Clinical implications of a rare renal entity: Pleomorphic Hyalinizing Angiectatic Tumor (PHAT).

PubMed

Scalici Gesolfo, Cristina; Serretta, Vincenzo; Di Maida, Fabrizio; Giannone, Giulio; Barresi, Elisabetta; Franco, Vito; Montironi, Rodolfo

2017-02-01

Pleomorphic Hyalinizing Angiectatic Tumor (PHAT) is a rare benign lesion characterized by slow growth, infiltrative behavior and high rate of local recurrences. Only one case has been described in retroperitoneum, at renal hilum, but not involving pelvis or parenchyma. Here we present the first case of PHAT arising in the renal parenchyma. A nodular lesion in right kidney lower pole was diagnosed to a 61 year old woman. The patient underwent right nephrectomy. Microscopically, the lesion showed solid and pseudo-cystic components with hemorrhagic areas characterized by aggregates of ectatic blood vessels. Pleomorphic cells were characterized by large eosinophilic cytoplasm with irregular and hyperchromatic nuclei. Immunohistochemistry was performed and the lesion was classified as a Pleomorphic Hyalinizing Angiectatic Tumor (PHAT). Due to the clinical behavior of this tumor, in spite of its benign nature, review of the surgical margins and close follow up after partial nephrectomy are mandatory. Copyright © 2016. Published by Elsevier GmbH.

Low enhancement on multiphase contrast-enhanced CT images: an independent predictor of the presence of high tumor grade of clear cell renal cell carcinoma.

PubMed

Zhu, Ye-Hua; Wang, Xun; Zhang, Jin; Chen, Yong-Hui; Kong, Wen; Huang, Yi-Ran

2014-09-01

The purpose of this study was to assess the relation between tumor enhancement on multiphase contrast-enhanced CT images and Fuhrman grade of clear cell renal cell carcinoma. A single-institution retrospective review was conducted on the records of 255 patients who underwent radical or partial nephrectomy and received a histologic diagnosis of clear cell renal cell carcinoma. Two radiologists recorded the radiographic features of each patient, including the attenuation value of the lesion, lesion size, calcification within the lesion, cystic versus solid appearance, and margin regularity. Parameters representing the extent of tumor enhancement were defined and calculated. The association between tumor enhancement and Fuhrman grade was analyzed, and multivariate analysis was performed to find independent predictors of high tumor grade. Significant differences existed in tumor enhancement among different Fuhrman grades (p < 0.001). High-grade tumors had significantly lower enhancement (p < 0.001). The enhancement parameter had a sensitivity of 0.84 and specificity of 0.93 in prediction of high tumor grade. In the multivariate analysis, more advanced age, irregular margin, and low tumor enhancement were the three independent predictors of high tumor grade. Tumor enhancement of clear cell renal cell carcinoma on multiphase contrast-enhanced CT images is associated with Fuhrman grade. Low tumor enhancement in the corticomedullary phase is an independent predictor of high tumor grade. This system may be helpful in clinical decision making about the care of patients treated by nonsurgical approaches.

The normal and pathologic renal medulla: a comprehensive overview.

PubMed

López, José I; Larrinaga, Gorka; Kuroda, Naoto; Angulo, Javier C

2015-04-01

The renal medulla comprises an intricate system of tubules, blood vessels and interstitium that is not well understood by most general pathologists. We conducted an extensive review of the literature on the renal medulla, in both normal and pathologic conditions. We set out in detail the points of key interest to pathologists: normal and pathological development, physiology, microscopic anatomy, histology and immunohistochemistry; and the specific and most common other types of disease associated with this part of the kidney: developmental abnormalities, (multicystic dysplastic kidney, autosomal dominant and recessive polycystic kidney diseases, medullary cystic kidney disease), inflammatory conditions (xanthogranulomatous pyelonephritis, malakoplakia), hyperplasia and dysplasia, and neoplastic processes (oncocytoma, atypical oncocytic tumors, chromophobe cell carcinoma, collecting duct carcinoma, urothelial carcinoma, other carcinomas, renal medullary fibroma and metastatic tumors). This condensed overview of the origin, function and pathology of the renal medulla, both in terms of development, inflammation and neoplastic processes, should help focus the interest of clinical pathologists on this widely overlooked part of the kidney. Copyright © 2014 Elsevier GmbH. All rights reserved.

Spontaneous Renal Tumors Suspected of Being Familial in Sprague-Dawley Rats

PubMed Central

Kudo, Kayoko; Hoshiya, Toru; Nakazawa, Tomomi; Saito, Tsubasa; Shimoyama, Natsumi; Suzuki, Isamu; Tamura, Kazutoshi; Seely, John Curtis

2012-01-01

Spontaneous renal tubule tumors (RTTs), with a distinctive morphological phenotype, were present in three Sprague-Dawley rats, 1 male and 2 females, out a total of 120 animals of each sex from untreated and placebo control groups in a 2-year carcinogenicity study. One female had one carcinoma, adenoma and hyperplasia, and the other female had five adenomas and many hyperplastic lesions; the male case had one carcinoma. From these cases, a biological continuum of hyperplasia, adenoma and carcinoma could be recognized. The tumors were present in the renal cortex and appeared as solid lobulated growths with occasional central necrosis. The lobules were divided by a small amount of fibrovascular tissue. Occasionally the larger tumors contained a cystic area. Tumor cells appeared distinctive and exhibited variable amounts of eosinophilic/amphophilic and vacuolated cytoplasm. Nuclei were round to oval with a prominent nucleolus. Mitotic figures were uncommon, and no distant metastasis was noted. The tumors were seen as multiple and bilateral lesions in two animals and had no apparent relationship to chronic progressive nephropathy (CPN). Foci of tubule hyperplasia were also noted to contain the same type of cellular morphology. The morphological and biological features of these 3 cases resembled the amphophilic-vacuolar (AV) variant of RTT that has been posited to be of familial origin. This is a report of spontaneous familial renal tumors in Sprague-Dawley rats from Japan. PMID:23345931

Spontaneous renal tumors suspected of being familial in sprague-dawley rats.

PubMed

Kudo, Kayoko; Hoshiya, Toru; Nakazawa, Tomomi; Saito, Tsubasa; Shimoyama, Natsumi; Suzuki, Isamu; Tamura, Kazutoshi; Seely, John Curtis

2012-12-01

Spontaneous renal tubule tumors (RTTs), with a distinctive morphological phenotype, were present in three Sprague-Dawley rats, 1 male and 2 females, out a total of 120 animals of each sex from untreated and placebo control groups in a 2-year carcinogenicity study. One female had one carcinoma, adenoma and hyperplasia, and the other female had five adenomas and many hyperplastic lesions; the male case had one carcinoma. From these cases, a biological continuum of hyperplasia, adenoma and carcinoma could be recognized. The tumors were present in the renal cortex and appeared as solid lobulated growths with occasional central necrosis. The lobules were divided by a small amount of fibrovascular tissue. Occasionally the larger tumors contained a cystic area. Tumor cells appeared distinctive and exhibited variable amounts of eosinophilic/amphophilic and vacuolated cytoplasm. Nuclei were round to oval with a prominent nucleolus. Mitotic figures were uncommon, and no distant metastasis was noted. The tumors were seen as multiple and bilateral lesions in two animals and had no apparent relationship to chronic progressive nephropathy (CPN). Foci of tubule hyperplasia were also noted to contain the same type of cellular morphology. The morphological and biological features of these 3 cases resembled the amphophilic-vacuolar (AV) variant of RTT that has been posited to be of familial origin. This is a report of spontaneous familial renal tumors in Sprague-Dawley rats from Japan.

The radiologist's role in the management of papillary renal cell carcinoma.

PubMed

Corral de la Calle, M Á; Encinas de la Iglesia, J; Martín López, M R; Fernández Pérez, G C; Águeda Del Bas, D S

Papillary carcinoma is the second most common renal cell carcinoma. It has a better prognosis than the more frequent clear cell carcinoma, although this does not hold true for advanced cases, because no specific treatment exists. It presents as a circumscribed peripheral tumor (small and homogeneously solid or larger and cystic/hemorrhagic) or as an infiltrating lesion that invades the veins, which has a worse prognosis. Due to their low vascular density, papillary renal cell carcinomas enhance less than other renal tumors, and this facilitates their characterization. On computed tomography, they might not enhance conclusively, and in these cases they are impossible to distinguish from hyperattenuating cysts. Contrast-enhanced ultrasonography and magnetic resonance imaging are more sensitive for detecting vascularization. Other characteristics include a specific vascular pattern, hypointensity on T2-weighted images, restricted water diffusion, and increased signal intensity in opposed phase images. We discuss the genetic, histologic, clinical, and radiological aspects of these tumors in which radiologists play a fundamental role in management. Copyright © 2016 SERAM. Publicado por Elsevier España, S.L.U. All rights reserved.

Xp11.2 translocation renal cell carcinoma occurring during pregnancy with a novel translocation involving chromosome 19: a case report with review of the literature

PubMed Central

Armah, Henry B; Parwani, Anil V; Surti, Urvashi; Bastacky, Sheldon I

2009-01-01

The recently recognized renal cell carcinomas (RCCs) associated with Xp11.2 translocations (TFE3 transcription factor gene fusions) are rare tumors predominantly reported in children. They comprise at least one-third of pediatric RCCs and only few adult cases have been reported. Here, we present a case of Xp11.2 translocation RCC in 26-year-old pregnant female. Her routine antenatal ultrasonography accidentally found a complex cystic right renal mass. Further radiologic studies revealed unilocular cyst with multiple mural nodules at inferior pole of right kidney, which was suspicious for RCC. She underwent right radical nephrectomy at 15 weeks gestation. Macroscopically, the cystic tumor was well encapsulated with multiple friable mural nodules on its inner surface. Microscopically, the tumor consisted of clear and eosinophilic/oncocytic voluminous cells arranged in papillary, trabecular, and nested/alveolar patterns. Occasional hyaline nodules and numerous psammoma bodies were present. Immunohistochemically, the tumor showed strong nuclear positivity for TFE3. Epithelial membrane antigen, CD10, and E-cadherin were strongly positive. Cytokeratin AE1/AE3, cytokeratin CAM-5.2, calveolin, and parvalbumin were moderately positive. Cytokeratin 7, renal cell carcinoma antigen, and colloidal iron were focally weakly positive. BerEP4 and carbonic anhydrase IX were negative. Cytogenetically, the tumor harbored a novel variant translocation involving chromosomes X and 19, t(X;19)(p11.2;q13.1). Interphase FISH analysis performed on cultured and uncultured tumor cells using a dual-color break-apart DNA probe within the BCL3 gene on 19q13.3 was negative for the BCL3 gene rearrangement. She received no adjuvant therapy, delivered a normal term baby five months later, and is alive without evidence of disease 27 months after diagnosis and surgery. Unlike most recently reported Xp11.2 translocation RCCs in adult patients with aggressive clinical course, this adult case occurring during pregnancy with a novel translocation involving chromosome 19 followed an indolent clinical course. PMID:19450277

Xp11.2 translocation renal cell carcinoma occurring during pregnancy with a novel translocation involving chromosome 19: a case report with review of the literature.

PubMed

Armah, Henry B; Parwani, Anil V; Surti, Urvashi; Bastacky, Sheldon I

2009-05-18

The recently recognized renal cell carcinomas (RCCs) associated with Xp11.2 translocations (TFE3 transcription factor gene fusions) are rare tumors predominantly reported in children. They comprise at least one-third of pediatric RCCs and only few adult cases have been reported. Here, we present a case of Xp11.2 translocation RCC in 26-year-old pregnant female. Her routine antenatal ultrasonography accidentally found a complex cystic right renal mass. Further radiologic studies revealed unilocular cyst with multiple mural nodules at inferior pole of right kidney, which was suspicious for RCC. She underwent right radical nephrectomy at 15 weeks gestation. Macroscopically, the cystic tumor was well encapsulated with multiple friable mural nodules on its inner surface. Microscopically, the tumor consisted of clear and eosinophilic/oncocytic voluminous cells arranged in papillary, trabecular, and nested/alveolar patterns. Occasional hyaline nodules and numerous psammoma bodies were present.Immunohistochemically, the tumor showed strong nuclear positivity for TFE3. Epithelial membrane antigen, CD10, and E-cadherin were strongly positive. Cytokeratin AE1/AE3, cytokeratin CAM-5.2, calveolin, and parvalbumin were moderately positive. Cytokeratin 7, renal cell carcinoma antigen, and colloidal iron were focally weakly positive. BerEP4 and carbonic anhydrase IX were negative. Cytogenetically, the tumor harbored a novel variant translocation involving chromosomes X and 19, t(X;19)(p11.2;q13.1). Interphase FISH analysis performed on cultured and uncultured tumor cells using a dual-color break-apart DNA probe within the BCL3 gene on 19q13.3 was negative for the BCL3 gene rearrangement. She received no adjuvant therapy, delivered a normal term baby five months later, and is alive without evidence of disease 27 months after diagnosis and surgery. Unlike most recently reported Xp11.2 translocation RCCs in adult patients with aggressive clinical course, this adult case occurring during pregnancy with a novel translocation involving chromosome 19 followed an indolent clinical course.

R.E.N.A.L. Nephrometry Score: A Preoperative Risk Factor Predicting the Fuhrman Grade of Clear-Cell Renal Carcinoma

PubMed Central

Chen, Shao-Hao; Wu, Yu-Peng; Li, Xiao-Dong; Lin, Tian; Guo, Qing-Yong; Chen, Ye-Hui; Huang, Jin-Bei; Wei, Yong; Xue, Xue-Yi; Zheng, Qing-Shui; Xu, Ning

2017-01-01

Objective: The purpose of this study was to evaluate the efficacy and feasibility of the R.E.N.A.L. Nephrometry Score to postoperatively predict high-grade clear-cell renal carcinoma (ccRCC). Methods: The study included 288 patients diagnosed with ccRCC who had complete CT/CTA data and R.E.N.A.L. Nephrometry Scores and underwent renal surgery at our center between January 2012 and December 2015. The relationship between the pathological grade of renal masses and R.E.N.A.L. Nephrometry Score was evaluated. Results: Univariate analysis indicated that diagnostic modality, cystic necrosis, enlargement of the regional lymph node, distant metastasis, clinical T stage, TNM stage, surgical modality, tumor size, nearness of the tumor to the collecting system or sinus, total Nephrometry Score and individual anatomic descriptor components were significantly associated with postoperative tumor grade (P < 0.05). Multivariate analysis showed that tumor size, the maximal diameter (R score), exophytic/endophytic properties (E score) and the location relative to the polar lines (L score) were independent prognostic factors to preoperatively predicting ccRCC pathological grade. The areas under the ROC curve with respect to the multi-parameter regression model (0.935, 95%CI: 0.904-0.966), tumor size (0.901, 95%CI: 0.866-0.937), R score (0.868, 95%CI: 0.825-0.911), E score (0.511, 95%CI: 0.442-0.581) and L score (0.842, 95%CI: 0.791-0.892) were calculated and compared. Conclusion: Tumor size, as well as R, E, and L scores were independent prognostic factors for high-grade pathology. Lager tumor sizes and higher R, E and L scores were more likely to be associated with high-grade pathological outcomes. Thus, the R.E.N.A.L. Score is of practical significance in facilitating urologists to make therapeutic decisions. PMID:29151960

A Case Report of Partial Nephrectomy of Mucinous Cystadenocarcinoma in Kidney and Its Literature Review

PubMed Central

Kim, Sung Han; Yuk, Heong Dong; Park, Weon Seo; Kim, Sun Ho; Joung, Jae Young; Seo, Ho Kyung; Lee, Kang Hyun; Chung, Jinsoo

2016-01-01

Mucinous cystadenocarcinoma (MC) of the kidney is a rare epithelial tumor originating from the renal pelvic urothelium and few study cases have been reported. Because of the rarity of these tumors and their unknown histogenesis, its diagnosis is difficult until surgical exploration. We report here on a 55-year-old man referred to the urology department from the hepatology department because of a cystic renal mass measuring approximately 5 cm in size, which was detected incidentally under ultrasonography during the routine examination of liver. The renal mass was finally diagnosed as MC originating from kidney after partial nephrectomy and the patient still showed no evidence of recurrence until 12 months postoperatively. This is the first report on a case of renal MC in a patient who underwent partial nephrectomy. The aim of this report is to present our unusual case of MC and also review the previous literature on the pathological and radiological aspects of MC of kidney. PMID:25687861

Renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions: findings on MRI and computed tomography imaging.

PubMed

Liu, Kefu; Xie, Ping; Peng, Weijun; Zhou, Zhengrong

2014-08-01

To retrospectively analyze MRI and computed tomographic (CT) findings from renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions (Xp11-RCC). Institutional review board permission was obtained to review patient medical records, and the requirement for informed consent was waved . The clinical and MRI/CT features of five cases with Xp11-RCC that were confirmed by pathology were analyzed retrospectively. The image characteristics included the lesion location and size, contribution of cystic and solid components, intratumoral necrosis or hemorrhage, invasion of perinephric tissue and renal sinus, lymphadenopathy, major venous or arterial vascular invasion, pattern of the tumor growth, intratumor calcification and lipids, homogeneity of SI on T2-weighted images, attenuation and SI of the mass with respect to the normal renal cortex on precontrast and contrasted CT/MRI images, tumor SIs, tumor attenuations and tumor-to-cortex indices, homogeneity of enhancement on the contrasted images. The mean age was 32 years (range, 15-47 years). Most patients (4/5) were women. All tumors showed a cortical location. The average tumor size was 9 cm (range, 4-18 cm). Four tumors comprised a predominantly solid lesion with focal necrosis, and one tumor comprised a solid lesion with significant necrosis. All tumors showed intertumor hemorrhage, infiltrative growth and invasion of the perirenal adipose/renal sinus. Four cases showed retroperitoneal lymphadenopathy, of which one case showed simultaneous mediastinal and supraclavicular lymphadenopathy. All tumors from four cases showed mild hyperintensity on T1-weighted MRI images, and three tumors showed hypointensity on T2-weighted MRI images relative to the renal cortex except for 1 tumor that showed significant hemorrhage and a relative hyperintensity. For 3 cases who were imaged with CT, two tumors imaged using nonenhanced CT images showed mild hyperdensity relative to the renal cortex. Calcification was noted in all three tumors. All tumors showed mild, persistent enhancement. Typical Xp11-RCC manifests as an advanced, solid renal mass with mild persistent enhancement, a prevalence of intertumor hemorrhage/calcification, and a cortical epicenter location. The predilection for children and young adults is a useful clinical feature when confirming a diagnosis of Xp11-RCC. © 2013 Wiley Periodicals, Inc.

[Value of contrast-enhanced ultrasound (CEUS) in the differential diagnosis between benign and malignant renal neoplasms].

PubMed

Zhang, Sheng; Wang, Xiao-qing; Xin, Xiao-jie; Xu, Yong

2013-05-01

To investigate the value of contrast enhanced ultrasound (CEUS) imaging in the differential diagnosis between benign and malignant renal neoplasms. Two hundred and forty-five cases of renal space-occupying lesions confirmed by biopsy or surgical pathology were included in this study. The CEUS features of the renal space-occupying lesions, i.e., the enhancement degree, homogeneity of enhancement, washing-in and washing-out time and enhancement pattern, were retrospectively analyzed. There were 210 cases of malignant renal tumors and 35 cases of benign lesions. The CEUS modes of the malignant renal tumors included "quick in and quick out" 82 cases, "quick in and slow out" 64 cases, "slow in and quick out" 18 cases and "slow in and slow out" 46 cases; good enhancement 150 cases (71.4%) and inhomogeneous enhancement 180 cases (85.7%).Both the contrast agent filling defect area and solid component enhancement of solid-cystic tumors were important features of malignant renal tumors. In the 35 cases of benign lesions,the CEUS modes included "quick in and quick out" 4 cases, "quick in and slow out" 8 cases, "slow in and quick out" 10 cases and "slow in and slow out" 13 cases. Most of the benign tumors showed low enhancement 51.4% (18/35) and inhomogeneous enhancement 54.3% (19/35). There were significant differences between the malignant and benign renal neoplasms in CEUS mode, degree of enhancement and homogeneity of enhancement (P < 0.05), and in time of increasing, peak time, peak intensity and peak intensity ratio (P < 0.05). The accuracy rates of contrast-enhanced ultrasound for diagnosis of benign and malignant tumors were 77.1% and 83.8%, respectively, while the two-dimensional ultrasound diagnosis of benign and malignant tumors were 68.6% and 76.7%, respectively, with a significant difference (P < 0.05). CEUS may provide more information to improve the diagnostic accuracy for renal neoplasms, and may play important role in differential diagnosis between benign and malignant renal lesions.

MDCT findings of renal cell carcinoma associated with Xp11.2 translocation and TFE3 gene fusion and papillary renal cell carcinoma.

PubMed

Woo, Sungmin; Kim, Sang Youn; Lee, Myoung Seok; Moon, Kyung Chul; Kim, See Hyung; Cho, Jeong Yeon; Kim, Seung Hyup

2015-03-01

OBJECTIVE. The purpose of this study was to compare the MDCT features of renal cell carcinoma (RCC) associated with Xp11.2 translocation and TFE3 gene fusion (Xp11 RCC) and papillary RCC. MATERIALS AND METHODS. The study included 19 and 39 patients with histologically proven Xp11 RCC and papillary RCC, respectively, who underwent multiphase renal MDCT before nephrectomy. CT findings were compared between Xp11 RCC and papillary RCC using the Student t test and chi-square test. Subgroup analyses of small (< 4 cm) renal masses for these features were performed. RESULTS. Patients with Xp11 RCC were younger (p < 0.001), and it was more prevalent in women (p = 0.007). Tumor size was greater in Xp11 RCC (p = 0.004) and more common in cystic change (p < 0.001). Calcification and unenhanced high-attenuating areas were more frequent in Xp11 RCC (p = 0.001 and 0.026, respectively). Xp11 RCCs were more prevalent in lymph node and distant metastasis (p < 0.001 and p = 0.031, respectively). Xp11 RCC and papillary RCC showed no significant difference in epicenter, margin, and venous and collecting duct invasion (p = 0.403-1.000). Although Xp11 RCC and papillary RCC had lower attenuation than the renal cortex on corticomedullary and early excretory phases (p < 0.001), only Xp11 RCCs were hyperattenuating to the cortex on the unenhanced phase (p < 0.001). Xp11 RCCs had significantly higher attenuation compared with papillary RCCs on all phases (p ≤ 0.02). Regarding small masses, cystic change, calcification, and lymph node metastasis were still more frequent in Xp11 RCCs (p ≤ 0.016). CONCLUSION. Greater size, more cystic change, calcification, high-attenuating areas on unenhanced imaging, and lymph node and distant metastasis were helpful for differentiating Xp11 RCC from papillary RCC.

Normal and abnormal development of the kidney: a clinician's interpretation of current knowledge.

PubMed

Glassberg, Kenneth I

2002-06-01

The recent basic science literature is replete with new discoveries in the molecular genetics of renal development. However, little of this information has filtered into urological textbooks and journals. An effort is made herein to integrate these new findings and propose a more sophisticated blueprint of renal development than the one traditionally taught in medical school and residency. To accomplish this goal the author offers simple definitions and interpretations of complicated terms and events, and points out how maldevelopment results when mutations take place. A review of recent advances in the molecular genetics of renal development and maldevelopment was done. Renal metanephric development results from the expression of many genes in the ureteral bud and metanephric blastema with each sending messages to the other to induce organogenesis. Currently an understanding of normal renal organogenesis stems from a study of disease states resulting from perturbations in molecular genetics. In turn, a better understanding of normal renal organogenesis facilitates an understanding of how dysplasia, hypoplasia, cystic disease and tumors develop when molecular genetics go awry. For each form of renal dysgenesis and for most renal tumors 1 or more gene defects are eventually identified. The young urologist based in these new discoveries would be better prepared to make the breakthroughs in the future that are necessary for advancing the prevention and management of these conditions.

Transitional cell carcinoma arising in a calyceal cyst mimicking a cystic renal tumour.

PubMed

Kim, Jeong Ho; Song, Joo Yeon; Lee, Wan

2014-01-01

Solitary renal cysts are relatively common. The occurrence of transitional cell carcinoma (TCC) in a renal cyst is rare. We present the case of a 59-year-old man with a medical history of viral hepatitis B. During a workup for his hepatitis, a computed tomography scan revealed a large cystic tumour in the upper region of the left kidney. A radical left nephrectomy was performed. Microscopic examination of the cystic tumour revealed a grade 2 TCC. The cyst was lined by transitional epithelium. This is a case of a TCC growing within a renal calyceal cyst.

[Autosomal-recessive renal cystic disease and congenital hepatic fibrosis: clinico-anatomic case].

PubMed

Rostol'tsev, K V; Burenkov, R A; Kuz'micheva, I A

2012-01-01

Clinico-anatomic observation of autosomal-recessive renal cystic disease and congenital hepatic fibrosis at two fetuses from the same family was done. Mutation of His3124Tyr in 58 exon of PKHD1 gene in heterozygous state was found out. The same pathomorphological changes in the epithelium of cystic renal tubules and bile ducts of the liver were noted. We suggest that the autopsy research of fetuses with congenital abnormalities, detected after prenatal ultrasonic screening, has high diagnostic importance.

Excisional treatment of renal hydatid cyst mimicking renal tumor with diode laser technique: A case report.

PubMed

Uçar, Murat; Karagözlü Akgül, Ahsen; Çelik, Fatih; Kılıç, Nizamettin

2016-08-01

Cystic echinococcosis, which is one of the most important helminthic infestations, is a serious life-threatening health problem in developing countries. Hydatid cyst of the kidney is a rare condition in children that can be treated with medical therapy or surgical treatment in some resistant cases. Here, we present a case of renal hydatid cyst that was treated with laparoscopic excision with diode laser. A 15-year-old female patient was admitted with abdominal pain. Abdominal ultrasonography revealed a 32 × 23 × 19-mm solid mass with cystic component at lower pole of right kidney. An indirect hemagglutination (IHA) test for echinococcosis granulosus was positive at a 1:320 titer. Other laboratory tests were within normal limits. The patient received albendazole therapy for 3 months. The follow-up magnetic resonance imaging showed a solitary lesion with exophytic extensions that contained large separations. No contrast enhancement could be detected after gadolinium injection. As no regression could be detected radiologically, surgical treatment was planned. Laparoscopic renal lower pole mass cyst excision with diode laser was performed (Figure). The patient was hospitalized for 1 day without any blood transfusion. Histopathological examination was consistent with hydatid cyst of the kidney. Diagnosis of hydatid cyst of the kidney is generally made incidentally and can be misdiagnosed as a primary kidney tumor. Radiological studies may be insufficient for accurate diagnosis. In our case, laparoscopic excision of cyst and histopathological examination confirmed the diagnosis of cyst hydatid. At the postoperative second month the ultrasonography of kidneys were normal. For patients from endemic areas, hydatid cyst should always be included in the differential diagnosis. Laparoscopic excision of renal hydatid cysts with diode laser is a feasible and safe technique for resistant cases. Copyright © 2016 Journal of Pediatric Urology Company. Published by Elsevier Ltd. All rights reserved.

Diagnostic Approach to Eosinophilic Renal Neoplasms

PubMed Central

Kryvenko, Oleksandr N.; Jorda, Merce; Argani, Pedram; Epstein, Jonathan I.

2015-01-01

Context Eosinophilic renal neoplasms include a spectrum of solid and papillary tumors ranging from indolent benign oncocytoma to highly aggressive malignancies. Recognition of the correct nature of the tumor, especially in biopsy specimens, is paramount for patient management. Objective To review the diagnostic approach to eosinophilic renal neoplasms with light microscopy and ancillary techniques. Data Sources Review of the published literature and personal experience. Conclusions The following tumors are in the differential diagnosis of oncocytic renal cell neoplasm: oncocytoma, chromophobe renal cell carcinoma (RCC), hybrid tumor, tubulocystic carcinoma, papillary RCC, clear cell RCC with predominant eosinophilic cell morphology, follicular thyroid-like RCC, hereditary leiomyomatosis–associated RCC, acquired cystic disease–associated RCC, rhabdoid RCC, microphthalmia transcription factor translocation RCC, epithelioid angiomyolipoma, and unclassified RCC. In low-grade nonpapillary eosinophilic neoplasms, distinction between oncocytoma and low-grade RCC mostly rests on histomorphology; however, cytokeratin 7 immunostain may be helpful. In high-grade nonpapillary lesions, there is more of a role for ancillary techniques, including immunohistochemistry for cytokeratin 7, CA9, CD10, racemase, HMB45, and Melan-A. In papillary eosinophilic neoplasms, it is important to distinguish sporadic type 2 papillary RCC from microphthalmia transcription factor translocation and hereditary leiomyomatosis–associated RCC. Histologic and cytologic features along with immunohistochemistry and fluorescence in situ hybridization tests for TFE3 (Xp11.2) and TFEB [t(6;11)] are reliable confirmatory tests. Eosinophilic epithelial neoplasms with architecture, cytology, and/or immunoprofile not qualifying for either of the established types of RCC should be classified as unclassified eosinophilic RCC and arbitrarily assigned a grade (low or high). PMID:25357116

Assessment of glomerular filtration rate and effective renal plasma flow in cystic fibrosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spino, M.; Chai, R.P.; Isles, A.F.

