten Wolde, Pieter Rein; Bolhuis, Peter G.

    2018-03-01

    To predict the response of a biochemical system, knowledge of the intrinsic and effective rate constants of proteins is crucial. The experimentally accessible effective rate constant for association can be decomposed in a diffusion-limited rate at which proteins come into contact and an intrinsic association rate at which the proteins in contact truly bind. Reversely, when dissociating, bound proteins first separate into a contact pair with an intrinsic dissociation rate, before moving away by diffusion. While microscopic expressions exist that enable the calculation of the intrinsic and effective rate constants by conducting a single rare event simulation of the protein dissociation reaction, these expressions are only valid when the substrate has just one binding site. If the substrate has multiple binding sites, a bound enzyme can, besides dissociating into the bulk, also hop to another binding site. Calculating transition rate constants between multiple states with forward flux sampling requires a generalized rate expression. We present this expression here and use it to derive explicit expressions for all intrinsic and effective rate constants involving binding to multiple states, including rebinding. We illustrate our approach by computing the intrinsic and effective association, dissociation, and hopping rate constants for a system in which a patchy particle model enzyme binds to a substrate with two binding sites. We find that these rate constants increase as a function of the rotational diffusion constant of the particles. The hopping rate constant decreases as a function of the distance between the binding sites. Finally, we find that blocking one of the binding sites enhances both association and dissociation rate constants. Our approach and results are important for understanding and modeling association reactions in enzyme-substrate systems and other patchy particle systems and open the way for large multiscale simulations of such systems.

  5. Symmetry of Fv architecture is conducive to grafting a second antibody binding site in the Fv region.

    PubMed Central

    Keck, P C; Huston, J S

    1996-01-01

    Molecular modeling studies on antibody Fv regions have been pursued to design a second antigen-binding site (chi-site) in a chimeric single-chain Fv (chi sFv) species of about 30 kDa. This analysis has uncovered an architectural basis common to many Fv regions that permits grafting a chi-site onto the Fv surface that diametrically opposes the normal combining site. By using molecular graphics analysis, chimeric complementarity-determining regions (chi CDRs) were defined that comprised most of the CDRs from an antibody binding site of interest. The chain directionality of chi CDRs was consistent with that of specific bottom loops of the sFv, which allowed for grafting of chi CDRs with an overall geometry approximating CDRs in the parent combining site. Analysis of 10 different Fv crystal structures indicates that the positions for inserting chi CDRs are very highly conserved, as are the corresponding chi CDR boundaries in the parent binding site. The results of this investigation suggest that it should be possible to generally apply this approach to the development of chimeric bispecific antibody binding site (chi BABS) proteins. Images FIGURE 2 FIGURE 3 PMID:8889174

  6. Deciphering common recognition principles of nucleoside mono/di and tri-phosphates binding in diverse proteins via structural matching of their binding sites.

    PubMed

    Bhagavat, Raghu; Srinivasan, Narayanaswamy; Chandra, Nagasuma

    2017-09-01

    Nucleoside triphosphate (NTP) ligands are of high biological importance and are essential for all life forms. A pre-requisite for them to participate in diverse biochemical processes is their recognition by diverse proteins. It is thus of great interest to understand the basis for such recognition in different proteins. Towards this, we have used a structural bioinformatics approach and analyze structures of 4677 NTP complexes available in Protein Data Bank (PDB). Binding sites were extracted and compared exhaustively using PocketMatch, a sensitive in-house site comparison algorithm, which resulted in grouping the entire dataset into 27 site-types. Each of these site-types represent a structural motif comprised of two or more residue conservations, derived using another in-house tool for superposing binding sites, PocketAlign. The 27 site-types could be grouped further into 9 super-types by considering partial similarities in the sites, which indicated that the individual site-types comprise different combinations of one or more site features. A scan across PDB using the 27 structural motifs determined the motifs to be specific to NTP binding sites, and a computational alanine mutagenesis indicated that residues identified to be highly conserved in the motifs are also most contributing to binding. Alternate orientations of the ligand in several site-types were observed and rationalized, indicating the possibility of some residues serving as anchors for NTP recognition. The presence of multiple site-types and the grouping of multiple folds into each site-type is strongly suggestive of convergent evolution. Knowledge of determinants obtained from this study will be useful for detecting function in unknown proteins. Proteins 2017; 85:1699-1712. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Catalytic site interactions in yeast OMP synthase.

    PubMed

    Hansen, Michael Riis; Barr, Eric W; Jensen, Kaj Frank; Willemoës, Martin; Grubmeyer, Charles; Winther, Jakob R

    2014-01-15

    The enigmatic kinetics, half-of-the-sites binding, and structural asymmetry of the homodimeric microbial OMP synthases (orotate phosphoribosyltransferase, EC 2.4.2.10) have been proposed to result from an alternating site mechanism in these domain-swapped enzymes [R.W. McClard et al., Biochemistry 45 (2006) 5330-5342]. This behavior was investigated in the yeast enzyme by mutations in the conserved catalytic loop and 5-phosphoribosyl-1-diphosphate (PRPP) binding motif. Although the reaction is mechanistically sequential, the wild-type (WT) enzyme shows parallel lines in double reciprocal initial velocity plots. Replacement of Lys106, the postulated intersubunit communication device, produced intersecting lines in kinetic plots with a 2-fold reduction of kcat. Loop (R105G K109S H111G) and PRPP-binding motif (D131N D132N) mutant proteins, each without detectable enzymatic activity and ablated ability to bind PRPP, complemented to produce a heterodimer with a single fully functional active site showing intersecting initial velocity plots. Equilibrium binding of PRPP and orotidine 5'-monophosphate showed a single class of two binding sites per dimer in WT and K106S enzymes. Evidence here shows that the enzyme does not follow half-of-the-sites cooperativity; that interplay between catalytic sites is not an essential feature of the catalytic mechanism; and that parallel lines in steady-state kinetics probably arise from tight substrate binding. Copyright © 2013. Published by Elsevier Inc.

  8. Characterization of local polarity and hydrophobic binding sites of beta-lactoglobulin by using N-terminal specific fluorescence labeling.

    PubMed

    Dong, Su-Ying; Zhao, Zhen-Wen; Ma, Hui-Min

    2006-01-01

    Because of wide ligand-binding ability and significant industrial interest of beta-lactoglobulin (beta-LG), its binding properties have been extensively studied. However, there still exists a controversy as to where a ligand binds, since at least two potential hydrophobic binding sites in beta-LG have been postulated for ligand binding: an internal one (calyx) and an external one (near the N-terminus). In this work, the local polarity and hydrophobic binding sites of beta-LG have been characterized by using N-terminal specific fluorescence labeling combined with a polarity-sensitive fluorescent probe 3-(4-chloro-6-hydrazino- 1,3,5-triazinylamino)-7-(dimethylamino)-2-methylphenazine (CHTDP). The polarity within the calyx is found to be extremely low, which is explained in terms of superhydrophobicity possibly resulting from its nanostructure, and the polarity is increased with the destruction of the calyx by heat treatment. However, the polarity of the N-terminal domain in native beta-LG is decreased after thermal denaturation. This polarity trend toward decreasing instead of increasing shows that beta-LG may have no definite external hydrophobic binding site. The hydrophobic binding of a ligand such as CHTDP at the surface of the protein is probably achieved via appropriate assembling of corresponding hydrophobic residues rather than via a fixed external hydrophobic binding site. Also, the ligand-binding location in beta-LG is found to be relevant to not only experimental conditions (pH < or = 6.2 or pH > 7.1) but also binding mechanisms (hydrophobic affinity or electrostatic interaction).

  9. Biochemical study of prolactin binding sites in Xenopus laevis brain and choroid plexus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muccioli, G.; Guardabassi, A.; Pattono, P.

    1990-03-01

    The occurrence of prolactin binding sites in some brain structures (telencephalon, ventral hypothalamus, myelencephalon, hypophysis, and choroid plexus) from Xenopus laevis (anuran amphibian) was studied by the in vitro biochemical technique. The higher binding values were obtained at the level of the choroid plexus and above all of the hypothalamus. On the bases of hormonal specificity and high affinity, these binding sites are very similar to those of prolactin receptors of classical target tissues as well as of those described by us in other structures from Xenopus. To our knowledge, the present results provide the first demonstration of the occurrencemore » of prolactin specific binding sites in Xenopus laevis choroid plexus cells.« less

  10. Study of DNA binding sites using the Rényi parametric entropy measure.

    PubMed

    Krishnamachari, A; moy Mandal, Vijnan; Karmeshu

    2004-04-07

    Shannon's definition of uncertainty or surprisal has been applied extensively to measure the information content of aligned DNA sequences and characterizing DNA binding sites. In contrast to Shannon's uncertainty, this study investigates the applicability and suitability of a parametric uncertainty measure due to Rényi. It is observed that this measure also provides results in agreement with Shannon's measure, pointing to its utility in analysing DNA binding site region. For facilitating the comparison between these uncertainty measures, a dimensionless quantity called "redundancy" has been employed. It is found that Rényi's measure at low parameter values possess a better delineating feature of binding sites (of binding regions) than Shannon's measure. The critical value of the parameter is chosen with an outlier criterion.

