Metabolism: Part II. The Tricarboxylic Acid (TCA), Citric Acid, or Krebs Cycle.
ERIC Educational Resources Information Center
Bodner, George M.
1986-01-01
Differentiates the tricarboxylic acid (TCA) cycle (or Krebs cycle) from glycolysis, and describes the bridge between the two as being the conversion of pyruvate into acetyl coenzyme A. Discusses the eight steps in the TCA cycle, the results of isotopic labeling experiments, and the net effects of the TCA cycle. (TW)
The emerging role and targetability of the TCA cycle in cancer metabolism.
Anderson, Nicole M; Mucka, Patrick; Kern, Joseph G; Feng, Hui
2018-02-01
The tricarboxylic acid (TCA) cycle is a central route for oxidative phosphorylation in cells, and fulfills their bioenergetic, biosynthetic, and redox balance requirements. Despite early dogma that cancer cells bypass the TCA cycle and primarily utilize aerobic glycolysis, emerging evidence demonstrates that certain cancer cells, especially those with deregulated oncogene and tumor suppressor expression, rely heavily on the TCA cycle for energy production and macromolecule synthesis. As the field progresses, the importance of aberrant TCA cycle function in tumorigenesis and the potentials of applying small molecule inhibitors to perturb the enhanced cycle function for cancer treatment start to evolve. In this review, we summarize current knowledge about the fuels feeding the cycle, effects of oncogenes and tumor suppressors on fuel and cycle usage, common genetic alterations and deregulation of cycle enzymes, and potential therapeutic opportunities for targeting the TCA cycle in cancer cells. With the application of advanced technology and in vivo model organism studies, it is our hope that studies of this previously overlooked biochemical hub will provide fresh insights into cancer metabolism and tumorigenesis, subsequently revealing vulnerabilities for therapeutic interventions in various cancer types.
Tao, Li; Zhang, Yulong; Fan, Shuru; Nobile, Clarissa J.; Guan, Guobo; Huang, Guanghua
2017-01-01
Morphological transitions and metabolic regulation are critical for the human fungal pathogen Candida albicans to adapt to the changing host environment. In this study, we generated a library of central metabolic pathway mutants in the tricarboxylic acid (TCA) cycle, and investigated the functional consequences of these gene deletions on C. albicans biology. Inactivation of the TCA cycle impairs the ability of C. albicans to utilize non-fermentable carbon sources and dramatically attenuates cell growth rates under several culture conditions. By integrating the Ras1-cAMP signaling pathway and the heat shock factor-type transcription regulator Sfl2, we found that the TCA cycle plays fundamental roles in the regulation of CO2 sensing and hyphal development. The TCA cycle and cAMP signaling pathways coordinately regulate hyphal growth through the molecular linkers ATP and CO2. Inactivation of the TCA cycle leads to lowered intracellular ATP and cAMP levels and thus affects the activation of the Ras1-regulated cAMP signaling pathway. In turn, the Ras1-cAMP signaling pathway controls the TCA cycle through both Efg1- and Sfl2-mediated transcriptional regulation in response to elevated CO2 levels. The protein kinase A (PKA) catalytic subunit Tpk1, but not Tpk2, may play a major role in this regulation. Sfl2 specifically binds to several TCA cycle and hypha-associated genes under high CO2 conditions. Global transcriptional profiling experiments indicate that Sfl2 is indeed required for the gene expression changes occurring in response to these elevated CO2 levels. Our study reveals the regulatory role of the TCA cycle in CO2 sensing and hyphal development and establishes a novel link between the TCA cycle and Ras1-cAMP signaling pathways. PMID:28787458
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-12-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.
In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance
Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf
2012-01-01
The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416
Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity
Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.
2016-01-01
The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015
Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C
2005-03-01
Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.
Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf
2017-11-01
Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae
Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.
2013-01-01
ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745
Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael
2009-01-01
While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152
Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.
Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin
2017-06-01
This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.
Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru
2014-01-01
We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603
Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu
2016-10-01
Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.
Weger, H G; Turpin, D H
1989-02-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.
Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1
Weger, Harold G.; Turpin, David H.
1989-01-01
Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557
Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.
2011-01-01
Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293
Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.
Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B
2014-10-23
Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.
Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.
Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian
2018-02-13
The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.
Tiwari, Vivek; Ambadipudi, Susmitha; Patel, Anant B
2013-10-01
The (13)C nuclear magnetic resonance (NMR) studies together with the infusion of (13)C-labeled substrates in rats and humans have provided important insight into brain energy metabolism. In the present study, we have extended a three-compartment metabolic model in mouse to investigate glutamatergic and GABAergic tricarboxylic acid (TCA) cycle and neurotransmitter cycle fluxes across different regions of the brain. The (13)C turnover of amino acids from [1,6-(13)C2]glucose was monitored ex vivo using (1)H-[(13)C]-NMR spectroscopy. The astroglial glutamate pool size, one of the important parameters of the model, was estimated by a short infusion of [2-(13)C]acetate. The ratio Vcyc/VTCA was calculated from the steady-state acetate experiment. The (13)C turnover curves of [4-(13)C]/[3-(13)C]glutamate, [4-(13)C]glutamine, [2-(13)C]/[3-(13)C]GABA, and [3-(13)C]aspartate from [1,6-(13)C2]glucose were analyzed using a three-compartment metabolic model to estimate the rates of the TCA cycle and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The glutamatergic TCA cycle rate was found to be highest in the cerebral cortex (0.91 ± 0.05 μmol/g per minute) and least in the hippocampal region (0.64 ± 0.07 μmol/g per minute) of the mouse brain. In contrast, the GABAergic TCA cycle flux was found to be highest in the thalamus-hypothalamus (0.28 ± 0.01 μmol/g per minute) and least in the cerebral cortex (0.24 ± 0.02 μmol/g per minute). These findings indicate that the energetics of excitatory and inhibitory function is distinct across the mouse brain.
Meringer, Markus; Cleaves, H James
2017-12-13
The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.
Sulfate radicals enable a non-enzymatic Krebs cycle precursor
Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus
2017-01-01
The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880
The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist
Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.
2007-01-01
The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068
Fu, Yanfen; Li, Yi; Lidstrom, Mary
2017-07-01
Methanotrophs are a group of bacteria that use methane as sole carbon and energy source. Type I methanotrophs are gamma-proteobacterial methanotrophs using the ribulose monophosphate cycle (RuMP) cycle for methane assimilation. In order to facilitate metabolic engineering in the industrially promising Type I methanotroph Methylomicrobium buryatense 5GB1, flux analysis of cellular metabolism is needed and 13 C tracer analysis is a foundational tool for such work. This biological system has a single-carbon input and a special network topology that together pose challenges to the current well-established methodology for 13 C tracer analysis using a multi-carbon input such as glucose, and to date, no 13 C tracer analysis of flux in a Type I methanotroph has been reported. In this study, we showed that by monitoring labeling patterns of several key intermediate metabolites in core metabolism, it is possible to quantitate the relative flux ratios for important branch points, such as the malate node. In addition, it is possible to assess the operation of the TCA cycle, which has been thought to be incomplete in Type I methanotrophs. Surprisingly, our analysis provides direct evidence of a complete, oxidative TCA cycle operating in M. buryatense 5GB1 using methane as sole carbon and energy substrate, contributing about 45% of the total flux for de novo malate production. Combined with mutant analysis, this method was able to identify fumA (METBUDRAFT_1453/MBURv2__60244) as the primary fumarase involved in the oxidative TCA cycle, among 2 predicted fumarases, supported by 13 C tracer analysis on both fumA and fumC single knockouts. Interrupting the oxidative TCA cycle leads to a severe growth defect, suggesting that the oxidative TCA cycle functions to not only provide precursors for de novo biomass synthesis, but also to provide reducing power to the system. This information provides new opportunities for metabolic engineering of M. buryatense for the production of industrially relevant products. Copyright © 2017 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2016-10-01
inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2
Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.
Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal
2005-01-01
Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.
Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula
2002-02-01
This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.
Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi
2010-04-01
In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth
2015-08-15
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.
Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth
2015-01-01
Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864
Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.
2009-01-01
Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642
Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan
2018-01-08
The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.
van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.
2016-01-01
Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788
Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.
Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B
2015-04-07
New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
K.M. Jenkins; S.V. Diehl; C.A. Clausen; F. Green
2011-01-01
Brown-rot fungi produce oxalate in large amounts; however, levels of accumulation and function vary by species. Copper-tolerant fungi, like Antrodia radiculosa, produce and accumulate high levels of oxalate in response to copper. Oxalate biosynthesis in copper-tolerant fungi has been linked to the glyoxylate and tricarboxylic acid (TCA) cycles. Within these two cycles...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.
Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less
Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod
2015-06-01
Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.
Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.
Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer
2017-11-06
Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup
2016-11-01
To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.
Salway, Jack G
2018-05-25
Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.
Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer
Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.
2016-01-01
SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747
Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective
Fujishima, Kosuke
2017-01-01
The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.
Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S
2016-10-15
Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids
Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George
2016-01-01
ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance oxidation of plant-derived dicarboxylates in the TCA cycle with lipid synthesis. Pea bacteroids channel acetyl-CoA into both lipid and the lipid-like polymer poly-β-hydroxybutyrate, the latter via a type II PHB synthase. Lipogenesis is likely to be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. PMID:27501983
Gluconeogenesis from labeled carbon: estimating isotope dilution
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelleher, J.K.
1986-03-01
To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less
NASA Astrophysics Data System (ADS)
Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin
2014-01-01
A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.
Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis
Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.
2011-01-01
Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate secretion. This fermentative process may offer unique targets for the treatment of latent tuberculosis. PMID:21998585
Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar
2016-01-01
Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed during hyperammonaemia with reduced TCA cycle intermediates compared to controls. Generation of reactive oxygen species resulted in increased content of skeletal muscle carbonylated proteins and thiobarbituric acid reactive substances during hyperammonaemia. A cell‐permeable ester of α‐ketoglutarate reversed the low TCA cycle intermediates and ATP content in myotubes during hyperammonaemia. However, the mitochondrial antioxidant MitoTEMPO did not reverse the lower ATP content during hyperammonaemia. We provide for the first time evidence that skeletal muscle hyperammonaemia results in mitochondrial dysfunction and oxidative stress. Use of anaplerotic substrates to reverse ammonia‐induced mitochondrial dysfunction is a novel therapeutic approach. PMID:27558544
PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.
Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D
2015-11-19
Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.
Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma
Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.
2015-01-01
Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035
Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells
Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.
2012-01-01
Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880
Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L
2013-01-01
Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wan, Ni; DeLorenzo, Drew M.; He, Lian
Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less
Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang
2018-07-15
Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.
Carrasco-Pozo, Catalina
2017-01-01
Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258
Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian
2015-11-01
Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.
Eoh, Hyungjin; Rhee, Kyu Y.
2014-01-01
Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517
Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.
Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji
2017-05-06
Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.
Tefera, Tesfaye W; Borges, Karin
2018-01-01
Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.
Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris
2011-05-20
The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.
Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony
2000-01-01
The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369
Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène
2016-12-01
This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.
Glial dysfunction in abstinent methamphetamine abusers
Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D
2010-01-01
Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926
Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E
2017-06-01
The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.
You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J
2014-05-01
The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S
2011-04-01
Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.
Tavsan, Zehra; Ayar Kayali, Hulya
2015-05-01
The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.
Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1
Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.
1988-01-01
Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971
Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L
2007-12-01
The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major postnatal growth spurt.
Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle
Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro
2017-01-01
Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886
Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing
2018-05-31
Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.
Metabolic profiles of exercise in patients with McArdle disease or mitochondrial myopathy
Sharma, Rohit; Tadvalkar, Laura; Clish, Clary B.; Haller, Ronald G.; Mootha, Vamsi K.
2017-01-01
McArdle disease and mitochondrial myopathy impair muscle oxidative phosphorylation (OXPHOS) by distinct mechanisms: the former by restricting oxidative substrate availability caused by blocked glycogen breakdown, the latter because of intrinsic respiratory chain defects. We applied metabolic profiling to systematically interrogate these disorders at rest, when muscle symptoms are typically minimal, and with exercise, when symptoms of premature fatigue and potential muscle injury are unmasked. At rest, patients with mitochondrial disease exhibit elevated lactate and reduced uridine; in McArdle disease purine nucleotide metabolites, including xanthine, hypoxanthine, and inosine are elevated. During exercise, glycolytic intermediates, TCA cycle intermediates, and pantothenate expand dramatically in both mitochondrial disease and control subjects. In contrast, in McArdle disease, these metabolites remain unchanged from rest; but urea cycle intermediates are increased, likely attributable to increased ammonia production as a result of exaggerated purine degradation. Our results establish skeletal muscle glycogen as the source of TCA cycle expansion that normally accompanies exercise and imply that impaired TCA cycle flux is a central mechanism of restricted oxidative capacity in this disorder. Finally, we report that resting levels of long-chain triacylglycerols in mitochondrial myopathy correlate with the severity of OXPHOS dysfunction, as indicated by the level of impaired O2 extraction from arterial blood during peak exercise. Our integrated analysis of exercise and metabolism provides unique insights into the biochemical basis of these muscle oxidative defects, with potential implications for their clinical management. PMID:28716914
NASA Astrophysics Data System (ADS)
Guzman, Marcelo I.; Martin, Scot T.
2008-10-01
The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.
Igamberdiev, Abir U.; Eprintsev, Alexander T.
2016-01-01
Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516
Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.
Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J
2016-11-01
Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H
1988-03-01
Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.
An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.
Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian
2003-04-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an important role in matching energy supply with demand in cardiac myocytes.
An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics
Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian
2003-01-01
We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in cardiac myocytes. PMID:12668482
PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis
Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.
2013-01-01
Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304
The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.
Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore
2017-02-01
Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin
2018-05-01
Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.
Krznar, Petra; Hörl, Manuel; Ammar, Zeinab; Montessuit, Sylvie; Pierredon, Sandra; Zamboni, Nicola; Martinou, Jean-Claude
2016-01-01
Mitochondrial import of pyruvate by the mitochondrial pyruvate carrier (MPC) is a central step which links cytosolic and mitochondrial intermediary metabolism. To investigate the role of the MPC in mammalian physiology and development, we generated a mouse strain with complete loss of MPC1 expression. This resulted in embryonic lethality at around E13.5. Mouse embryonic fibroblasts (MEFs) derived from mutant mice displayed defective pyruvate-driven respiration as well as perturbed metabolic profiles, and both defects could be restored by reexpression of MPC1. Labeling experiments using 13C-labeled glucose and glutamine demonstrated that MPC deficiency causes increased glutaminolysis and reduced contribution of glucose-derived pyruvate to the TCA cycle. Morphological defects were observed in mutant embryonic brains, together with major alterations of their metabolome including lactic acidosis, diminished TCA cycle intermediates, energy deficit and a perturbed balance of neurotransmitters. Strikingly, these changes were reversed when the pregnant dams were fed a ketogenic diet, which provides acetyl-CoA directly to the TCA cycle and bypasses the need for a functional MPC. This allowed the normal gestation and development of MPC deficient pups, even though they all died within a few minutes post-delivery. This study establishes the MPC as a key player in regulating the metabolic state necessary for embryonic development, neurotransmitter balance and post-natal survival. PMID:27176894
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-09-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.
Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula
2006-02-15
Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.
Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen
2018-05-07
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.
Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.
2011-01-01
Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286
Muoio, Deborah M; Koves, Timothy R
2007-10-01
Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.
Protein-bound NAD(P)H Lifetime is Sensitive to Multiple Fates of Glucose Carbon.
Sharick, Joe T; Favreau, Peter F; Gillette, Amani A; Sdao, Sophia M; Merrins, Matthew J; Skala, Melissa C
2018-04-03
While NAD(P)H fluorescence lifetime imaging (FLIM) can detect changes in flux through the TCA cycle and electron transport chain (ETC), it remains unclear whether NAD(P)H FLIM is sensitive to other potential fates of glucose. Glucose carbon can be diverted from mitochondria by the pentose phosphate pathway (via glucose 6-phosphate dehydrogenase, G6PDH), lactate production (via lactate dehydrogenase, LDH), and rejection of carbon from the TCA cycle (via pyruvate dehydrogenase kinase, PDK), all of which can be upregulated in cancer cells. Here, we demonstrate that multiphoton NAD(P)H FLIM can be used to quantify the relative concentrations of recombinant LDH and malate dehydrogenase (MDH) in solution. In multiple epithelial cell lines, NAD(P)H FLIM was also sensitive to inhibition of LDH and PDK, as well as the directionality of LDH in cells forced to use pyruvate versus lactate as fuel sources. Among the parameters measurable by FLIM, only the lifetime of protein-bound NAD(P)H (τ 2 ) was sensitive to these changes, in contrast to the optical redox ratio, mean NAD(P)H lifetime, free NAD(P)H lifetime, or the relative amount of free and protein-bound NAD(P)H. NAD(P)H τ 2 offers the ability to non-invasively quantify diversions of carbon away from the TCA cycle/ETC, which may support mechanisms of drug resistance.
Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia
2017-08-29
In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.
Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N
2018-03-01
Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.
The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.
Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji
2015-01-15
The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...
Mechanisms of Mitochondrial Defects in Gulf War Syndrome
2012-08-01
oxidized; POR: porin; TCA: Tricarboxylic acid cycle ( Kreb cycle ). Page 2 Body: YEAR 1 of research (10/13/2009-7/14/2010) (9 months): Human... mitochondria , fatigue, myalgias 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...abnormalities in genes that are related to mitochondrial function. Hence, investigation of mitochondrial dysfunction in GWS is a priority. Mitochondria
Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S
2007-06-01
Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially supported by catabolism of [U-13C]isoleucine. In conclusion, i) neuronal and astrocytic TCA cycle metabolism was not inhibited by ammonium and ii) isoleucine may provide the carbon skeleton for synthesis of glutamate/glutamine in the detoxification of ammonium.
Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.
Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu
2013-05-01
The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may aid in the identification of appropriate combinations of metabolic inhibitors at low concentrations which do not cause toxicities.
Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou
2015-03-18
Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.
Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R
2014-12-26
We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.
The polyamines of Xanthium strumarium and their response to photoperiod.
Hamasaki, N; Galston, A W
1990-01-01
Flowering plants of Xanthium strumarium L., grown in 8 h photoperiods, were analysed for polyamines. Putrescine, spermidine and spermine were found throughout the plant in three forms: (a) as free polyamines; (b) conjugates soluble in 5% trichloracetic acid (TCA); and (c) bound to the TCA-insoluble precipitate. On a fresh weight basis, total polyamines are most abundant in young leaves and buds, especially flower buds. Spermidine predominates in the free polyamine fractions, while spermine is dominant in the conjugated fraction. Transfer of vegetative plants from 16 h photoperiods to 1, 2, 3, or 4 inductive cycles (8 h light + 16 h uninterrupted dark) caused rapid and marked changes in the polyamine titer of the leaves and ultimately, floral initiation. The titer of free putrescine per mg protein declined progressively with induction in all leaf sizes, while the titers of free spermidine and spermine rose during days 2 and 3 in small and expanding leaves. Conjugated putrescine, spermidine and spermine rose sharply after only 1 inductive cycle, especially in small and expanding leaves, and maintained the higher level for at least several cycles. In plants given 4 inductive cycles, buds harvested after 4 additional days had sharply elevated levels of conjugated polyamines, especially spermine, on a protein basis.
Rink, Cameron; Gnyawali, Surya; Stewart, Richard; Teplitsky, Seth; Harris, Hallie; Roy, Sashwati; Sen, Chandan K.; Khanna, Savita
2017-01-01
Ischemic stroke results in excessive release of glutamate, which contributes to neuronal cell death. Here, we test the hypothesis that otherwise neurotoxic glutamate can be productively metabolized by glutamate oxaloacetate transaminase (GOT) to maintain cellular energetics and protect the brain from ischemic stroke injury. The GOT-dependent metabolism of glutamate was studied in primary neural cells and in stroke-affected C57-BL6 mice using magnetic resonance spectroscopy and GC-MS. Extracellular Glu sustained cell viability under hypoglycemic conditions and increased GOT-mediated metabolism in vitro. Correction of stroke-induced hypoxia using supplemental oxygen in vivo lowered Glu levels as measured by 1H magnetic resonance spectroscopy. GOT knockdown abrogated this effect and caused ATP loss in the stroke-affected brain. GOT overexpression increased anaplerotic refilling of tricarboxylic acid cycle intermediates in mouse brain during ischemic stroke. Furthermore, GOT overexpression not only reduced ischemic stroke lesion volume but also attenuated neurodegeneration and improved poststroke sensorimotor function. Taken together, our results show that GOT enables metabolism of otherwise neurotoxic extracellular Glu through a truncated tricarboxylic acid cycle under hypoglycemic conditions.—Rink, C., Gnyawali, S., Stewart, R., Teplitsky, S., Harris, H., Roy, S., Sen, C. K., Khanna, S. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain. PMID:28096234
Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula
2012-01-01
The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050
Etienne, Audrey; Génard, Michel; Bugaud, Christophe
2015-01-01
Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.
Lipid-induced metabolic dysfunction in skeletal muscle.
Muoio, Deborah M; Koves, Timothy R
2007-01-01
Insulin resistance is a hallmark of type 2 diabetes and commonly observed in other energy-stressed settings such as obesity, starvation, inactivity and ageing. Dyslipidaemia and 'lipotoxicity'--tissue accumulation of lipid metabolites-are increasingly recognized as important drivers of insulin resistant states. Mounting evidence suggests that lipid-induced metabolic dysfunction in skeletal muscle is mediated in large part by stress-activated serine kinases that interfere with insulin signal transduction. However, the metabolic and molecular events that connect lipid oversupply to stress kinase activation and glucose intolerance are as yet unclear. Application of transcriptomics and targeted mass spectrometry-based metabolomics tools has led to our finding that insulin resistance is a condition in which muscle mitochondria are persistently burdened with a heavy lipid load. As a result, high rates of beta-oxidation outpace metabolic flux through the TCA cycle, leading to accumulation of incompletely oxidized acyl-carnitine intermediates. In contrast, exercise training enhances mitochondrial performance, favouring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high fat diet. The exercise-activated transcriptional co-activator, PGC1alpha, plays a key role in co-ordinating metabolic flux through these two intersecting metabolic pathways, and its suppression by overfeeding may contribute to obesity-associated mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from mitochondrial lipid stress and a resultant disconnect between beta-oxidation and TCA cycle activity. Understanding this 'disconnect' and its molecular basis may lead to new therapeutic targets for combating metabolic disease.
Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes
Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.
2015-01-01
Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940
Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M
2018-02-07
Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.
[Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].
Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong
2010-10-01
Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.
SbnG, a Citrate Synthase in Staphylococcus aureus
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; Heinrichs, David E.; Murphy, Michael E. P.
2014-01-01
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. PMID:25336653
Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi
2018-05-01
Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P
2016-10-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.
Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott
2016-01-01
Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823
Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo
2016-12-15
Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.
Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.
Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P
2016-03-23
Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.
Tiwari, Vivek; Veeraiah, Pandichelvam; Subramaniam, Vaidyanathan; Patel, Anant Bahadur
2014-03-01
This study investigates the effects of ethanol on neuronal and astroglial metabolism using (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of [1,6-(13)C2]/[1-(13)C]glucose or [2-(13)C]acetate, respectively. A three-compartment metabolic model was fitted to the (13)C turnover of GluC3 , GluC4, GABAC 2, GABAC 3, AspC3 , and GlnC4 from [1,6-(13)C2 ]glucose to determine the rates of tricarboxylic acid (TCA) and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The ratio of neurotransmitter cycle to TCA cycle fluxes for glutamatergic and GABAegic neurons was obtained from the steady-state [2-(13)C]acetate experiment and used as constraints during the metabolic model fitting. (1)H MRS measurement suggests that depletion of ethanol from cerebral cortex follows zero order kinetics with rate 0.18 ± 0.04 μmol/g/min. Acute exposure of ethanol reduces the level of glutamate and aspartate in cortical region. GlnC4 labeling was found to be unchanged from a 15 min infusion of [2-(13)C]acetate suggesting that acute ethanol exposure does not affect astroglial metabolism in naive mice. Rates of TCA and neurotransmitter cycle associated with glutamatergic and GABAergic neurons were found to be significantly reduced in cortical and subcortical regions. Acute exposure of ethanol perturbs the level of neurometabolites and decreases the excitatory and inhibitory activity differentially across the regions of brain. Depletion of ethanol and its effect on brain functions were measured using (1)H and (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of (13)C-labeled substrates. Ethanol depletion from brain follows zero order kinetics. Ethanol perturbs level of glutamate, and the excitatory and inhibitory activity in mice brain. © 2013 International Society for Neurochemistry.
Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E
2012-08-01
Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.
Imaging Prostate Cancer (PCa) Phenotype and Evolution
2015-10-01
has two isoforms: m-Acon (mitochondrial aconitase) and c-Acon ( cytoplasmic ; additionally functions as iron regulatory protein 1, when the iron levels...migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity, glycolysis and lactate, and increase
Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.
2014-01-01
Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635
Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin
2014-11-01
Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.
Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A
2016-09-01
HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.
Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr
Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.
2016-01-01
ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560
Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.
2012-01-01
ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869
Yano, Takanori; Yoshida, Nobuyuki; Yu, Fujio; Wakamatsu, Miki; Takagi, Hiroshi
2015-07-01
Rhodococcus erythropolis N9T-4 shows extremely oligotrophic growth requiring atmospheric CO2 and forms its colonies on an inorganic basal medium (BM) without any additional carbon source. Screening of a random mutation library constructed by a unique genome deletion method that we established indicated that the aceA, aceB, and pckG genes encoding isocitrate lyase, malate synthase, and phosphoenolpyruvate carboxykinase, respectively, were requisite for survival on BM plates. The aceA- and aceB deletion mutants and the pckG deletion mutant grew well on BM plates containing L-malate and D-glucose, respectively, suggesting that the glyoxylate (GO) shunt and gluconeogenesis are essential for the oligotrophic growth of N9T-4. Interestingly, most of the enzyme activities in the TCA cycle were observed in the cell-free extract of N9T-4, with perhaps the most important exception being α-ketoglutarate dehydrogenase (KGDH) activity. Instead of the KGDH activity, we detected a remarkable level of α-ketoglutarate decarboxylase (KGD) activity, which is the activity exhibited by the E1 component of the KGDH complex in Mycobacterium tuberculosis. The recombinant KGD of N9T-4 catalyzed the decarboxylation of α-ketoglutarate to form succinic semialdehyde (SSA) in a time-dependent manner. Since N9T-4 also showed a detectable SSA dehydrogenase activity, we concluded that N9T-4 possesses a variant TCA cycle, which uses SSA rather than succinyl-CoA. These results suggest that oligotrophic N9T-4 cells utilize the GO shunt to avoid the loss of carbons as CO2 and to conserve CoA units in the TCA cycle.
Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano
2014-01-01
A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455
The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella
Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.
2012-01-01
Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876
Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M
2015-07-02
Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.
Cheng, Zhi-Xue; Yang, Man-Jun; Peng, Bo; Peng, Xuan-Xian; Lin, Xiang-Min; Li, Hui
2018-06-15
The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. It is especially required to understand for the mechanism of antibiotic resistance to control antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus with the most advanced iTRAQ quantitative proteomics technology. A total of 160 proteins of differential abundance were identified, where 70 were decreased and 90 were increased. Further analysis demonstrated that crucial metabolic pathways like TCA cycle were significantly down-regulated. qRT-PCR analysis demonstrated the decreased gene expression of glycolysis/gluconeogenesis, the TCA cycle, and fatty acid biosynthesis. Moreover, Na(+)-NQR complex gene expression, membrane potential and the adenylate energy charge ratio were decreased, indicating that the decreased central carbon metabolism is associated to the acquisition of levofloxacin resistance. Therefore, the reduced central carbon and energy metabolisms form a characteristic feature as fitness costs of V. alginolyticus in resistance to levofloxacin. The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. Understanding for the antibiotic resistance mechanisms is especially required to control these antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus using the most advanced iTRAQ quantitative proteomics technology. A total of 160 differential abundance of proteins were identified with 70 decreases and 90 increases by liquid chromatography matrix assisted laser desorption ionization mass spectrometry. Most interestingly, crucial metabolic pathways such as the TCA cycle sharply fluctuated. This is the first report that the reduced central carbon and energy metabolisms form a characteristic feature as a mechanism of V. alginolyticus in resistance to levofloxacin. Copyright © 2018 Elsevier B.V. All rights reserved.
Comparative Analysis of the Mitochondrial Physiology of Pancreatic β Cells
Kim, Chul; Patel, Pinal; Gouvin, Lindsey M.; Brown, Melissa L.; Khalil, Ahmed; Henchey, Elizabeth M; Heuck, Alejandro P.; Yadava, Nagendra
2014-01-01
The mitochondrial metabolism of β cells is thought to be highly specialized. Its direct comparison with other cells using isolated mitochondria is limited by the availability of islets/β cells in sufficient quantity. In this study, we have compared mitochondrial metabolism of INS1E/β cells with other cells in intact and permeabilized states. To selectively permeabilize the plasma membrane, we have evaluated the use of perfringolysin-O (PFO) in conjunction with microplate-based respirometry. PFO is a protein that binds membranes based on a threshold level of active cholesterol. Therefore, unless active cholesterol reaches a threshold level in mitochondria, they are expected to remain untouched by PFO. Cytochrome c sensitivity tests showed that in PFO-permeabilized cells, the mitochondrial integrity was completely preserved. Our data show that a time-dependent decline of the oligomycin-insensitive respiration observed in INS1E cells was due to a limitation in substrate supply to the respiratory chain. We predict that it is linked with the β cell-specific metabolism involving metabolites shuttling between the cytoplasm and mitochondria. In permeabilized β cells, the Complex l-dependent respiration was either transient or absent because of the inefficient TCA cycle. The TCA cycle insufficiency was confirmed by analysis of the CO2 evolution. This may be linked with lower levels of NAD+, which is required as a co-factor for CO2 producing reactions of the TCA cycle. β cells showed comparable OxPhos and respiratory capacities that were not affected by the inorganic phosphate (Pi) levels in the respiration medium. They showed lower ADP-stimulation of the respiration on different substrates. We believe that this study will significantly enhance our understanding of the β cell mitochondrial metabolism. PMID:25309834
Butyrate induces apoptosis by activating PDC and inhibiting complex I through SIRT3 inactivation.
Xu, Sha; Liu, Cai-Xia; Xu, Wei; Huang, Lei; Zhao, Jian-Yuan; Zhao, Shi-Min
2017-01-01
The underlying anticancer effects of butyrate, an end-product of the intestinal microbial fermentation of dietary fiber, remain elusive. Here, we report that butyrate promotes cancer cell apoptosis by acting as a SIRT3 inhibitor. Butyrate inhibits SIRT3 both in cultured cells and in vitro . Butyrate-induced PDHA1 hyperacetylation relieves the inhibitory phosphorylation of PDHA1 at serine 293, thereby activating an influx of glycolytic intermediates into the tricarboxylic acid (TCA) cycle and reversing the Warburg effect. Meanwhile, butyrate-induced hyperacetylation inactivates complex I of the electron transfer chain and prevents the utilization of TCA cycle intermediates. These metabolic stresses promote apoptosis in hyperglycolytic cancer cells, such as HCT116 p53 -/- cells. SIRT3 deacetylates both PDHA1 and complex I. Genetic ablation of Sirt3 in mouse hepatocytes abrogated the ability of butyrate to induce apoptosis. Our results identify a butyrate-mediated anti-tumor mechanism and indicate that the combined activation of PDC and inhibition of complex I is a novel tumor treatment strategy.
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T; Jiang, Lei; Wasti, Ajla T; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E; DeBerardinis, Ralph J
2014-11-06
Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and reroutes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. Copyright © 2014 Elsevier Inc. All rights reserved.
Yang, Chendong; Ko, Bookyung; Hensley, Christopher T.; Jiang, Lei; Wasti, Ajla T.; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E.; DeBerardinis, Ralph J.
2014-01-01
Summary Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and re-routes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. PMID:25458842
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan
2016-12-15
Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.
Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles
Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky
2016-01-01
Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700
Biochemical consequences of alginate encapsulation: a NMR study of insulin-secreting cells.
Simpson, Nicholas E; Grant, Samuel C; Gustavsson, Lenita; Peltonen, Vilje-Mia; Blackband, Stephen J; Constantinidis, Ioannis
2006-04-01
In this study we explore the biochemical consequences of alginate encapsulation on betaTC3 cells. (13)C NMR spectroscopy and isotopomer analysis were used to investigate the effects of encapsulation on several enzymatic processes associated with the TCA cycle. Our data show statistically significant differences in various enzymatic fluxes related to the TCA cycle and insulin secretion between monolayer and alginate-encapsulated cultures. The principal cause for these effects was the process of trypsinization. Embedding the trypsinized cells in alginate beads did not have a compounded effect on the enzymatic fluxes of entrapped cells. However, an additional small but statistically significant decrease in insulin secretion was measured in encapsulated cells. Finally, differences in either enzymatic fluxes or glucose consumption as a function of bead diameter were not observed. However, differences in T(2), assessed by (1)H NMR microimaging, were observed as a function of bead diameter, suggesting that smaller beads became more organized with time in culture, while larger beads displayed a looser organization.
Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.
2013-01-01
Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305
SbnG, a citrate synthase in Staphylococcus aureus: A new fold on an old enzyme
Kobylarz, Marek J.; Grigg, Jason C.; Sheldon, Jessica R.; ...
2014-10-21
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. In this paper, we present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic genemore » clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. Finally, a structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production.« less
SbnG, a citrate synthase in Staphylococcus aureus: a new fold on an old enzyme.
Kobylarz, Marek J; Grigg, Jason C; Sheldon, Jessica R; Heinrichs, David E; Murphy, Michael E P
2014-12-05
In response to iron deprivation, Staphylococcus aureus produces staphyloferrin B, a citrate-containing siderophore that delivers iron back to the cell. This bacterium also possesses a second citrate synthase, SbnG, that is necessary for supplying citrate to the staphyloferrin B biosynthetic pathway. We present the structure of SbnG bound to the inhibitor calcium and an active site variant in complex with oxaloacetate. The overall fold of SbnG is structurally distinct from TCA cycle citrate synthases yet similar to metal-dependent class II aldolases. Phylogenetic analyses revealed that SbnG forms a separate clade with homologs from other siderophore biosynthetic gene clusters and is representative of a metal-independent subgroup in the phosphoenolpyruvate/pyruvate domain superfamily. A structural superposition of the SbnG active site to TCA cycle citrate synthases and site-directed mutagenesis suggests a case for convergent evolution toward a conserved catalytic mechanism for citrate production. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.
Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou
2017-04-01
Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.
NASA Astrophysics Data System (ADS)
Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul
1991-03-01
It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson et.al. 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.
Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W
2017-06-01
Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.
Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin
2014-01-01
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509
Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin
2014-07-22
Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.
Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri
2017-11-26
Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2012-03-01
mitochondrial OAA measurement is performed by a commercial kit from Biovision . Briefly, whole cell lysates or mitochondria fraction were obtained from... Biovision based on the manufacturer protocols. 2) Cellular oxygen consumption and reactive oxygen (ROS) production. One of the metabolic consequences of
Takahashi, Shoko; Saito, Kenji; Jia, Huijuan; Kato, Hisanori
2014-01-01
Many epidemiological studies have indicated that coffee consumption may reduce the risks of developing obesity and diabetes, but the underlying mechanisms of these effects are poorly understood. Our previous study revealed the changes on gene expression profiles in the livers of C57BL/6J mice fed a high-fat diet containing three types of coffee (caffeinated, decaffeinated and green unroasted coffee), using DNA microarrays. The results revealed remarkable alterations in lipid metabolism-related molecules which may be involved in the anti-obesity effects of coffee. We conducted the present study to further elucidate the metabolic alterations underlying the effects of coffee consumption through comprehensive proteomic and metabolomic analyses. Proteomics revealed an up-regulation of isocitrate dehydrogenase (a key enzyme in the TCA cycle) and its related proteins, suggesting increased energy generation. The metabolomics showed an up-regulation of metabolites involved in the urea cycle, with which the transcriptome data were highly consistent, indicating accelerated energy expenditure. The TCA cycle and the urea cycle are likely be accelerated in a concerted manner, since they are directly connected by mutually providing each other's intermediates. The up-regulation of these pathways might result in a metabolic shift causing increased ATP turnover, which is related to the alterations of lipid metabolism. This mechanism may play an important part in the suppressive effects of coffee consumption on obesity, inflammation, and hepatosteatosis. This study newly revealed global metabolic alterations induced by coffee intake, providing significant insights into the association between coffee intake and the prevention of type 2 diabetes, utilizing the benefits of multi-omics analyses. PMID:24618914
Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger
2013-01-01
This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147
Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.
Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver
2008-09-18
Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.
Chrysanthopoulos, Panagiotis K.; Hodson, Mark P.; Darnell, Ross; Korie, Sam
2018-01-01
Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol (R = 0.48) and turanose and (R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity. PMID:29735944
2015-01-01
Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026
A reverse glyoxylate shunt to build a non-native route from C-4 to C-2 in Escherichia coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mainguet, SE; Gronenberg, LS; Wong, SS
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C-4 carboxylates into two molecules of acetyl-CoA without loss of CO2.more » Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. (C) 2013 Elsevier Inc. All rights reserved.« less
A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli.
Mainguet, Samuel E; Gronenberg, Luisa S; Wong, Sio Si; Liao, James C
2013-09-01
Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C4 carboxylates into two molecules of acetyl-CoA without loss of CO2. Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. © 2013 Elsevier Inc. All rights reserved.
Simulating Metabolism with Statistical Thermodynamics
Cannon, William R.
2014-01-01
New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed. PMID:25089525
Simulating metabolism with statistical thermodynamics.
Cannon, William R
2014-01-01
New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed.
Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.
Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R
2017-03-06
Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.
Chheda, Anuj H; Vernekar, Madhavi R
2015-10-01
Epsilon poly-L-lysine (ε-PL) is a homo-biopolymer with approximately 25-30 L-lysine residues. It is a promising natural biopolymer widely used in food and pharmaceutical industry. The present work reports enhanced production of ε-PL with a novel producer Bacillus cereus using amino acids and TCA cycle intermediates in the fermentation medium. Among the various amino acids and TCA cycle intermediates tested 2 mM L-aspartic acid and 5 mM citric acid gave ε-PL yield of 145.5 and 230 mg/L, respectively. A combination of citric acid after 24 h and L-aspartic acid after 36 h improved ε-PL yield from 85 mg/L (control) to 335 mg/L. Glucose feeding strategy along with metabolic precursors was employed which further enhanced ε-PL yield to 565 mg/L. Thus, more than sixfold increase in ε-PL yield was achieved suggesting the potential of Bacillus cereus as a novel ε-PL producer.
NASA Astrophysics Data System (ADS)
Vergara, Fredd; Kikuchi, Jun; Breuer, Christian
2016-05-01
Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.
Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro
2014-01-01
In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.
Cigarette smoke induces mitochondrial metabolic reprogramming in lung cells.
Solanki, Hitendra S; Babu, Niraj; Jain, Ankit P; Bhat, Mohd Younis; Puttamallesh, Vinuth N; Advani, Jayshree; Raja, Remya; Mangalaparthi, Kiran K; Kumar, Mahesh M; Prasad, T S Keshava; Mathur, Premendu Prakash; Sidransky, David; Gowda, Harsha; Chatterjee, Aditi
2018-05-01
Cellular transformation owing to cigarette smoking is due to chronic exposure and not acute. However, systematic studies to understand the molecular alterations in lung cells due to cigarette smoke are lacking. To understand these molecular alterations induced by chronic cigarette smoke exposure, we carried out tandem mass tag (TMT) based temporal proteomic profiling of lung cells exposed to cigarette smoke for upto 12months. We identified 2620 proteins in total, of which 671 proteins were differentially expressed (1.5-fold) after 12months of exposure. Prolonged exposure of lung cells to smoke for 12months revealed dysregulation of oxidative phosphorylation and overexpression of enzymes involved in TCA cycle. In addition, we also observed overexpression of enzymes involved in glutamine metabolism, fatty acid degradation and lactate synthesis. This could possibly explain the availability of alternative source of carbon to TCA cycle apart from glycolytic pyruvate. Our data indicates that chronic exposure to cigarette smoke induces mitochondrial metabolic reprogramming in cells to support growth and survival. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.
Li, Xinjian; Jiang, Yuhui; Meisenhelder, Jill; Yang, Weiwei; Hawke, David H; Zheng, Yanhua; Xia, Yan; Aldape, Kenneth; He, Jie; Hunter, Tony; Wang, Liwei; Lu, Zhimin
2016-03-03
It is unclear how the Warburg effect that exemplifies enhanced glycolysis in the cytosol is coordinated with suppressed mitochondrial pyruvate metabolism. We demonstrate here that hypoxia, EGFR activation, and expression of K-Ras G12V and B-Raf V600E induce mitochondrial translocation of phosphoglycerate kinase 1 (PGK1); this is mediated by ERK-dependent PGK1 S203 phosphorylation and subsequent PIN1-mediated cis-trans isomerization. Mitochondrial PGK1 acts as a protein kinase to phosphorylate pyruvate dehydrogenase kinase 1 (PDHK1) at T338, which activates PDHK1 to phosphorylate and inhibit the pyruvate dehydrogenase (PDH) complex. This reduces mitochondrial pyruvate utilization, suppresses reactive oxygen species production, increases lactate production, and promotes brain tumorigenesis. Furthermore, PGK1 S203 and PDHK1 T338 phosphorylation levels correlate with PDH S293 inactivating phosphorylation levels and poor prognosis in glioblastoma patients. This work highlights that PGK1 acts as a protein kinase in coordinating glycolysis and the tricarboxylic acid (TCA) cycle, which is instrumental in cancer metabolism and tumorigenesis. Copyright © 2016 Elsevier Inc. All rights reserved.
Seifert, Erin L; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R; Wohlgemuth, Gert; Adams, Sean H; Harper, Mary-Ellen
2010-03-24
Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA beta-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 microM; corresponding to low, intermediate and high oxidation rates) and 9 microM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle.
Seifert, Erin L.; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R.; Wohlgemuth, Gert; Adams, Sean H.; Harper, Mary-Ellen
2010-01-01
Background/Aim Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA β-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Methodology/Principal Findings Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 µM; corresponding to low, intermediate and high oxidation rates) and 9 µM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. Conclusions/Significance This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies should focus on the fate of effluxed TCA cycle intermediates and on mechanisms ensuring their replenishment during LCFA metabolism in skeletal muscle. PMID:20352092
Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao
2018-04-01
A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.
Park, Hee-Sook; Lee, So Min; Jeong, Nam-Joo; Kim, Soon-Hee; Lee, Kyoung-Won; Lee, Ju-A
2017-01-01
Shaofu Zhuyu decoction (SFZYD, also known as Sobokchugeo-tang), a classical prescription drug in traditional East Asian medicine, has been used to treat blood stasis syndrome (BSS). Hepatic steatosis is the result of excess caloric intake, and its pathogenesis involves internal retention of phlegm and dampness, blood stasis, and liver Qi stagnation. To evaluate the effects of treatment with SFZYD on obesity-induced inflammation and hepatic steatosis, we fed male C57BL/6N mice a high fat diet (HFD) for 8 weeks and then treated them with SFZYD by oral gavage for an additional 4 weeks. The results of histological and biochemical examinations indicated that SFZYD treatment ameliorates systemic inflammation and hepatic steatosis. A partial least squares-discriminant analysis (PLS-DA) scores plot of serum metabolites showed that HFD mice began to produce metabolites similar to those of normal chow (NC) mice after SFZYD administration. We noted significant alterations in the levels of twenty-seven metabolites, alterations indicating that SFZYD regulates the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. Increases in the levels of TCA cycle intermediate metabolites, such as 2-oxoglutaric acid, isocitric acid, and malic acid, in the serum of obese mice were significantly reversed after SFZYD treatment. In addition to inducing changes in the above metabolites, treatment with SFZYD also recovered the expression of genes related to hepatic mitochondrial dysfunction, including Ucp2, Cpt1α, and Ppargc1α, as well as the expression of genes involved in lipid metabolism and inflammation, without affecting glucose uptake or insulin signaling. Taken together, these findings suggest that treatment with SFZYD ameliorated obesity-induced systemic inflammation and hepatic steatosis by regulating inflammatory cytokine and adipokine levels in the circulation and various tissues. Moreover, treatment with SFZYD also reversed alterations in the levels of metabolites of the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. PMID:28570676
Effects of visceral adiposity on glycerol pathways in gluconeogenesis.
Neeland, Ian J; Hughes, Connor; Ayers, Colby R; Malloy, Craig R; Jin, Eunsook S
2017-02-01
To determine the feasibility of using oral 13 C labeled glycerol to assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Obese (BMI ≥30kg/m 2 ) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U- 13 C 3 ] glycerol and blood samples were subsequently analyzed at multiple time points over 3h by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U- 13 C 3 ] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13 C NMR analysis of glucose. Mixed linear models were used to compare 13 C enrichment in glucose between groups. Mean age, BMI, and baseline glucose were 49years, 40.1kg/m 2 , and 98mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13 C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13 C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2- 13 C 2 ] (via PPP) and [5,6- 13 C 2 ]/[4,5,6- 13 C 3 ] (via TCA cycle) glucose in high VAT versus low VAT groups. We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. Copyright © 2016 Elsevier Inc. All rights reserved.
Effects of Visceral Adiposity on Glycerol Pathways in Gluconeogenesis
Neeland, Ian J.; Hughes, Connor; Ayers, Colby R.; Malloy, Craig R.; Jin, Eunsook S.
2016-01-01
Objective To determine the feasibility of using oral 13C labeled glycerol at assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Research Design and Methods Obese (BMI ≥30 kg/m2) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U-13C3] glycerol and blood samples were subsequently analyzed at multiple time points over 3 hours by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U-13C3] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13C NMR analysis of glucose. Mixed linear models were used to compare 13C enrichment in glucose between groups. Results Mean age, BMI, and baseline glucose were 49 years, 40.1 kg/m2, and 98 mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2-13C2] (via PPP) and [5,6-13C2]/[4,5,6-13C3] (via TCA cycle) glucose in high VAT versus low VAT groups. Conclusions We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. PMID:28081781
McDonald, Tanya S; Borges, Karin
2017-07-01
To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from seizures. Wiley Periodicals, Inc. © 2017 International League Against Epilepsy.
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.
Shimada, Tomohiro; Tanaka, Kan
2016-10-01
Regulation of central carbon metabolism has long been an important research subject in every organism. While the dynamics of metabolic flows during changes in available carbon sources have been estimated based on changes in metabolism-related gene expression, as well as on changes in the metabolome, the flux change itself has scarcely been measured because of technical difficulty, which has made conclusions elusive in many cases. Here, we used a monitoring system employing Vibrio fischeri luciferase to probe the intracellular metabolic condition in Escherichia coli Using a batch culture provided with a limited amount of glucose, we performed a time course analysis, where the predominant carbon source shifts from glucose to acetate, and identified a series of sequential peaks in the luciferase activity (peaks 1 to 4). Two major peaks, peaks 1 and 3, were considered to correspond to the glucose and acetate consuming phases, respectively, based on the glucose, acetate, and dissolved oxygen concentrations in the medium. The pattern of these peaks was changed by the addition of a different carbon source or by an increasing concentration of glucose, which was consistent with the present model. Genetically, mutations involved in glycolysis or the tricarboxylic acid (TCA) cycle/gluconeogenesis specifically affected peak 1 or peak 3, respectively, as expected from the corresponding metabolic phase. Intriguingly, mutants for the acetate excretion pathway showed a phenotype of extended peak 2 and delayed transition to the TCA cycle/gluconeogenesis phase, which suggests that peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Intracellular metabolic flows dynamically change during shifts in available carbon sources. However, because of technical difficulty, the flux change has scarcely been measured in living cells. Here, we used a Vibrio fischeri luciferase monitoring system to probe the intracellular metabolic condition in Escherichia coli Using a limited amount of glucose batch culture, a series of sequential peaks (peaks 1 to 4) in the luciferase activity was observed. Changes in the pattern of these peaks by the addition of extra carbon sources and in mutant strains involved in glycolysis or the TCA cycle/gluconeogenesis gene assigned the metabolic phase corresponding to peak 1 as the glycolysis phase and peak 3 as the TCA cycle/gluconeogenesis phase. Intriguingly, the acetate excretion pathway engaged in peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Jucker, B M; Cline, G W; Barucci, N; Shulman, G I
1999-01-01
To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P < 0.006). This decrease in insulin-stimulated glucose disposal in the safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P < 0.001) and versus fish oil (45.7 +/- 6.7 nmol x g(-1) x min(-1), P < 0.04), as no change in glycogen synthesis (103 +/- 15, 133 +/- 19, and 125 +/- 14 nmol x g(-1) x min(-1) in safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P < 0.05) and the fish oil group (3.6 +/- 1.1 micromol/g, P < 0.01). Conversely, the percent PDH versus TCA cycle flux was decreased in the safflower oil (43 +/- 8%) versus the control (73 +/- 8%, P < 0.01) and fish oil (64 +/- 6%, P < 0.05) groups. These data suggest that the reduced insulin-stimulated glucose disposal attributed to safflower oil feeding was a consequence of reduced glycolytic flux associated with an increase in relative free fatty acid/ketone oxidation versus TCA cycle flux, whereas fish oil feeding did not alter glucose metabolism and may in part be protective of insulin-stimulated glucose disposal by limiting intramuscular TG deposition.
NASA Astrophysics Data System (ADS)
Farrell, Stuart Bennett
Mercury Cadmium Telluride (HgCdTe) is a material of great importance for infrared focal plane array applications. In order to produce large format detector arrays this material needs to be grown on a large area substrate, with silicon being the most mature substrate, it is the optimal choice for large format arrays. To help mitigate the effect of the lattice mismatch between the two materials, cadmium telluride (CdTe) is used as a buffer layer. The CdTe itself has nearly the same lattice mismatch (19.3%) to silicon, but due to the technological advantages it offers and compatibility with HgCdTe, it is the best buffer layer choice. The lattice mismatch between HgCdTe/CdTe and the silicon substrate leads to the formation of dislocations at densities in the mid 106 to low 107 cm-2 range in the epilayers. Such a high dislocation density greatly effects detector device performance quantities such as operability and sensitivity. Hence, the dislocation density should be brought down by at least an order of magnitude by adopting novel in situ and ex situ material processing techniques. In this work, in situ and ex situ thermal cycle annealing (TCA) methods have been used to decrease dislocation density in CdTe and HgCdTe. During the molecular beam epitaxial (MBE) growth of the CdTe buffer layer, the growth was interrupted and the layer was subjected to an annealing cycle within the growth chamber under tellurium overpressure. During the annealing cycle the temperature is raised to beyond the growth temperature (290 → 550 °C) and then allowed to cool before resuming growth again. This process was repeated several times during the growth. After growth, a portion of the material was subjected to a dislocation decoration etch in order to count the etch pit density (EPD) which has a direct correspondence with the dislocation density in the crystal. The crystalline quality was also characterized by x-ray diffraction rocking curves and photoluminescence. The in situ TCA resulted in almost a two order of magnitude reduction in the dislocation density, and factor of two reduction in the full width at half maximum of the x-ray rocking curves. Photoluminescence also suggested a decrease in the number of dislocations present in the material. This decrease is attributed to the movement of the dislocations during the annealing cycles and their subsequent interaction and annihilation. To decrease the dislocation density in HgCdTe layers grown on CdTe/Si composite substrates, ex situ TCA has been performed in a sealed quartz ampoule under a mercury overpressure in a conventional clam-shell furnace. The reduction in the dislocation density has been studied as a function of growth/annealing parameters such as the initial (as grown) dislocation density, buffer layer quality, Hg overpressure, annealing temperature, annealing duration, and the number of annealing cycles. It was found that the primary parameters that affect dislocation density reduction are the annealing temperature and the number of annealing cycles. Some secondary affects were observed by varying the duration spent at the maximum annealing temperature. Parameters such as the initial dislocation density and buffer layer quality did not play a significant role in dislocation reduction. Though no correlation between Hg overpressure and dislocation density was found, it did play a vital role in maintaining the quality of the surface. By using the ex situ TCA, a dislocation density of 1 x 106 cm-2 could be reliably and consistently achieved in HgCdTe layers that had a starting density ranging from 0.5 -- 3 x 107 cm-2. Examination of the annealing parameters revealed an exponential decay in the dislocation density as a function of increasing number of annealing cycles. In addition, a similar exponential decay was observed between the dislocation density and the annealing temperature. The decrease in the dislocation density is once again attributed to moving dislocations that interact and annihilate. This behavior was modeled using a second order reaction equation. It was found that the results of the model closely agreed with the experimental values for a wide range of annealing temperatures and number of annealing cycles.
USDA-ARS?s Scientific Manuscript database
To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cline, Gary W., E-mail: gary.cline@yale.edu; Department of Surgery, University of Minnesota-Twin Cities, Minneapolis, MN 55455; Pongratz, Rebecca L.
Highlights: Black-Right-Pointing-Pointer We studied media effects on mechanisms of insulin secretion of INS-1 cells. Black-Right-Pointing-Pointer Insulin secretion was higher in DMEM than KRB despite identical ATP synthesis rates. Black-Right-Pointing-Pointer Insulin secretion rates correlated with rates of anaplerosis and TCA cycle. Black-Right-Pointing-Pointer Mitochondria metabolism and substrate cycles augment secretion signal of ATP. -- Abstract: Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as amore » surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with {sup 31}P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by {sup 13}C NMR isotopomer analysis of the fate of [U-{sup 13}C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15 mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media.« less
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows
White, Heather M.
2015-01-01
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386
The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.
White, Heather M
2015-08-18
The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.
Transcriptional response to petiole heat girdling in cassava.
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K; Brutnell, Thomas P; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-02-12
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation.
Transcriptional response to petiole heat girdling in cassava
Zhang, Yang; Ding, Zehong; Ma, Fangfang; Chauhan, Raj Deepika; Allen, Doug K.; Brutnell, Thomas P.; Wang, Wenquan; Peng, Ming; Li, Pinghua
2015-01-01
To examine the interactions of starch and sugar metabolism on photosynthesis in cassava, a heat-girdling treatment was applied to petioles of cassava leaves at the end of the light cycle to inhibit starch remobilization during the night. The inhibition of starch remobilization caused significant starch accumulation at the beginning of the light cycle, inhibited photosynthesis, and affected intracellular sugar levels. RNA-seq analysis of heat-treated and control plants revealed significantly decreased expression of genes related to photosynthesis, as well as N-metabolism and chlorophyll biosynthesis. However, expression of genes encoding TCA cycle enzymes and mitochondria electron transport components, and flavonoid biosynthetic pathway enzymes were induced. These studies reveal a dynamic transcriptional response to perturbation of sink demand in a single leaf, and provide useful information for understanding the regulations of cassava under sink or source limitation. PMID:25672661
Renewable Bio-Solar Hydrogen Production: The Second Generation (Part B)
2015-03-20
SUBJECT TERMS Biohydrogen, biofuels, cyanobacteria, photosynthesis, fermentation , transcription profiling, metabolic engineering, TCA cycle... fermentation in the cyanobacterium Arthrospira (Spirulina) maxima CS-328. Appl. Environ. Microbiol., 77: 7185-7194. 5. Zhang, S. and Bryant, D. A...glycogen is the preferred substrate during auto- fermentation . J. Biotech. 166: 65-75. 10. Kumaraswamy, G. K., Guerra, T., Qian, X., Zhang, S., Bryant
Ghosh, Arpan C.; O’Connor, Michael B.
2014-01-01
The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779
Meshitsuka, Shunsuke; Aremu, David A
2008-02-01
Citrate has been identified as a major tricarboxylic acid (TCA) cycle constituent preferentially released by astrocytes. We undertook the present study to examine further the nature of metabolic compartmentation in central nervous system tissues using (13)C-labeled glucose and to provide new information on the influence of aluminum on the metabolic interaction between neurons and astrocytes. Metabolites released into the culture medium from astrocytes and neuron-astrocyte coculture, as well as the perchloric acid extracts of the cells were analyzed using 2D (1)H and (13)C NMR spectroscopy. Astrocytes released citrate into the culture medium and the released citrate was consumed by neurons in coculture. Citrate release by astrocytes was blocked in the presence of aluminum, with progressive accumulation of citrate within the cells. We propose citrate supply is a more efficient energy source than lactate for neurons to produce ATP, especially in the hypoglycemic state on account of it being a direct component of the TCA cycle. Astrocytes may be the cellular compartment for aluminum accumulation as a citrate complex in the brain.
Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto
2018-05-01
Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.
(13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.
Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi
2015-11-01
S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Hyder, F; Renken, R; Rothman, D L
1999-12-01
A method for in vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI) is described. This method is composed of an echo-planar based acquisition implemented with (13)C-(1)H J editing spectroscopy and is intended for high temporal and spatial resolution in vivo spectroscopic imaging of (13)C turnover, from D-[1,6-(13)C]glucose to glutamate and glutamine, in the brain. At a static magnetic field strength of 7 T, both in vitro and in vivo chemical shift imaging data are presented with a spatial resolution of 8 microL (i.e., 1.25 x 1.25 x 5.00 mm(3)) and a maximum spectral bandwidth of 5.2 ppm in (1)H. Chemical shift imaging data acquired every 11 minutes allowed detection of regional [4-(13)CH(2)]glutamate turnover in rat brain. The [4-(13)CH(2)]glutamate turnover curves, which can be converted to tricarboxylic acid cycle fluxes, showed that the tricarboxylic acid cycle flux (V(TCA)) in pure gray and white matter can range from 1.2 +/- 0.2 to 0.5 +/- 0.1 micromol/g/min, respectively, for morphine-anesthetized rats. The mean cortical V(TCA) from 32 voxels of 1.0 +/- 0.3 micromol/g/min (N = 3) is in excellent agreement with previous localized measurements that have demonstrated that V(TCA) can range from 0.9-1.1 micromol/g/min under identical anesthetized conditions. Magn Reson Med 42:997-1003, 1999. Copyright 1999 Wiley-Liss, Inc.
Bringaud, F; Ebikeme, C; Boshart, M
2010-08-01
Parasites that often grow anaerobically in their hosts have adopted a fermentative strategy relying on the production of partially oxidized end products, including lactate, glycerol, ethanol, succinate and acetate. This review focuses on recent progress in understanding acetate production in protist parasites, such as amoebae, diplomonads, trichomonads, trypanosomatids and in the metazoan parasites helminths, as well as the succinate production pathway(s) present in some of them. We also describe the unconventional organisation of the tricarboxylic acid cycle associated with the fermentative strategy adopted by the procyclic trypanosomes, which may resemble the probable structure of the primordial TCA cycle in prokaryotes.
Concurrent planning and execution for a walking robot
NASA Astrophysics Data System (ADS)
Simmons, Reid
1990-07-01
The Planetary Rover project is developing the Ambler, a novel legged robot, and an autonomous software system for walking the Ambler over rough terrain. As part of the project, we have developed a system that integrates perception, planning, and real-time control to navigate a single leg of the robot through complex obstacle courses. The system is integrated using the Task Control Architecture (TCA), a general-purpose set of utilities for building and controlling distributed mobile robot systems. The walking system, as originally implemented, utilized a sequential sense-plan-act control cycle. This report describes efforts to improve the performance of the system by concurrently planning and executing steps. Concurrency was achieved by modifying the existing sequential system to utilize TCA features such as resource management, monitors, temporal constraints, and hierarchical task trees. Performance was increased in excess of 30 percent with only a relatively modest effort to convert and test the system. The results lend support to the utility of using TCA to develop complex mobile robot systems.
NASA Astrophysics Data System (ADS)
Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.
2005-12-01
All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle. Based on the type of chemolithoautotrophy described above, it is clear why marine magnetite-producing MB occupy a precise location, the oxic-anoxic interface, in vertical chemical gradients within chemically-stratified coastal environments: they must have an electron donor, sulfide and perhaps others, and an electron acceptor, O2. The presumed function of magnetosomes is that the magnetic dipole resulting from the magnetosomes aids the cell in locating and maintaining an optimal position within vertical chemical gradients. MB process large amounts of Fe in the biomineralization of magnetosomes: cells consist of 1-3% Fe (dry wt). Because of this, and the fact that many chemolithoautotrophic, non-magnetotactic bacteria occupy a similar niche, we have been investigating possible physiological reasons for the production of magnetosomes and the processing of such large amounts of Fe. We have found that some marine vibrioid strains grow in O2-gradient medium with Fe(II) as the electron donor. Cells appear to oxidize the Fe(II) and produce a layer of Fe oxyhydroxides within the gradient suggesting that cells obtain energy from the oxidation of Fe(II).
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-10-17
Oxygenated monoterpenes citral and carvacrol are common constituents of many essential oils (EOs) that have been extensively studied as antimicrobial agents but whose mechanisms of microbial inactivation have not been totally elucidated. A recent study described a mechanism of Escherichia coli death for (+)-limonene, a hydrocarbon monoterpene also frequently present in EOs, similar to the common mechanism proposed for bactericidal antibiotics. This mechanism involves the formation of Fenton-mediated hydroxyl radical, a reactive oxygen species (ROS), via tricarboxylic acid (TCA) cycle, which would ultimately inactivate cells. Our objective was to determine whether E. coli MG1655 inactivation by citral and carvacrol follows a similar mechanism of cell death. Challenging experiments with 300μL/L citral and 100μL/L carvacrol inactivated at least 2.5log10cycles of exponentially growing cells in 3h under aerobic conditions. The presence of thiourea (an ROS scavenger) reduced cell inactivation in 2log10cycles, demonstrating the role of ROS in cell death. Decreased resistance of a ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) indicated that citral and carvacrol caused oxidative damage to DNA. Although the mechanism of E. coli inactivation by carvacrol and citral was similarly mediated by ROS, their formation did not follow the same pathways described for (+)-limonene and bactericidal drugs because neither Fenton reaction nor NADH production via the TCA cycle was involved in cell death. Moreover, further experiments demonstrated antimicrobial activity of citral and carvacrol in anaerobic environments without the involvement of ROS. As a consequence, cell death by carvacrol and citral in anaerobiosis follows a different mechanism than that observed under aerobic conditions. These results demonstrated a different mechanism of inactivation by citral and carvacrol with regard to (+)-limonene and bactericidal antibiotics, indicating the complexity of the mechanisms of bacterial inactivation among EO constituents. Advancements in the description of these mechanisms will help in extending and improving the use of these compounds as natural antimicrobials. Copyright © 2014 Elsevier B.V. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Tropospheric ozone (O3) is a pollutant that is generated by volatile organic compounds, nitrogen oxides and sunlight. When plants take in O3 through stomata, harmful reactive oxygen species (ROS) are produced that induce the production of ROS scavenging antioxidants. Climate change predictions indic...
U.S. Army Research Laboratory Annual Review 2011
2011-12-01
pioneered a defect reduction process using thermal cycle annealing (TCA) for improving mercury cadmium telluride ( MCT ) grown on scalable silicon (Si...substrates. Currently, the use of MCT -- a mainstay material for Army infrared (IR) systems -- is limited due to high levels of dislocations when...grown on scalable substrates such as Si (an inexpensive substrate material). These dislocations increase pixel noise and limit IR focal plane array
Tennessen, Jason M; Bertagnolli, Nicolas M; Evans, Janelle; Sieber, Matt H; Cox, James; Thummel, Carl S
2014-03-12
Rapidly proliferating cells such as cancer cells and embryonic stem cells rely on a specialized metabolic program known as aerobic glycolysis, which supports biomass production from carbohydrates. The fruit fly Drosophila melanogaster also utilizes aerobic glycolysis to support the rapid growth that occurs during larval development. Here we use singular value decomposition analysis of modENCODE RNA-seq data combined with GC-MS-based metabolomic analysis to analyze the changes in gene expression and metabolism that occur during Drosophila embryogenesis, spanning the onset of aerobic glycolysis. Unexpectedly, we find that the most common pattern of co-expressed genes in embryos includes the global switch to glycolytic gene expression that occurs midway through embryogenesis. In contrast to the canonical aerobic glycolytic pathway, however, which is accompanied by reduced mitochondrial oxidative metabolism, the expression of genes involved in the tricarboxylic cycle (TCA cycle) and the electron transport chain are also upregulated at this time. Mitochondrial activity, however, appears to be attenuated, as embryos exhibit a block in the TCA cycle that results in elevated levels of citrate, isocitrate, and α-ketoglutarate. We also find that genes involved in lipid breakdown and β-oxidation are upregulated prior to the transcriptional initiation of glycolysis, but are downregulated before the onset of larval development, revealing coordinated use of lipids and carbohydrates during development. These observations demonstrate the efficient use of nutrient stores to support embryonic development, define sequential metabolic transitions during this stage, and demonstrate striking similarities between the metabolic state of late-stage fly embryos and tumor cells. Copyright © 2014 Tennessen et al.
Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S
2009-04-01
Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.
Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin
2016-01-01
There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703
Greseth, Matthew D.; Traktman, Paula
2014-01-01
The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production. PMID:24651651
Greseth, Matthew D; Traktman, Paula
2014-03-01
The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in particular virion assembly, relies on the synthesis and mitochondrial import of fatty acids, where their β-oxidation drives robust ATP production.
Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping
2015-01-01
Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592
Zhang, Shuyi; Bryant, Donald A
2015-05-29
Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin
2014-01-01
Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588
Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F
2017-07-25
Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.
Glaubitz, Ulrike; Li, Xia; Schaedel, Sandra; Erban, Alexander; Sulpice, Ronan; Kopka, Joachim; Hincha, Dirk K; Zuther, Ellen
2017-01-01
Transcript and metabolite profiling were performed on leaves from six rice cultivars under high night temperature (HNT) condition. Six genes were identified as central for HNT response encoding proteins involved in transcription regulation, signal transduction, protein-protein interactions, jasmonate response and the biosynthesis of secondary metabolites. Sensitive cultivars showed specific changes in transcript abundance including abiotic stress responses, changes of cell wall-related genes, of ABA signaling and secondary metabolism. Additionally, metabolite profiles revealed a highly activated TCA cycle under HNT and concomitantly increased levels in pathways branching off that could be corroborated by enzyme activity measurements. Integrated data analysis using clustering based on one-dimensional self-organizing maps identified two profiles highly correlated with HNT sensitivity. The sensitivity profile included genes of the functional bins abiotic stress, hormone metabolism, cell wall, signaling, redox state, transcription factors, secondary metabolites and defence genes. In the tolerance profile, similar bins were affected with slight differences in hormone metabolism and transcription factor responses. Metabolites of the two profiles revealed involvement of GABA signaling, thus providing a link to the TCA cycle status in sensitive cultivars and of myo-inositol as precursor for inositol phosphates linking jasmonate signaling to the HNT response specifically in tolerant cultivars. © 2016 John Wiley & Sons Ltd.
Yang, Liu; Yu, Qing-Tao; Ge, Ya-Zhong; Zhang, Wen-Song; Fan, Yong; Ma, Chung-Wah; Liu, Qun; Qi, Lian-Wen
2016-01-01
Ginseng occupies a prominent position in the list of best-selling natural products worldwide. Asian ginseng (Panax ginseng) and American ginseng (Panax quinquefolius) show different properties and medicinal applications in pharmacology, even though the main active constituents of them are both thought to be ginsenosides. Metabolomics is a promising method to profile entire endogenous metabolites and monitor their fluctuations related to exogenous stimulus. Herein, an untargeted metabolomics approach was applied to study the overall urine metabolic differences between Asian ginseng and American ginseng in mice. Metabolomics analyses were performed using gas chromatography-mass spectrometry (GC-MS) together with multivariate statistical data analysis. A total of 21 metabolites related to D-glutamine and D-glutamate metabolism, glutathione metabolism, TCA cycle and glyoxylate and dicarboxylate metabolism, differed significantly under the Asian ginseng treatment; 34 metabolites mainly associated with glyoxylate and dicarboxylate metabolism, TCA cycle and taurine and hypotaurine metabolism, were significantly altered after American ginseng treatment. Urinary metabolomics reveal that Asian ginseng and American ginseng can benefit organism physiological and biological functions via regulating multiple metabolic pathways. The important pathways identified from Asian ginseng and American ginseng can also help to explore new therapeutic effects or action targets so as to broad application of these two ginsengs. PMID:27991533
NASA Astrophysics Data System (ADS)
Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun
2016-10-01
Tetrabromobisphenol A and tetrachlorobisphenol A are halogenated bisphenol A (H-BPA), and has raised concerns about their adverse effects on the development of fetuses and infants, however, the molecular mechanisms are unclear, and related metabolomics studies are limited. Accordingly, a metabolomics study based on gas chromatography-mass spectrometry was employed to elucidate the molecular developmental toxicology of H-BPA using the marine medaka (Oryzias melastigmas) embryo model. Here, we revealed decreased synthesis of nucleosides, amino acids and lipids, and disruptions in the TCA (tricarboxylic acid) cycle, glycolysis and lipid metabolism, thus inhibiting the developmental processes of embryos exposed to H-BPA. Unexpectedly, we observed enhanced neural activity accompanied by lactate accumulation and accelerated heart rates due to an increase in dopamine pathway and a decrease in inhibitory neurotransmitters following H-BPA exposure. Notably, disorders of the neural system, and disruptions in glycolysis, the TCA cycle, nucleoside metabolism, lipid metabolism, glutamate and aspartate metabolism induced by H-BPA exposure were heritable. Furthermore, lactate and dopa were identified as potential biomarkers of the developmental toxicity of H-BPA and related genetic effects. This study has demonstrated that the metabolomics approach is a useful tool for obtaining comprehensive and novel insights into the molecular developmental toxicity of environmental pollutants.
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis
Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019
Periyasamy, Kuppusamy; Sivabalan, Venkatachalam; Baskaran, Kuppusamy; Kasthuri, Kannayiram; Sakthisekaran, Dhanapal
2016-03-01
Breast cancer is the leading cause of death among women worldwide. Chemoprevention and chemotherapy play beneficial roles in reducing the incidence and mortality of cancer. Epidemiological and experimental studies showed that naturally-occurring antioxidants present in the diet may act as anticancer agents. Identifying the abnormalities of cellular energy metabolism facilitates early detection and management of breast cancer. The present study evaluated the effect of tangeretin on cellular metabolic energy fluxes in 7,12-dimethylbenz(a) anthracene (DMBA)-induced proliferative breast cancer. The results showed that the activities of glycolytic enzymes significantly increased in mammary tissues of DMBA-induced breast cancer bearing rats. The gluconeogenic tricarboxylic acid (TCA) cycle and respiratory chain enzyme activities significantly decreased in breast cancer-bearing rats. In addition, proliferating cell nuclear antigen (PCNA) was highly expressed in breast cancer tissues. However, the activities of glycolytic enzymes were significantly normalized in the tangeretin pre- and post-treated rats and the TCA cycle and respiratory chain enzyme activities were significantly increased in tangeretin treated rats. Furthermore, tangeretin down-regulated PCNA expression on breast cancer-bearing rats. Our study demonstrates that tangeretin specifically regulates cellular metabolic energy fluxes in DMBA-induced breast cancer-bearing rats. © 2016 by the Journal of Biomedical Research. All rights reserved.
Reid, Michael A.; Lowman, Xazmin H.; Pan, Min; Tran, Thai Q.; Warmoes, Marc O.; Ishak Gabra, Mari B.; Yang, Ying; Locasale, Jason W.; Kong, Mei
2016-01-01
Glutamine is an essential nutrient for cancer cell survival and proliferation. Enhanced utilization of glutamine often depletes its local supply, yet how cancer cells adapt to low glutamine conditions is largely unknown. Here, we report that IκB kinase β (IKKβ) is activated upon glutamine deprivation and is required for cell survival independently of NF-κB transcription. We demonstrate that IKKβ directly interacts with and phosphorylates 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase isoform 3 (PFKFB3), a major driver of aerobic glycolysis, at Ser269 upon glutamine deprivation to inhibit its activity, thereby down-regulating aerobic glycolysis when glutamine levels are low. Thus, due to lack of inhibition of PFKFB3, IKKβ-deficient cells exhibit elevated aerobic glycolysis and lactate production, leading to less glucose carbons contributing to tricarboxylic acid (TCA) cycle intermediates and the pentose phosphate pathway, which results in increased glutamine dependence for both TCA cycle intermediates and reactive oxygen species suppression. Therefore, coinhibition of IKKβ and glutamine metabolism results in dramatic synergistic killing of cancer cells both in vitro and in vivo. In all, our results uncover a previously unidentified role of IKKβ in regulating glycolysis, sensing low-glutamine-induced metabolic stress, and promoting cellular adaptation to nutrient availability. PMID:27585591
Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.
Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I
2017-01-01
The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.
Li, Xiaofei; Nong, Qingjiao; Mao, Baoyu; Pan, Xue
2017-01-01
This study aimed to determine the metabolic profile of non-toxic cadmium (Cd)-induced dysfunctional endothelial cells using human umbilical vein endothelial cells (HUVECs). HUVECs (n = 6 per group) were treated with 0, 1, 5, or 10 μM cadmium chloride (CdCl2) for 48 h. Cell phenotypes, including nitric oxide (NO) production, the inflammatory response, and oxidative stress, were evaluated in Cd-exposed and control HUVECs. Cd-exposed and control HUVECs were analysed using gas chromatography time-of-flight/mass spectrometry. Compared to control HUVECs, Cd-exposed HUVECs were dysfunctional, exhibiting decreased NO production, a proinflammatory state, and non-significant oxidative stress. Further metabolic profiling revealed 24 significantly-altered metabolites in the dysfunctional endothelial cells. The significantly-altered metabolites were involved in the impaired tricarboxylic acid (TCA) cycle, activated pyruvate metabolism, up-regulated glucogenic amino acid metabolism, and increased pyrimidine metabolism. The current metabolic findings further suggest that the metabolic changes linked to TCA cycle dysfunction, glycosylation of the hexosamine biosynthesis pathway (HBP), and compensatory responses to genomic instability and energy deficiency may be generally associated with dysfunctional phenotypes, characterized by decreased NO production, a proinflammatory state, and non-significant oxidative stress, in endothelial cells following non-toxic Cd exposure. PMID:28872622
Qattan, Amal T.; Radulovic, Marko; Crawford, Mark; Godovac-Zimmermann, Jasminka
2014-01-01
Concurrent proteomics analysis of the nuclei and mitochondria of MCF7 breast cancer cells identified 985 proteins (40% of all detected proteins) present in both organelles. Numerous proteins from all five complexes involved in oxidative phosphorylation (e.g., NDUFA5, NDUFB10, NDUFS1, NDUF2, SDHA, UQRB, UQRC2, UQCRH, COX5A, COX5B, MT-CO2, ATP5A1, ATP5B, ATP5H, etc.), from the TCA-cycle (DLST, IDH2, IDH3A, OGDH, SUCLAG2, etc.), and from glycolysis (ALDOA, ENO1, FBP1, GPI, PGK1, TALDO1, etc.) were distributed to both the nucleus and mitochondria. In contrast, proteins involved in nuclear/mitochondrial RNA processing/translation and Ras/Rab signaling showed different partitioning patterns. The identity of the OxPhos, TCA-cycle, and glycolysis proteins distributed to both the nucleus and mitochondria provides evidence for spatio-functional integration of these processes over the two different subcellular organelles. We suggest that there are unrecognized aspects of functional coordination between the nucleus and mitochondria, that integration of core functional processes via wide subcellular distribution of constituent proteins is a common characteristic of cells, and that subcellular spatial integration of function may be a vital aspect of cancer. PMID:23051583
Metabolic flux analysis of the halophilic archaeon Haladaptatus paucihalophilus.
Liu, Guangxiu; Zhang, Manxiao; Mo, Tianlu; He, Lian; Zhang, Wei; Yu, Yi; Zhang, Qi; Ding, Wei
2015-11-27
This work reports the (13)C-assisted metabolic flux analysis of Haladaptatus paucihalophilus, a halophilic archaeon possessing an intriguing osmoadaption mechanism. We showed that the carbon flow is through the oxidative tricarboxylic acid (TCA) cycle whereas the reductive TCA cycle is not operative in H. paucihalophilus. In addition, both threonine and the citramalate pathways contribute to isoleucine biosynthesis, whereas lysine is synthesized through the diaminopimelate pathway and not through the α-aminoadipate pathway. Unexpected, the labeling patterns of glycine from the cells grown on [1-(13)C]pyruvate and [2-(13)C]pyruvate suggest that, unlike all the organisms investigated so far, in which glycine is produced exclusively from the serine hydroxymethyltransferase (SHMT) pathway, glycine biosynthesis in H. paucihalophilus involves different pathways including SHMT, threonine aldolase (TA) and the reverse reaction of glycine cleavage system (GCS), demonstrating for the first time that other pathways instead of SHMT can also make a significant contribution to the cellular glycine pool. Transcriptional analysis confirmed that both TA and GCS genes were transcribed in H. paucihalophilus, and the transcriptional level is independent of salt concentrations in the culture media. This study expands our understanding of amino acid biosynthesis and provides valuable insights into the metabolism of halophilic archaea. Copyright © 2015 Elsevier Inc. All rights reserved.
Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A
2011-02-01
Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Cortex and hippocampus DNA epigenetic response to a long-term arsenic exposure via drinking water.
Du, Xiaoyan; Tian, Meiping; Wang, Xiaoxue; Zhang, Jie; Huang, Qingyu; Liu, Liangpo; Shen, Heqing
2018-03-01
The neurotoxicity of arsenic is a serious health problem, especially for children. DNA epigenetic change may be an important pathogenic mechanism, but the molecular pathway remains obscure. In this study, the weaned male Sprague-Dawly (SD) rats were treated with arsenic trioxide via drinking water for 6 months, simulating real developmental exposure situation of children. Arsenic exposure impaired the cognitive abilities, and altered the expression of neuronal activity-regulated genes. Total arsenic concentrations of cortex and hippocampus tissues were significantly increased in a dose-dependent manner. The reduction in 5-methylcytosine (5 mC) and 5-hydroxymethylcytosine (5hmC) levels as well as the down-regulation of DNA methyltransferases (DNMTs) and ten-eleven translocations (TETs) expression suggested that DNA methylation/demethylation processes were significantly suppressed in brain tissues. S-adenosylmethionine (SAM) level wasn't changed, but the expression of the important indicators of oxidative/anti-oxidative balance and tricarboxylic acid (TCA) cycle was significantly deregulated. Overall, arsenic can disrupt oxidative/anti-oxidative balance, further inhibit TETs expression through TCA cycle and alpha-ketoglutarate (α-KG) pathway, and consequently cause DNA methylation/demethylation disruption. The present study implies oxidative stress but not SAM depletion may lead to DNA epigenetic alteration and arsenic neurotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Lu, Ming; Zhu, Xiao-Hong; Zhang, Yi; Mateescu, Gheorghe; Chen, Wei
2017-11-01
Quantitative assessment of cerebral glucose consumption rate (CMR glc ) and tricarboxylic acid cycle flux (V TCA ) is crucial for understanding neuroenergetics under physiopathological conditions. In this study, we report a novel in vivo Deuterium ( 2 H) MRS (DMRS) approach for simultaneously measuring and quantifying CMR glc and V TCA in rat brains at 16.4 Tesla. Following a brief infusion of deuterated glucose, dynamic changes of isotope-labeled glucose, glutamate/glutamine (Glx) and water contents in the brain can be robustly monitored from their well-resolved 2 H resonances. Dynamic DMRS glucose and Glx data were employed to determine CMR glc and V TCA concurrently. To test the sensitivity of this method in response to altered glucose metabolism, two brain conditions with different anesthetics were investigated. Increased CMR glc (0.46 vs. 0.28 µmol/g/min) and V TCA (0.96 vs. 0.6 µmol/g/min) were found in rats under morphine as compared to deeper anesthesia using 2% isoflurane. This study demonstrates the feasibility and new utility of the in vivo DMRS approach to assess cerebral glucose metabolic rates at high/ultrahigh field. It provides an alternative MRS tool for in vivo study of metabolic coupling relationship between aerobic and anaerobic glucose metabolisms in brain under physiopathological states.
Matsen, Janet B.; Yang, Song; Stein, Lisa Y.; Beck, David; Kalyuzhnaya, Marina G.
2013-01-01
Methane utilizing bacteria (methanotrophs) are important in both environmental and biotechnological applications, due to their ability to convert methane to multicarbon compounds. However, systems-level studies of methane metabolism have not been carried out in methanotrophs. In this work we have integrated genomic and transcriptomic information to provide an overview of central metabolic pathways for methane utilization in Methylosinus trichosporium OB3b, a model alphaproteobacterial methanotroph. Particulate methane monooxygenase, PQQ-dependent methanol dehydrogenase, the H4MPT-pathway, and NAD-dependent formate dehydrogenase are involved in methane oxidation to CO2. All genes essential for operation of the serine cycle, the ethylmalonyl-CoA (EMC) pathway, and the citric acid (TCA) cycle were expressed. PEP-pyruvate-oxaloacetate interconversions may have a function in regulation and balancing carbon between the serine cycle and the EMC pathway. A set of transaminases may contribute to carbon partitioning between the pathways. Metabolic pathways for acquisition and/or assimilation of nitrogen and iron are discussed. PMID:23565111
Lu, Wanlu; Lu, Libing; Feng, Yun; Chen, Jiao; Li, Yan; Kong, Xiangli; Chen, Sixiu; Li, Xiaoyu; Chen, Qianming; Zhang, Ping
2013-05-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8 + T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment.
LU, WANLU; LU, LIBING; FENG, YUN; CHEN, JIAO; LI, YAN; KONG, XIANGLI; CHEN, SIXIU; LI, XIAOYU; CHEN, QIANMING; ZHANG, PING
2013-01-01
The association between inflammation and cancer provides a new target for tumor biotherapy. The inflammatory cells and molecules within the tumor microenvironment have decisive dual roles in antitumor immunity and immune evasion. In the present study, phytohemagglutinin (PHA) was used to stimulate peripheral blood mononuclear cells (PBMCs) to simulate the tumor inflammatory microenvironment. The effect of immune cells and inflammatory cytokines on the surface expression of programmed cell death-1 ligand 1 (PD-L1) and tumor immune evasion was investigated using flow cytometry (FCM) and an in vivo xenotransplantation model. Based on the data, PHA-activated, but not resting, immune cells were able to promote the surface expression of PD-L1 in Tca8113 oral squamous carcinoma cells via the secretion of inflammatory cytokines, but not by cell-cell contact. The majority of the inflammatory cytokines had no significant effect on the proliferation, cell cycle progression and apoptosis of the Tca8113 cells, although they each induced the expression of PD-L1 in a dose-dependent manner. In total, 99% of the Tca8113 cells expressed PD-L1 following treatment with the supernatant of PHA-stimulated PBMCs. The PHA-supernatant pretreated Tca8113 cells unusually induced Tca8113 antigen-specific CD8+ T cell apoptosis in vitro and the evasion of antigen-specific T cell attraction in a nude mouse tumor-bearing model. These results indicate a new mechanism for the promotion of tumor immune evasion by the tumor inflammatory microenvironment PMID:23761816
MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas
2013-09-01
A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.
Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.
2000-01-01
A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553
Durieux, P O; Schütz, P; Brun, R; Köhler, P
1991-03-01
A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)
Sugden, M C; Lall, H S; Harris, R A; Holness, M J
2000-11-01
The pyruvate dehydrogenase kinases (PDK1-4) regulate glucose oxidation through inhibitory phosphorylation of the pyruvate dehydrogenase complex (PDC). Immunoblot analysis with antibodies raised against recombinant PDK isoforms demonstrated changes in PDK isoform expression in response to experimental hyperthyroidism (100 microg/100 g body weight; 3 days) that was selective for fast-twitch vs slow-twitch skeletal muscle in that PDK2 expression was increased in the fast-twitch skeletal muscle (the anterior tibialis) (by 1. 6-fold; P<0.05) but not in the slow-twitch muscle (the soleus). PDK4 protein expression was increased by experimental hyperthyroidism in both muscle types, there being a greater response in the anterior tibialis (4.2-fold increase; P<0.05) than in the soleus (3.2-fold increase; P<0.05). The hyperthyroidism-associated up-regulation of PDK4 expression was observed in conjunction with suppression of skeletal-muscle PDC activity, but not suppression of glucose uptake/phosphorylation, as measured in vivo in conscious unrestrained rats (using the 2-[(3)H]deoxyglucose technique). We propose that increased PDK isoform expression contributes to the pathology of hyperthyroidism and to PDC inactivation by facilitating the operation of the glucose --> lactate --> glucose (Cori) and glucose --> alanine --> glucose cycles. We also propose that enhanced relative expression of the pyruvate-insensitive PDK isoform (PDK4) in skeletal muscle in hyperthyroidism uncouples glycolytic flux from pyruvate oxidation, sparing pyruvate for non-oxidative entry into the tricarboxylic acid (TCA) cycle, and thereby supporting entry of acetyl-CoA (derived from fatty acid oxidation) into the TCA cycle.
Lee, Yie-Vern; Wahab, Habibah A.
2015-01-01
Isocitrate lyase (ICL) is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle), especially Mycobacterium tuberculosis (MTB). In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a) MTB ICL with natural compounds; (b) MTB ICL with synthetic compounds; (c) non-MTB ICL with natural compounds; and (d) non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL. PMID:25649791
Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron
2012-01-01
Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Risis, Steve
Rationale: Cardiac metabolism is thought to be altered in insulin resistance and type 2 diabetes (T2D). Our understanding of the regulation of cardiac substrate metabolism and insulin sensitivity has largely been derived from ex vivo preparations which are not subject to the same metabolic regulation as in the intact heart in vivo. Studies are therefore required to examine in vivo cardiac glucose metabolism under physiologically relevant conditions. Objective: To determine the temporal pattern of the development of cardiac insulin resistance and to compare with dynamic approaches to interrogate cardiac glucose and intermediary metabolism in vivo. Methods and results: Studies were conducted to determine themore » evolution of cardiac insulin resistance in C57Bl/6 mice fed a high-fat diet (HFD) for between 1 and 16 weeks. Dynamic in vivo cardiac glucose metabolism was determined following oral administration of [U-{sup 13}C] glucose. Hearts were collected after 15 and 60 min and flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates. Cardiac insulin resistance, determined by euglycemic–hyperinsulinemic clamp, was evident after 3 weeks of HFD. Despite the presence of insulin resistance, in vivo cardiac glucose metabolism following oral glucose administration was not compromised in HFD mice. This contrasts our recent findings in skeletal muscle, where TCA cycle activity was reduced in mice fed a HFD. Similar to our report in muscle, glucose derived pyruvate entry into the TCA cycle in the heart was almost exclusively via pyruvate dehydrogenase, with pyruvate carboxylase mediated anaplerosis being negligible after oral glucose administration. Conclusions: Under experimental conditions which closely mimic the postprandial state, the insulin resistant mouse heart retains the ability to stimulate glucose metabolism. - Highlights: • Insulin clamp was used to determine the evolution of cardiac insulin resistance. • Clamp measures were compared to a dynamic metabolomics approach. • The clamp revealed the presence of cardiac insulin resistance after 3 weeks of HFD. • Cardiac glucose metabolism was not affected by HFD during an oral glucose challenge.« less
Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen
2018-01-01
Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid-lowering effects of AEM in boththe serum and liver may be partly related to PPARα signaling activation, including enhanced fatty acid β-oxidation and lipogenesis pathway inhibition. Together, our data demonstrated that AEM intervention significantly improved lipid and glucose metabolism disorder by regulating the glycolysis/gluconeogenesis-TCA cycle and by modulating gene expression levels involved in the PPARα signaling pathway. PMID:29681858
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H; Pedersen, Peter L; Goffeau, Andre; Ułaszewski, Stanisław
2016-03-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP.
Gao, Shu-Hong; Fan, Lu; Peng, Lai; Guo, Jianhua; Agulló-Barceló, Míriam; Yuan, Zhiguo; Bond, Philip L
2016-05-17
Free nitrous acid (FNA) has recently been demonstrated as an antimicrobial agent on a range of micro-organisms, especially in wastewater-treatment systems. However, the antimicrobial mechanism of FNA is largely unknown. Here, we report that the antimicrobial effects of FNA are multitargeted. The response of a model denitrifier, Pseudomnas aeruginosa PAO1 (PAO1), common in wastewater treatment, was investigated in the absence and presence of inhibitory level of FNA (0.1 mg N/L) under anaerobic denitrifying conditions. This was achieved through coupling gene expression analysis, by RNA sequencing, and with a suite of physiological analyses. Various transcripts exhibited significant changes in abundance in the presence of FNA. Respiration was likely inhibited because denitrification activity was severely depleted, and decreased transcript levels of most denitrification genes occurred. As a consequence, the tricarboxylic acid (TCA) cycle was inhibited due to the lowered cellular redox state in the FNA-exposed cultures. Meanwhile, during FNA exposure, PAO1 rerouted its carbon metabolic pathway from the TCA cycle to pyruvate fermentation with acetate as the end product as a possible survival mechanism. Additionally, protein synthesis was significantly decreased, and ribosome preservation was evident. These findings improve our understanding of PAO1 in response to FNA and contribute toward the potential application for use of FNA as an antimicrobial agent.
Baker, Peter R; Boyle, Kristen E; Koves, Timothy R; Ilkayeva, Olga R; Muoio, Deborah M; Houmard, Joseph A; Friedman, Jacob E
2015-05-01
Investigate the effects of obesity and high-fat diet (HFD) exposure on fatty acid oxidation and TCA cycle intermediates and amino acids in skeletal muscle to better characterize energy metabolism. Plasma and skeletal muscle metabolomic profiles were measured from lean and obese males before and after a 5-day HFD in the 4 h postprandial condition. At both time points, plasma short-chain acylcarnitine species (SCAC) were higher in the obese subjects, while the amino acids glycine, histidine, methionine, and citrulline were lower in skeletal muscle of obese subjects. Skeletal muscle medium-chain acylcarnitines (MCAC) C6, C8, C10:2, C10:1, C10, and C12:1 increased in obese subjects, but decreased in lean subjects, from pre- to post-HFD. Plasma content of C10:1 was also decreased in the lean but increased in the obese subjects from pre- to post-HFD. CD36 increased from pre- to post-HFD in obese but not lean subjects. Lower skeletal muscle amino acid content and accumulation of plasma SCAC in obese subjects could reflect increased anaplerosis for TCA cycle intermediates, while accumulation of MCAC suggests limitations in β-oxidation. These measures may be important markers of or contributors to dysregulated metabolism observed in skeletal muscle of obese humans. © 2015 The Obesity Society.
Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko
2018-05-24
Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sadler, Natalie C.; Angel, Thomas E.; Lewis, Michael P.
High-fat diet (HFD) induced obesity and concomitant development of insulin resistance (IR) and type 2 diabetes mellitus have been linked to mitochondrial dysfunction. However, it is not clear whether mitochondrial dysfunction is a direct effect of a HFD or if the mitochondrial function is reduced with increased HFD duration. We hypothesized that the function of mitochondrial oxidative and lipid metabolism functions in skeletal muscle mitochondria for HFD mice are similar or elevated relative to standard diet (SD) mice, thereby IR is neither cause nor consequence of mitochondrial dysfunction. We applied a chemical probe approach to identify functionally reactive ATPases andmore » nucleotide-binding proteins in mitochondria isolated from skeletal muscle of C57Bl/6J mice fed HFD or SD chow for 2-, 8-, or 16-weeks; feeding time points known to induce IR. A total of 293 probe-labeled proteins were identified by mass spectrometry-based proteomics, of which 54 differed in abundance between HFD and SD mice. We found proteins associated with the TCA cycle, oxidative phosphorylation (OXPHOS), and lipid metabolism were altered in function when comparing SD to HFD fed mice at 2-weeks, however by 16-weeks HFD mice had TCA cycle, β-oxidation, and respiratory chain function at levels similar to or higher than SD mice.« less
Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming.
Zeng, Zao-hai; Du, Chao-Chao; Liu, Shi-Rao; Li, Hui; Peng, Xuan-Xian; Peng, Bo
2017-02-01
We have recently reported that the survival of tilapia, Oreochromis niloticus, during Edwardsiella tarda infection is tightly associated with their metabolome, where the survived O. niloticus has distinct metabolomic profile to dying O. niloticus. Glucose is the key metabolite to distinguish the survival- and dying-metabolome. More importantly, exogenous administration of glucose to the fish greatly enhances their survival for the infection, indicating the functional roles of glucose in metabolome repurposing, known as reprogramming metabolomics. However, the underlying information for the reprogramming is not yet available. Here, GC/MS based metabolomics is used to understand the mechanisms by which how exogenous glucose elevates O. niloticus, anti-infectious ability to E. tarda. Results showed that exogenous glucose promotes stearic acid and palmitic acid biosynthesis but attenuates TCA cycle to potentiate O. niloticus against bacterial infection, which is confirmed by the fact that exogenous stearic acid increases immune protection in O. niloticus against E. tarda infection in a manner of Mx protein. These results indicate that exogenous glucose reprograms O. niloticus anti-infective metabolome that characterizes elevation of stearic acid and palmitic acid and attenuation of the TCA cycle. Therefore, our results proposed a novel mechanism that glucose promotes unsaturated fatty acid biosynthesis to cope with infection, thereby highlighting a potential way of enhancing fish immunity in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhang, Limin; Ye, Yangfang; An, Yanpeng; Tian, Yuan; Wang, Yulan; Tang, Huiru
2011-02-04
Exposure to aflatoxins causes liver fibrosis and hepatocellular carcinoma posing a significant health risk for human populations and livestock. To understand the mammalian systems responses to aflatoxin-B1 (AFB1) exposure, we analyzed the AFB1-induced metabonomic changes in multiple biological matrices (plasma, urine, and liver) of rats using (1)H NMR spectroscopy together with clinical biochemistry and histopathologic assessments. We found that AFB1 exposure caused significant elevation of glucose, amino acids, and choline metabolites (choline, phosphocholine, and glycerophosphocholine) in plasma but reduction of plasma lipids. AFB1 also induced elevation of liver lipids, amino acids (tyrosine, histidine, phenylalanine, leucine, isoleucine, and valine), choline, and nucleic acid metabolites (inosine, adenosine, and uridine) together with reduction of hepatic glycogen and glucose. AFB1 further caused decreases in urinary TCA cycle intermediates (2-oxoglutarate and citrate) and elevation of gut microbiota cometabolites (phenylacetylglycine and hippurate). These indicated that AFB1 exposure caused hepatic steatosis accompanied with widespread metabolic changes including lipid and cell membrane metabolisms, protein biosynthesis, glycolysis, TCA cycle, and gut microbiota functions. This implied that AFB1 exposure probably caused oxidative-stress-mediated impairments of mitochondria functions. These findings provide an overview of biochemical consequences of AFB1 exposure and comprehensive insights into the metabolic aspects of AFB1-induced hepatotoxicity in rats.
13C-labelled microdialysis studies of cerebral metabolism in TBI patients☆
Carpenter, Keri L.H.; Jalloh, Ibrahim; Gallagher, Clare N.; Grice, Peter; Howe, Duncan J.; Mason, Andrew; Timofeev, Ivan; Helmy, Adel; Murphy, Michael P.; Menon, David K.; Kirkpatrick, Peter J.; Carpenter, T. Adrian; Sutherland, Garnette R.; Pickard, John D.; Hutchinson, Peter J.
2014-01-01
Human brain chemistry is incompletely understood and better methodologies are needed. Traumatic brain injury (TBI) causes metabolic perturbations, one result of which includes increased brain lactate levels. Attention has largely focussed on glycolysis, whereby glucose is converted to pyruvate and lactate, and is proposed to act as an energy source by feeding into neurons’ tricarboxylic acid (TCA) cycle, generating ATP. Also reportedly upregulated by TBI is the pentose phosphate pathway (PPP) that does not generate ATP but produces various molecules that are putatively neuroprotective, antioxidant and reparative, in addition to lactate among the end products. We have developed a novel combination of 13C-labelled cerebral microdialysis both to deliver 13C-labelled substrates into brains of TBI patients and recover the 13C-labelled metabolites, with high-resolution 13C NMR analysis of the microdialysates. This methodology has enabled us to achieve the first direct demonstration in humans that the brain can utilise lactate via the TCA cycle. We are currently using this methodology to make the first direct comparison of glycolysis and the PPP in human brain. In this article, we consider the application of 13C-labelled cerebral microdialysis for studying brain energy metabolism in patients. We set this methodology within the context of metabolic pathways in the brain, and 13C research modalities addressing them. PMID:24361470
Lis, Paweł; Jurkiewicz, Paweł; Cal-Bąkowska, Magdalena; Ko, Young H.; Pedersen, Peter L.; Goffeau, Andre; Ułaszewski, Stanisław
2016-01-01
In this study the detailed characteristic of the anti-cancer agent 3-bromopyruvate (3-BP) activity in the yeast Saccharomyces cerevisiae model is described, with the emphasis on its influence on energetic metabolism of the cell. It shows that 3-BP toxicity in yeast is strain-dependent and influenced by the glucose-repression system. Its toxic effect is mainly due to the rapid depletion of intracellular ATP. Moreover, lack of the Whi2p phosphatase results in strongly increased sensitivity of yeast cells to 3-BP, possibly due to the non-functional system of mitophagy of damaged mitochondria through the Ras-cAMP-PKA pathway. Single deletions of genes encoding glycolytic enzymes, the TCA cycle enzymes and mitochondrial carriers result in multiple effects after 3-BP treatment. However, it can be concluded that activity of the pentose phosphate pathway is necessary to prevent the toxicity of 3-BP, probably due to the fact that large amounts of NADPH are produced by this pathway, ensuring the reducing force needed for glutathione reduction, crucial to cope with the oxidative stress. Moreover, single deletions of genes encoding the TCA cycle enzymes and mitochondrial carriers generally cause sensitivity to 3-BP, while totally inactive mitochondrial respiration in the rho0 mutant resulted in increased resistance to 3-BP. PMID:26862728
Egnatchik, Robert A; Brittain, Evan L; Shah, Amy T; Fares, Wassim H; Ford, H James; Monahan, Ken; Kang, Christie J; Kocurek, Emily G; Zhu, Shijun; Luong, Thong; Nguyen, Thuy T; Hysinger, Erik; Austin, Eric D; Skala, Melissa C; Young, Jamey D; Roberts, L Jackson; Hemnes, Anna R; West, James; Fessel, Joshua P
2017-03-01
Pulmonary arterial hypertension (PAH) is increasingly recognized as a systemic disease driven by alteration in the normal functioning of multiple metabolic pathways affecting all of the major carbon substrates, including amino acids. We found that human pulmonary hypertension patients (WHO Group I, PAH) exhibit systemic and pulmonary-specific alterations in glutamine metabolism, with the diseased pulmonary vasculature taking up significantly more glutamine than that of controls. Using cell culture models and transgenic mice expressing PAH-causing BMPR2 mutations, we found that the pulmonary endothelium in PAH shunts significantly more glutamine carbon into the tricarboxylic acid (TCA) cycle than wild-type endothelium. Increased glutamine metabolism through the TCA cycle is required by the endothelium in PAH to survive, to sustain normal energetics, and to manifest the hyperproliferative phenotype characteristic of disease. The strict requirement for glutamine is driven by loss of sirtuin-3 (SIRT3) activity through covalent modification by reactive products of lipid peroxidation. Using 2-hydroxybenzylamine, a scavenger of reactive lipid peroxidation products, we were able to preserve SIRT3 function, to normalize glutamine metabolism, and to prevent the development of PAH in BMPR2 mutant mice. In PAH, targeting glutamine metabolism and the mechanisms that underlie glutamine-driven metabolic reprogramming represent a viable novel avenue for the development of potentially disease-modifying therapeutics that could be rapidly translated to human studies.
Mycobacterium avium Genes Associated with the Ability To Form a Biofilm
Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.
2006-01-01
Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123
Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R
2016-06-01
During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.
Biotin deficiency inhibits heme synthesis and impairs mitochondria in human lung fibroblasts.
Atamna, Hani; Newberry, Justin; Erlitzki, Ronit; Schultz, Carla S; Ames, Bruce N
2007-01-01
Four of the 5 biotin-dependent carboxylases (BDC) are in the mitochondria. BDC replace intermediates in the Krebs [tricarboxylic acid (TCA)] cycle that are regularly removed for the synthesis of key metabolites such as heme or amino acids. Heme, unlike amino acids, is not recycled to regenerate these intermediates, is not utilized from the diet, and must be synthesized in situ. We studied whether biotin deficiency (BD) lowers heme synthesis and whether mitochondria would be disrupted. Biotin-deficient medium was prepared by using bovine serum stripped of biotin with charcoal/dextran or avidin. Biotin-deficient primary human lung fibroblasts (IMR90) lost their BDC and senesced before biotin-sufficient cells. BD caused heme deficiency; there was a decrease in heme content and heme synthesis, and biotin-deficient cells selectively lost mitochondrial complex IV, which contains heme-a. Loss of complex IV, which is part of the electron transport chain, triggered oxidant release and oxidative damage, hallmarks of heme deficiency. Restoring biotin to the biotin-deficient medium prevented the above changes. Old cells were more susceptible to biotin shortage than young cells. These findings highlight the biochemical connection among biotin, heme, and iron metabolism, and the mitochondria, due to the role of biotin in maintaining the biochemical integrity of the TCA cycle. The findings are discussed in relation to aging and birth defects in humans.
Smeland, Olav B; Hadera, Mussie G; McDonald, Tanya S; Sonnewald, Ursula; Borges, Karin
2013-01-01
Although certain metabolic characteristics such as interictal glucose hypometabolism are well established for temporal lobe epilepsy (TLE), its pathogenesis still remains unclear. Here, we performed a comprehensive study of brain metabolism in a mouse model of TLE, induced by pilocarpine–status epilepticus (SE). To investigate glucose metabolism, we injected mice 3.5–4 weeks after SE with [1,2-13C]glucose before microwave fixation of the head. Using 1H and 13C nuclear magnetic resonance spectroscopy, gas chromatography—mass spectrometry and high-pressure liquid chromatography, we quantified metabolites and 13C labeling in extracts of cortex and hippocampal formation (HF). Hippocampal levels of glutamate, glutathione and alanine were decreased in pilocarpine–SE mice compared with controls. Moreover, the contents of N-acetyl aspartate, succinate and reduced nicotinamide adenine dinucleotide (phosphate) NAD(P)H were decreased in HF indicating impairment of mitochondrial function. In addition, the reduction in 13C enrichment of hippocampal citrate and malate suggests decreased tricarboxylic acid (TCA) cycle turnover in this region. In cortex, we found reduced 13C labeling of glutamate, glutamine and aspartate via the pyruvate carboxylation and pyruvate dehydrogenation pathways, suggesting slower turnover of these amino acids and/or the TCA cycle. In conclusion, mitochondrial metabolic dysfunction and altered amino-acid metabolism is found in both cortex and HF in this epilepsy model. PMID:23611869
Nutrient Dependence of RNase E Essentiality in Escherichia coli
Tamura, Masaru; Moore, Christopher J.
2013-01-01
Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245
Kashyap, Des R; Kuzma, Marcin; Kowalczyk, Dominik A; Gupta, Dipika; Dziarski, Roman
2017-09-01
Mammalian Peptidoglycan Recognition Proteins (PGRPs) kill both Gram-positive and Gram-negative bacteria through simultaneous induction of oxidative, thiol and metal stress responses in bacteria. However, metabolic pathways through which PGRPs induce these bactericidal stress responses are unknown. We screened Keio collection of Escherichia coli deletion mutants and revealed that deleting genes for respiratory chain flavoproteins or for tricarboxylic acid (TCA) cycle resulted in increased resistance of E. coli to PGRP killing. PGRP-induced killing depended on the production of hydrogen peroxide, which required increased supply of NADH for respiratory chain oxidoreductases from central carbon catabolism (glycolysis and TCA cycle), and was controlled by cAMP-Crp. Bactericidal PGRP induced a rapid decrease in respiration, which suggested that the main source of increased production of hydrogen peroxide was a block in respiratory chain and diversion of electrons from NADH oxidoreductases to oxygen. CpxRA two-component system was a negative regulator of PGRP-induced oxidative stress. By contrast, PGRP-induced thiol stress (depletion of thiols) and metal stress (increase in intracellular free Zn 2+ through influx of extracellular Zn 2+ ) were mostly independent of oxidative stress. Thus, manipulating pathways that induce oxidative, thiol and metal stress in bacteria could be a useful strategy to design new approaches to antibacterial therapy. © 2017 John Wiley & Sons Ltd.
Gonsalves, Wilson I.; Hitosugi, Taro; Ghosh, Toshi; Jevremovic, Dragan; Petterson, Xuan-Mai; Wellik, Linda; Kumar, Shaji K.; Nair, K. Sreekumaran
2018-01-01
The production of the oncometabolite 2-hydroxyglutarate (2-HG) has been associated with c-MYC overexpression. c-MYC also regulates glutamine metabolism and drives progression of asymptomatic precursor plasma cell (PC) malignancies to symptomatic multiple myeloma (MM). However, the presence of 2-HG and its clinical significance in PC malignancies is unknown. By performing 13C stable isotope resolved metabolomics (SIRM) using U[13C6]Glucose and U[13C5]Glutamine in human myeloma cell lines (HMCLs), we show that 2-HG is produced in clonal PCs and is derived predominantly from glutamine anaplerosis into the TCA cycle. Furthermore, the 13C SIRM studies in HMCLs also demonstrate that glutamine is preferentially utilized by the TCA cycle compared with glucose. Finally, measuring the levels of 2-HG in the BM supernatant and peripheral blood plasma from patients with precursor PC malignancies such as smoldering MM (SMM) demonstrates that relatively elevated levels of 2-HG are associated with higher levels of c-MYC expression in the BM clonal PCs and with a subsequent shorter time to progression (TTP) to MM. Thus, measuring 2-HG levels in BM supernatant or peripheral blood plasma of SMM patients offers potential early identification of those patients at high risk of progression to MM, who could benefit from early therapeutic intervention. PMID:29321378
Jekabsons, Mika B; Gebril, Hoda M; Wang, Yan-Hong; Avula, Bharathi; Khan, Ikhlas A
2017-10-01
A hexose phosphate recycling model previously developed to infer fluxes through the major glucose consuming pathways in cultured cerebellar granule neurons (CGNs) from neonatal rats metabolizing [1,2- 13 C 2 ]glucose was revised by considering reverse flux through the non-oxidative pentose phosphate pathway (PPP) and symmetrical succinate oxidation within the tricarboxylic acid (TCA) cycle. The model adjusts three flux ratios to effect 13 C distribution in the hexose, pentose, and triose phosphate pools, and in TCA cycle malate to minimize the error between predicted and measured 13 C labeling in exported lactate (i.e., unlabeled, single-, double-, and triple-labeled; M, M1, M2, and M3, respectively). Inclusion of reverse non-oxidative PPP flux substantially increased the number of calculations but ultimately had relatively minor effects on the labeling of glycolytic metabolites. From the error-minimized solution in which the predicted M-M3 lactate differed by 0.49% from that measured by liquid chromatography-triple quadrupole mass spectrometry, the neurons exhibited negligible forward non-oxidative PPP flux. Thus, no glucose was used by the pentose cycle despite explicit consideration of hexose phosphate recycling. Mitochondria consumed only 16% of glucose while 45% was exported as lactate by aerobic glycolysis. The remaining 39% of glucose was shunted to pentose phosphates presumably for de novo nucleotide synthesis, but the proportion metabolized through the oxidative PPP vs. the reverse non-oxidative PPP could not be determined. The lactate exported as M1 (2.5%) and M3 (1.2%) was attributed to malic enzyme, which was responsible for 7.8% of pyruvate production (vs. 92.2% by glycolysis). The updated model is more broadly applicable to different cell types by considering bi-directional flux through the non-oxidative PPP. Its application to cultured neurons utilizing glucose as the sole exogenous substrate has demonstrated substantial oxygen-independent glucose utilization by aerobic glycolysis as well as the oxidative PPP and/or reverse non-oxidative PPP, but negligible glucose consumption by the pentose cycle. Copyright © 2017 Elsevier Ltd. All rights reserved.
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-01-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162
Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin
2017-09-01
The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.
Raman, Babu; Nandakumar, M P; Muthuvijayan, Vignesh; Marten, Mark R
2005-11-05
Proteome analysis was used to compare global protein expression changes in Escherichia coli fermentation between exponential and glucose-limited fed-batch phase. Two-dimensional gel electrophoresis and MALDI-TOF mass spectrometry were used to separate and identify 49 proteins showing >2-fold difference in expression. Proteins upregulated during exponential phase include ribonucleotide biosynthesis enzymes and ribosomal recycling factor. Proteins upregulated during fed-batch phase include those involved in high-affinity glucose uptake, transport and degradation of alternate carbon sources and TCA cycle, suggesting an enhanced role of the cycle under glucose- and energy-limited conditions. We report the upregulation of several putative proteins (ytfQ, ygiS, ynaF, yggX, yfeX), not identified in any previous study under carbon-limited conditions. Copyright (c) 2005 Wiley Periodicals, Inc.
McCommis, Kyle S; Chen, Zhouji; Fu, Xiaorong; McDonald, William G; Colca, Jerry R; Kletzien, Rolf F; Burgess, Shawn C; Finck, Brian N
2015-10-06
Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite for gluconeogenesis in hepatocytes, which is important for the maintenance of normoglycemia during prolonged food deprivation but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2(-/-)) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte conversion of labeled pyruvate to TCA cycle intermediates and glucose. Unbiased metabolomic analyses of livers from fasted LS-Mpc2(-/-) mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for the loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2(-/-) hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. Copyright © 2015 Elsevier Inc. All rights reserved.
McCommis, Kyle S.; Chen, Zhouji; Fu, Xiaorong; McDonald, William G.; Colca, Jerry R.; Kletzien, Rolf F.; Burgess, Shawn C.; Finck, Brian N.
2015-01-01
SUMMARY Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite step for gluconeogenesis in hepatocytes, which is important for maintenance of normoglycemia during prolonged food deprivation, but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2−/−) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte pyruvate metabolism, labelled pyruvate conversion to TCA cycle intermediates and glucose, and glucose production from pyruvate. Unbiased metabolomic analyses of livers from fasted LS-Mpc2−/− mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2−/− hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. PMID:26344101
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tabita, F. Robert
2008-12-04
During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO 2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris.
Synthesis of the 1-Monoester of 2-Ketoalkanedioic Acids, e.g., Octyl α-Ketoglutarate
Jung, Michael E.; Deng, Gang
2012-01-01
Oxidative cleavage of cycloalkene-1-carboxylates, made from the corresponding carboxylic acids, and subsequent oxidation of the resulting ketoaldehyde afforded the important 1-monoesters of 2-ketoalkanedioic acids. Thus ozonolysis of octyl cyclobutene-1-carboxylate followed by sodium chlorite oxidation afforded the 1-monooctyl 2-ketoglutarate. This is a cell-permeable prodrug form of α-ketoglutarate, an important intermediate in the tricarboxylic acid (TCA, Krebs) cycle and a promising therapeutic agent in its own right. PMID:23163977
The Role of Mitochondrial TCA Cycle Enzymes in Determining Prostate Cancer Chemosensitivity
2014-03-01
phosphorylation, Nat Rev Genet 2, 342-352. 17. Higgins , L. H., Withers, H. G., Garbens, A., Love, H. D., Magnoni, L., Hayward, S. W., and Moyes, C. D. (2009...MalateDehydrogenase 2ConfersDocetaxel Resistancevia Regulations of JNKSignaling andOxidativeMetabolism Qiong Liu, Chris T. Harvey, Hao Geng, Changhui...1036 Liuet al. The Prostate 40. Higgins LH, Withers HG, Garbens A, Love HD, Magnoni L, Hayward SW, Moyes CD. Hypoxia and the metabolic pheno- type of
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-01-01
(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2′-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about the mechanism of inactivation by bactericidal antibiotics. PMID:24705541
Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego
2014-01-01
(+)-limonene is a lipophilic antimicrobial compound, extracted from citrus fruits' essential oils, that is used as a flavouring agent and organic solvent by the food industry. A recent study has proposed a common and controversial mechanism of cell death for bactericidal antibiotics, in which hydroxyl radicals ultimately inactivated cells. Our objective was to determine whether the mechanism of Escherichia coli MG1655 inactivation by (+)-limonene follows that of bactericidal antibiotics. A treatment with 2,000 μL/L (+)-limonene inactivated 4 log10 cycles of exponentially growing E. coli cells in 3 hours. On one hand, an increase of cell survival in the ΔacnB mutant (deficient in a TCA cycle enzyme), or in the presence of 2,2'-dipyridyl (inhibitor of Fenton reaction by iron chelation), thiourea, or cysteamine (hydroxyl radical scavengers) was observed. Moreover, the ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) was more sensitive to (+)-limonene. Thus, this indirect evidence indicates that the mechanism of exponentially growing E. coli cells inactivation by 2,000 μL/L (+)-limonene is due to the TCA cycle and Fenton-mediated hydroxyl radical formation that caused oxidative DNA damage, as observed for bactericidal drugs. However, several differences have been observed between the proposed mechanism for bactericidal drugs and for (+)-limonene. In this regard, our results demonstrated that E. coli inactivation was influenced by its physiological state and the drug's concentration: experiments with stationary-phase cells or 4,000 μL/L (+)-limonene uncovered a different mechanism of cell death, likely unrelated to hydroxyl radicals. Our research has also shown that drug's concentration is an important factor influencing the mechanism of bacterial inactivation by antibiotics, such as kanamycin. These results might help in improving and spreading the use of (+)-limonene as an antimicrobial compound, and in clarifying the controversy about the mechanism of inactivation by bactericidal antibiotics.
Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K
2011-11-11
Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Huber, J. A.; Fortunato, C. S.