1985-07-01

A study was conducted to examine renal function in 10 healthy control subjects and eight patients with cystic fibrosis in stable condition. Sequential bolus injections of /sup 99m/Tc-DTPA and /sup 125/I-OIH were administered to assess glomerular filtration rate and effective renal plasma flow, respectively. Blood was subsequently collected for 3 hours, and urine for 24 hours. Renal clearances of both radioisotope markers were virtually identical in patients and controls. Inasmuch as neither glomerular filtration rate nor effective renal plasma flow was enhanced in patients with cystic fibrosis, increased clearance of drugs in these patients is unlikely to be the resultmore » of enhanced glomerular filtration or tubular secretion.« less

Sorting the Alphabet Soup of Renal Pathology: A Review.

PubMed

Curran-Melendez, Sheilah M; Hartman, Matthew S; Heller, Matthew T; Okechukwu, Nancy

2016-01-28

Diseases of the kidney often have their names shortened, creating an arcane set of acronyms which can be confusing to both radiologists and clinicians. This review of renal pathology aims to explain some of the most commonly used acronyms within the field. For each entity, a summary of the clinical features, pathophysiology, and radiological findings is included to aid in the understanding and differentiation of these entities. Discussed topics include acute cortical necrosis, autosomal dominant polycystic kidney disease, angiomyolipoma, autosomal recessive polycystic kidney disease, acute tubular necrosis, localized cystic renal disease, multicystic dysplastic kidney, multilocular cystic nephroma, multilocular cystic renal cell carcinoma, medullary sponge kidney, paroxysmal nocturnal hemoglobinuria, renal papillary necrosis, transitional cell carcinoma, and xanthogranulomatous pyelonephritis. Copyright © 2016 Mosby, Inc. All rights reserved.

Laparoscopic radiofrequency ablation-assisted enucleation of Xp11.2 translocation renal cell carcinoma: A case report

PubMed Central

XU, LINFENG; YANG, RONG; WANG, WEI; ZHANG, YIFEN; GAN, WEIDONG

2014-01-01

The current study presents a case of Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) in a 30-year-old female. The patient was referred to The Affiliated Drum Tower Hospital of the Medical College of Nanjing University (Nanjing, Jiangsu, China) due to a right renal tumor without evident symptoms, which was found by a routine physical examination. A computed tomography (CT) scan indicated that the mass exhibited cystic and solid components. The patient underwent laparoscopic radiofrequency ablation-assisted enucleation. Immunohistochemistry revealed intense nuclear staining for transcription factor E3 protein in the cancer cells. The patient was diagnosed with Xp11.2 RCC. The urological and radiological outcomes remained satisfactory after >2.5 years of follow-up. PMID:25120696

Laparoscopic radiofrequency ablation-assisted enucleation of Xp11.2 translocation renal cell carcinoma: A case report.

PubMed

Xu, Linfeng; Yang, Rong; Wang, Wei; Zhang, Yifen; Gan, Weidong

2014-09-01

The current study presents a case of Xp11.2 translocation renal cell carcinoma (Xp11.2 RCC) in a 30-year-old female. The patient was referred to The Affiliated Drum Tower Hospital of the Medical College of Nanjing University (Nanjing, Jiangsu, China) due to a right renal tumor without evident symptoms, which was found by a routine physical examination. A computed tomography (CT) scan indicated that the mass exhibited cystic and solid components. The patient underwent laparoscopic radiofrequency ablation-assisted enucleation. Immunohistochemistry revealed intense nuclear staining for transcription factor E3 protein in the cancer cells. The patient was diagnosed with Xp11.2 RCC. The urological and radiological outcomes remained satisfactory after >2.5 years of follow-up.

TFE3 break-apart FISH has a higher sensitivity for Xp11.2 translocation-associated renal cell carcinoma compared with TFE3 or cathepsin K immunohistochemical staining alone: expanding the morphologic spectrum.

PubMed

Rao, Qiu; Williamson, Sean R; Zhang, Shaobo; Eble, John N; Grignon, David J; Wang, Mingsheng; Zhou, Xiao-Jun; Huang, Wenbin; Tan, Puay-Hoon; Maclennan, Gregory T; Cheng, Liang

2013-06-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation is uncommon, characterized by several different translocations involving the TFE3 gene. We assessed the utility of break-apart fluorescence in situ hybridization (FISH) in establishing the diagnosis for suspected or unclassified cases with negative or equivocal TFE3 immunostaining by analyzing 24 renal cancers with break-apart TFE3 FISH and comparing the molecular findings with the results of TFE3 and cathepsin K immunostaining in the same tumors. Ten tumors were originally diagnosed as Xp11.2 RCC on the basis of positive TFE3 immunostaining, and 14 were originally considered unclassified RCCs with negative or equivocal TFE3 staining, but with a range of features suspicious for Xp11.2 RCC. Seventeen cases showed TFE3 rearrangement associated with Xp11.2 translocation by FISH, including all 13 tumors with moderate or strong TFE3 (n=10) or cathepsin K (n=7) immunoreactivity. FISH-positive cases showed negative or equivocal immunoreactivity for TFE3 or cathepsin K in 7 and 10 tumors, respectively (both=3). None had positive immunohistochemistry but negative FISH. Morphologic features were typical for Xp11.2 RCC in 10/17 tumors. Unusual features included 1 melanotic Xp11.2 renal cancer, 1 tumor with mixed features of Xp11.2 RCC and clear cell RCC, and other tumors mimicking clear cell RCC, multilocular cystic RCC, or high-grade urothelial carcinoma. Morphology mimicking high-grade urothelial carcinoma has not been previously reported in these tumors. Psammoma bodies, hyalinized stroma, and intracellular pigment were preferentially identified in FISH-positive cases compared with FISH-negative cases. Our results support the clinical application of a TFE3 break-apart FISH assay for diagnosis and confirmation of Xp11.2 RCC and further expand the histopathologic spectrum of these neoplasms to include tumors with unusual features. A renal tumor with pathologic or clinical features highly suggestive of translocation-associated RCC but exhibiting negative or equivocal TFE3 immunostaining should be evaluated by TFE3 FISH assay to fully assess this possibility.

A rare cause of childhood renal cysts: Xp11.2 translocation renal cell carcinoma

PubMed Central

Taşkınlar, Hakan; Avlan, Dinçer; Çıtak, Çağlar; Polat, Ayşe; Naycı, Ali

2015-01-01

Pediatric renal cysts are rare, usually asymptomatic and incidentally detected in children. Cyst associated renal cell carcinoma (RCC) or cystic RCC is extremely rare in children. Bosniak classification system has been accepted for the management of cystic renal masses. Xp11.2 translocation RCC is a recently classified distinct subtype and usually affects children and adolescents. We report the case of a 10-year-old girl with Xp11.2 translocation RCC from a cyst of the right kidney. PMID:25624966

A rare cause of childhood renal cysts: Xp11.2 translocation renal cell carcinoma.

PubMed

Taşkınlar, Hakan; Avlan, Dinçer; Çıtak, Çağlar; Polat, Ayşe; Naycı, Ali

2015-01-01

Pediatric renal cysts are rare, usually asymptomatic and incidentally detected in children. Cyst associated renal cell carcinoma (RCC) or cystic RCC is extremely rare in children. Bosniak classification system has been accepted for the management of cystic renal masses. Xp11.2 translocation RCC is a recently classified distinct subtype and usually affects children and adolescents. We report the case of a 10-year-old girl with Xp11.2 translocation RCC from a cyst of the right kidney.

Retroperitoneal dedifferentiated liposarcoma with huge cystic degeneration: A case report.

PubMed

Uchihashi, Kazuyoshi; Matsuyama, Atsuji; Shiba, Eisuke; Kimura, Yoshizo; Ogata, Toshiro; Yabuki, Kei; Harada, Hiroshi; Kubo, Chisachi; Tsuda, Yojiro; Jotatsu, Mao; Hisaoka, Masanori

2017-05-01

Prominent cyst formation is an unusual feature of liposarcoma. We report here a case of dedifferentiated liposarcoma with huge cystic change without preoperative chemo- or radiation therapy. The lesion arose in the retroperitoneum juxtaposed to the right kidney of a 67-year-old woman. She underwent a surgical removal of the retroperitoneal cyst. The cystic tumor contained 1600 mL of old bloody fluid, and its wall was composed of edematous, inflamed or sclerosing fibrous tissue with fatty tissue containing abundant atypical stromal cells, which were immunohistochemically positive for MDM2 and CDK4, and demonstrated MDM2 gene amplification by fluorescence in situ hybridization. The wall was contiguous to an atypical lipomatous nodule located in the mesentery. The following surgical specimens of the right hemicolectomy and right nephrectomy revealed atypical cells infiltrating into the subserosa of the colon and the perirenal fat tissue or that in the renal sinus. This case indicates that well differentiated or dedifferentiated liposarcoma should be also considered as a differential diagnosis of perirenal cystic mass. © 2017 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Subtype differentiation of renal tumors using voxel-based histogram analysis of intravoxel incoherent motion parameters.

PubMed

Gaing, Byron; Sigmund, Eric E; Huang, William C; Babb, James S; Parikh, Nainesh S; Stoffel, David; Chandarana, Hersh

2015-03-01

The aim of this study was to determine if voxel-based histogram analysis of intravoxel incoherent motion imaging (IVIM) parameters can differentiate various subtypes of renal tumors, including benign and malignant lesions. A total of 44 patients with renal tumors who underwent surgery and had histopathology available were included in this Health Insurance Portability and Accountability Act-compliant, institutional review board-approved, single-institution prospective study. In addition to routine renal magnetic resonance imaging examination performed on a 1.5-T system, all patients were imaged with axial diffusion-weighted imaging using 8 b values (range, 0-800 s/mm). A biexponential model was fitted to the diffusion signal data using a segmented algorithm to extract the IVIM parameters perfusion fraction (fp), tissue diffusivity (Dt), and pseudodiffusivity (Dp) for each voxel. Mean and histogram measures of heterogeneity (standard deviation, skewness, and kurtosis) of IVIM parameters were correlated with pathology results of tumor subtype using unequal variance t tests to compare subtypes in terms of each measure. Correction for multiple comparisons was accomplished using the Tukey honestly significant difference procedure. A total of 44 renal tumors including 23 clear cell (ccRCC), 4 papillary (pRCC), 5 chromophobe, and 5 cystic renal cell carcinomas, as well as benign lesions, 4 oncocytomas (Onc) and 3 angiomyolipomas (AMLs), were included in our analysis. Mean IVIM parameters fp and Dt differentiated 8 of 15 pairs of renal tumors. Histogram analysis of IVIM parameters differentiated 9 of 15 subtype pairs. One subtype pair (ccRCC vs pRCC) was differentiated by mean analysis but not by histogram analysis. However, 2 other subtype pairs (AML vs Onc and ccRCC vs Onc) were differentiated by histogram distribution parameters exclusively. The standard deviation of Dt [σ(Dt)] differentiated ccRCC (0.362 ± 0.136 × 10 mm/s) from AML (0.199 ± 0.043 × 10 mm/s) (P = 0.002). Kurtosis of fp separated Onc (2.767 ± 1.299) from AML (-0.325 ± 0.279; P = 0.001), ccRCC (0.612 ± 1.139; P = 0.042), and pRCC (0.308 ± 0.730; P = 0.025). Intravoxel incoherent motion imaging parameters with inclusion of histogram measures of heterogeneity can help differentiate malignant from benign lesions as well as various subtypes of renal cancers.

Peripheral calcifying cystic odontogenic tumour of the maxillary gingiva.

PubMed

de Lima, Ana Paula; Kitakawa, Dárcio; Almeida, Janete Dias; Brandão, Adriana Aigotti Haberbeck; Anbinder, Ana Lia

2012-08-23

Odontogenic tumors are lesions that are derived from remnants of the components of the developing tooth germ. The calcifying cystic odontogenic tumor or calcifying odontogenic cyst is a benign cystic neoplasm of odontogenic origin that is characterized by an ameloblastoma-like epithelium and ghost cells. Calcifying cystic odontogenic tumor may be centrally or peripherally located, and its ghost cells may exhibit calcification, as first described by Gorlin in 1962. Most peripheral calcifying cystic odontogenic tumors are located in the anterior gingiva of the mandible or maxilla. Authors report a rare case of a peripheral calcifying cystic odontogenic tumor of the maxillary gingiva. A 39-year-old male patient presented with a fibrous mass on the attached buccal gingiva of the upper left cuspid teeth. It was 0.7-cm-diameter, painless and it was clinically diagnosed as a peripheral ossifying fibroma. After an excisional biopsy, the diagnosis was peripheric calcifying cystic odontogenic tumor. The patient was monitored for five years following the excision, and no recurrence was detected. All biopsy material must be sent for histological examination. If the histological examination of gingival lesions with innocuous appearance is not performed, the frequency of peripheral calcifying cystic odontogenic tumor and other peripheral odontogenic tumors may be underestimated.

Metastatic, papillary cystadenocarcinoma of the mammary gland in a black-footed ferret

USGS Publications Warehouse

Carpenter, J.W.; Davidson, J.P.; Novilla, M.N.; Huang, J.C.M.

1980-01-01

A simple, papillary cystic adenocarcinoma of the mammary gland with metastases to the internal iliac and mesenteric lymph nodes, liver, and spleen was observed in a 12 to 13 year old female black-footed ferret (Mustela nigripes). Histologically, the tumor was aggressive, and lymphatic invasion was found. Attempts at virus isolation were negative. Other findings were bilateral infarcts in the kidneys, apparently resulting in acute renal shutdown and death, multiple thrombi in the right atrium, aortic arteriosclerosis, and focal interstitial pneumonia.

Metastatic, papillary cystadenocarcinoma of the mammary gland in a black-footed ferret.

PubMed

Carpenter, J W; Davidson, J P; Novilla, M N; Huang, J C

1980-10-01

A simple, papillary cystic adenocarcinoma of the mammary gland with metastases to the internal iliac and mesenteric lymph nodes, liver, and spleen was observed in a 12 to 13 year old female black-footed ferret (Mustela nigripes). Histologically, the tumor was aggressive, and lymphatic invasion was found. Attempts at virus isolation were negative. Other findings were bilateral infarcts in the kidneys, apparently resulting in acute renal shutdown and death, multiple thrombi in the right atrium, aortic arteriosclerosis, and focal interstitial pneumonia.

Peripheral calcifying cystic odontogenic tumour of the maxillary gingiva

PubMed Central

2012-01-01

Background Odontogenic tumors are lesions that are derived from remnants of the components of the developing tooth germ. The calcifying cystic odontogenic tumor or calcifying odontogenic cyst is a benign cystic neoplasm of odontogenic origin that is characterized by an ameloblastoma-like epithelium and ghost cells. Calcifying cystic odontogenic tumor may be centrally or peripherally located, and its ghost cells may exhibit calcification, as first described by Gorlin in 1962. Most peripheral calcifying cystic odontogenic tumors are located in the anterior gingiva of the mandible or maxilla. Case presentation Authors report a rare case of a peripheral calcifying cystic odontogenic tumor of the maxillary gingiva. A 39-year-old male patient presented with a fibrous mass on the attached buccal gingiva of the upper left cuspid teeth. It was 0.7-cm-diameter, painless and it was clinically diagnosed as a peripheral ossifying fibroma. After an excisional biopsy, the diagnosis was peripheric calcifying cystic odontogenic tumor. The patient was monitored for five years following the excision, and no recurrence was detected. Conclusions All biopsy material must be sent for histological examination. If the histological examination of gingival lesions with innocuous appearance is not performed, the frequency of peripheral calcifying cystic odontogenic tumor and other peripheral odontogenic tumors may be underestimated. PMID:22917449

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levine, E.; Cook, L.T.; Grantham, J.J.

Hepatic CT findings were analyzed in 44 patients with autosomal-dominant polycystic kidney disease and were correlated with liver and renal function tests and liver, splenic, and renal CT volume measurements. CT showed many large liver cysts in 31.8% of patients, small liver cysts in 25%, and no liver cysts in 43.2%. Patients with many large cysts often showed increased liver volumes. There was no correlation between severity of liver involvement and extent of renal cystic disease as determined from urea nitrogen and creatinine levels and renal volumes. Liver function tests were normal except in two patients, one with a cholangiocarcinoma,more » which may have arisen from a cyst, and the other with an infected liver cyst and chronic active hepatitis. Accordingly, if liver function tests are abnormal, an attempt should be made to identify complications of polycystic liver disease such as tumor cyst infection, and biliary obstruction. CT is a useful method for detecting liver cysts and identifying patients at risk for these complications.« less

Endoscopic treatment of intraventricular cystic tumors.

PubMed

Margetis, Konstantinos; Souweidane, Mark M

2013-02-01

Intraventricular cystic tumors constitute a surgical challenge, because of their deep location and the histologically benign nature of most of them. We aim to present concisely, yet comprehensively, the role of neuroendoscopy in the treatment of intraventricular cystic tumors. A literature review searching for applications of endoscopy in the treatment of intraventricular cystic tumors is presented. Our experience is added to the presented data. In controversial issues, a comparison is made with traditional treatment methods. Intraventricular endoscopy has been successfully used in the treatment of the whole range of intraventricular cystic tumors. The most common indication is the treatment of colloid cysts. In the treatment of colloid cysts, a comparison with microsurgical techniques showed that endoscopy is advantageous in regard to operative morbidity and postoperative shunt dependency but is associated with a slightly higher recurrence rate. Intraventricular endoscopy has emerged as a viable option in the treatment of intraventricular cystic tumors. Copyright © 2013 Elsevier Inc. All rights reserved.

Special considerations in the pediatric use of radionuclides for kidney studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ash, J.M.; Antico, V.F.; Gilday, D.L.

1982-10-01

Radionuclide renal studies are particularly well suited to pediatrics as renal problems in children usually are part of a dynamic process which requires serial assessment. The absence of side-effects and the low radiation dose has added to their popularity in pediatrics. A number of different renal parameters can be evaluated using the appropriate radiopharmaceutical and method of analysis. The renal study is of value to assess patients with hydronephrosis both pre-operatively and for serial follow-up post-operatively, as well as to distinguish obstructive from non-obstructive uropathy. Perfusion to the kidney may be assessed and ischemic areas detected in children with hypertensionmore » or trauma. The renal scan commonly is used in patients with congenital anomalies such as ectopic and duplex kidneys, nonvisualized kidney on IVP and in children with oliguria or anuria secondary to diseases such as acute tubular necrosis, hemolytic uremic syndrome, and renal vein thrombosis. It frequently is done as an emergency procedure in neonates. In conjunction with the IVP and ultrasound, the renal study is useful in some cases of abdominal mass to distinguish between hydronephrosis, cystic kidneys and tumors.« less

Automated noninvasive classification of renal cancer on multiphase CT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linguraru, Marius George; Wang, Shijun; Shah, Furhawn

2011-10-15

Purpose: To explore the added value of the shape of renal lesions for classifying renal neoplasms. To investigate the potential of computer-aided analysis of contrast-enhanced computed-tomography (CT) to quantify and classify renal lesions. Methods: A computer-aided clinical tool based on adaptive level sets was employed to analyze 125 renal lesions from contrast-enhanced abdominal CT studies of 43 patients. There were 47 cysts and 78 neoplasms: 22 Von Hippel-Lindau (VHL), 16 Birt-Hogg-Dube (BHD), 19 hereditary papillary renal carcinomas (HPRC), and 21 hereditary leiomyomatosis and renal cell cancers (HLRCC). The technique quantified the three-dimensional size and enhancement of lesions. Intrapatient and interphasemore » registration facilitated the study of lesion serial enhancement. The histograms of curvature-related features were used to classify the lesion types. The areas under the curve (AUC) were calculated for receiver operating characteristic curves. Results: Tumors were robustly segmented with 0.80 overlap (0.98 correlation) between manual and semi-automated quantifications. The method further identified morphological discrepancies between the types of lesions. The classification based on lesion appearance, enhancement and morphology between cysts and cancers showed AUC = 0.98; for BHD + VHL (solid cancers) vs. HPRC + HLRCC AUC = 0.99; for VHL vs. BHD AUC = 0.82; and for HPRC vs. HLRCC AUC = 0.84. All semi-automated classifications were statistically significant (p < 0.05) and superior to the analyses based solely on serial enhancement. Conclusions: The computer-aided clinical tool allowed the accurate quantification of cystic, solid, and mixed renal tumors. Cancer types were classified into four categories using their shape and enhancement. Comprehensive imaging biomarkers of renal neoplasms on abdominal CT may facilitate their noninvasive classification, guide clinical management, and monitor responses to drugs or interventions.« less

Leukemia kidney infiltration can cause secondary polycythemia by activating hypoxia-inducible factor (HIF) pathway.

PubMed

Osumi, Tomoo; Awazu, Midori; Fujimura, Eriko; Yamazaki, Fumito; Hashiguchi, Akinori; Shimada, Hiroyuki

2013-06-01

Secondary polycythemia with increased production of erythropoietin (EPO) is known to occur in kidney diseases such as hydronephrosis and cystic disease, but the mechanism remains unclear. We report an 18-year-old female with isolated renal relapse of acute lymphoblastic leukemia accompanied by polycythemia. At the relapse, she presented with bilateral nephromegaly, mild renal dysfunction, and erythrocytosis with increased serum EPO levels up to 52.1 mIU/mL (9.1-32.8). Renal biopsy demonstrated diffuse lymphoblastic infiltration. The expression of hypoxia-inducible factor (HIF)-1α, which is undetectable in normal kidney, was observed in the renal tubule epithelium compressed by lymphoblastic cells. These findings suggest that erythrocytosis was caused by renal ischemia due to leukemic infiltration. Polycythemia probably became apparent because of the lack of leukemic involvement of the bone marrow. With chemotherapy, the serum EPO level rapidly decreased to normal range accompanied by the normalization of kidney size and function. Renal leukemic infiltration may enhance EPO production, although not recognized in the majority of cases because of bone marrow involvement. Our case has clarified the mechanism of previously reported polycythemia associated with renal diseases as renal ischemia. Furthermore, we have added renal ischemia resulting from tumor infiltration to the list of causes of secondary polycythemia.

Interleukin-12 and Trastuzumab in Treating Patients With Cancer That Has High Levels of HER2/Neu

ClinicalTrials.gov

2013-02-27

Advanced Adult Primary Liver Cancer; Anaplastic Thyroid Cancer; Bone Metastases; Carcinoma of the Appendix; Distal Urethral Cancer; Fallopian Tube Cancer; Gastrinoma; Glucagonoma; Inflammatory Breast Cancer; Insulinoma; Liver Metastases; Localized Unresectable Adult Primary Liver Cancer; Lung Metastases; Male Breast Cancer; Malignant Pericardial Effusion; Malignant Pleural Effusion; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Parathyroid Cancer; Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Newly Diagnosed Carcinoma of Unknown Primary; Occult Non-small Cell Lung Cancer; Pancreatic Polypeptide Tumor; Primary Peritoneal Cavity Cancer; Proximal Urethral Cancer; Pulmonary Carcinoid Tumor; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Adrenocortical Carcinoma; Recurrent Adult Primary Liver Cancer; Recurrent Anal Cancer; Recurrent Bladder Cancer; Recurrent Breast Cancer; Recurrent Carcinoma of Unknown Primary; Recurrent Cervical Cancer; Recurrent Colon Cancer; Recurrent Endometrial Carcinoma; Recurrent Esophageal Cancer; Recurrent Extrahepatic Bile Duct Cancer; Recurrent Gallbladder Cancer; Recurrent Gastric Cancer; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Malignant Testicular Germ Cell Tumor; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Non-small Cell Lung Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Pancreatic Cancer; Recurrent Parathyroid Cancer; Recurrent Prostate Cancer; Recurrent Rectal Cancer; Recurrent Renal Cell Cancer; Recurrent Salivary Gland Cancer; Recurrent Small Intestine Cancer; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Thyroid Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Recurrent Vaginal Cancer; Recurrent Vulvar Cancer; Skin Metastases; Small Intestine Adenocarcinoma; Somatostatinoma; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Adrenocortical Carcinoma; Stage III Bladder Cancer; Stage III Cervical Cancer; Stage III Colon Cancer; Stage III Endometrial Carcinoma; Stage III Esophageal Cancer; Stage III Follicular Thyroid Cancer; Stage III Gastric Cancer; Stage III Malignant Testicular Germ Cell Tumor; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Ovarian Epithelial Cancer; Stage III Pancreatic Cancer; Stage III Papillary Thyroid Cancer; Stage III Prostate Cancer; Stage III Rectal Cancer; Stage III Renal Cell Cancer; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Vaginal Cancer; Stage III Vulvar Cancer; Stage IIIA Anal Cancer; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Anal Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IV Adenoid Cystic Carcinoma of the Oral Cavity; Stage IV Adrenocortical Carcinoma; Stage IV Anal Cancer; Stage IV Bladder Cancer; Stage IV Breast Cancer; Stage IV Colon Cancer; Stage IV Endometrial Carcinoma; Stage IV Esophageal Cancer; Stage IV Follicular Thyroid Cancer; Stage IV Gastric Cancer; Stage IV Mucoepidermoid Carcinoma of the Oral Cavity; Stage IV Non-small Cell Lung Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Pancreatic Cancer; Stage IV Papillary Thyroid Cancer; Stage IV Prostate Cancer; Stage IV Rectal Cancer; Stage IV Renal Cell Cancer; Stage IV Salivary Gland Cancer; Stage IV Squamous Cell Carcinoma of the Larynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Oropharynx; Stage IVA Cervical Cancer; Stage IVA Vaginal Cancer; Stage IVB Cervical Cancer; Stage IVB Vaginal Cancer; Stage IVB Vulvar Cancer; Thyroid Gland Medullary Carcinoma; Unresectable Extrahepatic Bile Duct Cancer; Unresectable Gallbladder Cancer; Urethral Cancer Associated With Invasive Bladder Cancer; WDHA Syndrome

Cystic dysplasia of the testis: a very rare paediatric tumor of the testis.

PubMed

Eberli, Daniel; Gretener, Heini; Dommann-Scherrer, Corina; Pestalozzi, Dietegen; Fehr, Jean-Luc

2002-01-01

To describe a case of cystic dysplasia of the testis (CDT), an uncommon cause of scrotal swelling in the pediatric patient. Clinic, therapy, fertility, and radiographic and pathologic findings are discussed and the 30 previously reported cases are reviewed. A 9-year-old boy presented with asymptomatic scrotal swelling. A scrotal ultrasound showed a multicystic scrotal mass in the rete testis and an ipsilateral renal agenesis. The growth in size of the mass forced the authors to perform an operative exploration. Intraoperative findings included a multicystic mass in the rete testis of the right testicle. Testicle-sparing total removal of the multicystic mass was performed and the pathologic examination revealed a benign, multilobulated configuration of the cysts in the region of the rete testis. These findings were similar to those found in previously reported cases of CDT. Ipsilateral renal agenesis is the most common associated anomaly. As a pathogenetic factor, mal-junction of the Wolffian duct in the 5th week of gestation is most creditable. CDT is a rare cause of pediatric scrotal mass. When feasible, a testicle-sparing approach should be considered and all patients should undergo evaluation for associated urologic anomalies.

Next-generation technologies for spatial proteomics: Integrating ultra-high speed MALDI-TOF and high mass resolution MALDI FTICR imaging mass spectrometry for protein analysis.

PubMed

Spraggins, Jeffrey M; Rizzo, David G; Moore, Jessica L; Noto, Michael J; Skaar, Eric P; Caprioli, Richard M

2016-06-01

MALDI imaging mass spectrometry is a powerful analytical tool enabling the visualization of biomolecules in tissue. However, there are unique challenges associated with protein imaging experiments including the need for higher spatial resolution capabilities, improved image acquisition rates, and better molecular specificity. Here we demonstrate the capabilities of ultra-high speed MALDI-TOF and high mass resolution MALDI FTICR IMS platforms as they relate to these challenges. High spatial resolution MALDI-TOF protein images of rat brain tissue and cystic fibrosis lung tissue were acquired at image acquisition rates >25 pixels/s. Structures as small as 50 μm were spatially resolved and proteins associated with host immune response were observed in cystic fibrosis lung tissue. Ultra-high speed MALDI-TOF enables unique applications including megapixel molecular imaging as demonstrated for lipid analysis of cystic fibrosis lung tissue. Additionally, imaging experiments using MALDI FTICR IMS were shown to produce data with high mass accuracy (<5 ppm) and resolving power (∼75 000 at m/z 5000) for proteins up to ∼20 kDa. Analysis of clear cell renal cell carcinoma using MALDI FTICR IMS identified specific proteins localized to healthy tissue regions, within the tumor, and also in areas of increased vascularization around the tumor. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Can a Modified Bosniak Classification System Risk Stratify Pediatric Cystic Renal Masses?