  11. SITEHOUND-web: a server for ligand binding site identification in protein structures.

    PubMed

    Hernandez, Marylens; Ghersi, Dario; Sanchez, Roberto

    2009-07-01

    SITEHOUND-web (http://sitehound.sanchezlab.org) is a binding-site identification server powered by the SITEHOUND program. Given a protein structure in PDB format SITEHOUND-web will identify regions of the protein characterized by favorable interactions with a probe molecule. These regions correspond to putative ligand binding sites. Depending on the probe used in the calculation, sites with preference for different ligands will be identified. Currently, a carbon probe for identification of binding sites for drug-like molecules, and a phosphate probe for phosphorylated ligands (ATP, phoshopeptides, etc.) have been implemented. SITEHOUND-web will display the results in HTML pages including an interactive 3D representation of the protein structure and the putative sites using the Jmol java applet. Various downloadable data files are also provided for offline data analysis.

  12. Common Anesthetic-binding Site for Inhibition of Pentameric Ligand-gated Ion Channels.

    PubMed

    Kinde, Monica N; Bu, Weiming; Chen, Qiang; Xu, Yan; Eckenhoff, Roderic G; Tang, Pei

    2016-03-01

    Identifying functionally relevant anesthetic-binding sites in pentameric ligand-gated ion channels (pLGICs) is an important step toward understanding the molecular mechanisms underlying anesthetic action. The anesthetic propofol is known to inhibit cation-conducting pLGICs, including a prokaryotic pLGIC from Erwinia chrysanthemi (ELIC), but the sites responsible for functional inhibition remain undetermined. We photolabeled ELIC with a light-activated derivative of propofol (AziPm) and performed fluorine-19 nuclear magnetic resonance experiments to support propofol binding to a transmembrane domain (TMD) intrasubunit pocket. To differentiate sites responsible for propofol inhibition from those that are functionally irrelevant, we made an ELIC-γ-aminobutyric acid receptor (GABAAR) chimera that replaced the ELIC-TMD with the α1β3GABAAR-TMD and compared functional responses of ELIC-GABAAR and ELIC with propofol modulations. Photolabeling showed multiple AziPm-binding sites in the extracellular domain (ECD) but only one site in the TMD with labeled residues M265 and F308 in the resting state of ELIC. Notably, this TMD site is an intrasubunit pocket that overlaps with binding sites for anesthetics, including propofol, found previously in other pLGICs. Fluorine-19 nuclear magnetic resonance experiments supported propofol binding to this TMD intrasubunit pocket only in the absence of agonist. Functional measurements of ELIC-GABAAR showed propofol potentiation of the agonist-elicited current instead of inhibition observed on ELIC. The distinctly different responses of ELIC and ELIC-GABAAR to propofol support the functional relevance of propofol binding to the TMD. Combining the newly identified TMD intrasubunit pocket in ELIC with equivalent TMD anesthetic sites found previously in other cationic pLGICs, we propose this TMD pocket as a common site for anesthetic inhibition of pLGICs.

  13. Multiple binding sites involved in the effect of choline esters on decarbamoylation of monomethylcarbamoyl- or dimethylcarbamoly-acetylcholinesterase.

    PubMed Central

    Sok, D E; Kim, Y B; Choi, S J; Jung, C H; Cha, S H

    1994-01-01

    Multiple binding sites for inhibitory choline esters in spontaneous decarbamoylation of dimethylcarbamoyl-acetylcholinesterase (AChE) were suggested from a wide range of IC50 values, in contrast with a limited range of AC50 values (concentration giving 50% of maximal activation) at a peripheral activatory site. Association of choline esters containing a long acyl chain (C7-C12) with the hydrophobic zone in the active site could be deduced from a linear relationship between the size of the acyl group and the inhibitory potency in either spontaneous decarbamoylation or acetylthiocholine hydrolysis. Direct support for laurylcholine binding to the active site might come from the competitive inhibition (Ki 33 microM) of choline-catalysed decarbamoylation by laurylcholine. Moreover, its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE, where there is a greater steric hindrance at the active centre. In further support, the inhibition of pentanoylthiocholine-induced decarbamoylation by laurylcholine was suggested to be due to laurylcholine binding to a central site rather than a peripheral site, similar to the inhibition of spontaneous decarbamoylation by laurylcholine. Supportive data for acetylcholine binding to the active site are provided by the results that acetylcholine is a competitive inhibitor (Ki 7.6 mM) of choline-catalysed decarbamoylation, and its inhibitory action was greater for monomethylcarbamoyl-AChE than for dimethylcarbamoyl-AChE. Meanwhile, choline esters with an acyl group of an intermediate size (C4-C6), more subject to steric exclusion at the active centre, and less associable with the hydrophobic zone, appear to bind preferentially to a peripheral activity site. Thus the multiple effects of choline esters may be governed by hydrophobicity and/or a steric effect exerted by the acyl moiety at the binding sites. PMID:8053896

  14. Binding site and affinity prediction of general anesthetics to protein targets using docking.

    PubMed

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G

    2012-05-01

    The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explored whether a computational method, AutoDock, could serve as such a tool. High-resolution crystal data of water-soluble proteins (cytochrome C, apoferritin, and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus [GLIC]) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (http://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants were compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent cocrystallization data. Docking calculations for 6 general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known 50% effective concentration (EC(50)) values were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC(50) values and octanol/water partition coefficients for the 6 general anesthetics. All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (P = 0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC(50) values for the 6 frequently used anesthetics in GLIC for the site identified in the experimental crystal data (P = 0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these 6 anesthetics' known experimental EC(50) values. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (AutoDock) for both water-soluble and membrane proteins. Correlation of predicted affinity and EC(50) for 6 frequently used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism.

  15. Binding Site and Affinity Prediction of General Anesthetics to Protein Targets Using Docking

    PubMed Central

    Liu, Renyu; Perez-Aguilar, Jose Manuel; Liang, David; Saven, Jeffery G.

    2012-01-01

    Background The protein targets for general anesthetics remain unclear. A tool to predict anesthetic binding for potential binding targets is needed. In this study, we explore whether a computational method, AutoDock, could serve as such a tool. Methods High-resolution crystal data of water soluble proteins (cytochrome C, apoferritin and human serum albumin), and a membrane protein (a pentameric ligand-gated ion channel from Gloeobacter violaceus, GLIC) were used. Isothermal titration calorimetry (ITC) experiments were performed to determine anesthetic affinity in solution conditions for apoferritin. Docking calculations were performed using DockingServer with the Lamarckian genetic algorithm and the Solis and Wets local search method (https://www.dockingserver.com/web). Twenty general anesthetics were docked into apoferritin. The predicted binding constants are compared with those obtained from ITC experiments for potential correlations. In the case of apoferritin, details of the binding site and their interactions were compared with recent co-crystallization data. Docking calculations for six general anesthetics currently used in clinical settings (isoflurane, sevoflurane, desflurane, halothane, propofol, and etomidate) with known EC50 were also performed in all tested proteins. The binding constants derived from docking experiments were compared with known EC50s and octanol/water partition coefficients for the six general anesthetics. Results All 20 general anesthetics docked unambiguously into the anesthetic binding site identified in the crystal structure of apoferritin. The binding constants for 20 anesthetics obtained from the docking calculations correlate significantly with those obtained from ITC experiments (p=0.04). In the case of GLIC, the identified anesthetic binding sites in the crystal structure are among the docking predicted binding sites, but not the top ranked site. Docking calculations suggest a most probable binding site located in the extracellular domain of GLIC. The predicted affinities correlated significantly with the known EC50s for the six commonly used anesthetics in GLIC for the site identified in the experimental crystal data (p=0.006). However, predicted affinities in apoferritin, human serum albumin, and cytochrome C did not correlate with these six anesthetics’ known experimental EC50s. A weak correlation between the predicted affinities and the octanol/water partition coefficients was observed for the sites in GLIC. Conclusion We demonstrated that anesthetic binding sites and relative affinities can be predicted using docking calculations in an automatic docking server (Autodock) for both water soluble and membrane proteins. Correlation of predicted affinity and EC50 for six commonly used general anesthetics was only observed in GLIC, a member of a protein family relevant to anesthetic mechanism. PMID:22392968

  16. AutoSite: an automated approach for pseudo-ligands prediction—from ligand-binding sites identification to predicting key ligand atoms

    PubMed Central

    Ravindranath, Pradeep Anand; Sanner, Michel F.