2014-12-01
The global ocean comprises the Earth's largest biome, with microorganisms playing a dominant biogeochemical role. However, the potential for production of new microbial biomass within the subseafloor is rarely considered in traditional oceanographic paradigms of carbon cycling or microbial food webs. In this study, we used RNA Stable Isotope Probing (RNA SIP) to determine the microbial community composition and genetic repertoire of active subseafloor autotrophs in warm venting fluids from Axial Seamount. RNA is a responsive biomarker because it is a reflection of cellular activity independent of replication, and RNA SIP thus provides access to both the function of a microbial community and the phylogeny of the organisms accountable for key functions. Diffuse fluids were incubated shipboard at 30°C, 55°C, and 80°C with 13DIC and H2. Metatranscriptomic sequencing of both the enriched and non-enriched RNA was carried out from 13C and 12C controls. In addition, filtered fluid samples were preserved in situ for comparative meta -transcriptomic and -genomic analyses. Diverse lineages of bacteria and archaea and accompanying metabolisms were detected in situ, but RNA SIP results show dominance of three different groups of autotrophs active under each experimental condition. At 30°C, members of the Sulfurimonas genus dominated, with genes for hydrogen oxidation, nitrate reduction, and carbon fixation via the rTCA cycle highly expressed. At 55°C, both Caminibacter and Nautilia transcripts were detected for rTCA cycle, hydrogen oxidation, and nitrate reduction. At 80°C, transcripts for hydrogenotrophic methanogenesis mediated by members of Methanocaldococcus were detected. These results suggest the subseafloor hosts various anaerobic chemolithoautotrophs that span a wide temperature range, with hydrogen playing a key role in microbial metabolism. Complementary experiments are currently being carried out on the seafloor with a novel in situ incubator unit to provide further insights to primary productivity in the subseafloor.
Pastor, José M.; Bernal, Vicente; Salvador, Manuel; Argandoña, Montserrat; Vargas, Carmen; Csonka, Laszlo; Sevilla, Ángel; Iborra, José L.; Nieto, Joaquín J.; Cánovas, Manuel
2013-01-01
Bacterial osmoadaptation involves the cytoplasmic accumulation of compatible solutes to counteract extracellular osmolarity. The halophilic and highly halotolerant bacterium Chromohalobacter salexigens is able to grow up to 3 m NaCl in a minimal medium due to the de novo synthesis of ectoines. This is an osmoregulated pathway that burdens central metabolic routes by quantitatively drawing off TCA cycle intermediaries. Consequently, metabolism in C. salexigens has adapted to support this biosynthetic route. Metabolism of C. salexigens is more efficient at high salinity than at low salinity, as reflected by lower glucose consumption, lower metabolite overflow, and higher biomass yield. At low salinity, by-products (mainly gluconate, pyruvate, and acetate) accumulate extracellularly. Using [1-13C]-, [2-13C]-, [6-13C]-, and [U-13C6]glucose as carbon sources, we were able to determine the main central metabolic pathways involved in ectoines biosynthesis from glucose. C. salexigens uses the Entner-Doudoroff pathway rather than the standard glycolytic pathway for glucose catabolism, and anaplerotic activity is high to replenish the TCA cycle with the intermediaries withdrawn for ectoines biosynthesis. Metabolic flux ratios at low and high salinity were similar, revealing a certain metabolic rigidity, probably due to its specialization to support high biosynthetic fluxes and partially explaining why metabolic yields are so highly affected by salinity. This work represents an important contribution to the elucidation of specific metabolic adaptations in compatible solute-accumulating halophilic bacteria. PMID:23615905
Boulangé, Claire L; Claus, Sandrine P; Chou, Chieh J; Collino, Sebastiano; Montoliu, Ivan; Kochhar, Sunil; Holmes, Elaine; Rezzi, Serge; Nicholson, Jeremy K; Dumas, Marc E; Martin, François-Pierre J
2013-04-05
We investigated the short-term (7 days) and long-term (60 days) metabolic effect of high fat diet induced obesity (DIO) and weight gain in isogenic C57BL/6 mice and examined the specific metabolic differentiation between mice that were either strong-responders (SR), or non-responders (NR) to weight gain. Mice (n = 80) were fed a standard chow diet for 7 days prior to randomization into a high-fat (HF) (n = 56) or a low-fat (LF) (n = 24) diet group. The (1)H NMR urinary metabolic profiles of LF and HF mice were recorded 7 and 60 days after the diet switch. On the basis of the body weight gain (BWG) distribution of HF group, we identified NR mice (n = 10) and SR mice (n = 14) to DIO. Compared with LF, HF feeding increased urinary excretion of glycine conjugates of β-oxidation intermediate (hexanoylglycine), branched chain amino acid (BCAA) catabolism intermediates (isovalerylglycine, α-keto-β-methylvalerate and α-ketoisovalerate) and end-products of nicotinamide adenine dinucleotide (NAD) metabolism (N1-methyl-2-pyridone-5-carboxamide, N1-methyl-4-pyridone-3-carboxamide) suggesting up-regulation of mitochondrial oxidative pathways. In the HF group, NR mice excreted relatively more hexanoylglycine, isovalerylglycine, and fewer tricarboxylic acid (TCA) cycle intermediate (succinate) in comparison to SR mice. Thus, subtle regulation of ketogenic pathways in DIO may alleviate the saturation of the TCA cycle and mitochondrial oxidative metabolism.
Mujahid, Md; Prasuna, M Lakshmi; Sasikala, Ch; Ramana, Ch Venkata
2015-02-06
Aromatic amines are widely distributed in the environment and are major environmental pollutants. Although degradation of aromatic amines is well studied in bacteria, physiological adaptations and stress response to these toxic compounds is not yet fully understood. In the present study, systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress were deciphered using metabolite and iTRAQ-labeled protein profiling. Strain JA2 tolerated high concentrations of aniline (30 mM) with trace amounts of aniline being transformed to acetanilide. GC-MS metabolite profiling revealed aniline stress phenotype wherein amino acid, carbohydrate, fatty acid, nitrogen metabolisms, and TCA (tricarboxylic acid cycle) were modulated. Strain JA2 responded to aniline by remodeling the proteome, and cellular functions, such as signaling, transcription, translation, stress tolerance, transport and carbohydrate metabolism, were highly modulated. Key adaptive responses, such as transcription/translational changes, molecular chaperones to control protein folding, and efflux pumps implicated in solvent extrusion, were induced in response to aniline stress. Proteo-metabolomics indicated extensive rewiring of metabolism to aniline. TCA cycle and amino acid catabolism were down-regulated while gluconeogenesis and pentose phosphate pathways were up-regulated, leading to the synthesis of extracellular polymeric substances. Furthermore, increased saturated fatty acid ratios in membranes due to aniline stress suggest membrane adaptation. The present study thus indicates that strain JA2 employs multilayered responses: stress response, toxic compound tolerance, energy conservation, and metabolic rearrangements to aniline.
Oxidation of [U-13 C]glucose in the human brain at 7T under steady state conditions.
Cheshkov, Sergey; Dimitrov, Ivan E; Jakkamsetti, Vikram; Good, Levi; Kelly, Dorothy; Rajasekaran, Karthik; DeBerardinis, Ralph J; Pascual, Juan M; Sherry, A Dean; Malloy, Craig R
2017-12-01
Disorders of brain energy metabolism and neurotransmitter recycling have been implicated in multiple neurological conditions. 13 C magnetic resonance spectroscopy ( 13 C MRS) during intravenous administration of 13 C-labeled compounds has been used to measure turnover rates of brain metabolites. This approach, however, requires prolonged infusion inside the magnet. Proton decoupling is typically required but may be difficult to implement with standard equipment. We examined an alternative approach to monitor glucose metabolism in the human brain. 13 C-enriched glucose was infused in healthy subjects outside the magnet to a steady-state level of 13 C enrichment. Subsequently, the subjects were scanned at 7T for 60 min without 1 H decoupling. Metabolic modeling was used to calculate anaplerosis. Biomarkers of energy metabolism and anaplerosis were detected. The glutamate C5 doublet provided information about glucose-derived acetyl-coenzyme A flux into the tricarboxylic acid (TCA) cycle via pyruvate dehydrogenase, and the bicarbonate signal reflected overall TCA cycle activity. The glutamate C1/C5 ratio is sensitive to anaplerosis. Brain 13 C MRS at 7T provides information about glucose oxidation and anaplerosis without the need of prolonged 13 C infusions inside the scanner and without technical challenges of 1 H decoupling, making it a feasible approach for clinical research. Magn Reson Med 78:2065-2071, 2017. © 2017 International Society for Magnetic Resonance in Medicine. © 2017 International Society for Magnetic Resonance in Medicine.
Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique
2014-01-01
Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C NMR to determine the concentrations of 13C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total (12C+13C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total 13C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168
Metabolic sensor governing bacterial virulence in Staphylococcus aureus.
Ding, Yue; Liu, Xing; Chen, Feifei; Di, Hongxia; Xu, Bin; Zhou, Lu; Deng, Xin; Wu, Min; Yang, Cai-Guang; Lan, Lefu
2014-11-18
An effective metabolism is essential to all living organisms, including the important human pathogen Staphylococcus aureus. To establish successful infection, S. aureus must scavenge nutrients and coordinate its metabolism for proliferation. Meanwhile, it also must produce an array of virulence factors to interfere with host defenses. However, the ways in which S. aureus ties its metabolic state to its virulence regulation remain largely unknown. Here we show that citrate, the first intermediate of the tricarboxylic acid (TCA) cycle, binds to and activates the catabolite control protein E (CcpE) of S. aureus. Using structural and site-directed mutagenesis studies, we demonstrate that two arginine residues (Arg145 and Arg256) within the putative inducer-binding cavity of CcpE are important for its allosteric activation by citrate. Microarray analysis reveals that CcpE tunes the expression of 126 genes that comprise about 4.7% of the S. aureus genome. Intriguingly, although CcpE is a major positive regulator of the TCA-cycle activity, its regulon consists predominantly of genes involved in the pathogenesis of S. aureus. Moreover, inactivation of CcpE results in increased staphyloxanthin production, improved ability to acquire iron, increased resistance to whole-blood-mediated killing, and enhanced bacterial virulence in a mouse model of systemic infection. This study reveals CcpE as an important metabolic sensor that allows S. aureus to sense and adjust its metabolic state and subsequently to coordinate the expression of virulence factors and bacterial virulence.
Guillemet, Mélanie L; Moreau, Patrice L
2008-08-01
The activity of amino acid-dependent acid resistance systems allows Escherichia coli to survive during prolonged incubation under phosphate (P(i)) starvation conditions. We show in this work that rpoS-null mutants incubated in the absence of any amino acid survived during prolonged incubation under aerobic, P(i) starvation conditions. Whereas rpoS(+) cells incubated with glutamate excreted high levels of acetate, rpoS mutants grew on acetic acid. The characteristic metabolism of rpoS mutants required the activity of Fur (ferric uptake regulator) in order to decrease the synthesis of the small RNA RyhB that might otherwise inhibit the synthesis of iron-rich proteins. We propose that RpoS (sigma(S)) and the small RNA RyhB contribute to decrease the synthesis of iron-rich proteins required for the activity of the tricarboxylic acid (TCA) cycle, which redirects the metabolic flux toward the production of acetic acid at the onset of stationary phase in rpoS(+) cells. In contrast, Fur activity, which represses ryhB, and the lack of RpoS activity allow a substantial activity of the TCA cycle to continue in stationary phase in rpoS mutants, which decreases the production of acetic acid and, eventually, allows growth on acetic acid and P(i) excreted into the medium. These data may help explain the fact that a high frequency of E. coli rpoS mutants is found in nature.
Araújo, Wagner L.; Tohge, Takayuki; Nunes-Nesi, Adriano; Daloso, Danilo M.; Nimick, Mhairi; Krahnert, Ina; Bunik, Victoria I.; Moorhead, Greg B. G.; Fernie, Alisdair R.
2012-01-01
Although the role of the 2-oxoglutarate dehydrogenase complex (2-OGDHC) has previously been demonstrated in plant heterotrophic tissues its role in photosynthetically active tissues remains poorly understood. By using a combination of metabolite and transcript profiles we here investigated the function of 2-OGDHC in leaves of Arabidopsis thaliana via use of specific phosphonate inhibitors of the enzyme. Incubation of leaf disks with the inhibitors revealed that they produced the anticipated effects on the in situ enzyme activity. In vitro experiments revealed that succinyl phosphonate (SP) and a carboxy ethyl ester of SP are slow-binding inhibitors of the 2-OGDHC. Our results indicate that the reduced respiration rates are associated with changes in the regulation of metabolic and signaling pathways leading to an imbalance in carbon-nitrogen metabolism and cell homeostasis. The inducible alteration of primary metabolism was associated with altered expression of genes belonging to networks of amino acids, plant respiration, and sugar metabolism. In addition, by using isothermal titration calorimetry we excluded the possibility that the changes in gene expression resulted from an effect on 2-oxoglutarate (2OG) binding to the carbon/ATP sensing protein PII. We also demonstrated that the 2OG degradation by the 2-oxoglutarate dehydrogenase strongly influences the distribution of intermediates of the tricarboxylic acid (TCA) cycle and the GABA shunt. Our results indicate that the TCA cycle activity is clearly working in a non-cyclic manner upon 2-OGDHC inhibition during the light period. PMID:22876250
The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo.
Chowdhury, Golam M I; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L
2014-07-01
The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-(13)C₂]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (V(acCoA-kbN)) and pyruvate (V(pdhN)), and the glutamate-glutamine cycle (V(cyc)) were determined by metabolic modeling of (13)C label trapped in major brain amino acid pools. V(acCoA-kbN) increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (V(tcaN)), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons.
Fiat lux! Phylogeny and bioinformatics shed light on GABA functions in plants.
Renault, Hugues
2013-06-01
The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants.
Renault, Hugues
2013-01-01
The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants. PMID:23518583
Wen, Li; Liu, Gai; Zhang, Zai-Jun; Tao, Jun; Wan, Cui-Xiang; Zhu, Ying-Guo
2006-03-01
The proteins of HL type cytoplasmic male sterility rice anther of YTA (CMS) and YTB (maintenance line) were separated by two-dimensional electrophoresis with immobilized ph (3-10 non-linear) gradients as the first dimension and SDS-PAGE as the second. The silver-stained proteins spots were analyzed using Image Master 2D software, there were about 1800 detectable spots on each 2D-gel, and about 85 spots were differential expressed. With direct MALDI-TOF mass spectrometry analysis and protein database searching, 9 protein spots out of 16 were identified. Among those proteins, there were Putative nucleic acid binding protein, glucose-1-phosphate adenylyltransferase (ADP-glucose pyrophosphorylase, AGPase) (EC: 2.7.7.27) large chain, UDP-glucuronic acid decarboxylase, putative calcium-binding protein annexin, putative acetyl-CoA synthetase and putative lipoamide dehydrogenase etc. They were closely associated with metabolism, protein biosynthesis, transcription, signal transduction and so on, all of which are cell activities that are essential to pollen development. Some of the identified proteins, i.e. AGPase, putative lipoamide dehydrogenase and putative acetyl-CoA synthetase were deeply discussed on the relationship to CMS. AGPase catalyzes a very important step in the biosynthesis of alpha 1,4-glucans (glycogen or starch) in bacteria and plants: synthesis of the activated glucosyl donor, ADP-glucose, from glucose-1-phosphate and ATP. The lack of the AGPase in male sterile line might directly result in the reduction of starch, and the synthesis of starch was the most important processes during the development of pollen. In present research, the descent or reduction of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase seemed involved in pollen sterility in rice. The degeneration and formation of various tissues during pollen development may impose high demands for energy and key biosynthetic intermediates. Under such conditions, the TCA cycle needs to operate fully, because the TCA cycle is an important source for many intermediates required for biosynthetic pathways, in addition to performing an oxidative, energy-producing role. Thus, it seemed reasonable to infer that the decrease of putative lipoamide dehydrogenase and putative acetyl-CoA synthetase in anther might prevent the conversion of pyruvate into acetyl-CoA, and as a result, the TCA cycle could no longer operate at a sufficient rate to meet all requirements in anther cells, leading to pollen sterility. This study gave new insights into the mechanism of CMS in rice and demonstrated the power of the proteomic approach in plant biology studies.
PIK3CA mutant tumors depend on oxoglutarate dehydrogenase | Office of Cancer Genomics
Oncogenic PIK3CA mutations are found in a significant fraction of human cancers, but therapeutic inhibition of PI3K has only shown limited success in clinical trials. To understand how mutant PIK3CA contributes to cancer cell proliferation, we used genome scale loss-of-function screening in a large number of genomically annotated cancer cell lines. As expected, we found that PIK3CA mutant cancer cells require PIK3CA but also require the expression of the TCA cycle enzyme 2-oxoglutarate dehydrogenase (OGDH).
[Morphological changes in tongue cancer after cryosurgery].
Zhou, X D; Mao, T Q
1993-01-01
Tca 8113 (human tongue cancer cell line) cell transplanted tumors in nude mice were treated with cryosurgery for three freeze-thaw cycles. Tumor samples were obtained by biopsies pre- and post-cryosurgery for morphological study. The results showed intercellular adhesion damage, nuclear pyknosis, cell death, etc. One week after, the deep parts of the frozen samples were similar to that of the untreated ones. Our study indicates the change of biomembrance may be also important as of nuclei in cell death and may play an important role in the treatment of cancer by cryochemistry.
NOK mediates glycolysis and nuclear PDC associated histone acetylation.
Shi, Wei-Ye; Yang, Xiao; Huang, Bo; Shen, Wen H; Liu, Li
2017-06-01
NOK is a potent oncogene that can transform normal cells to cancer cells. We hypothesized that NOK might impact cancer cell metabolism and histone acetylation. We show that NOK localizes in the mitochondria, and while it minimally impacts tricarboxylic acid (TCA) cycle, it markedly inhibits the process of electron transport and oxidative phosphorylation processes and dramatically enhances aerobic glycolysis in cancer cells. NOK promotes the mitochondrial-nuclear translocation of pyruvate dehydrogenase complex (PDC), and enhances histone acetylation in the nucleus. Together, these findings show that NOK mediates glycolysis and nuclear PDC associated histone acetylation.
NASA Astrophysics Data System (ADS)
Siyuan, He; Changhong, Zhang; Liang, Tao; Weifeng, Zhang; Longyue, Zeng; Wei, Lü; Haijun, Wu
2013-03-01
A CMOS long-term evolution (LTE) direct convert receiver that eliminates the interstage SAW filter is presented. The receiver consists of a low noise variable gain transconductance amplifier (TCA), a quadrature passive current commutating mixer with a 25% duty-cycle LO, a trans-impedance amplifier (TIA), a 7th-order Chebyshev filter and programmable gain amplifiers (PGAs). A wide dynamic gain range is allocated in the RF and analog parts. A current commutating passive mixer with a 25% duty-cycle LO improves gain, noise, and linearity. An LPF based on a Tow-Thomas biquad suppresses out-of-band interference. Fabricated in a 0.13 μm CMOS process, the receiver chain achieves a 107 dB maximum voltage gain, 2.7 dB DSB NF (from PAD port), -11 dBm IIP3, and > +65 dBm IIP2 after calibration, 96 dB dynamic control range with 1 dB steps, less than 2% error vector magnitude (EVM) from 2.3 to 2.7 GHz. The total receiver (total I Q path) draws 89 mA from a 1.2-V LDO on chip supply.
Zheng, Shiju; Jing, Guoxing; Wang, Xiao; Ouyang, Qiuli; Jia, Lei; Tao, Nengguo
2015-07-01
This work investigated the effect of citral on the mitochondrial morphology and function of Penicillium digitatum. Citral at concentrations of 2.0 or 4.0 μL/mL strongly damaged mitochondria of test pathogen by causing the loss of matrix and increase of irregular mitochondria. The deformation extent of the mitochondria of P. digitatum enhanced with increasing concentrations of citral, as evidenced by a decrease in intracellular ATP content and an increase in extracellular ATP content of P. digitatum cells. Oxygen consumption showed that citral resulted in an inhibition in the tricarboxylic acid cycle (TCA) pathway of P. digitatum cells, induced a decrease in activities of citrate synthetase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, succinodehydrogenase and the content of citric acid, while enhancing the activity of malic dehydrogenase in P. digitatum cells. Our present results indicated that citral could damage the mitochondrial membrane permeability and disrupt the TCA pathway of P. digitatum. Copyright © 2015 Elsevier Ltd. All rights reserved.
Pasricha, Shivani; MacRae, James I.; Chua, Hwa H.; Chambers, Jenny; Boyce, Kylie J.; McConville, Malcolm J.; Andrianopoulos, Alex
2017-01-01
Fungal infections are an increasing public health problem, particularly in immunocompromised individuals. While these pathogenic fungi show polyphyletic origins with closely related non-pathogenic species, many undergo morphological transitions to produce pathogenic cell types that are associated with increased virulence. However, the characteristics of these pathogenic cells that contribute to virulence are poorly defined. Talaromyces marneffei grows as a non-pathogenic hyphal form at 25°C but undergoes a dimorphic transition to a pathogenic yeast form at 37°C in vitro and following inhalation of asexual conidia by a host. Here we show that this transition is associated with major changes in central carbon metabolism, and that these changes are correlated with increased virulence of the yeast form. Comprehensive metabolite profiling and 13C-labeling studies showed that hyphal cells exhibited very active glycolytic metabolism and contain low levels of internal carbohydrate reserves. In contrast, yeast cells fully catabolized glucose in the mitochondrial TCA cycle, and store excess glucose in large intracellular pools of trehalose and mannitol. Inhibition of the yeast TCA cycle inhibited replication in culture and in host cells. Yeast, but not hyphae, were also able to use myo-inositol and amino acids as secondary carbon sources, which may support their survival in host macrophages. These analyses suggest that T. marneffei yeast cells exhibit a more efficient oxidative metabolism and are capable of utilizing a diverse range of carbon sources, which contributes to their virulence in animal tissues, highlighting the importance of dimorphic switching in pathogenic yeast. PMID:28861398
Pasricha, Shivani; MacRae, James I; Chua, Hwa H; Chambers, Jenny; Boyce, Kylie J; McConville, Malcolm J; Andrianopoulos, Alex
2017-01-01
Fungal infections are an increasing public health problem, particularly in immunocompromised individuals. While these pathogenic fungi show polyphyletic origins with closely related non-pathogenic species, many undergo morphological transitions to produce pathogenic cell types that are associated with increased virulence. However, the characteristics of these pathogenic cells that contribute to virulence are poorly defined. Talaromyces marneffei grows as a non-pathogenic hyphal form at 25°C but undergoes a dimorphic transition to a pathogenic yeast form at 37°C in vitro and following inhalation of asexual conidia by a host. Here we show that this transition is associated with major changes in central carbon metabolism, and that these changes are correlated with increased virulence of the yeast form. Comprehensive metabolite profiling and 13 C-labeling studies showed that hyphal cells exhibited very active glycolytic metabolism and contain low levels of internal carbohydrate reserves. In contrast, yeast cells fully catabolized glucose in the mitochondrial TCA cycle, and store excess glucose in large intracellular pools of trehalose and mannitol. Inhibition of the yeast TCA cycle inhibited replication in culture and in host cells. Yeast, but not hyphae, were also able to use myo -inositol and amino acids as secondary carbon sources, which may support their survival in host macrophages. These analyses suggest that T. marneffei yeast cells exhibit a more efficient oxidative metabolism and are capable of utilizing a diverse range of carbon sources, which contributes to their virulence in animal tissues, highlighting the importance of dimorphic switching in pathogenic yeast.
Physiological and Proteomic Analysis of Escherichia coli Iron-Limited Chemostat Growth
Folsom, James Patrick; Parker, Albert E.
2014-01-01
Iron bioavailability is a major limiter of bacterial growth in mammalian host tissue and thus represents an important area of study. Escherichia coli K-12 metabolism was studied at four levels of iron limitation in chemostats using physiological and proteomic analyses. The data documented an E. coli acclimation gradient where progressively more severe iron scarcity resulted in a larger percentage of substrate carbon being directed into an overflow metabolism accompanied by a decrease in biomass yield on glucose. Acetate was the primary secreted organic by-product for moderate levels of iron limitation, but as stress increased, the metabolism shifted to secrete primarily lactate (∼70% of catabolized glucose carbon). Proteomic analysis reinforced the physiological data and quantified relative increases in glycolysis enzyme abundance and decreases in tricarboxylic acid (TCA) cycle enzyme abundance with increasing iron limitation stress. The combined data indicated that E. coli responds to limiting iron by investing the scarce resource in essential enzymes, at the cost of catabolic efficiency (i.e., downregulating high-ATP-yielding pathways containing enzymes with large iron requirements, like the TCA cycle). Acclimation to iron-limited growth was contrasted experimentally with acclimation to glucose-limited growth to identify both general and nutrient-specific acclimation strategies. While the iron-limited cultures maximized biomass yields on iron and increased expression of iron acquisition strategies, the glucose-limited cultures maximized biomass yields on glucose and increased expression of carbon acquisition strategies. This study quantified ecologically competitive acclimations to nutrient limitations, yielding knowledge essential for understanding medically relevant bacterial responses to host and to developing intervention strategies. PMID:24837288
Li, Huihui; An, Yanpeng; Zhang, Lulu; Lei, Hehua; Zhang, Limin; Wang, Yulan; Tang, Huiru
2013-12-06
Inflammation is closely associated with pathogenesis of various metabolic disorders, cardiovascular diseases, and cancers. To understand the systems responses to localized inflammation, we analyzed the dynamic metabolic changes in rat plasma and urine associated with the carrageenan-induced self-limiting pleurisy using NMR spectroscopy in conjunction with multivariate data analysis. Fatty acids in plasma were also analyzed using GC-FID/MS with the data from clinical chemistry and histopathology as complementary information. We found that in the acute phase of inflammation rats with pleurisy had significantly lower levels in serum albumin, fatty acids, and lipoproteins but higher globulin level and larger quantity of pleural exudate than controls. The carrageenan-induced inflammation was accompanied by significant metabolic alterations involving TCA cycle, glycolysis, biosyntheses of acute phase proteins, and metabolisms of amino acids, fatty acids, ketone bodies, and choline in acute phase. The resolution process of pleurisy was heterogeneous, and two subgroups were observed for the inflammatory rats at day-6 post treatment with different metabolic features together with the quantity of pleural exudate and weights of thymus and spleen. The metabolic differences between these subgroups were reflected in the levels of albumin and acute-phase proteins, the degree of returning to normality for multiple metabolic pathways including glycolysis, TCA cycle, gut microbiota functions, and metabolisms of lipids, choline and vitamin B3. These findings provided some essential details for the dynamic metabolic changes associated with the carrageenan-induced self-limiting inflammation and demonstrated the combined NMR and GC-FID/MS analysis as a powerful approach for understanding biochemical aspects of inflammation.
Metabolic and physiological adjustment of Suaeda maritima to combined salinity and hypoxia
Behr, Jan H.; Bouchereau, Alain; Berardocco, Solenne; Seal, Charlotte E.; Flowers, Timothy J.
2017-01-01
Background and Aims Suaeda maritima is a halophyte commonly found on coastal wetlands in the intertidal zone. Due to its habitat S. maritima has evolved tolerance to high salt concentrations and hypoxic conditions in the soil caused by periodic flooding. In the present work, the adaptive mechanisms of S. maritima to salinity combined with hypoxia were investigated on a physiological and metabolic level. Methods To compare the adaptive mechanisms to deficient, optimal and stressful salt concentrations, S. maritima plants were grown in a hydroponic culture under low, medium and high salt concentrations. Additionally, hypoxic conditions were applied to investigate the impact of hypoxia combined with different salt concentrations. A non-targeted metabolic approach was used to clarify the biochemical pathways underlying the metabolic and physiological adaptation mechanisms of S. maritima. Key Results Roots exposed to hypoxic conditions showed an increased level of tricarboxylic acid (TCA)-cycle intermediates such as succinate, malate and citrate. During hypoxia, the concentration of free amino acids increased in shoots and roots. Osmoprotectants such as proline and glycine betaine increased in concentrations as the external salinity was increased under hypoxic conditions. Conclusions The combination of high salinity and hypoxia caused an ionic imbalance and an increase of metabolites associated with osmotic stress and photorespiration, indicating a severe physiological and metabolic response under these conditions. Disturbed proline degradation in the roots induced an enhanced proline accumulation under hypoxia. The enhanced alanine fermentation combined with a partial flux of the TCA cycle might contribute to the tolerance of S. maritima to hypoxic conditions. PMID:28110268
Hatazawa, Yukino; Minami, Kimiko; Yoshimura, Ryoji; Onishi, Takumi; Manio, Mark Christian; Inoue, Kazuo; Sawada, Naoki; Suzuki, Osamu; Miura, Shinji; Kamei, Yasutomi
2016-12-09
The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared with that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α's function in the oxidative energy metabolism of skeletal muscles. Copyright © 2016 Elsevier Inc. All rights reserved.
A Comparison of Oxidative Lactate Metabolism in Traumatically Injured Brain and Control Brain.
Jalloh, Ibrahim; Helmy, Adel; Howe, Duncan J; Shannon, Richard J; Grice, Peter; Mason, Andrew; Gallagher, Clare N; Murphy, Michael P; Pickard, John D; Menon, David K; Carpenter, T Adrian; Hutchinson, Peter J; Carpenter, Keri L H
2018-05-18
Metabolic abnormalities occur after traumatic brain injury (TBI). Glucose is conventionally regarded as the major energy substrate, although lactate can also be an energy source. We compared 3- 13 C lactate metabolism in TBI with "normal" control brain and muscle, measuring 13 C-glutamine enrichment to assess tricarboxylic acid (TCA) cycle metabolism. Microdialysis catheters in brains of nine patients with severe TBI, five non-TBI brain surgical patients, and five resting muscle (non-TBI) patients were perfused (24 h in brain, 8 h in muscle) with 8 mmol/L sodium 3- 13 C lactate. Microdialysate analysis employed ISCUS and nuclear magnetic resonance. In TBI, with 3- 13 C lactate perfusion, microdialysate glucose concentration increased nonsignificantly (mean +11.9%, p = 0.463), with significant increases (p = 0.028) for lactate (+174%), pyruvate (+35.8%), and lactate/pyruvate ratio (+101.8%). Microdialysate 13 C-glutamine fractional enrichments (median, interquartile range) were: for C4 5.1 (0-11.1) % in TBI and 5.7 (4.6-6.8) % in control brain, for C3 0 (0-5.0) % in TBI and 0 (0-0) % in control brain, and for C2 2.9 (0-5.7) % in TBI and 1.8 (0-3.4) % in control brain. 13 C-enrichments were not statistically different between TBI and control brain, showing both metabolize 3- 13 C lactate via TCA cycle, in contrast to muscle. Several patients with TBI exhibited 13 C-glutamine enrichment above the non-TBI control range, suggesting lactate oxidative metabolism as a TBI "emergency option."
Narayan, Shoba; Devi, R S; Devi, C S Shyamala
2007-11-20
Free radicals produced by ulcerogenic agents affect the TCA cycle enzymes located in the outer membrane of the mitochondria. Upon induction with ulcerogens, peroxidation of membrane lipids bring about alterations in the mitochondrial enzyme activity. This indicates an increase in the permeability levels of the mitochondrial membrane. The ability of PSE to scavenge the reactive oxygen species results in restoration of activities of TCA cycle enzymes. NSAIDs interfere with the mitochondrial beta-oxidation of fatty acids in vitro and in vivo, resulting in uncoupling of mitochondrial oxidative phosphorylation process. This usually results in diminished cellular ATP production. The recovery of gastric mucosal barrier function through maintenance of energy metabolism results in maintenance of ATP levels, as observed in this study upon treatment with PSE. Membrane integrity altered by peroxidation is known to have a modified fatty acid composition, a disruption of permeability, a decrease in electrical resistance, and increase in flip-flopping between monolayers and inactivated cross-linked proteins. The severe depletion of arachidonic acid in ulcer induced groups was prevented upon treatment with PSE. The acid inhibitory property of the herbal extract enables the maintenance of GL activity upon treatment with PSE. The ability to prevent membrane peroxidation has been traced to the presence of active constituents in the PSE. In essence, PSE has been found to prevent mitochondrial dysfunction, provide mitochondrial cell integrity, through the maintenance of lipid bilayer by its ability to provide a hydrophobic character to the gastric mucosa, further indicating its ability to reverse the action of NSAIDs and mast cell degranulators in gastric mucosa.
Inducible Glutamate Oxaloacetate Transaminase as a Therapeutic Target Against Ischemic Stroke
Khanna, Savita; Briggs, Zachary
2015-01-01
Abstract Significance: Glutamate serves multi-faceted (patho)physiological functions in the central nervous system as the most abundant excitatory neurotransmitter and under pathological conditions as a potent neurotoxin. Regarding the latter, elevated extracellular glutamate is known to play a central role in ischemic stroke brain injury. Recent Advances: Glutamate oxaloacetate transaminase (GOT) has emerged as a new therapeutic target in protecting against ischemic stroke injury. Oxygen-sensitive induction of GOT expression and activity during ischemic stroke lowers glutamate levels at the stroke site while sustaining adenosine triphosphate levels in brain. The energy demands of the brain are among the highest of all organs underscoring the need to quickly mobilize alternative carbon skeletons for metabolism in the absence of glucose during ischemic stroke. Recent work builds on the important observation of Hans Krebs that GOT-mediated metabolism of glutamate generates tri-carboxylic acid (TCA) cycle intermediates in brain tissue. Taken together, outcomes suggest GOT may enable the transformative switch of otherwise excitotoxic glutamate into life-sustaining TCA cycle intermediates during ischemic stroke. Critical Issues: Neuroprotective strategies that focus solely on blocking mechanisms of glutamate-mediated excitotoxicity have historically failed in clinical trials. That GOT can enable glutamate to assume the role of a survival factor represents a paradigm shift necessary to develop the overall significance of glutamate in stroke biology. Future Directions: Ongoing efforts are focused to develop the therapeutic significance of GOT in stroke-affected brain. Small molecules that target induction of GOT expression and activity in the ischemic penumbra are the focus of ongoing studies. Antioxid. Redox Signal. 22, 175–186. PMID:25343301
Hung, Chun-Hsien; Kanehara, Kazue; Nakamura, Yuki
2016-09-01
Triacylglycerol (TAG), a major source of biodiesel production, accumulates in nitrogen-starved Chlamydomonas reinhardtii. However, the metabolic pathway of starch-to-TAG conversion remains elusive because an enzyme that affects the starch degradation is unknown. Here, we isolated a new class of mutant bgal1, which expressed an overaccumulation of starch granules and defective photosynthetic growth. The bgal1 was a null mutant of a previously uncharacterized β-galactosidase-like gene (Cre02.g119700), which decreased total β-galactosidase activity 40% of the wild type. Upon nitrogen starvation, the bgal1 mutant showed decreased TAG accumulation mainly due to the reduced flux of de novo TAG biosynthesis evidenced by increased unsaturation of fatty acid composition in TAG and reduced TAG accumulation by additional supplementation of acetate to the culture media. Metabolomic analysis of the bgal1 mutant showed significantly reduced levels of metabolites following the hydrolysis of starch and substrates for TAG accumulation, whereas metabolites in TCA cycle were unaffected. Upon nitrogen starvation, while levels of glucose 6-phosphate, fructose 6-phosphate and acetyl-CoA remained lower, most of the other metabolites in glycolysis were increased but those in the TCA cycle were decreased, supporting TAG accumulation. We suggest that BGAL1 may be involved in the degradation of starch, which affects TAG accumulation in nitrogen-starved C. reinhardtii. This article is part of a Special Issue entitled: Plant Lipid Biology edited by Kent D. Chapman and Ivo Feussner. Copyright © 2016 Elsevier B.V. All rights reserved.
Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M
2013-10-01
Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid oxidation and subsequent energy production (TCA and OP genes). Our microarray analysis provided novel information that castration alters the transcriptome associated with lipid/energy metabolism, favoring IMF deposition in the LM.
García-Espinosa, María A; Rodrigues, Tiago B; Sierra, Alejandra; Benito, Marina; Fonseca, Carla; Gray, Heather L; Bartnik, Brenda L; García-Martín, María L; Ballesteros, Paloma; Cerdán, Sebastián
2004-01-01
We review briefly 13C NMR studies of cerebral glucose metabolism with an emphasis on the roles of glial energetics and the glutamine cycle. Mathematical modeling analysis of in vivo 13C turnover experiments from the C4 carbons of glutamate and glutamine are consistent with: (i) the glutamine cycle being the major cerebral metabolic route supporting glutamatergic neurotransmission, (ii) glial glutamine synthesis being stoichiometrically coupled to glycolytic ATP production, (iii) glutamine serving as the main precursor of neurotransmitter glutamate and (iv) glutamatergic neurotransmission being supported by lactate oxidation in the neurons in a process accounting for 60-80% of the energy derived from glucose catabolism. However, more recent experimental approaches using inhibitors of the glial tricarboxylic acid (TCA) cycle (trifluoroacetic acid, TFA) or of glutamine synthase (methionine sulfoximine, MSO) reveal that a considerable portion of the energy required to support glutamine synthesis is derived from the oxidative metabolism of glucose in the astroglia and that a significant amount of the neurotransmitter glutamate is produced from neuronal glucose or lactate rather than from glial glutamine. Moreover, a redox switch has been proposed that allows the neurons to use either glucose or lactate as substrates for oxidation, depending on the relative availability of these fuels under resting or activation conditions, respectively. Together, these results suggest that the coupling mechanisms between neuronal and glial metabolism are more complex than initially envisioned.
Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan
2018-02-14
Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whitaker, W. Brian; Jones, J. Andrew; Bennett, R. Kyle
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolyticmore » intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. In conclusion, by incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli.« less
Knoop, Henning; Gründel, Marianne; Zilliges, Yvonne; Lehmann, Robert; Hoffmann, Sabrina; Lockau, Wolfgang; Steuer, Ralf
2013-01-01
Cyanobacteria are versatile unicellular phototrophic microorganisms that are highly abundant in many environments. Owing to their capability to utilize solar energy and atmospheric carbon dioxide for growth, cyanobacteria are increasingly recognized as a prolific resource for the synthesis of valuable chemicals and various biofuels. To fully harness the metabolic capabilities of cyanobacteria necessitates an in-depth understanding of the metabolic interconversions taking place during phototrophic growth, as provided by genome-scale reconstructions of microbial organisms. Here we present an extended reconstruction and analysis of the metabolic network of the unicellular cyanobacterium Synechocystis sp. PCC 6803. Building upon several recent reconstructions of cyanobacterial metabolism, unclear reaction steps are experimentally validated and the functional consequences of unknown or dissenting pathway topologies are discussed. The updated model integrates novel results with respect to the cyanobacterial TCA cycle, an alleged glyoxylate shunt, and the role of photorespiration in cellular growth. Going beyond conventional flux-balance analysis, we extend the computational analysis to diurnal light/dark cycles of cyanobacterial metabolism. PMID:23843751
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli
Whitaker, W. Brian; Jones, J. Andrew; Bennett, R. Kyle; ...
2016-11-01
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolyticmore » intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. In conclusion, by incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli.« less
Tiret, Brice; Shestov, Alexander A.; Valette, Julien; Henry, Pierre-Gilles
2017-01-01
Most current brain metabolic models are not capable of taking into account the dynamic isotopomer information available from fine structure multiplets in 13C spectra, due to the difficulty of implementing such models. Here we present a new approach that allows automatic implementation of multi-compartment metabolic models capable of fitting any number of 13C isotopomer curves in the brain. The new automated approach also makes it possible to quickly modify and test new models to best describe the experimental data. We demonstrate the power of the new approach by testing the effect of adding separate pyruvate pools in astrocytes and neurons, and adding a vesicular neuronal glutamate pool. Including both changes reduced the global fit residual by half and pointed to dilution of label prior to entry into the astrocytic TCA cycle as the main source of glutamine dilution. The glutamate-glutamine cycle rate was particularly sensitive to changes in the model. PMID:26553273
Engineering the biological conversion of methanol to specialty chemicals in Escherichia coli.
Whitaker, W Brian; Jones, J Andrew; Bennett, R Kyle; Gonzalez, Jacqueline E; Vernacchio, Victoria R; Collins, Shannon M; Palmer, Michael A; Schmidt, Samuel; Antoniewicz, Maciek R; Koffas, Mattheos A; Papoutsakis, Eleftherios T
2017-01-01
Methanol is an attractive substrate for biological production of chemicals and fuels. Engineering methylotrophic Escherichia coli as a platform organism for converting methanol to metabolites is desirable. Prior efforts to engineer methylotrophic E. coli were limited by methanol dehydrogenases (Mdhs) with unfavorable enzyme kinetics. We engineered E. coli to utilize methanol using a superior NAD-dependent Mdh from Bacillus stearothermophilus and ribulose monophosphate (RuMP) pathway enzymes from B. methanolicus. Using 13 C-labeling, we demonstrate this E. coli strain converts methanol into biomass components. For example, the key TCA cycle intermediates, succinate and malate, exhibit labeling up to 39%, while the lower glycolytic intermediate, 3-phosphoglycerate, up to 53%. Multiple carbons are labeled for each compound, demonstrating a cycling RuMP pathway for methanol assimilation to support growth. By incorporating the pathway to synthesize the flavanone naringenin, we demonstrate the first example of in vivo conversion of methanol into a specialty chemical in E. coli. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
Integrated, Step-Wise, Mass-Isotopomeric Flux Analysis of the TCA Cycle.
Alves, Tiago C; Pongratz, Rebecca L; Zhao, Xiaojian; Yarborough, Orlando; Sereda, Sam; Shirihai, Orian; Cline, Gary W; Mason, Graeme; Kibbey, Richard G
2015-11-03
Mass isotopomer multi-ordinate spectral analysis (MIMOSA) is a step-wise flux analysis platform to measure discrete glycolytic and mitochondrial metabolic rates. Importantly, direct citrate synthesis rates were obtained by deconvolving the mass spectra generated from [U-(13)C6]-D-glucose labeling for position-specific enrichments of mitochondrial acetyl-CoA, oxaloacetate, and citrate. Comprehensive steady-state and dynamic analyses of key metabolic rates (pyruvate dehydrogenase, β-oxidation, pyruvate carboxylase, isocitrate dehydrogenase, and PEP/pyruvate cycling) were calculated from the position-specific transfer of (13)C from sequential precursors to their products. Important limitations of previous techniques were identified. In INS-1 cells, citrate synthase rates correlated with both insulin secretion and oxygen consumption. Pyruvate carboxylase rates were substantially lower than previously reported but showed the highest fold change in response to glucose stimulation. In conclusion, MIMOSA measures key metabolic rates from the precursor/product position-specific transfer of (13)C-label between metabolites and has broad applicability to any glucose-oxidizing cell. Copyright © 2015 Elsevier Inc. All rights reserved.
Acidosis induces reprogramming of cellular metabolism to mitigate oxidative stress
2013-01-01
Background A variety of oncogenic and environmental factors alter tumor metabolism to serve the distinct cellular biosynthetic and bioenergetic needs present during oncogenesis. Extracellular acidosis is a common microenvironmental stress in solid tumors, but little is known about its metabolic influence, particularly when present in the absence of hypoxia. In order to characterize the extent of tumor cell metabolic adaptations to acidosis, we employed stable isotope tracers to examine how acidosis impacts glucose, glutamine, and palmitate metabolism in breast cancer cells exposed to extracellular acidosis. Results Acidosis increased both glutaminolysis and fatty acid β-oxidation, which contribute metabolic intermediates to drive the tricarboxylic acid cycle (TCA cycle) and ATP generation. Acidosis also led to a decoupling of glutaminolysis and novel glutathione (GSH) synthesis by repressing GCLC/GCLM expression. We further found that acidosis redirects glucose away from lactate production and towards the oxidative branch of the pentose phosphate pathway (PPP). These changes all serve to increase nicotinamide adenine dinucleotide phosphate (NADPH) production and counter the increase in reactive oxygen species (ROS) present under acidosis. The reduced novel GSH synthesis under acidosis may explain the increased demand for NADPH to recycle existing pools of GSH. Interestingly, acidosis also disconnected novel ribose synthesis from the oxidative PPP, seemingly to reroute PPP metabolites to the TCA cycle. Finally, we found that acidosis activates p53, which contributes to both the enhanced PPP and increased glutaminolysis, at least in part, through the induction of G6PD and GLS2 genes. Conclusions Acidosis alters the cellular metabolism of several major metabolites, which induces a significant degree of metabolic inflexibility. Cells exposed to acidosis largely rely upon mitochondrial metabolism for energy generation to the extent that metabolic intermediates are redirected away from several other critical metabolic processes, including ribose and glutathione synthesis. These alterations lead to both a decrease in cellular proliferation and increased sensitivity to ROS. Collectively, these data reveal a role for p53 in cellular metabolic reprogramming under acidosis, in order to permit increased bioenergetic capacity and ROS neutralization. Understanding the metabolic adaptations that cancer cells make under acidosis may present opportunities to generate anti-tumor therapeutic agents that are more tumor-specific. PMID:24359630
McCammon, M. T.
1996-01-01
The two carbon compounds, ethanol and acetate, can be oxidatively metabolized as well as assimilated into carbohydrate in the yeast Saccharomyces cerevisiae. The distribution of acetate metabolic enzymes among several cellular compartments, mitochondria, peroxisomes, and cytoplasm makes it an intriguing system to study complex metabolic interactions. To investigate the complex process of carbon catabolism and assimilation, mutants unable to grow on acetate were isolated. One hundred five Acn(-) (``ACetate Nonutilizing'') mutants were sorted into 21 complementation groups with an additional 20 single mutants. Five of the groups have defects in TCA cycle enzymes: MDH1, CIT1, ACO1, IDH1, and IDH2. A defect in RTG2, involved in the retrograde communication between the mitochondrion and the nucleus, was also identified. Four genes encode enzymes of the glyoxylate cycle and gluconeogenesis: ICL1, MLS1, MDH2, and PCK1. Five other genes appear to be defective in regulating metabolic activity since elevated levels of enzymes in several metabolic pathways, including the glyoxylate cycle, gluconeogenesis, and acetyl-CoA metabolism, were detected in these mutants: ACN8, ACN9, ACN17, ACN18, and ACN42. In summary, this analysis has identified at least 22 and as many as 41 different genes involved in acetate metabolism. PMID:8878673
Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits.
Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin
2017-01-20
The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits' hearts after SXSM treatment. Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain.
Molecular Mechanisms of Increased Heart Rate in Shenxianshengmai-treated Bradycardia Rabbits
Liu, Zhou-Ying; Huang, Jian; Liu, Na-Na; Zheng, Min; Zhao, Tao; Zhao, Bu-Chang; Wang, Yi-Min; Pu, Jie-Lin
2017-01-01
Background: The molecular mechanisms of Shenxianshengmai (SXSM), a traditional Chinese medicine, on bradycardia have been incompletely understood. The study tried to investigate the gene expression profile and proteomics of bradycardia rabbits’ hearts after SXSM treatment. Methods: Twenty-four adult rabbits were randomly assigned in four groups: sham, model, model plus SXSM treatment, and sham plus SXSM treatment groups. Heart rate was recorded in all rabbits. Then, total RNA of atria and proteins of ventricle were isolated and quantified, respectively. Gene expression profiling was conducted by gene expression chip, and quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) was performed to confirm the results of gene expression chip. We used isobaric tags for elative and absolute quantitation and Western blotting to identify altered proteins after SXSM treatment. Results: There was a constant decrease in the mean heart rate (32%, from 238 ± 6 beats/min to 149 ± 12 beats/min) after six weeks in model compared with that in sham group. This effect was partially reversed by 4-week SXSM treatment. Complementary DNA microarray demonstrated that the increased acetylcholinesterase and reduced nicotinic receptor were take responsibility for the increased heart rate. In addition, proteins involved in calcium handling and signaling were affected by SXSM treatment. Real-time RT-PCR verified the results from gene chip. Results from proteomics demonstrated that SXSM enhanced oxidative phosphorylation and tricarboxylic acid (TCA) cycle in ventricular myocardium to improve ATP generation. Conclusions: Long-term SXSM stimulates sympathetic transmission by increasing the expression of acetylcholinesterase and reduces the expression of nicotinic receptor to increase heart rate. SXSM also restored the calcium handling genes and altered genes involved in signaling. In addition, SXSM improves the ATP supply of ventricular myocardium by increasing proteins involved in TCA cycle and oxidation-respiratory chain. PMID:28091410
Danne, Jillian C; Gornik, Sebastian G; Macrae, James I; McConville, Malcolm J; Waller, Ross F
2013-01-01
Mitochondrial metabolism is central to the supply of ATP and numerous essential metabolites in most eukaryotic cells. Across eukaryotic diversity, however, there is evidence of much adaptation of the function of this organelle according to specific metabolic requirements and/or demands imposed by different environmental niches. This includes substantial loss or retailoring of mitochondrial function in many parasitic groups that occupy potentially nutrient-rich environments in their metazoan hosts. Infrakingdom Alveolata comprises a well-supported alliance of three disparate eukaryotic phyla-dinoflagellates, apicomplexans, and ciliates. These major taxa represent diverse lifestyles of free-living phototrophs, parasites, and predators and offer fertile territory for exploring character evolution in mitochondria. The mitochondria of apicomplexan parasites provide much evidence of loss or change of function from analysis of mitochondrial protein genes. Much less, however, is known of mitochondrial function in their closest relatives, the dinoflagellate algae. In this study, we have developed new models of mitochondrial metabolism in dinoflagellates based on gene predictions and stable isotope labeling experiments. These data show that many changes in mitochondrial gene content previously only known from apicomplexans are found in dinoflagellates also. For example, loss of the pyruvate dehydrogenase complex and changes in tricarboxylic acid (TCA) cycle enzyme complement are shared by both groups and, therefore, represent ancestral character states. Significantly, we show that these changes do not result in loss of typical TCA cycle activity fueled by pyruvate. Thus, dinoflagellate data show that many changes in alveolate mitochondrial metabolism are independent of the major lifestyle changes seen in these lineages and provide a revised view of mitochondria character evolution during evolution of parasitism in apicomplexans.
Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats☆
Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.
2016-01-01
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O3, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073
Synergy as design principle for metabolic engineering of 1-propanol production in Escherichia coli.
Shen, Claire R; Liao, James C
2013-05-01
Synthesis of a desired product can often be achieved via more than one metabolic pathway. Whether naturally evolved or synthetically engineered, these pathways often exhibit specific properties that are suitable for production under distinct conditions and host organisms. Synergy between pathways arises when the underlying pathway characteristics, such as reducing equivalent demand, ATP requirement, intermediate utilization, and cofactor preferences, are complementary to each other. Utilization of such pathways in combination leads to an increased metabolite productivity and/or yield compared to using each pathway alone. This work illustrates the principle of synergy between two different pathways for 1-propanol production in Escherichia coli. A model-guided design based on maximum theoretical yield calculations identified synergy of the native threonine pathway and the heterologous citramalate pathway in terms of production yield across all flux ratios between the two pathways. Characterization of the individual pathways by host gene deletions demonstrates their distinct metabolic characteristics: the necessity of TCA cycle for threonine pathway and the independence of TCA cycle for the citramalate pathway. The two pathways are also complementary in driving force demands. Production experiments verified the synergistic effects predicted by the yield model, in which the platform with dual pathway for 2-ketobutyrate synthesis achieved higher yield (0.15g/g of glucose) and productivity (0.12g/L/h) of 1-propanol than individual ones alone: the threonine pathway (0.09g/g; 0.04g/L/h) or the citramalate pathway (0.11g/g; 0.04g/L/h). Thus, incorporation of synergy into the design principle of metabolic engineering may improve the production yield and rate of the desired compound. Copyright © 2013 Elsevier Inc. All rights reserved.
Folsom, James Patrick
2015-01-01
Escherichia coli physiological, biomass elemental composition and proteome acclimations to ammonium-limited chemostat growth were measured at four levels of nutrient scarcity controlled via chemostat dilution rate. These data were compared with published iron- and glucose-limited growth data collected from the same strain and at the same dilution rates to quantify general and nutrient-specific responses. Severe nutrient scarcity resulted in an overflow metabolism with differing organic byproduct profiles based on limiting nutrient and dilution rate. Ammonium-limited cultures secreted up to 35 % of the metabolized glucose carbon as organic byproducts with acetate representing the largest fraction; in comparison, iron-limited cultures secreted up to 70 % of the metabolized glucose carbon as lactate, and glucose-limited cultures secreted up to 4 % of the metabolized glucose carbon as formate. Biomass elemental composition differed with nutrient limitation; biomass from ammonium-limited cultures had a lower nitrogen content than biomass from either iron- or glucose-limited cultures. Proteomic analysis of central metabolism enzymes revealed that ammonium- and iron-limited cultures had a lower abundance of key tricarboxylic acid (TCA) cycle enzymes and higher abundance of key glycolysis enzymes compared with glucose-limited cultures. The overall results are largely consistent with cellular economics concepts, including metabolic tradeoff theory where the limiting nutrient is invested into essential pathways such as glycolysis instead of higher ATP-yielding, but non-essential, pathways such as the TCA cycle. The data provide a detailed insight into ecologically competitive metabolic strategies selected by evolution, templates for controlling metabolism for bioprocesses and a comprehensive dataset for validating in silico representations of metabolism. PMID:26018546
[Phenotypic properties of Sulfobacillus thermotolerans: comparative aspects].
Tsaplina, I A; Krasil'nikova, E N; Zhuravleva, A E; Egorova, M A; Zakharchuk, L M; Suzina, N E; Duda, V I; Bogdanova, T I; Stadnichuk, I N; Kondrat'eva, T F
2008-01-01
The phenotypic characteristics of the species Sulfobacillus thermotolerans Kr1(T), as dependent on the cultivation conditions, are described in detail. High growth rates (0.22-0.30 h(-1)) and high oxidative activity were recorded under optimum mixotrophic conditions at 40 degrees C on medium with inorganic (Fe(II), S(0), or pyrite-arsenopyrite concentrate) and organic (glucose and/or yeast extract) substrates. In cells grown under optimum conditions on medium with iron, hemes a, b, and, most probably, c were present, indicating the presence of the corresponding cytochromes. Peculiar extended structures in the form of cylindrical cords, never observed previously, were revealed; a mucous matrix, likely of polysaccharide nature, occurred around the cells. In the cells of sulfobacilli grown litho-, organo-, and mixotrophically at 40 degrees C, the enzymes of the three main pathways of carbon utilization and some enzymes of the TCA cycle were revealed. The enzyme activity was maximum under mixotrophic growth conditions. The growth rate in the regions of limiting temperatures (55 degrees C and 12-14 degrees C) decreased two- and tenfold, respectively; no activity of 6-phosphogluconate dehydrogenase, one of the key enzymes of the oxidative pentose phosphate pathway, could be revealed; and a decrease in the activity of almost all enzymes of glucose metabolism and of the TCA cycle was observed. The rate of 14CO2 fixation by cells under auto-, mixo-, and heterotrophic conditions constituted 31.8, 23.3, and 10.3 nmol/(h mg protein), respectively. The activities of RuBP carboxylase (it peaked during lithotrophic growth) and of carboxylases of heterotrophic carbon dioxide fixation were recorded. The physiological and biochemical peculiarities of the thermotolerant sulfobacillus are compared versus moderately thermophilic sulfobacilli.
DOE Office of Scientific and Technical Information (OSTI.GOV)
He, Lian; Xiu, Yu; Jones, J. Andrew
Microbial fermentation conditions are dynamic, due to transcriptional induction, nutrient consumption, or changes to incubation conditions. In this paper, 13C-metabolic flux analysis was used to characterize two violacein-producing E. coli strains with vastly different productivities, and to profile their metabolic adjustments resulting from external perturbations during fermentation. The two strains were first grown at 37 °C in stage 1, and then the temperature was transitioned to 20 °C in stage 2 for the optimal expression of the violacein synthesis pathway. After induction, violacein production was minimal in stage 3, but accelerated in stage 4 (early production phase) and 5 (latemore » production phase) in the high producing strain, reaching a final concentration of 1.5 mmol/L. On the contrary, ~0.02 mmol/L of violacein was obtained from the low producing strain. To have a snapshot of the temporal metabolic changes in each stage, we performed 13C-MFA via isotopomer analysis of fast-turnover free metabolites. The results indicate strikingly stable flux ratios in the central metabolism throughout the early growth stages. In the late stages, however, the high producer rewired its flux distribution significantly, which featured an upregulated pentose phosphate pathway and TCA cycle, reflux from acetate utilization, negligible anabolic fluxes, and elevated maintenance loss, to compensate for nutrient depletion and drainage of some building blocks due to violacein overproduction. The low producer with stronger promoters shifted its relative fluxes in stage 5 by enhancing the flux through the TCA cycle and acetate overflow, while exhibiting a reduced biomass growth and a minimal flux towards violacein synthesis. Finally, interestingly, the addition of the violacein precursor (tryptophan) in the medium inhibited high producer but enhanced low producer's productivity, leading to hypotheses of unknown pathway regulations (such as metabolite channeling).« less
Shaerzadeh, Fatemeh; Motamedi, Fereshteh; Khodagholi, Fariba
2014-11-01
3-Methyladenine (3-MA), as a PI3K inhibitor, is widely used for inhibition of autophagy. Inhibition of PI3K class I leads to inhibition of Akt phosphorylation, a central molecule involved in diverse arrays of intracellular cascades in nervous system. Accordingly, in the present study, we aimed to determine the alterations of specific mitochondrial biogenesis markers and mitochondrial function in 3-MA-injected rats following amyloid beta (Aβ) insult. Our data revealed that inhibition of Akt phosphorylation downregulates master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). Our data also showed that decrease in PGC-1α level presumably is due to decrease in the phosphorylation of cAMP-response element binding and AMP-activated kinase, two upstream activators of PGC-1α. As a consequence, the level of some mitochondrial biogenesis factors including nuclear respiratory factor-1, mitochondrial transcription factor A, and Cytochrome c decreased significantly. Also, activities of tricarboxylic acid cycle (TCA) enzymes such as Aconitase, a-ketoglutarate dehydrogenase, and malate dehydrogenase reduced in the presence of 3-MA with or without Aβ insult. Decrease in mitochondrial biogenesis factors and TCA enzyme activity in the rats receiving 3-MA and Aβ were more compared to the rats that received either alone; indicating the additive destructive effects of these two agents. In agreement with our molecular results, data obtained from behavioral test (using novel objective recognition test) indicated that inhibition of Akt phosphorylation with or without Aβ injection impaired novel recognition (non-spatial) memory. Our results suggest that 3-MA amplified deleterious effects of Aβ by targeting central molecule Akt.