PubMed

Saltzman, Amanda F; Carrasco, Alonso; Colvin, Alexandra N; Meyers, Mariana L; Cost, Nicholas G

2018-03-20

We characterize and apply the modified Bosniak classification system to a cohort of children with cystic renal lesions and known surgical pathology. We identified all patients at our institution with cystic renal masses who also underwent surgery for these lesions. Patients without available preoperative imaging or pathology were excluded. All radiological imaging was independently reviewed by a pediatric radiologist blinded to pathological findings. Imaging characteristics (size, border, septations, calcifications, solid components, vascularity) were recorded from the most recent preoperative ultrasounds and computerized tomograms. The modified Bosniak classification system was applied to these scans and then correlated with final pathology. A total of 22 patients met study criteria. Median age at surgery was 6.1 years (range 11 months to 16.8 years). Of the patients 12 (54.5%) underwent open nephrectomy, 6 (27.3%) open partial nephrectomy, 2 (9.1%) laparoscopic cyst decortication, 1 (4.5%) open renal biopsy and 1 (4.5%) laparoscopic partial nephrectomy. Final pathology was benign in 9 cases (41%), intermediate in 6 (27%) and malignant in 7 (32%). All malignant lesions were modified Bosniak class 4, all intermediate lesions were modified class 3 or 4 and 8 of 9 benign lesions (89%) were modified class 1 or 2. Cystic renal lesions in children with a modified Bosniak class of 1 or 2 were most often benign, while class 3 or 4 lesions warranted surgical excision since more than 90% of masses harbored intermediate or malignant pathology. The modified Bosniak classification system appears to allow for a reasonable clinical risk stratification of pediatric cystic renal masses. Copyright © 2018 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Family Stress with Chronic Childhood Illness: Cystic Fibrosis, Neuromuscular Disease, and Renal Disease.

ERIC Educational Resources Information Center

Holroyd, Jean; Guthrie, Donald

1986-01-01

Parents of children with neuromuscular disease, cystic fibrosis, and renal disease were compared with parents of control subjects matched by age to the clinical cases. The three clinical groups exhibited different patterns of stressful response, consistent with the nature of their illnesses and the requirements for care imposed on the families.…

Puncture-ejection of own egg by Least Bell's Vireo and potential implications for anti-parasitism defense

USGS Publications Warehouse

Sharp, Bryan L.; Peterson, Bonnie L.; Kus, Barbara E.

2005-01-01

A simple, papillary cystic adenocarcinoma of the mammary gland with metastases to the internal iliac and mesenteric lymph nodes, liver, and spleen was observed in a 12 to 13 year old female black-footed ferret (Mustela nigripes). Histologically, the tumor was aggressive, and lymphatic invasion was found. Attempts at virus isolation were negative. Other findings were bilateral infarcts in the kidneys, apparently resulting in acute renal shutdown and death, multiple thrombi in the right atrium, aortic arteriosclerosis, and focal interstitial pneumonia.

Mucinous cystic neoplasms of the mesentery: a case report and review of the literature

PubMed Central

Metaxas, Georgios; Tangalos, Athanasios; Pappa, Polyxeni; Papageorgiou, Irene

2009-01-01

Background Mucinous cystic neoplasms arise in the ovary and various extra-ovarian sites. While their pathogenesis remains conjectural, their similarities suggest a common pathway of development. There have been rare reports involving the mesentery as a primary tumour site. Case presentation A cystic mass of uncertain origin was demonstrated radiologically in a 22 year old female with chronic abdominal pain. At laparotomy, the mass was fixed within the colonic mesentery. Histology demonstrated a benign mucinous cystadenoma. Methods and results We review the literature on mucinous cystic neoplasms of the mesentery and report on the pathogenesis, biologic behavior, diagnosis and treatment of similar extra-ovarian tumors. We propose an updated classification of mesenteric cysts and cystic tumors. Conclusion Mucinous cystic neoplasms of the mesentery present almost exclusively in women and must be considered in the differential diagnosis of mesenteric tumors. Only full histological examination of a mucinous cystic neoplasm can exclude a borderline or malignant component. An updated classification of mesenteric cysts and cystic tumors is proposed. PMID:19454018

Ovarian mucinous tumors arising from mature cystic teratomas--a molecular genetic approach for understanding the cellular origin.

PubMed

Fujii, Kaho; Yamashita, Yoriko; Yamamoto, Toshimichi; Takahashi, Koji; Hashimoto, Katsunori; Miyata, Tomoko; Kawai, Kumi; Kikkawa, Fumitaka; Toyokuni, Shinya; Nagasaka, Tetsuro

2014-04-01

Mucinous tumors of the ovary are frequently associated with mature cystic teratomas, and it has been speculated that the mucinous tumors arise from teratoma components. The cellular origins of mature cystic teratomas are believed to be post-meiotic ovarian germ cells, and the analysis of microsatellite markers such as short tandem repeats is suitable for determining the cellular origin of tumors. In this study, we analyzed 3 ovarian mature cystic teratomas, all of which were associated with simultaneous ovarian mucinous tumors within the same ovary. Two of the 3 mucinous tumors were intestinal-type and the other was endocervical type. A laser capture microdissection technique was used to separate the epithelial component of the mucinous tumor, the components of the mature cystic teratoma, and control ovarian somatic tissue. Using short tandem repeat analysis based on 6 markers (D20S480, D6S2439, D6S1056, D9S1118, D4S2639, and D17S1290), we could distinguish the germ cell (homozygous) or somatic (heterozygous) origin of a given component in each sample. The epithelial components of the intestinal-type mucinous tumors in cases 1 and 2 were homozygous, and the epithelial component in case 3 (endocervical type) was heterozygous. All teratomatous components were homozygous, and the control components were heterozygous. In addition, we analyzed 3 mature cystic teratomas without mucinous tumors, and all 3 were homozygous in the tumor component. Our data suggest that the origin of mucinous tumors in the ovary may differ among histological subtypes, and intestinal-type mucinous tumors may arise from mature cystic teratomas, although endocervical-type mucinous tumors may not. Copyright © 2014 Elsevier Inc. All rights reserved.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Morphological, immunohistochemical, and chromosomal analysis of multicystic chromophobe renal cell carcinoma, an architecturally unusual challenging variant.

PubMed

Foix, Maria Pané; Dunatov, Ana; Martinek, Petr; Mundó, Enric Condom; Suster, Saul; Sperga, Maris; Lopez, Jose I; Ulamec, Monika; Bulimbasic, Stela; Montiel, Delia Perez; Alaghehbandan, Reza; Peckova, Kvetoslava; Pivovarcikova, Krystina; Ondrej, Daum; Rotterova, Pavla; Skenderi, Faruk; Prochazkova, Kristyna; Dusek, Martin; Hora, Milan; Michal, Michal; Hes, Ondrej

2016-12-01

Chromophobe renal cell carcinoma (ChRCC) is typically composed of large leaf-like cells and smaller eosinophilic cells arranged in a solid-alveolar pattern. Eosinophilic, adenomatoid/pigmented, or neuroendocrine variants have also been described. We collected 10 cases of ChRCC with a distinct multicystic pattern out of 733 ChRCCs from our registry, and subsequently analyzed these by morphology, immunohistochemistry, and array comparative genomic hybridization. Of the 10 patients, 6 were males with an age range of 50-89 years (mean 68, median 69). Tumor size ranged between 1.2 and 20 cm (mean 5.32, median 3). Clinical follow-up was available for seven patients, ranging 1-19 years (mean 7.2, median 2.5). No aggressive behavior was documented. We observed two growth patterns, which were similar in all tumors: (1) variable-sized cysts, resembling multilocular cystic neoplasm of low malignant potential and (2) compressed cystic and tubular pattern with slit-like spaces. Raisinoid nuclei were consistently present while necrosis was absent in all cases. Half of the cases showed eosinophilic/oncocytic cytology, deposits of pigment (lipochrome) and microcalcifications. The other half was composed of pale or mixed cell populations. Immunostains for epithelial membrane antigen (EMA), CK7, OSCAR, CD117, parvalbumin, MIA, and Pax 8 were positive in all tumors while negative for vimentin, TFE3, CANH 9, HMB45, cathepsin K, and AMACR. Ki67 immunostain was positive in up to 1 % of neoplastic cells. Molecular genetic examination revealed multiple chromosomal losses in two fifths analyzable tumors, while three cases showed no chromosomal numerical aberrations. ChRCC are rarely arranged in a prominent multicystic pattern, which is probably an extreme form of the microcystic adenomatoid pigmented variant of ChRCC. The spectrum of tumors entering the differential diagnosis of ChRCC is quite different from that of conventional ChRCC. The immunophenotype of ChRCC is identical with that of conventional ChRCC. Chromosomal numerical aberration pattern was variable; no chromosomal numerical aberrations were found in three cases. All the cases in this series have shown an indolent and non-aggressive behavior.

Identical twins with mature cystic teratomas treated with laparoscopic surgery: Two case reports.

PubMed

Mabuchi, Yasushi; Ota, Nami; Kobayashi, Aya; Tanizaki, Yuko; Minami, Sawako; Ino, Kazuhiko

2017-02-01

Mature cystic teratomas are the most common among all ovarian neoplasms, representing 30-40% of the cases. However, to the best of our knowledge, there have been only two reports of mature cystic teratomas occurring in identical twins to date. We herein report a case of identical twins with mature cystic teratomas who were treated with laparoscopic surgery. A 32-year-old woman was referred to our hospital due to a tumor in the right ovary. The patient underwent laparoscopic resection of the ovarian tumor and the pathological diagnosis was benign mature cystic teratoma. Two years later, the identical twin of the abovementioned patient was referred to our hospital also due to a right ovarian tumor. The patient underwent laparoscopic resection of the ovarian tumor and the pathological diagnosis was benign mature cystic teratoma. Therefore, for early diagnosis, it may be important to consider the possibility of mature cystic teratoma in the identical twin of a patient, even in the absence of symptoms.

[A Case of Cystic Cervical Lymph Node Metastasis of HPV-positive Tonsil Cancer, Being Discriminated as the Branchiogenic Carcinoma].

PubMed

Kambara, Rumi; Tamai, Masamitsu; Horii, Arata

2016-02-01

In recent years, human papillomavirus (HPV)-positive oropharyngeal carcinomas have been increasing. The first manifestation of these tumors is frequently as cystic metastasis to cervical lymph nodes that may precede recognition of the primary tumor, so, they often result in misdiagnosis as branchial cleft cysts. We report a case of cystic cervical lymph node metastasis of HPV-positive tonsil cancer. The patient was a 70-years-old man who noticed a mass on his left neck. The tumor was large and soft, and it was diagnosed as benign in fine-needle aspiration cytology. We diagnosed the tumor as a branchial cleft cyst and undertook surgery. The histopathological diagnosis was squamous cell carcinoma arising from a branchiogenic cyst. However, because it did not satisfy the diagnostic criteria, we diagnosed the tumor as an unknown primary tumor. One year later, left tonsil cancer was suspected based on PET-CT imaging and a left tonsillectomy was undertaken, whereafter tonsil cancer was found. In p16 immunostaining, it was positive in both cystic mass and tonsil. The cervical mass was cystic lymph node metastasis of HPV-positive tonsil cancer. It is important to investigate the oropharynx, when we found cystic cervical mass, because HPV-positive oropharyngeal carcinoma frequently results in cystic neck metastasis.

[MALIGNANT TUMORS IN OVARIAN MATURE CYSTIC TERATOMAS INTRAOPERATIVE DIAGNOSTIC BASIS].

PubMed

Khachatryan, A

2016-11-01

Extremely rare ovarian primary tumors formed in a mature cystic teratomaare described in the literature. This research work studies the frequency of malignant mature cystic teratoma, as well as their clinical and morphological features and necessity of intraoperative histological examination of all teratomas. Cases histories of 56 patients, suffering from ovarian mature cystic teratomahave been studied in MC Shengavit in the period of 2003 - 2015. Among them 4 patients with the somatic malignancies were identified. Morphological methods, which are considered to be "gold standard" of tumor investigation, were used in staining the slides with hematoxylin - eosin. According to the literature the secondary malignant transformation rarely occurs and is typical in postmenopausal women, with a frequency of 0.17-3%. According to the results of our study, malignant tumors in mature cystic teratomas were observed in 4 (7,14%) from the total number of mature cystic teratomas (n=56). There was not revealed a correlation between the duration of the complaints, age of the patients, sizes of ovarian mature teratoma and malignization degree. Thus, the greatest difficulties of clinical diagnosis of malignant tumors in the ovarian mature cystic teratomas were in the early stage of the disease, because of a variety of clinical manifestations, not pathognomonic for malignization. All mentioned symptoms may be observed in the patients with usual mature cystic teratomas. Тhis cases confirm the necessity to take tissue samples from the other ovary for intraoperative histopathological evaluation in each case of mature cystic teratomas. It is necessary to examine a large number of tumor sites, to prevent errors in the assessment of the maturity degree of teratoma.

Solitary Hepatocellular Carcinoma Fed by the Cystic Artery: Limitation of Transcatheter Arterial Embolization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirota, Shozo; Matsumoto, Shinichi; Fukuda, Tetsuya

1999-05-15

Purpose: To clarify the limitations of transcatheter treatment for hepatocellular carcinoma (HCC) with parasitic feeders from the cystic artery. Methods: Three male patients had a solitary HCC (average diameter 3 cm) fed by the cystic artery among 221 patients with HCC from 1994 to 1997. One tumor was nourished entirely from the cystic artery arising from the medial branch of the left hepatic artery, and two tumors were fed partially by the cystic arteries arising from the anterior inferior branch of the right hepatic artery. We analyzed the indications for transcatheter treatment for these three patients. Results: We chose notmore » to embolize the cystic artery for fear of necrosis of the gallbladder. Although embolization of the anterior branch of the right hepatic artery was performed in one patient with a tumor fed partially by the cystic artery, only half the tumor was embolized. Two patients underwent hepatic resection, and one received percutaneous ethanol injection therapy. At follow-up of 28-40 months (average 33 months) all patients are alive. Conclusion: Feeding by the cystic artery represents a limitation of TAE for HCC.« less

Dose-Dependent Effects of Sirolimus on mTOR Signaling and Polycystic Kidney Disease

PubMed Central

Novalic, Zlata; van der Wal, Annemieke M.; Leonhard, Wouter N.; Koehl, Gudrun; Breuning, Martijn H.; Geissler, Edward K.; de Heer, Emile

2012-01-01

Inhibition of the mammalian target of rapamycin (mTOR) shows beneficial effects in animal models of polycystic kidney disease (PKD); however, two clinical trials in patients with autosomal dominant PKD failed to demonstrate a short-term benefit in either the early or progressive stages of disease. The stage of disease during treatment and the dose of mTOR inhibitors may account for these differing results. Here, we studied the effects of a conventional low dose and a higher dose of sirolimus (blood levels of 3 ng/ml and 30–60 ng/ml, respectively) on mTOR activity and renal cystic disease in two Pkd1-mutant mouse models at different stages of the disease. When initiated at early but not late stages of disease, high-dose treatment strongly reduced mTOR signaling in renal tissues, inhibited cystogenesis, accelerated cyst regression, and abrogated fibrosis and the infiltration of immune cells. In contrast, low-dose treatment did not significantly reduce renal cystic disease. Levels of p-S6RpSer240/244, which marks mTOR activity, varied between kidneys; severity of the renal cystic phenotype correlated with the level of mTOR activity. Taken together, these data suggest that long-term treatment with conventional doses of sirolimus is insufficient to inhibit mTOR activity in renal cystic tissue. Mechanisms to increase bioavailability or to target mTOR inhibitors more specifically to kidneys, alone or in combination with other compounds, may improve the potential for these therapies in PKD. PMID:22343118

Telomerase activity is a useful marker to distinguish malignant pancreatic cystic tumors from benign neoplasms and pseudocysts.

PubMed

Yeh, T S; Cheng, A J; Chen, T C; Jan, Y Y; Hwang, T L; Jeng, L B; Chen, M F; Wang, T C

1999-12-01

Pancreatic serous cystadenoma, mucinous cystic neoplasms, ductal adenocarcinoma with cystic change, and pseudocysts are a spectrum of pancreatic cystic lesions. Their management strategy and prognosis are extremely diverse. Imaging study, cytology, and analysis of the tumor markers of cyst fluid are not always reliable in differentiation of these disease entities. Fifteen patients with pancreatic cystic neoplasms (including six mucinous cystadenocarcinomas, two mucinous cystic neoplasms with borderline malignancy, two mucinous cystadenomas, and five serous cystadenomas), 4 patients with pancreatic ductal adenocarcinomas with cystic change, and 10 patients with pseudocysts were studied. Echo-guided or computed tomography-guided biopsies of pancreatic cystic lesions and their normal counterparts were conducted on all patients prior to operation or other management. The specimens were assayed for telomerase activity by using TRAP (telomere repeat amplification protocol). The level of telomerase activity in each specimen was semiquantitated as strong, moderate, weak, and none. The final diagnoses were made from histopathological examination of surgically resected or biopsied specimens. The efficacy of telomerase activity as a tumor marker to predict malignancy of pancreatic cystic lesions was evaluated. Three of the four pancreatic ductal adenocarcinomas with cystic change had strong or moderate telomerase activity; four of the six mucinous cystadenocarcinomas had moderate or weak telomerase activity; one of the two mucinous cystadenomas with borderline malignancy had weak telomerase activity; and none of their normal counterparts had detectable telomerase activity. In contrast, none of the two mucinous cystadenomas, five serous cystadenomas, and 10 pseudocysts had detectable telomerase activity. Based on these results, the sensitivity of telomerase activity for prediction of malignancy or premalignancy of pancreatic cystic lesions was 67%, the specificity was 100%, and the positive and negative predictive values were 1.0 and 0.81, respectively. The overall accuracy was 86%. The differential expressions of telomerase activity have been detected specifically in malignant and premalignant pancreatic cystic tumors, but not in benign cystic neoplasms or pseudocysts. The implications of these results are that telomerase activation takes part in the malignant transformation of pancreatic cystic neoplasms and that telomerase activity is a useful marker to distinguish malignant pancreatic cystic tumors from benign neoplasms and pseudocysts. Copyright 1999 Academic Press.

Intracranial extension of adenoid cystic carcinoma: potential involvement of EphA2 expression and epithelial-mesenchymal transition in tumor metastasis: a case report.

PubMed

Fukai, Junya; Fujita, Koji; Yamoto, Toshikazu; Sasaki, Takahiro; Uematsu, Yuji; Nakao, Naoyuki

2014-03-07

Adenoid cystic carcinoma is a malignant epithelial tumor derived from salivary glands and tends to invade the surrounding structures including nervous system. We present a case of adenoid cystic carcinoma with intracranial extension and propose a novel molecular mechanism of adenoid cystic carcinoma metastasis. A 29-year-old Japanese male presented with left trigeminal nerve disturbance. Neuroimaging revealed a tumor located at the right middle cranial and infratemporal fossa. The tumor was removed via a subtemporal extradural and infratemporal fossa approach and histologically diagnosed as adenoid cystic carcinoma. Radiological and operative findings confirmed a perineural spread of the tumor along the mandibular nerve. Immunohistochemical analyses of molecular consequences in this case were performed for better understanding of the biological processes associated with adenoid cystic carcinoma metastasis. First, the neoplastic cells were not immunoreactive for E-cadherin, an epithelial marker, but for vimentin, a mesenchymal marker, suggesting changes in cell phenotype from epithelial to mesenchymal states. Correspondingly, immunoreactivity of transcriptional factors, such as Slug, Twist, matrix metalloproteinase-2 and -9, which are involved in epithelial-mesenchymal transition, were observed. Second, elevated expression of EphA2 receptor, not ephrin-A1, was notable in the neoplastic cells, suggesting morphological changes reminiscent of epithelial-mesenchymal transition and ligand-independent promotion of tumor cell migration and invasion. We report a case of adenoid cystic carcinoma with perineural spread and provide the first published evidence that EphA2 expression without ephrin-A1 and epithelial-mesenchymal transition might play important roles in adenoid cystic carcinoma progression.

Congenital Adrenal Neuroblastoma With and Without Cystic Change: Differentiating Features With an Emphasis on the of Value of Ultrasound.

PubMed

Hwang, Sook Min; Yoo, So-Young; Kim, Ji Hye; Jeon, Tae Yeon

2016-11-01

The purpose of this study was to compare the features of congenital adrenal neuroblastomas with and without cystic changes and to emphasize the value of ultrasound in the diagnostic evaluation of cystic congenital adrenal neuroblastoma. A total of 41 patients with surgically confirmed congenital adrenal neuroblastoma were enrolled. We divided the patients into two groups according to presence or absence of cystic change in the tumor, as determined from the initial ultrasound findings. Clinical and laboratory findings, disease stage, and patient outcome were investigated with a statistical comparison between the two groups. The imaging findings for cystic congenital adrenal neuroblastoma were reviewed to compare the additional diagnostic value of CT and MRI when paired with ultrasound. There were 22 patients (54%) in the group without cystic changes and 19 patients (46%) in the group with cystic changes. Prenatal detection and absence of metastasis were significantly more common in the cystic group than in the noncystic group (p < 0.05). Sensitivities of tumor marker levels were also significantly lower in the cystic group. Patient outcome was excellent, and there was no significant difference between the groups. With regard to imaging of cystic congenital adrenal neuroblastoma, in the 15 cases in which CT or MRI was paired with ultrasound, no additional diagnostic information was discerned with CT or MRI. Nearly one-half of congenital adrenal neuroblastomas are cystic, and these tumors have clinical and laboratory features that distinguish them from noncystic congenital adrenal neuroblastoma. Diagnostic tests, including CT, MRI, and assessment of tumor markers, have low diagnostic value in the evaluation of cystic congenital adrenal neuroblastoma.

Incidental synovial myxoma with extensive intermuscular infiltration in a dog.

PubMed

Izawa, Takeshi; Tanaka, Miyuu; Aoki, Mika; Ohashi, Fumihito; Yamate, Jyoji; Kuwamura, Mitsuru

2012-12-01

A 16-year-old male mixed-breed dog was euthanized due to progression of renal failure caused by renal adenocarcinoma in the left kidney. Apart from main symptomatic lesion, accumulation of transparent jelly-like fluid was observed between the right femoral muscles. Gross examination of the right hindlimb revealed multiple nodules in the articular surface and capsule of the stifle joints, which extended into the crural muscles. Histopathologically, the joint and intermuscular masses were characterized by variously-sized hypocellular nodules consisting of spindle to stellate cells suspended in an abundant myxoid matrix. There were cystic structures within the intermuscular masses, lined by synoviocyte-like cells. Based on the gross and histopathologic findings, the case was diagnosed as synovial myxoma with extensive intermuscular infiltration. Synovial myxoma should be considered in the differential diagnosis of dogs with myxomatous tumor between skeletal muscles, even in absence of joint or muscle symptoms.

Perinatal Diagnosis, Management, and Follow-up of Cystic Renal Diseases: A Clinical Practice Recommendation With Systematic Literature Reviews.

PubMed

Gimpel, Charlotte; Avni, Fred E; Bergmann, Carsten; Cetiner, Metin; Habbig, Sandra; Haffner, Dieter; König, Jens; Konrad, Martin; Liebau, Max C; Pape, Lars; Rellensmann, Georg; Titieni, Andrea; von Kaisenberg, Constantin; Weber, Stefanie; Winyard, Paul J D; Schaefer, Franz

2018-01-01

Prenatal and neonatal cystic kidney diseases are a group of rare disorders manifesting as single, multiple unilateral, or bilateral cysts or with increased echogenicity of the renal cortex without macroscopic cysts. They may be accompanied by grossly enlarged kidneys, renal oligohydramnios, pulmonary hypoplasia, extrarenal abnormalities, and neonatal kidney failure. The prognosis is extremely variable from trivial to very severe or even uniformly fatal, which poses significant challenges to prenatal counseling and management. To provide a clinical practice recommendation for fetal medicine specialists, obstetricians, neonatologists, pediatric nephrologists, pediatricians, and human geneticists by aggregating current evidence and consensus expert opinion on current management of cystic nephropathies before and after birth. After 8 systematic literature reviews on clinically relevant questions were prepared (including 90 studies up to mid-2016), recommendations were formulated and formally graded at a consensus meeting that included experts from all relevant specialties. After further discussion, the final version was voted on by all members using the Delphi method. The recommendations were reviewed and endorsed by the working groups on inherited renal disorders of the European Renal Association-European Dialysis and Transplant Association (ERA-EDTA) and European Society for Paediatric Nephrology (ESPN); the German Society of Obstetrics and Gynecology (DGGG), German Society of Perinatal Medicine (DGPM), and German Society of Ultrasound in Medicine (DEGUM); and the alliance of patient organizations, PKD International. The group makes a number of recommendations on prenatal and postnatal imaging by ultrasound and magnetic resonance imaging, genetic testing, prenatal counseling, in utero therapeutic interventions, and postnatal management of prenatal and neonatal cystic kidney diseases, including provision of renal replacement therapy in neonates. In addition to detailed knowledge about possible etiologies and their prognosis, physicians need to be aware of recent improvements and remaining challenges of childhood chronic kidney disease, neonatal renal replacement therapy, and intensive pulmonary care to manage these cases and to empower parents for informed decision making.

Relation of epidermal growth factor receptor and estrogen receptor-independent pS2 protein to the malignant transformation of mucinous cystic neoplasms of the pancreas.

PubMed

Kirby, R E; Lewandrowski, K B; Southern, J F; Compton, C C; Warshaw, A L

1995-01-01

To evaluate the role of epidermal growth factor receptor (EGF-R) and pS2 protein in the evolution of malignancy in mucinous cystic tumors of the pancreas. Mucinous cystic tumors of the pancreas include histologically benign but premalignant mucinous cystic neoplasms and mucinous cystadenocarcinoma. The molecular events leading to transformation from a benign to a malignant mucinous tumor are not known. Overexpression of EGF-R and detection of an estrogen-induced protein (pS2) has been demonstrated in ductal adenocarcinomas of the pancreas, but these factors have not been evaluated in mucinous cystic tumors. Twenty-six mucinous tumors were examined for EGF-R, pS2 protein, and estrogen and progesterone receptors. Eight (61.2%) of 13 malignant tumors exhibited increased expression of EGF-R, whereas EGF-R was not detected in any of the 13 benign tumors (P = .002). The pS2 protein was detected in nine of 11 malignant and 11 of 11 benign tumors (P = .480). Estrogen and progesterone receptors were not detected in the epithelium of either tumor type. The median survival time of the patients with EGF-R-negative tumors was 29.0 months compared with 14.5 months for those with EGF-R-positive tumors, but this difference did not reach significance owing to the small population size. Overexpression of EGF-R in mucinous cystic tumors, as in ductal adenocarcinomas, may be an important feature associated with malignancy and may have prognostic significance. Failure to detect EGF-R in histologically benign epithelium suggests that the upregulation of EGF-R may be important in the evolution of aggressive behavior. The expression of pS2 protein appears to be independent of estrogen and may play a role in the proliferative activity of mucinous tumors. However, pS2 expression is not a feature associated exclusively with malignancy.

Pancreatic neuroendocrine tumor with complete replacement of the pancreas by serous cystic neoplasms in a patient with von Hippel-Lindau disease: a case report.

PubMed

Maeda, Shimpei; Motoi, Fuyuhiko; Oana, Shuhei; Ariake, Kyohei; Mizuma, Masamichi; Morikawa, Takanori; Hayashi, Hiroki; Nakagawa, Kei; Kamei, Takashi; Naitoh, Takeshi; Unno, Michiaki

2017-09-25

von Hippel-Lindau disease is a dominantly inherited multi-system syndrome with neoplastic hallmarks. Pancreatic lesions associated with von Hippel-Lindau include serous cystic neoplasms, simple cysts, and neuroendocrine tumors. The combination of pancreatic neuroendocrine tumors and serous cystic neoplasms is relatively rare, and the surgical treatment of these lesions must consider both preservation of pancreatic function and oncological clearance. We report a patient with von Hippel-Lindau disease successfully treated with pancreas-sparing resection of a pancreatic neuroendocrine tumor where the pancreas had been completely replaced by serous cystic neoplasms, in which pancreatic function was preserved. A 39-year-old female with von Hippel-Lindau disease was referred to our institution for treatment of a pancreatic neuroendocrine tumor. Abdominal computed tomography demonstrated a well-enhanced mass, 4 cm in diameter in the tail of the pancreas, and two multilocular tumors with several calcifications, 5 cm in diameter, in the head of the pancreas. There was complete replacement of the pancreas by multiple cystic lesions with diameters ranging from 1 to 3 cm. Magnetic resonance cholangiopancreatography showed innumerable cystic lesions on the whole pancreas and no detectable main pancreatic duct. Endoscopic ultrasound-guided fine-needle aspiration of the mass in the pancreatic tail showed characteristic features of a neuroendocrine tumor. A diagnosis of pancreatic neuroendocrine tumor in the tail of the pancreas and mixed-type serous cystic neoplasms replacing the whole pancreas was made and she underwent distal pancreatectomy while avoiding total pancreatectomy. The stump of the pancreas was sutured as firm as possible using a fish-mouth closure. The patient made a good recovery and was discharged on postoperative day 9. She is currently alive and well with no symptoms of endocrine or exocrine pancreatic insufficiency 8 months after surgery. A pancreas-sparing resection should be considered for patients with pancreatic neuroendocrine tumors and complete cystic replacement of the pancreas to preserve quality of life after surgery.

Dynamic Computed Tomographic Features of Adult Renal Cell Carcinoma Associated With Xp11.2 Translocation/TFE3 Gene Fusions: Comparison With Clear Cell Renal Cell Carcinoma.