    2016-01-01

    Motivation: The identification of ligand-binding sites from a protein structure facilitates computational drug design and optimization, and protein function assignment. We introduce AutoSite: an efficient software tool for identifying ligand-binding sites and predicting pseudo ligand corresponding to each binding site identified. Binding sites are reported as clusters of 3D points called fills in which every point is labelled as hydrophobic or as hydrogen bond donor or acceptor. From these fills AutoSite derives feature points: a set of putative positions of hydrophobic-, and hydrogen-bond forming ligand atoms. Results: We show that AutoSite identifies ligand-binding sites with higher accuracy than other leading methods, and produces fills that better matches the ligand shape and properties, than the fills obtained with a software program with similar capabilities, AutoLigand. In addition, we demonstrate that for the Astex Diverse Set, the feature points identify 79% of hydrophobic ligand atoms, and 81% and 62% of the hydrogen acceptor and donor hydrogen ligand atoms interacting with the receptor, and predict 81.2% of water molecules mediating interactions between ligand and receptor. Finally, we illustrate potential uses of the predicted feature points in the context of lead optimization in drug discovery projects. Availability and Implementation: http://adfr.scripps.edu/AutoDockFR/autosite.html Contact: sanner@scripps.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:27354702

  17. Characterization of the binding of 8-anilinonaphthalene sulphonate to rat class Mu GST M1-1

    PubMed Central

    Kinsley, Nichole; Sayed, Yasien; Armstrong, Richard N.; Dirr, Heini W.

    2008-01-01

    Molecular docking and ANS-displacement experiments indicated that 8-anilinonaphthalene sulphonate (ANS) binds the hydrophobic site (H-site) in the active site of dimeric class Mu rGST M1-1. The naphthalene moiety provides most of the van der Waals contacts at the ANS-binding interface while the anilino group is able to sample different rotamers. The energetics of ANS binding were studied by isothermal titration calorimetry (ITC) over the temperature range of 5–30 °C. Binding is both enthalpically and entropically driven and displays a stoichiometry of one ANS molecule per subunit (or H-site). ANS binding is linked to the uptake of 0.5 protons at pH 6.5. Enthalpy of binding depends linearly upon temperature yielding a ΔCp of −80 ± 4 cal K−1 mol−1 indicating the burial of solvent-exposed nonpolar surface area upon ANS-protein complex formation. While ion-pair interactions between the sulfonate moiety of ANS and protein cationic groups may be significant for other ANS-binding proteins, the binding of ANS to rGST M1-1 is primarily hydrophobic in origin. The binding properties are compared with those of other GSTs and ANS-binding proteins. PMID:18703268

  18. Convection, diffusion and reaction in a surface-based biosensor: modeling of cooperativity and binding site competition on the surface and in the hydrogel.

    PubMed

    Lebedev, Konstantin; Mafé, Salvador; Stroeve, Pieter

    2006-04-15

    We study theoretically the transport and kinetic processes underlying the operation of a biosensor (particularly the surface plasmon sensor "Biacore") used to study the surface binding kinetics of biomolecules in solution to immobilized receptors. Unlike previous studies, we concentrate mainly on the modeling of system-specific phenomena rather than on the influence of mass transport limitations on the intrinsic kinetic rate constants determined from binding data. In the first problem, the case of two-site binding where each receptor unit on the surface can accommodate two analyte molecules on two different sites is considered. One analyte molecule always binds first to a specific site. Subsequently, the second analyte molecule can bind to the adjacent unoccupied site. In the second problem, two different analytes compete for one binding site on the same surface receptor. Finally, the third problem considers the case of positive cooperativity among bound molecules in the hydrogel using a simple mean-field approach. The transport in both the flow channel and the hydrogel phases of the biosensor is taken into account in this case (with few exceptions, most previous studies assume a simpler model in which the hydrogel is treated as a planar surface with the receptors). We consider simultaneously diffusion and convection through the flow channel together with diffusion and cooperativity binding on the surface and in the hydrogel. In each case, typical results for the concentration contours of the free and bound molecules in the flow channel and hydrogel regions are presented together with the time-dependent association/dissociation curves and reaction rates. For binding site competition, the analysis predicts overshoot phenomena.

  19. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  20. Caffeine inhibits glucose transport by binding at the GLUT1 nucleotide-binding site

    PubMed Central

    Sage, Jay M.; Cura, Anthony J.; Lloyd, Kenneth P.

    2015-01-01

    Glucose transporter 1 (GLUT1) is the primary glucose transport protein of the cardiovascular system and astroglia. A recent study proposes that caffeine uncompetitive inhibition of GLUT1 results from interactions at an exofacial GLUT1 site. Intracellular ATP is also an uncompetitive GLUT1 inhibitor and shares structural similarities with caffeine, suggesting that caffeine acts at the previously characterized endofacial GLUT1 nucleotide-binding site. We tested this by confirming that caffeine uncompetitively inhibits GLUT1-mediated 3-O-methylglucose uptake in human erythrocytes [Vmax and Km for transport are reduced fourfold; Ki(app) = 3.5 mM caffeine]. ATP and AMP antagonize caffeine inhibition of 3-O-methylglucose uptake in erythrocyte ghosts by increasing Ki(app) for caffeine inhibition of transport from 0.9 ± 0.3 mM in the absence of intracellular nucleotides to 2.6 ± 0.6 and 2.4 ± 0.5 mM in the presence of 5 mM intracellular ATP or AMP, respectively. Extracellular ATP has no effect on sugar uptake or its inhibition by caffeine. Caffeine and ATP displace the fluorescent ATP derivative, trinitrophenyl-ATP, from the GLUT1 nucleotide-binding site, but d-glucose and the transport inhibitor cytochalasin B do not. Caffeine, but not ATP, inhibits cytochalasin B binding to GLUT1. Like ATP, caffeine renders the GLUT1 carboxy-terminus less accessible to peptide-directed antibodies, but cytochalasin B and d-glucose do not. These results suggest that the caffeine-binding site bridges two nonoverlapping GLUT1 endofacial sites—the regulatory, nucleotide-binding site and the cytochalasin B-binding site. Caffeine binding to GLUT1 mimics the action of ATP but not cytochalasin B on sugar transport. Molecular docking studies support this hypothesis. PMID:25715702

  1. Mechanism of human antibody-mediated neutralization of Marburg virus.

    PubMed

    Flyak, Andrew I; Ilinykh, Philipp A; Murin, Charles D; Garron, Tania; Shen, Xiaoli; Fusco, Marnie L; Hashiguchi, Takao; Bornholdt, Zachary A; Slaughter, James C; Sapparapu, Gopal; Klages, Curtis; Ksiazek, Thomas G; Ward, Andrew B; Saphire, Erica Ollmann; Bukreyev, Alexander; Crowe, James E

    2015-02-26

    The mechanisms by which neutralizing antibodies inhibit Marburg virus (MARV) are not known. We isolated a panel of neutralizing antibodies from a human MARV survivor that bind to MARV glycoprotein (GP) and compete for binding to a single major antigenic site. Remarkably, several of the antibodies also bind to Ebola virus (EBOV) GP. Single-particle EM structures of antibody-GP complexes reveal that all of the neutralizing antibodies bind to MARV GP at or near the predicted region of the receptor-binding site. The presence of the glycan cap or mucin-like domain blocks binding of neutralizing antibodies to EBOV GP, but not to MARV GP. The data suggest that MARV-neutralizing antibodies inhibit virus by binding to infectious virions at the exposed MARV receptor-binding site, revealing a mechanism of filovirus inhibition. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Photoabsorption of acridine yellow and proflavin bound to human serum albumin studied by means of quantum mechanics/molecular dynamics.

    PubMed

    Aidas, Kęstutis; Olsen, Jógvan Magnus H; Kongsted, Jacob; Ågren, Hans

    2013-02-21

    Attempting to unravel mechanisms in optical probing of proteins, we have performed pilot calculations of two cationic chromophores-acridine yellow and proflavin-located at different binding sites within human serum albumin, including the two primary drug binding sites as well as a heme binding site. The computational scheme adopted involves classical molecular dynamics simulations of the ligands bound to the protein and subsequent linear response polarizable embedding density functional theory calculations of the excitation energies. A polarizable embedding potential consisting of point charges fitted to reproduce the electrostatic potential and isotropic atomic polarizabilities computed individually for every residue of the protein was used in the linear response calculations. Comparing the calculated aqueous solution-to-protein shifts of maximum absorption energies to available experimental data, we concluded that the cationic proflavin chromophore is likely not to bind albumin at its drug binding site 1 nor at its heme binding site. Although agreement with experimental data could only be obtained in qualitative terms, our results clearly indicate that the difference in optical response of the two probes is due to deprotonation, and not, as earlier suggested, to different binding sites. The ramifications of this finding for design of molecular probes targeting albumin or other proteins is briefly discussed.

  3. Autoradiographic localization of /sup 3/H-paroxetine-labeled serotonin uptake sites in rat brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    De Souza, E.B.; Kuyatt, B.L.