Voll, Lars Matthias; Horst, Robin Jonathan; Voitsik, Anna-Maria; Zajic, Doreen; Samans, Birgit; Pons-Kühnemann, Jörn; Doehlemann, Gunther; Münch, Steffen; Wahl, Ramon; Molitor, Alexandra; Hofmann, Jörg; Schmiedl, Alfred; Waller, Frank; Deising, Holger Bruno; Kahmann, Regine; Kämper, Jörg; Kogel, Karl-Heinz; Sonnewald, Uwe
2011-01-01
During compatible interactions with their host plants, biotrophic plant–pathogens subvert host metabolism to ensure the sustained provision of nutrient assimilates by the colonized host cells. To investigate, whether common motifs can be revealed in the response of primary carbon and nitrogen metabolism toward colonization with biotrophic fungi in cereal leaves, we have conducted a combined metabolome and transcriptome study of three quite divergent pathosystems, the barley powdery mildew fungus (Blumeria graminis f.sp. hordei), the corn smut fungus Ustilago maydis, and the maize anthracnose fungus Colletotrichum graminicola, the latter being a hemibiotroph that only exhibits an initial biotrophic phase during its establishment. Based on the analysis of 42 water-soluble metabolites, we were able to separate early biotrophic from late biotrophic interactions by hierarchical cluster analysis and principal component analysis, irrespective of the plant host. Interestingly, the corresponding transcriptome dataset could not discriminate between these stages of biotrophy, irrespective, of whether transcript data for genes of central metabolism or the entire transcriptome dataset was used. Strong differences in the transcriptional regulation of photosynthesis, glycolysis, the TCA cycle, lipid biosynthesis, and cell wall metabolism were observed between the pathosystems. However, increased contents of Gln, Asn, and glucose as well as diminished contents of PEP and 3-PGA were common to early post-penetration stages of all interactions. On the transcriptional level, genes of the TCA cycle, nucleotide energy metabolism and amino acid biosynthesis exhibited consistent trends among the compared biotrophic interactions, identifying the requirement for metabolic energy and the rearrangement of amino acid pools as common transcriptional motifs during early biotrophy. Both metabolome and transcript data were employed to generate models of leaf primary metabolism during early biotrophy for the three investigated interactions. PMID:22645534
Dong, Hong-Po; Huang, Kai-Xuan; Wang, Hua-Long; Lu, Song-Hui; Cen, Jing-Yi; Dong, Yue-Lei
2014-01-01
Aureococcus anophagefferens is a harmful alga that dominates plankton communities during brown tides in North America, Africa, and Asia. Here, RNA-seq technology was used to profile the transcriptome of a Chinese strain of A. anophagefferens that was grown on urea, nitrate, and a mixture of urea and nitrate, and that was under N-replete, limited and recovery conditions to understand the molecular mechanisms that underlie nitrate and urea utilization. The number of differentially expressed genes between urea-grown and mixture N-grown cells were much less than those between urea-grown and nitrate-grown cells. Compared with nitrate-grown cells, mixture N-grown cells contained much lower levels of transcripts encoding proteins that are involved in nitrate transport and assimilation. Together with profiles of nutrient changes in media, these results suggest that A. anophagefferens primarily feeds on urea instead of nitrate when urea and nitrate co-exist. Furthermore, we noted that transcripts upregulated by nitrate and N-limitation included those encoding proteins involved in amino acid and nucleotide transport, degradation of amides and cyanates, and nitrate assimilation pathway. The data suggest that A. anophagefferens possesses an ability to utilize a variety of dissolved organic nitrogen. Moreover, transcripts for synthesis of proteins, glutamate-derived amino acids, spermines and sterols were upregulated by urea. Transcripts encoding key enzymes that are involved in the ornithine-urea and TCA cycles were differentially regulated by urea and nitrogen concentration, which suggests that the OUC may be linked to the TCA cycle and involved in reallocation of intracellular carbon and nitrogen. These genes regulated by urea may be crucial for the rapid proliferation of A. anophagefferens when urea is provided as the N source. PMID:25338000
Studies of Secondary Melanoma on C57BL/6J Mouse Liver Using 1H NMR Metabolomics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng, Ju; Isern, Nancy G.; Burton, Sarah D.
2013-10-31
NMR metabolomics, consisting of solid state high resolution (hr) magic angle spinning (MAS) 1H NMR (1H hr-MAS), liquid state high resolution 1H-NMR, and principal components analysis (PCA) has been used to study secondary metastatic B16-F10 melanoma in C57BL/6J mouse liver . The melanoma group can be differentiated from its control group by PCA analysis of the absolute concentrations or by the absolute peak intensities of metabolites from either 1H hr-MAS NMR data on intact liver tissues or liquid state 1H-NMR spectra on liver tissue extracts. In particular, we found that the absolute concentrations of alanine, glutamate, creatine, creatinine, fumarate andmore » cholesterol are elevated in the melanoma group as compared to controls, while the absolute concentrations of succinate, glycine, glucose, and the family of linear lipids including long chain fatty acids, total choline and acylglycerol are decreased. The ratio of glycerophosphocholine to phosphocholine is increased by about 1.5 fold in the melanoma group, while the absolute concentration of total choline is actually lower in melanoma mice. These results suggest the following picture in secondary melanoma metastasis: Linear lipid levels are decreased by beta oxidation in the melanoma group, which contributes to an increase in the synthesis of cholesterol, and also provides an energy source input for TCA cycle. These findings suggest a link between lipid oxidation, the TCA cycle and the hypoxia-inducible factors (HIF) signal pathway in tumor metastases. Thus this study indicates that the metabolic profile derived from NMR analysis can provide a valuable bio-signature of malignancy and cell hypoxia in metastatic melanoma.« less
Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.
2018-01-01
ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267
Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I
2018-01-01
Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aklujkar, Muktak; Haveman, Shelley; DiDonatoJr, Raymond
2012-01-01
Background: The bacterium Pelobacter carbinolicus is able to grow by fermentation, syntrophic hydrogen/formate transfer, or electron transfer to sulfur from short-chain alcohols, hydrogen or formate; it does not oxidize acetate and is not known to ferment any sugars or grow autotrophically. The genome of P. carbinolicus was sequenced in order to understand its metabolic capabilities and physiological features in comparison with its relatives, acetate-oxidizing Geobacter species. Results: Pathways were predicted for catabolism of known substrates: 2,3-butanediol, acetoin, glycerol, 1,2-ethanediol, ethanolamine, choline and ethanol. Multiple isozymes of 2,3-butanediol dehydrogenase, ATP synthase and [FeFe]-hydrogenase were differentiated and assigned roles according to theirmore » structural properties and genomic contexts. The absence of asparagine synthetase and the presence of a mutant tRNA for asparagine encoded among RNA-active enzymes suggest that P. carbinolicus may make asparaginyl-tRNA in a novel way. Catabolic glutamate dehydrogenases were discovered, implying that the tricarboxylic acid (TCA) cycle can function catabolically. A phosphotransferase system for uptake of sugars was discovered, along with enzymes that function in 2,3-butanediol production. Pyruvate: ferredoxin/flavodoxin oxidoreductase was identified as a potential bottleneck in both the supply of oxaloacetate for oxidation of acetate by the TCA cycle and the connection of glycolysis to production of ethanol. The P. carbinolicus genome was found to encode autotransporters and various appendages, including three proteins with similarity to the geopilin of electroconductive nanowires. Conclusions: Several surprising metabolic capabilities and physiological features were predicted from the genome of P. carbinolicus, suggesting that it is more versatile than anticipated.« less
Lacking Ketohexokinase-A Exacerbates Renal Injury in Streptozotocin-induced Diabetic Mice.
Doke, Tomohito; Ishimoto, Takuji; Hayasaki, Takahiro; Ikeda, Satsuki; Hasebe, Masako; Hirayama, Akiyoshi; Soga, Tomoyoshi; Kato, Noritoshi; Kosugi, Tomoki; Tsuboi, Naotake; Lanaspa, Miguel A; Johnson, Richard J; Kadomatsu, Kenji; Maruyama, Shoichi
2018-03-28
Ketohexokinase (KHK), a primary enzyme in fructose metabolism, has two isoforms, namely, KHK-A and KHK-C. Previously, we reported that renal injury was reduced in streptozotocin-induced diabetic mice which lacked both isoforms. Although both isoforms express in kidney, it has not been elucidated whether each isoform plays distinct roles in the development of diabetic kidney disease (DKD). The aim of the study is to elucidate the role of KHK-A for DKD progression. Diabetes was induced by five consecutive daily intraperitoneal injections of streptozotocin (50 mg/kg) in C57BL/6 J wild-type mice, mice lacking KHK-A alone (KHK-A KO), and mice lacking both KHK-A and KHK-C (KHK-A/C KO). At 35 weeks, renal injury, inflammation, hypoxia, and oxidative stress were examined. Metabolomic analysis including polyol pathway, fructose metabolism, glycolysis, TCA (tricarboxylic acid) cycle, and NAD (nicotinamide adenine dinucleotide) metabolism in kidney and urine was done. Diabetic KHK-A KO mice developed severe renal injury compared to diabetic wild-type mice, and this was associated with further increases of intrarenal fructose, dihydroxyacetone phosphate (DHAP), TCA cycle intermediates levels, and severe inflammation. In contrast, renal injury was prevented in diabetic KHK-A/C KO mice compared to both wild-type and KHK-A KO diabetic mice. Further, diabetic KHK-A KO mice contained decreased renal NAD + level with the increase of renal hypoxia-inducible factor 1-alpha expression despite having increased renal nicotinamide (NAM) level. These results suggest that KHK-C might play a deleterious role in DKD progression through endogenous fructose metabolism, and that KHK-A plays a unique protective role against the development of DKD. Copyright © 2018. Published by Elsevier Inc.
Differential expression of glucose-metabolizing enzymes in multiple sclerosis lesions.
Nijland, Philip G; Molenaar, Remco J; van der Pol, Susanne M A; van der Valk, Paul; van Noorden, Cornelis J F; de Vries, Helga E; van Horssen, Jack
2015-12-04
Demyelinated axons in multiple sclerosis (MS) lesions have an increased energy demand in order to maintain conduction. However, oxidative stress-induced mitochondrial dysfunction likely alters glucose metabolism and consequently impairs neuronal function in MS. Imaging and pathological studies indicate that glucose metabolism is altered in MS, although the underlying mechanisms and its role in neurodegeneration remain elusive. We investigated expression patterns of key enzymes involved in glycolysis, tricarboxylic acid (TCA) cycle and lactate metabolism in well-characterized MS tissue to establish which regulators of glucose metabolism are involved in MS and to identify underlying mechanisms. Expression levels of glycolytic enzymes were increased in active and inactive MS lesions, whereas expression levels of enzymes involved in the TCA cycle were upregulated in active MS lesions, but not in inactive MS lesions. We observed reduced expression and production capacity of mitochondrial α-ketoglutarate dehydrogenase (αKGDH) in demyelinated axons, which correlated with signs of axonal dysfunction. In inactive lesions, increased expression of lactate-producing enzymes was observed in astrocytes, whereas lactate-catabolising enzymes were mainly detected in axons. Our results demonstrate that the expression of various enzymes involved in glucose metabolism is increased in both astrocytes and axons in active MS lesions. In inactive MS lesions, we provide evidence that astrocytes undergo a glycolytic shift resulting in enhanced astrocyte-axon lactate shuttling, which may be pivotal for the survival of demyelinated axons. In conclusion, we show that key enzymes involved in energy metabolism are differentially expressed in active and inactive MS lesions. Our findings imply that, in addition to reduced oxidative phosphorylation activity, other bioenergetic pathways are affected as well, which may contribute to ongoing axonal degeneration in MS.
Denou, Emmanuel; Marcinko, Katarina; Surette, Michael G.; Steinberg, Gregory R.
2016-01-01
Diet and exercise underpin the risk of obesity-related metabolic disease. Diet alters the gut microbiota, which contributes to aspects of metabolic disease during obesity. Repeated exercise provides metabolic benefits during obesity. We assessed whether exercise could oppose changes in the taxonomic and predicted metagenomic characteristics of the gut microbiota during diet-induced obesity. We hypothesized that high-intensity interval training (HIIT) would counteract high-fat diet (HFD)-induced changes in the microbiota without altering obesity in mice. Compared with chow-fed mice, an obesity-causing HFD decreased the Bacteroidetes-to-Firmicutes ratio and decreased the genetic capacity in the fecal microbiota for metabolic pathways such as the tricarboxylic acid (TCA) cycle. After HFD-induced obesity was established, a subset of mice were HIIT for 6 wk, which increased host aerobic capacity but did not alter body or adipose tissue mass. The effects of exercise training on the microbiota were gut segment dependent and more extensive in the distal gut. HIIT increased the alpha diversity and Bacteroidetes/Firmicutes ratio of the distal gut and fecal microbiota during diet-induced obesity. Exercise training increased the predicted genetic capacity related to the TCA cycle among other aspects of metabolism. Strikingly, the same microbial metabolism indexes that were increased by exercise were all decreased in HFD-fed vs. chow diet-fed mice. Therefore, exercise training directly opposed some of the obesity-related changes in gut microbiota, including lower metagenomic indexes of metabolism. Some host and microbial pathways appeared similarly affected by exercise. These exercise- and diet-induced microbiota interactions can be captured in feces. PMID:27117007
Denou, Emmanuel; Marcinko, Katarina; Surette, Michael G; Steinberg, Gregory R; Schertzer, Jonathan D
2016-06-01
Diet and exercise underpin the risk of obesity-related metabolic disease. Diet alters the gut microbiota, which contributes to aspects of metabolic disease during obesity. Repeated exercise provides metabolic benefits during obesity. We assessed whether exercise could oppose changes in the taxonomic and predicted metagenomic characteristics of the gut microbiota during diet-induced obesity. We hypothesized that high-intensity interval training (HIIT) would counteract high-fat diet (HFD)-induced changes in the microbiota without altering obesity in mice. Compared with chow-fed mice, an obesity-causing HFD decreased the Bacteroidetes-to-Firmicutes ratio and decreased the genetic capacity in the fecal microbiota for metabolic pathways such as the tricarboxylic acid (TCA) cycle. After HFD-induced obesity was established, a subset of mice were HIIT for 6 wk, which increased host aerobic capacity but did not alter body or adipose tissue mass. The effects of exercise training on the microbiota were gut segment dependent and more extensive in the distal gut. HIIT increased the alpha diversity and Bacteroidetes/Firmicutes ratio of the distal gut and fecal microbiota during diet-induced obesity. Exercise training increased the predicted genetic capacity related to the TCA cycle among other aspects of metabolism. Strikingly, the same microbial metabolism indexes that were increased by exercise were all decreased in HFD-fed vs. chow diet-fed mice. Therefore, exercise training directly opposed some of the obesity-related changes in gut microbiota, including lower metagenomic indexes of metabolism. Some host and microbial pathways appeared similarly affected by exercise. These exercise- and diet-induced microbiota interactions can be captured in feces. Copyright © 2016 the American Physiological Society.
Armah, Charlotte N; Traka, Maria H; Dainty, Jack R; Defernez, Marianne; Janssens, Astrid; Leung, Wing; Doleman, Joanne F; Potter, John F
2013-01-01
Background: Observational and experimental studies suggest that diets rich in cruciferous vegetables and glucosinolates may reduce the risk of cancer and cardiovascular disease (CVD). Objective: We tested the hypothesis that a 12-wk dietary intervention with high-glucoraphanin (HG) broccoli would modify biomarkers of CVD risk and plasma metabolite profiles to a greater extent than interventions with standard broccoli or peas. Design: Subjects were randomly assigned to consume 400 g standard broccoli, 400 g HG broccoli, or 400 g peas each week for 12 wk, with no other dietary restrictions. Biomarkers of CVD risk and 347 plasma metabolites were quantified before and after the intervention. Results: No significant differences in the effects of the diets on biomarkers of CVD risk were found. Multivariate analyses of plasma metabolites identified 2 discrete phenotypic responses to diet in individuals within the HG broccoli arm, differentiated by single nucleotide polymorphisms associated with the PAPOLG gene. Univariate analysis showed effects of sex (P < 0.001), PAPOLG genotype (P < 0.001), and PAPOLG genotype × diet (P < 0.001) on the plasma metabolic profile. In the HG broccoli arm, the consequence of the intervention was to reduce variation in lipid and amino acid metabolites, tricarboxylic acid (TCA) cycle intermediates, and acylcarnitines between the 2 PAPOLG genotypes. Conclusions: The metabolic changes observed with the HG broccoli diet are consistent with a rebalancing of anaplerotic and cataplerotic reactions and enhanced integration of fatty acid β-oxidation with TCA cycle activity. These modifications may contribute to the reduction in cancer risk associated with diets that are rich in cruciferous vegetables. This trial was registered at clinicaltrials.gov as NCT01114399. PMID:23964055
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique
2009-01-20
A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
2013-01-01
Background Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. Results We constructed an l-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for l-glutamic acid production; the results of this process corresponded with previous experimental data regarding l-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of l-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model l-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in l-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. Conclusions In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation. PMID:24053676
Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi
2013-09-22
Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.
Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats.
Miller, Desinia B; Karoly, Edward D; Jones, Jan C; Ward, William O; Vallanat, Beena D; Andrews, Debora L; Schladweiler, Mette C; Snow, Samantha J; Bass, Virginia L; Richards, Judy E; Ghio, Andrew J; Cascio, Wayne E; Ledbetter, Allen D; Kodavanti, Urmila P
2015-07-15
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0ppm, 6h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0ppm O3, 6h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress-response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. Published by Elsevier Inc.
Influence of Iron and Aeration on Staphylococcus aureus Growth, Metabolism, and Transcription
Ledala, Nagender; Zhang, Bo; Seravalli, Javier; Powers, Robert
2014-01-01
Staphylococcus aureus is a prominent nosocomial pathogen and a major cause of biomaterial-associated infections. The success of S. aureus as a pathogen is due in part to its ability to adapt to stressful environments. As an example, the transition from residing in the nares to residing in the blood or deeper tissues is accompanied by changes in the availability of nutrients and elements such as oxygen and iron. As such, nutrients, oxygen, and iron are important determinants of virulence factor synthesis in S. aureus. In addition to influencing virulence factor synthesis, oxygen and iron are critical cofactors in enzymatic and electron transfer reactions; thus, a change in iron or oxygen availability alters the bacterial metabolome. Changes in metabolism create intracellular signals that alter the activity of metabolite-responsive regulators such as CodY, RpiRc, and CcpA. To assess the extent of metabolomic changes associated with oxygen and iron limitation, S. aureus cells were cultivated in iron-limited medium and/or with decreasing aeration, and the metabolomes were examined by nuclear magnetic resonance (NMR) spectroscopy. As expected, oxygen and iron limitation dramatically decreased tricarboxylic acid (TCA) cycle activity, creating a metabolic block and significantly altering the metabolome. These changes were most prominent during post-exponential-phase growth, when TCA cycle activity was maximal. Importantly, many of the effects of iron limitation were obscured by aeration limitation. Aeration limitation not only obscured the metabolic effects of iron limitation but also overrode the transcription of iron-regulated genes. Finally, in contrast to previous speculation, we confirmed that acidification of the culture medium occurs independent of the availability of iron. PMID:24706736
Zhang, Tiantian; Bu, Pengli; Zeng, Joey; Vancura, Ales
2017-10-13
Regulation of mitochondrial biogenesis and respiration is a complex process that involves several signaling pathways and transcription factors as well as communication between the nuclear and mitochondrial genomes. Under aerobic conditions, the budding yeast Saccharomyces cerevisiae metabolizes glucose predominantly by glycolysis and fermentation. We have recently shown that altered chromatin structure in yeast induces respiration by a mechanism that requires transport and metabolism of pyruvate in mitochondria. However, how pyruvate controls the transcriptional responses underlying the metabolic switch from fermentation to respiration is unknown. Here, we report that this pyruvate effect involves heme. We found that heme induces transcription of HAP4 , the transcriptional activation subunit of the Hap2/3/4/5p complex, required for growth on nonfermentable carbon sources, in a Hap1p- and Hap2/3/4/5p-dependent manner. Increasing cellular heme levels by inactivating ROX1 , which encodes a repressor of many hypoxic genes, or by overexpressing HEM3 or HEM12 induced respiration and elevated ATP levels. Increased heme synthesis, even under conditions of glucose repression, activated Hap1p and the Hap2/3/4/5p complex and induced transcription of HAP4 and genes required for the tricarboxylic acid (TCA) cycle, electron transport chain, and oxidative phosphorylation, leading to a switch from fermentation to respiration. Conversely, inhibiting metabolic flux into the TCA cycle reduced cellular heme levels and HAP4 transcription. Together, our results indicate that the glucose-mediated repression of respiration in budding yeast is at least partly due to the low cellular heme level. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Stepanova, Anna; Shurubor, Yevgeniya; Valsecchi, Federica; Manfredi, Giovanni; Galkin, Alexander
2016-09-01
Mitochondrial Complex II is a key mitochondrial enzyme connecting the tricarboxylic acid (TCA) cycle and the electron transport chain. Studies of complex II are clinically important since new roles for this enzyme have recently emerged in cell signalling, cancer biology, immune response and neurodegeneration. Oxaloacetate (OAA) is an intermediate of the TCA cycle and at the same time is an inhibitor of complex II with high affinity (Kd~10(-8)M). Whether or not OAA inhibition of complex II is a physiologically relevant process is a significant, but still controversial topic. We found that complex II from mouse heart and brain tissue has similar affinity to OAA and that only a fraction of the enzyme in isolated mitochondrial membranes (30.2±6.0% and 56.4±5.6% in the heart and brain, respectively) is in the free, active form. Since OAA could bind to complex II during isolation, we established a novel approach to deplete OAA in the homogenates at the early stages of isolation. In heart, this treatment significantly increased the fraction of free enzyme, indicating that OAA binds to complex II during isolation. In brain the OAA-depleting system did not significantly change the amount of free enzyme, indicating that a large fraction of complex II is already in the OAA-bound inactive form. Furthermore, short-term ischemia resulted in a dramatic decline of OAA in tissues, but it did not change the amount of free complex II. Our data show that in brain OAA is an endogenous effector of complex II, potentially capable of modulating the activity of the enzyme. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Zhang, Li-Li; Feng, Ren-Jun; Zhang, Yin-Dong
2012-08-15
Banana peels (Musa spp.) are a good example of a plant tissue where protein extraction is challenging due to the abundance of interfering metabolites. Sample preparation is a critical step in proteomic research and is critical for good results. We sought to evaluate three methods of protein extraction: trichloroacetic acid (TCA)-acetone precipitation, phenol extraction, and TCA precipitation. We found that a modified phenol extraction protocol was the most optimal method. SDS-PAGE and two-dimensional gel electrophoresis (2-DE) demonstrated good protein separation and distinct spots of high quality protein. Approximately 300 and 550 protein spots were detected on 2-DE gels at pH values of 3-10 and 4-7, respectively. Several spots were excised from the 2-DE gels and identified by mass spectrometry. The protein spots identified were found to be involved in glycolysis, the tricarboxylic acid cycle, and the biosynthesis of ethylene. Several of the identified proteins may play important roles in banana ripening. Copyright © 2012 Society of Chemical Industry.
Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.
2016-01-01
Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Conclusions Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes. PMID:27499608
Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A
2016-01-01
The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The combined results indicate that glycolysis is regulated by the compartmental expression of hexokinase 2, pyruvate kinase M1, and pyruvate kinase M2 in photoreceptors, whereas the inner retinal neurons exhibit a lower capacity for glycolysis and aerobic glycolysis. Expression of nucleoside diphosphate kinase, mitochondria-associated adenylate kinase, and several mitochondria-associated creatine kinase isozymes was highest in the outer retina, whereas expression of cytosolic adenylate kinase and brain creatine kinase was higher in the cones, horizontal cells, and amacrine cells indicating the diversity of ATP-buffering strategies among retinal neurons. Based on the antibody intensities and the COX and LDH activity, Müller glial cells (MGCs) had the lowest capacity for glycolysis, aerobic glycolysis, and OXPHOS. However, they showed high expression of glutamate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate thiokinase, GABA transaminase, and ~P transferring kinases. This suggests that MGCs utilize TCA cycle anaplerosis and cataplerosis to generate GTP and ~P transferring kinases to produce ATP that supports MGC energy requirements. Our comprehensive and integrated results reveal that the adult mouse retina expresses numerous isoforms of ATP synthesizing, regulating, and buffering genes; expresses differential cellular and compartmental levels of glycolytic, OXPHOS, TCA cycle, and ~P transferring kinase proteins; and exhibits differential layer-by-layer LDH and COX activity. New insights into cell-specific and compartmental ATP and GTP production, as well as utilization and buffering strategies and their relationship with known retinal and cellular functions, are discussed. Developing therapeutic strategies for neuroprotection and treating retinal deficits and degeneration in a cell-specific manner will require such knowledge. This work provides a platform for future research directed at identifying the molecular targets and proteins that regulate these processes.
Wang, Guangji; Yan, Bei; Zhang, Sujiang; Huang, Qing; Ni, Lingna; Zha, Weibin; Liu, Linsheng; Cao, Bei; Hong, Ming; Wu, Hanxin; Lu, Hua; Shi, Jian; Li, Mengjie; Li, Jianyong
2010-01-01
The BCR-ABL tyrosine kinase inhibitor imatinib is highly effective for chronic myeloid leukemia (CML). However, some patients gradually develop resistance to imatinib, resulting in therapeutic failure. Metabonomic and genomic profiling of patients' responses to drug interventions can provide novel information about the in vivo metabolism of low-molecular-weight compounds and extend our insight into the mechanism of drug resistance. Based on a multi-platform of high-throughput metabonomics, SNP array analysis, karyotype and mutation, the metabolic phenotypes and genomic polymorphisms of CML patients and their diverse responses to imatinib were characterized. The untreated CML patients (UCML) showed different metabolic patterns from those of healthy controls, and the discriminatory metabolites suggested the perturbed metabolism of the urea cycle, tricarboxylic acid cycle, lipid metabolism, and amino acid turnover in UCML. After imatinib treatment, patients sensitive to imatinib (SCML) and patients resistant to imatinib (RCML) had similar metabolic phenotypes to those of healthy controls and UCML, respectively. SCML showed a significant metabolic response to imatinib, with marked restoration of the perturbed metabolism. Most of the metabolites characterizing CML were adjusted to normal levels, including the intermediates of the urea cycle and tricarboxylic acid cycle (TCA). In contrast, neither cytogenetic nor metabonomic analysis indicated any positive response to imatinib in RCML. We report for the first time the associated genetic and metabonomic responses of CML patients to imatinib and show that the perturbed in vivo metabolism of UCML is independent of imatinib treatment in resistant patients. Thus, metabonomics can potentially characterize patients' sensitivity or resistance to drug intervention. PMID:20949032
Fonseca, Carla P; Jones, John G; Carvalho, Rui A; Jeffrey, F Mark H; Montezinho, Liliana P; Geraldes, Carlos F G C; Castro, M M C A
2005-11-01
Li+ effects on glucose metabolism and on the competitive metabolism of glucose and lactate were investigated in the human neuroblastoma SH-SY5Y cell line using 13C NMR spectroscopy. The metabolic model proposed for glucose and lactate metabolism in these cells, based on tcaCALC best fitting solutions, for both control and Li+ conditions, was consistent with: (i) a single pyruvate pool; (ii) anaplerotic flux from endogenous unlabelled substrates; (iii) no cycling between pyruvate and oxaloacetate. Li+ was shown to induce a 38 and 53% decrease, for 1 and 15 mM Li+, respectively, in the rate of glucose conversion into pyruvate, when [U-13C]glucose was present, while no effects on lactate production were observed. Pyruvate oxidation by the tricarboxylic acid cycle and citrate synthase flux were shown to be significantly reduced by 64 and 84% in the presence of 1 and 15 mM Li+, respectively, suggesting a direct inhibitory effect of Li+ on tricarboxylic acid cycle flux. This work also showed that when both glucose and lactate are present as energetic substrates, SH-SY5Y cells preferentially consumed exogenous lactate over glucose, as 62% of the acetyl-CoA was derived from [3-13C]lactate while only 26% was derived from [U-13C]glucose. Li+ did not significantly affect the relative utilisation of these two substrates by the cells or the residual contribution of unlabelled endogenous sources for the acetyl-CoA pool.
Varma, Vijayalakshmi; Boros, László G.; Nolen, Greg T.; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D.; Kaput, Jim
2015-01-01
Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138
Roles of glucose in photoreceptor survival.
Chertov, Andrei O; Holzhausen, Lars; Kuok, Iok Teng; Couron, Drew; Parker, Ed; Linton, Jonathan D; Sadilek, Martin; Sweet, Ian R; Hurley, James B
2011-10-07
Vertebrate photoreceptor neurons have a high demand for metabolic energy, and their viability is very sensitive to genetic and environmental perturbations. We investigated the relationship between energy metabolism and cell death by evaluating the metabolic effects of glucose deprivation on mouse photoreceptors. Oxygen consumption, lactate production, ATP, NADH/NAD(+), TCA cycle intermediates, morphological changes, autophagy, and viability were evaluated. We compared retinas incubated with glucose to retinas deprived of glucose or retinas treated with a mixture of mitochondrion-specific fuels. Rapid and slow phases of cell death were identified. The rapid phase is linked to reduced mitochondrial activity, and the slower phase reflects a need for substrates for cell maintenance and repair.
Garrido-Sanz, Daniel; Manzano, Javier; Martín, Marta; Redondo-Nieto, Miguel; Rivilla, Rafael
2018-01-01
Polychlorinated biphenyls (PCBs) are widespread persistent pollutants that cause several adverse health effects. Aerobic bioremediation of PCBs involves the activity of either one bacterial species or a microbial consortium. Using multiple species will enhance the range of PCB congeners co-metabolized since different PCB-degrading microorganisms exhibit different substrate specificity. We have isolated a bacterial consortium by successive enrichment culture using biphenyl (analog of PCBs) as the sole carbon and energy source. This consortium is able to grow on biphenyl, benzoate, and protocatechuate. Whole-community DNA extracted from the consortium was used to analyze biodiversity by Illumina sequencing of a 16S rRNA gene amplicon library and to determine the metagenome by whole-genome shotgun Illumina sequencing. Biodiversity analysis shows that the consortium consists of 24 operational taxonomic units (≥97% identity). The consortium is dominated by strains belonging to the genus Pseudomonas, but also contains betaproteobacteria and Rhodococcus strains. whole-genome shotgun (WGS) analysis resulted in contigs containing 78.3 Mbp of sequenced DNA, representing around 65% of the expected DNA in the consortium. Bioinformatic analysis of this metagenome has identified the genes encoding the enzymes implicated in three pathways for the conversion of biphenyl to benzoate and five pathways from benzoate to tricarboxylic acid (TCA) cycle intermediates, allowing us to model the whole biodegradation network. By genus assignment of coding sequences, we have also been able to determine that the three biphenyl to benzoate pathways are carried out by Rhodococcus strains. In turn, strains belonging to Pseudomonas and Bordetella are the main responsible of three of the benzoate to TCA pathways while the benzoate conversion into TCA cycle intermediates via benzoyl-CoA and the catechol meta-cleavage pathways are carried out by beta proteobacteria belonging to genera such as Achromobacter and Variovorax. We have isolated a Rhodococcus strain WAY2 from the consortium which contains the genes encoding the three biphenyl to benzoate pathways indicating that this strain is responsible for all the biphenyl to benzoate transformations. The presented results show that metagenomic analysis of consortia allows the identification of bacteria active in biodegradation processes and the assignment of specific reactions and pathways to specific bacterial groups. PMID:29497412
Cellular responses in Bacillus thuringiensis CS33 during bacteriophage BtCS33 infection.
Wu, Dandan; Yuan, Yihui; Liu, Pengming; Wu, Yan; Gao, Meiying
2014-04-14
Bacillus thuringiensis (Bt) has been widely used for 50years as a biopesticide for controlling insect pests. However, bacteriophage infection can cause failures in 50%-80% of the batches during Bt fermentation, resulting in severe losses. In the present work, the physiological and biochemical impacts of Bt strain CS33 have been studied during bacteriophage infection. This study adopted a gel-based proteomics approach to probe the sequential changed proteins in phage-infected Bt cells. To phage, it depressed the host energy metabolism by suppressing the respiration chain, the TCA cycle, and the utilization of PHB on one hand; on the other hand, it hijacked the host translational machine for its own macromolecular synthesis. To host, superinfection exclusion might be triggered by the changes of S-layer protein and flagella related proteins, which were located on the cell surface and might play as the candidates for the phage recognition. More importantly, the growth rate, cell mass, and ICPs yield were significantly decreased. The low yield of ICPs was mainly due to the suppressed utilization of PHB granules. Further functional study on these altered proteins may lead to a better understanding of the pathogenic mechanisms and the identification of new targets for phage control. B. thuringiensis (Bt) has been widely used for 50years as a safe biopesticide for controlling agricultural and sanitary insect pests. However, bacteriophage infection can cause severe losses during B. thuringiensis fermentation. The processes and consequences of interactions between bacteriophage and Bt were still poorly understood, and the molecular mechanisms involved were more unknown. This study adopted a gel-based proteomics approach to probe the physiological and biochemical impacts of Bt strain CS33 after phage-infection. The interactions between phage BtCS33 and its host Bt strain CS33 occurred mainly on four aspects. First, phage synthesized its nucleic acids through metabolic regulation by increasing the amount of NDK. Second, it is reasonable to infer that a phage resistance or superinfection exclusion was triggered by several increased or decreased proteins (SLP, FliD, FlaB), which were located on the cell surface and might play as candidates for the phage recognition. Third, combining the decreased flavoproteins (SdhA and EtfB) and the down regulated Fe-S cluster biosynthesis pathway together, it can be suggested that the respiration chain was weakened after phage infection. Additionally, three key enzymes (AcnB, FumC and AdhA) involved in the TCA cycle were all decreased, indicating the TCA cycle was seriously inhibited after infection. Fourth, the growth rate, cell mass and ICPs yield of the host were significantly decreased. To the best of our knowledge, this work represents the first systematic study on the interactions of an insecticidal bacterium with its phage, and has contributed novel information to understand the molecular events in the important biological pesticide producer, B. thuringiensis, in response to phage challenge. Copyright © 2014 Elsevier B.V. All rights reserved.
Shen, Guolin; Zhou, Lili; Liu, Wei; Cui, Yuan; Xie, Wenping; Chen, Huiming; Yu, Wenlian; Li, Wentao; Li, Haishan
2017-06-21
Di(2-ethylhexyl) phthalate (DEHP) is considered to be an environmental endocrine disruptor at high levels of general exposure. Studies show that DEHP may cause testicular toxicity on human being. In this study, metabonomics techniques were used to identify differential endogenous metabolites, draw the network metabolic pathways, and conduct network analysis, to determine the underlying mechanisms of testicular toxicity induced by DEHP. The results showed that DEHP inhibited synthesis and accelerated β-oxidation of fatty acids and impaired the tricarboxylic acid cycle (TCA cycle) and gluconeogenesis, resulting in lactic acid accumulation and an insufficient ATP supply in the microenvironment of the testis. These alterations led to testicular atrophy and, thus, may be the underlying causes of testicular toxicity. DEHP also inhibited peroxisome proliferator activated receptors in the testis, which may be another potential reason for the testicular atrophy. These findings provided new insights to better understand the mechanisms of testicular toxicity induced by DEHP exposure.
Effects of diabetes on brain metabolism--is brain glycogen a significant player?
Sickmann, Helle M; Waagepetersen, Helle S
2015-02-01
Brain glycogen, being an intracellular glucose reservoir, contributes to maintain energy and neurotransmitter homeostasis under physiological as well as pathological conditions. Under conditions with a disturbance in systemic glucose metabolism such as in diabetes, the supply of glucose to the brain may be affected and have important impacts on brain metabolism and neurotransmission. This also implies that brain glycogen may serve an essential role in the diabetic state to sustain appropriate brain function. There are two main types of diabetes; type 1 and type 2 diabetes and both types may be associated with brain impairments e.g. cognitive decline and dementia. It is however, not clear how these impairments on brain function are linked to alterations in brain energy and neurotransmitter metabolism. In this review, we will illuminate how rodent diabetes models have contributed to a better understanding of how brain energy and neurotransmitter metabolism is affected in diabetes. There will be a particular focus on the role of brain glycogen to support glycolytic and TCA cycle activity as well as glutamate-glutamine cycle in type 1 and type 2 diabetes.
Gray, Lawrence R; Sultana, Mst Rasheda; Rauckhorst, Adam J; Oonthonpan, Lalita; Tompkins, Sean C; Sharma, Arpit; Fu, Xiaorong; Miao, Ren; Pewa, Alvin D; Brown, Kathryn S; Lane, Erin E; Dohlman, Ashley; Zepeda-Orozco, Diana; Xie, Jianxin; Rutter, Jared; Norris, Andrew W; Cox, James E; Burgess, Shawn C; Potthoff, Matthew J; Taylor, Eric B
2015-10-06
Gluconeogenesis is critical for maintenance of euglycemia during fasting. Elevated gluconeogenesis during type 2 diabetes (T2D) contributes to chronic hyperglycemia. Pyruvate is a major gluconeogenic substrate and requires import into the mitochondrial matrix for channeling into gluconeogenesis. Here, we demonstrate that the mitochondrial pyruvate carrier (MPC) comprising the Mpc1 and Mpc2 proteins is required for efficient regulation of hepatic gluconeogenesis. Liver-specific deletion of Mpc1 abolished hepatic MPC activity and markedly decreased pyruvate-driven gluconeogenesis and TCA cycle flux. Loss of MPC activity induced adaptive utilization of glutamine and increased urea cycle activity. Diet-induced obesity increased hepatic MPC expression and activity. Constitutive Mpc1 deletion attenuated the development of hyperglycemia induced by a high-fat diet. Acute, virally mediated Mpc1 deletion after diet-induced obesity decreased hyperglycemia and improved glucose tolerance. We conclude that the MPC is required for efficient regulation of gluconeogenesis and that the MPC contributes to the elevated gluconeogenesis and hyperglycemia in T2D. Copyright © 2015 Elsevier Inc. All rights reserved.
Ren, Min; Zhang, Zhufeng; Wang, Xuelian; Zhou, Zhiwei; Chen, Dong; Zeng, Hui; Zhao, Shumiao; Chen, Lingling; Hu, Yuanliang; Zhang, Changyi; Liang, Yunxiang; She, Qunxin; Zhang, Yi; Peng, Nan
2018-01-01
Arid and semi-arid regions comprise nearly one-fifth of the earth's terrestrial surface. However, the diversities and functions of their soil microbial communities are not well understood, despite microbial ecological importance in driving biogeochemical cycling. Here, we analyzed the geochemistry and microbial communities of the desert soils from Tarim Basin, northwestern China. Our geochemical data indicated half of these soils are saline. Metagenomic analysis showed that bacterial phylotypes (89.72% on average) dominated the community, with relatively small proportions of Archaea (7.36%) and Eukaryota (2.21%). Proteobacteria, Firmicutes, Actinobacteria, and Euryarchaeota were most abundant based on metagenomic data, whereas genes attributed to Proteobacteria, Actinobacteria, Euryarchaeota, and Thaumarchaeota most actively transcribed. The most abundant phylotypes (Halobacterium, Halomonas, Burkholderia, Lactococcus, Clavibacter, Cellulomonas, Actinomycetospora, Beutenbergia, Pseudomonas, and Marinobacter) in each soil sample, based on metagenomic data, contributed marginally to the population of all microbial communities, whereas the putative halophiles, which contributed the most abundant transcripts, were in the majority of the active microbial population and is consistent with the soil salinity. Sample correlation analyses according to the detected and active genotypes showed significant differences, indicating high diversity of microbial communities among the Tarim soil samples. Regarding ecological functions based on the metatranscriptomic data, transcription of genes involved in various steps of nitrogen cycling, as well as carbon fixation, were observed in the tested soil samples. Metatranscriptomic data also indicated that Thaumarchaeota are crucial for ammonia oxidation and Proteobacteria play the most important role in other steps of nitrogen cycle. The reductive TCA pathway and dicarboxylate-hydroxybutyrate cycle attributed to Proteobacteria and Crenarchaeota, respectively, were highly represented in carbon fixation. Our study reveals that the microbial communities could provide carbon and nitrogen nutrients for higher plants in the sandy saline soils of Tarim Basin. PMID:29593680
Li, Haixing; Liang, Zhijun; Ding, Guangda; Shi, Lei; Xu, Fangsen; Cai, Hongmei
2016-01-01
Light and temperature are two particularly important environmental cues for plant survival. Carbon and nitrogen are two essential macronutrients required for plant growth and development, and cellular carbon and nitrogen metabolism must be tightly coordinated. In order to understand how the natural light/dark cycle regulates carbon and nitrogen metabolism in rice plants, we analyzed the photosynthesis, key carbon-nitrogen metabolites, and enzyme activities, and differentially expressed genes and miRNAs involved in the carbon and nitrogen metabolic pathway in rice shoots at the following times: 2:00, 6:00, 10:00, 14:00, 18:00, and 22:00. Our results indicated that more CO2 was fixed into carbohydrates by a high net photosynthetic rate, respiratory rate, and stomatal conductance in the daytime. Although high levels of the nitrate reductase activity, free ammonium and carbohydrates were exhibited in the daytime, the protein synthesis was not significantly facilitated by the light and temperature. In mRNA sequencing, the carbon and nitrogen metabolism-related differentially expressed genes were obtained, which could be divided into eight groups: photosynthesis, TCA cycle, sugar transport, sugar metabolism, nitrogen transport, nitrogen reduction, amino acid metabolism, and nitrogen regulation. Additionally, a total of 78,306 alternative splicing events have been identified, which primarily belong to alternative 5' donor sites, alternative 3' acceptor sites, intron retention, and exon skipping. In sRNA sequencing, four carbon and nitrogen metabolism-related miRNAs (osa-miR1440b, osa-miR2876-5p, osa-miR1877 and osa-miR5799) were determined to be regulated by natural light/dark cycle. The expression level analysis showed that the four carbon and nitrogen metabolism-related miRNAs negatively regulated their target genes. These results may provide a good strategy to study how natural light/dark cycle regulates carbon and nitrogen metabolism to ensure plant growth and development.
NASA Astrophysics Data System (ADS)
Blumenfeld, H. N.; Kelley, D. S.; Girguis, P. R.; Schrenk, M. O.
2010-12-01
The walls of deep-sea hydrothermal vent chimneys sustain steep thermal and chemical gradients resulting from the mixing of hot (350°C+) hydrothermal fluids with cold, oxygenated seawater. The chemical disequilibrium generated from this process has the potential to drive numerous chemolithoautotrophic metabolisms, many of which have been demonstrated to be operative in microbial pure cultures. In addition to the well-known Calvin Cycle, at least five additional pathways have been discovered including the Reverse Tricarboxylic Acid Cycle (rTCA), the Reductive Acetyl-CoA pathway, and the 3-hydroxyproprionate pathway. Most of the newly discovered pathways have been found in thermophilic and hyperthermophilic Bacteria and Archaea, which are the well represented in microbial diversity studies of hydrothermal chimney walls. However, to date, little is known about the environmental controls that impact various carbon fixation pathways. The overlap of limited microbial diversity with distinct habitat conditions in hydrothermal chimney walls provides an ideal setting to explore these relationships. Hydrothermal chimney walls from multiple structures recovered from the Juan de Fuca Ridge in the northeastern Pacific were sub-sampled and analyzed using PCR-based assays. Earlier work showed elevated microbial abundances in the outer portions of mature chimney walls, with varying ratios of Archaea to Bacteria from the outer to inner portions of the chimneys. Common phylotypes identified in these regions included Epsilonproteobacteria, Gammaproteobacteria, and Desulfurococcales. Total genomic DNA was extracted from mineralogically distinct niches within these structures and queried for genes coding key regulatory enzymes for each of the well studied carbon fixation pathways. Preliminary results show the occurrence of genes representing rTCA cycle (aclB) and methyl coenzyme A reductase (mcrA) - a proxy for the Reductive Acetyl-CoA Pathway within interior portion of mature hydrothermal chimneys. Ongoing analyses are aimed at quantifying the abundances of these diagnostic carbon fixation genes within the hydrothermal chimney gradients. These data are being compared to a broad array of contextual data to provide insight into the environmental and biological controls that may impact the distribution of the various carbon fixation pathways. Application of genomic approaches to the hydrothermal chimney ecosystem will provide insight into the microbial ecology of such structures and refine our ability to measure autotrophy in hydrothermal habitats sustained by chemical energy.
Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen
2011-01-01
Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.
Choi, Yong-Min; Kim, Han-Kyul; Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ruvindy, Rendy; White III, Richard Allen; Neilan, Brett Anthony
Modern microbial mats are potential analogues of some of Earth’s earliest ecosystems. Excellent examples can be found in Shark Bay, Australia, with mats of various morphologies. To further our understanding of the functional genetic potential of these complex microbial ecosystems, we conducted for the first time shotgun metagenomic analyses. We assembled metagenomic nextgeneration sequencing data to classify the taxonomic and metabolic potential across diverse morphologies of marine mats in Shark Bay. The microbial community across taxonomic classifications using protein-coding and small subunit rRNA genes directly extracted from the metagenomes suggests that three phyla Proteobacteria, Cyanobacteria and Bacteriodetes dominate all marinemore » mats. However, the microbial community structure between Shark Bay and Highbourne Cay (Bahamas) marine systems appears to be distinct from each other. The metabolic potential (based on SEED subsystem classifications) of the Shark Bay and Highbourne Cay microbial communities were also distinct. Shark Bay metagenomes have a metabolic pathway profile consisting of both heterotrophic and photosynthetic pathways, whereas Highbourne Cay appears to be dominated almost exclusively by photosynthetic pathways. Alternative non-rubisco-based carbon metabolism including reductive TCA cycle and 3-hydroxypropionate/4-hydroxybutyrate pathways is highly represented in Shark Bay metagenomes while not represented in Highbourne Cay microbial mats or any other mat forming ecosystems investigated to date. Potentially novel aspects of nitrogen cycling were also observed, as well as putative heavy metal cycling (arsenic, mercury, copper and cadmium). Finally, archaea are highly represented in Shark Bay and may have critical roles in overall ecosystem function in these modern microbial mats.« less
Klingner, Arne; Bartsch, Annekathrin; Dogs, Marco; Wagner-Döbler, Irene; Jahn, Dieter; Simon, Meinhard; Brinkhoff, Thorsten; Becker, Judith
2015-01-01
Marine bacteria form one of the largest living surfaces on Earth, and their metabolic activity is of fundamental importance for global nutrient cycling. Here, we explored the largely unknown intracellular pathways in 25 microbes representing different classes of marine bacteria that use glucose: Alphaproteobacteria, Gammaproteobacteria, and Flavobacteriia of the Bacteriodetes phylum. We used 13C isotope experiments to infer metabolic fluxes through their carbon core pathways. Notably, 90% of all strains studied use the Entner-Doudoroff (ED) pathway for glucose catabolism, whereas only 10% rely on the Embden-Meyerhof-Parnas (EMP) pathway. This result differed dramatically from the terrestrial model strains studied, which preferentially used the EMP pathway yielding high levels of ATP. Strains using the ED pathway exhibited a more robust resistance against the oxidative stress typically found in this environment. An important feature contributing to the preferential use of the ED pathway in the oceans could therefore be enhanced supply of NADPH through this pathway. The marine bacteria studied did not specifically rely on a distinct anaplerotic route, but the carboxylation of phosphoenolpyruvate (PEP) or pyruvate for fueling of the tricarboxylic acid (TCA) cycle was evenly distributed. The marine isolates studied belong to clades that dominate the uptake of glucose, a major carbon source for bacteria in seawater. Therefore, the ED pathway may play a significant role in the cycling of mono- and polysaccharides by bacterial communities in marine ecosystems. PMID:25616803
NASA Astrophysics Data System (ADS)
Probst, A. J.; Jerett, J.; Castelle, C. J.; Thomas, B. C.; Sharon, I.; Brown, C. T.; Anantharaman, K.; Emerson, J. B.; Hernsdorf, A. W.; Amano, Y.; Suzuki, Y.; Tringe, S. G.; Woyke, T.; Banfield, J. F.
2015-12-01
Subsurface environments span the planet but remain little understood from the perspective of the capacity of the resident organisms to fix CO2. Here we investigated the autotrophic capacity of microbial communities in range of a high-CO2 subsurface environments via analysis of 250 near-complete microbial genomes (151 of them from distinct species) that represent the most abundant organisms over a subsurface depth transect. More than one third of the genomes belonged to the so-called candidate phyla radiation (CPR), which have limited metabolic capabilities. Approximately 30% of the community members are autotrophs that comprise 70% of the microbiome with metabolism likely supported by sulfur and nitrogen respiration. Of the carbon fixation pathways, the Calvin Benson Basham Cycle was most common, but the Wood-Ljungdhal pathway was present in the greatest phylogenetic diversity of organisms. Unexpectedly, one organism from a novel phylum sibling to the CPR is predicted to fix carbon by the reverse TCA cycle. The genome of the most abundant organism, an archaeon designated "Candidatus Altiarchaeum hamiconexum", was also found in subsurface samples from other continents including Europe and Asia. The archaeon was proven to be a carbon fixer using a novel reductive acetyl-CoA pathway. These results provide evidence that carbon dioxide is the major carbon source in these environments and suggest that autotrophy in the subsurface represents a substantial carbon dioxide sink affecting the global carbon cycle.
Wu, Fang; Zheng, Hua; Yang, Zheng-Teng; Cheng, Bang; Wu, Jin-Xia; Liu, Xu-Wen; Tang, Chao-Ling; Lu, Shi-Yin; Chen, Zhao-Ni; Song, Fang-Ming; Ruan, Jun-Xiang; Zhang, Hong-Ye; Liang, Yong-Hong; Song, Hui; Su, Zhi-Heng
2017-06-05
Chronic liver injury has been shown to cause liver fibrosis due to the sustained pathophysiological wound healing response of the liver, and eventually progresses to cirrhosis. The total alkaloids of Corydalis saxicola Bunting (TACS), a collection of important bioactive ingredients derived from the traditional Chinese folk medicine Corydalis saxicola Bunting (CS), have been reported to have protective effects on the liver. However, the underlying molecular mechanisms need further elucidation. In this study, the urinary metabonomics and the biochemical changes in rats with carbon tetrachloride (CCl 4 )-induced chronic liver injury due to treatment TACS or administration of the positive control drug-bifendate were studied via proton nuclear magnetic resonance ( 1 H NMR) analysis. Partial least squares-discriminate analysis (PLS-DA) suggested that metabolic perturbation caused by CCl 4 damage was recovered with TACS and bifendate treatment. A total of seven metabolites including 2-oxoglutarate, citrate, dimethylamine, taurine, phenylacetylglycine, creatinine and hippurate were considered as potential biomarkers involved in the development of CCl 4 -induced chronic liver injury. According to pathway analysis using identified metabolites and correlation network construction, the tricarboxylic acid (TCA) cycle, gut microbiota metabolism and taurine and hypotaurine metabolism were recognized as the most affected metabolic pathways associated with CCl 4 chronic hepatotoxicity. Notably, the changes in 2-oxoglutarate, citrate, taurine and hippurate during the process of CCl 4 -induced chronic liver injury were significantly restored by TACS treatment, which suggested that TACS synergistically mediated the regulation of multiple metabolic pathways including the TCA cycle, gut microbiota metabolism and taurine and hypotaurine metabolism. This study could bring valuable insight to evaluating the efficacy of TACS intervention therapy, help deepen the understanding of the hepatoprotective mechanisms of TACS and enable optimal diagnosis of chronic liver injury. Copyright © 2017 Elsevier B.V. All rights reserved.
Andreozzi, Stefano; Chakrabarti, Anirikh; Soh, Keng Cher; Burgard, Anthony; Yang, Tae Hoon; Van Dien, Stephen; Miskovic, Ljubisa; Hatzimanikatis, Vassily
2016-05-01
Rational metabolic engineering methods are increasingly employed in designing the commercially viable processes for the production of chemicals relevant to pharmaceutical, biotechnology, and food and beverage industries. With the growing availability of omics data and of methodologies capable to integrate the available data into models, mathematical modeling and computational analysis are becoming important in designing recombinant cellular organisms and optimizing cell performance with respect to desired criteria. In this contribution, we used the computational framework ORACLE (Optimization and Risk Analysis of Complex Living Entities) to analyze the physiology of recombinant Escherichia coli producing 1,4-butanediol (BDO) and to identify potential strategies for improved production of BDO. The framework allowed us to integrate data across multiple levels and to construct a population of large-scale kinetic models despite the lack of available information about kinetic properties of every enzyme in the metabolic pathways. We analyzed these models and we found that the enzymes that primarily control the fluxes leading to BDO production are part of central glycolysis, the lower branch of tricarboxylic acid (TCA) cycle and the novel BDO production route. Interestingly, among the enzymes between the glucose uptake and the BDO pathway, the enzymes belonging to the lower branch of TCA cycle have been identified as the most important for improving BDO production and yield. We also quantified the effects of changes of the target enzymes on other intracellular states like energy charge, cofactor levels, redox state, cellular growth, and byproduct formation. Independent earlier experiments on this strain confirmed that the computationally obtained conclusions are consistent with the experimentally tested designs, and the findings of the present studies can provide guidance for future work on strain improvement. Overall, these studies demonstrate the potential and effectiveness of ORACLE for the accelerated design of microbial cell factories. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.
McNair, Laura F; Kornfelt, Rasmus; Walls, Anne B; Andersen, Jens V; Aldana, Blanca I; Nissen, Jakob D; Schousboe, Arne; Waagepetersen, Helle S
2017-03-01
Brain slice preparations from rats, mice and guinea pigs have served as important tools for studies of neurotransmission and metabolism. While hippocampal slices routinely have been used for electrophysiology studies, metabolic processes have mostly been studied in cerebral cortical slices. Few comparative characterization studies exist for acute hippocampal and cerebral cortical slices, hence, the aim of the current study was to characterize and compare glucose and acetate metabolism in these slice preparations in a newly established incubation design. Cerebral cortical and hippocampal slices prepared from 16 to 18-week-old mice were incubated for 15-90 min with unlabeled glucose in combination with [U- 13 C]glucose or [1,2- 13 C]acetate. Our newly developed incubation apparatus allows accurate control of temperature and is designed to avoid evaporation of the incubation medium. Subsequent to incubation, slices were extracted and extracts analyzed for 13 C-labeling (%) and total amino acid contents (µmol/mg protein) using gas chromatography-mass spectrometry and high performance liquid chromatography, respectively. Release of lactate from the slices was quantified by analysis of the incubation media. Based on the measured 13 C-labeling (%), total amino acid contents and relative activity of metabolic enzymes/pathways, we conclude that the slice preparations in the current incubation apparatus exhibited a high degree of metabolic integrity. Comparison of 13 C-labeling observed with [U- 13 C]glucose in slices from cerebral cortex and hippocampus revealed no significant regional differences regarding glycolytic or total TCA cycle activities. On the contrary, results from the incubations with [1,2- 13 C]acetate suggest a higher capacity of the astrocytic TCA cycle in hippocampus compared to cerebral cortex. Finally, we propose a new approach for assessing compartmentation of metabolite pools between astrocytes and neurons using 13 C-labeling (%) data obtained from mass spectrometry. Based on this approach we suggest that cellular metabolic compartmentation in hippocampus and cerebral cortex is very similar.
Reid, William D. K.; Sweeting, Christopher J.; Wigham, Ben D.; Zwirglmaier, Katrin; Hawkes, Jeffrey A.; McGill, Rona A. R.; Linse, Katrin; Polunin, Nicholas V. C.