PubMed

He, Jian; Gan, Weidong; Liu, Song; Zhou, Kefeng; Zhang, Gutian; Guo, Hongqian; Zhu, Bin

2015-01-01

To investigate the dynamic contrast-enhanced computed tomography (CT) characteristics of renal cell carcinoma associated with Xp11.2 translocation and TFE gene fusion (Xp11.2 RCC) by comparison with clear cell renal cell carcinoma (CCRCC). Dynamic contrast-enhanced CT images and clinical and pathological records of 20 adult patients with Xp11.2 RCC confirmed by TFE3 immunohistochemical and fluorescence in situ hybridization assay were retrospectively analyzed and compared with the findings of 21 contemporary CCRCCs. Renal cell carcinoma associated with Xp11.2 translocation and TFE gene fusions often occurred in young (30.6 ± 8.6 years) patients with hematuria (9/20). They presented as well-defined (17/20) cystic-solid (17/20) mass with hemorrhage (8/20) and circular/rim calcifications (6/20). Dynamic contrast-enhanced CT showed heterogeneous moderate prolonged enhancement. A tumor-to-cortex attenuation ratio in corticomedullary phase less than 0.62 gave a sensitivity of 90.0% and a specificity of 92.9% in differentiating Xp11.2 RCC from CCRCC (area under the receiver operating characteristic curve = 0.957, P < 0.001). Computed tomographic characteristics and dynamic contrast-enhanced patterns and index can differentiate Xp11.2 RCC from CCRCC.

Nonclinical safety of the sodium-glucose cotransporter 2 inhibitor empagliflozin.

PubMed

Bogdanffy, Matthew S; Stachlewitz, Robert F; van Tongeren, Susan; Knight, Brian; Sharp, Dale E; Ku, Warren; Hart, Susan Emeigh; Blanchard, Kerry

2014-01-01

Empagliflozin, a selective inhibitor of the renal tubular sodium-glucose cotransporter 2, was developed for treatment of type 2 diabetes mellitus. Nonclinical safety of empagliflozin was studied in a battery of tests to support global market authorization. Safety pharmacology studies indicated no effect of empagliflozin on measures of respiratory or central nervous system function in rats or cardiovascular safety in telemeterized dogs. In CD-1 mouse, Wistar Han rat, or beagle dogs up to 13, 26, or 52 weeks of treatment, respectively, empagliflozin exhibited a toxicity profile consistent with secondary supratherapeutic pharmacology related to glucose loss and included decreased body weight and body fat, increased food consumption, diarrhea, dehydration, decreased serum glucose and increases in other serum parameters reflective of increased protein catabolism, gluconeogenesis, and electrolyte imbalances, and urinary changes such as polyuria and glucosuria. Microscopic changes were consistently observed in kidney and included tubular nephropathy and interstitial nephritis (dog), renal mineralization (rat) and tubular epithelial cell karyomegaly, single cell necrosis, cystic hyperplasia, and hypertrophy (mouse). Empagliflozin was not genotoxic. Empagliflozin was not carcinogenic in female mice or female rats. Renal adenoma and carcinoma were induced in male mice only at exposures 45 times the maximum clinical dose. These tumors were associated with a spectrum of nonneoplastic changes suggestive of a nongenotoxic, cytotoxic, and cellular proliferation-driven mechanism. In male rats, testicular interstitial cell tumors and hemangiomas of the mesenteric lymph node were observed; both tumors are common in rats and are unlikely to be relevant to humans. These studies demonstrate the nonclinical safety of empagliflozin. © The Author(s) 2014.

Thyroid-like follicular carcinoma of the kidney: A report of two cases and literature review

PubMed Central

LIN, YUN-ZHI; WEI, YONG; XU, NING; LI, XIAO-DONG; XUE, XUE-YI; ZHENG, QING-SHUI; JIANG, TAO; HUANG, JIN-BEI

2014-01-01

There have only been a few reports of thyroid-like follicular carcinoma of the kidney (TLFCK) to date. In the present study, two patients with TLFCK are reported. Patient 1 was a 65-year-old male exhibiting repeated hematuria and right back pain. No tumors were located in the patient’s thyroid or lungs. The physical examination revealed percussion tenderness over the right kidney region was noticed. Enhanced computed tomography (CT) indicated a right renal pelvic carcinoma, for which the patient underwent a radical right nephrectomy. Patient 2 was a 59-year-old male with a mass in the right kidney, located during a health examination and who exhibited no obvious clinical symptoms. The patient was clinically diagnosed with right renal carcinoma, confirmed by an enhanced CT. The patient underwent a radical right nephrectomy. The clinical features, imaging results, pathology, immune phenotypes, treatment and prognosis were analyzed. The associated literature was also reviewed. The cut surface of each tumor showed gray-white material with a central solid area, including scattered gray-brown necrotic and gray hemorrhagic areas and small cystic cavities. Microscopically, the arrangement of the tumor cells mimicked thyroid follicles with red-stained colloid-like material in the lumen. No renal hilar lymph node involvement was noted. The tumor tissue of patient 1 was immunohistochemically positive for vimentin, epithelial membrane antigen (EMA), cytokeratin (CK), CK7, and neuron specific enolase; and negative for CK34BE12, synapsin (Syn), CK20, cluster of differentiation 56 (CD56), CD10, Wilm’s tumor-1 (WT-1), CD34, CD57, P53, CD99, thyroid transcription factor-1 (TTF-1), CD15 and thyroglobulin (TG); with a Ki-67 labeling index (LI) of 30%. The tumor tissue of patient 2 was immunohistochemically positive for vimentin, EMA, CK7 and CK20; and negative for CD56, CD10, WT-1, CD34, CD57, P53, CD117, TTF-1, CD15, CD99, TG, chromogranin A and Syn; with a Ki-67 LI of 20%. TLFCK is a rare renal tumor with low malignancy but medium invasiveness. It morphologically resembles thyroid follicular carcinoma but does not express TTF-1 or TG. Radical nephrectomy can achieve good patient outcomes. PMID:24932236

Thyroid-like follicular carcinoma of the kidney: A report of two cases and literature review.

PubMed

Lin, Yun-Zhi; Wei, Yong; Xu, Ning; Li, Xiao-Dong; Xue, Xue-Yi; Zheng, Qing-Shui; Jiang, Tao; Huang, Jin-Bei

2014-06-01

There have only been a few reports of thyroid-like follicular carcinoma of the kidney (TLFCK) to date. In the present study, two patients with TLFCK are reported. Patient 1 was a 65-year-old male exhibiting repeated hematuria and right back pain. No tumors were located in the patient's thyroid or lungs. The physical examination revealed percussion tenderness over the right kidney region was noticed. Enhanced computed tomography (CT) indicated a right renal pelvic carcinoma, for which the patient underwent a radical right nephrectomy. Patient 2 was a 59-year-old male with a mass in the right kidney, located during a health examination and who exhibited no obvious clinical symptoms. The patient was clinically diagnosed with right renal carcinoma, confirmed by an enhanced CT. The patient underwent a radical right nephrectomy. The clinical features, imaging results, pathology, immune phenotypes, treatment and prognosis were analyzed. The associated literature was also reviewed. The cut surface of each tumor showed gray-white material with a central solid area, including scattered gray-brown necrotic and gray hemorrhagic areas and small cystic cavities. Microscopically, the arrangement of the tumor cells mimicked thyroid follicles with red-stained colloid-like material in the lumen. No renal hilar lymph node involvement was noted. The tumor tissue of patient 1 was immunohistochemically positive for vimentin, epithelial membrane antigen (EMA), cytokeratin (CK), CK7, and neuron specific enolase; and negative for CK34BE12, synapsin (Syn), CK20, cluster of differentiation 56 (CD56), CD10, Wilm's tumor-1 (WT-1), CD34, CD57, P53, CD99, thyroid transcription factor-1 (TTF-1), CD15 and thyroglobulin (TG); with a Ki-67 labeling index (LI) of 30%. The tumor tissue of patient 2 was immunohistochemically positive for vimentin, EMA, CK7 and CK20; and negative for CD56, CD10, WT-1, CD34, CD57, P53, CD117, TTF-1, CD15, CD99, TG, chromogranin A and Syn; with a Ki-67 LI of 20%. TLFCK is a rare renal tumor with low malignancy but medium invasiveness. It morphologically resembles thyroid follicular carcinoma but does not express TTF-1 or TG. Radical nephrectomy can achieve good patient outcomes.

A pediatric intramedullary spinal cord tumor with unusual solid-cystic and papillary features: a case report.

PubMed

Iwasaki, Takeshi; Kato, Masako; Horie, Yasushi; Kato, Shinsuke; Akatsuka, Keiichi; Watanabe, Takashi; Kuwamoto, Satoshi; Murakami, Ichiro; Hayashi, Kazuhiko

2011-12-01

Spinal cord tumors are rare in children. We report a novel case of pediatric intramedullary spinal cord tumor with unusual solid-cystic and papillary features. Clinically, the patient presented at the age of 3 years with motor deficit and urinary incontinence, and MRI demonstrated multilocular cystic lesions in the thoracic spine. Histologically the tumor consisted of solid, sheet-like components and branching papillary structures, and immunohistochemistry demonstrated positive reactivity for epithelial membrane antigen, cytokeratins (7, AE1/3, CAM5.2), E-cadherin and transthyretin, and negativity for GFAP, S-100 protein, synaptophysin and neurofilament. These histological and immunohistochemical findings appeared to be unique, and were not compatible with the features of classical ependymoma or choroid plexus papilloma. The clinical behavior, characterized by relatively rapid tumor regrowth after surgical resection and a relatively high MIB-1 labeling index, suggest that this tumor might have had moderate malignant potential. This pediatric case appears to be particularly informative with regard to the tumor biology or tumorigenesis of intramedullary spinal cord tumor with unusual solid-cystic and papillary features. © 2011 Japanese Society of Neuropathology.

Simultaneous liver mucinous cystic and intraductal papillary mucinous neoplasms of the bile duct: a case report.

PubMed

Budzynska, Agnieszka; Hartleb, Marek; Nowakowska-Dulawa, Ewa; Krol, Robert; Remiszewski, Piotr; Mazurkiewicz, Michal

2014-04-14

Cystic hepatic neoplasms are rare tumors, and are classified into two separate entities: mucinous cystic neoplasms (MCNs) and intraductal papillary mucinous neoplasms of the bile duct (IPMN-B). We report the case of a 56-year-old woman who presented with abdominal pain and jaundice due to the presence of a large hepatic multilocular cystic tumor associated with an intraductal tumor. Partial hepatectomy with resection of extrahepatic bile ducts demonstrated an intrahepatic MCN and an intraductal IPMN-B. This is the first report of the simultaneous occurrence of these two histologically distinct entities in the liver.

Renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion: imaging findings in 21 patients.

PubMed

Chen, Xiao; Zhu, Qingqiang; Li, Baoxin; Cui, Wenjing; Zhou, Hao; Duan, Na; Liu, Yongkang; Kundra, Vikas; Wang, Zhongqiu

2017-02-01

To characterize imaging features of renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE gene fusion. Twenty-one patients with Xp11.2/TFE RCC were retrospectively evaluated. Tumour location, size, density, cystic or solid appearance, calcification, capsule sign, enhancement pattern and metastases were assessed. Fourteen women and seven men were identified with 12 being 25 years old or younger. Tumours were solitary and cystic-solid (76.2 %) masses with a capsule (76.2 %); 90.5 % were located in the medulla. Calcifications and lymph node metastases were each observed in 24 %. On unenhanced CT, tumour attenuation was greater than in normal renal parenchyma (85.7 %). Tumour enhancement was less than in normal renal cortex on all enhanced phases, greater than in normal renal medulla on cortical and medullary phases, but less than in normal renal medulla on delayed phase. On MR, the tumours were isointense on T1WI, heterogeneously hypointense on T2WI and slightly hyperintense on diffusion-weighted imaging. Xp11.2/TFE RCC usually occurs in young women. It is a cystic-solid, hyperdense mass with a capsule. It arises from the renal medulla with enhancement less than in the cortex but greater than in the medulla in all phases except the delayed phase, when it is lower than in the medulla. • Xp11.2/TFE RCC was more prevalent in young women. • On unenhanced CT, Xp11.2/TFE RCC attenuation was greater than in renal parenchyma. • Xp111/2TFE RCC arises primarily from the renal medulla. • Xp11.2/TFE RCC enhancement was less than in the cortex on all phases. • Enhancement was greater than in the medulla in arterial and corticomedullary phase.

Inversin, the gene product mutated in nephronophthisis type II, functions as a molecular switch between Wnt signaling pathways

PubMed Central

Simons, Matias; Gloy, Joachim; Ganner, Athina; Bullerkotte, Axel; Bashkurov, Mikhail; Krönig, Corinna; Schermer, Bernhard; Benzing, Thomas; Cabello, Olga A; Jenny, Andreas; Mlodzik, Marek; Polok, Bozena; Driever, Wolfgang; Obara, Tomoko; Walz, Gerd

2013-01-01

Cystic renal diseases are caused by mutations of proteins that share a unique subcellular localization: the primary cilium of tubular epithelial cells1. Mutations of the ciliary protein inversin cause nephronophthisis type II, an autosomal recessive cystic kidney disease characterized by extensive renal cysts, situs inversus and renal failure2. Here we report that inversin acts as a molecular switch between different Wnt signaling cascades. Inversin inhibits the canonical Wnt pathway by targeting cytoplasmic dishevelled (Dsh or Dvl1) for degradation; concomitantly, it is required for convergent extension movements in gastrulating Xenopus laevis embryos and elongation of animal cap explants, both regulated by noncanonical Wnt signaling. In zebrafish, the structurally related switch molecule diversin ameliorates renal cysts caused by the depletion of inversin, implying that an inhibition of canonical Wnt signaling is required for normal renal development. Fluid flow increases inversin levels in ciliated tubular epithelial cells and seems to regulate this crucial switch between Wnt signaling pathways during renal development. PMID:15852005

Pancreatic cystic tumors.

PubMed

Salvia, R; Festa, L; Butturini, G; Tonsi, A; Sartori, N; Biasutti, C; Capelli, P; Pederzoli, P

2004-04-01

Cystic tumors of the pancreas are less frequent than other tumors in neoplastic pancreatic pathology, but in recent years the literature has reported an increasing number. After the first report by Becourt in 1830, cystic tumors were classified into 2 different types by Compagno and Oertel in 1978: benign tumors with glycogen-rich cells and mucinous cystic neoplasms with overt and latent malignancy. The WHO classification of exocrine tumors of the pancreas, published in 1996, is based on the histopathological features of the epithelial wall, which are the main factor in differential diagnosis with cystic lesions of the pancreas. Thanks to the knowledge acquired up to now, a surgical procedure is not always required because the therapeutic choice is conditioned by the correct classification of this heterogeneous group of tumors. Clinical signs are not really useful in the clinical work up, most patients have no symptoms and when clinical signs are present, they may help us to pinpoint the organ of origin but never to identify the type of pathology. In the last few years, the great improvement in imaging has enabled us not only to discriminate cystic from solid lesions, but also to identify the features of the lesions and label them preoperatively. More invasive diagnostic procedures such as fine needle aspiration and intracystic fluid tumor marker level are not really useful because they are not sensitive and the cystic wall can show different degrees of dysplasia and de-epithelialization. These are the reasons for sending the entire specimen to pathology. Good cooperation between surgeons, pathologists, radiologists and gastroenterologists is mandatory to increase the chances of making a proper diagnosis. Therefore, we must analyze all the information we have, such as age, sex, clinical history, location of the tumor and radiological features, in order to avoid the mistake of treating a cystic neoplasm as a benign lesion or as a pseudocyst, as described in the literature. Except for inoperable cases due to the critical condition of the patient or non-resectable lesions, surgical treatment differs with the diagnosis. Cystic tumors of the pancreas, therefore, are a heterogeneous group of tumors, with a real problem regarding differential diagnosis between neoplastic and inflammatory lesions. Even with a proper work up, some perplexity may remain about the nature of the lesion and in these cases the surgical procedure has a therapeutic value as well as playing a diagnostic role. The role of surgery is central in the treatment of these tumors because it could be curative when complete resection is possible. In this way, the lack of good therapeutic results with chemotherapy and radiotherapy force the surgeon to go ahead with the procedure. Intraductal papillary mucinous neoplasms represent a new and, from the epidemiological point of view, important chapter in the world of cystic tumors. The margin of resection is important and the surgeon has to be aware that in order to have a curative resection, total pancreatectomy is sometimes required. In the last few years the therapeutic approach has changed thanks to new knowledge of the biological behavior of these tumors. In fact, from a surgical approach in all cases, we are now discussing the possibility of a follow-up not only for asymptomatic serous cystadenomas but also for the little branch side intraductal papillary mucinous neoplasms (IPMNs) in critical patients. A follow-up could be planned even for solid pseudopapillary tumors but it seems risky to leave untreated big tumors in young patients without a certain diagnosis and with so few studies reported in the literature.

Embryonal rhabdomyosarcoma in a patient with a heterozygous frameshift variant in the DICER1 gene and additional manifestations of the DICER1 syndrome.

PubMed

Fremerey, Julia; Balzer, Stefan; Brozou, Triantafyllia; Schaper, Joerg; Borkhardt, Arndt; Kuhlen, Michaela

2017-07-01

Germline mutations in the DICER1 gene are associated with an inherited cancer predisposition syndrome also known as the DICER1-syndrome, which is implicated in a broad range of tumors including pleuropulmonary blastoma, ovarian Sertoli-Leydig cell tumors, ciliary body medulloepithelioma (CBME), pituitary blastoma, embryonal rhabdomyosarcoma (eRMS), anaplastic renal sarcoma as well as ocular, sinonasal tumors ovarian sex-cord tumors, thyroid neoplasia and cystic nephroma. This study describes a novel, heterozygous frameshift DICER1 mutation in a patient, who is affected by different tumors of the DICER1-syndrome, including eRMS, CBME and suspected pleuropulmonary blastoma type I. By whole-exome sequencing of germline material using peripheral blood-derived DNA, we identified a single base pair duplication within the DICER1 gene (c.3405 dupA) that leads to a frameshift and results in a premature stop in exon 21 (p.Gly1136Arg). The metachronous occurrence of two unrelated tumor entities (eRMS and CBME) in a very young child within a short timeframe should have raised the suspicion of an underlying cancer susceptibility syndrome and should be prompt tested for DICER1.

Adenoid cystic carcinoma of cervix: two cases report and review of the literature.

PubMed

Benhayoune, Khadija; El Fatemi, Hinde; Bannani, Abdelaziz; Melhouf, Abdelilah; Harmouch, Toufik

2015-01-01

Adenoid cystic carcinoma of the cervix is a rare and aggressive tumor with fatal outcome. In this paper we report two cases of primary adenoid cystic carcinoma and a review of literature. A 80 years old woman, admitted to our hospital with postmenopausal bleeding and hydrorrhea. Gynealogical examination showed a cervical stenotic with the presence of a tumor processus. Biopsy of cervical growth was done. 80-year-old woman presented with vaginal bleeding with pelvic pain. Physical examination revealed a friable mass in the cervix. Incisional biopsy was performed. In the both cases the diagnosis of adenoid cystic carcinoma of the cercix was confirmed. Adenoid cystic carcinoma of the cervix is clinically and radiologically similar to other tumors of the cervix but the diagnosis can only be made by histological examination.

Adenoid cystic carcinoma of cervix: two cases report and review of the literature

PubMed Central

Benhayoune, Khadija; El Fatemi, Hinde; Bannani, Abdelaziz; Melhouf, Abdelilah; Harmouch, Toufik

2015-01-01

Adenoid cystic carcinoma of the cervix is a rare and aggressive tumor with fatal outcome. In this paper we report two cases of primary adenoid cystic carcinoma and a review of literature. A 80 years old woman, admitted to our hospital with postmenopausal bleeding and hydrorrhea. Gynealogical examination showed a cervical stenotic with the presence of a tumor processus. Biopsy of cervical growth was done. 80-year-old woman presented with vaginal bleeding with pelvic pain. Physical examination revealed a friable mass in the cervix. Incisional biopsy was performed. In the both cases the diagnosis of adenoid cystic carcinoma of the cercix was confirmed. Adenoid cystic carcinoma of the cervix is clinically and radiologically similar to other tumors of the cervix but the diagnosis can only be made by histological examination. PMID:26090035

[Diagnostic value of MYB protein expression in adenoid cystic carcinoma and status of MYB gene copy number].

PubMed

Huo, Zhen; Zeng, Xuan; Wu, Shafei; Wu, Huanwen; Meng, Yunxiao; Liu, Yuanyuan; Luo, Yufeng; Cao, Jinling; Liang, Zhiyong

2015-08-01

To explore the diagnostic value of MYB protein expression for adenoid cystic carcinoma and its differential diagnosis from other salivary gland tumors, and to further investigate the status of MYB gene copy number. MYB expression was studied by immunohistochemistry in 34 adenoid cystic carcinomas, 55 non-adenoid cystic carcinomas (other salivary gland tumors) including 10 pleomorphic adenomas, 10 basal cell adenomas, 10 epithelial-myoepithelial carcinomas, 9 basal cell adenocarcinomas, 8 mucoepidermoid carcinomas, 4 carcinoma in pleomorphic adenomas, and 4 polymorphous low-grade adenocarcinoma. MYB gene copy number status was detected by FISH in MYB protein-positive cases. 82.4% (28/34) of adenoid cystic carcinomas were MYB protein-positive, compared with 9.1% (5/55) of non-adenoid cystic carcinomas, and the difference between the two groups was statistically significant (P < 0.01). 2/18 of adenoid cystic carcinomas had duplication of MYB gene by FISH, and all non-adenoid cystic carcinomas were negative although the difference was not statistically significant (P = 0.435). MYB protein expression is a useful diagnostic marker for adenoid cystic carcinomas in its separation from other salivary gland tumors. In addition, duplication of MYB gene is no a major mechanism for the MYB protein overexpression.

BH3-mimetic small molecule inhibits the growth and recurrence of adenoid cystic carcinoma

PubMed Central

Acasigua, Gerson A.; Warner, Kristy A.; Nör, Felipe; Helman, Joseph; Pearson, Alexander T.; Fossati, Anna C.; Wang, Shaomeng; Nör, Jacques E.

2015-01-01

Objectives To evaluate the anti-tumor effect of BM-1197, a new potent and highly specific small molecule inhibitor of Bcl-2/Bcl-xL, in preclinical models of human adenoid cystic carcinoma (ACC). Methods Low passage primary human adenoid cystic carcinoma cells (UM-HACC-2A,-2B,-5,-6) and patient-derived xenograft (PDX) models (UM-PDX-HACC) were developed from surgical specimens obtained from 4 patients. The effect of BM-1197 on cell viability and cell cycle were evaluated in vitro using this panel of low passage ACC cells. The effect of BM-1197 on tumor growth, recurrence and tumor cell apoptosis in vivo was evaluated with the PDX model of ACC (UM-PDX-HACC-5). Results Exposure of low passage primary human ACC cells to BM-1197 mediated an IC50 of 0.92-2.82 μM. This correlated with an increase in the fraction of apoptotic cells (p<0.0001) and an increase in caspase-3 activity (p<0.0001), but no noticeable differences in cell cycle (p>0.05). In vivo, BM-1197 inhibited tumor growth (p=0.0256) and induced tumor cell apoptosis (p=0.0165) without causing significant systemic toxicities, as determined by mouse weight over time. Surprisingly, weekly BM-1197 decreased the incidence of tumor recurrence (p=0.0297), as determined by Kaplan-Meier analysis. Conclusion These data demonstrated that single agent BM-1197 induces apoptosis and inhibits tumor growth in preclinical models of adenoid cystic carcinoma. Notably, single agent BM-1197 inhibited tumor recurrence, which is considered a major clinical challenge in the clinical management of adenoid cystic carcinoma. Collectively, these results suggest that patients with adenoid cystic carcinoma might benefit from therapy with a BH3-mimetic small molecule. PMID:26121939

Lapatinib in Treating Patients With Recurrent and/or Metastatic Adenoid Cystic Cancer or Other Salivary Gland Cancers

ClinicalTrials.gov

2017-03-06

High-grade Salivary Gland Carcinoma; High-grade Salivary Gland Mucoepidermoid Carcinoma; Low-grade Salivary Gland Carcinoma; Low-grade Salivary Gland Mucoepidermoid Carcinoma; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Salivary Gland Cancer; Salivary Gland Acinic Cell Tumor; Salivary Gland Adenocarcinoma; Salivary Gland Adenoid Cystic Carcinoma; Salivary Gland Malignant Mixed Cell Type Tumor

Gender hormones and the progression of experimental polycystic kidney disease.

PubMed

Stringer, Kenneth D; Komers, Radko; Osman, Shukri A; Oyama, Terry T; Lindsley, Jessie N; Anderson, Sharon

2005-10-01

Male gender is a risk factor for progression of autosomal-dominant polycystic kidney disease (ADPKD), clinically and in the Han:SPRD rat model. Orchiectomy limits progression, but mechanisms of the detrimental effect of androgen, and/or beneficial effects of estrogen, are not known. This protocol tested the hypothesis that male gender (intact androgen status) promotes progression, while female gender (intact estrogen status) is protective; and that these disease-modifying effects are due to changes in expression of known fibrotic mediators. Studies were performed in male and female noncystic control (+/+) and cystic (+/-) rats subjected to orchiectomy, ovariectomy, or sham operation. At 12 weeks of age, renal function was measured. Blood and kidneys were taken for measurement of plasma and renal renin, endothelin (ET-1), endothelial nitric oxide synthase (eNOS), and vascular endothelial growth factor (VEGF), using biochemical, protein expression, and immunohistochemical methods. Cystic male rats exhibited significantly reduced glomerular filtration (GFR) and effective renal plasma flow (ERPF) rates, with suppression of plasma and renal renin, up-regulation of renal ET-1 and eNOS, and down-regulation of renal VEGF expression. Orchiectomy attenuated the fall in GFR and ERPF, while numerically limiting changes in eNOS and VEGF. Female rats exhibited less cystic growth, with normal renin status, lesser elevation of renal ET-1, and proportionately lesser changes in VEGF and eNOS. Ovariectomy led to higher blood pressure and reduced GFR and ERPF, with a trend toward upregulation of ET-1, and significant down-regulation of VEGF and eNOS. Female gender is protective, but ovariectomy attenuates the protective effect of female gender, in association with changes in renal expression of ET-1, VEGF, and eNOS. The accelerated disease in male rats can be attenuated by orchiectomy and consequent changes in expression of disease mediators.

Differential tumor microenvironment in human ovarian cystic tumors.

PubMed

Tavares Murta, Beatriz Martins; Cunha, Fernando de Queiróz; Miranda, Rodrigo; Adad, Sheila Jorge; Murta, Eddie Fernando Candido

2004-01-01

Cells and soluble mediators obtained from tumor effusions are useful in evaluating the tumor microenvironment. Our aim was to examine cytologically and to quantify the leukocyte infiltrate, nitric oxide, cytokines and tumor markers in the intracystic fluid from patients with a cystic adnexal mass, for a possible differentiation between benign and malignant findings. Sixty-six women who had their cystic fluids collected were prospectively divided into benign tumor (22, 33.3%), malignant tumor (10, 15.2%) or other gynecological alterations (34, 51.5%). Cytology, total and differential leukocyte counts were determined by light microscopy. Tumor markers, cytokines and nitric oxide were assayed in the supernatants using the Immulite system, ELISA and Griess reaction, respectively. The sensitivity and specificity of the cytological analysis was 66.7% and 97.7%, respectively. The levels of CA 19.9, CA 15.3, alpha-fetoprotein, carcinoembryonic antigen, progesterone and beta-HCG were significantly higher in the benign and/or malignant group than in the other gynecological alterations. Also, the local concentrations of CA 15.3 and beta-HCG were significantly higher in malignant than in benign tumors. In malignant tumors, increased leukocyte counts and higher concentrations of IL-6, IL-10 and nitric oxide were detected than in benign tumors or other gynecological alterations. In malignant tumors, the microenvironment could be differentiated from benign tumors or other gynecological alterations by cystic fluid analysis.

Adenoid cystic carcinoma: An unusual presentation.

PubMed

Pushpanjali, M; Sujata, D Naga; Subramanyam, S Bala; Jyothsna, M

2014-05-01

The adenoid cystic carcinoma is a relatively rare epithelial tumor of the major and minor salivary glands, accounting for about 1% of all malignant tumor of the oral and maxillofacial regions. Peak incidence occurs between the 5(th) and 6(th) decades of life. The clinical and pathological findings typical of this tumor include slow growth, peri-neural invasion, multiple local recurrences and distant metastasis. Herein, we report a case of adenoid cystic carcinoma of oropharynx with unusual clinical presentation. The diagnosis of this case and importance of cytology in diagnosing such cases is discussed.

Adenoid cystic carcinoma: An unusual presentation

PubMed Central

Pushpanjali, M; Sujata, D Naga; Subramanyam, S Bala; Jyothsna, M

2014-01-01

The adenoid cystic carcinoma is a relatively rare epithelial tumor of the major and minor salivary glands, accounting for about 1% of all malignant tumor of the oral and maxillofacial regions. Peak incidence occurs between the 5th and 6th decades of life. The clinical and pathological findings typical of this tumor include slow growth, peri-neural invasion, multiple local recurrences and distant metastasis. Herein, we report a case of adenoid cystic carcinoma of oropharynx with unusual clinical presentation. The diagnosis of this case and importance of cytology in diagnosing such cases is discussed. PMID:25328314

Contrast-enhanced multidetector computerized tomography for odontogenic cysts and cystic-appearing tumors of the jaws: is it useful?