    1987-01-01

    Paroxetine is a potent and selective inhibitor of serotonin uptake into neurons. Serotonin uptake sites have been identified, localized, and quantified in rat brain by autoradiography with 3H-paroxetine; 3H-paroxetine binding in slide-mounted sections of rat forebrain was of high affinity (KD = 10 pM) and the inhibition affinity constant (Ki) values of various drugs in competing 3H-paroxetine binding significantly correlated with their reported potencies in inhibiting synaptosomal serotonin uptake. Serotonin uptake sites labeled by 3H-paroxetine were highly concentrated in the dorsal and median raphe nuclei, central gray, superficial layer of the superior colliculus, lateral septal nucleus, paraventricular nucleus of themore » thalamus, and the islands of Calleja. High concentrations of 3H-paroxetine binding sites were found in brainstem areas containing dopamine (substantia nigra and ventral tegmental area) and norepinephrine (locus coeruleus) cell bodies. Moderate concentrations of 3H-paroxetine binding sites were present in laminae I and IV of the frontal parietal cortex, primary olfactory cortex, olfactory tubercle, regions of the basal ganglia, septum, amygdala, thalamus, hypothalamus, hippocampus, and some brainstem areas including the interpeduncular, trigeminal, and parabrachial nuclei. Lower densities of 3H-paroxetine binding sites were found in other regions of the neocortex and very low to nonsignificant levels of binding were present in white matter tracts and in the cerebellum. Lesioning of serotonin neurons with 3,4-methylenedioxyamphetamine caused large decreases in 3H-paroxetine binding. The autoradiographic distribution of 3H-paroxetine binding sites in rat brain corresponds extremely well to the distribution of serotonin terminals and cell bodies as well as with the pharmacological sites of action of serotonin.« less

  4. Mercury(II) sorption to two Florida Everglades peat--Evidence for strong and weak binding and competition by dissolved organic matter released from the peat

    USGS Publications Warehouse

    Drexel, R. Todd; Haitzer, Markus; Ryan, Joseph N.; Aiken, George R.; Nagy, Kathryn L.

    2002-01-01

    The binding of mercury(II) to two peats from Florida Everglades sites with different rates of mercury methylation was measured at pH 6.0 and 0.01 M ionic strength. The mercury(II) sorption isotherms, measured over a total mercury(II) range of 10-7.4 to 10-3.7 M, showed the competition for mercury(II) between the peat and dissolved organic matter released from the peat and the existence of strong and weak binding sites for mercury(II). Binding was portrayed by a model accounting for strong and weak sites on both the peat and the released DOM. The conditional binding constants (for which the ligand concentration was set as the concentration of reduced sulfur in the organic matter as measured by X-ray absorption near-edge structure spectroscopy) determined for the strong sites on the two peats were similar (Kpeat,s = 1021.8±0.1and 1022.0±0.1 M-1), but less than those determined for the DOM strong sites (Kdom,s = 1022.8±0.1and 1023.2±0.1 M-1), resulting in mercury(II) binding by the DOM at low mercury(II) concentrations. The magnitude of the strong site binding constant is indicative of mercury(II) interaction with organic thiol functional groups. The conditional binding constants determined for the weak peat sites (Kpeat,w = 1011.5±0.1 and 1011.8±0.1 M-1) and weak DOM sites (Kdom,w = 108.7±3.0 and 107.3±4.5 M-1) were indicative of mercury(II) interaction with carboxyl and phenol functional groups.

  5. Allosteric Ligand Binding and Anisotropic Energy Flow in Albumin

    NASA Astrophysics Data System (ADS)

    Dyer, Brian

    2014-03-01

    Protein allostery usually involves propagation of local structural changes through the protein to a remote site. Coupling of structural changes at remote sites is thought to occur through anisotropic energy transport, but the nature of this process is poorly understood. We have studied the relationship between allosteric interactions of remote ligand binding sites of the protein and energy flow through the structure of bovine serum albumin (BSA). We applied ultrafast infrared spectroscopy to probe the flow of energy through the protein backbone following excitation of a heater dye, a metalloporphyrin or malachite green, bound to different binding sites in the protein. We observe ballistic flow through the protein structure following input of thermal energy into the flexible ligand binding sites. We also observe anisotropic heat flow through the structure, without local heating of the rigid helix bundles that connect these sites. We will discuss the implications of this efficient energy transport mechanism with regard to the allosteric propagation of binding energy through the connecting helix structures.

  6. The structure of ribosome-lankacidin complex reveals ribosomal sites for synergistic antibiotics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Auerbach, Tamar; Mermershtain, Inbal; Davidovich, Chen

    2010-04-26

    Crystallographic analysis revealed that the 17-member polyketide antibiotic lankacidin produced by Streptomyces rochei binds at the peptidyl transferase center of the eubacterial large ribosomal subunit. Biochemical and functional studies verified this finding and showed interference with peptide bond formation. Chemical probing indicated that the macrolide lankamycin, a second antibiotic produced by the same species, binds at a neighboring site, at the ribosome exit tunnel. These two antibiotics can bind to the ribosome simultaneously and display synergy in inhibiting bacterial growth. The binding site of lankacidin and lankamycin partially overlap with the binding site of another pair of synergistic antibiotics, themore » streptogramins. Thus, at least two pairs of structurally dissimilar compounds have been selected in the course of evolution to act synergistically by targeting neighboring sites in the ribosome. These results underscore the importance of the corresponding ribosomal sites for development of clinically relevant synergistic antibiotics and demonstrate the utility of structural analysis for providing new directions for drug discovery.« less

  7. Characterization of the Artemisinin Binding Site for Translationally Controlled Tumor Protein (TCTP) by Bioorthogonal Click Chemistry.

    PubMed

    Li, Weichao; Zhou, Yiqing; Tang, Guanghui; Xiao, Youli

    2016-12-21

    Despite the fact that multiple artemisinin-alkylated proteins in Plasmodium falciparum have been identified in recent studies, the alkylation mechanism and accurate binding site of artemisinin-protein interaction have remained elusive. Here, we report the chemical-probe-based enrichment of the artemisinin-binding peptide and characterization of the artemisinin-binding site of P. falciparum translationally controlled tumor protein (TCTP). A peptide fragment within the N-terminal region of TCTP was enriched and found to be alkylated by an artemisinin-derived probe. MS2 fragments showed that artemisinin could alkylate multiple amino acids from Phe12 to Tyr22 of TCTP, which was supported by labeling experiments upon site-directed mutagenesis and computational modeling studies. Taken together, the "capture-and-release" strategy affords consolidated advantages previously unavailable in artemisinin-protein binding site studies, and our results deepened the understanding of the mechanism of protein alkylation via heme-activated artemisinin.

  8. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  9. Gonadotropin binding sites in human ovarian follicles and corpora lutea during the menstrual cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shima, K.; Kitayama, S.; Nakano, R.

    Gonadotropin binding sites were localized by autoradiography after incubation of human ovarian sections with /sup 125/I-labeled gonadotropins. The binding sites for /sup 125/I-labeled human follicle-stimulating hormone (/sup 125/I-hFSH) were identified in the granulosa cells and in the newly formed corpora lutea. The /sup 125/I-labeled human luteinizing hormone (/sup 125/I-hLH) binding to the thecal cells increased during follicular maturation, and a dramatic increase was preferentially observed in the granulosa cells of the large preovulatory follicle. In the corpora lutea, the binding of /sup 125/I-hLH increased from the early luteal phase and decreased toward the late luteal phase. The changes in 3more » beta-hydroxysteroid dehydrogenase activity in the corpora lutea corresponded to the /sup 125/I-hLH binding. Thus, the changes in gonadotropin binding sites in the follicles and corpora lutea during the menstrual cycle may help in some important way to regulate human ovarian function.« less

  10. Thermodynamic Modeling of Donor Splice Site Recognition in pre-mRNA

    NASA Astrophysics Data System (ADS)

    Aalberts, Daniel P.; Garland, Jeffrey A.

    2004-03-01

    When eukaryotic genes are edited by the spliceosome, the first step in intron recognition is the binding of a U1 snRNA with the donor (5') splice site. We model this interaction thermodynamically to identify splice sites. Applied to a set of 65 annotated genes, our Finding with Binding method achieves a significant separation between real and false sites. Analyzing binding patterns allows us to discard a large number of decoy sites. Our results improve statistics-based methods for donor site recognition, demonstrating the promise of physical modeling to find functional elements in the genome.

  11. Labeling by ( sup 3 H)1,3-di(2-tolyl)guanidine of two high affinity binding sites in guinea pig brain: Evidence for allosteric regulation by calcium channel antagonists and pseudoallosteric modulation by sigma ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rothman, R.B.; Reid, A.; Mahboubi, A.