2013-01-01
The hydrothermal vents on the East Scotia Ridge are the first to be explored in the Antarctic and are dominated by large peltospiroid gastropods, stalked barnacles (Vulcanolepas sp.) and anomuran crabs (Kiwa sp.) but their food webs are unknown. Vent fluid and macroconsumer samples were collected at three vent sites (E2, E9N and E9S) at distances of tens of metres to hundreds of kilometres apart with contrasting vent fluid chemistries to describe trophic interactions and identify potential carbon fixation pathways using stable isotopes. δ13C of dissolved inorganic carbon from vent fluids ranged from −4.6‰ to 0.8‰ at E2 and from −4.4‰ to 1.5‰ at E9. The lowest macroconsumer δ13C was observed in peltospiroid gastropods (−30.0‰ to −31.1‰) and indicated carbon fixation via the Calvin-Benson-Bassham (CBB) cycle by endosymbiotic gamma-Proteobacteria. Highest δ13C occurred in Kiwa sp. (−19.0‰ to −10.5‰), similar to that of the epibionts sampled from their ventral setae. Kiwa sp. δ13C differed among sites, which were attributed to spatial differences in the epibiont community and the relative contribution of carbon fixed via the reductive tricarboxylic acid (rTCA) and CBB cycles assimilated by Kiwa sp. Site differences in carbon fixation pathways were traced into higher trophic levels e.g. a stichasterid asteroid that predates on Kiwa sp. Sponges and anemones at the periphery of E2 assimilated a proportion of epipelagic photosynthetic primary production but this was not observed at E9N. Differences in the δ13C and δ34S values of vent macroconsumers between E2 and E9 sites suggest the relative contributions of photosynthetic and chemoautotrophic carbon fixation (rTCA v CBB) entering the hydrothermal vent food webs vary between the sites. PMID:23762393
Zhu, Wei; Zhang, Huan; Li, Xuan; Meng, Qian; Shu, Ruihao; Wang, Menglong; Zhou, Guiling; Wang, Hongtuo; Miao, Lin; Zhang, Jihong; Qin, Qilian
2016-02-01
Ghost moths (Lepidoptera: Hepialidae) are cold-adapted stenothermal species inhabiting alpine meadows on the Tibetan Plateau. They have an optimal developmental temperature of 12-16 °C but can maintain feeding and growth at 0 °C. Their survival strategies have received little attention, but these insects are a promising model for environmental adaptation. Here, biochemical adaptations and energy metabolism in response to cold were investigated in larvae of the ghost moth Hepialus xiaojinensis. Metabolic rate and respiratory quotient decreased dramatically with decreasing temperature (15-4 °C), suggesting that the energy metabolism of ghost moths, especially glycometabolism, was sensitive to cold. However, the metabolic rate at 4 °C increased with the duration of cold exposure, indicating thermal compensation to sustain energy budgets under cold conditions. Underlying regulation strategies were studied by analyzing metabolic differences between cold-acclimated (4 °C for 48 h) and control larvae (15 °C). In cold-acclimated larvae, the energy generating pathways of carbohydrates, instead of the overall consumption of carbohydrates, was compensated in the fat body by improving the transcription of related enzymes. The mobilization of lipids was also promoted, with higher diacylglycerol, monoacylglycerol and free fatty acid content in hemolymph. These results indicated that cold acclimation induced a reorganization on metabolic structure to prioritise energy metabolism. Within the aerobic process, flux throughout the tricarboxylic acid (TCA) cycle was encouraged in the fat body, and the activity of α-ketoglutarate dehydrogenase was the likely compensation target. Increased mitochondrial cristae density was observed in the midgut of cold-acclimated larvae. The thermal compensation strategies in this ghost moth span the entire process of energy metabolism, including degration of metabolic substrate, TCA cycle and oxidative phosphorylation, and from an energy budget perspective explains how ghost moths sustain physiological activity in cold environments. Copyright © 2015 Elsevier Ltd. All rights reserved.
Guarnieri, Michael T.; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St. John, Peter C.; Peterson, Darren J.; Bomble, Yannick J.
2017-01-01
ABSTRACT Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic acid production improvements and identifies key flux determinants and new bottlenecks and energetic needs when removing by-product pathways in A. succinogenes metabolism. PMID:28625987
Ghorbaniaghdam, Atefeh; Chen, Jingkui; Henry, Olivier; Jolicoeur, Mario
2014-01-01
Monoclonal antibody producing Chinese hamster ovary (CHO) cells have been shown to undergo metabolic changes when engineered to produce high titers of recombinant proteins. In this work, we have studied the distinct metabolism of CHO cell clones harboring an efficient inducible expression system, based on the cumate gene switch, and displaying different expression levels, high and low productivities, compared to that of the parental cells from which they were derived. A kinetic model for CHO cell metabolism was further developed to include metabolic regulation. Model calibration was performed using intracellular and extracellular metabolite profiles obtained from shake flask batch cultures. Model simulations of intracellular fluxes and ratios known as biomarkers revealed significant changes correlated with clonal variation but not to the recombinant protein expression level. Metabolic flux distribution mostly differs in the reactions involving pyruvate metabolism, with an increased net flux of pyruvate into the tricarboxylic acid (TCA) cycle in the high-producer clone, either being induced or non-induced with cumate. More specifically, CHO cell metabolism in this clone was characterized by an efficient utilization of glucose and a high pyruvate dehydrogenase flux. Moreover, the high-producer clone shows a high rate of anaplerosis from pyruvate to oxaloacetate, through pyruvate carboxylase and from glutamate to α-ketoglutarate, through glutamate dehydrogenase, and a reduced rate of cataplerosis from malate to pyruvate, through malic enzyme. Indeed, the increase of flux through pyruvate carboxylase was not driven by an increased anabolic demand. It is in fact linked to an increase of the TCA cycle global flux, which allows better regulation of higher redox and more efficient metabolic states. To the best of our knowledge, this is the first time a dynamic in silico platform is proposed to analyze and compare the metabolomic behavior of different CHO clones. PMID:24632968
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hatazawa, Yukino; Research Fellow of Japan Society for the Promotion of Science, Tokyo; Minami, Kimiko
The expression of the transcriptional coactivator PGC1α is increased in skeletal muscles during exercise. Previously, we showed that increased PGC1α leads to prolonged exercise performance (the duration for which running can be continued) and, at the same time, increases the expression of branched-chain amino acid (BCAA) metabolism-related enzymes and genes that are involved in supplying substrates for the TCA cycle. We recently created mice with PGC1α knockout specifically in the skeletal muscles (PGC1α KO mice), which show decreased mitochondrial content. In this study, global gene expression (microarray) analysis was performed in the skeletal muscles of PGC1α KO mice compared withmore » that of wild-type control mice. As a result, decreased expression of genes involved in the TCA cycle, oxidative phosphorylation, and BCAA metabolism were observed. Compared with previously obtained microarray data on PGC1α-overexpressing transgenic mice, each gene showed the completely opposite direction of expression change. Bioinformatic analysis of the promoter region of genes with decreased expression in PGC1α KO mice predicted the involvement of several transcription factors, including a nuclear receptor, ERR, in their regulation. As PGC1α KO microarray data in this study show opposing findings to the PGC1α transgenic data, a loss-of-function experiment, as well as a gain-of-function experiment, revealed PGC1α’s function in the oxidative energy metabolism of skeletal muscles. - Highlights: • Microarray analysis was performed in the skeletal muscle of PGC1α KO mice. • Expression of genes in the oxidative energy metabolism was decreased. • Bioinformatic analysis of promoter region of the genes predicted involvement of ERR. • PGC1α KO microarray data in this study show the mirror image of transgenic data.« less
Guarnieri, Michael T; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St John, Peter C; Peterson, Darren J; Bomble, Yannick J; Beckham, Gregg T
2017-09-01
Actinobacillus succinogenes , a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes , enabling examination of SA flux determinants via knockout of the primary competing pathways-namely, acetate and formate production-and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic acid production improvements and identifies key flux determinants and new bottlenecks and energetic needs when removing by-product pathways in A. succinogenes metabolism. Copyright © 2017 American Society for Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez
Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic acid production improvements and identifies key flux determinants and new bottlenecks and energetic needs when removing by-product pathways in A. succinogenes metabolism.« less
Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez; ...
2017-06-16
Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic acid production improvements and identifies key flux determinants and new bottlenecks and energetic needs when removing by-product pathways in A. succinogenes metabolism.« less
Shibayama, Junko; Yuzyuk, Tatiana N.; Cox, James; Makaju, Aman; Miller, Mickey; Lichter, Justin; Li, Hui; Leavy, Jane D.; Franklin, Sarah; Zaitsev, Alexey V.
2015-01-01
Heart failure (HF) is accompanied by complex alterations in myocardial energy metabolism. Up to 40% of HF patients have dyssynchronous ventricular contraction, which is an independent indicator of mortality. We hypothesized that electromechanical dyssynchrony significantly affects metabolic remodeling in the course of HF. We used a canine model of tachypacing-induced HF. Animals were paced at 200 bpm for 6 weeks either in the right atrium (synchronous HF, SHF) or in the right ventricle (dyssynchronous HF, DHF). We collected biopsies from left ventricular apex and performed comprehensive metabolic pathway analysis using multi-platform metabolomics (GC/MS; MS/MS; HPLC) and LC-MS/MS label-free proteomics. We found important differences in metabolic remodeling between SHF and DHF. As compared to Control, ATP, phosphocreatine (PCr), creatine, and PCr/ATP (prognostic indicator of mortality in HF patients) were all significantly reduced in DHF, but not SHF. In addition, the myocardial levels of carnitine (mitochondrial fatty acid carrier) and fatty acids (12:0, 14:0) were significantly reduced in DHF, but not SHF. Carnitine parmitoyltransferase I, a key regulatory enzyme of fatty acid ß-oxidation, was significantly upregulated in SHF but was not different in DHF, as compared to Control. Both SHF and DHF exhibited a reduction, but to a different degree, in creatine and the intermediates of glycolysis and the TCA cycle. In contrast to this, the enzymes of creatine kinase shuttle were upregulated, and the enzymes of glycolysis and the TCA cycle were predominantly upregulated or unchanged in both SHF and DHF. These data suggest a systemic mismatch between substrate supply and demand in pacing-induced HF. The energy deficit observed in DHF, but not in SHF, may be associated with a critical decrease in fatty acid delivery to the ß-oxidation pipeline, primarily due to a reduction in myocardial carnitine content. PMID:25790351
Zhang, Wenlin; Ogando, Diego G; Kim, Edward T; Choi, Moon-Jung; Li, Hongde; Tenessen, Jason M; Bonanno, Joseph A
2017-07-01
To establish conditionally immortal mouse corneal endothelial cell lines with genetically matched Slc4a11+/+ and Slc4a11-/- mice as a model for investigating pathology and therapies for SLC4A11 associated congenital hereditary endothelial dystrophy (CHED) and Fuchs' endothelial corneal dystrophy. We intercrossed H-2Kb-tsA58 mice (Immortomouse) expressing an IFN-γ dependent and temperature-sensitive mutant of the SV40 large T antigen (tsTAg) with Slc4a11+/+ and Slc4a11-/- C57BL/6 mice. The growth characteristics of the cell lines was assessed by doubling time. Ion transport activities (Na+/H+ exchange, bicarbonate, lactate, and Slc4a11 ammonia transport) were analyzed by intracellular pH measurement. The metabolic status of the cell lines was assessed by analyzing TCA cycle intermediates via gas chromatography mass spectrometry (GC-MS). The immortalized Slc4a11+/+ and Slc4a11-/- mouse corneal endothelial cells (MCECs) remained proliferative through passage 49 and maintained similar active ion transport activity. As expected, proliferation was temperature sensitive and IFN-γ dependent. Slc4a11-/- MCECs exhibited decreased proliferative capacity, reduced NH3:H+ transport, altered expression of glutaminolysis enzymes similar to the Slc4a11-/- mouse, and reduced proportion of TCA cycle intermediates derived from glutamine with compensatory increases in glucose flux compared with Slc4a11+/+ MCECs. This is the first report of the immortalization of MCECs. Ion transport of the immortalized endothelial cells remains active, except for NH3:H+ transporter activity in Slc4a11-/- MCECs. Furthermore, Slc4a11-/- MCECs recapitulate the glutaminolysis defects observed in Slc4a11-/- mouse corneal endothelium, providing an excellent tool to study the pathogenesis of SLC4A11 mutations associated with corneal endothelial dystrophies and to screen potential therapeutic agents.
Cuenca, María del Sol; Roca, Amalia; Molina-Santiago, Carlos; Duque, Estrella; Armengaud, Jean; Gómez-Garcia, María R; Ramos, Juan L
2016-01-01
Pseudomonas putida BIRD-1 has the potential to be used for the industrial production of butanol due to its solvent tolerance and ability to metabolize low-cost compounds. However, the strain has two major limitations: it assimilates butanol as sole carbon source and butanol concentrations above 1% (v/v) are toxic. With the aim of facilitating BIRD-1 strain design for industrial use, a genome-wide mini-Tn5 transposon mutant library was screened for clones exhibiting increased butanol sensitivity or deficiency in butanol assimilation. Twenty-one mutants were selected that were affected in one or both of the processes. These mutants exhibited insertions in various genes, including those involved in the TCA cycle, fatty acid metabolism, transcription, cofactor synthesis and membrane integrity. An omics-based analysis revealed key genes involved in the butanol response. Transcriptomic and proteomic studies were carried out to compare short and long-term tolerance and assimilation traits. Pseudomonas putida initiates various butanol assimilation pathways via alcohol and aldehyde dehydrogenases that channel the compound to central metabolism through the glyoxylate shunt pathway. Accordingly, isocitrate lyase - a key enzyme of the pathway - was the most abundant protein when butanol was used as the sole carbon source. Upregulation of two genes encoding proteins PPUBIRD1_2240 and PPUBIRD1_2241 (acyl-CoA dehydrogenase and acyl-CoA synthetase respectively) linked butanol assimilation with acyl-CoA metabolism. Butanol tolerance was found to be primarily linked to classic solvent defense mechanisms, such as efflux pumps, membrane modifications and control of redox state. Our results also highlight the intensive energy requirements for butanol production and tolerance; thus, enhancing TCA cycle operation may represent a promising strategy for enhanced butanol production. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cohen, S.M.
/sup 13/C NMR has been used to study the competition of pyruvate dehydrogenase with pyruvate carboxylase for entry of pyruvate into the tricarboxylic acid (TCA) cycle in perfused liver from streptozotocin-diabetic and normal donor rats. The relative proportion of pyruvate entering the TCA cycle by these two routes was estimated from the /sup 13/C enrichments at the individual carbons of glutamate when (3-/sup 13/C)alanine was the only exogenous substrate present. In this way, the proportion of pyruvate entering by the pyruvate dehydrogenase route relative to the pyruvate carboxylase route was determined to be 1:1.2 +/- 0.1 in liver from fedmore » controls, 1:7.7 +/- 2 in liver from 24-fasted controls, and 1:2.6 +/- 0.3 in diabetic liver. Pursuant to this observation that conversion of pyruvate to acetyl coenzyme A (acetyl-CoA) was greatest in perfused liver from fed controls, the incorporation of /sup 13/C label into fatty acids was monitored in this liver preparation. With the exception of the repeating methylene carbons, fatty acyl carbons labeled by (1-/sup 13/C)acetyl-CoA (from (2-/sup 13/C)pyruvate) gave rise to resonances distinguishable on the basis of chemical shift from those observed when label was introduced by (3-/sup 13/C)alanine plus (2-/sup 13/C)ethanol, which are converted to (2-/sup 13/C)acetyl-CoA. Thus, measurement of /sup 13/C enrichment at several specific sites in the fatty acyl chains in time-resolved spectra of perfused liver offers a novel way of monitoring the kinetics of the biosynthesis of fatty acids. In addition to obtaining the rate of lipogenesis, it was possible to distinguish the contributions of chain elongation from those of the de novo synthesis pathway and to estimate the average chain length of the /sup 13/C-labeled fatty acids produced.« less
Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu
2017-01-01
Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions. PMID:28704842
Mitochondrial Proteome Studies in Seeds during Germination
Czarna, Malgorzata; Kolodziejczak, Marta; Janska, Hanna
2016-01-01
Seed germination is considered to be one of the most critical phases in the plant life cycle, establishing the next generation of a plant species. It is an energy-demanding process that requires functioning mitochondria. One of the earliest events of seed germination is progressive development of structurally simple and metabolically quiescent promitochondria into fully active and cristae-containing mitochondria, known as mitochondrial biogenesis. This is a complex and tightly regulated process, which is accompanied by sequential and dynamic gene expression, protein synthesis, and post-translational modifications. The aim of this review is to give a comprehensive summary of seed mitochondrial proteome studies during germination of various plant model organisms. We describe different gel-based and gel-free proteomic approaches used to characterize mitochondrial proteomes of germinating seeds as well as challenges and limitations of these proteomic studies. Furthermore, the dynamic changes in the abundance of the mitochondrial proteomes of germinating seeds are illustrated, highlighting numerous mitochondrial proteins involved in respiration, tricarboxycylic acid (TCA) cycle, metabolism, import, and stress response as potentially important for seed germination. We then review seed mitochondrial protein carbonylation, phosphorylation, and S-nitrosylation as well as discuss the possible link between these post-translational modifications (PTMs) and the regulation of seed germination. PMID:28248229
Increased Dynamics of Tricarboxylic Acid Cycle and Glutamate Synthesis in Obese Adipose Tissue
Nagao, Hirofumi; Nishizawa, Hitoshi; Bamba, Takeshi; Nakayama, Yasumune; Isozumi, Noriyoshi; Nagamori, Shushi; Kanai, Yoshikatsu; Tanaka, Yoshimitsu; Kita, Shunbun; Fukuda, Shiro; Funahashi, Tohru; Maeda, Norikazu; Fukusaki, Eiichiro; Shimomura, Iichiro
2017-01-01
Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and in vivo metabolic turnover analysis to assess metabolic dynamics in obese mice. The static metabolic analyses showed that glutamate and constitutive metabolites of the TCA cycle were increased in the white adipose tissue (WAT) of ob/ob and diet-induced obesity mice but not in the liver or skeletal muscle of these obese mice. Moreover, in vivo metabolic turnover analyses demonstrated that these glucose-derived metabolites were dynamically and specifically produced in obese WAT compared with lean WAT. Glutamate rise in obese WAT was associated with down-regulation of glutamate aspartate transporter (GLAST), a major glutamate transporter for adipocytes, and low uptake of glutamate into adipose tissue. In adipocytes, glutamate treatment reduced adiponectin secretion and insulin-mediated glucose uptake and phosphorylation of Akt. These data suggest that a high intra-adipocyte glutamate level potentially relates to adipocyte dysfunction in obesity. This study provides novel insights into metabolic dysfunction in obesity through comprehensive application of in vivo metabolic turnover analysis in two obese animal models. PMID:28119455
Arsenic metabolism in high altitude modern stromatolites revealed by metagenomic analysis.
Kurth, Daniel; Amadio, Ariel; Ordoñez, Omar F; Albarracín, Virginia H; Gärtner, Wolfgang; Farías, María E
2017-04-21
Modern stromatolites thrive only in selected locations in the world. Socompa Lake, located in the Andean plateau at 3570 masl, is one of the numerous extreme Andean microbial ecosystems described over recent years. Extreme environmental conditions include hypersalinity, high UV incidence, and high arsenic content, among others. After Socompa's stromatolite microbial communities were analysed by metagenomic DNA sequencing, taxonomic classification showed dominance of Proteobacteria, Bacteroidetes and Firmicutes, and a remarkably high number of unclassified sequences. A functional analysis indicated that carbon fixation might occur not only by the Calvin-Benson cycle, but also through alternative pathways such as the reverse TCA cycle, and the reductive acetyl-CoA pathway. Deltaproteobacteria were involved both in sulfate reduction and nitrogen fixation. Significant differences were found when comparing the Socompa stromatolite metagenome to the Shark Bay (Australia) smooth mat metagenome: namely, those involving stress related processes, particularly, arsenic resistance. An in-depth analysis revealed a surprisingly diverse metabolism comprising all known types of As resistance and energy generating pathways. While the ars operon was the main mechanism, an important abundance of arsM genes was observed in selected phyla. The data resulting from this work will prove a cornerstone for further studies on this rare microbial community.
Tajima, Satoshi; Itoh, Yoko; Sugimoto, Takashi; Kato, Tatsuya; Park, Enoch Y
2009-10-01
The production of riboflavin from vegetable oil was increased using a mutant strain of Ashbya gossypii. This mutant was generated by treating the wild-type strain with N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). Riboflavin production was 10-fold higher in the mutant compared to the wild-type strain. The specific intracellular catalase activity after 3 d of culture was 6-fold higher in the mutant than in the wild-type strain. For the mutant, riboflavin production in the presence of 40 mM hydrogen peroxide was 16% less than that in the absence of hydrogen peroxide, whereas it was 56% less for the wild-type strain. The isocitrate lyase (ICL) activity of the mutant was 0.26 mU/mg of protein during the active riboflavin production phase, which was 2.6-fold higher than the wild-type strain. These data indicate that the mutant utilizes the carbon flux from the TCA cycle to the glyoxylate cycle more efficiently than the wild-type strain, resulting in enhanced riboflavin production. This novel mutant has the potential to be of use for industrial-scale riboflavin production from waste-activated bleaching earth (ABE), thereby transforming a useless material into a valuable bioproduct.
Ma, Fangfang; Jazmin, Lara J; Young, Jamey D; Allen, Doug K
2017-01-01
Photorespiration is a central component of photosynthesis; however to better understand its role it should be viewed in the context of an integrated metabolic network rather than a series of individual reactions that operate independently. Isotopically nonstationary 13 C metabolic flux analysis (INST-MFA), which is based on transient labeling studies at metabolic steady state, offers a comprehensive platform to quantify plant central metabolism. In this chapter, we describe the application of INST-MFA to investigate metabolism in leaves. Leaves are an autotrophic tissue, assimilating CO 2 over a diurnal period implying that the metabolic steady state is limited to less than 12 h and thus requiring an INST-MFA approach. This strategy results in a comprehensive unified description of photorespiration, Calvin cycle, sucrose and starch synthesis, tricarboxylic acid (TCA) cycle, and amino acid biosynthetic fluxes. We present protocols of the experimental aspects for labeling studies: transient 13 CO 2 labeling of leaf tissue, sample quenching and extraction, mass spectrometry (MS) analysis of isotopic labeling data, measurement of sucrose and amino acids in vascular exudates, and provide details on the computational flux estimation using INST-MFA.
Das, Gitishree; Patra, Jayanta Kumar; Lee, Sun-Young; Kim, Changgeon; Park, Jae Gyu; Baek, Kwang-Hyun
2017-01-01
Microbial cell performance in food biotechnological processes has become an important concern for improving human health worldwide. Lactobacillus plantarum, which is widely distributed in nature, is a lactic acid bacterium with many industrial applications for fermented foods or functional foods (e.g., probiotics). In the present study, using capillary electrophoresis time of flight mass spectrometry, the metabolomic profile of dried Orostachys japonicus A. Berger, a perennial medicinal herb with L. plantarum was compared with that of O. japonicus fermented with L. plantarum to elucidate the metabolomic changes induced by the fermentation process. The levels of several metabolites were changed by the fermentation process, indicating their involvement in microbial performance. For example, glycolysis, the pentose phosphate pathway, the TCA cycle, the urea cycle-related metabolism, nucleotide metabolism, and lipid and amino acid metabolism were altered significantly by the fermentation process. Although the fermented metabolites were not tested using in vivo studies to increase human health benefits, our findings provide an insight into the alteration of metabolites induced by fermentation, and indicated that the metabolomic analysis for the process should be accompanied by fermenting strains and conditions.
Pascual, Juan M.; Liu, Peiying; Mao, Deng; Kelly, Dorothy; Hernandez, Ana; Sheng, Min; Good, Levi B.; Ma, Qian; Marin-Valencia, Isaac; Zhang, Xuchen; Park, Jason Y.; Hynan, Linda S.; Stavinoha, Peter; Roe, Charles R.; Lu, Hanzhang
2015-01-01
Objective G1D is commonly associated with electrographic spike-wave and - less-noticeably – with absence seizures. The G1D syndrome has long been attributed to energy (i.e., ATP-synthetic) failure, as have experimental, toxic-rodent epilepsies to impaired brain metabolism and tricarboxylic acid (TCA) cycle intermediate depletion. Indeed, a (seldom-acknowledged) function of glucose and other substrates is the generation of brain TCAs via carbon-donor reactions collectively named anaplerosis. However, TCAs are preserved in murine G1D. This renders inferences about energy failure premature and suggests a different hypothesis, also grounded on our findings, that consumption of alternate TCA precursors is stimulated, potentially detracting from other functions. Second, common ketogenic diets can ameliorate G1D seizures, but lead to a therapeutically-counterintuitive reduction in blood glucose available to the brain, and they can prove ineffective in 1/3 of cases. While developing G1D treatments, all of this motivated us to: a) uphold (rather than attenuate) the residual brain glucose flux that all G1D patients possess; and b) stimulate the TCA cycle, including anaplerosis. Therefore, we tested the medium-chain triglyceride triheptanoin, a widely-used medical food supplement that can fulfill both of these metabolic roles. The rationale is that ketone bodies derived from ketogenic diets are not anaplerotic, in contrast with triheptanoin metabolites, as we have shown in the G1D mouse brain. Design We supplemented the regular diet of a case series of G1D patients with food-grade triheptanoin. First we confirmed that, despite their frequent electroencephalographic (EEG) presence as spike-waves, most seizures are rarely visible, such that perceptions by patients or others are inadequate for treatment evaluation. Thus, we used EEG, quantitative neuropsychological, blood analytical, and MRI cerebral metabolic rate measurements as main outcomes. Setting Academic and unsponsored. Patients Fourteen G1D children and adults not receiving a ketogenic diet. Results Eleven patients tolerated triheptanoin without significant adverse effects. Spike-waves decreased robustly in all patients who manifested them. Additionally, neuropsychological performance and cerebral metabolic rate increased in most patients. Conclusions Triheptanoin can favorably influence cardinal aspects of neural function in G1D. Additionally, our outcome measures offer a framework for the evaluation of therapies for G1D and other encephalopathies associated with impaired intermediary metabolism. PMID:25110966
Characterization of HgCdTe and Related Materials For Third Generation Infrared Detectors
NASA Astrophysics Data System (ADS)
Vaghayenegar, Majid
Hg1-xCdxTe (MCT) has historically been the primary material used for infrared detectors. Recently, alternative substrates for MCT growth such as Si, as well as alternative infrared materials such as Hg1-xCdxSe, have been explored. This dissertation involves characterization of Hg-based infrared materials for third generation infrared detectors using a wide range of transmission electron microscopy (TEM) techniques. A microstructural study on HgCdTe/CdTe heterostructures grown by MBE on Si (211) substrates showed a thin ZnTe layer grown between CdTe and Si to mediate the large lattice mismatch of 19.5%. Observations showed large dislocation densities at the CdTe/ZnTe/Si (211) interfaces, which dropped off rapidly away from the interface. Growth of a thin HgTe buffer layer between HgCdTe and CdTe layers seemed to improve the HgCdTe layer quality by blocking some defects. A second study investigated the correlation of etch pits and dislocations in as-grown and thermal-cycle-annealed (TCA) HgCdTe (211) films. For as-grown samples, pits with triangular and fish-eye shapes were associated with Frank partial and perfect dislocations, respectively. Skew pits were determined to have a more complex nature. TCA reduced the etch-pit density by 72%. Although TCA processing eliminated the fish-eye pits, dislocations reappeared in shorter segments in the TCA samples. Large pits were observed in both as-grown and TCA samples, but the nature of any defects associated with these pits in the as-grown samples is unclear. Microstructural studies of HgCdSe revealed large dislocation density at ZnTe/Si(211) interfaces, which dropped off markedly with ZnTe thickness. Atomic-resolution STEM images showed that the large lattice mismatch at the ZnTe/Si interface was accommodated through {111}-type stacking faults. A detailed analysis showed that the stacking faults were inclined at angles of 19.5 and 90 degrees at both ZnTe/Si and HgCdSe/ZnTe interfaces. These stacking faults were associated with Shockley and Frank partial dislocations, respectively. Initial attempts to delineate individual dislocations by chemical etching revealed that while the etchants successfully attacked defective areas, many defects in close proximity to the pits were unaffected.
Chen, Yong; Li, Shuya; Xiong, Jian; Li, Zhenjiang; Bai, Jianxin; Zhang, Lei; Ye, Qi; Ouyang, Pingkai; Ying, Hanjie
2010-03-01
A whole cell biocatalytic process for uridine 5'-monophosphate (UMP) production from orotic acid by Saccharomyces cerevisiae was developed. The concentration of UMP was increased by 23% when 1 g l(-1) sodium citrate was fed into the broth. Effects of citrate addition on UMP production were investigated. Glucose-6-phosphate pool was elevated by onefold, while FBP and pyruvate were decreased by 42% and 40%, respectively. Organic acid pools such as acetate and succinate were averagely decreased by 30% and 49%. The results demonstrated that manipulation of citrate levels could be used as a novel tool to regulate the metabolic fluxes distribution among glycolysis, pentose phosphate pathway, and TCA cycle.
Stamler, Rio A.; Holguin, Omar; Dungan, Barry; Schaub, Tanner; Sanogo, Soumaila; Goldberg, Natalie; Randall, Jennifer J.
2015-01-01
Induced resistance in plants is a systemic response to certain microorganisms or chemicals that enhances basal defense responses during subsequent plant infection by pathogens. Inoculation of chile pepper with zoospores of non-host Phytophthora nicotianae or the chemical elicitor beta-aminobutyric acid (BABA) significantly inhibited foliar blight caused by Phytophthora capsici. Tissue extract analyses by GC/MS identified conserved change in certain metabolite concentrations following P. nicotianae or BABA treatment. Induced chile pepper plants had reduced concentrations of sucrose and TCA cycle intermediates and increased concentrations of specific hexose-phosphates, hexose-disaccharides and amino acids. Galactose, which increased significantly in induced chile pepper plants, was shown to inhibit growth of P. capsici in a plate assay. PMID:26020237
Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki
2016-01-01
We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ. PMID:27297893
Tamazawa, Satoshi; Yamamoto, Kyosuke; Takasaki, Kazuto; Mitani, Yasuo; Hanada, Satoshi; Kamagata, Yoichi; Tamaki, Hideyuki
2016-06-25
We investigated the in situ gene expression profile of sulfur-turf microbial mats dominated by an uncultured large sausage-shaped Aquificae bacterium, a key metabolic player in sulfur-turfs in sulfidic hot springs. A reverse transcription-PCR analysis revealed that the genes responsible for sulfide, sulfite, and thiosulfate oxidation and carbon fixation via the reductive TCA cycle were continuously expressed in sulfur-turf mats taken at different sampling points, seasons, and years. These results suggest that the uncultured large sausage-shaped bacterium has the ability to grow chemolithoautotrophically and plays key roles as a primary producer in the sulfidic hot spring ecosystem in situ.
Stamler, Rio A; Holguin, Omar; Dungan, Barry; Schaub, Tanner; Sanogo, Soumaila; Goldberg, Natalie; Randall, Jennifer J
2015-01-01
Induced resistance in plants is a systemic response to certain microorganisms or chemicals that enhances basal defense responses during subsequent plant infection by pathogens. Inoculation of chile pepper with zoospores of non-host Phytophthora nicotianae or the chemical elicitor beta-aminobutyric acid (BABA) significantly inhibited foliar blight caused by Phytophthora capsici. Tissue extract analyses by GC/MS identified conserved change in certain metabolite concentrations following P. nicotianae or BABA treatment. Induced chile pepper plants had reduced concentrations of sucrose and TCA cycle intermediates and increased concentrations of specific hexose-phosphates, hexose-disaccharides and amino acids. Galactose, which increased significantly in induced chile pepper plants, was shown to inhibit growth of P. capsici in a plate assay.
Hertz, Leif; Chen, Ye
2017-01-01
The 1988 observation by Fox et al. (1988) that brief intense brain activation increases glycolysis (pyruvate formation from glucose) much more than oxidative metabolism has been abundantly confirmed. Specifically glycolytic increase was unexpected because the amount of ATP it generates is much smaller than that formed by subsequent oxidative metabolism of pyruvate. The present article shows that preferential glycolysis can be explained by metabolic processes associated with activation of the glutamate-glutamine cycle. The flux in this cycle, which is essential for production of transmitter glutamate and GABA, equals 75% of brain glucose utilization and each turn is associated with utilization of ~1 glucose molecule. About one half of the association between cycle flux and glucose metabolism occurs during neuronal conversion of glutamine to glutamate in a process similar to the malate-aspartate shuttle (MAS) except that glutamate is supplied from glutamine, not formed from α-ketoglutarate (αKG) as during operation of conventional MAS. Regular MAS function is triggered by one oxidative process in the cytosol during glycolysis causing NAD+ reduction to NADH. Since NADH cannot cross the mitochondrial membrane (MEM) for oxidation NAD+ is re-generated by conversion of cytosolic oxaloacetate (OAA) to malate, which enters the mitochondria for oxidation and in a cyclic process regenerates cytosolic OAA. Therefore MAS as well as the “pseudo-MAS” necessary for neuronal glutamate formation can only operate together with cytosolic reduction of NAD+ to NADH. The major process causing NAD+ reduction is glycolysis which therefore also must occur during neuronal conversion of glutamine to glutamate and may energize vesicular glutamate uptake which preferentially uses glycolytically derived energy. Another major contributor to the association between glutamate-glutamine cycle and glucose utilization is the need for astrocytic pyruvate to generate glutamate. Although some oxidative metabolism occurs during glutamate formation it is only one half of that during normal tricarboxylic acid (TCA) cycle function. Glutamate’s receptor stimulation leads to potassium ion (K+) release and astrocytic uptake, preferentially fueled by glycolysis and followed by release and neuronal re-accumulation. The activation-induced preferential glycolysis diminishes with continued activation and is followed by an increased ratio between oxidative metabolism and glycolysis, reflecting oxidation of generated glutamate and accumulated lactate. PMID:28890689
NASA Astrophysics Data System (ADS)
Meyer-Dombard, D. R.; Loiacono, S. T.; Shock, E.
2012-12-01
Coordinated analysis of the "Bison Pool" (BP) Environmental Genome and a complementary contextual geochemical dataset of ~75 parameters revealed biogeochemical cycling and metabolic and microbial community shifts in a Yellowstone National Park hot spring ecosystem (1). The >22m outflow of BP is a gradient of decreasing temperature, increasing dissolved oxygen, and changing availability of nutrients. Microbial life at BP transitions from a 92°C chemosynthetic community in the BP source pool to a 56°C photosynthetic mat community. Metagenomic data at BP showed the potential for both heterotrophic and autotrophic carbon metabolism (rTCA and acetyl-CoA cycles) in the highest temperature, chemosynthetic regions (1). This region of the outflow is dominated by Aquificales and Pyrococcus relatives, with smaller contributions of heterotrophic Bacteria. Following a 2h heavy precipitation event we observed an influx of exogenous organic material into the source pool supplied from the meadow surrounding the BP area. We sampled biomass and fluid at several locations within the outflow immediately following the event, and on several occasions for the next eight days. Elemental analysis and carbon and nitrogen isotopic analyses were conducted on biomass and sediment, and dissolved organic and inorganic carbon content and δ13C of fluids were analyzed. DNA and RNA were extracted, and following RT-PCR, nitrogen cycle functional gene expression was evaluated. Previous work at BP has shown that chemosynthetic biomass may carry isotopic signatures of fractionation during carbon fixation, via the acetyl-CoA and rTCA cycles (2). However, the addition of exogenous organic carbon during the rain event had an immediate and dramatic effect on the sediments and biofilms in the chemosynthetic zone of the outflow. Dissolved organic carbon was the highest measured in six years. Chemosynthetic biomass responded by incorporating the organic carbon. Carbon isotopic signatures in chemosynthetic biomass at "Bison Pool" have been previously measured at ~ -4‰ (2). However, immediately following the event, carbon in biomass was measured at ~ -25‰ (values similar to local soil and bison excrement). Biomass closest to the source of "Bison Pool" returned to ~ -4‰ within a few days, but biomass ~ 3m downstream was still ~ -14‰ eight days after the event. Carbon isotopic signatures of the dissolved inorganic carbon (DIC) were depleted relative to values measured in 2005-2009, possibly a result of a combination of added DIC in rain and heterotrophic waste produced using the exogenous depleted carbon; this depleted DIC persisted for the full study period. These results suggest that a shift from autotrophic to heterotrophic metabolism may occur following every significant precipitation event at BP, and support previous observations concerning potential periodic eutrophic conditions in this ecosystem (3). 1 Swingley, W.D. et al., PLoS ONE, 7(6): e38108. 2 Havig et al., 2011. JGR Biogeosciences, 116, G01005. 3 Loiacono, S.T. et al., 2012. EM, 14(5): 1272-1283.
Methane utilization in Methylomicrobium alcaliphilum 20ZR: a systems approach.
Akberdin, Ilya R; Thompson, Merlin; Hamilton, Richard; Desai, Nalini; Alexander, Danny; Henard, Calvin A; Guarnieri, Michael T; Kalyuzhnaya, Marina G
2018-02-06
Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13 C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization in M. alcaliphilum 20Z R . A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. The computational framework of C 1 -metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.
Zhang, Hong-Tao; Zhan, Xiao-Bei; Zheng, Zhi-Yong; Wu, Jian-Rong; Yu, Xiao-Bin; Jiang, Yun; Lin, Chi-Chung
2011-07-01
Expression at the mRNA level of ten selected genes in Agrobacterium sp. ATCC 31749 under various dissolved oxygen (DO) levels during curdlan fermentation related to electron transfer chain (ETC), tricarboxylic acid (TCA) cycle, peptidoglycan/lipopolysaccharide biosynthesis, and uridine diphosphate (UDP)-glucose biosynthesis were determined by qRT-PCR. Experiments were performed at DO levels of 30%, 50%, and 75%, as well as under low-oxygen conditions. The effect of high cell density on transcriptional response of the above genes under low oxygen was also studied. Besides cytochrome d (cyd A), the transcription levels of all the other genes were increased at higher DO and reached maximum at 50% DO. Under 75% DO, the transcriptional levels of all the genes were repressed. In addition, transcription levels of icd, sdh, cyo A, and fix N genes did not exhibit significant fluctuation with high cell density culture under low oxygen. These results suggested a mechanism for DO regulation of curdlan synthesis through regulation of transcriptional levels of ETCs, TCA, and UDP-glucose synthesis genes during curdlan fermentation. To our knowledge, this is the first report that DO concentration apparently regulates curdlan biosynthesis in Agrobacterium sp. ATCC 31749 providing essential lead for the optimization of the fermentation at the industrial scale.
Srivastava, Anubhav; Philip, Nisha; Hughes, Katie R; Georgiou, Konstantina; MacRae, James I; Barrett, Michael P; Creek, Darren J; McConville, Malcolm J; Waters, Andrew P
2016-12-01
Malaria parasites (Plasmodium spp.) encounter markedly different (nutritional) environments during their complex life cycles in the mosquito and human hosts. Adaptation to these different host niches is associated with a dramatic rewiring of metabolism, from a highly glycolytic metabolism in the asexual blood stages to increased dependence on tricarboxylic acid (TCA) metabolism in mosquito stages. Here we have used stable isotope labelling, targeted metabolomics and reverse genetics to map stage-specific changes in Plasmodium berghei carbon metabolism and determine the functional significance of these changes on parasite survival in the blood and mosquito stages. We show that glutamine serves as the predominant input into TCA metabolism in both asexual and sexual blood stages and is important for complete male gametogenesis. Glutamine catabolism, as well as key reactions in intermediary metabolism and CoA synthesis are also essential for ookinete to oocyst transition in the mosquito. These data extend our knowledge of Plasmodium metabolism and point towards possible targets for transmission-blocking intervention strategies. Furthermore, they highlight significant metabolic differences between Plasmodium species which are not easily anticipated based on genomics or transcriptomics studies and underline the importance of integration of metabolomics data with other platforms in order to better inform drug discovery and design.
Srivastava, Anubhav; Philip, Nisha; Hughes, Katie R.; Georgiou, Konstantina; MacRae, James I.; Barrett, Michael P.; McConville, Malcolm J.
2016-01-01
Malaria parasites (Plasmodium spp.) encounter markedly different (nutritional) environments during their complex life cycles in the mosquito and human hosts. Adaptation to these different host niches is associated with a dramatic rewiring of metabolism, from a highly glycolytic metabolism in the asexual blood stages to increased dependence on tricarboxylic acid (TCA) metabolism in mosquito stages. Here we have used stable isotope labelling, targeted metabolomics and reverse genetics to map stage-specific changes in Plasmodium berghei carbon metabolism and determine the functional significance of these changes on parasite survival in the blood and mosquito stages. We show that glutamine serves as the predominant input into TCA metabolism in both asexual and sexual blood stages and is important for complete male gametogenesis. Glutamine catabolism, as well as key reactions in intermediary metabolism and CoA synthesis are also essential for ookinete to oocyst transition in the mosquito. These data extend our knowledge of Plasmodium metabolism and point towards possible targets for transmission-blocking intervention strategies. Furthermore, they highlight significant metabolic differences between Plasmodium species which are not easily anticipated based on genomics or transcriptomics studies and underline the importance of integration of metabolomics data with other platforms in order to better inform drug discovery and design. PMID:28027318
Shim, Wooyoung; Anwar, Muhammad Ayaz; Kwon, Ji-Woong; Kwon, Hyuk-Kwon; Kim, Hyung Joong; Jeong, Hyobin; Kim, Hwan Myung; Hwang, Daehee; Kim, Hyung Sik; Choi, Sangdun
2015-01-01
The chemotherapeutic use of cisplatin is limited by its severe side effects. In this study, by conducting different omics data analyses, we demonstrated that cisplatin induces cell death in a proximal tubular cell line by suppressing glycolysis- and tricarboxylic acid (TCA)/mitochondria-related genes. Furthermore, analysis of the urine from cisplatin-treated rats revealed the lower expression levels of enzymes involved in glycolysis, TCA cycle, and genes related to mitochondrial stability and confirmed the cisplatin-related metabolic abnormalities. Additionally, an increase in the level of p53, which directly inhibits glycolysis, has been observed. Inhibition of p53 restored glycolysis and significantly reduced the rate of cell death at 24 h and 48 h due to p53 inhibition. The foremost reason of cisplatin-related cytotoxicity has been correlated to the generation of mitochondrial reactive oxygen species (ROS) that influence multiple pathways. Abnormalities in these pathways resulted in the collapse of mitochondrial energy production, which in turn sensitized the cells to death. The quenching of ROS led to the amelioration of the affected pathways. Considering these observations, it can be concluded that there is a significant correlation between cisplatin and metabolic dysfunctions involving mROS as the major player. PMID:26247588
Ruvindy, Rendy; White III, Richard Allen; Neilan, Brett Anthony; Burns, Brendan Paul
2016-01-01
Modern microbial mats are potential analogues of some of Earth's earliest ecosystems. Excellent examples can be found in Shark Bay, Australia, with mats of various morphologies. To further our understanding of the functional genetic potential of these complex microbial ecosystems, we conducted for the first time shotgun metagenomic analyses. We assembled metagenomic next-generation sequencing data to classify the taxonomic and metabolic potential across diverse morphologies of marine mats in Shark Bay. The microbial community across taxonomic classifications using protein-coding and small subunit rRNA genes directly extracted from the metagenomes suggests that three phyla Proteobacteria, Cyanobacteria and Bacteriodetes dominate all marine mats. However, the microbial community structure between Shark Bay and Highbourne Cay (Bahamas) marine systems appears to be distinct from each other. The metabolic potential (based on SEED subsystem classifications) of the Shark Bay and Highbourne Cay microbial communities were also distinct. Shark Bay metagenomes have a metabolic pathway profile consisting of both heterotrophic and photosynthetic pathways, whereas Highbourne Cay appears to be dominated almost exclusively by photosynthetic pathways. Alternative non-rubisco-based carbon metabolism including reductive TCA cycle and 3-hydroxypropionate/4-hydroxybutyrate pathways is highly represented in Shark Bay metagenomes while not represented in Highbourne Cay microbial mats or any other mat forming ecosystems investigated to date. Potentially novel aspects of nitrogen cycling were also observed, as well as putative heavy metal cycling (arsenic, mercury, copper and cadmium). Finally, archaea are highly represented in Shark Bay and may have critical roles in overall ecosystem function in these modern microbial mats. PMID:26023869
NMR- and GC/MS-based metabolomics of sulfur mustard exposed individuals: a pilot study.
Nobakht, B Fatemeh; Aliannejad, Rasoul; Rezaei-Tavirani, Mostafa; Arefi Oskouie, Afsaneh; Naseri, Mohammad Taghi; Parastar, Hadi; Aliakbarzadeh, Ghazaleh; Fathi, Fariba; Taheri, Salman
2016-09-01
Sulfur mustard (SM) is a potent alkylating agent and its effects on cells and tissues are varied and complex. Due to limitations in the diagnostics of sulfur mustard exposed individuals (SMEIs) by noninvasive approaches, there is a great necessity to develop novel techniques and biomarkers for this condition. We present here the first nuclear magnetic resonance (NMR) and gas chromatography-mass spectrometry (GC/MS) metabolic profiling of serum from and healthy controls to identify novel biomarkers in blood serum for better diagnostics. Of note, SMEIs were exposed to SM 30 years ago and that differences between two groups could still be found. Pathways in which differences between SMEIs and healthy controls are observed are related to lipid metabolism, ketogenesis, tricarboxylic acid (TCA) cycle and amino acid metabolism.
Porporato, Paolo E; Payen, Valéry L; Baselet, Bjorn; Sonveaux, Pierre
2016-04-01
Metabolic alterations are a hallmark of cancer controlling tumor progression and metastasis. Among the various metabolic phenotypes encountered in tumors, this review focuses on the contributions of mitochondria, lipid and amino acid metabolism to the metastatic process. Tumor cells require functional mitochondria to grow, proliferate and metastasize, but shifts in mitochondrial activities confer pro-metastatic traits encompassing increased production of mitochondrial reactive oxygen species (mtROS), enhanced resistance to apoptosis and the increased or de novo production of metabolic intermediates of the TCA cycle behaving as oncometabolites, including succinate, fumarate, and D-2-hydroxyglutarate that control energy production, biosynthesis and the redox state. Lipid metabolism and the metabolism of amino acids, such as glutamine, glutamate and proline are also currently emerging as focal control points of cancer metastasis.
Shimoda, Yoichi; Han, Junkyu; Kawada, Kiyokazu; Smaoui, Abderrazak; Isoda, Hiroko
2012-01-01
Energy metabolism is a very important process to improve and maintain health from the point of view of physiology. It is well known that the intracellular ATP production is contributed to energy metabolism in cells. Cistus monspeliensis is widely used as tea, spices, and medical herb; however, it has not been focusing on the activation of energy metabolism. In this study, C. monspeliensis was investigated as the food resources by activation of energy metabolism in human intestinal epithelial cells. C. monspeliensis extract showed high antioxidant ability. In addition, the promotion of metabolites of glycolysis and TCA cycle was induced by C. monspeliensis treatment. These results suggest that C. monspeliensis extract has an ability to enhance the energy metabolism in human intestinal cells. PMID:22523469
DOE Office of Scientific and Technical Information (OSTI.GOV)
Konno, S.; Chiao, J.; Rossi, J.
1986-05-01
Addition of nicotine causes a dose- and time-dependent inhibition of cell growth in established human and murine cells. In the human promyelocytic HL-60 leukemic cells, 3 mM nicotine results in a 50% inhibition of cellular proliferation after 80 h. Nicotine was also found to affect the cell cycle distribution of HL-60 cells. Treatment with 4 mM nicotine for 20 h causes an increase in proportion of Gl-phase cells (from 49% to 57%) and a significant decrease in the proportion of S-phase cells (from 41% to 32%). These results suggest that nicotine causes cell arrest in the Gl-phase which may inmore » part account for its effects on cell growth. To determine whether nicotine has a primary effect on the uptake/transport of macromolecular precursors into cells, HL-60 cells were treated with 2-6 mM nicotine for 30 h/sub 3/ at the end of which time cells were labeled with (/sup 3/H)thymidine, (/sup 3/H)uridine, (/sup 14/C)lysine and (/sup 35/S)methionine, the trichloroacetic acid (TCA) soluble and insoluble radioactivities from each of the labeling conditions were determined. These studies show that nicotine primarily affect the synthesis of proteins.« less
Metabolomic signature associated with reproduction-regulated aging in Caenorhabditis elegans.
Wan, Qin-Li; Shi, Xiaohuo; Liu, Jiangxin; Ding, Ai-Jun; Pu, Yuan-Zhu; Li, Zhigang; Wu, Gui-Sheng; Luo, Huai-Rong
2017-02-06
In Caenorhabditis elegans (C. elegans) , ablation of germline stem cells (GSCs) leads to infertility, which extends lifespan. It has been reported that aging and reproduction are both inextricably associated with metabolism. However, few studies have investigated the roles of polar small molecules metabolism in regulating longevity by reproduction. In this work, we combined the nuclear magnetic resonance (NMR) and ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) to profile the water-soluble metabolome in C. elegans . Comparing the metabolic fingerprint between two physiological ages among different mutants, our results demonstrate that aging is characterized by metabolome remodeling and metabolic decline. In addition, by analyzing the metabolic profiles of long-lived germline-less glp-1 mutants, we discovered that glp-1 mutants regulate the levels of many age-variant metabolites to attenuate aging, including elevated concentrations of the pyrimidine and purine metabolism intermediates and decreased concentrations of the citric acid cycle intermediates. Interestingly, by analyzing the metabolome of daf-16;glp-1 double mutants, our results revealed that some metabolic exchange contributing to germline-mediated longevity was mediated by transcription factor FOXO/DAF-16, including pyrimidine metabolism and the TCA cycle. Based on a comprehensive metabolic analysis, we provide novel insight into the relationship between longevity and metabolism regulated by germline signals in C. elegans .
Metabolomic signature associated with reproduction-regulated aging in Caenorhabditis elegans
Wan, Qin-Li; Shi, Xiaohuo; Liu, Jiangxin; Ding, Ai-Jun; Pu, Yuan-Zhu; Li, Zhigang; Wu, Gui-Sheng; Luo, Huai-Rong
2017-01-01
In Caenorhabditis elegans (C. elegans), ablation of germline stem cells (GSCs) leads to infertility, which extends lifespan. It has been reported that aging and reproduction are both inextricably associated with metabolism. However, few studies have investigated the roles of polar small molecules metabolism in regulating longevity by reproduction. In this work, we combined the nuclear magnetic resonance (NMR) and ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) to profile the water-soluble metabolome in C. elegans. Comparing the metabolic fingerprint between two physiological ages among different mutants, our results demonstrate that aging is characterized by metabolome remodeling and metabolic decline. In addition, by analyzing the metabolic profiles of long-lived germline-less glp-1 mutants, we discovered that glp-1 mutants regulate the levels of many age-variant metabolites to attenuate aging, including elevated concentrations of the pyrimidine and purine metabolism intermediates and decreased concentrations of the citric acid cycle intermediates. Interestingly, by analyzing the metabolome of daf-16;glp-1 double mutants, our results revealed that some metabolic exchange contributing to germline-mediated longevity was mediated by transcription factor FOXO/DAF-16, including pyrimidine metabolism and the TCA cycle. Based on a comprehensive metabolic analysis, we provide novel insight into the relationship between longevity and metabolism regulated by germline signals in C. elegans PMID:28177875
Global transcriptomic response of Anoxybacillus sp. SK 3-4 to aluminum exposure.
Lim, Jia Chun; Thevarajoo, Suganthi; Selvaratnam, Chitra; Goh, Kian Mau; Shamsir, Mohd Shahir; Ibrahim, Zaharah; Chong, Chun Shiong
2017-02-01
Anoxybacillus sp. SK 3-4 is a Gram-positive, rod-shaped bacterium and a member of family Bacillaceae. We had previously reported that the strain is an aluminum resistant thermophilic bacterium. This is the first report to provide a detailed analysis of the global transcriptional response of Anoxybacillus when the cells were exposed to 600 mg L -1 of aluminum. The transcriptome was sequenced using Illumina MiSeq sequencer. Total of 708 genes were differentially expressed (fold change >2.00) with 316 genes were up-regulated while 347 genes were down-regulated, in comparing to control with no aluminum added in the culture. Based on Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, the majority of genes encoding for cell metabolism such as glycolysis, sulfur metabolism, cysteine and methionine metabolism were up-regulated; while most of the gene associated with tricarboxylic acid cycle (TCA cycle) and valine, leucine and isoleucine metabolism were down-regulated. In addition, a significant number of the genes encoding ABC transporters, metal ions transporters, and some stress response proteins were also differentially expressed following aluminum exposure. The findings provide further insight and help us to understand on the resistance of Anoxybacillus sp. SK 3-4 toward aluminium. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Lu, Na; Chen, Jun-Hui; Wei, Dong; Chen, Feng; Chen, Gu
2016-05-10
In the present work, Chlamydomonas nivalis, a model species of snow algae, was used to illustrate the metabolic regulation mechanism of microalgae under nutrient deprivation stress. The seed culture was inoculated into the medium without nitrate or phosphate to reveal the cell responses by a metabolome profile analysis using gas chromatography time-of-flight mass spectrometry (GC/TOF-MS). One hundred and seventy-one of the identified metabolites clustered into five groups by the orthogonal partial least squares discriminant analysis (OPLS-DA) model. Among them, thirty of the metabolites in the nitrate-deprived group and thirty-nine of the metabolites in the phosphate-deprived group were selected and identified as "responding biomarkers" by this metabolomic approach. A significant change in the abundance of biomarkers indicated that the enhanced biosynthesis of carbohydrates and fatty acids coupled with the decreased biosynthesis of amino acids, N-compounds and organic acids in all the stress groups. The up- or down-regulation of these biomarkers in the metabolic network provides new insights into the global metabolic regulation and internal relationships within amino acid and fatty acid synthesis, glycolysis, the tricarboxylic acid cycle (TCA) and the Calvin cycle in the snow alga under nitrate or phosphate deprivation stress.
Bönnighausen, Jakob; Gebhard, Daniel; Kröger, Cathrin; Hadeler, Birgit; Tumforde, Thomas; Lieberei, Reinhard; Bergemann, Jörg; Schäfer, Wilhelm; Bormann, Jörg
2015-12-01
The cereal pathogen Fusarium graminearum threatens food and feed production worldwide. It reduces the yield and poisons the remaining kernels with mycotoxins, notably deoxynivalenol (DON). We analyzed the importance of gamma-aminobutanoic acid (GABA) metabolism for the life cycle of this fungal pathogen. GABA metabolism in F. graminearum is partially regulated by the global nitrogen regulator AreA. Genetic disruption of the GABA shunt by deletion of two GABA transaminases renders the pathogen unable to utilize the plant stress metabolites GABA and putrescine. The mutants showed increased sensitivity against oxidative stress, GABA accumulation in the mycelium, downregulation of two key enzymes of the TCA cycle, disturbed potential gradient in the mitochondrial membrane and lower mitochondrial oxygen consumption. In contrast, addition of GABA to the wild type resulted in its rapid turnover and increased mitochondrial steady state oxygen consumption. GABA concentrations are highly upregulated in infected wheat tissues. We conclude that GABA is metabolized by the pathogen during infection increasing its energy production, whereas the mutants accumulate GABA intracellularly resulting in decreased energy production. Consequently, the GABA mutants are strongly reduced in virulence but, because of their DON production, are able to cross the rachis node. © 2015 John Wiley & Sons Ltd.
Peng, Chao; Zhao, Xinguo; Liu, Saixi; Shi, Wei; Han, Yu; Guo, Cheng; Jiang, Jingang; Wan, Haibo; Shen, Tiedong; Liu, Guangxu
2016-01-01
Anthropogenic sound has increased significantly in the past decade. However, only a few studies to date have investigated its effects on marine bivalves, with little known about the underlying physiological and molecular mechanisms. In the present study, the effects of different types, frequencies, and intensities of anthropogenic sounds on the digging behavior of razor clams (Sinonovacula constricta) were investigated. The results showed that variations in sound intensity induced deeper digging. Furthermore, anthropogenic sound exposure led to an alteration in the O:N ratios and the expression of ten metabolism-related genes from the glycolysis, fatty acid biosynthesis, tryptophan metabolism, and Tricarboxylic Acid Cycle (TCA cycle) pathways. Expression of all genes under investigation was induced upon exposure to anthropogenic sound at ~80 dB re 1 μPa and repressed at ~100 dB re 1 μPa sound. In addition, the activity of Ca2+/Mg2+-ATPase in the feet tissues, which is directly related to muscular contraction and subsequently to digging behavior, was also found to be affected by anthropogenic sound intensity. The findings suggest that sound may be perceived by bivalves as changes in the water particle motion and lead to the subsequent reactions detected in razor clams. PMID:27063002
Peng, Chao; Zhao, Xinguo; Liu, Saixi; Shi, Wei; Han, Yu; Guo, Cheng; Jiang, Jingang; Wan, Haibo; Shen, Tiedong; Liu, Guangxu
2016-04-11
Anthropogenic sound has increased significantly in the past decade. However, only a few studies to date have investigated its effects on marine bivalves, with little known about the underlying physiological and molecular mechanisms. In the present study, the effects of different types, frequencies, and intensities of anthropogenic sounds on the digging behavior of razor clams (Sinonovacula constricta) were investigated. The results showed that variations in sound intensity induced deeper digging. Furthermore, anthropogenic sound exposure led to an alteration in the O:N ratios and the expression of ten metabolism-related genes from the glycolysis, fatty acid biosynthesis, tryptophan metabolism, and Tricarboxylic Acid Cycle (TCA cycle) pathways. Expression of all genes under investigation was induced upon exposure to anthropogenic sound at ~80 dB re 1 μPa and repressed at ~100 dB re 1 μPa sound. In addition, the activity of Ca(2+)/Mg(2+)-ATPase in the feet tissues, which is directly related to muscular contraction and subsequently to digging behavior, was also found to be affected by anthropogenic sound intensity. The findings suggest that sound may be perceived by bivalves as changes in the water particle motion and lead to the subsequent reactions detected in razor clams.