PubMed

Kakimoto, Naoya; Chindasombatjaroen, Jira; Tomita, Seiki; Shimamoto, Hiroaki; Uchiyama, Yuka; Hasegawa, Yoko; Kishino, Mitsunobu; Murakami, Shumei; Furukawa, Souhei

2013-01-01

The purpose of this study was to investigate the usefulness of computerized tomography (CT), particularly contrast-enhanced CT, in differentiation of jaw cysts and cystic-appearing tumors. We retrospectively analyzed contrast-enhanced CT images of 90 patients with odontogenic jaw cysts or cystic-appearing tumors. The lesion size and CT values were measured and the short axis to long axis (S/L) ratio, contrast enhancement (CE) ratio, and standard deviation ratio were calculated. The lesion size and the S/L ratio of keratocystic odontogenic tumors were significantly different from those of radicular cysts and follicular cysts. There were no significant differences in the CE ratio among the lesions. Multidetector CT provided diagnostic information about the size of odontogenic cysts and cystic-appearing tumors of the jaws that was related to the lesion type, but showed no relation between CE ratio and the type of these lesions. Copyright © 2013 Elsevier Inc. All rights reserved.

Lower Female Genital Tract Tumors With Adenoid Cystic Differentiation: P16 Expression and High-risk HPV Detection.

PubMed

Xing, Deyin; Schoolmeester, J Kenneth; Ren, Zhiyong; Isacson, Christina; Ronnett, Brigitte M

2016-04-01

Lower female genital tract tumors with adenoid cystic differentiation are rare, and data on their relationship with high-risk human papillomavirus (HPV) are limited. Here we report the clinicopathologic features from a case series. Tumors with adenoid cystic differentiation, either pure or as part of a carcinoma with mixed differentiation, arising in the lower female genital tract were evaluated by means of immunohistochemical analysis for p16 expression and in situ hybridization using 1 or more probes for high-risk HPV (a high-risk probe covering multiple types, a wide-spectrum probe, and separate type-specific probes for HPV16 and HPV18) and when possible by polymerase chain reaction for high-risk HPV. Six cervical carcinomas with adenoid cystic differentiation admixed with various combinations of at least 1 other pattern of differentiation, including adenoid basal tumor (epithelioma and/or carcinoma), squamous cell carcinoma (basaloid or keratinizing), and small cell carcinoma were identified in patients ranging in age from 50 to 86 years (mean, 73 y; median, 76 y). All of these tumors were characterized by diffuse p16 expression. High-risk HPV was detected in 5 of 6 tested cases: 4 cases by in situ hybridization (all positive for HPV-wide-spectrum and HPV16) and 1 by polymerase chain reaction (HPV45). Seven pure adenoid cystic carcinomas (6 vulvar and 1 cervical) were identified in patients ranging in age from 27 to 74 years (mean, 48 y; median, 48 y). All of these tumors were characterized by variable p16 expression ranging from very limited to more extensive but never diffuse. No high-risk HPV was detected in any of these pure tumors. Lower female genital tract carcinomas with adenoid cystic differentiation appear to comprise 2 pathogenetically distinct groups. Cervical carcinomas with mixed differentiation, including adenoid cystic, adenoid basal, squamous, and small cell components, are etiologically related to high-risk HPV and can be identified by diffuse p16 expression. Pure vulvar and cervical adenoid cystic carcinomas appear to be unrelated to high-risk HPV and are distinguished from the mixed carcinomas by nondiffuse p16 expression.

Combination Chemotherapy, Radiation Therapy, and/or Surgery in Treating Patients With High-Risk Kidney Tumors

ClinicalTrials.gov

2017-06-22

Childhood Renal Cell Carcinoma; Clear Cell Renal Cell Carcinoma; Clear Cell Sarcoma of the Kidney; Papillary Renal Cell Carcinoma; Rhabdoid Tumor of the Kidney; Stage I Renal Cell Cancer; Stage I Renal Wilms Tumor; Stage II Renal Cell Cancer; Stage II Renal Wilms Tumor; Stage III Renal Cell Cancer; Stage III Renal Wilms Tumor; Stage IV Renal Cell Cancer; Stage IV Renal Wilms Tumor

Adenoid cystic carcinoma of the buccal mucosa: A case report and review of the literature

PubMed Central

Ajila, Vidya; Hegde, Shruthi; Nair, Gopakumar R; Babu, Subhas G

2012-01-01

Adenoid cystic carcinomas are deceptive malignancies that show slow growth and local invasion with recurrences seen many years after diagnosis. Upto 50% of these tumors occur in the intraoral minor salivary glands usually in the hard palate. Buccal mucosal tumors are relatively rare. We determined the incidence of buccal mucosal adenoid cystic carcinoma by reviewing the number of reported cases in the literature. This is the first article to analyze the occurrence of adenoid cystic carcinomas in the buccal mucosa through a review of 41 articles. Our review revealed 178 buccal mucosal adenoid cystic carcinomas among a total of 2,280 reported cases. We present a case of adenoid cystic carcinoma occurring in the left buccal mucosa of a 45-year-old female. PMID:23559934

Cystic lung disease in birt-hogg-dubé syndrome: a case series of three patients.

PubMed

Kilincer, Abidin; Ariyurek, Orhan Macit; Karabulut, Nevzat

2014-06-01

Birt-Hogg-Dubé syndrome is characterized by clinical manifestations such as hamartomas of the skin, renal tumors and lung cysts with spontaneous pneumothoraces. Patients with Birt-Hogg-Dubé syndrome may present with only multiple lung cysts. We report the chest computerized tomography (CT) features of three patients with Birt-Hogg-Dubé syndrome. Each patient had multiple lung cysts of various sizes according to chest CT evaluation, most of which were located in lower lobes and related to pleura. The identification of unique characteristics in the chest CT of patients with Birt-Hogg-Dubé syndrome may provide an efficient mechanism for diagnosis.

Ovarian mature cystic teratoma with fistula formation into the rectum: a case report.

PubMed

Kizaki, Yuichiro; Nagai, Tomonori; Ohara, Ken; Gomi, Yosuke; Akahori, Taichi; Ono, Yoshihisa; Matsunaga, Shigetaka; Takai, Yasushi; Saito, Masahiro; Baba, Kazunori; Seki, Hiroyuki

2016-01-01

While ovarian mature cystic teratomas are benign ovarian germ-cell tumors and the most common type of all ovarian tumors, the formation of fistulas into surrounding organs such as the bladder and the intestinal tract is extremely rare. This report documents a case of ovarian mature cystic teratoma with a rectal fistula, thought to be caused by local inflammation. A pelvic mass was diagnosed as an ovarian mature cystic teratoma of approximately 10 cm in diameter on transvaginal ultrasound and magnetic resonance examinations. Endoscopic examination of the lower gastrointestinal tract to investigate diarrhea revealed an ulcerative lesion with hair in the rectal wall adjacent to the ovarian cyst, and formation of a fistula from the ovarian teratoma into the rectum was suspected. Laparotomy revealed extensive inflammatory adhesions between a left ovarian tumor and the rectum. Left salpingo-oophorectomy and upper anterior resection of the rectum were performed. The final pathological diagnosis was ovarian mature cystic teratoma with no malignant findings, together with severe rectal inflammation and fistula formation with no structural disorders such as diverticulitis of the colon or malignant signs. The formation of fistulas and invasion into the neighboring organs are extremely rare complications for ovarian mature cystic teratomas. The invasion of malignant cells into neighboring organs due to malignant transformation of the tumor is reported as the cause of fistula formation into the neighboring organs. A review of 17 cases including the present case revealed that fistula formation due to malignant transformation comprised only 4 cases (23.5 %), with inflammation as the actual cause in the majority of cases (13 cases, 76.5 %). Although malignancy is the first consideration when fistula formation is observed between ovarian tumors and surrounding organs, in mature cystic teratoma, local inflammation is more likely than malignant transformation.

Uncommon Localization of Extrarenal Xp11.2 Translocation-associated Renal Cell Carcinoma (RCC): Case Report.

PubMed

Al-Maghrabi, Jaudah Ahmed; Khabaz, Mohamad Nidal

2017-09-04

The World Health Organization has recognized Xp11.2 translocation-associated renal cell carcinoma (RCC) as a distinct neoplasm that arises within the kidney. Although many reports of extrarenal carcinoma may be found in the literature, to the best of our knowledge, Xp11 translocation-associated RCC with intact kidneys has not been documented. This report describes a multilobulated right retroperitoneal soft tissue mass (7.9×5.3×12.6 cm) of a 37-year-old man complaining of abdominal pain in the right side. The patient underwent a computed tomography-guided biopsy. Microscopic evaluation reveals a tumor with papillary and sheaths architectures with cells revealing clear to eosinophilic cytoplasm. Immunohistochemical evaluation on the biopsy reveals that the tumor is positive for PAX-8, CD10, and TFE3. It is negative for CK7, EMA, Vimentin, RCC, CK8/18, D20, CD3, PLAP, OCT4, CD30, MART-1, Inhibin, S-100, HMB-45, Desmin, SMA, and DOG-1. The diagnosis was malignant epithelioid neoplasm and the diagnosis of translocation RCC was suggested. Excision was recommended. The patient underwent right radical nephrectomy with removal of this large mass. Pathologic examination showed a large cystic and solid, nonhomogenous mass with some necrotic areas, originating from the perirenal fat between the adrenal gland and the kidney. Microscopic features showed a tumor with papillary, rhabdoid, and clear cell features. Immunohistochemical stains showed that the tumor cells positively expressed AMACR, PAX-8, CD10, RCC, and TFE3, but were negative for cytokeratins, vimentin, HMB-45, desmin, SMA, EMA, and MSA. Cytogenetic studies confirmed the diagnosis of Xp11.2 translocation-associated RCC with positive TFE3 gene rearrangement. To the best of our knowledge, this type of extrarenal tumor has never been reported.

Disruption of IFT Complex A Causes Cystic Kidneys without Mitotic Spindle Misorientation

PubMed Central

Jonassen, Julie A.; SanAgustin, Jovenal; Baker, Stephen P.

2012-01-01

Intraflagellar transport (IFT) complexes A and B build and maintain primary cilia. In the mouse, kidney-specific or hypomorphic mutant alleles of IFT complex B genes cause polycystic kidneys, but the influence of IFT complex A proteins on renal development is not well understood. In the present study, we found that HoxB7-Cre–driven deletion of the complex A gene Ift140 from collecting ducts disrupted, but did not completely prevent, cilia assembly. Mutant kidneys developed collecting duct cysts by postnatal day 5, with rapid cystic expansion and renal dysfunction by day 15 and little remaining parenchymal tissue by day 20. In contrast to many models of polycystic kidney disease, precystic Ift140-deleted collecting ducts showed normal centrosomal positioning and no misorientation of the mitotic spindle axis, suggesting that disruption of oriented cell division is not a prerequisite to cyst formation in these kidneys. Precystic collecting ducts had an increased mitotic index, suggesting that cell proliferation may drive cyst expansion even with normal orientation of the mitotic spindle. In addition, we observed significant increases in expression of canonical Wnt pathway genes and mediators of Hedgehog and tissue fibrosis in highly cystic, but not precystic, kidneys. Taken together, these studies indicate that loss of Ift140 causes pronounced renal cystic disease and suggest that abnormalities in several different pathways may influence cyst progression. PMID:22282595

Angiomyolipoma with Minimal Fat: Can It Be Differentiated from Clear Cell Renal Cell Carcinoma by Using Standard MR Techniques?

PubMed Central

Hindman, Nicole; Ngo, Long; Genega, Elizabeth M.; Melamed, Jonathan; Wei, Jesse; Braza, Julia M.; Rofsky, Neil M.

2012-01-01

Purpose: To retrospectively assess whether magnetic resonance (MR) imaging with opposed-phase and in-phase gradient-echo (GRE) sequences and MR feature analysis can differentiate angiomyolipomas (AMLs) that contain minimal fat from clear cell renal cell carcinomas (RCCs), with particular emphasis on small (<3-cm) masses. Materials and Methods: Institutional review board approval and a waiver of informed consent were obtained for this HIPAA-compliant study. MR images from 108 pathologically proved renal masses (88 clear cell RCCs and 20 minimal fat AMLs from 64 men and 44 women) at two academic institutions were evaluated. The signal intensity (SI) of each renal mass and spleen on opposed-phase and in-phase GRE images was used to calculate an SI index and tumor-to-spleen SI ratio. Two radiologists who were blinded to the pathologic results independently assessed the subjective presence of intravoxel fat (ie, decreased SI on opposed-phase images compared with that on in-phase images), SI on T1-weighted and T2-weighted images, cystic degeneration, necrosis, hemorrhage, retroperitoneal collaterals, and renal vein thrombosis. Results were analyzed by using the Wilcoxon rank sum test, two-tailed Fisher exact test, and multivariate logistic regression analysis for all renal masses and for small masses. A P value of less than .05 was considered to indicate a statistically significant difference. Results: There were no differences between minimal fat AMLs and clear cell RCCs for the SI index (8.05% ± 14.46 vs 14.99% ± 19.9; P = .146) or tumor-to-spleen ratio (−8.96% ± 16.6 and −15.8% ± 22.4; P = .227) when all masses or small masses were analyzed. Diagnostic accuracy (area under receiver operating characteristic curve) for the SI index and tumor-to-spleen ratio was 0.59. Intratumoral necrosis and larger size were predictive of clear cell RCC (P < .001) for all lesions, whereas low SI (relative to renal parenchyma SI) on T2-weighted images, smaller size, and female sex correlated with minimal fat AML (P < .001) for all lesions. Conclusion: The diagnostic accuracy of opposed-phase and in-phase GRE MR imaging for the differentiation of minimal fat AML and clear cell RCC is poor. In this cohort, low SI on T2-weighted images relative to renal parenchyma and small size suggested minimal fat AML, whereas intratumoral necrosis and large size argued against this diagnosis. © RSNA, 2012 PMID:23012463

Epidural Cystic Spinal Meningioma

PubMed Central

Zhang, Ji; Chen, Zheng-he; Wang, Zi-feng; Sun, Peng; Jin, Jie-tian; Zhang, Xiang-heng; Zhao, Yi-ying; Wang, Jian; Mou, Yong-gao; Chen, Zhong-ping

2016-01-01

Abstract Cystic spinal meningioma (CSM) is an uncommon meningioma variant. Extradural CSMs are particularly rare and difficult to distinguish from other intraaxial tumors. This study presents a case of a 36-year-old woman with intraspinal extradual CSM at the thoracolumbar spine. She experienced persistent weakness, progressive numbness, and sensory disturbance in the right lower limb. Magnetic resonance imaging (MRI) of the patient revealed an irregular cystic mass at the thoracic 11 to lumbar 3 levels dorsally. This case was misdiagnosed as other neoplasms prior to surgery because of the atypical radiographic features and location of the tumor. Extradural CSMs should be considered in the differential diagnosis of intraspinal extradural cystic neoplasms. Complete removal of cystic wall provides an optimal outcome, rendering the lesion curable. PMID:26986119

Cystic tumors of the liver: A practical approach

PubMed Central

Poggio, Paolo Del; Buonocore, Marco

2008-01-01

Biliary cyst tumors (cystadenoma and cystadeno-carcinoma) are an indication for liver resection. They account for only 5% of all solitary cystic lesions of the liver, but differential diagnosis with multiloculated or complicated biliary cysts, atypical hemangiomas, hamartomas and lymphangiomas may be difficult. The most frequent challenge is to differentiate biliary cyst tumors from hemorrhagic cysts. Computerized tomography (CT) and magnetic resonance imaging (MRI) are often not diagnostic and in these cases fine needle aspiration (FNA) is used to confirm the presence of atypical biliary cells. FNA, however, lacks adequate sensitivity and specificity and should always be used in conjunction with imaging. Pre-operative differentiation of cystadenoma from cystadenocarcinoma is impossible and surgery must be performed if a biliary cyst tumor is suspected. When multiple cystic lesions are observed throughout the liver parenchyma, it is important to exclude liver metastasis, of which colonic cancer is the most common primary site. Multiple biliary hamartomas (von Meyenburg complex) can appear as a mixture of solid and cystic lesions and can be confused with cystic metastasis. Strong and uniform T2 hyperintensity on MRI is usually diagnostic, but occasionally a percutaneous biopsy may be required. PMID:18595127

Ghost cells in pilomatrixoma, craniopharyngioma, and calcifying cystic odontogenic tumor: histological, immunohistochemical, and ultrastructural study.

PubMed

Rumayor, Alicia; Carlos, Román; Kirsch, Hernán Molina; de Andrade, Bruno A Benevenuto; Romañach, Mario J; de Almeida, Oslei Paes

2015-04-01

Pilomatrixoma, craniopharyngioma, and calcifying cystic odontogenic tumor are the main entities presenting ghost cells as an important histological feature, in spite their quite different clinical presentation; it seems that they share a common pathway in the formation of these cells. The aim of this study is to examine and compare the characteristics of ghost and other cells that form these lesions. Forty-three cases including 21 pilomatrixomas, 14 craniopharyngiomas, and eight calcifying cystic odontogenic tumors were evaluated by immunohistochemistry for cytokeratins, CD138, β-catenin, D2-40, Glut-1, FAS, CD10 and also by scanning electron microscopy. The CKs, CD138, β-catenin, Glut-1, FAS, and CD10 were more often expressed by transitional cells of craniopharyngioma and calcifying cystic odontogenic tumor, compared with pilomatrixoma. Basaloid cells of pilomatrixoma showed strong positivity for CD138 and CD10. Differences on expression pattern were identified in transitional and basal cells, as ghost cells were negative for most antibodies used, except by low expression for cytokeratins. By scanning electron microscopy, the morphology of ghost cells were similar in their fibrillar cytoplasm, but their pattern varied from sheets in pilomatrixoma to small clusters in craniopharyngioma and calcifying cystic odontogenic tumor. Mechanisms involved in formation of ghost cells are unknown, but probably they follow different pathways as protein expression in the basal/transitional cells was not uniform in the three tumors studied. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Influenza A non-H1N1 associated with acute respiratory failure and acute renal failure in a previously vaccinated cystic fibrosis patient

PubMed Central

Penteado, Louise Piva; Osório, Cecília Susin; Balbinotto, Antônio; Dalcin, Paulo de Tarso Roth

2018-01-01

In the 2014 - 2015 season, most influenza infections were due to A (H3N2) viruses. More than two-thirds of circulating A (H3N2) viruses are antigenically and genetically different (drifted) from the A (H3N2) vaccine component of 2014 - 2015 northern and southern Hemisphere seasonal influenza vaccines. The purpose of this paper is to report a case of seasonal influenza A non-H1N1 infection that occurred in June 2015 in an adult cystic fibrosis patient with severe lung disease previously vaccinated with the anti-flu trivalent vaccine. The patient evolved to respiratory and renal failure (without rhabdomyolysis) and was placed under mechanical ventilation and hemodialysis. The clinical outcome was positive after 39 days of hospital stay. In addition, the patient was clinically stable after 18 months of follow-up. With the recent advances in critical care medicine and in cystic fibrosis treatment, survival with advanced pulmonary disease in cystic fibrosis presents new questions and potential problems, which are still being formulated. PMID:29742226

Effectiveness of navigation-guided cyst aspiration before resection of large cystic brain tumors: a proof of concept for more radical surgery.

PubMed

Roh, Tae Hoon; Sung, Kyoung Su; Kang, Seok-Gu; Moon, Ju Hyung; Kim, Eui Hyun; Kim, Sun Ho; Chang, Jong Hee

2017-10-01

Resection of tumors close to the corticospinal tract (CST) carries a high risk of damage to the CST. For cystic tumors, aspirating the cyst before resection may reduce the risk of damage to vital structures. This study evaluated the effectiveness of cyst aspiration, by comparing the results before and after aspiration of diffusion tensor image (DTI) tractography. This study enrolled 23 patients with large cystic brain tumors (>20 cm 3 ) between 2012 and 2016. All underwent magnetic resonance imaging (MRI), including DTI tractography, followed by navigation-guided aspiration of the cyst and subsequent tumor resection via craniotomy. Distances between the tumor margin and CST before and after cyst aspiration, volume reduction, and postoperative outcomes were assessed. Median tumor volume decreased from 88 cm 3 (range, 25-153) to 29 cm 3 (range, 20-80) and distances between tumor margins and the CST increased from 5.7 mm (range, 0.6-22.0) to 14.8 mm (range, 0.6-41.4) after aspiration. Neurological symptoms of patients immediately improved after cyst aspiration. All patients, except for one with a secondary glioblastoma, underwent gross total resection of the tumor. No neurological deterioration was observed after tumor resection. Navigation-guided cyst aspiration followed by resection is a useful and safe procedure for brain tumors with large cystic components. Cyst aspiration resulted in expansion of the compressed brain tissue between the tumor margins and vital structures, making maximal safe resection possible.

Mature cystic teratoma with high proportion of solid thyroid tissue: a controversial case with unusual imaging findings.

PubMed

Gil, Rui; Cunha, Teresa Margarida; Rolim, Ines

2017-07-01

We describe a case of a mature cystic teratoma of the ovary with high proportion of solid thyroid tissue (< 50% of the entire tumor) in a childbearing woman. The patient presented with non-specific abdominal bloating. Pelvic ultrasound and magnetic resonance imaging revealed a complex cystic-solid tumor confined to the left ovary with an anterior fat-containing locus compatible with mature cystic teratoma and a posterior predominantly solid component with low signal intensity on T2-weighted images that was histopatologically diagnosed as benign thyroid tissue. Thyroglobulin levels were in normal range. Although thyroid tissue is present in up to 20% of mature cystic teratomas, with exception of struma ovarii, it is not usually macroscopically nor radiologically identified. The differential diagnosis should include T2-hypointense adnexal lesions associated with mature cystic teratoma, malignant transformation of mature teratoma, and immature teratoma.

Blocking rpS6 Phosphorylation Exacerbates Tsc1 Deletion–Induced Kidney Growth

PubMed Central

Wu, Huijuan; Chen, Jianchun; Xu, Jinxian; Dong, Zheng; Meyuhas, Oded

2016-01-01

The molecular mechanisms underlying renal growth and renal growth–induced nephron damage remain poorly understood. Here, we report that in murine models, deletion of the tuberous sclerosis complex protein 1 (Tsc1) in renal proximal tubules induced strikingly enlarged kidneys, with minimal cystogenesis and occasional microscopic tumorigenesis. Signaling studies revealed hyperphosphorylation of eukaryotic translation initiation factor 4E-binding protein 1 (4E-BP1) and increased phosphorylation of ribosomal protein S6 (rpS6) in activated renal tubules. Notably, knockin of a nonphosphorylatable rpS6 in these Tsc1-mutant mice exacerbated cystogenesis and caused drastic nephron damage and renal fibrosis, leading to kidney failure and a premature death rate of 67% by 9 weeks of age. In contrast, Tsc1 single-mutant mice were all alive and had far fewer renal cysts at this age. Mechanistic studies revealed persistent activation of mammalian target of rapamycin complex 1 (mTORC1) signaling causing hyperphosphorylation and consequent accumulation of 4E-BP1, along with greater cell proliferation, in the renal tubules of Tsc1 and rpS6 double-mutant mice. Furthermore, pharmacologic treatment of Tsc1 single-mutant mice with rapamycin reduced hyperphosphorylation and accumulation of 4E-BP1 but also inhibited phosphorylation of rpS6. Rapamycin also exacerbated cystic and fibrotic lesions and impaired kidney function in these mice, consequently leading to a premature death rate of 40% within 2 weeks of treatment, despite destroying tumors and decreasing kidney size. These findings indicate that Tsc1 prevents aberrant renal growth and tumorigenesis by inhibiting mTORC1 signaling, whereas phosphorylated rpS6 suppresses cystogenesis and fibrosis in Tsc1-deleted kidneys. PMID:26296742

Adenoid cystic carcinomas of the salivary gland, lacrimal gland, and breast are morphologically and genetically similar but have distinct microRNA expression profiles.

PubMed

Andreasen, Simon; Tan, Qihua; Agander, Tina Klitmøller; Steiner, Petr; Bjørndal, Kristine; Høgdall, Estrid; Larsen, Stine Rosenkilde; Erentaite, Daiva; Olsen, Caroline Holkmann; Ulhøi, Benedicte Parm; von Holstein, Sarah Linéa; Wessel, Irene; Heegaard, Steffen; Homøe, Preben

2018-02-21

Adenoid cystic carcinoma is among the most frequent malignancies in the salivary and lacrimal glands and has a grave prognosis characterized by frequent local recurrences, distant metastases, and tumor-related mortality. Conversely, adenoid cystic carcinoma of the breast is a rare type of triple-negative (estrogen and progesterone receptor, HER2) and basal-like carcinoma, which in contrast to other triple-negative and basal-like breast carcinomas has a very favorable prognosis. Irrespective of site, adenoid cystic carcinoma is characterized by gene fusions involving MYB, MYBL1, and NFIB, and the reason for the different clinical outcomes is unknown. In order to identify the molecular mechanisms underlying the discrepancy in clinical outcome, we characterized the phenotypic profiles, pattern of gene rearrangements, and global microRNA expression profiles of 64 salivary gland, 9 lacrimal gland, and 11 breast adenoid cystic carcinomas. All breast and lacrimal gland adenoid cystic carcinomas had triple-negative and basal-like phenotypes, while salivary gland tumors were indeterminate in 13% of cases. Aberrations in MYB and/or NFIB were found in the majority of cases in all three locations, whereas MYBL1 involvement was restricted to tumors in the salivary gland. Global microRNA expression profiling separated salivary and lacrimal gland adenoid cystic carcinoma from their respective normal glands but could not distinguish normal breast adenoid cystic carcinoma from normal breast tissue. Hierarchical clustering separated adenoid cystic carcinomas of salivary gland origin from those of the breast and placed lacrimal gland carcinomas in between these. Functional annotation of the microRNAs differentially expressed between salivary gland and breast adenoid cystic carcinoma showed these as regulating genes involved in metabolism, signal transduction, and genes involved in other cancers. In conclusion, microRNA dysregulation is the first class of molecules separating adenoid cystic carcinoma according to the site of origin. This highlights a novel venue for exploring the biology of adenoid cystic carcinoma.

Regression of Crizotinib-Associated Complex Cystic Lesions after Switching to Alectinib.

PubMed

Taima, Kageaki; Tanaka, Hisashi; Tanaka, Yoshihito; Itoga, Masamichi; Takanashi, Shingo; Tasaka, Sadatomo

2017-09-01

Crizotinib, which is effective in patients with anaplastic lymphoma kinase (ALK) positive non-small cell lung cancer, is sometimes associated with the generation of complex renal cysts. A 56-year-old man with ALK positive adenocarcinoma received crizotinib. Ten months after the introduction of crizotinib, a cystic lesion developed from his right kidney to the iliopsoas muscle, accompanied by fever, anemia, and hypoproteinemia. After 17 months of treatment, crizotinib was switched to alectinib, followed by the recovery of hypoproteinemia and systemic inflammation. Switching to alectinib may be beneficial in patients demonstrating crizotinib-associated complex renal cysts with systemic inflammation and exhaustion.

Regression of Crizotinib-Associated Complex Cystic Lesions after Switching to Alectinib

PubMed Central

Taima, Kageaki; Tanaka, Hisashi; Tanaka, Yoshihito; Itoga, Masamichi; Takanashi, Shingo; Tasaka, Sadatomo

2017-01-01

Crizotinib, which is effective in patients with anaplastic lymphoma kinase (ALK) positive non-small cell lung cancer, is sometimes associated with the generation of complex renal cysts. A 56-year-old man with ALK positive adenocarcinoma received crizotinib. Ten months after the introduction of crizotinib, a cystic lesion developed from his right kidney to the iliopsoas muscle, accompanied by fever, anemia, and hypoproteinemia. After 17 months of treatment, crizotinib was switched to alectinib, followed by the recovery of hypoproteinemia and systemic inflammation. Switching to alectinib may be beneficial in patients demonstrating crizotinib-associated complex renal cysts with systemic inflammation and exhaustion. PMID:28794366

Characteristics and Treatments of Large Cystic Brain Metastasis: Radiosurgery and Stereotactic Aspiration

PubMed Central

Kim, Moinay; Cheok, Stephanie; Chung, Lawrance K.; Ung, Nolan; Thill, Kimberly; Voth, Brittany; Kwon, Do Hoon; Kim, Jeong Hoon; Kim, Chang Jin; Tenn, Stephen; Lee, Percy

2015-01-01

Brain metastasis represents one of the most common causes of intracranial tumors in adults, and the incidence of brain metastasis continues to rise due to the increasing survival of cancer patients. Yet, the development of cystic brain metastasis remains a relatively rare occurrence. In this review, we describe the characteristics of cystic brain metastasis and evaluate the combined use of stereotactic aspiration and radiosurgery in treating large cystic brain metastasis. The results of several studies show that stereotactic radiosurgery produces comparable local tumor control and survival rates as other surgery protocols. When the size of the tumor interferes with radiosurgery, stereotactic aspiration of the metastasis should be considered to reduce the target volume as well as decreasing the chance of radiation induced necrosis and providing symptomatic relief from mass effect. The combined use of stereotactic aspiration and radiosurgery has strong implications in improving patient outcomes. PMID:25977901

Role of HIF-1α and CASPASE-3 in cystogenesis of odontogenic cysts and tumors.