    1991-02-01

    Equilibrium binding studies with the sigma receptor ligand ({sup 3}H)1,3-di(2-tolyl)guanidine (({sup 3}H)DTG) demonstrated two high affinity binding sites in membranes prepared from guinea pig brain. The apparent Kd values of DTG for sites 1 and 2 were 11.9 and 37.6 nM, respectively. The corresponding Bmax values were 1045 and 1423 fmol/mg of protein. Site 1 had high affinity for (+)-pentazocine, haloperidol, (R)-(+)-PPP, carbepentane, and other sigma ligands, suggesting a similarity with the dextromethorphan/sigma 1 binding site described by Musacchio et al. (Life Sci. 45:1721-1732 (1989)). Site 2 had high affinity for DTG and haloperidol (Ki = 36.1 nM) and lowmore » affinity for most other sigma ligands. Kinetic experiments demonstrated that ({sup 3}H)DTG dissociated in a biphasic manner from both site 1 and site 2. DTG and haloperidol increased the dissociation rate of ({sup 3}H)DTG from site 1 and site 2, demonstrating the presence of pseudoallosteric interactions. Inorganic calcium channel blockers such as Cd2+ selectively increased the dissociation rate of ({sup 3}H)DTG from site 2, suggesting an association of this binding site with calcium channels.« less

  12. Binding of the cyclic AMP receptor protein of Escherichia coli and DNA bending at the P4 promoter of pBR322.

    PubMed

    Brierley, I; Hoggett, J G

    1992-07-01

    The binding of the Escherichia coli cyclic AMP receptor protein (CRP) to its specific site on the P4 promoter of pBR322 has been studied by gel electrophoresis. Binding to the P4 site was about 40-50-fold weaker than to the principal CRP site on the lactose promoter at both low (0.01 M) and high (0.1 M) ionic strengths. CRP-induced bending at the P4 site was investigated from the mobilities of CRP bound to circularly permuted P4 fragments. The estimated bending angle, based on comparison with Zinkel & Crothers [(1990) Biopolymers 29, 29-38] A-tract bending standards, was found to be approximately 96 degrees, similar to that found for binding to the lac site. These observations suggest that there is not a simple relationship between strength of CRP binding and the extent of induced bending for different CRP sites. The apparent centre of bending in P4 is displaced about 6-8 bp away from the conserved TGTGA sequence and the P4 transcription start site.

  13. Receptor binding sites for atrial natriuretic factor are expressed by brown adipose tissue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bacay, A.C.; Mantyh, C.R.; Vigna, S.R.

    1988-09-01

    To explore the possibility that atrial natriuretic factor (ANF) is involved in thermoregulation we used quantitative receptor autoradiography and homogenate receptor binding assays to identify ANF bindings sites in neonatal rat and sheep brown adipose tissue, respectively. Using quantitative receptor autoradiography were were able to localize high levels of specific binding sites for {sup 125}I-rat ANF in neonatal rat brown adipose tissue. Homogenate binding assays on sheep brown fat demonstrated that the radioligand was binding to the membrane fraction and that the specific binding was not due to a lipophilic interaction between {sup 125}I-rat ANF and brown fat. Specific bindingmore » of {sup 125}I-rat ANF to the membranes of brown fat cells was inhibited by unlabeled rat ANF with a Ki of 8.0 x 10(-9) M, but not by unrelated peptides. These studies demonstrate that brown fat cells express high levels of ANF receptor binding sites in neonatal rat and sheep and suggest that ANF may play a role in thermoregulation.« less

  14. Probing the binding of fluoxetine hydrochloride to human serum albumin by multispectroscopic techniques

    NASA Astrophysics Data System (ADS)

    Katrahalli, Umesha; Jaldappagari, Seetharamappa; Kalanur, Shankara S.

    2010-01-01

    The interaction between human serum albumin (HSA) and fluoxetine hydrochloride (FLX) have been studied by using different spectroscopic techniques viz., fluorescence, UV-vis absorption, circular dichroism and FTIR under simulated physiological conditions. Fluorescence results revealed the presence of static type of quenching mechanism in the binding of FLX to HSA. The values of binding constant, K of FLX-HSA were evaluated at 289, 300 and 310 K and were found to be 1.90 × 10 3, 1.68 × 10 3 and 1.45 × 10 3 M -1, respectively. The number of binding sites, n was noticed to be almost equal to unity thereby indicating the presence of a single class of binding site for FLX on HSA. Based on the thermodynamic parameters, Δ H0 and Δ S0 nature of binding forces operating between HSA and FLX were proposed. Spectral results revealed the conformational changes in protein upon interaction. Displacement studies indicated the site I as the main binding site for FLX on HSA. The effect of common ions on the binding of FLX to HSA was also investigated.

  15. Cooperative interplay of let-7 mimic and HuR with MYC RNA

    PubMed Central

    Gunzburg, Menachem J; Sivakumaran, Andrew; Pendini, Nicole R; Yoon, Je-Hyun; Gorospe, Myriam; Wilce, Matthew Cj; Wilce, Jacqueline A

    2015-01-01

    Both RNA-binding proteins (RBP) and miRNA play important roles in the regulation of mRNA expression, often acting together to regulate a target mRNA. In some cases the RBP and miRNA have been reported to act competitively, but in other instances they function cooperatively. Here, we investigated HuR function as an enhancer of let-7-mediated translational repression of c-Myc despite the separation of their binding sites. Using an in vitro system, we determined that a let-7 mimic, consisting of single-stranded (ss)DNA complementary to the let-7 binding site, enhanced the affinity of HuR for a 122-nt MYC RNA encompassing both binding sites. This finding supports the biophysical principle of cooperative binding by an RBP and miRNA purely through interactions at distal mRNA binding sites. PMID:26177105

  16. Two classes of binding sites for [3H]substance P in rat cerebral cortex.

    PubMed

    Geraghty, D P; Burcher, E

    1993-01-22

    The binding characteristics of [3H]substance P ([3H]SP) were investigated in membranes prepared from rat cerebral cortex. Binding of [3H]SP reached equilibrium after 50 min at 25 degrees C and was saturable at 8 nM. Saturation data could be resolved into high affinity (equilibrium dissociation constant, Kd, 0.22 nM) and low affinity sites (Kd, 2.65 nM). The low affinity sites were more numerous than the high affinity sites, with a ratio of 4:1. The non-hydrolyzable GTP analogue GppNHp had no effect on binding, indicating that the high and low affinity sites are not guanine nucleotide-regulated states of the same (NK-1) receptor. The low affinity sites are unlikely to represent NK-3 receptors since coincubation with the selective NK-3 receptor agonist senktide did not alter the biphasic nature of [3H]SP binding. The rank order of potency for inhibition of [3H]SP (2 nM) binding was SP > or = [Sar9, Met(O2)11]-SP > or = physalaemin > SP(3-11) > NP gamma = [Ala3]-SP > or = SP(4-11) > or = NPK > or = SP(5-11) > or = NKB approximately NKA > SP(1-9), compatible with binding to an NK-1 site. N-terminal fragments and non-amidated analogues were ineffective competitors for [3H]SP binding. However, competition data for several peptides including substance P (SP) and the NK-1 selective agonist [Sar9, Met(O2)11]-SP could be resolved into two components.(ABSTRACT TRUNCATED AT 250 WORDS)

  17. A web server for analysis, comparison and prediction of protein ligand binding sites.

    PubMed

    Singh, Harinder; Srivastava, Hemant Kumar; Raghava, Gajendra P S

    2016-03-25

    One of the major challenges in the field of system biology is to understand the interaction between a wide range of proteins and ligands. In the past, methods have been developed for predicting binding sites in a protein for a limited number of ligands. In order to address this problem, we developed a web server named 'LPIcom' to facilitate users in understanding protein-ligand interaction. Analysis, comparison and prediction modules are available in the "LPIcom' server to predict protein-ligand interacting residues for 824 ligands. Each ligand must have at least 30 protein binding sites in PDB. Analysis module of the server can identify residues preferred in interaction and binding motif for a given ligand; for example residues glycine, lysine and arginine are preferred in ATP binding sites. Comparison module of the server allows comparing protein-binding sites of multiple ligands to understand the similarity between ligands based on their binding site. This module indicates that ATP, ADP and GTP ligands are in the same cluster and thus their binding sites or interacting residues exhibit a high level of similarity. Propensity-based prediction module has been developed for predicting ligand-interacting residues in a protein for more than 800 ligands. In addition, a number of web-based tools have been integrated to facilitate users in creating web logo and two-sample between ligand interacting and non-interacting residues. In summary, this manuscript presents a web-server for analysis of ligand interacting residue. This server is available for public use from URL http://crdd.osdd.net/raghava/lpicom .