NASA Astrophysics Data System (ADS)
Bomberg, Malin; Lamminmäki, Tiina; Itävaara, Merja
2016-11-01
The microbial diversity in oligotrophic isolated crystalline Fennoscandian Shield bedrock fracture groundwaters is high, but the core community has not been identified. Here we characterized the bacterial and archaeal communities in 12 water conductive fractures situated at depths between 296 and 798 m by high throughput amplicon sequencing using the Illumina HiSeq platform. Between 1.7 × 104 and 1.2 × 106 bacterial or archaeal sequence reads per sample were obtained. These sequences revealed that up to 95 and 99 % of the bacterial and archaeal sequences obtained from the 12 samples, respectively, belonged to only a few common species, i.e. the core microbiome. However, the remaining rare microbiome contained over 3- and 6-fold more bacterial and archaeal taxa. The metabolic properties of the microbial communities were predicted using PICRUSt. The approximate estimation showed that the metabolic pathways commonly included fermentation, fatty acid oxidation, glycolysis/gluconeogenesis, oxidative phosphorylation, and methanogenesis/anaerobic methane oxidation, but carbon fixation through the Calvin cycle, reductive TCA cycle, and the Wood-Ljungdahl pathway was also predicted. The rare microbiome is an unlimited source of genomic functionality in all ecosystems. It may consist of remnants of microbial communities prevailing in earlier environmental conditions, but could also be induced again if changes in their living conditions occur.
Sanchez, Erica L.; Carroll, Patrick A.; Thalhofer, Angel B.; Lagunoff, Michael
2015-01-01
Kaposi’s Sarcoma-associated Herpesvirus (KSHV) is the etiologic agent of Kaposi’s Sarcoma (KS). KSHV establishes a predominantly latent infection in the main KS tumor cell type, the spindle cell, which is of endothelial cell origin. KSHV requires the induction of multiple metabolic pathways, including glycolysis and fatty acid synthesis, for the survival of latently infected endothelial cells. Here we demonstrate that latent KSHV infection leads to increased levels of intracellular glutamine and enhanced glutamine uptake. Depletion of glutamine from the culture media leads to a significant increase in apoptotic cell death in latently infected endothelial cells, but not in their mock-infected counterparts. In cancer cells, glutamine is often required for glutaminolysis to provide intermediates for the tri-carboxylic acid (TCA) cycle and support for the production of biosynthetic and bioenergetic precursors. In the absence of glutamine, the TCA cycle intermediates alpha-ketoglutarate (αKG) and pyruvate prevent the death of latently infected cells. Targeted drug inhibition of glutaminolysis also induces increased cell death in latently infected cells. KSHV infection of endothelial cells induces protein expression of the glutamine transporter, SLC1A5. Chemical inhibition of SLC1A5, or knockdown by siRNA, leads to similar cell death rates as glutamine deprivation and, similarly, can be rescued by αKG. KSHV also induces expression of the heterodimeric transcription factors c-Myc-Max and related heterodimer MondoA-Mlx. Knockdown of MondoA inhibits expression of both Mlx and SLC1A5 and induces a significant increase in cell death of only cells latently infected with KSHV, again, fully rescued by the supplementation of αKG. Therefore, during latent infection of endothelial cells, KSHV activates and requires the Myc/MondoA-network to upregulate the glutamine transporter, SLC1A5, leading to increased glutamine uptake for glutaminolysis. These findings expand our understanding of the required metabolic pathways that are activated during latent KSHV infection of endothelial cells, and demonstrate a novel role for the extended Myc-regulatory network, specifically MondoA, during latent KSHV infection. PMID:26197457
Metabolic adaptation of two in silico mutants of Mycobacterium tuberculosis during infection.
López-Agudelo, Víctor A; Baena, Andres; Ramirez-Malule, Howard; Ochoa, Silvia; Barrera, Luis F; Ríos-Estepa, Rigoberto
2017-11-21
Up to date, Mycobacterium tuberculosis (Mtb) remains as the worst intracellular killer pathogen. To establish infection, inside the granuloma, Mtb reprograms its metabolism to support both growth and survival, keeping a balance between catabolism, anabolism and energy supply. Mtb knockouts with the faculty of being essential on a wide range of nutritional conditions are deemed as target candidates for tuberculosis (TB) treatment. Constraint-based genome-scale modeling is considered as a promising tool for evaluating genetic and nutritional perturbations on Mtb metabolic reprogramming. Nonetheless, few in silico assessments of the effect of nutritional conditions on Mtb's vulnerability and metabolic adaptation have been carried out. A genome-scale model (GEM) of Mtb, modified from the H37Rv iOSDD890, was used to explore the metabolic reprogramming of two Mtb knockout mutants (pfkA- and icl-mutants), lacking key enzymes of central carbon metabolism, while exposed to changing nutritional conditions (oxygen, and carbon and nitrogen sources). A combination of shadow pricing, sensitivity analysis, and flux distributions patterns allowed us to identify metabolic behaviors that are in agreement with phenotypes reported in the literature. During hypoxia, at high glucose consumption, the Mtb pfkA-mutant showed a detrimental growth effect derived from the accumulation of toxic sugar phosphate intermediates (glucose-6-phosphate and fructose-6-phosphate) along with an increment of carbon fluxes towards the reductive direction of the tricarboxylic acid cycle (TCA). Furthermore, metabolic reprogramming of the icl-mutant (icl1&icl2) showed the importance of the methylmalonyl pathway for the detoxification of propionyl-CoA, during growth at high fatty acid consumption rates and aerobic conditions. At elevated levels of fatty acid uptake and hypoxia, we found a drop in TCA cycle intermediate accumulation that might create redox imbalance. Finally, findings regarding Mtb-mutant metabolic adaptation associated with asparagine consumption and acetate, succinate and alanine production, were in agreement with literature reports. This study demonstrates the potential application of genome-scale modeling, flux balance analysis (FBA), phenotypic phase plane (PhPP) analysis and shadow pricing to generate valuable insights about Mtb metabolic reprogramming in the context of human granulomas.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.
Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a secondmore » experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces leptinemia, hyperglycemia, and glucose intolerance. • Ozone increases serum free fatty acids, branched chain amino acids, cholesterols. • Ozone metabolic derangement is likely mediated by neuronal stress response pathway.« less
Zhang, Wenlin; Ogando, Diego G.; Kim, Edward T.; Choi, Moon-Jung; Li, Hongde; Tenessen, Jason M.; Bonanno, Joseph A.
2017-01-01
Purpose To establish conditionally immortal mouse corneal endothelial cell lines with genetically matched Slc4a11+/+ and Slc4a11−/− mice as a model for investigating pathology and therapies for SLC4A11 associated congenital hereditary endothelial dystrophy (CHED) and Fuchs' endothelial corneal dystrophy. Methods We intercrossed H-2Kb-tsA58 mice (Immortomouse) expressing an IFN-γ dependent and temperature-sensitive mutant of the SV40 large T antigen (tsTAg) with Slc4a11+/+ and Slc4a11−/− C57BL/6 mice. The growth characteristics of the cell lines was assessed by doubling time. Ion transport activities (Na+/H+ exchange, bicarbonate, lactate, and Slc4a11 ammonia transport) were analyzed by intracellular pH measurement. The metabolic status of the cell lines was assessed by analyzing TCA cycle intermediates via gas chromatography mass spectrometry (GC-MS). Results The immortalized Slc4a11+/+ and Slc4a11−/− mouse corneal endothelial cells (MCECs) remained proliferative through passage 49 and maintained similar active ion transport activity. As expected, proliferation was temperature sensitive and IFN-γ dependent. Slc4a11−/− MCECs exhibited decreased proliferative capacity, reduced NH3:H+ transport, altered expression of glutaminolysis enzymes similar to the Slc4a11−/− mouse, and reduced proportion of TCA cycle intermediates derived from glutamine with compensatory increases in glucose flux compared with Slc4a11+/+ MCECs. Conclusions This is the first report of the immortalization of MCECs. Ion transport of the immortalized endothelial cells remains active, except for NH3:H+ transporter activity in Slc4a11−/− MCECs. Furthermore, Slc4a11−/− MCECs recapitulate the glutaminolysis defects observed in Slc4a11−/− mouse corneal endothelium, providing an excellent tool to study the pathogenesis of SLC4A11 mutations associated with corneal endothelial dystrophies and to screen potential therapeutic agents. PMID:28738416
Overcoming substrate limitations for improved production of ethylene in E. coli.
Lynch, Sean; Eckert, Carrie; Yu, Jianping; Gill, Ryan; Maness, Pin-Ching
2016-01-01
Ethylene is an important industrial compound for the production of a wide variety of plastics and chemicals. At present, ethylene production involves steam cracking of a fossil-based feedstock, representing the highest CO2-emitting process in the chemical industry. Biological ethylene production can be achieved via expression of a single protein, the ethylene-forming enzyme (EFE), found in some bacteria and fungi; it has the potential to provide a sustainable alternative to steam cracking, provided that significant increases in productivity can be achieved. A key barrier is determining factors that influence the availability of substrates for the EFE reaction in potential microbial hosts. In the presence of O2, EFE catalyzes ethylene formation from the substrates α-ketoglutarate (AKG) and arginine. The concentrations of AKG, a key TCA cycle intermediate, and arginine are tightly controlled by an intricate regulatory system that coordinates carbon and nitrogen metabolism. Therefore, reliably predicting which genetic changes will ultimately lead to increased AKG and arginine availability is challenging. We systematically explored the effects of media composition (rich versus defined), gene copy number, and the addition of exogenous substrates and other metabolites on the formation of ethylene in Escherichia coli expressing EFE. Guided by these results, we tested a number of genetic modifications predicted to improve substrate supply and ethylene production, including knockout of competing pathways and overexpression of key enzymes. Several such modifications led to higher AKG levels and higher ethylene productivity, with the best performing strain more than doubling ethylene productivity (from 81 ± 3 to 188 ± 13 nmol/OD600/mL). Both EFE activity and substrate supply can be limiting factors in ethylene production. Targeted modifications in central carbon metabolism, such as overexpression of isocitrate dehydrogenase, and deletion of glutamate synthase or the transcription regulator ArgR, can effectively enhance substrate supply and ethylene productivity. These results not only provide insight into the intricate regulatory network of the TCA cycle, but also guide future pathway and genome-scale engineering efforts to further boost ethylene productivity.
Wang, Yanan; Zhang, Sufang; Zhu, Zhiwei; Shen, Hongwei; Lin, Xinping; Jin, Xiang; Jiao, Xiang; Zhao, Zongbao Kent
2018-01-01
Lipid accumulation by oleaginous microorganisms is of great scientific interest and biotechnological potential. While nitrogen limitation has been routinely employed, low-cost raw materials usually contain rich nitrogenous components, thus preventing from efficient lipid production. Inorganic phosphate (Pi) limitation has been found sufficient to promote conversion of sugars into lipids, yet the molecular basis of cellular response to Pi limitation and concurrent lipid accumulation remains elusive. Here, we performed multi-omic analyses of the oleaginous yeast Rhodosporidium toruloides to shield lights on Pi-limitation-induced lipid accumulation. Samples were prepared under Pi-limited as well as Pi-repleted chemostat conditions, and subjected to analysis at the transcriptomic, proteomic, and metabolomic levels. In total, 7970 genes, 4212 proteins, and 123 metabolites were identified. Results showed that Pi limitation facilitates up-regulation of Pi-associated metabolism, RNA degradation, and triacylglycerol biosynthesis while down-regulation of ribosome biosynthesis and tricarboxylic acid cycle. Pi limitation leads to dephosphorylation of adenosine monophosphate and the allosteric activator of isocitrate dehydrogenase key to lipid biosynthesis. It was found that NADPH, the key cofactor for fatty acid biosynthesis, is limited due to reduced flux through the pentose phosphate pathway and transhydrogenation cycle and that this can be overcome by over-expression of an endogenous malic enzyme. These phenomena are found distinctive from those under nitrogen limitation. Our data suggest that Pi limitation activates Pi-related metabolism, RNA degradation, and TAG biosynthesis while inhibits ribosome biosynthesis and TCA cycle, leading to enhanced carbon fluxes into lipids. The information greatly enriches our understanding on microbial oleaginicity and Pi-related metabolism. Importantly, systems data may facilitate designing advanced cell factories for production of lipids and related oleochemicals.
D'Alessandro, Angelo; Amelio, Ivano; Berkers, Celia R.; Antonov, Alexey; Vousden, Karen H.; Melino, Gerry; Zolla, Lello
2014-01-01
TAp63α is a member of the p53 family, which plays a central role in epithelial cancers. Recently, a role has emerged for p53 family members in cancer metabolic modulation. In order to assess whether TAp63α plays a role in cancer metabolism, we exploited p53-null osteosarcoma Tet-On Saos-2 cells, in which the expression of TAp63α was dependent on doxycycline supplementation to the medium. Metabolomics labeling experiments were performed by incubating the cells in 13C-glucose or 13C15N-glutamine-labeled culture media, as to monitor metabolic fluxes upon induced expression of TAp63α. Induced expression of TAp63α resulted in cell cycle arrest at the G1 phase. From a metabolic standpoint, expression of Tap63α promoted glycolysis and the pentose phosphate pathway, which was uncoupled from nucleotide biosynthesis, albeit prevented oxidative stress in the form of oxidized glutathione. Double 13C-glucose and 13C15N-glutamine metabolic labeling confirmed that induced expression of TAp63α corresponded to a decreased flux of pyruvate to the Krebs cycle and decreased utilization of glutamine for catabolic purposes in the TCA cycle. Results were not conclusive in relation to anabolic utilization of labeled glutamine, since it is unclear to what extent the observed minor TAp63α-dependent increases of glutamine-derived labeling in palmitate could be tied to increased rates of reductive carboxylation and de novo synthesis of fatty acids. Finally, bioinformatics elaborations highlighted a link between patient survival rates and the co-expression of p63 and rate limiting enzymes of the pentose phosphate pathway, G6PD and PGD. PMID:25229745
Methane utilization in Methylomicrobium alcaliphilum 20Z R: a systems approach
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akberdin, Ilya R.; Thompson, Merlin; Hamilton, Richard
Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization inmore » M. alcaliphilum 20Z R. A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. As a result, the computational framework of C 1-metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.« less
Methane utilization in Methylomicrobium alcaliphilum 20Z R: a systems approach
Akberdin, Ilya R.; Thompson, Merlin; Hamilton, Richard; ...
2018-02-06
Biological methane utilization, one of the main sinks of the greenhouse gas in nature, represents an attractive platform for production of fuels and value-added chemicals. Despite the progress made in our understanding of the individual parts of methane utilization, our knowledge of how the whole-cell metabolic network is organized and coordinated is limited. Attractive growth and methane-conversion rates, a complete and expert-annotated genome sequence, as well as large enzymatic, 13C-labeling, and transcriptomic datasets make Methylomicrobium alcaliphilum 20Z R an exceptional model system for investigating methane utilization networks. Here we present a comprehensive metabolic framework of methane and methanol utilization inmore » M. alcaliphilum 20Z R. A set of novel metabolic reactions governing carbon distribution across central pathways in methanotrophic bacteria was predicted by in-silico simulations and confirmed by global non-targeted metabolomics and enzymatic evidences. Our data highlight the importance of substitution of ATP-linked steps with PPi-dependent reactions and support the presence of a carbon shunt from acetyl-CoA to the pentose-phosphate pathway and highly branched TCA cycle. The diverged TCA reactions promote balance between anabolic reactions and redox demands. As a result, the computational framework of C 1-metabolism in methanotrophic bacteria can represent an efficient tool for metabolic engineering or ecosystem modeling.« less
Pancreatic Cancer Metabolism: Molecular Mechanisms and Clinical Applications.
Hosein, Abdel Nasser; Beg, Muhammad Shaalan
2018-05-11
Pancreatic adenocarcinoma is a leading cause of cancer mortality in western countries with a uniformly poor prognosis. Unfortunately, there has been little in the way of novel therapeutics for this malignancy over the last several decades. Derangements in metabolic circuitry favoring excess glycolysis are increasingly recognized as a key hallmark of cancer. The role of alterations in glutamine metabolism in pancreatic tumor progression has been elucidated in animal models and human cells lines, and there has been considerable interest in exploiting these aberrations for the treatment of pancreatic cancer. Other strategies targeting NQO1/GLS1 inhibition, NAD+ synthesis, and TCA cycle intermediates are being actively studied in the clinic. Aberrant metabolism in pancreatic cancer poses a unique therapeutic strategy. We review preclinical and clinical studies looking to exploit alterations in the metabolic circuitry of pancreatic cancer.
Çakιr, Tunahan; Alsan, Selma; Saybaşιlι, Hale; Akιn, Ata; Ülgen, Kutlu Ö
2007-01-01
Background It is a daunting task to identify all the metabolic pathways of brain energy metabolism and develop a dynamic simulation environment that will cover a time scale ranging from seconds to hours. To simplify this task and make it more practicable, we undertook stoichiometric modeling of brain energy metabolism with the major aim of including the main interacting pathways in and between astrocytes and neurons. Model The constructed model includes central metabolism (glycolysis, pentose phosphate pathway, TCA cycle), lipid metabolism, reactive oxygen species (ROS) detoxification, amino acid metabolism (synthesis and catabolism), the well-known glutamate-glutamine cycle, other coupling reactions between astrocytes and neurons, and neurotransmitter metabolism. This is, to our knowledge, the most comprehensive attempt at stoichiometric modeling of brain metabolism to date in terms of its coverage of a wide range of metabolic pathways. We then attempted to model the basal physiological behaviour and hypoxic behaviour of the brain cells where astrocytes and neurons are tightly coupled. Results The reconstructed stoichiometric reaction model included 217 reactions (184 internal, 33 exchange) and 216 metabolites (183 internal, 33 external) distributed in and between astrocytes and neurons. Flux balance analysis (FBA) techniques were applied to the reconstructed model to elucidate the underlying cellular principles of neuron-astrocyte coupling. Simulation of resting conditions under the constraints of maximization of glutamate/glutamine/GABA cycle fluxes between the two cell types with subsequent minimization of Euclidean norm of fluxes resulted in a flux distribution in accordance with literature-based findings. As a further validation of our model, the effect of oxygen deprivation (hypoxia) on fluxes was simulated using an FBA-derivative approach, known as minimization of metabolic adjustment (MOMA). The results show the power of the constructed model to simulate disease behaviour on the flux level, and its potential to analyze cellular metabolic behaviour in silico. Conclusion The predictive power of the constructed model for the key flux distributions, especially central carbon metabolism and glutamate-glutamine cycle fluxes, and its application to hypoxia is promising. The resultant acceptable predictions strengthen the power of such stoichiometric models in the analysis of mammalian cell metabolism. PMID:18070347
Welkie, David; Zhang, Xiaohui; Markillie, Meng Lye; Taylor, Ronald; Orr, Galya; Jacobs, Jon; Bhide, Ketaki; Thimmapuram, Jyothi; Gritsenko, Marina; Mitchell, Hugh; Smith, Richard D; Sherman, Louis A
2014-12-29
Cyanothece sp. PCC 7822 is an excellent cyanobacterial model organism with great potential to be applied as a biocatalyst for the production of high value compounds. Like other unicellular diazotrophic cyanobacterial species, it has a tightly regulated metabolism synchronized to the light-dark cycle. Utilizing transcriptomic and proteomic methods, we quantified the relationships between transcription and translation underlying central and secondary metabolism in response to nitrogen free, 12 hour light and 12 hour dark conditions. By combining mass-spectrometry based proteomics and RNA-sequencing transcriptomics, we quantitatively measured a total of 6766 mRNAs and 1322 proteins at four time points across a 24 hour light-dark cycle. Photosynthesis, nitrogen fixation, and carbon storage relevant genes were expressed during the preceding light or dark period, concurrent with measured nitrogenase activity in the late light period. We describe many instances of disparity in peak mRNA and protein abundances, and strong correlation of light dependent expression of both antisense and CRISPR-related gene expression. The proteins for nitrogenase and the pentose phosphate pathway were highest in the dark, whereas those for glycolysis and the TCA cycle were more prominent in the light. Interestingly, one copy of the psbA gene encoding the photosystem II (PSII) reaction center protein D1 (psbA4) was highly upregulated only in the dark. This protein likely cannot catalyze O2 evolution and so may be used by the cell to keep PSII intact during N2 fixation. The CRISPR elements were found exclusively at the ends of the large plasmid and we speculate that their presence is crucial to the maintenance of this plasmid. This investigation of parallel transcriptional and translational activity within Cyanothece sp. PCC 7822 provided quantitative information on expression levels of metabolic pathways relevant to engineering efforts. The identification of expression patterns for both mRNA and protein affords a basis for improving biofuel production in this strain and for further genetic manipulations. Expression analysis of the genes encoded on the 6 plasmids provided insight into the possible acquisition and maintenance of some of these extra-chromosomal elements.
Shui, Sufang; Cai, Xiaorong; Huang, Rongqing; Xiao, Bingkun; Yang, Jianyun
2017-01-30
Yi Guanjian (YGJ), one of the Chinese herbal medicines most commonly used in western countries, reported to possess significant anti-inflammatary effects that inhibit the process of inflammation. However, the mechanisms underlying its anti-inflammation effects remain largely unresolved. This study was aimed to investigate the anti-inflammatory activity of YGJ and to explore its potential anti-inflammatory mechanisms by serum metabonomics approach. An xylene-induced mouse right-ear-edema model was used as an inflammatory response in vivo model. Ear edema, prostaglandin E2 (PGE 2 ) and Tumor-Necrosis-Factor-alpha (TNF-α) were detected. Then, serum metabolic profiling was analyzed and pathway analysis performed on the biomarkers reversed after YGJ administration and further integration of metabolic networks. The results showed that YGJ alleviated ear edema and decreased serum PGE 2 and TNF-α levels. Fourteen biomarkers were screened, and the levels were all reversed to different degrees after YGJ administration. These biomarkers were mainly related to linoleic acid metabolism, taurine and hypotaurine metabolism, glyoxylate and dicarboxylate metabolism, glycine, serine and threonine metabolism and citrate cycle (TCA cycle). In metabolic networks, glycine and pyruvate were node molecules. This indicated that YGJ could significantly inhibit inflammatory response triggered by acute local stimulation and exerted anti-inflammatory activity mainly by regulating node molecules. Copyright © 2016 Elsevier B.V. All rights reserved.
Metabonomics identifies serum metabolite markers of colorectal cancer.
Tan, Binbin; Qiu, Yunping; Zou, Xia; Chen, Tianlu; Xie, Guoxiang; Cheng, Yu; Dong, Taotao; Zhao, Linjing; Feng, Bo; Hu, Xiaofang; Xu, Lisa X; Zhao, Aihua; Zhang, Menghui; Cai, Guoxiang; Cai, Sanjun; Zhou, Zhanxiang; Zheng, Minhua; Zhang, Yan; Jia, Wei
2013-06-07
Recent studies suggest that biofluid-based metabonomics may identify metabolite markers promising for colorectal cancer (CRC) diagnosis. We report here a follow-up replication study, after a previous CRC metabonomics study, aiming to identify a distinct serum metabolic signature of CRC with diagnostic potential. Serum metabolites from newly diagnosed CRC patients (N = 101) and healthy subjects (N = 102) were profiled using gas chromatography time-of-flight mass spectrometry (GC-TOFMS) and ultraperformance liquid chromatography quadrupole time-of-flight mass spectrometry (UPLC-QTOFMS). Differential metabolites were identified with statistical tests of orthogonal partial least-squares-discriminant analysis (VIP > 1) and the Mann-Whitney U test (p < 0.05). With a total of 249 annotated serum metabolites, we were able to differentiate CRC patients from the healthy controls using an orthogonal partial least-squares-discriminant analysis (OPLS-DA) in a learning sample set of 62 CRC patients and 62 matched healthy controls. This established model was able to correctly assign the rest of the samples to the CRC or control groups in a validation set of 39 CRC patients and 40 healthy controls. Consistent with our findings from the previous study, we observed a distinct metabolic signature in CRC patients including tricarboxylic acid (TCA) cycle, urea cycle, glutamine, fatty acids, and gut flora metabolism. Our results demonstrated that a panel of serum metabolite markers is of great potential as a noninvasive diagnostic method for the detection of CRC.
Guo, Hongwei; Wan, Hui; Chen, Hongwen; Fang, Fang; Liu, Song; Zhou, Jingwen
2016-10-01
During bioproduction of short-chain carboxylates, a shift in pH is a common strategy for enhancing the biosynthesis of target products. Based on two-dimensional gel electrophoresis, comparative proteomics analysis of general and mitochondrial protein samples was used to investigate the cellular responses to environmental pH stimuli in the α-ketoglutarate overproducer Yarrowia lipolytica WSH-Z06. The lower environmental pH stimuli tensioned intracellular acidification and increased the level of reactive oxygen species (ROS). A total of 54 differentially expressed protein spots were detected, and 11 main cellular processes were identified to be involved in the cellular response to environmental pH stimuli. Slight decrease in cytoplasmic pH enhanced the cellular acidogenicity by elevating expression level of key enzymes in tricarboxylic acid cycle (TCA cycle). Enhanced energy biosynthesis, ROS elimination, and membrane potential homeostasis processes were also employed as cellular defense strategies to compete with environmental pH stimuli. Owing to its antioxidant role of α-ketoglutarate, metabolic flux shifted to α-ketoglutarate under lower pH by Y. lipolytica in response to acidic pH stimuli. The identified differentially expressed proteins provide clues for understanding the mechanisms of the cellular responses and for enhancing short-chain carboxylate production through metabolic engineering or process optimization strategies in combination with manipulation of environmental conditions.
Laminaria japonica Extract, an Inhibitor of Clavibater michiganense Subsp. Sepedonicum
Cai, Jin; Feng, Jia; Xie, Shulian; Wang, Feipeng; Xu, Qiufeng
2014-01-01
Bacterial ring rot of potato is one of the most serious potato plant and tuber diseases. Laminaria japonica extract was investigated for its antimicrobial activity against Clavibater michiganense subsp. sepedonicum (Spieckermann & Kotthoff) Davis et al., the causative agent of bacterial ring rot of potato. The results showed that the optimum extraction conditions of antimicrobial substances from L. japonica were an extraction temperature of 80°C, an extraction time of 12 h, and a solid to liquid ratio of 1∶25. Active compounds of L. japonica were isolated by solvent partition, thin layer chromatography (TLC) and column chromatography. All nineteen fractionations had antimicrobial activities against C. michiganense subsp. sepedonicum, while Fractionation three (Fr.3) had the highest (P<0.05) antimicrobial activity. Chemical composition analysis identified a total of 26 components in Fr.3. The main constituents of Fr.3 were alkanes (80.97%), esters (5.24%), acids (4.87%) and alcohols (2.21%). Antimicrobial activity of Fr.3 against C. michiganense subsp. sepedonicum could be attributed to its ability to damage the cell wall and cell membrane, induce the production of reactive oxygen species (ROS), increase cytosolic Ca2+ concentration, inhibit the glycolytic pathway (EMP) and tricarboxylic acid (TCA) cycle, inhibit protein and nucleic acid synthesis, and disrupt the normal cycle of DNA replication. These findings indicate that L. japonica extracts have potential for inhibiting C. michiganense subsp. sepedonicum. PMID:24714388
Boros, László G; D'Agostino, Dominic P; Katz, Howard E; Roth, Justine P; Meuillet, Emmanuelle J; Somlyai, Gábor
2016-02-01
The naturally occurring isotope of hydrogen ((1)H), deuterium ((2)H), could have an important biological role. Deuterium depleted water delays tumor progression in mice, dogs, cats and humans. Hydratase enzymes of the tricarboxylic acid (TCA) cycle control cell growth and deplete deuterium from redox cofactors, fatty acids and DNA, which undergo hydride ion and hydrogen atom transfer reactions. A model is proposed that emphasizes the terminal complex of mitochondrial electron transport chain reducing molecular oxygen to deuterium depleted water (DDW); this affects gluconeogenesis as well as fatty acid oxidation. In the former, the DDW is thought to diminish the deuteration of sugar-phosphates in the DNA backbone, helping to preserve stability of hydrogen bond networks, possibly protecting against aneuploidy and resisting strand breaks, occurring upon exposure to radiation and certain anticancer chemotherapeutics. DDW is proposed here to link cancer prevention and treatment using natural ketogenic diets, low deuterium drinking water, as well as DDW production as the mitochondrial downstream mechanism of targeted anti-cancer drugs such as Avastin and Glivec. The role of (2)H in biology is a potential missing link to the elusive cancer puzzle seemingly correlated with cancer epidemiology in western populations as a result of excessive (2)H loading from processed carbohydrate intake in place of natural fat consumption. Published by Elsevier Ltd.
Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition
Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian
2016-01-01
Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029
Yang, Jehoon; Shen, Jun
2006-09-01
The significance of changes in cerebral oxygen consumption in focally activated brain tissue is still controversial. Since the rate of cerebral oxygen consumption is tightly coupled to that of tricarboxylic acid cycle which can be measured from the turnover kinetics of [4-(13)C]glutamate using in vivo (1)H{(13)C} magnetic resonance spectroscopy, changes in tricarboxylic acid cycle flux rate were assessed in primary somatosensory cortex of alpha-chloralose anesthetized rats during electrical forepaw stimulation. With markedly improved (1)H{(13)C} magnetic resonance spectroscopy technique and the use of high magnetic field strength of 11.7 T accessible to the current study, [4-(13)C]glutamate at 2.35 ppm was spectrally resolved from overlapping resonances of [4-(13)C]glutamine at 2.46 ppm and [2-(13)C]GABA at 2.28 ppm as well as the more distal [3-(13)C]glutamate and [3-(13)C]glutamine. The results showed a significantly increased V(TCA) in focally activated primary somatosensory cortex during forepaw stimulation, corresponding to approximately 51 +/- 27% (n = 6, mean +/- SD) increase in cerebral oxygen consumption rate. Considering the high efficiency in producing adenosine triphosphate by oxidative metabolism of glucose, the results demonstrate that aerobic oxidative metabolism provides the majority of energy required for cerebral focal activation in alpha-chloralose anesthetized rats subjected to forepaw stimulation.
González-Peña, Diana; Dudzik, Danuta; García, Antonia; de Ancos, Begoña; Barbas, Coral; Sánchez-Moreno, Concepción
2017-01-01
The consumption of functional ingredients has been suggested to be a complementary tool for the prevention and management of liver disease. In this light, processed onion can be considered as a source of multiple bioactive compounds with hepatoprotective properties. The liver fingerprint of male Wistar rats (n = 24) fed with three experimental diets (control (C), high-cholesterol (HC), and high-cholesterol enriched with onion (HCO) diets) was obtained through a non-targeted, multiplatform metabolomics approach to produce broad metabolite coverage. LC-MS, CE-MS and GC-MS results were subjected to univariate and multivariate analyses, providing a list of significant metabolites. All data were merged in order to figure out the most relevant metabolites that were modified by the onion ingredient. Several relevant metabolic changes and related metabolic pathways were found to be impacted by both HC and HCO diet. The model highlighted several metabolites (such as hydroxybutyryl carnitine and palmitoyl carnitine) modified by the HCO diet. These findings could suggest potential impairments in the energy−lipid metabolism, perturbations in the tricarboxylic acid cycle (TCA) cycle and β-oxidation modulated by the onion supplementation in the core of hepatic dysfunction. Metabolomics shows to be a valuable tool to evaluate the effects of complementary dietetic approaches directed to hepatic damage amelioration or non-alcoholic fatty liver disease (NAFLD) prevention. PMID:28134852
Brychkova, Galina; Yarmolinsky, Dmitry; Batushansky, Albert; Grishkevich, Vladislav; Khozin-Goldberg, Inna; Fait, Aaron; Amir, Rachel; Fluhr, Robert; Sagi, Moshe
2015-01-01
Plant sulfite oxidase [SO; E.C.1.8.3.1] has been shown to be a key player in protecting plants against exogenous toxic sulfite. Recently we showed that SO activity is essential to cope with rising dark-induced endogenous sulfite levels in tomato plants (Lycopersicon esculentum/Solanum lycopersicum Mill. cv. Rheinlands Ruhm). Here we uncover the ramifications of SO impairment on carbon, nitrogen and sulfur (S) metabolites. Current analysis of the wild-type and SO-impaired plants revealed that under controlled conditions, the imbalanced sulfite level resulting from SO impairment conferred a metabolic shift towards elevated reduced S-compounds, namely sulfide, S-amino acids (S-AA), Co-A and acetyl-CoA, followed by non-S-AA, nitrogen and carbon metabolite enhancement, including polar lipids. Exposing plants to dark-induced carbon starvation resulted in a higher degradation of S-compounds, total AA, carbohydrates, polar lipids and total RNA in the mutant plants. Significantly, a failure to balance the carbon backbones was evident in the mutants, indicated by an increase in tricarboxylic acid cycle (TCA) cycle intermediates, whereas a decrease was shown in stressed wild-type plants. These results indicate that the role of SO is not limited to a rescue reaction under elevated sulfite, but SO is a key player in maintaining optimal carbon, nitrogen and sulfur metabolism in tomato plants. PMID:27135342
Kim, Jin Yeong; Wu, Jingni; Kwon, Soon Jae; Oh, Haram; Lee, So Eui; Kim, Sang Gon; Wang, Yiming; Agrawal, Ganesh Kumar; Rakwal, Randeep; Kang, Kyu Young; Ahn, Il-Pyung; Kim, Beom-Gi; Kim, Sun Tae
2014-10-01
Necrotrophic fungal pathogen Cochliobolus miyabeanus causes brown spot disease in rice leaves upon infection, resulting in critical rice yield loss. To better understand the rice-C. miyabeanus interaction, we employed proteomic approaches to establish differential proteomes of total and secreted proteins from the inoculated leaves. The 2DE approach after PEG-fractionation of total proteins coupled with MS (MALDI-TOF/TOF and nESI-LC-MS/MS) analyses led to identification of 49 unique proteins out of 63 differential spots. SDS-PAGE in combination with nESI-LC-MS/MS shotgun approach was applied to identify secreted proteins in the leaf apoplast upon infection and resulted in cataloging of 501 unique proteins, of which 470 and 31 proteins were secreted from rice and C. miyabeanus, respectively. Proteins mapped onto metabolic pathways implied their reprogramming upon infection. The enzymes involved in Calvin cycle and glycolysis decreased in their protein abundance, whereas enzymes in the TCA cycle, amino acids, and ethylene biosynthesis increased. Differential proteomes also generated distribution of identified proteins in the intracellular and extracellular spaces, providing a better insight into defense responses of proteins in rice against C. miyabeanus. Established proteome of the rice-C. miyabeanus interaction serves not only as a good resource for the scientific community but also highlights its significance from biological aspects. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fraga, Carolina Miguel; da Costa, Tatiane Luiza; de Castro, Ana Maria; Reynoso-Ducoing, Olivia; Ambrosio, Javier; Hernández-Campos, Alicia; Castillo, Rafael; Vinaud, Marina Clare
2017-01-01
Human cysticercosis caused by Taenia crassiceps is unusual; however, it is an useful experimental model for cysticercosis studies. Benzimidazole derivatives are important antihelminthic drugs widely used against helminths. A novel compound 6-chloro-5-(1-naphthyloxy) -2-(trifluoromethyl)-1H-benzimidazole (RCB20) is a benzimidazole derivative less polar and more lipophilic. The aim of this study was to detect the effect of the RCB20 on the in vitro energetic metabolism of T. crassiceps cysticerci. For this, products of the metabolism both produced and secreted/excreted (S/E) by the parasite were detected through spectrophotometry and high performance liquid chromatography after exposure to 6.5 and 13 μM of RCB20 and albendazole sulfoxide (ABZSO). There was a gradual increase in the concentrations of glucose not uptaken by parasites exposed to both concentrations RCB20 and ABZSO. There was a higher concentration of all the organic acids related to the tricarboxilic acid cycle int the parasites exposed to RCB20. The structural differences between RCB20 and ABZSO result in different targets within the parasite and in a greater induction of the energetic pathways, such as the glycolysis and the TCA cycle. RCB20 is a good candidate as a substitute for anthelminthic benzimidazoles due to a differentiated site of action with similar outcome. Copyright © 2016 Elsevier Inc. All rights reserved.
Liu, Xiuxia; Yang, Sun; Wang, Fen; Dai, Xiaofeng; Yang, Yankun; Bai, Zhonghu
2017-02-01
The dissolved oxygen (DO) level of a culture of Corynebacterium glutamicum (C. glutamicum) in a bioreactor has a significant impact on the cellular redox potential and the distribution of energy and metabolites. In this study, to gain a deeper understanding of the effects of DO on the metabolism of C. glutamicum, we sought to systematically explore the influence of different DO concentrations on genetic regulation and metabolism through transcriptomic analysis. The results revealed that after 20 h of fermentation, oxygen limitation enhanced the glucose metabolism, pyruvate metabolism and carbon overflow, and restricted NAD + availability. A high oxygen supply enhanced the TCA cycle and reduced glyoxylate metabolism. Several key genes involved in response of C. glutamicum to different oxygen concentrations were examined, which provided suggestions for target site modifications in developing optimized oxygen supply strategies. These data provided new insights into the relationship between oxygen supply and metabolism of C. glutamicum.
Synthetic Biology Expands the Industrial Potential of Yarrowia lipolytica.
Markham, Kelly A; Alper, Hal S
2018-06-04
The oleaginous yeast Yarrowia lipolytica is quickly emerging as the most popular non-conventional (i.e., non-model organism) yeast in the bioproduction field. With a high propensity for flux through tricarboxylic acid (TCA) cycle intermediates and biological precursors such as acetyl-CoA and malonyl-CoA, this host is especially well suited to meet our industrial chemical production needs. Recent progress in synthetic biology tool development has greatly enhanced our ability to rewire this organism, with advances in genetic component design, CRISPR technologies, and modular cloning strategies. In this review we investigate recent developments in metabolic engineering and describe how the new tools being developed help to realize the full industrial potential of this host. Finally, we conclude with our vision of the developments that will be necessary to enhance future engineering efforts. Copyright © 2018 Elsevier Ltd. All rights reserved.
Uptake of atmospheric carbon dioxide into silk fiber by silkworms.
Magoshi, Jun; Tanaka, Toshihisa; Sasaki, Haruto; Kobayashi, Masatoshi; Magoshi, Yoshiko; Tsuda, Hidetoshi; Becker, Mary A; Inoue, Shun-ichi; Ishimaru, Ken
2003-01-01
The relation between the uptake of atmospheric CO(2) and insect's production of silk fiber has not yet been reported. Here, we provide the first quantitative demonstrations that four species of silkworms (Bombyx mori, Samia cynthia ricini, Antheraea pernyi, and Antheraea yamamai) and a silk-producing spider (Nephila clavata) incorporate atmospheric CO(2) into their silk fibers. The abundance of (13)C incorporated from the environment was determined by mass spectrometry and (13)C NMR measurements. Atmospheric CO(2) was incorporated into the silk fibers in the carbonyl groups of alanine, aspartic acid, serine, and glycine and the C(gamma) of aspartic acid. We show a simple model for the uptake of atmospheric CO(2) by silkworms. These results will demonstrate that silkworm has incorporated atmospheric CO(2) into silk fiber via the TCA cycle; however, the magnitude of uptake into the silk fibers is smaller than that consumed by the photosynthesis in trees and coral reefs.
Xu, Shan; Tian, Yuan; Hu, Yili; Zhang, Nijia; Hu, Sheng; Song, Dandan; Wu, Zhengshun; Wang, Yulan; Cui, Yanfang; Tang, Huiru
2016-06-22
The effects of tumorigenesis and tumor growth on the non-involved organs remain poorly understood although many research efforts have already been made for understanding the metabolic phenotypes of various tumors. To better the situation, we systematically analyzed the metabolic phenotypes of multiple non-involved mouse organ tissues (heart, liver, spleen, lung and kidney) in an A549 lung cancer xenograft model at two different tumor-growth stages using the NMR-based metabonomics approaches. We found that tumor growth caused significant metabonomic changes in multiple non-involved organ tissues involving numerous metabolic pathways, including glycolysis, TCA cycle and metabolisms of amino acids, fatty acids, choline and nucleic acids. Amongst these, the common effects are enhanced glycolysis and nucleoside/nucleotide metabolisms. These findings provided essential biochemistry information about the effects of tumor growth on the non-involved organs.
Glycolytic reprogramming through PCK2 regulates tumor initiation of prostate cancer cells
Zhao, Jiangsha; Li, Jieran; Fan, Teresa W.M.; Hou, Steven X.
2017-01-01
Tumor-initiating cells (TICs) play important roles in tumor progression and metastasis. Identifying the factors regulating TICs may open new avenues in cancer therapy. Here, we show that TIC-enriched prostate cancer cell clones use more glucose and secrete more lactate than TIC-low clones. We determined that elevated levels of phosphoenolpyruvate carboxykinase isoform 2 (PCK2) are critical for the metabolic switch and the maintenance of TICs in prostate cancer. Information from prostate cancer patient databases revealed that higher PCK2 levels correlated with more aggressive tumors and lower survival rates. PCK2 knockdown resulted in low TIC numbers, increased cytosolic acetyl-CoA and cellular protein acetylation. Our data suggest PCK2 promotes tumor initiation by lowering acetyl-CoA level through reducing the mitochondrial tricarboxylic acid (TCA) cycle. Thus, PCK2 is a potential therapeutic target for aggressive prostate tumors. PMID:29137367
Hosios, Aaron M.; Hecht, Vivian C.; Danai, Laura V.; Johnson, Marc O.; Rathmell, Jeffrey C.; Steinhauser, Matthew L.; Manalis, Scott R.; Vander Heiden, Matthew G.
2016-01-01
Cells must duplicate their mass in order to proliferate. Glucose and glutamine are the major nutrients consumed by proliferating mammalian cells, but the extent to which these and other nutrients contribute to cell mass is unknown. We quantified the fraction of cell mass derived from different nutrients and find that the majority of carbon mass in cells is derived from other amino acids, which are consumed at much lower rates than glucose and glutamine. While glucose carbon has diverse fates, glutamine contributes most to protein, and this suggests that glutamine’s ability to replenish TCA cycle intermediates (anaplerosis) is primarily used for amino acid biosynthesis. These findings demonstrate that rates of nutrient consumption are indirectly associated with mass accumulation and suggest that high rates of glucose and glutamine consumption support rapid cell proliferation beyond providing carbon for biosynthesis. PMID:26954548
Chang, Xiao; Wang, Zhuo; Hao, Pei; Li, Yuan-Yuan; Li, Yi-Xue
2010-06-01
The endosymbiotic theory proposed that mitochondrial genomes are derived from an alpha-proteobacterium-like endosymbiont, which was concluded from sequence analysis. We rebuilt the metabolic networks of mitochondria and 22 relative species, and studied the evolution of mitochondrial metabolism at the level of enzyme content and network topology. Our phylogenetic results based on network alignment and motif identification supported the endosymbiotic theory from the point of view of systems biology for the first time. It was found that the mitochondrial metabolic network were much more compact than the relative species, probably related to the higher efficiency of oxidative phosphorylation of the specialized organelle, and the network is highly clustered around the TCA cycle. Moreover, the mitochondrial metabolic network exhibited high functional specificity to the modules. This work provided insight to the understanding of mitochondria evolution, and the organization principle of mitochondrial metabolic network at the network level. Copyright 2010 Elsevier Inc. All rights reserved.
Metabolomics Reveals that Dietary Ferulic Acid and Quercetin Modulate Metabolic Homeostasis in Rats.
Zhang, Limin; Dong, Manyuan; Guangyong Xu; Yuan Tian; Tang, Huiru; Wang, Yulan
2018-02-21
Phenolic compounds ingestion has been shown to have potential preventive and therapeutic effects against various metabolic diseases such as obesity and cancer. To provide a better understanding of these potential benefit effects, we investigated the metabolic alterations in urine and feces of rat ingested ferulic acid (FA) and quercetin (Qu) using NMR-based metabolomics approach. Our results suggested that dietary FA and/or Qu significantly decreased short chain fatty acids and elevated oligosaccharides in the feces, implying that dietary FA and Qu may modulate gut microbial community with inhibition of bacterial fermentation of dietary fibers. We also found that dietary FA and/or Qu regulated several host metabolic pathways including TCA cycle and energy metabolism, bile acid, amino acid, and nucleic acid metabolism. These biological effects suggest that FA and Qu display outstanding bioavailability and bioactivity and could be used for treatment of some metabolic syndromes, such as inflammatory bowel diseases and obesity.
Zhang, Li-fang; Liu, Ling-sheng; Chu, Xiao-man; Xie, Hao; Cao, Li-juan; Guo, Cen; A, Ji-ye; Cao, Bei; Li, Meng-jie; Wang, Guang-ji; Hao, Hai-ping
2014-01-01
Aim: To investigate the potential interactive effects of a high-fat diet (HFD) and valproic acid (VPA) on hepatic steatosis and hepatotoxicity in rats. Methods: Male SD rats were orally administered VPA (100 or 500 mg·kg−1·d−1) combined with HFD or a standard diet for 8 weeks. Blood and liver samples were analyzed to determine lipid levels and hepatic function biomarkers using commercial kit assays. Low-molecular-weight compounds in serum, urine and bile samples were analyzed using a metabonomic approach based on GC/TOF-MS. Results: HFD alone induced extensive hepatocyte steatosis and edema in rats, while VPA alone did not cause significant liver lesions. VPA significantly aggravated HFD-induced accumulation of liver lipids, and caused additional spotty or piecemeal necrosis, accompanied by moderate infiltration of inflammatory cells in the liver. Metabonomic analysis of serum, urine and bile samples revealed that HFD significantly increased the levels of amino acids, free fatty acids (FFAs) and 3-hydroxy-butanoic acid, whereas VPA markedly decreased the levels of amino acids, FFAs and the intermediate products of the tricarboxylic acid cycle (TCA) compared with the control group. HFD aggravated VPA-induced inhibition on lipid and amino acid metabolism. Conclusion: HFD magnifies VPA-induced impairment of mitochondrial β-oxidation of FFAs and TCA, thereby increases hepatic steatosis and hepatotoxicity. The results suggest the patients receiving VPA treatment should be advised to avoid eating HFD. PMID:24442146
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rubin, Benjamin E.; Wetmore, Kelly M.; Price, Morgan N.
Synechococcus elongatus PCC 7942 is a model organism used for studying photosynthesis and the circadian clock, and it is being developed for the production of fuel, industrial chemicals, and pharmaceuticals. To identify a comprehensive set of genes and intergenic regions that impacts fitness in S. elongatus, we created a pooled library of ~250,000 transposon mutants and used sequencing to identify the insertion locations. By analyzing the distribution and survival of these mutants, we identified 718 of the organism's 2,723 genes as essential for survival under laboratory conditions. The validity of the essential gene set is supported by its tight overlapmore » with wellconserved genes and its enrichment for core biological processes. The differences noted between our dataset and these predictors of essentiality, however, have led to surprising biological insights. One such finding is that genes in a large portion of the TCA cycle are dispensable, suggesting that S. elongatus does not require a cyclic TCA process. Furthermore, the density of the transposon mutant library enabled individual and global statements about the essentiality of noncoding RNAs, regulatory elements, and other intergenic regions. In this way, a group I intron located in tRNA Leu , which has been used extensively for phylogenetic studies, was shown here to be essential for the survival of S. elongatus. Our survey of essentiality for every locus in the S. elongatus genome serves as a powerful resource for understanding the organism's physiology and defines the essential gene set required for the growth of a photosynthetic organism.« less
The essential gene set of a photosynthetic organism
Rubin, Benjamin E.; Wetmore, Kelly M.; Price, Morgan N.; ...
2015-10-27
Synechococcus elongatus PCC 7942 is a model organism used for studying photosynthesis and the circadian clock, and it is being developed for the production of fuel, industrial chemicals, and pharmaceuticals. To identify a comprehensive set of genes and intergenic regions that impacts fitness in S. elongatus, we created a pooled library of ~250,000 transposon mutants and used sequencing to identify the insertion locations. By analyzing the distribution and survival of these mutants, we identified 718 of the organism's 2,723 genes as essential for survival under laboratory conditions. The validity of the essential gene set is supported by its tight overlapmore » with wellconserved genes and its enrichment for core biological processes. The differences noted between our dataset and these predictors of essentiality, however, have led to surprising biological insights. One such finding is that genes in a large portion of the TCA cycle are dispensable, suggesting that S. elongatus does not require a cyclic TCA process. Furthermore, the density of the transposon mutant library enabled individual and global statements about the essentiality of noncoding RNAs, regulatory elements, and other intergenic regions. In this way, a group I intron located in tRNA Leu , which has been used extensively for phylogenetic studies, was shown here to be essential for the survival of S. elongatus. Our survey of essentiality for every locus in the S. elongatus genome serves as a powerful resource for understanding the organism's physiology and defines the essential gene set required for the growth of a photosynthetic organism.« less
Marden, James H
2013-12-01
Metabolic enzyme loci were some of the first genes accessible for molecular evolution and ecology research. New technologies now make the whole genome, transcriptome or proteome readily accessible, allowing unbiased scans for loci exhibiting significant differences in allele frequency or expression level and associated with phenotypes and/or responses to natural selection. With surprising frequency and in many cases in proportions greater than chance relative to other genes, glycolysis and TCA cycle enzyme loci appear among the genes with significant associations in these studies. Hence, there is an ongoing need to understand the basis for fitness effects of metabolic enzyme polymorphisms. Allele-specific effects on the binding affinity and catalytic rate of individual enzymes are well known, but often of uncertain significance because metabolic control theory and in vivo studies indicate that many individual metabolic enzymes do not affect pathway flux rate. I review research, so far little used in evolutionary biology, showing that metabolic enzyme substrates affect signalling pathways that regulate cell and organismal biology, and that these enzymes have moonlighting functions. To date there is little knowledge of how alleles in natural populations affect these phenotypes. I discuss an example in which alleles of a TCA enzyme locus associate with differences in a signalling pathway and development, organismal performance, and ecological dynamics. Ultimately, understanding how metabolic enzyme polymorphisms map to phenotypes and fitness remains a compelling and ongoing need for gaining robust knowledge of ecological and evolutionary processes. © 2013 John Wiley & Sons Ltd.
Stark, Romana; Kibbey, Richard G.
2013-01-01
Background Plasma glucose levels are tightly regulated within a narrow physiologic range. Insulin-mediated glucose uptake by tissues must be balanced by the appearance of glucose from nutritional sources, glycogen stores, or gluconeogenesis. In this regard, a common pathway regulating both glucose clearance and appearance has not been described. The metabolism of glucose to produce ATP is generally considered to be the primary stimulus for insulin release from beta-cells. Similarly, gluconeogenesis from phosphoenolpyruvate (PEP) is believed to be the primarily pathway via the cytosolic isoform of phosphoenolpyruvate carboxykinase (PEPCK-C). These models cannot adequately explain the regulation of insulin secretion or gluconeogenesis. Scope of review A metabolic sensing pathway involving mitochondrial GTP (mtGTP) and PEP synthesis by the mitochondrial isoform of PEPCK (PEPCK-M) is associated with glucose-stimulated insulin secretion from pancreatic beta-cells. Here we examine whether there is evidence for a similar mtGTP-dependent pathway involved in gluconeogenesis. In both islets and the liver, mtGTP is produced at the substrate level by the enzyme succinyl CoA synthetase (SCS-GTP) with a rate proportional to the TCA cycle. In the beta-cell PEPCK-M then hydrolyzes mtGTP in the production of PEP that, unlike mtGTP, can escape the mitochondria to generate a signal for insulin release. Similarly, PEPCK-M and mtGTP might also provide a significant source of PEP in gluconeogenic tissues for the production of glucose. This review will focus on the possibility that PEPCK-M, as a sensor for TCA cycle flux, is a key mechanism to regulate both insulin secretion and gluconeogenesis suggesting conservation of this biochemical mechanism in regulating multiple aspects of glucose homeostasis. Moreover, we propose that this mechanism may be more important for regulating insulin secretion and gluconeogenesis compared to canonical nutrient sensing pathways. Major conclusions PEPCK-M, initially believed to be absent in islets, carries a substantial metabolic flux in beta-cells. This flux is intimately involved with the coupling of glucose-stimulated insulin secretion. PEPCK-M activity may have been similarly underestimated in glucose producing tissues and could potentially be an unappreciated but important source of gluconeogenesis. General Significance The generation of PEP via PEPCK-M may occur via a metabolic sensing pathway important for regulating both insulin secretion and gluconeogenesis. PMID:24177027
Jain, Abhishek; Chen, Wei Ning
2018-05-01
Nickel (Ni(II)) toxicity is addressed by many different bacteria, but bacterial responses to nickel stress are still unclear. Therefore, we studied the effect of Ni(II) toxicity on cell proliferation of α-proteobacterium Caulobacter crescentus. Next, we showed the mechanism that allows C. crescentus to survive in Ni(II) stress condition. Our results revealed that the growth of C. crescentus is severely affected when the bacterium was exposed to different Ni(II) concentrations, 0.003 mM slightly affected the growth, 0.008 mM reduced the growth by 50%, and growth was completely inhibited at 0.015 mM. It was further shown that Ni(II) toxicity induced mislocalization of major regulatory proteins such as MipZ, FtsZ, ParB, and MreB, resulting in dysregulation of the cell cycle. GC-MS metabolomics analysis of Ni(II) stressed C. crescentus showed an increased level of nine important metabolites including TCA cycle intermediates and amino acids. This indicates that changes in central carbon metabolism and nitrogen metabolism are linked with the disruption of cell division process. Addition of malic acid, citric acid, alanine, proline, and glutamine to 0.015 mM Ni(II)-treated C. crescentus restored its growth. Thus, the present work shows a protective effect of these organic acids and amino acids on Ni(II) toxicity. Metabolic stimulation through the PutA/GlnA pathway, accelerated degradation of CtrA, and Ni-chelation by organic acids or amino acids are some of the possible mechanisms suggested to be involved in enhancing C. crescentus's tolerance. Our results shed light on the mechanism of increased Ni(II) tolerance in C. crescentus which may be useful in bioremediation strategies and synthetic biology applications such as the development of whole cell biosensor.
Ko, Ying-Hui; Lin, Zhao; Flomenberg, Neal; Pestell, Richard G; Howell, Anthony; Sotgia, Federica
2011-01-01
Glutamine metabolism is crucial for cancer cell growth via the generation of intermediate molecules in the tricarboxylic acid (TCA) cycle, antioxidants and ammonia. The goal of the current study was to evaluate the effects of glutamine on metabolism in the breast cancer tumor microenvironment, with a focus on autophagy and cell death in both epithelial and stromal compartments. For this purpose, MCF7 breast cancer cells were cultured alone or co-cultured with nontransformed fibroblasts in media containing high glutamine and low glucose (glutamine +) or under control conditions, with no glutamine and high glucose (glutamine −). Here, we show that MCF7 cells maintained in co-culture with glutamine display increased mitochondrial mass, as compared with control conditions. Importantly, treatment with the autophagy inhibitor chloroquine abolishes the glutamine-induced augmentation of mitochondrial mass. It is known that loss of caveolin-1 (Cav-1) expression in fibroblasts is associated with increased autophagy and an aggressive tumor microenvironment. Here, we show that Cav-1 downregulation which occurs in fibroblasts maintained in co-culture specifically requires glutamine. Interestingly, glutamine increases the expression of autophagy markers in fibroblasts, but decreases expression of autophagy markers in MCF7 cells, indicating that glutamine regulates the autophagy program in a compartment-specific manner. Functionally, glutamine protects MCF7 cells against apoptosis, via the upregulation of the anti-apoptotic and anti-autophagic protein TIGAR. Also, we show that glutamine cooperates with stromal fibroblasts to confer tamoxifen-resistance in MCF7 cancer cells. Finally, we provide evidence that co-culture with fibroblasts (1) promotes glutamine catabolism, and (2) decreases glutamine synthesis in MCF7 cancer cells. Taken together, our findings suggest that autophagic fibroblasts may serve as a key source of energy-rich glutamine to fuel cancer cell mitochondrial activity, driving a vicious cycle of catabolism in the tumor stroma and anabolic tumor cell expansion. PMID:22236876
DOE Office of Scientific and Technical Information (OSTI.GOV)
Qian, Chen; Hettich, Robert L.
The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less
Qian, Chen; Hettich, Robert L.
2017-05-24
The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less
Acute effect of glucose on cerebral blood flow, blood oxygenation, and oxidative metabolism.