PubMed

da Costa, Natacha M M; de Siqueira, Adriane S; Ribeiro, André L R; da Silva Kataoka, Maria S; Jaeger, Ruy G; de Alves-Júnior, Sérgio M; Smith, Andrew M; de Jesus Viana Pinheiro, João

2018-01-01

Odontogenic cysts and tumors are the most relevant lesions that affect the gnathic bones. These lesions have in common the formation of cystic areas and this common feature may suggest involvement of similar mechanisms. The hypoxia inducible factor 1 alpha (HIF-1α), a responsive protein to hypoxia and caspase-3, an irreversible apoptosis marker, may contribute to cyst formation. Thus, this study aimed to investigate the immunoexpression of these proteins in odontogenic cysts and tumors. Twenty cases of ameloblastoma, keratocystic odontogenic tumor (KOT) (n = 20), radicular cyst (RC) (n = 18), dentigerous cyst (DC) (n = 11), calcifying cystic odontogenic tumor (n = 8), and dental follicle (DF) (n = 10) were used to investigate HIF-1α and caspase-3 expression in sequential serial cuts by immunohistochemistry. HIF-1α was overexpressed in RC, DC, and ameloblastoma when compared with DF. The basal and sometimes the lower suprabasal layer showed no or very low expression in DC, KOT, and ameloblastoma, the last also showing strong expression in solid epithelial areas and initial cystic formation regions. Caspase-3 was found to be overexpressed in all lesions, with the highest expression in odontogenic cysts compared to tumors. HIF-1α and caspase-3 were localized in similar areas of the same lesions, especially in the epithelium surrounding cystic formations. This study showed distinct immunoexpression of HIF-1α and caspase-3 in odontogenic cyst and tumors, with higher expression observed in odontogenic cysts. These findings suggest a possible correlation between hypoxia, apoptosis, and cystogenesis, leading to understand the mechanisms responsible to cystic formation in odontogenic lesions.

A giant cystic pheochromocytoma mimicking liver abscess an unusual presentation - a case report.

PubMed

Sarveswaran, Venugopal; Kumar, Surees; Kumar, Amit; Vamseedharan, Muthukumar

2015-01-01

Giant cystic pheochromocytoma is a rare neuroendocrine tumor. The possibility of cystic pheochromocytoma should be considered for any peri-adrenal mass even in absence of characteristic symptoms and negative biochemical analysis. The key in the management of a case of cystic pheochromocytoma is the preoperative suspicion and the intraoperative crisis management.

Retrograde renal hilar dissection and segmental arterial clamping: a simple modification to achieve super-selective robotic partial nephrectomy.

PubMed

Greene, Richard N; Sutherland, Douglas E; Tausch, Timothy J; Perez, Deo S

2014-03-01

Super-selective vascular control prior to robotic partial nephrectomy (also known as 'zero-ischemia') is a novel surgical technique that promises to reduce warm ischemia time. The technique has been shown to be feasible but adds substantial technical complexity and cost to the procedure. We present a simplified retrograde dissection of the renal hilum to achieve selective vascular control during robotic partial nephrectomy. Consecutive patients with stage 1 solid and complex cystic renal masses underwent robotic partial nephrectomies with selective vascular control using a modification to previously described super-selective robotic partial nephrectomy. In each case, the renal arterial branch supplying the mass and surrounding parenchyma was dissected in a retrograde fashion from the tumor. Intra-renal dissection of the interlobular artery was not performed. Intra-operative immunofluorescence was not utilized as assessment of parenchymal ischemia was documented before partial nephrectomy. Data was prospectively collected in an IRB-approved partial nephrectomy database. Operative variables between patients undergoing super-selective versus standard robotic partial nephrectomy were compared. Super-selective partial nephrectomy with retrograde hilar dissection was successfully completed in five consecutive patients. There were no complications or conversions to traditional partial nephrectomy. All were diagnosed with renal cell carcinoma and surgical margins were all negative. Estimated blood loss, warm ischemia time, operative time and length of stay were all comparable between patients undergoing super-selective and standard robotic partial nephrectomy. Retrograde hilar dissection appears to be a feasible and safe approach to super-selective partial nephrectomy without adding complex renovascular surgical techniques or cost to the procedure.

Cystic brain metastasis is associated with poor prognosis in patients with advanced breast cancer.

PubMed

Sun, Bing; Huang, Zhou; Wu, Shikai; Ding, Lijuan; Shen, Ge; Cha, Lei; Wang, Junliang; Song, Santai

2016-11-08

Brain metastasis (BM) with a cystic component from breast cancer is rare and largely uncharacterized. The purpose of this study was to identify the characteristics of cystic BM in a large cohort of breast cancer patients. A total of 35 eligible patients with cystic BM and 255 patients with solid BM were analyzed. Three factors were significantly associated with an increased probability of developing cystic lesions: age at diagnosis ≤ 40 years, age at BM ≤ 45 years, and poor histological grade (p < 0.05). Patients with cystic metastasis were also characterized by a larger metastasis volume, a shorter progression-free survival (PFS) following their first treatment for BM, and poor overall survival after BM (p < 0.05). Multivariate analysis further demonstrated that local control of cystic BM was only potentially achieved for HER2-negative primary tumors (p = 0.084). Breast cancer patients with parenchymal BM were reviewed from consecutive cases treated at our institution. Cystic BM was defined when the volume of a cystic lesion was greater than 50% of the aggregated volume of all lesions present. Clinicopathologic and radiographic variables were correlated with development of cystic lesions and with prognosis of cystic BM. This study shows that cystic BM from breast cancer, a special morphological type of BM, had worse prognosis than the more commonly observed solid BM. Younger age and low tumor grade were associated with the development of cystic lesions. Further comprehensive research and management of cystic BM are warranted to improve its poor prognosis.

The usefulness of (18)F-FDG PET/MRI fusion image in diagnosing pancreatic tumor: comparison with (18)F-FDG PET/CT.

PubMed

Nagamachi, Shigeki; Nishii, Ryuichi; Wakamatsu, Hideyuki; Mizutani, Youichi; Kiyohara, Shogo; Fujita, Seigo; Futami, Shigemi; Sakae, Tatefumi; Furukoji, Eiji; Tamura, Shozo; Arita, Hideo; Chijiiwa, Kazuo; Kawai, Keiichi

2013-07-01

This study aimed at demonstrating the feasibility of retrospectively fused (18)F FDG-PET and MRI (PET/MRI fusion image) in diagnosing pancreatic tumor, in particular differentiating malignant tumor from benign lesions. In addition, we evaluated additional findings characterizing pancreatic lesions by FDG-PET/MRI fusion image. We analyzed retrospectively 119 patients: 96 cancers and 23 benign lesions. FDG-PET/MRI fusion images (PET/T1 WI or PET/T2WI) were made by dedicated software using 1.5 Tesla (T) MRI image and FDG-PET images. These images were interpreted by two well-trained radiologists without knowledge of clinical information and compared with FDG-PET/CT images. We compared the differential diagnostic capability between PET/CT and FDG-PET/MRI fusion image. In addition, we evaluated additional findings such as tumor structure and tumor invasion. FDG-PET/MRI fusion image significantly improved accuracy compared with that of PET/CT (96.6 vs. 86.6 %). As additional finding, dilatation of main pancreatic duct was noted in 65.9 % of solid types and in 22.6 % of cystic types, on PET/MRI-T2 fusion image. Similarly, encasement of adjacent vessels was noted in 43.1 % of solid types and in 6.5 % of cystic types. Particularly in cystic types, intra-tumor structures such as mural nodule (35.4 %) or intra-cystic septum (74.2 %) were detected additionally. Besides, PET/MRI-T2 fusion image could detect extra benign cystic lesions (9.1 % in solid type and 9.7 % in cystic type) that were not noted by PET/CT. In diagnosing pancreatic lesions, FDG-PET/MRI fusion image was useful in differentiating pancreatic cancer from benign lesions. Furthermore, it was helpful in evaluating relationship between lesions and surrounding tissues as well as in detecting extra benign cysts.

A rare case report of squamous-cell carcinoma arising from mature cystic teratoma of ovary.

PubMed

Kalampokas, E; Boutas, I; Kairi-Vasilatou, E; Salakos, N; Panoulis, K; Aravantinos, L; Damaskos, C; Kalampokas, T; Deligeoroglou, E

2014-01-01

The most frequent ovarian germ cell tumors are mature cystic teratomas (MCTs), composing 10-25% of all ovarian neoplasms. MCTs have the potential of undergoing malignant transformation, typically in postmenopausal women, with a frequency of 0.17-3%, with squamous cell carcinoma being the most common malignant tumor arising from MCT. We present the rare clinical entity of a squamous cell carcinoma arising from a mature cystic teratoma in a 56-year-old premenopausal woman as well as diagnostic and therapeutic route followed.

Renal and adrenal tumors: Pathology, radiology, ultrasonography, therapy, immunology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lohr, E.; Leder, L.D.

1987-01-01

Aspects as diverse as radiology, pathology, urology, pediatrics and immunology have been brought together in one book. The most up-do-date methods of tumor diagnosis by CT, NMR, and ultrasound are covered, as are methods of catheter embolization and radiation techniques in case of primarily inoperable tumors. Contents: Pathology of Renal and Adrenal Neoplasms; Ultrasound Diagnosis of Renal and Pararenal Tumors; Computed-Body-Tomography of Renal Carcinoma and Perirenal Masses; Magnetic Resonance Imaging of Renal Mass Lesions; I-125 Embolotherapy of Renal Tumors; Adrenal Mass Lesions in Infants and Children; Computed Tomography of the Adrenal Glands; Scintigraphic Studies of Renal and Adrenal Function; Surgicalmore » Management of Renal Cell Carcinoma; Operative Therapy of Nephroblastoma; Nonoperative Treatment of Renal Cell Carcinoma; Prenatal Wilms' Tumor; Congenital Neuroblastoma; Nonsurgical Management of Wilms' Tumor; Immunologic Aspects of Malignant Renal Disease.« less

Rapid increase in cystic volume of an anaplastic astrocytoma misdiagnosed as neurocysticercosis: A case report

PubMed Central

Li, Hong-Jiang; Han, Hong-Xiu; Feng, Dong-Fu

2016-01-01

Reports describing a rapid increase in the cystic volume of anaplastic astrocytoma (AA) in a short time frame are rare. The present study reports the case of a 68-year-old male who was admitted to the No. 9 People's Hospital, Shanghai Jiaotong University School of Medicine (Shanghai, China), with a small cystic brain lesion and positive immunological testing for cysticercosis. Head magnetic resonance imaging (MRI) showed a cystic lesion, 6 mm in diameter, in the left frontal lobe. Neurocysticercosis was suspected and the patient was treated with a clinical trial of albendazole and steroids. A period of 25 days later, the patient's condition had deteriorated, and MRI revealed a cystic lesion in the left frontal lobe; thereafter, the cystic lesion was removed and a diagnosis of AA was established. The tumor was soft, ivory white and gelatinous due to myxoid degeneration. In this case, tumor-related angiogenesis and microvascular extravasation (blood-brain barrier disruption) may have been the main cause of the rapid increase in the cystic volume in such a short time frame. The similarity of the glioma and cysticercus antigens may have been the cause of the positive reactions in the cystic fluid. The present study reports the rare occurrence of a rapid increase of cystic volume and potential diagnostic difficulties. PMID:27698865

The Role of Apparent Diffusion Coefficient Quantification in Differentiating Benign and Malignant Renal Masses by 3 Tesla Magnetic Resonance Imaging.

PubMed

Göya, Cemil; Hamidi, Cihad; Bozkurt, Yaşar; Yavuz, Alpaslan; Kuday, Suzan; Gümüş, Hatice; Türkçü, Gül; Hattapoğlu, Salih; Bilici, Aslan

2015-07-01

Diffusion-weighted magnetic resonance imaging (DWI) is a widely-accepted diagnostic modality whose efficacy has been investigated by numerous past studies in the differentiation of malignant lesions from benign entities. The aim of this study was to evaluate the efficiency of diffusion-weighted magnetic resonance imaging in the characterization of renal lesions. Diagnostic accuracy study. A total of 137 patients with renal lesions were included in this study. The median apparent diffusion coefficient (ADC) values as well as the b 800 and b 1600 signal intensities of normal kidneys, solid components of mixed renal masses, and total cystic lesions were evaluated. There were significant differences between the ADC values of lesions and normal renal parenchyma, and between the ADC values of benign and malignant renal lesions on DWIs at b values of 800 and 1600 s/mm(2) (p<0.001 and p<0.001, respectively). There were significant differences between the ADC values of Bosniak Category 1 and 2 cysts and the ADC values of Bosniak Category 1 and 3 cysts on DWIs at b values of 800 s/mm(2) (p<0.001) and 1600 s/mm(2) (p<0.001). A cutoff value of 1.902 × 10(-3) mm(2)/s for the ADC with a b value of 800 s/mm(2) provided 88% sensitivity and 96% specificity for differentiation between benign and malignant renal lesions. A cutoff value of 1.623 × 10(-3) mm(2)/s for the ADC with a b value of 1600 s/mm(2) provided 79% sensitivity and 96% specificity (p<0.001) for the differentiation between benign and malignant renal lesions. Accurate assessment of renal masses is important for determining the necessity for surgical intervention. DWI provides additional value by differentiating benign from malignant renal tumors and can be added to routine kidney MRI protocols.

Long-term success of combined kidney-lung transplantation in a patient with cystic fibrosis.

PubMed

Borro, José M; Rama, Pablo; Rey, Teresa; Fernández-Rivera, Constantino

2013-06-01

Advanced kidney disease is usually considered an absolute contraindication for lung transplantation due to the difficult management of these patients in the post-operative period. Combined lung-kidney transplantation, however, could offer an opportunity for selected patients with renal and pulmonary dysfunction. This study summarizes the long-term success of a double transplantation in a 38-year-old male patient with cystic fibrosis who presented respiratory and kidney failure. After a complicated post-operative period, the patient currently lives completely independently 46 months after the operation and he enjoys excellent pulmonary and renal function. Copyright © 2012 SEPAR. Published by Elsevier España, S.L. All rights reserved.

Adenoid Cystic Carcinoma of the Trachea Resulting in Fatal Asphyxia.

PubMed

Huston, Butch; Froloff, Victor; Mills, Kelly; McGee, Michael

2017-01-01

Primary malignant tumors of the trachea are uncommon. The authors report a case of a 72-year-old female who died from asphyxia due to an undiagnosed obstructing adenoid cystic carcinoma of the trachea. The decedent became unresponsive while eating cereal and was pronounced upon arrival at the local hospital. The autopsy revealed a near occlusive tumor mass just superior to the bifurcation of the distal trachea. There was no evidence of aspiration. The death was the result of asphyxia due to obstruction of the trachea by an adenoid cystic carcinoma. This case demonstrates that an obstructive tumor mass may remain undiagnosed until an obstructive episode results in a sudden death. © 2016 American Academy of Forensic Sciences.

MYB expression and translocation in adenoid cystic carcinomas and other salivary gland tumors with clinicopathologic correlation

PubMed Central

Kong, Christina; Clarke, Nicole; Gilks, Thea; Lipsick, Joe; Cao, Hongbin; Kwok, Shirley; Montgomery, Kelli D.; Varma, Sushama; Le, Quynh-Thu

2011-01-01

Background Adenoid cystic carcinoma is a locally aggressive salivary gland neoplasm which has a poor long term prognosis. A chromosomal translocation involving the genes encoding the transcription factors MYB and NFIB has been recently discovered in these tumors. Methods MYB translocation and protein expression was studied in 37 adenoid cystic carcinomas, 112 other salivary gland neoplasms, and 409 non salivary gland neoplasms by FISH and immunohistochemistry. MYB translocation and expression status in adenoid cystic carcinoma was correlated with clinicopathologic features including outcome, with a median follow up of 77.1 months (range: 23.2–217.5) for living patients. Results A balanced translocation between MYB and NFIB is present in 49% of adenoid cystic carcinomas but is not identified in other salivary gland tumors or non-salivary gland neoplasms. There is no apparent translocation of MYB in 35% of the cases. Strong Myb immunostaining is very specific for adenoid cystic carcinomas but is only present in 65% of all cases. Interestingly, Myb immunostaining is confined to the basal cell component though the translocation is present in all the cells. Neoplasms with MYB translocation demonstrate a trend towards higher local relapse rates, but the results are not statistically significant with current case numbers. Conclusions MYB translocation and expression are useful diagnostic markers for a subset of adenoid cystic carcinomas. The presence of the translocation may be indicative of local aggressive behavior but a larger cohort may be required to demonstrate statistical significance. PMID:21164292

Low-Grade Astrocytoma within a Mature Cystic Teratoma in an Adolescent Patient.

PubMed

Yoder, Nicole; Marks, Asher; Hui, Pei; Litkouhi, Babak; Cron, Julia

2018-06-01

Mature cystic teratomas are the most common ovarian neoplasm in adolescents. They are typically benign, however, malignant transformation rarely occurs. We report a low-grade astrocytoma arising from a mature cystic teratoma in an adolescent patient. The patient was a 12-year-old girl with an asymptomatic ovarian cyst and subsequent cystectomy. Final pathology identified a solid tumor with glial tissue within the cyst, reported as low-grade astrocytoma arising in a mature cystic teratoma. There are few data on astrocytomas in the gynecologic tract. Risk factors for malignant transformation in a mature cystic teratoma include increased age, postmenopausal status, elevated carcinoma antigen 125, and large tumor size. Interestingly, this patient had a history of partial trisomy 20, which has been associated with teratoma formation in a mouse model. Copyright © 2017 North American Society for Pediatric and Adolescent Gynecology. Published by Elsevier Inc. All rights reserved.

Study of Kidney Tumors in Younger Patients

ClinicalTrials.gov

2017-11-27

Clear Cell Sarcoma of the Kidney; Congenital Mesoblastic Nephroma; Diffuse Hyperplastic Perilobar Nephroblastomatosis; Rhabdoid Tumor of the Kidney; Stage I Renal Cell Cancer; Stage I Wilms Tumor; Stage II Renal Cell Cancer; Stage II Wilms Tumor; Stage III Renal Cell Cancer; Stage III Wilms Tumor; Stage IV Renal Cell Cancer; Stage IV Wilms Tumor; Stage V Wilms Tumor

Multi-institutional analysis of CT and MRI reports evaluating indeterminate renal masses: comparison to a national survey investigating desired report elements.

PubMed

Hu, Eric M; Zhang, Andrew; Silverman, Stuart G; Pedrosa, Ivan; Wang, Zhen J; Smith, Andrew D; Chandarana, Hersh; Doshi, Ankur; Shinagare, Atul B; Remer, Erick M; Kaffenberger, Samuel D; Miller, David C; Davenport, Matthew S

2018-04-17

To determine the need for a standardized renal mass reporting template by analyzing reports of indeterminate renal masses and comparing their contents to stated preferences of radiologists and urologists. The host IRB waived regulatory oversight for this multi-institutional HIPAA-compliant quality improvement effort. CT and MRI reports created to characterize an indeterminate renal mass were analyzed from 6 community (median: 17 reports/site) and 6 academic (median: 23 reports/site) United States practices. Report contents were compared to a published national survey of stated preferences by academic radiologists and urologists from 9 institutions. Descriptive statistics and Chi-square tests were calculated. Of 319 reports, 85% (271; 192 CT, 79 MRI) reported a possibly malignant mass (236 solid, 35 cystic). Some essential elements were commonly described: size (99% [269/271]), mass type (solid vs. cystic; 99% [268/271]), enhancement (presence vs. absence; 92% [248/271]). Other essential elements had incomplete penetrance: the presence or absence of fat in solid masses (14% [34/236]), size comparisons when available (79% [111/140]), Bosniak classification for cystic masses (54% [19/35]). Preferred but non-essential elements generally were described in less than half of reports. Nephrometry scores usually were not included for local therapy candidates (12% [30/257]). Academic practices were significantly more likely than community practices to include mass characterization details, probability of malignancy, and staging. Community practices were significantly more likely to include management recommendations. Renal mass reporting elements considered essential or preferred often are omitted in radiology reports. Variation exists across radiologists and practice settings. A standardized template may mitigate these inconsistencies.

Treatment of cystic craniopharyngioma with phosphorus-32 intracavitary irradiation

PubMed Central

Zhao, Rong; Deng, Jinglan; Liang, Xiaoyan; Zeng, Jin; Chen, Xiaoyuan

2013-01-01

Purpose The aim of the study was to evaluate the effect of phosphorus-32 colloid ([32P]) intracavitary irradiation on the treatment of patients with cystic craniopharyngiomas. Methods Twenty patients with predominantly cystic craniopharyngiomas were admitted from 1981 to 2006. Eleven patients had [32P] intracavitary irradiation by stereotactic injection or Ommaya cyst instillation as the primary treatment, and the remaining nine had the same internal irradiation as an adjuvant treatment after tumor resection. A calculated irradiation dose of 400~500 Gy per once was delivered to the cyst wall. Conclusion The patients were followed up ranging from 36 to 336 months; no operative morbidity or mortality was found from [32P] intracavitary irradiation. Fourteen patients (70%) had tumor progression and required further two to four times intracavitary irradiation. All 20 cases achieved tumor shrinkage or stabilization with effective outcome 3–6 months after the last [32P] therapy. For patients with cystic craniopharyngioma, [32P] administration by stereo-tactic injection or Ommaya cyst instillation is a safe and helpful option, which could improve the life quality, prolong the life span, and enhance the survival rate of cystic craniopharyngioma patients. PMID:19904543

Novel NEK8 Mutations Cause Severe Syndromic Renal Cystic Dysplasia through YAP Dysregulation

PubMed Central

Grampa, Valentina; Odye, Gweltas; Thomas, Sophie; Elkhartoufi, Nadia; Filhol, Emilie; Niel, Olivier; Silbermann, Flora; Lebreton, Corinne; Collardeau-Frachon, Sophie; Rouvet, Isabelle; Alessandri, Jean-Luc; Devisme, Louise; Dieux-Coeslier, Anne; Cordier, Marie-Pierre; Capri, Yline; Khung-Savatovsky, Suonavy; Sigaudy, Sabine; Salomon, Rémi; Antignac, Corinne; Gubler, Marie-Claire; Benmerah, Alexandre; Terzi, Fabiola; Attié-Bitach, Tania; Jeanpierre, Cécile; Saunier, Sophie

2016-01-01

Ciliopathies are a group of genetic multi-systemic disorders related to dysfunction of the primary cilium, a sensory organelle present at the cell surface that regulates key signaling pathways during development and tissue homeostasis. In order to identify novel genes whose mutations would cause severe developmental ciliopathies, >500 patients/fetuses were analyzed by a targeted high throughput sequencing approach allowing exome sequencing of >1200 ciliary genes. NEK8/NPHP9 mutations were identified in five cases with severe overlapping phenotypes including renal cystic dysplasia/hypodysplasia, situs inversus, cardiopathy with hypertrophic septum and bile duct paucity. These cases highlight a genotype-phenotype correlation, with missense and nonsense mutations associated with hypodysplasia and enlarged cystic organs, respectively. Functional analyses of NEK8 mutations in patient fibroblasts and mIMCD3 cells showed that these mutations differentially affect ciliogenesis, proliferation/apoptosis/DNA damage response, as well as epithelial morphogenesis. Notably, missense mutations exacerbated some of the defects due to NEK8 loss of function, highlighting their likely gain-of-function effect. We also showed that NEK8 missense and loss-of-function mutations differentially affect the regulation of the main Hippo signaling effector, YAP, as well as the expression of its target genes in patient fibroblasts and renal cells. YAP imbalance was also observed in enlarged spheroids of Nek8-invalidated renal epithelial cells grown in 3D culture, as well as in cystic kidneys of Jck mice. Moreover, co-injection of nek8 MO with WT or mutated NEK8-GFP RNA in zebrafish embryos led to shortened dorsally curved body axis, similar to embryos injected with human YAP RNA. Finally, treatment with Verteporfin, an inhibitor of YAP transcriptional activity, partially rescued the 3D spheroid defects of Nek8-invalidated cells and the abnormalities of NEK8-overexpressing zebrafish embryos. Altogether, our study demonstrates that NEK8 human mutations cause major organ developmental defects due to altered ciliogenesis and cell differentiation/proliferation through deregulation of the Hippo pathway. PMID:26967905

Collision Tumor between Trichofolliculoma and Melanocytic Nevus.

PubMed

Bolte, Christel; Cullen, Roberto; Sazunic, Ivo

2017-01-01

Trichofolliculoma (TF) is a hamartomatous hair follicle-related tumor, clinically described as a dome-shaped papule with a central pore crossed by one or more silky white hairs. Histologically, it described as a cystic cavity containing keratinous debris, hair shaft fragments, and numerous hair follicles arising from its linings. Collision or compound tumors are a coexistence of two or more identifiable tumors in the same lesion. We present a case of a 47-year-old man with a lesion on his left cheek clinically characterized as a TF. However, the histopathological study reveals a collision tumor involving a TF and a melanocytic nevus. Collision tumors involving melanocytic nevi and hair follicle-related tumors have been previously reported, such as desmoplastic trichoepithelioma, epidermoid cyst, folliculosebaceous cystic hamartoma, and trichoadenoma.

Adenoid cystic carcinoma of child: a rare case.

PubMed

Mathai, Meera; Sherubin, J Eugenia; Agnihotri, Pg; Sangeetha, Gs

2014-01-01

Adenoid cystic carcinoma (ACC) is the second most common malignant tumor affecting both major and minor salivary glands. Clinically, it is a slowly growing tumor with high propensity for local invasion, recurrence and distant metastasis. It is predominantly seen in the ffith and sixth decades of life. Here, we report a rare case of ACC affecting the right maxilla of a 12-year-old girl. How to cite this article: Mathai M, Sherubin JE, Agnihotri PG, Sangeetha GS. Adenoid Cystic Carcinoma of Child: A Rare Case. Int J Clin Pediatr Dent 2014;7(3):206-208.

Von Hippel–Lindau and myotonic dystrophy of Steinert along with pancreatic neuroendocrine tumor and renal clear cell carcinomal neoplasm: Case report and review of the literature

PubMed Central

Addeo, A.; Bini, R.; Viora, T.; Bonaccorsi, L.; Leli, R.

2013-01-01

INTRODUCTION Myotonic dystrophy of Steinert, DM1, is the most common adult muscular dystrophy and generally is not associated to development on multiple site neoplasm. Von Hippel-Lindau (VHL) disease is a dominantly inherited familial cancer syndrome that is associated to tumors such as hemangioblastoma of the retina or central nervous system, clear-cell renal carcinoma (RCC) and endocrine tumors, most commonly pheochromocytoma and non-secretory pancreatic islet cell cancers. No data exist in literature describing the coexistence of both DM1 and VHL. PRESENTATION OF CASE Herein we report a case of renal and pancreatic neoplasm in a young adult female affected by DM1 and VHL simultaneously. DISCUSSION DM1 is due to an unstable trinucleotide (CTG) expansion in the 30 antranslated region of the dystrophia myotonica-protein kinase (DMPK) gene, located on chromosome 19q13.3. Several molecular mechanisms thought to be determining the classical DM phenotype have been shown. VHL disease is characterized by marked phenotypic variability and the most common tumors are hemangioblastomas of the retina or central nervous system, clear-cell renal carcinoma (RCC) and endocrine tumors, most commonly pheochromocytoma and non-secretory pancreatic islet cell cancers. The pancreatic manifestations seen in patients with VHL disease are divided into 2 categories: pancreatic neuroendocrine tumor (PNET) as solid tumors, and cystic lesions, including a simple cyst and serous cystadenoma. The surgical approach for these cistic lesions is to consider as golden standard. Blansfield has proposed 3 criteria to predict metastatic disease of PNET in patients with VHL disease: (1) tumor size greater than or equal to 3 cm; (2) presence of a mutation in exon 3; and (3) tumor doubling time less than 500 d. If the patient has none of these criteria the patient could be followed with physical examination and radiological surveillance on a 2/3 years base.4 If the patient has 1 criterion, the patient should be followed more closely every 6 months to 1 year. If the patient has 2 or 3 criteria, the patient should be considered for surgery given the high risk of future malignancy. Our patient owned only one criterion but in presence of a second malignant tumor. Our hypothesis for this rare findings is that both DM and VHL might be derived from genetic aberration and these might be linked to a major cancer susceptibility. As far as we know this is the first confirmed case of RCC and neuroendocrine pancreatic cancer occurring concurrently with VHL and, at the same time, DM1. According to this case report and the literature data a VHL should be ruled out in the presence of RCC presenting along with pancreatic cysts/tumor. CONCLUSION As far as we know this is the first confirmed case of RCC and neuroendocrine pancreatic cancer occurring concurrently with VHL and, at the same time, DM1. Our hypothesis for the unusual findings is that both DM and VHL derived from genetic aberration and these are linked to a major cancer susceptibility. PMID:23774333

Hyponatremia-associated rhabdomyolysis following exercise in an adolescent with cystic fibrosis.

PubMed

Kaskavage, Jillian; Sklansky, Daniel

2012-07-01

Adolescents with well-controlled cystic fibrosis, including good lung function and appropriate growth, commonly participate in competitive athletic activities. We present the case of an adolescent male with cystic fibrosis, hyponatremia, dehydration, and rhabdomyolysis after participating in football practice on a summer morning. The patient presented with severe myalgia and serum sodium of 129 mmol/L, chloride 90 mmol/L, and creatine phosphokinase 1146 U/L. Aggressive hydration with intravenous 0.9% saline resulted in clinical improvement with no renal or muscular sequelae. Health care providers need to educate patients with cystic fibrosis about maintaining adequate hydration and sodium repletion during exercise. Research is needed regarding the appropriate amount and composition of oral rehydration fluids in exercising individuals with cystic fibrosis, as the physiology encountered in these patients provides a unique challenge to maintaining electrolyte balance and stimulation of thirst.