  18. Free Energy Simulations of Ligand Binding to the Aspartate Transporter GltPh

    PubMed Central

    Heinzelmann, Germano; Baştuğ, Turgut; Kuyucak, Serdar

    2011-01-01

    Glutamate/Aspartate transporters cotransport three Na+ and one H+ ions with the substrate and countertransport one K+ ion. The binding sites for the substrate and two Na+ ions have been observed in the crystal structure of the archeal homolog GltPh, while the binding site for the third Na+ ion has been proposed from computational studies and confirmed by experiments. Here we perform detailed free energy simulations of GltPh, giving a comprehensive characterization of the substrate and ion binding sites, and calculating their binding free energies in various configurations. Our results show unequivocally that the substrate binds after the binding of two Na+ ions. They also shed light into Asp/Glu selectivity of GltPh, which is not observed in eukaryotic glutamate transporters. PMID:22098736

  19. Variola Virus IL-18 Binding Protein Interacts with Three Human IL-18 Residues That Are Part of a Binding Site for Human IL-18 Receptor Alpha Subunit

    PubMed Central

    Meng, Xiangzhi; Leman, Michael; Xiang, Yan

    2007-01-01

    Interleukin-18 (IL-18) plays an important role in host defense against microbial pathogens. Many poxviruses encode homologous IL-18 binding proteins (IL-18BP) that neutralize IL-18 activity. Here, we examined whether IL-18BP neutralizes IL-18 activity by binding to the same region of IL-18 where IL-18 receptor (IL-18R) binds. We introduced alanine substitutions to known receptor binding sites of human IL18, and found that only the substitution of Leu5 reduced the binding affinity of IL-18 with IL-18BP of variola virus (varvIL-18BP) by more than 4-fold. The substitutions of Lys53 and Ser55, which were not previously known to be part of the receptor binding site but that are spatially adjacent to Leu5, reduced the binding affinity to varvIL-18BP by approximately 100- and 7-fold, respectively. These two substitutions also reduced the binding affinity with human IL-18R alpha subunit (hIL-18Rα) by 4- and 2-fold, respectively. Altogether, our data shows that varvIL-18BP prevents IL-18 from binding to IL-18R by interacting with three residues that are part of the binding site for hIL-18Rα. PMID:16979683

  20. Core Binding Site of a Thioflavin-T-Derived Imaging Probe on Amyloid β Fibrils Predicted by Computational Methods.

    PubMed

    Kawai, Ryoko; Araki, Mitsugu; Yoshimura, Masashi; Kamiya, Narutoshi; Ono, Masahiro; Saji, Hideo; Okuno, Yasushi

    2018-05-16

    Development of new diagnostic imaging probes for Alzheimer's disease, such as positron emission tomography (PET) and single photon emission computed tomography (SPECT) probes, has been strongly desired. In this study, we investigated the most accessible amyloid β (Aβ) binding site of [ 123 I]IMPY, a Thioflavin-T-derived SPECT probe, using experimental and computational methods. First, we performed a competitive inhibition assay with Orange-G, which recognizes the KLVFFA region in Aβ fibrils, suggesting that IMPY and Orange-G bind to different sites in Aβ fibrils. Next, we precisely predicted the IMPY binding site on a multiple-protofilament Aβ fibril model using computational approaches, consisting of molecular dynamics and docking simulations. We generated possible IMPY-binding structures using docking simulations to identify candidates for probe-binding sites. The binding free energy of IMPY with the Aβ fibril was calculated by a free energy simulation method, MP-CAFEE. These computational results suggest that IMPY preferentially binds to an interfacial pocket located between two protofilaments and is stabilized mainly through hydrophobic interactions. Finally, our computational approach was validated by comparing it with the experimental results. The present study demonstrates the possibility of computational approaches to screen new PET/SPECT probes for Aβ imaging.

  1. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  2. Site-directed mutagenesis of the regulatory light-chain Ca2+/Mg2+ binding site and its role in hybrid myosins

    NASA Astrophysics Data System (ADS)

    Reinach, Fernando C.; Nagai, Kiyoshi; Kendrick-Jones, John

    1986-07-01

    The regulatory light chains, small polypeptides located on the myosin head, regulate the interaction of myosin with actin in response to either Ca2+ or phosphorylation. The demonstration that the regulatory light chains on scallop myosin can be replaced by light chains from other myosins has allowed us to compare the functional capabilities of different light chains1, but has not enabled us to probe the role of features, such as the Ca2+/Mg2+ binding site, that are common to all of them. Here, we describe the use of site-directed mutagenesis to study the function of that site. We synthesized the chicken skeletal myosin light chain in Escherichia coli and constructed mutants with substitutions within the Ca2+/Mg2+ binding site. When the aspartate residues at the first and sixth Ca2+ coordination positions are replaced by uncharged alanines, the light chains have a reduced Ca2+ binding capacity but still bind to scallop myosin with high affinity. Unlike the wild-type skeletal light chain which inhibits myosin interaction with actin, the mutants activate it. Thus, an intact Ca2+/Mg2+ binding site in the N-terminal region of the light chain is essential for regulating the interaction of myosin with actin.

  3. Strong Ligand-Protein Interactions Derived from Diffuse Ligand Interactions with Loose Binding Sites.

    PubMed

    Marsh, Lorraine

    2015-01-01

    Many systems in biology rely on binding of ligands to target proteins in a single high-affinity conformation with a favorable ΔG. Alternatively, interactions of ligands with protein regions that allow diffuse binding, distributed over multiple sites and conformations, can exhibit favorable ΔG because of their higher entropy. Diffuse binding may be biologically important for multidrug transporters and carrier proteins. A fine-grained computational method for numerical integration of total binding ΔG arising from diffuse regional interaction of a ligand in multiple conformations using a Markov Chain Monte Carlo (MCMC) approach is presented. This method yields a metric that quantifies the influence on overall ligand affinity of ligand binding to multiple, distinct sites within a protein binding region. This metric is essentially a measure of dispersion in equilibrium ligand binding and depends on both the number of potential sites of interaction and the distribution of their individual predicted affinities. Analysis of test cases indicates that, for some ligand/protein pairs involving transporters and carrier proteins, diffuse binding contributes greatly to total affinity, whereas in other cases the influence is modest. This approach may be useful for studying situations where "nonspecific" interactions contribute to biological function.

  4. Binding of the respiratory chain inhibitor ametoctradin to the mitochondrial bc1 complex.

    PubMed

    Fehr, Marcus; Wolf, Antje; Stammler, Gerd

    2016-03-01

    Ametoctradin is an agricultural fungicide that inhibits the mitochondrial bc1 complex of oomycetes. The bc1 complex has two quinone binding sites that can be addressed by inhibitors. Depending on their binding sites and binding modes, the inhibitors show different degrees of cross-resistance that need to be considered when designing spray programmes for agricultural fungicides. The binding site of ametoctradin was unknown. Cross-resistance analyses, the reduction of isolated Pythium sp. bc1 complex in the presence of different inhibitors and molecular modelling studies were used to analyse the binding site and binding mode of ametoctradin. All three approaches provide data supporting the argument that ametoctradin binds to the Pythium bc1 complex similarly to stigmatellin. The binding mode of ametoctradin differs from other agricultural fungicides such as cyazofamid and the strobilurins. This explains the lack of cross-resistance with strobilurins and related inhibitors, where resistance is mainly caused by G143A amino acid exchange. Accordingly, mixtures or alternating applications of these fungicides and ametoctradin can help to minimise the risk of the emergence of new resistant isolates. © 2015 Society of Chemical Industry.

  5. Batrachotoxin Changes the Properties of the Muscarinic Receptor in Rat Brain and Heart: Possible Interaction(s) between Muscarinic Receptors and Sodium Channels

    NASA Astrophysics Data System (ADS)

    Cohen-Armon, Malca; Kloog, Yoel; Henis, Yoav I.; Sokolovsky, Mordechai

    1985-05-01

    The effects of Na+-channel activator batrachotoxin (BTX) on the binding properties of muscarinic receptors in homogenates of rat brain and heart were studied. BTX enhanced the affinity for the binding of the agonists carbamoylcholine and acetylcholine to the muscarinic receptors in brainstem and ventricle, but not in the cerebral cortex. Analysis of the data according to a two-site model for agonist binding indicated that the effect of BTX was to increase the affinity of the agonists to the high-affinity site. Guanyl nucleotides, known to induce interconversion of high-affinity agonist binding sites to the low-affinity state, canceled the effect of BTX on carbamoylcholine and acetylcholine binding. BTX had no effect on the binding of the agonist oxotremorine or on the binding of the antagonist [3H]-N-methyl-4-piperidyl benzilate. The local anesthetics dibucaine and tetracaine antagonized the effect of BTX on the binding of muscarinic agonists at concentrations known to inhibit the activation of Na+ channels by BTX. On the basis of these findings, we propose that in specific tissues the muscarinic receptors may interact with the BTX binding site (Na+ channels).

  6. Proflavine acts as a Rev inhibitor by targeting the high-affinity Rev binding site of the Rev responsive element of HIV-1.