Xu, Feng; Liu, Peiying; Pascual, Juan M; Xiao, Guanghua; Huang, Hao; Lu, Hanzhang
2015-02-01
While it is known that specific nuclei of the brain, for example hypothalamus, contain glucose-sensing neurons thus their activity is affected by blood glucose level, the effect of glucose modulation on whole-brain metabolism is not completely understood. Several recent reports have elucidated the long-term impact of caloric restriction on the brain, showing that animals under caloric restriction had enhanced rate of tricarboxylic acid cycle (TCA) cycle flux accompanied by extended life span. However, acute effect of postprandial blood glucose increase has not been addressed in detail, partly due to a scarcity and complexity of measurement techniques. In this study, using a recently developed noninvasive MR technique, we measured dynamic changes in global cerebral metabolic rate of O2 (CMRO2 ) following a 50 g glucose ingestion (N = 10). A time dependent decrease in CMRO2 was observed, which was accompanied by a reduction in oxygen extraction fraction (OEF) with unaltered cerebral blood flow (CBF). At 40 min post-ingestion, the amount of CMRO2 reduction was 7.8 ± 1.6%. A control study without glucose ingestion was performed (N = 10), which revealed no changes in CMRO2 , CBF, or OEF, suggesting that the observations in the glucose study was not due to subject drowsiness or fatigue after staying inside the scanner. These findings suggest that ingestion of glucose may alter the rate of cerebral metabolism of oxygen in an acute setting. © 2014 Wiley Periodicals, Inc.
Liu, Huihui; Chen, Rui; Wang, Jiyun; Chen, Suming; Xiong, Caiqiao; Wang, Jianing; Hou, Jian; He, Qing; Zhang, Ning; Nie, Zongxiu; Mao, Lanqun
2014-10-21
A sensitive analytical technique for visualizing small endogenous molecules simultaneously is of great significance for clearly elucidating metabolic mechanisms during pathological progression. In the present study, 1,5-naphthalenediamine (1,5-DAN) hydrochloride was prepared for matrix-assisted laser desorption/ionization (MALDI) mass spectrometry imaging (MSI) of small molecules in liver, brain, and kidneys from mice. Furthermore, 1,5-DAN hydrochloride assisted LDI MSI of small molecules in brain tissue of rats subjected to middle cerebral artery occlusion (MCAO) was carried out to investigate the altered metabolic pathways and mechanisms underlying the development of ischemic brain damage. Our results suggested that the newly prepared matrix possessed brilliant features including low cost, strong ultraviolet absorption, high salt tolerance capacity, and fewer background signals especially in the low mass range (typically m/z < 500), which permitted us to visualize the spatial distribution of a broad range of small molecule metabolites including metal ions, amino acids, carboxylic acids, nucleotide derivatives, peptide, and lipids simultaneously. Nineteen endogenous metabolites involved in metabolic networks such as ATP metabolism, tricarboxylic acid (TCA) cycle, glutamate-glutamine cycle, and malate-aspartate shuttle, together with metal ions and phospholipids as well as antioxidants underwent relatively obvious changes after 24 h of MCAO. The results were highly consistent with the data obtained by MRM MS analysis. These findings highlighted the promising potential of the organic salt matrix for application in the field of biomedical research.
Visual gene-network analysis reveals the cancer gene co-expression in human endometrial cancer
2014-01-01
Background Endometrial cancers (ECs) are the most common form of gynecologic malignancy. Recent studies have reported that ECs reveal distinct markers for molecular pathogenesis, which in turn is linked to the various histological types of ECs. To understand further the molecular events contributing to ECs and endometrial tumorigenesis in general, a more precise identification of cancer-associated molecules and signaling networks would be useful for the detection and monitoring of malignancy, improving clinical cancer therapy, and personalization of treatments. Results ECs-specific gene co-expression networks were constructed by differential expression analysis and weighted gene co-expression network analysis (WGCNA). Important pathways and putative cancer hub genes contribution to tumorigenesis of ECs were identified. An elastic-net regularized classification model was built using the cancer hub gene signatures to predict the phenotypic characteristics of ECs. The 19 cancer hub gene signatures had high predictive power to distinguish among three key principal features of ECs: grade, type, and stage. Intriguingly, these hub gene networks seem to contribute to ECs progression and malignancy via cell-cycle regulation, antigen processing and the citric acid (TCA) cycle. Conclusions The results of this study provide a powerful biomarker discovery platform to better understand the progression of ECs and to uncover potential therapeutic targets in the treatment of ECs. This information might lead to improved monitoring of ECs and resulting improvement of treatment of ECs, the 4th most common of cancer in women. PMID:24758163
Sun, Qing-Lei; Zeng, Zhi-Gang; Chen, Shuai; Sun, Li
2016-01-01
Alvinocaris longirostris is a species of shrimp existing in the hydrothermal fields of Okinawa Trough. To date the structure and function of the microbial community associated with A. longirostris are essentially unknown. In this study, by employment of the techniques of high through-put sequencing and clone library construction and analysis, we compared for the first time the community structures and metabolic profiles of microbes associated with the gill and gut of A. longirostris in a hydrothermal field of Okinawa Trough. Fourteen phyla were detected in the gill and gut communities, of which 11 phyla were shared by both tissues. Proteobacteria made up a substantial proportion in both tissues, while Firmicutes was abundant only in gut. Although gill and gut communities were similar in bacterial diversities, the bacterial community structures in these two tissues were significantly different. Further, we discovered for the first time the existence in the gill and gut communities of A. longirostris the genes (cbbM and aclB) encoding the key enzymes of Calvin-Benson-Bassham (CBB) cycle and the reductive tricarboxylic acid (rTCA) cycle, and that both cbbM and aclB were significantly more abundant in gill than in gut. Taken together, these results provide the first evidence that at least two carbon fixation pathways are present in both the gill and the gut communities of A. longirostris, and that the communities in different tissues likely differ in autotrophic productivity.
Zhao, Yunxia; Hou, Ye; Zhao, Changzhi; Liu, Fei; Luan, Yu; Jing, Lu; Li, Xinyun; Zhu, Mengjin; Zhao, Shuhong
2016-01-01
Cis-natural antisense transcripts (cis-NATs) are a new class of RNAs identified in various species. However, the biological functions of cis-NATs are largely unknown. In this study, we investigated the transcriptional characteristics and functions of cis-NATs in the muscle tissue of lean Landrace and indigenous fatty Lantang pigs. In total, 3,306 cis-NATs of 2,469 annotated genes were identified in the muscle tissue of pigs. More than 1,300 cis-NATs correlated with their sense genes at the transcriptional level, and approximately 80% of them were co-expressed in the two breeds. Furthermore, over 1,200 differentially expressed cis-NATs were identified during muscle development. Function annotation showed that the cis-NATs participated in muscle development mainly by co-expressing with genes involved in energy metabolic pathways, including citrate cycle (TCA cycle), glycolysis or gluconeogenesis, mitochondrial activation and so on. Moreover, these cis-NATs and their sense genes abruptly increased at the transition from the late fetal stages to the early postnatal stages and then decreased along with muscle development. In conclusion, the cis-NATs in the muscle tissue of pigs were identified and determined to be mainly co-expressed with their sense genes. The co-expressed cis-NATs and their sense gene were primarily related to energy metabolic pathways during muscle development in pigs. Our results offered novel evidence on the roles of cis-NATs during the muscle development of pigs.
Metabolism of [U-13C]glucose in Human Brain Tumors In Vivo
Maher, Elizabeth A.; Marin-Valencia, Isaac; Bachoo, Robert M.; Mashimo, Tomoyuki; Raisanen, Jack; Hatanpaa, Kimmo J.; Jindal, Ashish; Jeffrey, F. Mark; Choi, Changho; Madden, Christopher; Mathews, Dana; Pascual, Juan M.; Mickey, Bruce E.; Malloy, Craig R.; DeBerardinis, Ralph J.
2012-01-01
Glioblastomas (GBMs) and brain metastases demonstrate avid uptake of 18fluoro-2-deoxyglucose (FDG) by positron emission tomography (PET) and display perturbations of intracellular metabolite pools by 1H magnetic resonance spectroscopy (MRS). These observations suggest that metabolic reprogramming contributes to brain tumor growth in vivo. The Warburg effect, excess metabolism of glucose to lactate in the presence of oxygen, is a hallmark of cancer cells in culture. FDG-positive tumors are assumed to metabolize glucose in a similar manner, with high rates of lactate formation compared to mitochondrial glucose oxidation, but few studies have specifically examined the metabolic fates of glucose in vivo. In particular, the capacity of human brain malignancies to oxidize glucose in the tricarboxylic acid cycle is unknown. Here we studied the metabolism of human brain tumors in situ. [U-13C]glucose was infused during surgical resection, and tumor samples were subsequently subjected to 13C NMR spectroscopy. Analysis of tumor metabolites revealed lactate production, as expected. We also determined that pyruvate dehydrogenase, turnover of the TCA cycle, anaplerosis and de novo glutamine and glycine synthesis contributed significantly to the ultimate disposition of glucose carbon. Surprisingly, less than 50% of the acetyl-CoA pool was derived from blood-borne glucose, suggesting that additional substrates contribute to tumor bioenergetics. This study illustrates a convenient approach that capitalizes on the high information content of 13C NMR spectroscopy and enables the analysis of intermediary metabolism in diverse malignancies growing in their native microenvironment. PMID:22419606
Noguerola, Imma; Picazo, Antonio; Llirós, Marc; Camacho, Antonio; Borrego, Carles M
2015-07-01
Sulfidic redoxclines are a suitable niche for the growth and activity of different chemo- and photolithotrophic sulphide-oxidizing microbial groups such as the Epsilonproteobacteria and the green sulfur bacteria (GSB). We have investigated the diversity, abundance and contribution to inorganic carbon uptake of Epsilonproteobacteria in a meromictic basin of Lake Banyoles. CARD-FISH counts revealed that Epsilonproteobacteria were prevalent at the redoxcline in winter (maximum abundance of 2 × 10(6) cells mL(-1), ≈60% of total cells) but they were nearly absent in summer, when GSB bloomed. This seasonal trend was supported by 16S rRNA gene pyrotag datasets, which revealed that the epsilonproteobacterial community was mainly composed of a member of the genus Arcobacter. In situ incubations using NaH(14)CO3 and MAR-CARD-FISH observations showed that this population assimilated CO2 in the dark, likely being mainly responsible for the autotrophic activity at the redoxcline in winter. Clone libraries targeting the aclB gene provided additional evidence of the potential capacity of these epsilonproteobacteria to fix carbon via rTCA cycle. Our data reinforce the key role of Epsilonproteobacteria in linking carbon and sulphur cycles, extend their influence to freshwater karstic lakes and raise questions about the actual contribution of chemolithotrophy at their redoxcline and euxinic water compartments. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Bekele, Elias A; Beshir, Wasiye F; Hertog, Maarten L A T M; Nicolai, Bart M; Geeraerd, Annemie H
2015-11-01
Apples are predominantly stored in controlled atmosphere (CA) storage to delay ripening and prolong their storage life. Profiling the dynamics of metabolic changes during ripening and CA storage is vital for understanding the governing molecular mechanism. In this study, the dynamics of the primary metabolism of 'Jonagold' apples during ripening in regular air (RA) storage and initiation of CA storage was profiled. 1-Methylcyclopropene (1-MCP) was exploited to block ethylene receptors and to get insight into ethylene mediated metabolic changes during ripening of the fruit and in response to hypoxic stress. Metabolic changes were quantified in glycolysis, the tricarboxylic acid (TCA) cycle, the Yang cycle and synthesis of the main amino acids branching from these metabolic pathways. Partial least square discriminant analysis of the metabolic profiles of 1-MCP treated and control apples revealed a metabolic divergence in ethylene, organic acid, sugar and amino acid metabolism. During RA storage at 18°C, most amino acids were higher in 1-MCP treated apples, whereas 1-aminocyclopropane-1-carboxylic acid (ACC) was higher in the control apples. The initial response of the fruit to CA initiation was accompanied by an increase of alanine, succinate and glutamate, but a decline in aspartate. Furthermore, alanine and succinate accumulated to higher levels in control apples than 1-MCP treated apples. The observed metabolic changes in these interlinked metabolites may indicate a coordinated adaptive strategy to maximize energy production. © 2015 Scandinavian Plant Physiology Society.
Chen, Liwei; Lee, Jaslyn Jie Lin; Zhang, Jianhua; Chen, Wei Ning
2016-02-01
The engineered Saccharomyces cerevisiae strain △faa1△faa4 [Acot5s] was demonstrated to accumulate more free fatty acids (FFA) previously. Here, comparative proteomic analysis was performed to get a global overview of metabolic regulation in the strain. Over 500 proteins were identified, and 82 of those proteins were found to change significantly in the engineered strains. Proteins involved in glycolysis, acetate metabolism, fatty acid synthesis, TCA cycle, glyoxylate cycle, the pentose phosphate pathway, respiration, transportation, and stress response were found to be upregulated in △faa1△faa4 [Acot5s] as compared to the wild type. On the other hand, proteins involved in glycerol, ethanol, ergosterol, and cell wall synthesis were downregulated. Taken together with our metabolite analysis, our results showed that the disruption of Faa1 and Faa4 and expression of Acot5s in the engineered strain △faa1△faa4 [Acot5s] not only relieved the feedback inhibition of fatty acyl-CoAs on fatty acid synthesis, but also caused a major metabolic rearrangement. The rearrangement redirected carbon flux toward the pathways which generate the essential substrates and cofactors for fatty acid synthesis, such as acetyl-CoA, ATP, and NADPH. Therefore, our results help shed light on the mechanism for the increased production of fatty acids in the engineered strains, which is useful in providing information for future studies in biofuel production.
Du, Chunlei; Zhang, Bo; He, Yiliang; Hu, Chaoyang; Ng, Qin Xiang; Zhang, Hui; Ong, Choon Nam; ZhifenLin
2017-02-15
This work evaluated biological effect of nC 60 on Scenedesmus obliquus. The cells were exposed to various concentrations of nC 60 for 7days. Low-dose of nC 60 was found to have a minor growth inhibitory effect. The transcriptomics and metabolomics were integrated to examine intricate molecular and cellular effects of nC 60 on Scenedesmus obliquus. We found that Scenedesmus obliquus cells exposed to nC 60 had several significant alterations in cellular transcription and biochemical processes. During the 7-day exposure to nC 60 , 2234 and 2,448 unigenes were differentially expressed by 0.1mg/L and 1mg/L nC 60 -treated groups compared with the control, including 2085 or 2247 up-regulated genes and 149 or 201 down-regulated genes, respectively. We successfully identified 22 metabolites, including 6 significantly changed metabolites, such as sucrose, d-glucose, and malic acid. The citrate cycle (TCA cycle) (ko00020) was the main target of both differentially expressed genes and metabolic change. However, accumulation of sucrose (end-product) could have induced feedback inhibition of photosynthesis in Scenedesmus obliquus, explaining the slight growth inhibition observed. The results provided a mechanistic understanding of the growth inhibition of nC 60 toxicity. These genes and metabolites are useful biomarkers for future studies and offer new insights into the early detectable changes in Scenedesmus obliquus with nC 60 exposure. Copyright © 2016 Elsevier B.V. All rights reserved.
The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo
Chowdhury, Golam MI; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L
2014-01-01
The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-13C2]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (VacCoA-kbN) and pyruvate (VpdhN), and the glutamate-glutamine cycle (Vcyc) were determined by metabolic modeling of 13C label trapped in major brain amino acid pools. VacCoA-kbN increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (VtcaN), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons. PMID:24780902
Hernández-Alonso, Pablo; Cañueto, Daniel; Giardina, Simona; Salas-Salvadó, Jordi; Cañellas, Nicolau; Correig, Xavier; Bulló, Mònica
2017-07-01
The specific nutritional composition of nuts could affect different metabolic pathways involved in a broad range of metabolic diseases. We therefore investigated whether chronic consumption of pistachio nuts modifies the urine metabolome in prediabetic subjects. We designed a randomized crossover clinical trial in 39 prediabetic subjects. They consumed a pistachio-supplemented diet (PD, 50% carbohydrates, 33% fat, including 57 g/d of pistachios daily) and a control diet (CD, 55% carbohydrates, 30% fat) for 4 months each, separated by a 2-week wash-out. Nuclear magnetic resonance (NRM) was performed to determine changes in 24-h urine metabolites. Significant changes in urine metabolites according to the different intervention periods were found in uni- and multivariate analysis. Score plot of the first two components of the multilevel partial least squares discriminant analysis (ML-PLS-DA) showed a clear separation of the intervention periods. Three metabolites related with gut microbiota metabolism (i.e., hippurate, p-cresol sulfate and dimethylamine) were found decreased in PD compared with CD (P<.05). Moreover, cis-aconitate [intermediate of the tricarboxylic acid (TCA)] was also found decreased following PD compared with CD. Intragroup analysis showed that creatinine levels were significantly increased in PD (P=.023), whereas trimethylamine N-oxide (TMAO) was found significantly reduced following PD (P=.034). Our results suggest that chronic pistachio consumption may modulate some urinary metabolites related to gut microbiota metabolism and the TCA cycle; all associated with metabolic derangements associated with insulin resistance and Type 2 diabetes. Copyright © 2017 Elsevier Inc. All rights reserved.
Feizi, Sepehr; Delfazayebaher, Siamak; Ownagh, Vahid; Sadeghpour, Fatemeh
To evaluate the agreement between total corneal astigmatism calculated by vector summation of anterior and posterior corneal astigmatism (TCA Vec ) and total corneal astigmatism measured by ray tracing (TCA Ray ). This study enrolled a total of 204 right eyes of 204 normal subjects. The eyes were measured using a Galilei double Scheimpflug analyzer. The measured parameters included simulated keratometric astigmatism using the keratometric index, anterior corneal astigmatism using the corneal refractive index, posterior corneal astigmatism, and TCA Ray . TCA Vec was derived by vector summation of the astigmatism on the anterior and posterior corneal surfaces. The magnitudes and axes of TCA Vec and TCA Ray were compared. The Pearson correlation coefficient and Bland-Altman plots were used to assess the relationship and agreement between TCA Vec and TCA Ray , respectively. The mean TCA Vec and TCA Ray magnitudes were 0.76±0.57D and 1.00±0.78D, respectively (P<0.001). The mean axis orientations were 85.12±30.26° and 89.67±36.76°, respectively (P=0.02). Strong correlations were found between the TCA Vec and TCA Ray magnitudes (r=0.96, P<0.001). Moderate associations were observed between the TCA Vec and TCA Ray axes (r=0.75, P<0.001). Bland-Altman plots produced the 95% limits of agreement for the TCA Vec and TCA Ray magnitudes from -0.33 to 0.82D. The 95% limits of agreement between the TCA Vec and TCA Ray axes was -43.0 to 52.1°. The magnitudes and axes of astigmatisms measured by the vector summation and ray tracing methods cannot be used interchangeably. There was a systematic error between the TCA Vec and TCA Ray magnitudes. Copyright © 2017 Spanish General Council of Optometry. Published by Elsevier España, S.L.U. All rights reserved.
NASA Technical Reports Server (NTRS)
Frakes, P.
2016-01-01
Question was raised: are we seeing more late-notice events in recent months? Two definitions oflate-notice used to compare data: Event has at least one data point between TCA-4 days and TCA-2 days where the Pcwas below 1E-7, OR there were no data points in that timeframe. Event has at least one data point between TCA-2days and TCA where the Pc was at least 1E-4Event has at least one data point between TCA-4 days and TCA-2 dayswhere the Pc was below 1E-5, OR there were no data points in that timeframe. Event has at least one data pointbetween TCA-2 days and TCA where the Pc was at least 1E-4. The case studies that were examined all fall within criteriafor both definitions Terra vs 38192; TCA 24 JUN 2015Aura vs 89477; TCA 29 AUG 2015Terra vs 37131; TCA 19 DEC2015GPM vs 28685; TCA 5 SEP 2015.
Zhang, Limin; Wang, Yulan; Xu, Yunxiang; Lei, Hehua; Zhao, Ying; Li, Huihui; Lin, Xiaosheng; Chen, Guizhen; Tang, Huiru
2014-01-01
Acupoint stimulations are effective in ameliorating symptoms of menopause which is an unavoidable ageing consequence for women. To understand the mechanistic aspects of such treatments, we systematically analyzed the effects of acupoint laser-irradiation and catgut-embedding on the ovariectomy-induced rat metabolic changes using NMR and GC-FID/MS methods. Results showed that ovariectomization (OVX) caused comprehensive metabolic changes in lipid peroxidation, glycolysis, TCA cycle, choline and amino acid metabolisms. Both acupoint laser-irradiation and catgut-embedding ameliorated the OVX-caused metabonomic changes more effectively than hormone replacement therapy (HRT) with nilestriol. Such effects of acupoint stimulations were highlighted in alleviating lipid peroxidation, restoring glucose homeostasis and partial reversion of the OVX-altered amino acid metabolism. These findings provided new insights into the menopause effects on mammalian biochemistry and beneficial effects of acupoint stimulations in comparison with HRT, demonstrating metabonomics as a powerful approach for potential applications in disease prognosis and developments of effective therapies. PMID:24407431
NADPH-generating systems in bacteria and archaea
Spaans, Sebastiaan K.; Weusthuis, Ruud A.; van der Oost, John; Kengen, Servé W. M.
2015-01-01
Reduced nicotinamide adenine dinucleotide phosphate (NADPH) is an essential electron donor in all organisms. It provides the reducing power that drives numerous anabolic reactions, including those responsible for the biosynthesis of all major cell components and many products in biotechnology. The efficient synthesis of many of these products, however, is limited by the rate of NADPH regeneration. Hence, a thorough understanding of the reactions involved in the generation of NADPH is required to increase its turnover through rational strain improvement. Traditionally, the main engineering targets for increasing NADPH availability have included the dehydrogenase reactions of the oxidative pentose phosphate pathway and the isocitrate dehydrogenase step of the tricarboxylic acid (TCA) cycle. However, the importance of alternative NADPH-generating reactions has recently become evident. In the current review, the major canonical and non-canonical reactions involved in the production and regeneration of NADPH in prokaryotes are described, and their key enzymes are discussed. In addition, an overview of how different enzymes have been applied to increase NADPH availability and thereby enhance productivity is provided. PMID:26284036
Gibson, Gary E.; Karuppagounder, Saravanan S.; Shi, Qingli
2009-01-01
Considerable data supports the hypothesis that mitochondrial abnormalities link gene defects and/or environmental insults to the neurodegenerative process The interaction of oxidants with calcium and the mitochondrial enzymes of the tricarboxylic acid (TCA) cycle are central to that relationship. Abnormalities that were discovered in brains or fibroblasts from patients with Alzheimer's Disease (AD) have been modeled in vitro and in vivo to assess their pathophysiological importance and to determine how they might be reversed. The conclusions are consistent with the hypothesis that the AD-related abnormalities result from oxidative stress. The selection of compounds for reversal is complex because the actions of the relevant compounds vary under different conditions such as cell redox states and acute vs chronic changes. However, the models that have been developed are useful for testing the effectiveness of the potential medications. The results suggest that the reversal of the mitochondrial deficits and a reduction in oxidative stress will reduce the clinical and pathological changes and benefit patients. PMID:19076444
A medium-chain fatty acid as an alternative energy source in mouse preimplantation development.
Yamada, Mitsutoshi; Takanashi, Kazumi; Hamatani, Toshio; Hirayama, Akiyoshi; Akutsu, Hidenori; Fukunaga, Tomoko; Ogawa, Seiji; Sugawara, Kana; Shinoda, Kosaku; Soga, Tomoyoshi; Umezawa, Akihiro; Kuji, Naoaki; Yoshimura, Yasunori; Tomita, Masaru
2012-01-01
To further optimize the culturing of preimplantation embryos, we undertook metabolomic analysis of relevant culture media using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS). We detected 28 metabolites: 23 embryo-excreted metabolites including 16 amino acids and 5 media-derived metabolites (e.g., octanoate, a medium-chain fatty acid (MCFA)). Due to the lack of information on MCFAs in mammalian preimplantation development, this study examined octanoate as a potential alternative energy source for preimplantation embryo cultures. No embryos survived in culture media lacking FAs, pyruvate, and glucose, but supplementation of octanoate rescued the embryonic development. Immunoblotting showed significant expression of acyl-CoA dehydrogenase and hydroxyacyl-CoA dehydrogenase, important enzymes for ß-oxidation of MCFAs, in preimplantation embryo. Furthermore, CE-TOFMS traced [1-(13)C(8)] octanoate added to the culture media into intermediate metabolites of the TCA cycle via ß-oxidation in mitochondria. These results are the first demonstration that octanoate could provide an efficient alternative energy source throughout preimplantation development.
Feng, Yuan Z; Nikolić, Nataša; Bakke, Siril S; Boekschoten, Mark V; Kersten, Sander; Kase, Eili T; Rustan, Arild C; Thoresen, G Hege
2014-02-01
The role of peroxisome proliferator-activated receptor δ (PPARδ) activation on global gene expression and mitochondrial fuel utilization were investigated in human myotubes. Only 21 genes were up-regulated and 3 genes were down-regulated after activation by the PPARδ agonist GW501516. Pathway analysis showed up-regulated mitochondrial fatty acid oxidation, TCA cycle and cholesterol biosynthesis. GW501516 increased oleic acid oxidation and mitochondrial oxidative capacity by 2-fold. Glucose uptake and oxidation were reduced, but total substrate oxidation was not affected, indicating a fuel switch from glucose to fatty acid. Cholesterol biosynthesis was increased, but lipid biosynthesis and mitochondrial content were not affected. This study confirmed that the principal effect of PPARδ activation was to increase mitochondrial fatty acid oxidative capacity. Our results further suggest that PPARδ activation reduced glucose utilization through a switch in mitochondrial substrate preference by up-regulating pyruvate dehydrogenase kinase isozyme 4 and genes involved in lipid metabolism and fatty acid oxidation.
Hashimoto, Wataru; Kawai, Shigeyuki; Murata, Kousaku
2010-01-01
Distinct from most alginate-assimilating bacteria that secrete polysaccharide lyases extracellularly, a gram-negative bacterium, Sphingomonas sp. A1 (strain A1), can directly incorporate alginate into its cytoplasm, without degradation, through a "superchannel" consisting of a mouth-like pit on the cell surface, periplasmic binding proteins, and a cytoplasmic membrane-bound ATP-binding cassette transporter. Flagellin homologues function as cell surface alginate receptors essential for expressing the superchannel. Cytoplasmic alginate lyases with different substrate specificities and action modes degrade the polysaccharide to its constituent monosaccharides. The resultant monosaccharides, α-keto acids, are converted to a reduced form by NADPH-dependent reductase, and are finally metabolized in the TCA cycle. Transplantation of the strain A1 superchannel to xenobiotic-degrading sphingomonads enhances bioremediation through the propagation of bacteria with an elevated transport activity. Furthermore, strain A1 cells transformed with Zymomonas mobilis genes for pyruvate decarboxylase and alcohol dehydrogenase II produce considerable amounts of biofuel ethanol from alginate when grown statically. © 2010 Landes Bioscience
Exogenous alanine and/or glucose plus kanamycin kills antibiotic-resistant bacteria.
Peng, Bo; Su, Yu-Bin; Li, Hui; Han, Yi; Guo, Chang; Tian, Yao-Mei; Peng, Xuan-Xian
2015-02-03
Multidrug-resistant bacteria are an increasingly serious threat to human and animal health. However, novel drugs that can manage infections by multidrug-resistant bacteria have proved elusive. Here we show that glucose and alanine abundances are greatly suppressed in kanamycin-resistant Edwardsiella tarda by GC-MS-based metabolomics. Exogenous alanine or glucose restores susceptibility of multidrug-resistant E. tarda to killing by kanamycin, demonstrating an approach to killing multidrug-resistant bacteria. The mechanism underlying this approach is that exogenous glucose or alanine promotes the TCA cycle by substrate activation, which in turn increases production of NADH and proton motive force and stimulates uptake of antibiotic. Similar results are obtained with other Gram-negative bacteria (Vibrio parahaemolyticus, Klebsiella pneumoniae, Pseudomonas aeruginosa) and Gram-positive bacterium (Staphylococcus aureus), and the results are also reproduced in a mouse model for urinary tract infection. This study establishes a functional metabolomics-based strategy to manage infection by antibiotic-resistant bacteria. Copyright © 2015 Elsevier Inc. All rights reserved.
Overcoming substrate limitations for improved production of ethylene in E. coli
Lynch, Sean; Eckert, Carrie; Yu, Jianping; ...
2016-01-04
Ethylene is an important industrial compound for the production of a wide variety of plastics and chemicals. At present, ethylene production involves steam cracking of a fossil-based feedstock, representing the highest CO 2-emitting process in the chemical industry. Biological ethylene production can be achieved via expression of a single protein, the ethylene-forming enzyme (EFE), found in some bacteria and fungi; it has the potential to provide a sustainable alternative to steam cracking, provided that significant increases in productivity can be achieved. A key barrier is determining factors that influence the availability of substrates for the EFE reaction in potential microbialmore » hosts. In the presence of O 2, EFE catalyzes ethylene formation from the substrates α-ketoglutarate (AKG) and arginine. The concentrations of AKG, a key TCA cycle intermediate, and arginine are tightly controlled by an intricate regulatory system that coordinates carbon and nitrogen metabolism. Thus, reliably predicting which genetic changes will ultimately lead to increased AKG and arginine availability is challenging.« less
Liu, Xiaoliu; Zhu, Ping; Jiang, Ruifan; Wu, Lingtian; Feng, Xiaohai; Li, Sha; Xu, Hong
2017-01-20
Welan gum is a microbial polysaccharide produced by Sphingomonas sp. Its production is limited by the dissolved oxygen levels in the highly viscous fermentation. A strategy of heterologous expression of the Vitreoscilla hemoglobin gene in Sphingomonas sp. HT-1 was investigated to alleviate oxygen limitation and improve the yield of welan gum. Ultimately, the welan gum production increased from 25.3g/L to 34.6g/L, whereas the rheological behavior of welan gum solutions remained virtually unchanged. The transcriptional levels of the key genes in the electron transfer chain, TCA cycle and welan gum synthesis pathway, as well as ATP level revealed that the VHb expression in Sphingomonas sp. HT-1 enhanced welan gum biosynthesis by improving respiration and ATP supply. This study would pave the genetic manipulation way for enhancing welan gum yield, and it's also of great importance for the industrial applications of welan gum under harsh conditions. Copyright © 2016 Elsevier Ltd. All rights reserved.
Newborn Urinary Metabolic Signatures of Prematurity and Other Disorders: A Case Control Study.
Diaz, Sílvia O; Pinto, Joana; Barros, António S; Morais, Elisabete; Duarte, Daniela; Negrão, Fátima; Pita, Cristina; Almeida, Maria do Céu; Carreira, Isabel M; Spraul, Manfred; Gil, Ana M
2016-01-04
This work assesses the urinary metabolite signature of prematurity in newborns by nuclear magnetic resonance (NMR) spectroscopy, while establishing the role of possible confounders and signature specificity, through comparison to other disorders. Gender and delivery mode are shown to impact importantly on newborn urine composition, their analysis pointing out at specific metabolite variations requiring consideration in unmatched subject groups. Premature newborns are, however, characterized by a stronger signature of varying metabolites, suggestive of disturbances in nucleotide metabolism, lung surfactants biosynthesis and renal function, along with enhancement of tricarboxylic acid (TCA) cycle activity, fatty acids oxidation, and oxidative stress. Comparison with other abnormal conditions (respiratory depression episode, large for gestational age, malformations, jaundice and premature rupture of membranes) reveals that such signature seems to be largely specific of preterm newborns, showing that NMR metabolomics can retrieve particular disorder effects, as well as general stress effects. These results provide valuable novel information on the metabolic impact of prematurity, contributing to the better understanding of its effects on the newborn's state of health.
Bradfield, Michael F A; Nicol, Willie
2016-11-01
Increased pentose phosphate pathway flux, relative to total substrate uptake flux, is shown to enhance succinic acid (SA) yields under continuous, non-growth conditions of Actinobacillus succinogenes biofilms. Separate fermentations of glucose and xylose were conducted in a custom, continuous biofilm reactor at four different dilution rates. Glucose-6-phosphate dehydrogenase assays were performed on cell extracts derived from in situ removal of biofilm at each steady state. The results of the assays were coupled to a kinetic model that revealed an increase in oxidative pentose phosphate pathway (OPPP) flux relative to total substrate flux with increasing SA titre, for both substrates. Furthermore, applying metabolite concentration data to metabolic flux models that include the OPPP revealed similar flux relationships to those observed in the experimental kinetic analysis. A relative increase in OPPP flux produces additional reduction power that enables increased flux through the reductive branch of the TCA cycle, leading to increased SA yields, reduced by-product formation and complete closure of the overall redox balance.
The First Complete Genome Sequence of the Class Fimbriimonadia in the Phylum Armatimonadetes
Im, Wan-Taek; Wang, Sheng-Yue; Zhao, Guo-Ping; Zheng, Hua-Jun; Quan, Zhe-Xue
2014-01-01
In this study, we present the complete genome of Fimbriimonas ginsengisoli Gsoil 348T belonging to the class Fimbriimonadia of the phylum Armatimonadetes, formerly called as candidate phylum OP10. The complete genome contains a single circular chromosome of 5.23 Mb including a 45.5 kb prophage. Of the 4820 open reading frames (ORFs), 3,000 (62.2%) genes could be classified into Clusters of Orthologous Groups (COG) families. With the split of rRNA genes, strain Gsoil 348T had no typical 16S-23S-5S ribosomal RNA operon. In this genome, the GC skew inversion which was usually observed in archaea was found. The predicted gene functions suggest that the organism lacks the ability to synthesize histidine, and the TCA cycle is incomplete. Phylogenetic analyses based on ribosomal proteins indicated that strain Gsoil 348T represents a deeply branching lineage of sufficient divergence with other phyla, but also strongly involved in superphylum Terrabacteria. PMID:24967843
NASA Astrophysics Data System (ADS)
Zhang, Limin; Wang, Yulan; Xu, Yunxiang; Lei, Hehua; Zhao, Ying; Li, Huihui; Lin, Xiaosheng; Chen, Guizhen; Tang, Huiru
2014-01-01
Acupoint stimulations are effective in ameliorating symptoms of menopause which is an unavoidable ageing consequence for women. To understand the mechanistic aspects of such treatments, we systematically analyzed the effects of acupoint laser-irradiation and catgut-embedding on the ovariectomy-induced rat metabolic changes using NMR and GC-FID/MS methods. Results showed that ovariectomization (OVX) caused comprehensive metabolic changes in lipid peroxidation, glycolysis, TCA cycle, choline and amino acid metabolisms. Both acupoint laser-irradiation and catgut-embedding ameliorated the OVX-caused metabonomic changes more effectively than hormone replacement therapy (HRT) with nilestriol. Such effects of acupoint stimulations were highlighted in alleviating lipid peroxidation, restoring glucose homeostasis and partial reversion of the OVX-altered amino acid metabolism. These findings provided new insights into the menopause effects on mammalian biochemistry and beneficial effects of acupoint stimulations in comparison with HRT, demonstrating metabonomics as a powerful approach for potential applications in disease prognosis and developments of effective therapies.
Sheng, Ling; Shen, Dandan; Yang, Wei; Zhang, Mingfei; Zeng, Yunliu; Xu, Juan; Deng, Xiuxin; Cheng, Yunjiang
2017-03-01
Organic acids are a major index of fresh fruit marketing properties. However, the genetic effects on the organic acid level in postharvest citrus fruit still remain unknown. Here, we used the fruits of about 40 lines in a hybrid population (high-acid "HB Pumelo" × low-acid "Fairchild") to analyze the organic acid metabolism of postharvest citrus fruit. A transgressive content of titratable acid (TA) was observed, which was attributed to citrate accumulation. High- and low-acid fruits (No. 130, 168 and No. 080, 181, respectively) were chosen for further study. Gene expression analysis on citrate metabolism showed that the high accumulation of citrate could be attributed to the low activity of γ-aminobutyric acid (GABA) shunt, and was partially due to the block of tricarboxylic acid (TCA) cycle by low mitochondrial aconitase (m-ACO) expression. TA level was significantly negatively correlated with weight loss in fruits during postharvest storage, implying a close relationship between organic acid and water metabolism.
Schryer, David W; Peterson, Pearu; Paalme, Toomas; Vendelin, Marko
2009-04-17
Isotope labeling is one of the few methods of revealing the in vivo bidirectionality and compartmentalization of metabolic fluxes within metabolic networks. We argue that a shift from steady state to dynamic isotopomer analysis is required to deal with these cellular complexities and provide a review of dynamic studies of compartmentalized energy fluxes in eukaryotic cells including cardiac muscle, plants, and astrocytes. Knowledge of complex metabolic behaviour on a molecular level is prerequisite for the intelligent design of genetically modified organisms able to realize their potential of revolutionizing food, energy, and pharmaceutical production. We describe techniques to explore the bidirectionality and compartmentalization of metabolic fluxes using information contained in the isotopic transient, and discuss the integration of kinetic models with MFA. The flux parameters of an example metabolic network were optimized to examine the compartmentalization of metabolites and and the bidirectionality of fluxes in the TCA cycle of Saccharomyces uvarum for steady-state respiratory growth.
Neuroprotection of ebselen against ischemia/reperfusion injury involves GABA shunt enzymes.
Seo, Jeong Yeol; Lee, Choong Hyun; Cho, Jun Hwi; Choi, Jung Hoon; Yoo, Ki-Yeon; Kim, Dae Won; Park, Ok Kyu; Li, Hua; Choi, Soo Young; Hwang, In Koo; Won, Moo-Ho
2009-10-15
Seleno-organic compound, ebselen (2-phenyl-1,2-benzisoselenazol-3(2H)-one), is a substrate with radical-scavenging activity. In this study, we observed the neuroprotective effects of ebselen against ischemic damage and on GABA shunt enzymes such as glutamic acid decarboxylase 67 (GAD67), GABA transaminse (GABA-T) and succinic semialdehyde dehydrogenase (SSADH) in the hippocampal CA1 region after 5 min of transient forebrain ischemia in gerbils. For this, vehicle (physiological saline) or ebselen was administered 30 min before or after ischemia/reperfusion and sacrificed 4 days after ischemia/reperfusion. The administration of ebselen significantly reduced the neuronal death in the CA1 region induced by ischemia/reperfusion. In addition, treatment with ebselen markedly elevated GAD67, GABA-T and SSADH immunoreactivity and their protein levels compared to that in the vehicle-treated group, respectively. These results suggest that ebselen protects neurons from ischemic damage via control of the expressions of GABA shunt enzymes to enter the TCA cycle.
Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael
2012-09-01
The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis.
Life and Death of Proteins: A Case Study of Glucose-starved Staphylococcus aureus*
Michalik, Stephan; Bernhardt, Jörg; Otto, Andreas; Moche, Martin; Becher, Dörte; Meyer, Hanna; Lalk, Michael; Schurmann, Claudia; Schlüter, Rabea; Kock, Holger; Gerth, Ulf; Hecker, Michael
2012-01-01
The cellular amount of proteins not only depends on synthesis but also on degradation. Here, we expand the understanding of differential protein levels by complementing synthesis data with a proteome-wide, mass spectrometry-based stable isotope labeling with amino acids in cell culture analysis of protein degradation in the human pathogen Staphylococcus aureus during glucose starvation. Monitoring protein stability profiles in a wild type and an isogenic clpP protease mutant revealed that 1) proteolysis mainly affected proteins with vegetative functions, anabolic and selected catabolic enzymes, whereas the expression of TCA cycle and gluconeogenesis enzymes increased; 2) most proteins were prone to aggregation in the clpP mutant; 3) the absence of ClpP correlated with protein denaturation and oxidative stress responses, deregulation of virulence factors and a CodY repression. We suggest that degradation of redundant, inactive proteins disintegrated from functional complexes and thereby amenable to proteolytic attack is a fundamental cellular process in all organisms to regain nutrients and guarantee protein homeostasis. PMID:22556279
Mitochondrial protein hyperacetylation in the failing heart
Horton, Julie L.; Martin, Ola J.; Lai, Ling; Richards, Alicia L.; Vega, Rick B.; Leone, Teresa C.; Pagliarini, David J.; Muoio, Deborah M.; Bedi, Kenneth C.; Coon, Joshua J.
2016-01-01
Myocardial fuel and energy metabolic derangements contribute to the pathogenesis of heart failure. Recent evidence implicates posttranslational mechanisms in the energy metabolic disturbances that contribute to the pathogenesis of heart failure. We hypothesized that accumulation of metabolite intermediates of fuel oxidation pathways drives posttranslational modifications of mitochondrial proteins during the development of heart failure. Myocardial acetylproteomics demonstrated extensive mitochondrial protein lysine hyperacetylation in the early stages of heart failure in well-defined mouse models and the in end-stage failing human heart. To determine the functional impact of increased mitochondrial protein acetylation, we focused on succinate dehydrogenase A (SDHA), a critical component of both the tricarboxylic acid (TCA) cycle and respiratory complex II. An acetyl-mimetic mutation targeting an SDHA lysine residue shown to be hyperacetylated in the failing human heart reduced catalytic function and reduced complex II–driven respiration. These results identify alterations in mitochondrial acetyl-CoA homeostasis as a potential driver of the development of energy metabolic derangements that contribute to heart failure. PMID:26998524
Mitochondrial protein hyperacetylation in the failing heart.
Horton, Julie L; Martin, Ola J; Lai, Ling; Riley, Nicholas M; Richards, Alicia L; Vega, Rick B; Leone, Teresa C; Pagliarini, David J; Muoio, Deborah M; Bedi, Kenneth C; Margulies, Kenneth B; Coon, Joshua J; Kelly, Daniel P
2016-02-01
Myocardial fuel and energy metabolic derangements contribute to the pathogenesis of heart failure. Recent evidence implicates posttranslational mechanisms in the energy metabolic disturbances that contribute to the pathogenesis of heart failure. We hypothesized that accumulation of metabolite intermediates of fuel oxidation pathways drives posttranslational modifications of mitochondrial proteins during the development of heart failure. Myocardial acetylproteomics demonstrated extensive mitochondrial protein lysine hyperacetylation in the early stages of heart failure in well-defined mouse models and the in end-stage failing human heart. To determine the functional impact of increased mitochondrial protein acetylation, we focused on succinate dehydrogenase A (SDHA), a critical component of both the tricarboxylic acid (TCA) cycle and respiratory complex II. An acetyl-mimetic mutation targeting an SDHA lysine residue shown to be hyperacetylated in the failing human heart reduced catalytic function and reduced complex II-driven respiration. These results identify alterations in mitochondrial acetyl-CoA homeostasis as a potential driver of the development of energy metabolic derangements that contribute to heart failure.
Gene expression analysis of six GC-rich Gram-negative phytopathogens.
Fu, Qing-Shan; Li, Feng; Chen, Ling-Ling
2005-07-01
Predicted highly expressed (PHX) genes are comparatively analyzed for six GC-rich Gram-negative phytopathogens, i.e., Ralstonia solanacearum, Agrobacterium tumefaciens, Xanthomonas campestris pv. campestris (Xcc), Xanthomonas axonopodis pv. citri (Xac), Pseudomonas syringae pv. tomato, and Xylella fastidiosa. Enzymes involved in energy metabolism, such as ATP synthase, and genes involved in TCA cycle, are PHX in most bacteria except X. fastidiosa, which prefers an anaerobic environment. Most pathogenicity-related factors, including flagellar proteins and some outer membrane proteins, are PHX, except that flagellar proteins are missing in X. fastidiosa which is spread by insects and does not need to move during invasion. Although type III secretion system apparatus are homologous to flagellar proteins, none of them is PHX, which support the viewpoint that the two types of genes have evolved independently. Furthermore, it is revealed that some biosynthesis-related enzymes are highly expressed in certain bacteria. The PHX genes may provide potential drug targets for the design of new bactericide.
Energy Metabolism Rewiring Precedes UVB-Induced Primary Skin Tumor Formation.
Hosseini, Mohsen; Dousset, Léa; Mahfouf, Walid; Serrano-Sanchez, Martin; Redonnet-Vernhet, Isabelle; Mesli, Samir; Kasraian, Zeinab; Obre, Emilie; Bonneu, Marc; Claverol, Stephane; Vlaski, Marija; Ivanovic, Zoran; Rachidi, Walid; Douki, Thierry; Taieb, Alain; Bouzier-Sore, Anne-Karine; Rossignol, Rodrigue; Rezvani, Hamid Reza
2018-06-19
Although growing evidence indicates that bioenergetic metabolism plays an important role in the progression of tumorigenesis, little information is available on the contribution of reprogramming of energy metabolism in cancer initiation. By applying a quantitative proteomic approach and targeted metabolomics, we find that specific metabolic modifications precede primary skin tumor formation. Using a multistage model of ultraviolet B (UVB) radiation-induced skin cancer, we show that glycolysis, tricarboxylic acid (TCA) cycle, and fatty acid β-oxidation are decreased at a very early stage of photocarcinogenesis, while the distal part of the electron transport chain (ETC) is upregulated. Reductive glutamine metabolism and the activity of dihydroorotate dehydrogenase (DHODH) are both necessary for maintaining high ETC. Mice with decreased DHODH activity or impaired ETC failed to develop pre-malignant and malignant lesions. DHODH activity represents a major link between DNA repair efficiency and bioenergetic patterning during skin carcinogenesis. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Yamada, Shigeru; Kotake, Yaichiro; Demizu, Yosuke; Kurihara, Masaaki; Sekino, Yuko; Kanda, Yasunari
2014-08-01
Tributyltin (TBT) is known to cause developmental defects as endocrine disruptive chemicals (EDCs). At nanomoler concentrations, TBT actions were mediated by genomic pathways via PPAR/RXR. However, non-genomic target of TBT has not been elucidated. To investigate non-genomic TBT targets, we performed comprehensive metabolomic analyses using human embryonic carcinoma NT2/D1 cells. We found that 100 nM TBT reduced the amounts of α-ketoglutarate, succinate and malate. We further found that TBT decreased the activity of NAD-dependent isocitrate dehydrogenase (NAD-IDH), which catalyzes the conversion of isocitrate to α-ketoglutarate in the TCA cycle. In addition, TBT inhibited cell growth and enhanced neuronal differentiation through NAD-IDH inhibition. Furthermore, studies using bacterially expressed human NAD-IDH and in silico simulations suggest that TBT inhibits NAD-IDH due to a possible interaction. These results suggest that NAD-IDH is a novel non-genomic target of TBT at nanomolar levels. Thus, a metabolomic approach may provide new insights into the mechanism of EDC action.
Yamada, Shigeru; Kotake, Yaichiro; Demizu, Yosuke; Kurihara, Masaaki; Sekino, Yuko; Kanda, Yasunari
2014-08-05
Tributyltin (TBT) is known to cause developmental defects as endocrine disruptive chemicals (EDCs). At nanomoler concentrations, TBT actions were mediated by genomic pathways via PPAR/RXR. However, non-genomic target of TBT has not been elucidated. To investigate non-genomic TBT targets, we performed comprehensive metabolomic analyses using human embryonic carcinoma NT2/D1 cells. We found that 100 nM TBT reduced the amounts of α-ketoglutarate, succinate and malate. We further found that TBT decreased the activity of NAD-dependent isocitrate dehydrogenase (NAD-IDH), which catalyzes the conversion of isocitrate to α-ketoglutarate in the TCA cycle. In addition, TBT inhibited cell growth and enhanced neuronal differentiation through NAD-IDH inhibition. Furthermore, studies using bacterially expressed human NAD-IDH and in silico simulations suggest that TBT inhibits NAD-IDH due to a possible interaction. These results suggest that NAD-IDH is a novel non-genomic target of TBT at nanomolar levels. Thus, a metabolomic approach may provide new insights into the mechanism of EDC action.
Tumor microenvironment derived exosomes pleiotropically modulate cancer cell metabolism.
Zhao, Hongyun; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Bernard, Vincent; Moss, Tyler; Marini, Juan C; Tudawe, Thavisha; Seviour, Elena G; San Lucas, F Anthony; Alvarez, Hector; Gupta, Sonal; Maiti, Sourindra N; Cooper, Laurence; Peehl, Donna; Ram, Prahlad T; Maitra, Anirban; Nagrath, Deepak
2016-02-27
Cancer-associated fibroblasts (CAFs) are a major cellular component of tumor microenvironment in most solid cancers. Altered cellular metabolism is a hallmark of cancer, and much of the published literature has focused on neoplastic cell-autonomous processes for these adaptations. We demonstrate that exosomes secreted by patient-derived CAFs can strikingly reprogram the metabolic machinery following their uptake by cancer cells. We find that CAF-derived exosomes (CDEs) inhibit mitochondrial oxidative phosphorylation, thereby increasing glycolysis and glutamine-dependent reductive carboxylation in cancer cells. Through 13C-labeled isotope labeling experiments we elucidate that exosomes supply amino acids to nutrient-deprived cancer cells in a mechanism similar to macropinocytosis, albeit without the previously described dependence on oncogenic-Kras signaling. Using intra-exosomal metabolomics, we provide compelling evidence that CDEs contain intact metabolites, including amino acids, lipids, and TCA-cycle intermediates that are avidly utilized by cancer cells for central carbon metabolism and promoting tumor growth under nutrient deprivation or nutrient stressed conditions.
Oppenheim, Rebecca D.; Limenitakis, Julien; Polonais, Valerie; Seeber, Frank; Barrett, Michael P.; Billker, Oliver; McConville, Malcolm J.; Soldati-Favre, Dominique
2014-01-01
While the apicomplexan parasites Plasmodium falciparum and Toxoplasma gondii are thought to primarily depend on glycolysis for ATP synthesis, recent studies have shown that they can fully catabolize glucose in a canonical TCA cycle. However, these parasites lack a mitochondrial isoform of pyruvate dehydrogenase and the identity of the enzyme that catalyses the conversion of pyruvate to acetyl-CoA remains enigmatic. Here we demonstrate that the mitochondrial branched chain ketoacid dehydrogenase (BCKDH) complex is the missing link, functionally replacing mitochondrial PDH in both T. gondii and P. berghei. Deletion of the E1a subunit of T. gondii and P. berghei BCKDH significantly impacted on intracellular growth and virulence of both parasites. Interestingly, disruption of the P. berghei E1a restricted parasite development to reticulocytes only and completely prevented maturation of oocysts during mosquito transmission. Overall this study highlights the importance of the molecular adaptation of BCKDH in this important class of pathogens. PMID:25032958
Tumor microenvironment derived exosomes pleiotropically modulate cancer cell metabolism
Zhao, Hongyun; Yang, Lifeng; Baddour, Joelle; Achreja, Abhinav; Bernard, Vincent; Moss, Tyler; Marini, Juan C; Tudawe, Thavisha; Seviour, Elena G; San Lucas, F Anthony; Alvarez, Hector; Gupta, Sonal; Maiti, Sourindra N; Cooper, Laurence; Peehl, Donna; Ram, Prahlad T; Maitra, Anirban; Nagrath, Deepak
2016-01-01
Cancer-associated fibroblasts (CAFs) are a major cellular component of tumor microenvironment in most solid cancers. Altered cellular metabolism is a hallmark of cancer, and much of the published literature has focused on neoplastic cell-autonomous processes for these adaptations. We demonstrate that exosomes secreted by patient-derived CAFs can strikingly reprogram the metabolic machinery following their uptake by cancer cells. We find that CAF-derived exosomes (CDEs) inhibit mitochondrial oxidative phosphorylation, thereby increasing glycolysis and glutamine-dependent reductive carboxylation in cancer cells. Through 13C-labeled isotope labeling experiments we elucidate that exosomes supply amino acids to nutrient-deprived cancer cells in a mechanism similar to macropinocytosis, albeit without the previously described dependence on oncogenic-Kras signaling. Using intra-exosomal metabolomics, we provide compelling evidence that CDEs contain intact metabolites, including amino acids, lipids, and TCA-cycle intermediates that are avidly utilized by cancer cells for central carbon metabolism and promoting tumor growth under nutrient deprivation or nutrient stressed conditions. DOI: http://dx.doi.org/10.7554/eLife.10250.001 PMID:26920219
Proteome map of Aspergillus nidulans during osmoadaptation.
Kim, Yonghyun; Nandakumar, M P; Marten, Mark R
2007-09-01
The model filamentous fungus Aspergillus nidulans, when grown in a moderate level of osmolyte (+0.6M KCl), was previously found to have a significantly reduced cell wall elasticity (Biotech Prog, 21:292, 2005). In this study, comparative proteomic analysis via two-dimensional gel electrophoresis (2de) and matrix-assisted laser desorption ionization/time-of-flight (MALDI-TOF) mass spectrometry was used to assess molecular level events associated with this phenomenon. Thirty of 90 differentially expressed proteins were identified. Sequence homology and conserved domains were used to assign probable function to twenty-one proteins currently annotated as "hypothetical." In osmoadapted cells, there was an increased expression of glyceraldehyde-3-phosphate dehydrogenase and aldehyde dehydrogenase, as well as a decreased expression of enolase, suggesting an increased glycerol biosynthesis and decreased use of the TCA cycle. There also was an increased expression of heat shock proteins and Shp1-like protein degradation protein, implicating increased protein turnover. Five novel osmoadaptation proteins of unknown functions were also identified.
RapidRIP quantifies the intracellular metabolome of 7 industrial strains of E. coli.
McCloskey, Douglas; Xu, Julia; Schrübbers, Lars; Christensen, Hanne B; Herrgård, Markus J
2018-04-25
Fast metabolite quantification methods are required for high throughput screening of microbial strains obtained by combinatorial or evolutionary engineering approaches. In this study, a rapid RIP-LC-MS/MS (RapidRIP) method for high-throughput quantitative metabolomics was developed and validated that was capable of quantifying 102 metabolites from central, amino acid, energy, nucleotide, and cofactor metabolism in less than 5 minutes. The method was shown to have comparable sensitivity and resolving capability as compared to a full length RIP-LC-MS/MS method (FullRIP). The RapidRIP method was used to quantify the metabolome of seven industrial strains of E. coli revealing significant differences in glycolytic, pentose phosphate, TCA cycle, amino acid, and energy and cofactor metabolites were found. These differences translated to statistically and biologically significant differences in thermodynamics of biochemical reactions between strains that could have implications when choosing a host for bioprocessing. Copyright © 2018. Published by Elsevier Inc.
ARTD1 (PARP1) activation and NAD+ in DNA repair and cell death
Fouquerel, Elise; Sobol, Robert W.
2014-01-01
Nicotinamide adenine dinucleotide, NAD+, is a small metabolite coenzyme that is essential for the progress of crucial cellular pathways including glycolysis, the tricarboxylic acid cycle (TCA) and mitochondrial respiration. These processes consume and produce both oxidative and reduced forms of NAD (NAD+ and NADH). NAD+ is also important for ADP(ribosyl)ation reactions mediated by the ADP-ribosyltransferase enzymes (ARTDs) or deacetylation reactions catalysed by the sirtuins (SIRTs) which use NAD+ as a substrate. In this review, we highlight the significance of NAD+ catabolism in DNA repair and cell death through its utilization by ARTDs and SIRTs. We summarize the current findings on the involvement of ARTD1 activity in DNA repair and most specifically its involvement in the trigger of cell death mediated by energy depletion. By sharing the same substrate, the activities of ARTDs and SIRTs are tightly linked and dependent on each other and are thereby involved in the same cellular processes that play an important role in cancer biology, inflammatory diseases and ischemia/reperfusion. PMID:25283336
Proteins involved in flor yeast carbon metabolism under biofilm formation conditions.
Moreno-García, Jaime; García-Martínez, Teresa; Moreno, Juan; Mauricio, Juan Carlos
2015-04-01
A lack of sugars during the production of biologically aged wines after fermentation of grape must causes flor yeasts to metabolize other carbon molecules formed during fermentation (ethanol and glycerol, mainly). In this work, a proteome analysis involving OFFGEL fractionation prior to LC/MS detection was used to elucidate the carbon metabolism of a flor yeast strain under biofilm formation conditions (BFC). The results were compared with those obtained under non-biofilm formation conditions (NBFC). Proteins associated to processes such as non-fermentable carbon uptake, the glyoxylate and TCA cycles, cellular respiration and inositol metabolism were detected at higher concentrations under BFC than under the reference conditions (NBFC). This study constitutes the first attempt at identifying the flor yeast proteins responsible for the peculiar sensory profile of biologically aged wines. A better metabolic knowledge of flor yeasts might facilitate the development of effective strategies for improved production of these special wines. Copyright © 2014 Elsevier Ltd. All rights reserved.