Breast cancer metastatic to the kidney with renal vein involvement.

PubMed

Nasu, Hatsuko; Miura, Katsutoshi; Baba, Megumi; Nagata, Masao; Yoshida, Masayuki; Ogura, Hiroyuki; Takehara, Yasuo; Sakahara, Harumi

2015-02-01

The common sites of breast cancer metastases include bones, lung, brain, and liver. Renal metastasis from the breast is rare. We report a case of breast cancer metastatic to the kidney with extension into the renal vein. A 40-year-old woman had undergone left mastectomy for breast cancer at the age of 38. A gastric tumor, which was later proved to be metastasis from breast cancer, was detected by endoscopy. Computed tomography performed for further examination of the gastric tumor revealed a large left renal tumor with extension into the left renal vein. It mimicked a primary renal tumor. Percutaneous biopsy of the renal tumor confirmed metastasis from breast cancer. Surgical intervention of the stomach and the kidney was avoided, and she was treated with systemic chemotherapy. Breast cancer metastatic to the kidney may present a solitary renal mass with extension into the renal vein, which mimics a primary renal tumor.

Safety of Chemotherapeutic Infusion or Chemoembolization for Hepatocellular Carcinoma Supplied Exclusively by the Cystic Artery

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang, Beomsik, E-mail: kangbs98@gmail.com; Kim, Hyo-Cheol, E-mail: angiointervention@gmail.com; Chung, Jin Wook, E-mail: chungjw@snu.ac.kr

Purpose: This study was designed to evaluate the safety of chemotherapeutic infusion or chemoembolization by way of the cystic artery in patients with hepatocellular carcinoma (HCC) supplied exclusively by the cystic artery. Methods: Between Jan 2002 and Dec 2011, we performed chemotherapeutic infusion or chemoembolization using iodized oil for the treatment of 27 patients with HCC supplied exclusively by the cystic artery. Computed tomography (CT) scans, digital subtraction angiograms, and medical records were retrospectively reviewed by consensus. Results: The cystic artery originated from the main right hepatic artery in 24 (89 %) patients, from the right anterior hepatic artery inmore » 2 (7 %) patients, and from the left hepatic artery in 1 (4 %) patient. Selective catheterization of the cystic artery was achieved in all patients. Superselection of tumor-feeding vessels from the cystic artery was achieved in 7 patients (26 %). Chemotherapeutic infusion was performed in 18 patients (67 %), and chemoembolization was performed in 9 patients (33 %). There were no major complications and only 2 minor complications, including vasovagal syncope and nausea with vomiting. Individual tumor response supplied exclusively by the cystic artery at the follow-up enhanced CT scan were complete response (n = 16), partial response (n = 3), and stable disease (n = 8). Conclusion: HCC supplied exclusively by the cystic artery can be safely treated without severe complications by chemotherapeutic infusion or chemoembolization using iodized oil through the cystic artery.« less

Atelectasis

MedlinePlus

... a possible complication of other respiratory problems, including cystic fibrosis, inhaled foreign objects, lung tumors, fluid in the ... plugs also are common in children, people with cystic fibrosis and during severe asthma attacks. Foreign body. Atelectasis ...

Cavernous sinus involvement is not a risk factor for the primary tumor site treatment outcome of Sinonasal adenoid cystic carcinoma.

PubMed

Lee, Yi-Chan; Lee, Ta-Jen; Tsang, Ngan-Ming; Huang, Yenlin; Hsu, Cheng-Lung; Hsin, Li-Jen; Lee, Yi-Hsuan; Chang, Kai-Ping

2018-02-05

Sinonasal adenoid cystic carcinoma is a rare malignancy of the head and neck. Cavernous sinus invasion from sinonasal adenoid cystic carcinoma and its related management have rarely been investigated. This study evaluated the relationship between treatment outcome and cavernous sinus involvement in addition to other parameters. A retrospective case series study was conducted at a tertiary referral center. The medical records of 47 patients diagnosed with primary sinonasal adenoid cystic carcinoma between 1984 and 2015 were retrospectively reviewed. The survival impact of the primary treatment modalities and the anatomic sites of tumor involvement were analyzed. Cavernous sinus invasion was observed in 8 patients (17%), of whom 7 had ACC tumors originating from the maxillary sinus. The results of univariate analysis revealed that tumor stage, primary surgery, and the absence of skull-base and infratemporal fossa invasion were associated with better overall survival (P = 0.033, P = 0.012, P = 0.011, and P = 0.040, respectively) and better disease-free survival (P = 0.019, P = 0.001, P = 0.017, and P = 0.029, respectively). Multivariate analysis identified primary surgery as the only independent prognostic factor for disease-free survival (P = 0.026). Cavernous sinus invasion by sinonasal adenoid cystic carcinoma was not associated with worse overall survival or disease-free survival (P = 0.200 and P = 0.198, respectively). Because maxillary adenoid cystic carcinoma is associated with a higher rate of cavernous sinus invasion, such cases warrant caution during preoperative planning. Primary surgery as the initial therapy provides better locoregional control and survival for patients with sinonasal adenoid cystic carcinoma. Cavernous sinus invasion did not significantly impact survival; thus, it should not be regarded as a contraindication for curative treatment.

Quantitative magnetic resonance imaging assessments of autosomal recessive polycystic kidney disease progression and response to therapy in an animal model.

PubMed

Erokwu, Bernadette O; Anderson, Christian E; Flask, Chris A; Dell, Katherine M

2018-05-01

BackgroundAutosomal recessive polycystic kidney disease (ARPKD) is associated with significant mortality and morbidity, and currently, there are no disease-specific treatments available for ARPKD patients. One major limitation in establishing new therapies for ARPKD is a lack of sensitive measures of kidney disease progression. Magnetic resonance imaging (MRI) can provide multiple quantitative assessments of the disease.MethodsWe applied quantitative image analysis of high-resolution (noncontrast) T2-weighted MRI techniques to study cystic kidney disease progression and response to therapy in the PCK rat model of ARPKD.ResultsSerial imaging over a 2-month period demonstrated that renal cystic burden (RCB, %)=[total cyst volume (TCV)/total kidney volume (TKV) × 100], TCV, and, to a lesser extent, TKV detected cystic kidney disease progression, as well as the therapeutic effect of octreotide, a clinically available medication shown previously to slow both kidney and liver disease progression in this model. All three MRI measures correlated significantly with histologic measures of renal cystic area, although the correlation of RCB and TCV was stronger than that of TKV.ConclusionThese preclinical MRI results provide a basis for applying these quantitative MRI techniques in clinical studies, to stage and measure progression in human ARPKD kidney disease.

Human papillomavirus-related carcinoma with adenoid cystic-like features of the inferior turbinate: a case report.

PubMed

Hwang, Sun Jin; Ok, Sohea; Lee, Heung-Man; Lee, Eunjung; Park, Il-Ho

2015-02-01

Sinonasal malignancies are uncommon, but are of many different histologic types. Recently, Human papillomavirus (HPV)-related carcinoma with adenoid cystic features was reported as a new histologic form. Although this histologic type resembles an adenoid cystic carcinoma, it differs from adenoid cystic carcinomas with regard to its association with HPV. Here, we present a case of HPV-related carcinoma with adenoid cystic features in the nasal cavity. We also review the histological characters of the tumor. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Endoscopic Transsphenoidal Salvage Surgery for Symptomatic Residual Cystic Craniopharyngioma after Radiotherapy.

PubMed

Emanuelli, Enzo; Frasson, Giuliana; Cazzador, Diego; Borsetto, Daniele; Denaro, Luca

2018-04-01

Objectives  Ideal treatment of craniopharyngiomas is still controversial. Radiotherapy (RT) is considered effective for recurrences or after subtotal tumor removal (STR). About 40 to 50% of patients may experience tumor cyst expansion soon after RT; in these cases, the role of salvage surgery is debated. Design  Operative video. Setting  Tertiary care center. Participants  An 11-year-old boy diagnosed with persistent craniopharyngioma. In 2015, the patient underwent right frontotemporal craniotomy for STR at another center, complicated by panhypopituitarism. Two years later, fractionated 54-Gy RT was performed on growing residual tumor. After 3 months, he was admitted to our hospital due to persistent malaise, vomiting, pulsating headache, and epistaxis. Ophthalmologic evaluation evidenced left homonymous hemianopsia. Results  A contrast-enhanced magnetic resonance imaging (MRI) showed a 27-mm cystic component enlarging from the cranial end of the persistent craniopharyngioma lesion, extending into the third ventricle. Biventricular hydrocephalus and brain midline shift to the right were present. Compared with the early post-RT MRI, the cystic component of the tumor demonstrated growth. The patient underwent external ventricular drainage placement for emergent treatment of hydrocephalus and endoscopic transsphenoidal surgery. After cystic content drainage, the lesion was completely removed with its capsule. A "gasket seal" technique was performed for skull base reconstruction, with autologous fascia lata, septal bone, and mucoperiosteum from inferior turbinate. Histologic examination confirmed the craniopharyngioma diagnosis. Postoperative MRI showed resolution of the hydrocephalus and complete tumor removal. Conclusion  Although shrinkage of cystic components of craniopharyngioma residuals may occur within 5 to 6 months after RT, salvage surgery is indicated in symptomatic patients. The link to the video can be found at https://youtu.be/4x6Qe76bf60 .

Exfoliative cytologic findings of primary pulmonary adenoid cystic carcinom: a report of 2 cases with a review of the cytologic features.

PubMed

Daneshbod, Yahya; Modjtahedi, Ebrahim; Atefi, Sohrab; Bedayat, Gholam Reza; Daneshbod, Khosrow

2007-01-01

Adenoid cystic carcinoma is a very rare primary pulmonary neoplasm. Cytologic findings of pulmonary washing and brushing in 2 cases of primary bronchial adenoid cystic carcinoma with special histologic features are described, with an emphasis on some points that have not been reported previously, together with the diagnostic pitfalls. Two cases of primary adenoid cystic carcinoma of the lung were diagnosed on exfoliative cytology. The patients' ages were 55 and 65 years old. Cytologic findings included large and small clusters of small cells in both 2 and 3 dimensions with occasional cystlike spaces containing mucoid material. The cells were arranged in spherical, cylindrical, basaloid and rosettelike arrangements. There were also abundant small and large mucoid globules, cylinders of homogeneous, acellular, mucous material and "cannon balls." Cytoplasmic and intranuclear round inclusions were noted in case 1. Rare findings of nuclear molding were noted. In case 2, chondromyxoid material and a bimorphic population of tumor cells caused diagnostic confusion with other salivary gland-type tumors of the lung. These cases showed characteristic cytologic findings of adenoid cystic carcinoma together with rare findings of intracellular and extracellular inclusionlike bodies, myxochondroid material, bimorphic populations and nuclear molding, which can cause diagnostic confusion with other lung tumors.

Primary pulmonary adenoid cystic carcinoma: clinicopathological analyses of 12 cases.

PubMed

Qing, Song; Zhou, Keming; Liu, Xia; Li, Xiaohong; Deng, Feiyan; Ma, Yuqing

2015-01-01

Adenoid cystic primary pulmonary carcinomas (adenoid cystic carcinomas or ACCs) are rare tumors, so we described the clinical and pathological features of these tumors and related these findings with diagnosis and prognosis of ACC, comparing our data to the existing literature. Clinical and pathological features of 12 ACC cases were observed and described. Immunohistochemical EnVision staining, fluorescent PCR detection, and FISH were used to characterize tumor samples and the literature was reviewed. Of the 12 ACC cases (7 male; average 53.1 years-of-age; range 33-78 years), the chief presentation symptom was cough, followed by expectoration, gasping, and bloody sputum. Microscopically, histopathology revealed cribriform, tubular, or solid cords. CD117 was overexpressed in glandular epithelia in 9 cases and calcitonin and thyroid transcription factor-1 (TTF-1) were overexpressed in 4 cases. One case was positive for EML4 ALK gene rearrangement. ACC is a low-grade malignant tumor with poor prognosis and high recurrence and metastases. TTF-1 expression indicates a primary tumor and CD117 expression is not significant to prognosis.

[Retroperitoneal bronchogenic cyst treated by laparoscopic surgery].

PubMed

Rud, O; May, M; Brookman-Amissah, S; Moersler, J; Greiner, A; Gilfrich, C

2010-03-01

The diagnosis of primary retroperitoneal cystic tumors is very infrequent in surgical pathology. We report the case of a 51-year-old woman presenting with an incidental left-sided retroperitoneal mass (32 x 24 mm in diameter) suspected of being an adrenal tumor. Intraoperatively the tumor was identified as a cystic lesion filled with mucous secretion and laparoscopically completely resected. The diagnosis was histopathologically confirmed as a bronchogenic cyst. In this article the laparoscopic removal of such a rare benign congenital aberration resulting from an abnormal budding of the tracheobronchial tree is presented.

Retrorectal Tumors

PubMed Central

Neale, Jeffrey A.

2011-01-01

Tumors that arise in the retrorectal (presacral) space are uncommon lesions that present with nonspecific signs and symptoms, which lead to difficult diagnoses. For complete evaluation of the lesion, cross-sectional imaging is required to determine the extent of resection and the appropriate surgical approach. Surgical removal leads to favorable outcomes for patients with benign purely cystic retrorectal tumors. Preoperative tissue diagnosis with transperineal and transsacral biopsies of solid or heterogeneous cystic lesions, are essential to determine the necessity of neoadjuvant therapy, which may decrease local recurrence after surgery and avoid an unnecessary delay in systemic therapy. PMID:22942797

Calyceal diverticula in children: imaging findings and presentations.

PubMed

Ochoa Santiago, Y; Sangüesa Nebot, C; Aliaga, S Picó; Serrano Durbá, A; López, P Ortega

2018-04-26

A calyceal diverticulum consists of a cystic eventration in the renal parenchyma that is lined with transitional cell epithelium with a narrow infundibular connection with the calyces or pelvis of the renal collector system; thus, the term pyelocalyceal diverticulum would be more accurate. Very rare in pediatric patients, calyceal diverticula can be symptomatic and require treatment. Calyceal diverticula are underdiagnosed because they can be mistaken for simple renal cysts on ultrasonography. To determine the approach to their follow-up and management, the diagnosis must be confirmed by excretory-phase computed tomography (CT) or magnetic resonance imaging (MRI). This article aims to show the different ways that calyceal diverticula can present in pediatric patients; it emphasizes the ultrasonographic findings that enable the lesion to be suspected and the definitive findings that confirm the diagnosis on CT and MRI. It also discusses the differential diagnosis with other cystic kidney lesions and their treatment. Copyright © 2018 SERAM. Publicado por Elsevier España, S.L.U. All rights reserved.

Unique presentation of giant metastatic microcystic serous adenocarcinoma of the pancreas.

PubMed

Philips, Cyriac Abby; Kalal, Chetan Ramesh; Bihari, Chhagan; Sahney, Amrish; Kumar, Kn Chandan; Rastogi, Archana

2014-01-01

Tumors of the pancreas that contain substantial cystic components include mainly mucinous cystic neoplasm, intraductal papillary mucinous neoplasm, solid pseudopapillary tumor, and cystadenomas (which encompass microcystic, macrocystic/oligocystic, and rare solid serous adenomas). Microcystic adenoma of the pancreas is a tumor that is benign in nature. Malignant transformation in the tumor with metastases is rare and only about 26 cases have been reported so far. Here we present a giant microcystic adenoma of the pancreas, possibly the largest ever malignant type in this group ever reported in the literature with extensive metastases to the liver and causing extensive compression and encasement on surrounding structures.

Unique Presentation of Giant Metastatic Microcystic Serous Adenocarcinoma of the Pancreas

PubMed Central

Kalal, Chetan Ramesh; Bihari, Chhagan; Sahney, Amrish; Kumar, KN Chandan; Rastogi, Archana

2014-01-01

Tumors of the pancreas that contain substantial cystic components include mainly mucinous cystic neoplasm, intraductal papillary mucinous neoplasm, solid pseudopapillary tumor, and cystadenomas (which encompass microcystic, macrocystic/oligocystic, and rare solid serous adenomas). Microcystic adenoma of the pancreas is a tumor that is benign in nature. Malignant transformation in the tumor with metastases is rare and only about 26 cases have been reported so far. Here we present a giant microcystic adenoma of the pancreas, possibly the largest ever malignant type in this group ever reported in the literature with extensive metastases to the liver and causing extensive compression and encasement on surrounding structures. PMID:24782930

Kidney enlargement and multiple liver cyst formation implicate mutations in PKD1/2 in adult sporadic polycystic kidney disease.

PubMed

Fujimaru, T; Mori, T; Sekine, A; Mandai, S; Chiga, M; Kikuchi, H; Ando, F; Mori, Y; Nomura, N; Iimori, S; Naito, S; Okado, T; Rai, T; Hoshino, J; Ubara, Y; Uchida, S; Sohara, E

2018-07-01

Distinguishing autosomal-dominant polycystic kidney disease (ADPKD) from other inherited renal cystic diseases in patients with adult polycystic kidney disease and no family history is critical for correct treatment and appropriate genetic counseling. However, for patients with no family history, there are no definitive imaging findings that provide an unequivocal ADPKD diagnosis. We analyzed 53 adult polycystic kidney disease patients with no family history. Comprehensive genetic testing was performed using capture-based next-generation sequencing for 69 genes currently known to cause hereditary renal cystic diseases including ADPKD. Through our analysis, 32 patients had PKD1 or PKD2 mutations. Additionally, 3 patients with disease-causing mutations in NPHP4, PKHD1, and OFD1 were diagnosed with an inherited renal cystic disease other than ADPKD. In patients with PKD1 or PKD2 mutations, the prevalence of polycystic liver disease, defined as more than 20 liver cysts, was significantly higher (71.9% vs 33.3%, P = .006), total kidney volume was significantly increased (median, 1580.7 mL vs 791.0 mL, P = .027) and mean arterial pressure was significantly higher (median, 98 mm Hg vs 91 mm Hg, P = .012). The genetic screening approach and clinical features described here are potentially beneficial for optimal management of adult sporadic polycystic kidney disease patients. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Liesegang rings in renal cyst fluid.

PubMed

Katz, L B; Ehya, H

1990-01-01

Peculiar ring-like structures identified as Liesegang rings (LRs) were found in renal cyst fluid from three patients with benign renal cysts. They ranged in size from 5 to 820 mu. Most had a double-layer outer wall with equally spaced radial cross-striations and an amorphous central nidus. Special stains were performed in one case, and the results are discussed. Reports of LRs in cystic or inflamed tissues have recently appeared in the literature. Some LRs have been mistaken for eggs or mature components of the giant kidney worm, Dioctophyma renale. We propose that cytologic assessment of renal cyst fluid in conjunction with histologic examination decreases the likelihood of misdiagnosis of LRs.

Mutation spectrum and differential gene expression in cystic and solid vestibular schwannoma.

PubMed

Zhang, Zhihua; Wang, Zhaoyan; Sun, Lianhua; Li, Xiaohua; Huang, Qi; Yang, Tao; Wu, Hao

2014-03-01

We sought to characterize the mutation spectrum of NF2 and the differential gene expression in cystic and solid vestibular schwannomas. We collected tumor tissue and blood samples of 31 cystic vestibular schwannomas and 114 solid vestibular schwannomas. Mutation screening of NF2 was performed in both tumor and blood DNA samples of all patients. cDNA microarray was used to analyze the differential gene expression between 11 cystic vestibular schwannomas and 6 solid vestibular schwannomas. Expression levels of top candidate genes were verified by quantitative reverse transcription PCR. NF2 mutations were identified in 34.5% of sporadic vestibular schwannomas, with all mutations being exclusively somatic. No significant difference was found between the mutation detection rates of cystic vestibular schwannoma (35.5%) and solid vestibular schwannoma (34.2%). cDNA microarray analysis detected a total of 46 differentially expressed genes between the cystic vestibular schwannoma and solid vestibular schwannoma samples. The significantly decreased expression of four top candidate genes, C1orf130, CNTF, COL4A3, and COL4A4, was verified by quantitative reverse transcription PCR. NF2 mutations are not directly involved in the cystic formation of vestibular schwannoma. In addition, the differential gene expression of cystic vestibular schwannoma reported in our study may provide useful insights into the molecular mechanism underlying this process.

Robotic partial nephrectomy for complex renal tumors: surgical technique.

PubMed

Rogers, Craig G; Singh, Amar; Blatt, Adam M; Linehan, W Marston; Pinto, Peter A

2008-03-01

Laparoscopic partial nephrectomy requires advanced training to accomplish tumor resection and renal reconstruction while minimizing warm ischemia times. Complex renal tumors add an additional challenge to a minimally invasive approach to nephron-sparing surgery. We describe our technique, illustrated with video, of robotic partial nephrectomy for complex renal tumors, including hilar, endophytic, and multiple tumors. Robotic assistance was used to resect 14 tumors in eight patients (mean age: 50.3 yr; range: 30-68 yr). Three patients had hereditary kidney cancer. All patients had complex tumor features, including hilar tumors (n=5), endophytic tumors (n=4), and/or multiple tumors (n=3). Robotic partial nephrectomy procedures were performed successfully without complications. Hilar clamping was used with a mean warm ischemia time of 31 min (range: 24-45 min). Mean blood loss was 230 ml (range: 100-450 ml). Histopathology confirmed clear-cell renal cell carcinoma (n=3), hybrid oncocytic tumor (n=2), chromophobe renal cell carcinoma (n=2), and oncocytoma (n=1). All patients had negative surgical margins. Mean index tumor size was 3.6 cm (range: 2.6-6.4 cm). Mean hospital stay was 2.6 d. At 3-mo follow-up, no patients experienced a statistically significant change in serum creatinine or estimated glomerular filtration rate and there was no evidence of tumor recurrence. Robotic partial nephrectomy is safe and feasible for select patients with complex renal tumors, including hilar, endophytic, and multiple tumors. Robotic assistance may facilitate a minimally invasive, nephron-sparing approach for select patients with complex renal tumors who might otherwise require open surgery or total nephrectomy.

18F FPPRGD2 PET/CT or PET/MRI in Predicting Early Response in Patients With Cancer Receiving Anti-Angiogenesis Therapy

ClinicalTrials.gov

2017-03-12

Adult Giant Cell Glioblastoma; Adult Glioblastoma; Adult Gliosarcoma; Male Breast Cancer; Metastatic Squamous Neck Cancer With Occult Primary Squamous Cell Carcinoma; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Adult Brain Tumor; Recurrent Basal Cell Carcinoma of the Lip; Recurrent Breast Cancer; Recurrent Colon Cancer; Recurrent Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity; Recurrent Hypopharyngeal Cancer; Recurrent Inverted Papilloma of the Paranasal Sinus and Nasal Cavity; Recurrent Laryngeal Cancer; Recurrent Lip and Oral Cavity Cancer; Recurrent Lymphoepithelioma of the Nasopharynx; Recurrent Lymphoepithelioma of the Oropharynx; Recurrent Metastatic Squamous Neck Cancer With Occult Primary; Recurrent Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Nasopharyngeal Cancer; Recurrent Non-small Cell Lung Cancer; Recurrent Oropharyngeal Cancer; Recurrent Pancreatic Cancer; Recurrent Paranasal Sinus and Nasal Cavity Cancer; Recurrent Rectal Cancer; Recurrent Renal Cell Cancer; Recurrent Salivary Gland Cancer; Stage IIIA Breast Cancer; Stage IIIA Non-small Cell Lung Cancer; Stage IIIB Breast Cancer; Stage IIIB Non-small Cell Lung Cancer; Stage IIIC Breast Cancer; Stage IV Breast Cancer; Stage IV Non-small Cell Lung Cancer; Stage IV Pancreatic Cancer; Stage IV Renal Cell Cancer; Stage IVA Colon Cancer; Stage IVA Rectal Cancer; Stage IVA Salivary Gland Cancer; Stage IVB Colon Cancer; Stage IVB Salivary Gland Cancer; Stage IVC Salivary Gland Cancer; Tongue Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Intratumoral peripheral small papillary tufts: a diagnostic clue of renal tumors associated with Birt-Hogg-Dubé syndrome.

PubMed

Kuroda, Naoto; Furuya, Mitsuko; Nagashima, Yoji; Gotohda, Hiroko; Moritani, Suzuko; Kawakami, Fumi; Imamura, Yoshiaki; Bando, Yoshimi; Takahashi, Masayuki; Kanayama, Hiro-omi; Ota, Satoshi; Michal, Michal; Hes, Ondrej; Nakatani, Yukio

2014-06-01

In this article, we searched for the common histologic characteristic of renal tumors in patients with Birt-Hogg-Dubé syndrome (BHDS). We selected 6 patients with histologically confirmed renal tumor in BHDS. Germline FLCN gene mutation has been identified in 5 patients. Multifocality and bilaterality of the renal tumors were pathologically or radiologically confirmed in 5 and 2 cases, respectively. Histologic subtypes of the dominant tumor included 3 previously described hybrid oncocytic tumors, one composite chromophobe/papillary/clear cell renal cell carcinoma (RCC) and one unclassified RCC resembling hybrid chromophobe/clear cell RCC. In one case, chromophobe RCC and clear cell RCC were separately observed. Small papillary lesions located in the peripheral area of the tumor, which we designated as intratumoral peripheral small papillary tufts, were identified in all patients. In conclusion, multifocality/bilaterality of renal tumors, discordance of histologic subtypes, and the presence of intratumoral peripheral small papillary tufts may be important clues to identify BHDS-associated renal tumors. Copyright © 2014 Elsevier Inc. All rights reserved.

High Resolution Diffusion-Weighted Imaging for Solitary Orbital Tumors : 3D Turbo Field Echo with Diffusion-Sensitized Driven-Equilibrium (DSDE-TFE) Preparation Technique.

PubMed

Hiwatashi, Akio; Togao, Osamu; Yamashita, Koji; Kikuchi, Kazufumi; Yoshikawa, Hiroshi; Obara, Makoto; Honda, Hiroshi

2018-06-01

To differentiate cystic from solid solitary intraorbital tumors using 3D turbo field echo with diffusion-sensitized driven-equilibrium preparation without contrast material. This retrospective study was approved by our institutional review boards, and written informed consent was waived. A total of 26 patients with intraorbital tumors were studied. Motion probing gradients were conducted at one direction with b‑values of 0 and 500 s/mm 2 . The voxel size was 1.5 × 1.5 × 1.5 mm 3 , and acquisition time was 5 min 22 s. Additionally, fat-suppressed T2-weighted imaging (T2WI) and T1WI were obtained. The apparent diffusion coefficients (ADC) of the lesions were measured. Signal intensity on conventional magnetic resonance imaging (MRI) compared to normal appearing white matter was also measured. Statistical analysis was performed with Mann-Whitney U-test, the Steel-Dwass test and the receiver operating characteristic (ROC) analysis. There were 10 cystic (7 dermoids, 2 epidermoids, and 1 cystadenoma) and 16 solid (8 cavernous hemangiomas, 6 pleomorphic adenomas, 1 adenocarcinoma, and 1 sebaceous carcinoma) tumors. The ADC of the cystic tumors (mean ± SD; 2.21 ± 0.76 × 10 -3 mm 2 /s) was statistically significantly lower than that of solid tumors (1.43 ± 0.41 × 10 -3 mm 2 /s; P < 0.05).; however, there were no statistically significant differences on conventional MRI (P > 0.05). There were no statistically significant differences among tumor subtypes in all parameters (P > 0.05). The ROC analysis showed the best diagnostic performance with ADC (Az = 0.77). With its insensitivity to field inhomogeneity and high spatial resolution, the 3D DSDE-TFE technique enabled us to discriminate cystic tumors from solid tumors.

Pneumothorax caused by cystic and nodular lung metastases from a malignant uterine perivascular epithelioid cell tumor (PEComa).

PubMed

Okamoto, Shouichi; Komura, Moegi; Terao, Yasuhisa; Kurisaki-Arakawa, Aiko; Hayashi, Takuo; Saito, Tsuyoshi; Togo, Shinsaku; Shiokawa, Akira; Mitani, Keiko; Kobayashi, Etsuko; Kumasaka, Toshio; Takahashi, Kazuhisa; Seyama, Kuniaki

2017-01-01

Perivascular epithelioid cell tumors (PEComas) are mesenchymal neoplasms with immunoreactivity for both melanocytic and smooth muscle markers. PEComas occur at multiple sites, and malignant PEComas can undergo metastasis, recurrence and aggressive clinical courses. Although the lung is a common metastatic site of PEComas, they usually appear as multiple nodules but rarely become cystic or cavitary. Here, we describe a female patient whose lungs manifested multiple cystic, cavity-like and nodular metastases 3 years after the resection of uterine tumors tentatively diagnosed as epithelioid smooth muscle tumors with uncertain malignant potential. This patient's subsequent pneumothorax necessitated video-assisted thoracoscopic surgery, and examination of her resected lung specimens eventually led to correcting the diagnosis, i.e., to a PEComa harboring tuberous sclerosis complex 1 ( TSC1 ) loss-of-heterozygosity that originated in the uterus and then metastasized to the lungs. The administration of a gonadotropin-releasing hormone analogue later stabilized her clinical course. To the best of our knowledge, the present case is the first in the literature that associates PEComas with a TSC1 abnormality. Additionally, the pulmonary manifestations, including imaging appearance and pneumothorax, somewhat resembled those of lymphangioleiomyomatosis, a representative disease belonging to the PEComa family. Although PEComas are rare, clinicians, radiologists and pathologists should become aware of this disease entity, especially in the combined clinical setting of multiple cystic, cavity-like, nodular lesions on computed tomography of the chest and a past history of the tumor in the female reproductive system.