    PubMed

    DeJong, Eric S; Chang, Chia-en; Gilson, Michael K; Marino, John P

    2003-07-08

    Rev is an essential regulatory HIV-1 protein that binds the Rev responsive element (RRE) within the env gene of the HIV-1 RNA genome, activating the switch between viral latency and active viral replication. Previously, we have shown that selective incorporation of the fluorescent probe 2-aminopurine (2-AP) into a truncated form of the RRE sequence (RRE-IIB) allowed the binding of an arginine-rich peptide derived from Rev and aminoglycosides to be characterized directly by fluorescence methods. Using these fluorescence and nuclear magnetic resonance (NMR) methods, proflavine has been identified, through a limited screen of selected small heterocyclic compounds, as a specific and high-affinity RRE-IIB binder which inhibits the interaction of the Rev peptide with RRE-IIB. Direct and competitive 2-AP fluorescence binding assays reveal that there are at least two classes of proflavine binding sites on RRE-IIB: a high-affinity site that competes with the Rev peptide for binding to RRE-IIB (K(D) approximately 0.1 +/- 0.05 microM) and a weaker binding site(s) (K(D) approximately 1.1 +/- 0.05 microM). Titrations of RRE-IIB with proflavine, monitored using (1)H NMR, demonstrate that the high-affinity proflavine binding interaction occurs with a 2:1 (proflavine:RRE-IIB) stoichiometry, and NOEs observed in the NOESY spectrum of the 2:1 proflavine.RRE-IIB complex indicate that the two proflavine molecules bind specifically and close to each other within a single binding site. NOESY data further indicate that formation of the 2:1 proflavine.RRE-IIB complex stabilizes base pairing and stacking within the internal purine-rich bulge of RRE-IIB in a manner analogous to what has been observed in the Rev peptide.RRE-IIB complex. The observation that proflavine competes with Rev for binding to RRE-IIB by binding as a dimer to a single high-affinity site opens the possibility for rational drug design based on linking and modifying it and related compounds.

  7. Mapping of a binding site for ATP within the extracellular region of the Torpedo nicotinic acetylcholine receptor beta-subunit.

    PubMed

    Schrattenholz, A; Roth, U; Godovac-Zimmermann, J; Maelicke, A

    1997-10-28

    Using 2,8,5'-[3H]ATP as a direct photoaffinity label for membrane-bound nicotinic acetylcholine receptor (nAChR) from Torpedo marmorata, we have identified a binding site for ATP in the extracellular region of the beta-subunit of the receptor. Photolabeling was completely inhibited in the presence of saturating concentrations of nonradioactive ATP, whereas neither the purinoreceptor antagonists suramin, theophyllin, and caffeine nor the nAChR antagonists alpha-bungarotoxin and d-tubocurarine affected the labeling reaction. Competitive and noncompetitive nicotinic agonists and Ca2+ increased the yield of the photoreaction by up to 50%, suggesting that the respective binding sites are allosterically linked with the ATP site. The dissociation constant KD of binding of ATP to the identified site on the nAChR was of the order of 10(-4) M. Sites of labeling were found in the sequence regions Leu11-Pro17 and Asp152-His163 of the nAChR beta-subunit. These regions may represent parts of a single binding site for ATP, which is discontinuously distributed within the primary structure of the N-terminal extracellular domain. The existence of an extracellular binding site for ATP confirms, on the molecular level, that this nucleotide can directly act on nicotinic receptors, as has been suggested from previous electrophysiological and biochemical studies.

  8. Site-specific cleavage of the transactivation response site of human immunodeficiency virus RNA with a tat-based chemical nuclease.

    PubMed Central

    Jayasena, S D; Johnston, B H

    1992-01-01

    tat, an essential transactivator of gene transcription in the human immunodeficiency virus (HIV), is believed to activate viral gene expression by binding to the transactivation response (TAR) site located at the 5' end of all viral mRNAs. The TAR element forms a stem-loop structure containing a 3-nucleotide bulge that is the site for tat binding and is required for transactivation. Here we report the synthesis of a site-specific chemical ribonuclease based on the TAR binding domain of the HIV type 1 (HIV-1) tat. A peptide consisting of this 24-amino acid domain plus an additional C-terminal cysteine residue was chemically synthesized and covalently linked to 1,10-phenanthroline at the cysteine residue. The modified peptide binds to TAR sequences of both HIV-1 and HIV-2 and, in the presence of cupric ions and a reducing agent, cleaves these RNAs at specific sites. Cleavage sites on TAR sequences are consistent with peptide binding to the 3-nucleotide bulge, and the relative displacement of cleavage sites on the two strands suggests peptide binding to the major groove of the RNA. These results and existing evidence of the rapid cellular uptake of tat-derived peptides suggest that chemical nucleases based on tat may be useful for inactivating HIV mRNA in vivo. Images PMID:1565648

  9. Fast and automated functional classification with MED-SuMo: an application on purine-binding proteins.

    PubMed

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-04-01

    Ligand-protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects.

  10. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase

    PubMed Central

    Galka, Marek M.; Rajagopalan, Nandhakishore; Buhrow, Leann M.; Nelson, Ken M.; Switala, Jacek; Cutler, Adrian J.; Palmer, David R. J.; Loewen, Peter C.; Abrams, Suzanne R.; Loewen, Michele C.

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation. PMID:26197050

  11. Identification of Interactions between Abscisic Acid and Ribulose-1,5-Bisphosphate Carboxylase/Oxygenase.

    PubMed

    Galka, Marek M; Rajagopalan, Nandhakishore; Buhrow, Leann M; Nelson, Ken M; Switala, Jacek; Cutler, Adrian J; Palmer, David R J; Loewen, Peter C; Abrams, Suzanne R; Loewen, Michele C

    2015-01-01

    Abscisic acid ((+)-ABA) is a phytohormone involved in the modulation of developmental processes and stress responses in plants. A chemical proteomics approach using an ABA mimetic probe was combined with in vitro assays, isothermal titration calorimetry (ITC), x-ray crystallography and in silico modelling to identify putative (+)-ABA binding-proteins in crude extracts of Arabidopsis thaliana. Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) was identified as a putative ABA-binding protein. Radiolabelled-binding assays yielded a Kd of 47 nM for (+)-ABA binding to spinach Rubisco, which was validated by ITC, and found to be similar to reported and experimentally derived values for the native ribulose-1,5-bisphosphate (RuBP) substrate. Functionally, (+)-ABA caused only weak inhibition of Rubisco catalytic activity (Ki of 2.1 mM), but more potent inhibition of Rubisco activation (Ki of ~ 130 μM). Comparative structural analysis of Rubisco in the presence of (+)-ABA with RuBP in the active site revealed only a putative low occupancy (+)-ABA binding site on the surface of the large subunit at a location distal from the active site. However, subtle distortions in electron density in the binding pocket and in silico docking support the possibility of a higher affinity (+)-ABA binding site in the RuBP binding pocket. Overall we conclude that (+)-ABA interacts with Rubisco. While the low occupancy (+)-ABA binding site and weak non-competitive inhibition of catalysis may not be relevant, the high affinity site may allow ABA to act as a negative effector of Rubisco activation.

  12. The correlation between ouabain binding and potassium pump inhibition in human and sheep erythrocytes.

    PubMed Central

    Joiner, C H; Lauf, P K

    1978-01-01

    1. [3H]Ouabain binding to human and sheep red blood cells was shown to be specific for receptors associated with Na/K transport. Virtually all tritium binding was abolished by dilution with unlabelled drug. Saturation levels of binding were independent of glycoside concentration and were identical to those associated with 100% inhibition of K pumping. 2. [3H]Ouabain binding and 42K influx were measured simultaneously in order to correlate the degree of K pump inhibition with the amount of glycoside bound. Results by this method agreed exactly with those obtained by pre-exposing cells to drug, followed by washing and then measuring K influx. 3. Plots of [3H]oubain binding vs. K pump inhibition were rectilinear for human and low K (LK) sheep red cells, indicating one glycoside receptor per K pump site and functional homogeneity of pump sites. High K (HK) sheep red cells exhibited curved plots of binding versus inhibition, which were best explained in terms of one receptor per pump, but a heterogeneous population of pump sites. 4. External K reduced the rate of glycoside binding, but did not alter the relationship between binding and inhibition. 5. The number of K pump sites was estimated as 450--500 per human cell and 30--50 per LK sheep cell. HK sheep cells had 90--130 sites per cell, of which eighty to ninety were functionally dominant. The number of K pump sites on LK sheep cells was not changed by anti-L, although the maximum velocity of pump turnover was increased. PMID:722573

  13. Identification of thyroid hormone receptor binding sites and target genes using ChIP-on-chip in developing mouse cerebellum.

    PubMed

    Dong, Hongyan; Yauk, Carole L; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R Thomas; Lambert, Iain; Wade, Michael G

    2009-01-01

    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRbeta) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning -8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5') of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRbeta binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding.