Zhang, Xiaojian; Liu, Huan; Wang, Jinrong; Ren, Guangyuan; Xie, Beizhen; Liu, Hong; Zhu, Ying; Jiang, Lei
2015-11-28
Dissimilatory metal reducing bacteria are capable of extracellular electron transfer (EET) to insoluble metal oxides as external electron acceptors for their anaerobic respiration, which is recognized as an important energy-conversion process in natural and engineered environments, such as in mineral cycling, bioremediation, and microbial fuel/electrolysis cells. However, the low EET efficiency remains one of the major bottlenecks for its practical application. We report firstly that the microbial current generated by Shewanella loihica PV-4 (S. loihica PV-4) could be greatly improved that is up to ca. 115 fold, by adding antimony-doped tin oxide (ATO) nanoparticles in the electrochemical reactor. The results demonstrate that the biocompatible, electrically conductive ATO nanoparticles acted as active microelectrodes could facilitate the formation of a cells/ATO composite biofilm and the reduction of the outer membrane c-type cytochromes (OM c-Cyts) that are beneficial for the electron transfer from cells to electrode. Meanwhile, a synergistic effect between the participation of OM c-Cyts and the accelerated EET mediated by cell-secreted flavins may play an important role for the enhanced current generation in the presence of ATO nanoparticles. Moreover, it is worth noting that the TCA cycle in S. loihica PV-4 cells is activated by adding ATO nanoparticles, even if the potential is poised at +0.2 V, thereby also improving the EET process. The results presented here may provide a simple and effective strategy to boost the EET of S. loihica PV-4 cells, which is conducive to providing potential applications in bioelectrochemical systems.
Ries, Laure Nicolas Annick; de Assis, Leandro José; Rodrigues, Fernando José Santos; Caldana, Camila; Rocha, Marina Campos; Malavazi, Iran; Bayram, Özgür; Goldman, Gustavo H
2018-05-24
The pyruvate dehydrogenase complex (PDH), that converts pyruvate to acetyl-coA, is regulated by pyruvate dehydrogenase kinases (PDHK) and phosphatases (PDHP) that have been shown to be important for morphology, pathogenicity and carbon source utilisation in different fungal species. The aim of this study was to investigate the role played by the three PDHKs PkpA, PkpB and PkpC in carbon source utilisation in the reference filamentous fungus Aspergillus nidulans , in order to unravel regulatory mechanisms which could prove useful for fungal biotechnological and biomedical applications. PkpA and PkpB were shown to be mitochondrial whereas PkpC localised to the mitochondria in a carbon source-dependent manner. Only PkpA was shown to regulate PDH activity. In the presence of glucose, deletion of pkpA and pkpC resulted in reduced glucose utilisation, which affected carbon catabolite repression (CCR) and hydrolytic enzyme secretion, due to de-regulated glycolysis and TCA cycle enzyme activities. Furthermore, PkpC was shown to be required for the correct metabolic utilisation of cellulose and acetate. PkpC negatively regulated the activity of the glyoxylate cycle enzyme isocitrate lyase (ICL), required for acetate metabolism. In summary, this study identified PDHKs important for the regulation of central carbon metabolism in the presence of different carbon sources, with effects on the secretion of biotechnologically important enzymes and carbon source-related growth. This work demonstrates how central carbon metabolism can affect a variety of fungal traits and lays a basis for further investigation into these characteristics with potential interest for different applications. Copyright © 2018, G3: Genes, Genomes, Genetics.
Auger, Christopher; Appanna, Vasu D
2015-01-01
It is well-known that elevated amounts of nitric oxide and other reactive nitrogen species (RNS) impact negatively on the tricarboxylic acid (TCA) cycle and oxidative phosphorylation. These perturbations severely compromise O2-dependent energy production. While bacteria are known to adapt to RNS, a key tool employed by macrophages to combat infections, the exact mechanisms are unknown. The bacterium was cultured in a defined mineral medium and cell-free extracts obtained at the same growth phase were utilized for various biochemical studies Blue native polyacrylamide gel electrophoresis followed by in-gel activity assays, high performance liquid chromatography and co-immunoprecipitaton are applied to investigate the effects of RNS on the model microbe Pseudomonas fluorescens. Citrate is channeled away from the tricarboxylic acid cycle using a novel metabolon consisting of citrate lyase (CL), phosphoenolpyruvate carboxylase (PEPC) and pyruvate phosphate dikinase (PPDK). This metabolic engine comprising three disparate enzymes appears to transiently assemble as a supercomplex aimed at ATP synthesis. The up-regulation in the activities of adenylate kinase (AK) and nucleoside diphosphate kinase (NDPK) ensured the efficacy of this ATP-making machine. Microbes may escape the effects of nitrosative stress by re-engineering metabolic networks in order to generate and store ATP anaerobically when the electron transport chain is defective. The molecular configuration described herein provides further understanding of how metabolism plays a key role in the adaptation to nitrosative stress and reveals novel targets that will inform the development of antimicrobial agents to counter RNS-resistant pathogens. Copyright © 2014 Elsevier B.V. All rights reserved.
Dong, Shi-Jun; Lin, Xiang-Hua; Li, Hao
2015-11-01
During the industrial bioethanol fermentation, Saccharomyces cerevisiae cells are often stressed by bacterial contaminants, especially lactic acid bacteria. Generally, lactic acid bacteria contamination can inhibit S. cerevisiae cell growth through secreting lactic acid and competing with yeast cells for micronutrients and living space. However, whether are there still any other influences of lactic acid bacteria on yeast or not? In this study, Lactobacillus plantarum ATCC 8014 was co-cultivated with S. cerevisiae S288c to mimic the L. plantarum contamination in industrial bioethanol fermentation. The contaminative L. plantarum-associated expression changes of genes involved in carbohydrate and energy related metabolisms in S. cerevisiae cells were determined by quantitative real-time polymerase chain reaction to evaluate the influence of L. plantarum on carbon source utilization and energy related metabolism in yeast cells during bioethanol fermentation. Contaminative L. plantarum influenced the expression of most of genes which are responsible for encoding key enzymes involved in glucose related metabolisms in S. cerevisiae. Specific for, contaminated L. plantarum inhibited EMP pathway but promoted TCA cycle, glyoxylate cycle, HMP, glycerol synthesis pathway, and redox pathway in S. cerevisiae cells. In the presence of L. plantarum, the carbon flux in S. cerevisiae cells was redistributed from fermentation to respiratory and more reducing power was produced to deal with the excess NADH. Moreover, L. plantarum contamination might confer higher ethanol tolerance to yeast cells through promoting accumulation of glycerol. These results also highlighted our knowledge about relationship between contaminative lactic acid bacteria and S. cerevisiae during bioethanol fermentation. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of muscle IL-6 in gender-specific metabolism in mice
Fernandez-Perez, Antonio; Mogas, Aina; Giralt, Mercedes; Comes, Gemma; Fernandez-Gayol, Olaya; Vallejo, Mario; Hidalgo, Juan
2017-01-01
The aim of the present work was to further explore the physiological roles of muscle-derived IL-6. Adult-floxed and conditional skeletal muscle IL-6 knock out male and female mice were used to study energy expenditure (indirect calorimetry at rest and during treadmill exercise, and body temperature cycle during the light phase) and energy intake (response to fast/refeeding). We also evaluated the responses to leptin and the activity of the insulin signalling pathway in skeletal muscle and liver by phosphorylation of Akt at Ser 473. The stress response was also studied. Results indicate a relevant role of muscle IL-6 in maintaining energy homeostasis, especially in males. Absence of muscle IL-6 in male mice results in lower core body temperature in the light phase, increased respiratory exchange ratio (RER) both at rest and during exercise, increased expression of TCA cycle marked gene, citrate synthase in muscle, reduced fat storage and decreased body weight and food consumption in response to leptin. In females, muscle IL-6 deficiency increases VO2 and CO2 levels similarly. Also in contrast to males, energy expenditure (EE) measured over 48h reveals a significant elevation in female mice with muscle IL-6 deficiency; moreover, they show a modified response to fasting-refeeding and to restraint stress. The present results contribute to the understanding of the role of muscle IL-6 in male and female mouse metabolism, not only during exercise but also in the basal state and in situations where energy balance is altered. PMID:28319140
Phosphoketolase pathway contributes to carbon metabolism in cyanobacteria.
Xiong, Wei; Lee, Tai-Chi; Rommelfanger, Sarah; Gjersing, Erica; Cano, Melissa; Maness, Pin-Ching; Ghirardi, Maria; Yu, Jianping
2015-12-07
Central carbon metabolism in cyanobacteria comprises the Calvin-Benson-Bassham (CBB) cycle, glycolysis, the pentose phosphate (PP) pathway and the tricarboxylic acid (TCA) cycle. Redundancy in this complex metabolic network renders the rational engineering of cyanobacterial metabolism for the generation of biomass, biofuels and chemicals a challenge. Here we report the presence of a functional phosphoketolase pathway, which splits xylulose-5-phosphate (or fructose-6-phosphate) to acetate precursor acetyl phosphate, in an engineered strain of the model cyanobacterium Synechocystis (ΔglgC/xylAB), in which glycogen synthesis is blocked, and xylose catabolism enabled through the introduction of xylose isomerase and xylulokinase. We show that this mutant strain is able to metabolise xylose to acetate on nitrogen starvation. To see whether acetate production in the mutant is linked to the activity of phosphoketolase, we disrupted a putative phosphoketolase gene (slr0453) in the ΔglgC/xylAB strain, and monitored metabolic flux using (13)C labelling; acetate and 2-oxoglutarate production was reduced in the light. A metabolic flux analysis, based on isotopic data, suggests that the phosphoketolase pathway metabolises over 30% of the carbon consumed by ΔglgC/xylAB during photomixotrophic growth on xylose and CO2. Disruption of the putative phosphoketolase gene in wild-type Synechocystis also led to a deficiency in acetate production in the dark, indicative of a contribution of the phosphoketolase pathway to heterotrophic metabolism. We suggest that the phosphoketolase pathway, previously uncharacterized in photosynthetic organisms, confers flexibility in energy and carbon metabolism in cyanobacteria, and could be exploited to increase the efficiency of cyanobacterial carbon metabolism and photosynthetic productivity.
Jiang, Cheng-Ying; Liu, Li-Jun; Guo, Xu; You, Xiao-Yan; Liu, Shuang-Jiang; Poetsch, Ansgar
2014-09-23
Metallosphaera cuprina is able to grow either heterotrophically on organics or autotrophically on CO2 with reduced sulfur compounds as electron donor. These traits endowed the species desirable for application in biomining. In order to obtain a global overview of physiological adaptations on the proteome level, proteomes of cytoplasmic and membrane fractions from cells grown autotrophically on CO2 plus sulfur or heterotrophically on yeast extract were compared. 169 proteins were found to change their abundance depending on growth condition. The proteins with increased abundance under autotrophic growth displayed candidate enzymes/proteins of M. cuprina for fixing CO2 through the previously identified 3-hydroxypropionate/4-hydroxybutyrate cycle and for oxidizing elemental sulfur as energy source. The main enzymes/proteins involved in semi- and non-phosphorylating Entner-Doudoroff (ED) pathway and TCA cycle were less abundant under autotrophic growth. Also some transporter proteins and proteins of amino acid metabolism changed their abundances, suggesting pivotal roles for growth under the respective conditions. The described work is of great significance: For general microbiology: How do extremophile organisms use their unique metabolic capabilities in adapting to autotrophic and hetetrotrophic growth conditions? Which are important enzymes involved in the metabolic adaptation and which enzyme candidate should be investigated in more detail with microbiological/biochemical approaches? For applied microbiology: Which are the key enzymes and reaction pathways for sulfur oxidation and autotrophic growth? This knowledge should accelerate future design of improved bioleaching processes in biomining industries or bioremediation. Copyright © 2014 Elsevier B.V. All rights reserved.
Popko, Jennifer; Herrfurth, Cornelia; Feussner, Kirstin; Ischebeck, Till; Iven, Tim; Haslam, Richard; Hamilton, Mary; Sayanova, Olga; Napier, Jonathan; Khozin-Goldberg, Inna; Feussner, Ivo
2016-01-01
Oleaginous microalgae are considered as a promising resource for the production of biofuels. Especially diatoms arouse interest as biofuel producers since they are most productive in carbon fixation and very flexible to environmental changes in the nature. Naturally, triacylglycerol (TAG) accumulation in algae only occurs under stress conditions like nitrogen-limitation. We focused on Phaeodactylum strain Pt4 (UTEX 646), because of its ability to grow in medium with low salinity and therefore being suited when saline water is less available or for wastewater cultivation strategies. Our data show an increase in neutral lipids during nitrogen-depletion and predominantly 16:0 and 16:1(n-7) accumulated in the TAG fraction. The molecular species composition of TAG suggests a remodeling primarily from the betaine lipid diacylglyceroltrimethylhomoserine (DGTS), but a contribution of the chloroplast galactolipid monogalactosyldiacylglycerol (MGDG) cannot be excluded. Interestingly, the acyl-CoA pool is rich in 20:5(n-3) and 22:6(n-3) in all analyzed conditions, but these fatty acids are almost excluded from TAG. Other metabolites most obviously depleted under nitrogen-starvation were amino acids, lyso-phospholipids and tricarboxylic acid (TCA) cycle intermediates, whereas sulfur-containing metabolites as dimethylsulfoniopropionate, dimethylsulfoniobutyrate and methylsulfate as well as short acyl chain carnitines, propanoyl-carnitine and butanoyl-carnitine increased upon nitrogen-starvation. Moreover, the Calvin cycle may be de-regulated since sedoheptulose accumulated after nitrogen-depletion. Together the data provide now the basis for new strategies to improve lipid production and storage in Phaeodactylum strain Pt4.
Branco Dos Santos, Filipe; Olivier, Brett G; Boele, Joost; Smessaert, Vincent; De Rop, Philippe; Krumpochova, Petra; Klau, Gunnar W; Giera, Martin; Dehottay, Philippe; Teusink, Bas; Goffin, Philippe
2017-08-25
Whooping cough is a highly-contagious respiratory disease caused by Bordetella pertussi s. Despite vaccination, its incidence has been rising alarmingly, and yet, the physiology of B. pertussis remains poorly understood. We combined genome-scale metabolic reconstruction, a novel optimization algorithm and experimental data to probe the full metabolic potential of this pathogen, using strain Tohama I as a reference. Experimental validation showed that B. pertussis secretes a significant proportion of nitrogen as arginine and purine nucleosides, which may contribute to modulation of the host response. We also found that B. pertussis can be unexpectedly versatile, being able to metabolize many compounds while displaying minimal nutrient requirements. It can grow without cysteine - using inorganic sulfur sources such as thiosulfate - and it can grow on organic acids such as citrate or lactate as sole carbon sources, providing in vivo demonstration that its TCA cycle is functional. Although the metabolic reconstruction of eight additional strains indicates that the structural genes underlying this metabolic flexibility are widespread, experimental validation suggests a role of strain-specific regulatory mechanisms in shaping metabolic capabilities. Among five alternative strains tested, three were shown to grow on substrate combinations requiring a functional TCA cycle, but only one could use thiosulfate. Finally, the metabolic model was used to rationally design growth media with over two-fold improvements in pertussis toxin production. This study thus provides novel insights into B. pertussis physiology, and highlights the potential, but also limitations of models solely based on metabolic gene content. IMPORTANCE The metabolic capabilities of Bordetella pertussis - the causative agent of whooping cough - were investigated from a systems-level perspective. We constructed a comprehensive genome-scale metabolic model for B. pertussis , and challenged its predictions experimentally. This systems approach shed light on new potential host-microbe interactions, and allowed to rationally design novel growth media with over two-fold improvements in pertussis toxin production. Most importantly, we also uncovered the potential for metabolic flexibility of B. pertussis (significantly larger range of substrates than previously alleged; novel active pathways allowing growth in minimal, nearly mineral nutrient combinations where only the carbon source must be organic), although our results also highlight the importance of strain-specific regulatory determinants in shaping metabolic capabilities. Deciphering the underlying regulatory mechanisms appears crucial for a comprehensive understanding of B. pertussis 's lifestyle and the epidemiology of whooping cough. The contribution of metabolic models in this context will require the extension of the genome-scale metabolic model to integrate this regulatory dimension. Copyright © 2017 Branco dos Santos et al.
Role of O2 in the Growth of Rhizobium leguminosarum bv. viciae 3841 on Glucose and Succinate
Wheatley, Rachel M.; Ramachandran, Vinoy K.; Geddes, Barney A.; Perry, Benjamin J.; Yost, Chris K.
2016-01-01
ABSTRACT Insertion sequencing (INSeq) analysis of Rhizobium leguminosarum bv. viciae 3841 (Rlv3841) grown on glucose or succinate at both 21% and 1% O2 was used to understand how O2 concentration alters metabolism. Two transcriptional regulators were required for growth on glucose (pRL120207 [eryD] and RL0547 [phoB]), five were required on succinate (pRL100388, RL1641, RL1642, RL3427, and RL4524 [ecfL]), and three were required on 1% O2 (pRL110072, RL0545 [phoU], and RL4042). A novel toxin-antitoxin system was identified that could be important for generation of new plasmidless rhizobial strains. Rlv3841 appears to use the methylglyoxal pathway alongside the Entner-Doudoroff (ED) pathway and tricarboxylic acid (TCA) cycle for optimal growth on glucose. Surprisingly, the ED pathway was required for growth on succinate, suggesting that sugars made by gluconeogenesis must undergo recycling. Altered amino acid metabolism was specifically needed for growth on glucose, including RL2082 (gatB) and pRL120419 (opaA, encoding omega-amino acid:pyruvate transaminase). Growth on succinate specifically required enzymes of nucleobase synthesis, including ribose-phosphate pyrophosphokinase (RL3468 [prs]) and a cytosine deaminase (pRL90208 [codA]). Succinate growth was particularly dependent on cell surface factors, including the PrsD-PrsE type I secretion system and UDP-galactose production. Only RL2393 (glnB, encoding nitrogen regulatory protein PII) was specifically essential for growth on succinate at 1% O2, conditions similar to those experienced by N2-fixing bacteroids. Glutamate synthesis is constitutively activated in glnB mutants, suggesting that consumption of 2-ketoglutarate may increase flux through the TCA cycle, leading to excess reductant that cannot be reoxidized at 1% O2 and cell death. IMPORTANCE Rhizobium leguminosarum, a soil bacterium that forms N2-fixing symbioses with several agriculturally important leguminous plants (including pea, vetch, and lentil), has been widely utilized as a model to study Rhizobium-legume symbioses. Insertion sequencing (INSeq) has been used to identify factors needed for its growth on different carbon sources and O2 levels. Identification of these factors is fundamental to a better understanding of the cell physiology and core metabolism of this bacterium, which adapts to a variety of different carbon sources and O2 tensions during growth in soil and N2 fixation in symbiosis with legumes. PMID:27795326
Olivier, Brett G.; Boele, Joost; Smessaert, Vincent; De Rop, Philippe; Krumpochova, Petra; Klau, Gunnar W.; Giera, Martin; Dehottay, Philippe; Goffin, Philippe
2017-01-01
ABSTRACT Whooping cough is a highly contagious respiratory disease caused by Bordetella pertussis. Despite widespread vaccination, its incidence has been rising alarmingly, and yet, the physiology of B. pertussis remains poorly understood. We combined genome-scale metabolic reconstruction, a novel optimization algorithm, and experimental data to probe the full metabolic potential of this pathogen, using B. pertussis strain Tohama I as a reference. Experimental validation showed that B. pertussis secretes a significant proportion of nitrogen as arginine and purine nucleosides, which may contribute to modulation of the host response. We also found that B. pertussis can be unexpectedly versatile, being able to metabolize many compounds while displaying minimal nutrient requirements. It can grow without cysteine, using inorganic sulfur sources, such as thiosulfate, and it can grow on organic acids, such as citrate or lactate, as sole carbon sources, providing in vivo demonstration that its tricarboxylic acid (TCA) cycle is functional. Although the metabolic reconstruction of eight additional strains indicates that the structural genes underlying this metabolic flexibility are widespread, experimental validation suggests a role of strain-specific regulatory mechanisms in shaping metabolic capabilities. Among five alternative strains tested, three strains were shown to grow on substrate combinations requiring a functional TCA cycle, but only one strain could use thiosulfate. Finally, the metabolic model was used to rationally design growth media with >2-fold improvements in pertussis toxin production. This study thus provides novel insights into B. pertussis physiology and highlights the potential, but also the limitations, of models based solely on metabolic gene content. IMPORTANCE The metabolic capabilities of Bordetella pertussis, the causative agent of whooping cough, were investigated from a systems-level perspective. We constructed a comprehensive genome-scale metabolic model for B. pertussis and challenged its predictions experimentally. This systems approach shed light on new potential host-microbe interactions and allowed us to rationally design novel growth media with >2-fold improvements in pertussis toxin production. Most importantly, we also uncovered the potential for metabolic flexibility of B. pertussis (significantly larger range of substrates than previously alleged; novel active pathways allowing growth in minimal, nearly mineral nutrient combinations where only the carbon source must be organic), although our results also highlight the importance of strain-specific regulatory determinants in shaping metabolic capabilities. Deciphering the underlying regulatory mechanisms appears to be crucial for a comprehensive understanding of B. pertussis's lifestyle and the epidemiology of whooping cough. The contribution of metabolic models in this context will require the extension of the genome-scale metabolic model to integrate this regulatory dimension. PMID:28842544
Wheatley, Carmen
2007-01-01
The up-regulation of transcobalamins [hitherto posited as indicating a central need for cobalamin (Cbl) in inflammation], whose expression, like inducible nitric oxide synthase (iNOS), is Sp1- and interferondependent, together with increased intracellular formation of glutathionylcobalamin (GSCbl), adenosylcobalamin (AdoCbl), methylcobalamin (MeCbl), may be essential for the timely promotion and later selective inhibition of iNOS and concordant regulation of endothelial and neuronal NOS (eNOS/nNOS.) Cbl may ensure controlled high output of nitric oxide (NO) and its safe deployment, because: (1) Cbl is ultimately responsible for the synthesis or availability of the NOS substrates and cofactors heme, arginine, BH4 flavin adenine dinucleotide/flavin mononucleotide (FAD/FMN) and NADPH, via the far-reaching effects of the two Cbl coenzymes, methionine synthase (MS) and methylmalonyl CoA mutase (MCoAM) in, or on, the folate, glutathione, tricarboxylic acid (TCA) and urea cycles, oxidative phosphorylation, glycolysis and the pentose phosphate pathway. Deficiency of any of theNOS substrates and cofactors results in ‘uncoupled’ NOS reactions, decreasedNO production and increased or excessive O2−, H2O2, ONOO− and other reactive oxygen species (ROS), reactive nitric oxide species (RNIS) leading to pathology. (2) Cbl is also the overlooked ultimate determinant of positive glutathione status, which favours the formation of more benign NO species, s-nitrosothiols, the predominant form in which NO is safely deployed. Cbl status may consequently act as a ‘back-up disc’ that ensures the active status of antioxidant systems, as well as reversing and modulating the effects of nitrosylation in cell signal transduction.New evidence shows that GSCbl can significantly promote iNOS/ eNOS NO synthesis in the early stages of inflammation, thus lowering high levels of tumour necrosis factor-a that normally result in pathology, while existing evidence shows that in extreme nitrosative and oxidative stress, GSCbl can regenerate the activity of enzymes important for eventual resolution, such as glucose 6 phosphate dehydrogenase, which ensures NADPH supply, lactate dehydrogenase, and more; with human clinical case studies of OHCbl for cyanide poisoning, suggesting Cbl may regenerate aconitase and cytochrome c oxidase in the TCA cycle and oxidative phosphorylation. Thus, Cbl may simultaneously promote a strong inflammatory response and the means to resolve it. PMID:18836533
Leatham-Jensen, Mary P.; Mokszycki, Matthew E.; Rowley, David C.; Deering, Robert; Camberg, Jodi L.; Sokurenko, Evgeni V.; Tchesnokova, Veronika L.; Frimodt-Møller, Jakob; Leth Nielsen, Karen; Sun, Gongqin
2016-01-01
ABSTRACT In the present study, it is shown that although Escherichia coli CFT073, a human uropathogenic (UPEC) strain, grows in liquid glucose M9 minimal medium, it fails to grow on glucose M9 minimal medium agar plates seeded with ≤106 CFU. The cells on glucose plates appear to be in a “quiescent” state that can be prevented by various combinations of lysine, methionine, and tyrosine. Moreover, the quiescent state is characteristic of ~80% of E. coli phylogenetic group B2 multilocus sequence type 73 strains, as well as 22.5% of randomly selected UPEC strains isolated from community-acquired urinary tract infections in Denmark. In addition, E. coli CFT073 quiescence is not limited to glucose but occurs on agar plates containing a number of other sugars and acetate as sole carbon sources. It is also shown that a number of E. coli CFT073 mini-Tn5 metabolic mutants (gnd, gdhA, pykF, sdhA, and zwf) are nonquiescent on glucose M9 minimal agar plates and that quiescence requires a complete oxidative tricarboxylic acid (TCA) cycle. In addition, evidence is presented that, although E. coli CFT073 quiescence and persistence in the presence of ampicillin are alike in that both require a complete oxidative TCA cycle and each can be prevented by amino acids, E. coli CFT073 quiescence occurs in the presence or absence of a functional rpoS gene, whereas maximal persistence requires a nonfunctional rpoS. Our results suggest that interventions targeting specific central metabolic pathways may mitigate UPEC infections by interfering with quiescence and persistence. IMPORTANCE Recurrent urinary tract infections (UTIs) affect 10 to 40% of women. In up to 77% of those cases, the recurrent infections are caused by the same uropathogenic E. coli (UPEC) strain that caused the initial infection. Upon infection of urothelial transitional cells in the bladder, UPEC appear to enter a nongrowing quiescent intracellular state that is thought to serve as a reservoir responsible for recurrent UTIs. Here, we report that many UPEC strains enter a quiescent state when ≤106 CFU are seeded on glucose M9 minimal medium agar plates and show that mutations in several genes involved in central carbon metabolism prevent quiescence, as well as persistence, possibly identifying metabolic pathways involved in UPEC quiescence and persistence in vivo. PMID:27303698
Lai, Marta; Lanz, Bernard; Poitry-Yamate, Carole; Romero, Jackeline F; Berset, Corina M; Cudalbu, Cristina; Gruetter, Rolf
2017-01-01
In vivo 13 C magnetic resonance spectroscopy (MRS) enables the investigation of cerebral metabolic compartmentation while, e.g. infusing 13 C-labeled glucose. Metabolic flux analysis of 13 C turnover previously yielded quantitative information of glutamate and glutamine metabolism in humans and rats, while the application to in vivo mouse brain remains exceedingly challenging. In the present study, 13 C direct detection at 14.1 T provided highly resolved in vivo spectra of the mouse brain while infusing [1,6- 13 C 2 ]glucose for up to 5 h. 13 C incorporation to glutamate and glutamine C4, C3, and C2 and aspartate C3 were detected dynamically and fitted to a two-compartment model: flux estimation of neuron-glial metabolism included tricarboxylic acid cycle (TCA) flux in astrocytes (V g = 0.16 ± 0.03 µmol/g/min) and neurons (V TCA n = 0.56 ± 0.03 µmol/g/min), pyruvate carboxylase activity (V PC = 0.041 ± 0.003 µmol/g/min) and neurotransmission rate (V NT = 0.084 ± 0.008 µmol/g/min), resulting in a cerebral metabolic rate of glucose (CMR glc ) of 0.38 ± 0.02 µmol/g/min, in excellent agreement with that determined with concomitant 18 F-fluorodeoxyglucose positron emission tomography ( 18 FDG PET).We conclude that modeling of neuron-glial metabolism in vivo is accessible in the mouse brain from 13 C direct detection with an unprecedented spatial resolution under [1,6- 13 C 2 ]glucose infusion.
Li, Xinhong; Wang, Lirui; Li, Yuhua; Fu, Jieli; Zhen, Linqing; Yang, Qiangzhen; Li, Sisi; Zhang, Yukun
2016-05-16
Cadmium (Cd) is reported to reduce sperm motility and functions. However, the molecular mechanisms of Cd-induced toxicity remain largely unknown, presenting a major knowledge gap in research on reproductive toxicology. In the present study, we identified a candidate protein, dihydrolipoamide dehydrogenase (DLD), which is a post-pyruvate metabolic enzyme, exhibiting tyrosine phosphorylation in mouse sperm exposed to Cd both in vivo and in vitro. Immunoprecipitation assay demonstrated DLD was phosphorylated in tyrosine residues without altered expression after Cd treatment, which further confirmed our identified result. However, the tyrosine phosphorylation of DLD did not participate in mouse sperm capacitation and Bovine Serum Albumin (BSA) effectively prevented the tyrosine phosphorylation of DLD. Moreover, Cd-induced tyrosine phosphorylation of DLD lowered its dehydrogenase activity and meanwhile, Nicotinamide Adenine Dinucleotide Hydrogen (NADH) content, Adenosine Triphosphate (ATP) production and sperm motility were all inhibited by Cd. Interestingly, when the tyrosine phosphorylation of DLD was blocked by BSA, the decrease of DLD activity, NADH and ATP content as well as sperm motility was also suppressed simultaneously. These results suggested that Cd-induced tyrosine phosphorylation of DLD inhibited its activity and thus suppressed the tricarboxylic acid (TCA) cycle, which resulted in the reduction of NADH and hence the ATP production generated through oxidative phosphorylation (OPHOXS). Taken together, our results revealed that Cd induced DLD tyrosine phosphorylation, in response to regulate TCA metabolic pathway, which reduced ATP levels and these negative effects led to decreased sperm motility. This study provided new understanding of the mechanisms contributing to the harmful effects of Cd on the motility and function of spermatozoa. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Aydın, Birsen
2017-03-01
Argan oil (AO) is rich in minor compounds such as polyphenols and tocopherols which are powerful antioxidants. Acrylamide (ACR) has been classified as a neurotoxic agent in animals and humans. Mitochondrial oxidative stress and dysfunction is one of the most probable molecular mechanisms of neurodegenerative diseases. Female Sprague Dawley rats were exposed to ACR (50mg/kg i.p. three times a week), AO (6ml/kg,o.p, per day) or together for 30days. The activities of cytosolic enzymes such as xanthine oxidase (XO), glucose 6-phosphate dehydrogenase (G6PDH), glutathione-S-transferase (GST), mitochondrial oxidative stress, oxidative phosphorylation (OXPHOS) and tricarboxylic acid cycle (TCA) enzymes, mitochondrial metabolic function, adenosine triphosphate (ATP) level and acetylcholinesterase (AChE) activity were assessed in rat brain. Cytosolic and mitochondrial antioxidant enzymes were significantly diminished in the brains of rats treated with ACR compared to those in control. Besides, ACR treatment resulted in a significant reduction in brain ATP level, mitochondrial metabolic function, OXPHOS and TCA enzymes. Administration of AO restored both the cytosolic and mitochondrial oxidative stress by normalizing nicotinamide adenine dinucleotide phosphate (NADPH) generating enzymes. In addition, improved mitochondrial function primarily enhancing nicotinamide adenine dinucleotide (NADH) generated enzymes activities and ATP level in the mitochondria. The reason for AO's obvious beneficial effects in this study may be due to synergistic effects of its different bioactive compounds which is especially effective on mitochondria. Modulation of the brain mitochondrial functions and antioxidant systems by AO may lead to the development of new mitochondria-targeted antioxidants in the future. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Bai, Xiuzhi; Zhang, Ting; Qu, Zhipeng; Li, Haipu; Yang, Zhaoguang
2017-09-01
In this study, the distribution of 2,4,6-trichloroanisole (2,4,6-TCA) in two water supply reservoirs and four associated drinking water treatment plants (DWTPs) were investigated. The 2,4,6-TCA concentrations were in the range of 1.53-2.36 ng L -1 in water supply reservoirs and 0.76-6.58 ng L -1 at DWTPs. To determine the contribution of filamentous fungi to 2,4,6-TCA in a full-scale treatment process, the concentrations of 2,4,6-TCA in raw water, settled water, post-filtration water, and finished water were measured. The results showed that 2,4,6-TCA levels continuously increased until chlorination, suggesting that 2,4,6-TCA could form without a chlorination reaction and fungi might be the major contributor to the 2,4,6-TCA formation. Meanwhile, twenty-nine fungal strains were isolated and identified by morphological and molecular biological methods. Of the seventeen isolated fungal species, eleven showed the capability to convert 2,4,6-trichlorophenol (2,4,6-TCP) to 2,4,6-TCA. The highest level of 2,4,6-TCA formation was carried out by Aspergillus versicolor voucher BJ1-3: 40.5% of the original 2,4,6-TCP was converted to 2,4,6-TCA. There was a significant variation in the capability of different species to generate 2,4,6-TCA. The results from the proportions of cell-free, cell-attached, and cell-bound 2,4,6-TCA suggested that 2,4,6-TCA generated by fungi was mainly distributed in their extracellular environment. In addition to 2,4,6-TCA, five putative volatile by-products were also identified by gas chromatography and mass spectrometry. These findings increase our understanding on the mechanisms involved in the formation of 2,4,6-TCA and provide insights into managing and controlling 2,4,6-TCA-related problems in drinking water. Copyright © 2017 Elsevier Ltd. All rights reserved.
Sunitha, Balaraju; Gayathri, Narayanappa; Kumar, Manish; Keshava Prasad, Thottethodi Subrahmanya; Nalini, Atchayaram; Padmanabhan, Balasundaram; Srinivas Bharath, Muchukunte Mukunda
2016-07-01
Muscle diseases are clinically and genetically heterogeneous and manifest as dystrophic, inflammatory and myopathic pathologies, among others. Our previous study on the cardiotoxin mouse model of myodegeneration and inflammation linked muscle pathology with mitochondrial damage and oxidative stress. In this study, we investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies from muscle disease patients, represented by dysferlinopathy (dysfy) (dystrophic pathology; n = 43), polymyositis (PM) (inflammatory pathology; n = 24), and distal myopathy with rimmed vacuoles (DMRV) (distal myopathy; n = 31) were analyzed. Mitochondrial damage (ragged blue and COX-deficient fibers) was revealed in dysfy, PM, and DMRV cases by enzyme histochemistry (SDH and COX-SDH), electron microscopy (vacuolation and altered cristae) and biochemical assays (significantly increased ADP/ATP ratio). Proteomic analysis of muscle mitochondria from all three muscle diseases by isobaric tag for relative and absolute quantitation labeling and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis demonstrated down-regulation of electron transport chain (ETC) complex subunits, assembly factors and Krebs cycle enzymes. Interestingly, 80 of the under-expressed proteins were common among the three pathologies. Assay of ETC and Krebs cycle enzyme activities validated the MS data. Mitochondrial proteins from muscle pathologies also displayed higher tryptophan (Trp) oxidation and the same was corroborated in the cardiotoxin model. Molecular modeling predicted Trp oxidation to alter the local structure of mitochondrial proteins. Our data highlight mitochondrial alterations in muscle pathologies, represented by morphological changes, altered mitochondrial proteome and protein oxidation, thereby establishing the role of mitochondrial damage in human muscle diseases. We investigated whether human muscle diseases display mitochondrial changes. Muscle biopsies from dysferlinopathy (Dysfy), polymyositis (PM), and distal myopathy with rimmed vacuoles (DMRV) displayed morphological and biochemical evidences of mitochondrial dysfunction. Proteomic analysis revealed down-regulation of electron transport chain (ETC) subunits, assembly factors, and tricarboxylic acid (TCA) cycle enzymes, with 80 proteins common among the three pathologies. Mitochondrial proteins from muscle pathologies also displayed higher Trp oxidation that could alter the local structure. Cover image for this issue: doi: 10.1111/jnc.13324. © 2016 International Society for Neurochemistry.
TCA High Lift Preliminary Assessment
NASA Technical Reports Server (NTRS)
Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.
1999-01-01
This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.
Tian, Cihui; Asghar, Sajid; Wu, Yifan; Chen, Zhipeng; Jin, Xin; Yin, Lining; Huang, Lin; Ping, Qineng; Xiao, Yanyu
2017-01-01
The expression of multiple receptors on intestinal epithelial cells enables an actively targeted carrier to significantly enhance the oral delivery of payloads. Conjugating the receptors' ligands on the surfaces of a particulate-delivery system allows site-specific targeting. Here, we used taurocholic acid (TCA) as a ligand for uptake of nanostructured lipid carriers (NLCs) mediated by a bile-acid transporter to improve oral bioavailability of curcumin (Cur). First, synthesis of TCA-polyethylene glycol 100-monostearate (S100-TCA) was carried out. Then, the physical and chemical properties of S100-TCA-modified Cur-loaded NLCs (Cur-TCA NLCs) with varying levels of S100-TCA modifications were investigated. Small particle size (<150 nm), high drug encapsulation (>90%), drug loading (about 3%), negative ζ-potential (-7 to -3 mV), and sustained release were obtained. In situ intestinal perfusion studies demonstrated improved absorption rate and permeability coefficient of Cur-TCA NLCs. Depending on the degree of modification, Cur-TCA NLCs displayed about a five- to 15-fold higher area under the curve in rats after oral administration than unmodified Cur NLCs, which established that the addition of S100-TCA to the NLCs boosted absorption of Cur. Further investigations of TCA NLCs might reveal a bright future for effective oral delivery of poorly bioavailable drugs.
Kaku, Yoshio; Ookawara, Susumu; Miyazawa, Haruhisa; Ito, Kiyonori; Ueda, Yuichirou; Hirai, Keiji; Hoshino, Taro; Mori, Honami; Yoshida, Izumi; Morishita, Yoshiyuki; Tabei, Kaoru
2016-02-01
The following conventional calcium correction formula (Payne) is broadly applied for serum calcium estimation: corrected total calcium (TCa) (mg/dL) = TCa (mg/dL) + (4 - albumin (g/dL)); however, it is inapplicable to chronic kidney disease (CKD) patients. A total of 2503 venous samples were collected from 942 all-stage CKD patients, and levels of TCa (mg/dL), ionized calcium ([iCa(2+) ] mmol/L), phosphate (mg/dL), albumin (g/dL), and pH, and other clinical parameters were measured. We assumed corrected TCa (the gold standard) to be equal to eight times the iCa(2+) value (measured corrected TCa). Then, we performed stepwise multiple linear regression analysis by using the clinical parameters and derived a simple formula for corrected TCa approximation. The following formula was devised from multiple linear regression analysis: Approximated corrected TCa (mg/dL) = TCa + 0.25 × (4 - albumin) + 4 × (7.4 - p H) + 0.1 × (6 - phosphate) + 0.3. Receiver operating characteristic curves analysis illustrated that area under the curve of approximated corrected TCa for detection of measured corrected TCa ≥ 8.4 mg/dL and ≤ 10.4 mg/dL were 0.994 and 0.919, respectively. The intraclass correlation coefficient demonstrated superior agreement using this new formula compared to other formulas (new formula: 0.826, Payne: 0.537, Jain: 0.312, Portale: 0.582, Ferrari: 0.362). In CKD patients, TCa correction should include not only albumin but also pH and phosphate. The approximated corrected TCa from this formula demonstrates superior agreement with the measured corrected TCa in comparison to other formulas. © 2016 International Society for Apheresis, Japanese Society for Apheresis, and Japanese Society for Dialysis Therapy.
Yin, Zepeng; Ren, Jing; Zhou, Lijuan; Sun, Lina; Wang, Jiewan; Liu, Yulong; Song, Xingshun
2016-01-01
Drought (Water deficit, WD) poses a serious threat to extensively economic losses of trees throughout the world. Chinese dwarf cherry ( Cerasus humilis ) is a good perennial plant for studying the physiological and sophisticated molecular network under WD. The aim of this study is to identify the effect of WD on C. humilis through physiological and global proteomics analysis and improve understanding of the WD resistance of plants. Currently, physiological parameters were applied to investigate C. humilis response to WD. Moreover, we used two-dimensional gel electrophoresis (2DE) to identify differentially expressed proteins in C. humilis leaves subjected to WD (24 d). Furthermore, we also examined the correlation between protein and transcript levels. Several physiological parameters, including relative water content and Pn were reduced by WD. In addition, the malondialdehyde (MDA), relative electrolyte leakage (REL), total soluble sugar, and proline were increased in WD-treated C. humilis . Comparative proteomic analysis revealed 46 protein spots (representing 43 unique proteins) differentially expressed in C. humilis leaves under WD. These proteins were mainly involved in photosynthesis, ROS scavenging, carbohydrate metabolism, transcription, protein synthesis, protein processing, and nitrogen and amino acid metabolisms, respectively. WD promoted the CO 2 assimilation by increase light reaction and Calvin cycle, leading to the reprogramming of carbon metabolism. Moreover, the accumulation of osmolytes (i.e., proline and total soluble sugar) and enhancement of ascorbate-glutathione cycle and glutathione peroxidase/glutathione s-transferase pathway in leaves could minimize oxidative damage of membrane and other molecules under WD. Importantly, the regulation role of carbohydrate metabolisms (e. g. glycolysis, pentose phosphate pathways, and TCA) was enhanced. These findings provide key candidate proteins for genetic improvement of perennial plants metabolism under WD.
Jayakumar, A R; Bak, L K; Rama Rao, K V; Waagepetersen, H S; Schousboe, A; Norenberg, M D
2016-02-01
Traumatic brain injury (TBI) is a devastating neurological disorder that usually presents in acute and chronic forms. Brain edema and associated increased intracranial pressure in the early phase following TBI are major consequences of acute trauma. On the other hand, neuronal injury, leading to neurobehavioral and cognitive impairments, that usually develop months to years after single or repetitive episodes of head trauma, are major consequences of chronic TBI. The molecular mechanisms responsible for TBI-induced injury, however, are unclear. Recent studies have suggested that early mitochondrial dysfunction and subsequent energy failure play a role in the pathogenesis of TBI. We therefore examined whether oxidative metabolism of (13)C-labeled glucose, lactate or glutamine is altered early following in vitro mechanical percussion-induced trauma (5 atm) to neurons (4-24 h), and whether such events contribute to the development of neuronal injury. Cell viability was assayed using the release of the cytoplasmic enzyme lactate dehydrogenase (LDH), together with fluorescence-based cell staining (calcein and ethidium homodimer-1 for live and dead cells, respectively). Trauma had no effect on the LDH release in neurons from 1 to 18 h. However, a significant increase in LDH release was detected at 24 h after trauma. Similar findings were identified when traumatized neurons were stained with fluorescent markers. Additionally (13)C-labeling of glutamate showed a small, but statistically significant decrease at 14 h after trauma. However, trauma had no effect on the cycling ratio of the TCA cycle at any time-period examined. These findings indicate that trauma does not cause a disturbance in oxidative metabolism of any of the substrates used for neurons. Accordingly, such metabolic disturbance does not appear to contribute to the neuronal death in the early stages following trauma.
NASA Astrophysics Data System (ADS)
Wang, P. L.; Hsiao, K. T.; Lin, L. H.
2017-12-01
Amino acids represent one of the most important categories of biomolecule. Their abundance and isotopic patterns have been broadly used to address issues related to biochemical processes and elemental cycling in natural environments. Previous studies have shown that various carbon assimilative pathways of microorganisms (e.g. autotrophy, heterotrophy and acetotrophy) could be distinguished by carbon isotopic patterns of amino acids. However, the taxonomic and catabolic coverage are limited in previous examination. This study aims to uncover the carbon isotopic patterns of amino acids for microorganisms remaining uncharacterized but bearing biogeochemical and ecological significance in anoxic environments. To fulfill the purpose, two anaerobic strains were isolated from riverine wetland and mud volcano in Taiwan. One strain is a sulfate reducing bacterium (related to Desulfovibrio marrakechensis), which is capable of utilizing either H2 or lactate, and the other is a methanogen (related to Methanolobus profundi), which grows solely with methyl-group compounds. Carbon isotope analyses of amino acids were performed on cells grown in exponential and stationary phase. The isotopic patterns were similar for all examined cultures, showing successive 13C depletion along synthetic pathways. No significant difference was observed for the methanogen and lactate-utilizing sulfate reducer harvested in exponential and stationary phases. In contrast, the H2-utilizing sulfate reducer harvested in stationary phase depleted and enriched 13C in aspartic acid and glycine, respectively when compared with that harvested in exponential phase. Such variations might infer the change of carbon flux during synthesis of these two amino acids in the reverse TCA cycle. In addition, the discriminant function analysis for all available data from culture studies further attests the capability of using carbon isotope patterns of amino acids in identifying microbial metabolisms.
Yang, Jhung-Ahn; Yang, Sung-Hyun; Kim, Junghee; Kwon, Kae Kyoung; Oh, Hyun-Myung
2017-07-01
Here we report the comparative genomic analysis of strain UJ101 with 15 strains from the family Flavobacteriaceae, using the CGExplorer program. Flavobacteriales bacterium strain UJ101 was isolated from a xanthid crab, Atergatis reticulatus, from the East Sea near Korea. The complete genome of strain UJ101 is a 3,074,209 bp, single, circular chromosome with 30.74% GC content. While the UJ101 genome contains a number of annotated genes for many metabolic pathways, such as the Embden-Meyerhof pathway, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the glyoxylate cycle, genes for the Entner-Douddoroff pathway are not found in the UJ101 genome. Overall, carbon fixation processes were absent but nitrate reduction and denitrification pathways were conserved. The UJ101 genome was compared to genomes from other marine animals (three invertebrate strains and 5 fish strains) and other marine animal- derived genera. Notable results by genome comparisons showed that UJ101 is capable of denitrification and nitrate reduction, and that biotin-thiamine pathway participation varies among marine bacteria; fish-dwelling bacteria, freeliving bacteria, invertebrate-dwelling bacteria, and strain UJ101. Pan-genome analysis of the 16 strains in this study included 7,220 non-redundant genes that covered 62% of the pan-genome. A core-genome of 994 genes was present and consisted of 8% of the genes from the pan-genome. Strain UJ101 is a symbiotic hetero-organotroph isolated from xanthid crab, and is a metabolic generalist with nitrate-reducing abilities but without the ability to synthesize biotin. There is a general tendency of UJ101 and some fish pathogens to prefer thiamine-dependent glycolysis to gluconeogenesis. Biotin and thiamine auxotrophy or prototrophy may be used as important markers in microbial community studies.
NASA Astrophysics Data System (ADS)
Dijkstra, P.; Fairbanks, D.; Miller, E.; Salpas, E.; Hagerty, S.
2013-12-01
Understanding the mechanisms regulating C cycling is hindered by our inability to directly observe and measure the biochemical processes of glycolysis, pentose phosphate pathway, and TCA cycle in intact and complex microbial communities. Position-specific 13C labeled metabolic tracer probing is proposed as a new way to study microbial community energy production, biosynthesis, C use efficiency (the proportion of substrate incorporated into microbial biomass), and enables the quantification of C fluxes through the central C metabolic network processes (Dijkstra et al 2011a,b). We determined the 13CO2 production from U-13C, 1-13C, 2-13C, 3-13C, 4-13C, 5-13C, and 6-13C labeled glucose and 1-13C and 2,3-13C pyruvate in parallel incubations in three soils along an elevation gradient. Qualitative and quantitative interpretation of the results indicate a high pentose phosphate pathway activity in soils. Agreement between modeled and measured CO2 production rates for the six C-atoms of 13C-labeled glucose indicate that the metabolic model used is appropriate for soil community processes, but that improvements can be made. These labeling and modeling techniques may improve our ability to analyze the biochemistry and (eco)physiology of intact microbial communities. Dijkstra, P., Blankinship, J.C., Selmants, P.C., Hart, S.C., Koch, G.W., Schwartz, E., Hungate, B.A., 2011a. Probing C flux patterns of soil microbial metabolic networks using parallel position-specific tracer labeling. Soil Biology & Biochemistry 43, 126-132. Dijkstra, P., Dalder, J.J., Selmants, P.C., Hart, S.C., Koch, G.W., Schwartz, E., Hungate, B.A., 2011b. Modeling soil metabolic processes using isotopologue pairs of position-specific 13C-labeled glucose and pyruvate. Soil Biology & Biochemistry 43, 1848-1857.
Phenotypic and metabolic responses to drought and salinity of four contrasting lentil accessions
Muscolo, A.; Junker, A.; Klukas, C.; Weigelt-Fischer, K.; Riewe, D.; Altmann, T.
2015-01-01
Drought and salinity are among the major abiotic stresses which, often inter-relatedly, adversely affect plant growth and productivity. Plant stress responses depend on the type of stress, on its intensity, on the species, and also on the genotype. Different accessions of a species may have evolved different mechanisms to cope with stress and to complete their life cycles. This study is focused on lentil, an important Mediterranean legume with high quality protein for the human diet. The effects of salinity and drought on germination and early growth of Castelluccio di Norcia (CAST), Pantelleria (PAN), Ustica (UST), and Eston (EST) accessions were evaluated to identify metabolic and phenotypic traits related to drought and/or salinity stress tolerance. The results showed a relationship between imposed stresses and performance of the cultivars. According to germination frequencies, the accession ranking was as follows: NaCl resistant > susceptible, PAN > UST > CAST > EST; polyethylene glycol (PEG) resistant > susceptible, CAST > UST > EST > PAN. Seedling tolerance rankings were: NaCl resistant > susceptible, CAST ≈ UST > PAN ≈ EST; PEG resistant > susceptible, CAST > EST ≈ UST > PAN. Changes in the metabolite profiles, mainly quantitative rather than qualitative, were observed in the same cultivar in respect to the treatments, and among the cultivars under the same treatment. Metabolic differences in the stress tolerance of the different genotypes were related to a reduction in the levels of tricarboxylic acid (TCA) cycle intermediates. The relevant differences, between the most NaCl-tolerant genotype (PAN) and the most sensitive one (EST) were related to the decrease in the threonic acid level. Stress-specific metabolite indicators were also identified: ornithine and asparagine as markers of drought stress and alanine and homoserine as markers of salinity stress. PMID:25969553
Thongkum, Angkana; Wu, Chunjing; Li, Ying-Ying; Wangpaichitr, Medhi; Navasumrit, Panida; Parnlob, Varabhorn; Sricharunrat, Thaniya; Bhudhisawasdi, Vajarabhongsa; Ruchirawat, Mathuros; Savaraj, Niramol
2017-01-01
Argininosuccinate synthetase (ASS), a key enzyme to synthesize arginine is down regulated in many tumors including hepatocellular carcinoma (HCC). Similar to previous reports, we have found the decrease in ASS expression in poorly differentiated HCC. These ASS(-) tumors are auxotrophic for arginine. Pegylated arginine deiminase (ADI-PEG20), which degrades arginine, has shown activity in these tumors, but the antitumor effect is not robust and hence combination treatment is needed. Herein, we have elucidated the effectiveness of ADI-PEG20 combined with 5-Fluorouracil (5-FU) in ASS(-)HCC by targeting urea cycle and pyrimidine metabolism using four HCC cell lines as model. SNU398 and SNU387 express very low levels of ASS or ASS(-) while Huh-1, and HepG2 express high ASS similar to normal cells. Our results showed that the augmented cytotoxic effect of combination treatment only occurs in SNU398 and SNU387, and not in HepG2 and Huh-1 (ASS(+)) cells, and is partly due to reduced anti-apoptotic proteins X-linked inhibitor of apoptosis protein (XIAP), myeloid leukemia cell differentiation protein (Mcl-1) and B-cell lymphoma-2 (Bcl-2). Importantly, lack of ASS also influences essential enzymes in pyrimidine synthesis (carbamoyl-phosphate synthetase2, aspartate transcarbamylase and dihydrooratase (CAD) and thymidylate synthase (TS)) and malate dehydrogenase-1 (MDH-1) in TCA cycle. ADI-PEG20 treatment decreased these enzymes and made them more vulnerable to 5-FU. Transfection of ASS restored these enzymes and abolished the sensitivity to ADI-PEG20 and combination treatment. Overall, our data suggest that ASS influences multiple enzymes involved in 5-FU sensitivity. Combining ADI-PEG20 and 5-FU may be effective to treat ASS(-)hepatoma and warrants further clinical investigation. PMID:28587170
Thongkum, Angkana; Wu, Chunjing; Li, Ying-Ying; Wangpaichitr, Medhi; Navasumrit, Panida; Parnlob, Varabhorn; Sricharunrat, Thaniya; Bhudhisawasdi, Vajarabhongsa; Ruchirawat, Mathuros; Savaraj, Niramol
2017-06-01
Argininosuccinate synthetase (ASS), a key enzyme to synthesize arginine is down regulated in many tumors including hepatocellular carcinoma (HCC). Similar to previous reports, we have found the decrease in ASS expression in poorly differentiated HCC. These ASS(-) tumors are auxotrophic for arginine. Pegylated arginine deiminase (ADI-PEG20), which degrades arginine, has shown activity in these tumors, but the antitumor effect is not robust and hence combination treatment is needed. Herein, we have elucidated the effectiveness of ADI-PEG20 combined with 5-Fluorouracil (5-FU) in ASS(-)HCC by targeting urea cycle and pyrimidine metabolism using four HCC cell lines as model. SNU398 and SNU387 express very low levels of ASS or ASS(-) while Huh-1, and HepG2 express high ASS similar to normal cells. Our results showed that the augmented cytotoxic effect of combination treatment only occurs in SNU398 and SNU387, and not in HepG2 and Huh-1 (ASS(+)) cells, and is partly due to reduced anti-apoptotic proteins X-linked inhibitor of apoptosis protein (XIAP), myeloid leukemia cell differentiation protein (Mcl-1) and B-cell lymphoma-2 (Bcl-2). Importantly, lack of ASS also influences essential enzymes in pyrimidine synthesis (carbamoyl-phosphate synthetase2, aspartate transcarbamylase and dihydrooratase (CAD) and thymidylate synthase (TS)) and malate dehydrogenase-1 (MDH-1) in TCA cycle. ADI-PEG20 treatment decreased these enzymes and made them more vulnerable to 5-FU. Transfection of ASS restored these enzymes and abolished the sensitivity to ADI-PEG20 and combination treatment. Overall, our data suggest that ASS influences multiple enzymes involved in 5-FU sensitivity. Combining ADI-PEG20 and 5-FU may be effective to treat ASS(-)hepatoma and warrants further clinical investigation.
Anti-bacterial activity of Achatina CRP and its mechanism of action.
Mukherjee, Sandip; Barman, Soma; Mandal, Narayan Chandra; Bhattacharya, Shelley
2014-07-01
The physiological role of C-reactive protein (CRP), the classical acute-phase protein, is not well documented, despite many reports on biological effects of CRP in vitro and in model systems in vivo. It has been suggested that CRP protects mice against lethal toxicity of bacterial infections by implementing immunological responses. In Achatina fulica CRP is a constitutive multifunctional protein in haemolymph and considered responsible for their survival in the environment for millions of years. The efficacy of Achatina CRP (ACRP) was tested against both Salmonella typhimurium and Bacillus subtilis infections in mice where endogenous CRP level is negligible even after inflammatory stimulus. Further, growth curves of the bacteria revealed that ACRP (50 microg/mL) is bacteriostatic against gram negative salmonellae and bactericidal against gram positive bacilli. ACRP induced energy crises in bacterial cells, inhibited key carbohydrate metabolic enzymes such as phosphofructokinase in glycolysis, isocitrate dehydrogenase in TCA cycle, isocitrate lyase in glyoxylate cycle and fructose-1,6-bisphosphatase in gluconeogenesis. ACRP disturbed the homeostasis of cellular redox potential as well as reduced glutathione status, which is accompanied by an enhanced rate of lipid peroxidation. Annexin V-Cy3/CFDA dual staining clearly showed ACRP induced apoptosis-like death in bacterial cell population. Moreover, immunoblot analyses also indicated apoptosis-like death in ACRP treated bacterial cells, where activation of poly (ADP-ribose) polymerase-1 (PARP) and caspase-3 was noteworthy. It is concluded that metabolic impairment by ACRP in bacterial cells is primarily due to generation of reactive oxygen species and ACRP induced anti-bacterial effect is mediated by metabolic impairment leading to apoptosis-like death in bacterial cells.
Sudheesh, N P; Ajith, T A; Janardhanan, K K
2013-04-30
Decreased mitochondrial function has been suggested to be one of the important pathological events in isoproterenol (ISO)-induced cardiotoxicity. In this communication, we have evaluated the protective effect of Ganoderma lucidum against ISO induced cardiac toxicity and mitochondrial dysfunction. Cardiac toxicity was assessed by determining the activities of creatine kinase (CK) and lactate dehydrogenases (LDH) after subcutaneous injection of ISO (85 mg/kg) at an interval of 24h for 2 days. The animals were sacrificed 24h after last ISO administration. G. lucidum (100 and 250 mg/kg, p.o.) was given to the rats once daily for 15 days prior to the ISO challenge. Similarly, α-Tocopherol (100mg/kg, p.o) was kept as the standard. To assess the extent of cardiac mitochondrial damage, the activities of Krebs cycle dehydrogenases and mitochondrial complexes I, II, III, and IV as well as the level of ROS and mitochondrial membrane potential (ΔΨmt) were evaluated. Administration of G. lucidum and α-tocopherol significantly protected the elevated activities of CK and LDH. Further, the activities of mitochondrial enzymes and the level of ΔΨmt were significantly enhanced and the level of ROS was significantly declined in the G. lucidum and α-tocopherol treatments. The present study concluded that the cardiac mitochondrial enzymes are markedly declined by the ISO challenge and the administration G. lucidum and α-Tocopherol significantly protected mitochondria by preventing the decline of antioxidant status and ΔΨmt or by directly scavenging the free radicals. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.