  14. Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

    PubMed Central

    Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

    2018-01-01

    Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

  15. Fast and automated functional classification with MED-SuMo: An application on purine-binding proteins

    PubMed Central

    Doppelt-Azeroual, Olivia; Delfaud, François; Moriaud, Fabrice; de Brevern, Alexandre G

    2010-01-01

    Ligand–protein interactions are essential for biological processes, and precise characterization of protein binding sites is crucial to understand protein functions. MED-SuMo is a powerful technology to localize similar local regions on protein surfaces. Its heuristic is based on a 3D representation of macromolecules using specific surface chemical features associating chemical characteristics with geometrical properties. MED-SMA is an automated and fast method to classify binding sites. It is based on MED-SuMo technology, which builds a similarity graph, and it uses the Markov Clustering algorithm. Purine binding sites are well studied as drug targets. Here, purine binding sites of the Protein DataBank (PDB) are classified. Proteins potentially inhibited or activated through the same mechanism are gathered. Results are analyzed according to PROSITE annotations and to carefully refined functional annotations extracted from the PDB. As expected, binding sites associated with related mechanisms are gathered, for example, the Small GTPases. Nevertheless, protein kinases from different Kinome families are also found together, for example, Aurora-A and CDK2 proteins which are inhibited by the same drugs. Representative examples of different clusters are presented. The effectiveness of the MED-SMA approach is demonstrated as it gathers binding sites of proteins with similar structure-activity relationships. Moreover, an efficient new protocol associates structures absent of cocrystallized ligands to the purine clusters enabling those structures to be associated with a specific binding mechanism. Applications of this classification by binding mode similarity include target-based drug design and prediction of cross-reactivity and therefore potential toxic side effects. PMID:20162627

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Beaumont, K.; Vaughn, D.A.; Fanestil, D.D.

    Thiazides and related diuretics inhibit NaCl reabsorption in the distal tubule through an unknown mechanism. The authors report here that ({sup 3}H)metolazone, a diuretic with a thiazide-like mechanism of action, labels a site in rat kidney membranes that has characteristics of the thiazide-sensitive ion transporter. ({sup 3}H)Metolazone bound with high affinity to a site with a density of 0.717 pmol/mg of protein in kidney membranes. The binding site was localized to the renal cortex, with little or not binding in other kidney regions and 11 other tissues. The affinities of thiazide-type diuretics for this binding site were significantly correlated withmore » their clinical potency. Halide anions specifically inhibited high-affinity binding of ({sup 3}H)metolazone to this site. ({sup 3})Metolazone also bound with lower affinity to sites present in kidney as well as in liver, testis, lung, brain, heart, and other tissues. Calcium antagonists and certain smooth muscle relaxants had K{sub i} values of 0.6-10 {mu}M for these low-affinity sites, which were not inhibited by most of the thiazide diuretics tested. Properties of the high-affinity ({sup 3}H)metolazone binding site are consistent with its identity as the receptor for thiazide-type diuretics.« less

  17. Human serum albumin binding assay based on displacement of a non selective fluorescent inhibitor.

    PubMed

    Thorarensen, Atli; Sarver, Ronald W; Tian, Fang; Ho, Andrea; Romero, Donna L; Marotti, Keith R

    2007-08-15

    In this paper, we describe a fluorescent antibacterial analog, 6, with utility as a competition probe to determine affinities of other antibacterial analogs for human serum albumin (HSA). Analog 6 bound to HSA with an affinity of 400+/-100 nM and the fluorescence was environmentally sensitive. With 370 nm excitation, environmental sensitivity was indicated by a quenching of the 530 nm emission when the probe bound to HSA. Displacement of dansylsarcosine from HSA by 6 indicated it competed with compounds that bound at site II (ibuprofen binding site) on HSA. Analog 6 also shifted the NMR peaks of an HSA bound oleic acid molecule that itself was affected by compounds that bound at site II. In addition to binding at site II, 6 interacted at site I (warfarin binding site) as indicated by displacement of dansylamide and the shifting of NMR peaks of an HSA bound oleic acid molecule affected by warfarin site binding. Additional evidence for multiple site interaction was discovered when a percentage of 6 could be displaced by either ibuprofen or phenylbutazone. A competition assay was established using 6 to determine relative affinities of other antibacterial inhibitors for HSA.

  18. The D-galactose specific lectin of field bean (Dolichos lablab) seed binds sugars with extreme negative cooperativity and half-of-the-sites binding.

    PubMed

    Rao, Devavratha H; Gowda, Lalitha R

    2012-08-15

    The field bean (Dolichos lablab) lectin designated as PPO-haemagglutinin (DLL-II) is bifunctional, exhibiting both polyphenol oxidase and haemagglutinating activity. The lectin is unusual in that it binds galactose (Gal), lactose (Lac) and N-acetylgalactosamine (GalNAc) only in the presence of (NH₄)₂SO₄ and exhibits negative cooperativity and half-of-the-sites binding. Circular dichroism, isothermal titration calorimetry and fluorescence quenching were used to assess the sugar binding in the presence of (NH₄)₂O₄. Comparison of the near-UV CD spectra with and without bound sugar revealed ligand induced conformational changes. The intrinsic fluorescence quenching data indicate that DLL-II exhibits weak binding to Gal in the presence of (NH₄)₂SO₄ with a stoichiometry of one bound ligand per dimer. ITC data fitted using a two sets of sites binding model presented a similar picture. The K(a)'s for Gal, Lac and GalNAc in the presence of (NH₄)₂SO₄ were 0.16±0.002, 0.21±0.004 and 8.45±0.78 (×10⁻³) M⁻¹ respectively. The Hill plot for the binding of these sugars to DLL-II was curvilinear with a tangent slope <1.0 indicating negative cooperativity. DLL-II thus exhibits half-of-the-site binding, an extreme form of negative cooperativity in which the second ligand does not bind at all. This is the first report of a legume lectin, exhibiting half-of-the-sites binding. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Negatively Cooperative Binding of High Density Lipoprotein to the HDL Receptor SR-BI†

    PubMed Central

    Nieland, Thomas J.F.; Xu, Shangzhe; Penman, Marsha; Krieger, Monty

    2011-01-01

    Scavenger receptor class B, type I (SR-BI) is a high-density lipoprotein (HDL) receptor, which also binds low density lipoprotein (LDL), and mediates the cellular selective uptake of cholesteryl esters from lipoproteins. SR-BI also is a co-receptor for hepatitis C virus and a signaling receptor that regulates cell metabolism. Many investigators have reported that lipoproteins bind to SR-BI via a single class of independent (not interacting), high affinity binding sites (one site model). We have re-investigated the ligand concentration dependence of 125I-HDL binding to SR-BI and SR-BI-mediated specific uptake of [3H]CE from [3H]CE-HDL using an expanded range of ligand concentrations (<1 µg protein/ml, lower than previously reported). Scatchard and non-linear least squares model fitting analyses of the binding and uptake data were both inconsistent with a single class of independent binding sites binding univalent lipoprotein ligands. The data are best fit by models in which SR-BI has either two independent classes of binding sites, or one class of sites exhibiting negative cooperativity due to either classic allostery or ensemble effects (‘ lattice model’). Similar results were observed for LDL. Application of the ‘infinite dilution’ dissociation rate method established that the binding of 125I-HDL to SR-BI at 4 °C exhibits negative cooperativity. The unexpected complexity of the interactions of lipoproteins with SR-BI should be taken into account when interpreting the results of experiments that explore the mechanism(s) by which SR-BI mediates ligand binding, lipid transport and cell signaling. PMID:21254782

  20. Biological Activity and Binding Site Characteristics of the PA1b Entomotoxin on Insects from Different Orders

    PubMed Central

    Gressent, Frédéric; Duport, Gabrielle; Rahioui, Isabelle; Pauchet, Yannick; Bolland, Patrice; Specty, Olivier; Rahbe, Yvan

    2007-01-01

    The aim of this work was to investigate both the biological activity of an entomotoxin, the pea albumin 1b (PA1b), and the presence or absence of its binding site within an array of insect species. The data obtained showed that insect sensitivity was not related to its taxonomic position. Moreover, PA1b was not toxic to several tested microorganisms. However, the binding site was found to be conserved among very different insects, displaying similar thermodynamic constants regardless of the in vivo species sensitivity. The binding site alone was, therefore, not sufficient for toxicity. One exception was the pea weevil, Bruchus pisorum, which was the only tested species without any detectable binding activity. These findings indicate that the binding site probably has an important endogenous function in insects and that adaptation to pea seeds resulted in the elimination of the toxin binding activity in two independent insect lineages. Other mechanisms are likely to interact with the toxin effects, although they are still largely unknown, but there is no evidence of any specific degradation of PA1b in the midgut of insects insensitive to the toxin, such as Drosophila melanogaster or Mamestra brassicae. PMID:20331395

Top