Risk factors for end stage renal disease in non-WT1-syndromic Wilms tumor.

PubMed

Lange, Jane; Peterson, Susan M; Takashima, Janice R; Grigoriev, Yevgeny; Ritchey, Michael L; Shamberger, Robert C; Beckwith, J Bruce; Perlman, Elizabeth; Green, Daniel M; Breslow, Norman E

2011-08-01

We assessed risk factors for end stage renal disease in patients with Wilms tumor without known WT1 related syndromes. We hypothesized that patients with characteristics suggestive of a WT1 etiology (early onset, stromal predominant histology, intralobar nephrogenic rests) would have a higher risk of end stage renal disease due to chronic renal failure. We predicted a high risk of end stage renal disease due to progressive bilateral Wilms tumor in patients with metachronous bilateral disease. End stage renal disease was ascertained in 100 of 7,950 nonsyndromic patients enrolled in a National Wilms Tumor Study during 1969 to 2002. Risk factors were evaluated with cumulative incidence curves and proportional hazard regressions. The cumulative incidence of end stage renal disease due to chronic renal failure 20 years after Wilms tumor diagnosis was 0.7%. For end stage renal disease due to progressive bilateral Wilms tumor the incidence was 4.0% at 3 years after diagnosis in patients with synchronous bilateral Wilms tumor and 19.3% in those with metachronous bilateral Wilms tumor. For end stage renal disease due to chronic renal failure stromal predominant histology had a HR of 6.4 relative to mixed (95% CI 3.4, 11.9; p<0.001), intralobar rests had a HR of 5.9 relative to no rests (95% CI 2.0, 17.3; p=0.001), and Wilms tumor diagnosis at less than 24 months had a HR of 1.7 relative to 24 to 48 months and 2.8 relative to greater than 48 months (p=0.003 for trend). Metachronous bilateral Wilms tumor is associated with high rates of end stage renal disease due to surgery for progressive Wilms tumor. Characteristics associated with a WT1 etiology markedly increased the risk of end stage renal disease due to chronic renal failure despite the low risk in non-WT1 syndromic cases overall. Copyright © 2011 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Alvespimycin Hydrochloride in Treating Patients With Metastatic or Unresectable Solid Tumors

ClinicalTrials.gov

2013-04-09

Male Breast Cancer; Recurrent Adenoid Cystic Carcinoma of the Oral Cavity; Recurrent Basal Cell Carcinoma of the Lip; Recurrent Breast Cancer; Recurrent Colon Cancer; Recurrent Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity; Recurrent Gastric Cancer; Recurrent Inverted Papilloma of the Paranasal Sinus and Nasal Cavity; Recurrent Lymphoepithelioma of the Nasopharynx; Recurrent Lymphoepithelioma of the Oropharynx; Recurrent Melanoma; Recurrent Metastatic Squamous Neck Cancer With Occult Primary; Recurrent Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity; Recurrent Mucoepidermoid Carcinoma of the Oral Cavity; Recurrent Ovarian Epithelial Cancer; Recurrent Prostate Cancer; Recurrent Renal Cell Cancer; Recurrent Salivary Gland Cancer; Recurrent Squamous Cell Carcinoma of the Hypopharynx; Recurrent Squamous Cell Carcinoma of the Larynx; Recurrent Squamous Cell Carcinoma of the Lip and Oral Cavity; Recurrent Squamous Cell Carcinoma of the Nasopharynx; Recurrent Squamous Cell Carcinoma of the Oropharynx; Recurrent Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity; Recurrent Verrucous Carcinoma of the Larynx; Recurrent Verrucous Carcinoma of the Oral Cavity; Stage III Adenoid Cystic Carcinoma of the Oral Cavity; Stage III Basal Cell Carcinoma of the Lip; Stage III Colon Cancer; Stage III Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity; Stage III Gastric Cancer; Stage III Inverted Papilloma of the Paranasal Sinus and Nasal Cavity; Stage III Lymphoepithelioma of the Nasopharynx; Stage III Lymphoepithelioma of the Oropharynx; Stage III Melanoma; Stage III Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity; Stage III Mucoepidermoid Carcinoma of the Oral Cavity; Stage III Ovarian Epithelial Cancer; Stage III Renal Cell Cancer; Stage III Salivary Gland Cancer; Stage III Squamous Cell Carcinoma of the Hypopharynx; Stage III Squamous Cell Carcinoma of the Larynx; Stage III Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage III Squamous Cell Carcinoma of the Nasopharynx; Stage III Squamous Cell Carcinoma of the Oropharynx; Stage III Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity; Stage III Verrucous Carcinoma of the Larynx; Stage III Verrucous Carcinoma of the Oral Cavity; Stage IIIB Breast Cancer; Stage IIIC Breast Cancer; Stage IV Adenoid Cystic Carcinoma of the Oral Cavity; Stage IV Basal Cell Carcinoma of the Lip; Stage IV Breast Cancer; Stage IV Colon Cancer; Stage IV Esthesioneuroblastoma of the Paranasal Sinus and Nasal Cavity; Stage IV Gastric Cancer; Stage IV Inverted Papilloma of the Paranasal Sinus and Nasal Cavity; Stage IV Lymphoepithelioma of the Nasopharynx; Stage IV Lymphoepithelioma of the Oropharynx; Stage IV Melanoma; Stage IV Midline Lethal Granuloma of the Paranasal Sinus and Nasal Cavity; Stage IV Mucoepidermoid Carcinoma of the Oral Cavity; Stage IV Ovarian Epithelial Cancer; Stage IV Prostate Cancer; Stage IV Renal Cell Cancer; Stage IV Salivary Gland Cancer; Stage IV Squamous Cell Carcinoma of the Hypopharynx; Stage IV Squamous Cell Carcinoma of the Larynx; Stage IV Squamous Cell Carcinoma of the Lip and Oral Cavity; Stage IV Squamous Cell Carcinoma of the Nasopharynx; Stage IV Squamous Cell Carcinoma of the Oropharynx; Stage IV Squamous Cell Carcinoma of the Paranasal Sinus and Nasal Cavity; Stage IV Verrucous Carcinoma of the Larynx; Stage IV Verrucous Carcinoma of the Oral Cavity; Unspecified Adult Solid Tumor, Protocol Specific; Untreated Metastatic Squamous Neck Cancer With Occult Primary

Melan-A/Mart-1- or HMB-45-positive melanocytes are not present in calcifying cystic odontogenic tumors (calcifying odontogenic cysts): a study in 13 Caucasian patients.

PubMed

Tosios, Konstantinos I; Prountzos, Nikolaos; Katsoulas, Nikolaos; Koutlas, Ioannis G; Sklavounou-Andrikopoulou, Alexandra

2012-03-01

Melanin pigment and melanocytes may be found in odontogenic cysts and tumors, particularly calcifying cystic odontogenic tumor (CCOT). In the present study we investigated the immunohistochemical expression of the Melan-A/Mart-1 and HMB-45 antigens in 13 Caucasians patients with CCOT. Melan-A/Mart-1- and HMB-45-positive melanocytes were not seen in any of the cases. Our findings are in agreement with the assumption that pigmentation in odontogenic lesions may be a racial phenomenon.

[Solid cystic papillary tumor of the pancreas].

PubMed

Bahri, I; Njim, L; Khabir, A; Mahmoudi, H; Ghorbel, A; Zakhama, A; Jlidi, R

2001-11-01

Solid cystic papillary tumors of the pancreas are rare; they occur most commonly in young women. Despite their characteristic microscopic appearance, their immunophenotype is not specific. Their prognosis is excellent after complete surgical resection. The study aim was to report two cases in female patients who were 15 and 20 years old; the first tumor was discovered fortuitously and the second girl presented with abdominal pain and vomiting. Both tumors were encapsulated and located in the tail of the pancreas. The histological study showed the papillary architecture mixed with solid areas. Immunohistochemical staining was positive only for vimentin in one case and positive for cytokeratin, chromogranin, synaptophysin, neuron specific enolase, vimentin and protein S100 in the second case.

Multidetector Computed Tomography Features in Differentiating Exophytic Renal Angiomyolipoma from Retroperitoneal Liposarcoma

PubMed Central

Wang, Qiushi; Juan, Yu-Hsiang; Li, Yong; Xie, Jia-Jun; Liu, Hui; Huang, Hongfei; Liu, Zaiyi; Zheng, Junhui; Saboo, Ujwala S.; Saboo, Sachin S.; Liang, Changhong

2015-01-01

Abstract This study aims to evaluate the multidetector computed tomography (CT) imaging features in differentiating exophytic renal angiomyolipoma (AML) from retroperitoneal liposarcoma. We retrospectively enrolled 42 patients with confirmed exophytic renal AML (31 patients) or retroperitoneal liposarcoma (11 patients) during 8 years period to assess: renal parenchymal defect at site of tumor contact, supply from branches of renal artery, tumoral vessel extending through the renal parenchyma, dilated intratumoral vessels, hemorrhage, non–fat-containing intratumoral nodules with postcontrast enhancement, calcification, renal sinus enlargement, anterior displacement of kidneys, and other associated AML. Renal parenchymal defect, renal arterial blood supply, tumoral vessel through the renal parenchyma, dilated intratumoral vessels, intratumoral/perirenal hemorrhage, renal sinus enlargement, and associated AML were seen only or mainly in exophytic renal AML (all P value < 0.05); however, non–fat-attenuating enhancing intratumoral nodules, intratumoral calcification, and anterior displacement of the kidney were more common in liposarcoma (all P value < 0.05). AMLs reveal renal parenchymal defect at the site of tumor contact, supply from renal artery, tumoral vessel extending through the renal parenchyma, dilated intratumoral vessels, intratumoral and/or perirenal hemorrhage, renal sinus enlargement, and associated AML. Non–fat-attenuating enhancing intratumoral nodules, intratumoral calcifications, and anterior displacement of kidney were more commonly seen in liposarcoma. PMID:26376398

Improved diagnostic differentiation of renal cystic lesions with phase-contrast computed tomography (PCCT)

NASA Astrophysics Data System (ADS)

Noel, Peter B.; Willner, Marian; Fingerle, Alexander; Herzen, Julia; Münzel, Daniela; Hahn, Dieter; Rummeny, Ernst J.; Pfeiffer, Franz

2012-03-01

The diagnostic quality of phase-contrast computed tomography (PCCT) is one the unexplored areas in medical imaging; at the same time, it seems to offer the opportunity as a fast and highly sensitive diagnostic tool. Conventional computed tomography (CT) has had an enormous impact on medicine, while it is limited in soft-tissue contrast. One example that portrays this challenge is the differentiation between benign and malignant renal cysts. In this work we report on a feasibility study to determine the usefulness of PCCT in differentiation of renal cysts. A renal phantom was imaged with a grating-based PCCT system consisting of a standard rotating anode x-ray tube (40 kV, 70 mA) and a Pilatus II photoncounting detector (pixel size: 172 μm). The phantom is composed of a renal equivalent soft-tissue and cystic lesions grouped in non-enhancing cyst and hemorrhage series and an iodine enhancing series. The acquired projection images (absorption and phase-contrast) are reconstructed with a standard filtered backprojection algorithm. For evaluation both reconstructions are compared in respect to contrast-to-noise ratio (CNR), signal-to-noise ratio (SNR), and subjective image quality. We found that with PCCT a significantly improved differentiation between hemorrhage renal cysts from contrast enhancing malignant cysts is possible. If comparing PCCT and CT with respect to CNR and SNR, PCCT shows significant improvements. In conclusion, PCCT has the potential to improve the diagnostics and characterization of renal cysts without using any contrast agents. These results in combination with a non-synchrotron setup indicate a future paradigm shift in diagnostic computed tomography.

Renal capillary haemangioma associated with renal cell carcinoma and polycythaemia in acquired cystic disease.

PubMed

Beamer, Matthew; Love, Matthew; Ghasemian, Seyed

2017-06-16

Capillary haemangiomas are relatively common tumours, typically occurring in the subcutaneous tissue during childhood. However, visceral occurrence is very rare. These tumours make up a subset of vascular lesions that have previously, although rarely, been described in case reports in association with the kidney. Here we review the literature and describe a capillary haemangioma occurring in the renal hilum found to be coexistent with end-stage renal disease, renal cell carcinoma and polycythaemia. To our knowledge, this is the first case report to describe the occurrence of this tumour in the renal hilum in association with this constitution of renal pathologies. © BMJ Publishing Group Ltd (unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Long-Term Outcomes of Eye-Sparing Surgery for Adenoid Cystic Carcinoma of Lacrimal Gland.

PubMed

Han, Jisang; Kim, Yoon-Duck; Woo, Kyung In; Sobti, Deepak

This study's primary purpose is to assess the long-term outcomes of patients who have undergone eye-sparing surgery and adjuvant radiotherapy for adenoid cystic carcinoma of the lacrimal gland. In this retrospective analysis, clinical records were reviewed of all patients diagnosed with adenoid cystic carcinoma of the lacrimal gland, at a single institution, between March 1998 and November 2012. Ten patients were identified as having undergone eye-sparing surgery and adjuvant radiotherapy for adenoid cystic carcinoma of the lacrimal gland. Preoperative radiographic findings, treatment modalities, histological results, and patient outcomes were analyzed. There were 6 male and 4 female patients. The patients' tumors were staged according to the 8th American Joint Committee on Cancer staging system, and were as follows: 1 patient was classified as T1aN0M0; 6 patients were classified as T2aN0M0; 1 patient was classified as T2cN0M0; 2 patients were classified as T3aN0M0. All patients had a histologically confirmed diagnosis of lacrimal gland adenoid cystic carcinoma, which was confined to the orbit, and was without extension into adjacent bone marrow or other organs. All patients underwent eye-sparing tumor excision followed by postoperative radiotherapy, with a median dose of 6000 cGy (range: 5000-6600 cGy). At the last follow up, 8 patients were alive without evidence of disease. One patient was deceased at 58 months post-surgery, due to esophageal carcinoma; this was unrelated to the lacrimal gland tumor. The final patient experienced tumor recurrence in the medial orbit 53 months post-surgery, and exenteration was performed. This patient was alive, without disease recurrence, at 90 months following exenteration. The median follow-up time was 89.5 months (range: 37-217 months). Systemic metastasis did not occur in any patient. Eye-sparing surgery and adjuvant radiotherapy have demonstrated favorable local control and long-term survival outcomes in patients with orbit-confined lacrimal gland adenoid cystic carcinoma. Consequently, eye-sparing surgery with adjuvant radiotherapy can be considered as a viable treatment option for orbit-confined lacrimal gland adenoid cystic carcinoma.

Adenoid Cystic Carcinoma of the Uterine Cervix: A Report of 2 Cases

PubMed Central

Kharmoum, Jinane; Ech-Charif, Soumaya; El Khannoussi, Basma

2017-01-01

Adenoid cystic carcinoma is malignant tumor that exceptionally occurs in the uterine cervix. It is mostly seen in postmenopausal women and has an aggressive clinical course. We report two cases of an adenoid cystic carcinoma associated with a high grade squamous intraepithelial lesion and invasive squamous cell carcinoma of the uterine cervix and discuss briefly its clinical and pathological characteristics. PMID:28348909

Shorter telomere length increases age-related tumor risks in von Hippel-Lindau disease patients.

PubMed

Wang, Jiang-Yi; Peng, Shuang-He; Ning, Xiang-Hui; Li, Teng; Liu, Sheng-Jie; Liu, Jia-Yuan; Hong, Bao-An; Qi, Nie-Nie; Peng, Xiang; Zhou, Bo-Wen; Zhang, Jiu-Feng; Cai, Lin; Gong, Kan

2017-09-01

Von Hippel-Lindau (VHL) disease is a rare autosomal dominant cancer syndrome caused by alterations of VHL gene. Patients are predisposed to develop pheochromocytomas and solid or cystic tumors of the central nervous system, kidney, pancreas, and retina. Remarkable phenotypic heterogeneity exits in organ involvement and tumor onset age between and within VHL families. However, no reliable markers have been found to predict the age-related tumor risks in VHL patients. A large Chinese cohort composed of 300 VHL patients and 92 healthy family controls was enrolled in our study. Blood relative telomere length was measured in 184 patients and all the controls available for genomic DNA samples. Age-related risks for the five major VHL-associated tumors were evaluated using Kaplan-Meier plots and Cox regression analysis. Differences in clinical phenotype were observed between Chinese cohort and the United Kingdom cohort. VHL patients showed significantly shorter telomere length than healthy family controls(P = 0.0183), and a positive correlation was found between telomere length and onset age of the five major tumors, respectively. Moreover, patients in the shorter telomere group (age-adjusted telomere length ≤ 0.44) suffered higher age-related risks for VHL-associated central nervous system hemangioblastomas (HR: 1.879, P = 0.004), renal cell carcinoma (HR: 2.126, P = 0.002) and pancreatic cyst and neuroendocrine tumors (HR: 2.093, P = 0.001). These results indicate that blood shorter telomere length is a new biomarker for age-related tumor risks in VHL patients, which will be crucial to genetic counseling and future research about the role of telomere shortening in the pathogenesis of VHL-associated tumors. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

Different optical spectral characteristics in a necrotic transmissible venereal tumor and a cystic lesion in the same canine prostate observed by triple-band trans-rectal optical tomography under trans-rectal ultrasound guidance

NASA Astrophysics Data System (ADS)

Jiang, Zhen; Holyoak, G. Reed; Ritchey, Jerry W.; Bartels, Kenneth E.; Rock, Kendra; Ownby, Charlotte L.; Slobodov, Gennady; Bunting, Charles F.; Piao, Daqing

2011-03-01

Different optical spectral characteristics were observed in a necrotic transmissible venereal tumor (TVT) and a cystic lesion in the same canine prostate by triple-wavelength trans-rectal optical tomography under trans-rectal ultrasound (TRUS) guidance. The NIR imager acquiring at 705nm, 785nm and 808nm was used to quantify both the total hemoglobin concentration (HbT) and oxygen saturation (StO2) in the prostate. The TVT tumor in the canine prostate as a model of prostate cancer was induced in a 7-year old, 27 kg dog. A 2 mL suspension of 2.5x106 cells/mL of homogenized TVT cells recovered from an in vivo subcutaneously propagated TVT tumor in an NOD/SCID mouse were injected in the cranial aspect of the right lobe of the canine prostate. The left lobe of the prostate had a cystic lesion present before TVT inoculation. After the TVT homogenate injection, the prostate was monitored weekly over a 9-week period, using trans-rectal NIR and TRUS in grey-scale and Doppler. A TVT mass within the right lobe developed a necrotic center during the later stages of this study, as the mass presented with substantially increased [HbT] in the periphery, with an area of reduced StO2 less than the area of the mass itself shown on ultrasonography. Conversely, the cystic lesion presented with slightly increased [HbT] in the periphery of the lesion shown on ultrasound with oxygen-reduction inside and in the periphery of the lesion. There was no detectable change of blood flow on Doppler US in the periphery of the cystic lesion. The slightly increased [HbT] in the periphery of the cystic lesion was correlated with intra-lesional hemorrhage upon histopathologic examination.

Decompression Device Using a Stainless Steel Tube and Wire for Treatment of Odontogenic Cystic Lesions: A Technical Report.

PubMed

Jung, Eun-Joo; Baek, Jin-A; Leem, Dae-Ho

2014-11-01

Decompression is considered an effective treatment for odontogenic cystic lesions in the jaw. A variety of decompression devices are successfully used for the treatment of keratocystic odontogenic tumors, radicular cysts, dentigerous cysts, and ameloblastoma. The purpose of these devices is to keep an opening between the cystic lesion and the oral environment during treatment. The aim of this report is to describe an effective decompression tube using a stainless steel tube and wire for treatment of jaw cystic lesions.

[Pseudo-Bartter syndrome as manifestation of cystic fibrosis with DF508 mutation].

PubMed

Galaviz-Ballesteros, María de Jesús; Acosta-Rodríguez-Bueno, Carlos Patricio; Consuelo-Sánchez, Alejandra; Franco-Álvarez, Isidro; Olalla-Mora, Odilo Iván; Vázquez-Frias, Rodrigo

Pseudo Bartter syndrome (PBS) is defined as hypokalaemic hypochloraemic metabolic alkalosis in the absence of renal tubular pathology. Children with cystic fibrosis (CF) are at risk of developing electrolyte abnormalities and even PBS may occur. 5 months old female infant with a history of two events of dehydration with vomit, refusal to eat, chronic cough, polyuria, malnutrition, metabolic alkalosis, hypokalemia, hyponatremia, hypochloremia and acute renal failure. Chronic cough study was performed, discarding pulmonary tuberculosis, gastroesophageal reflux disease and impaired swallowing. PBS was diagnosed due to hypokalaemic hypochloraemic metabolic alkalosis in the absence of renal tubular pathology. CF was corroborated by electrolytes in sweat and through molecular analysis of the delta F508 mutation. This is one of the few reported cases linking PBS and this mutation. In patients with hyponatremic dehydration episodes with hypokalaemic hypochloraemic metabolic alkalosis, PBS should be considered as differential diagnosis. CF could be presented as PBS, mainly in patients younger than 2 years. Copyright © 2016 Hospital Infantil de México Federico Gómez. Publicado por Masson Doyma México S.A. All rights reserved.

[CT diagnosis of hemorrhagic renal cysts].

PubMed

Wu, Y Z; Li, D T; Luo, J G

2001-06-28

CT signs of nineteen cases of hemorrhagic renal cysts that surgically and pathologically proved were analyzed. 8 of the 19 cases revealed as high density hemorrhagic lesion. CT signs in those 8 patients include low density rim sign, cyst immerging sign, and perirenal fascia thickening. The other 11 of 19 cases revealed as low density lesion. CT signs include thickened cyst wall and inhomogeneous density of the cystic content. The hounsfield unit of the lesion is correlated with the duration of disease. It is suggested that CT is valuable in diagnosis of high density hemorrhagic renal cysts, and it gives a clue to the diagnosis of low density hemorrhagic renal cysts.

Prognostic significance of extensive necrosis in renal cell carcinoma.

PubMed

Collins, Jennifer; Epstein, Jonathan I

2017-08-01

Few studies using the current classification of renal cell carcinoma (RCC) have looked at a large number of cases with near total necrosis. We identified 21 cases of resections of RCC with >90% necrosis from the archives of Johns Hopkins Hospital between 2000 and 2015. Patients' mean age was 59 years (43-77) with 16 men (76%); 12 cases (57%) were papillary RCC, 4 clear cell papillary RCC (19%), 4 clear cell RCC (19%), and 1 unclassified with sarcomatoid differentiation (5%). International Society of Urological Pathology (ISUP) nucleolar grade was grade 1 (9 cases) or grade 2 (9 cases). Two cases were ISUP nucleolar grade 3, and 1 case was grade 4. Pathological stage was low (pT1-2) in 20 (95%) with the unclassified RCC with sarcomatoid differentiation RCC stage pT3a. Mean tumor size was 6.3 cm (1.2-17). In 52% (11) of cases, it was difficult to identify viable tumor, requiring multiple sections; 4 cases of papillary RCC were diagnosed in part due to necrotic tumor "ghost" architecture. Follow-up was available in 17 cases (81%) with a mean follow-up of 59 months. Thirteen patients (62%) are alive without disease. The patient with unclassified carcinoma with sarcomatoid differentiation died of cancer, and 2 died due to causes unrelated to cancer. One patient (5%) with low-grade clear cell RCC developed metastases but had a contralateral RCC. In the setting of a low-grade RCC, extensive necrosis does not have an adverse prognosis. In summary, our data, together with a prior study from our institution, comprise one of the largest cohorts of extensively (>90%) necrotic RCCs and suggests that in the setting of a low-grade RCC, it portends a good prognosis (only 2/36 cases showing progression (6%) on follow-up). However, we did identify a single case of high-grade RCC with an adverse prognosis and therefore, careful attention to tumor grade and classification is critical. The presence of tumor necrosis as a prognosticator in RCCs is complex, and despite its well-accepted role as an indicator of poor prognosis, our data would suggest otherwise under specific conditions. Importantly, in diagnosing a renal mass with extensive cystic necrosis, careful and extensive sampling to identify small foci of viable tumor or "ghost" architecture may be necessary for classification. As such, evaluation of its presence should not only be quantitative, but critical attention should be made to tumor grade and stage, whereby in high-grade carcinomas, necrosis likely imparts a worse prognosis; however, in low-grade carcinomas with extensive necrosis, the histological subtype, grade, and stage drive prognosis. Copyright © 2017 Elsevier Inc. All rights reserved.

A Case Report of Cystic Pheochromocytoma.

PubMed

Junejo, Shoaib Z; Tuli, Sandeep; Heimann, David M; Sachmechi, Issac; Reich, David

2017-07-25

BACKGROUND Pheochromocytoma is a rare catecholamine-producing tumor with an estimated incidence of less than 0.1% in the global population. We present a case of cystic pheochromocytoma that was diagnosed as an incidental finding. The patient presented with abdominal pain and had a history of hypertension. CASE REPORT A 64-year-old man with hypertension presented with a clinical history of intermittent abdominal pain for one year. He denied sweating, palpitations, headache or back pain. He was found to have an elevated blood pressure of 170/90 and no palpable abdominal mass. Contrast-enhanced computed tomography (CT) imaging of the abdomen and pelvis were performed that showed cystic mass measuring 9 cm in diameter arising from the left adrenal gland with contrast-enhancing mural nodules. Magnetic resonance imaging (MRI) confirmed the cystic nature of the mass. Laboratory analysis showed an elevated plasma normetanephrine (NMN) of 1,087 pg/ml and metanephrine (MN) of 372 pg/ml; 24-hour urine showed elevated levels of NMN and MN, 3,002 mg/24 h and 1,596 mg/24 h, respectively. Given the laboratory and radiologic findings, a diagnosis of cystic pheochromocytoma was made. After controlling blood pressure with the alpha-blocker, doxazosin, the patient was hydrated and scheduled for an elective adrenalectomy. The histopathology of the excised adrenal gland was consistent with a cystic pheochromocytoma. CONCLUSIONS Cystic pheochromocytoma is a very rare tumor that may present without symptoms. The clinical course of cystic pheochromocytoma is similar to that of solid pheochromocytoma. Early surgical intervention is recommended, following blood pressure control with an alpha-blocker, and adequate hydration.

Small Renal Masses in Close Proximity to the Collecting System and Renal Sinus Are Enriched for Malignancy and High Fuhrman Grade and Should Be Considered for Early Intervention.

PubMed

Correa, Andres F; Toussi, Amir; Amin, Milon; Hrebinko, Ronald L; Gayed, Bishoy A; Parwani, Anil V; Maranchie, Jodi K

2018-02-05

Recent reports show a correlation between renal tumor radiographic characteristics and pathologic features. We hypothesize that a more central location within the relatively hypoxic renal medulla might confer a more aggressive tumor phenotype. To test this, radiographic tumor characteristics were compared with tumor grade and histology. We retrospectively reviewed renal masses <4 cm in diameter that underwent resection between 2008 and 2013. Tumor location was recorded using standard R.E.N.A.L. Nephrometry Score. Multivariate logistic regression was performed to compare independent anatomic features with incidence of malignancy and high nuclear grade. A total of 334 renal tumors had information available for analysis. Univariate analysis showed that increasing endophycity and proximity to the collecting system (<4 mm) were predictors of malignancy and high-grade features. In multivariate analysis, proximity to the collecting system <4 mm remained the as the only anatomical variable predictive of malignancy (odds ratio [OR], 3.58; 95% confidence interval [CI], 1.06-12.05; P = .04) and high nuclear grade (OR, 2.81; 95% CI, 1.44-5.51; P = .003). Malignancy and high tumor grade occur with much greater frequency when tumors are located deep in the kidney, in close proximity to the collecting system and renal sinus. Ninety-six percent of small renal masses in this region were cancers and nearly half were Fuhrman Grade 3 or 4, suggesting that these small centrally located tumors should be targeted for early intervention. Copyright © 2018 Elsevier Inc. All rights reserved.

Polymorphous low grade adenocarcinoma has a consistent p63+/p40- immunophenotype that helps distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma.

PubMed

Rooper, Lisa; Sharma, Rajni; Bishop, Justin A

2015-03-01

Polymorphous low grade adenocarcinoma (PLGA) is a tumor of minor salivary glands that exhibits considerable morphologic overlap with adenoid cystic carcinoma and cellular pleomorphic adenoma, especially in small biopsy specimens. Unlike these other tumor types. PLGAs do not harbor a myoepithelial component, yet their frequent positivity for p63 diminishes the usefulness of this particular myoepithelial marker as a discriminating immunostain. p40 is an antibody that recognizes ΔNp63, a p63 isoform that is more specific for true myoepithelial differentiation. As such, p40 immunostaining could help distinguish PLGAs from adenoid cystic carcinomas and pleomorphic adenomas. In this study, p63 and p40 immunohistochemistry was performed on paraffin embedded, formalin fixed tissue from 11 PLGAs, 101 adenoid cystic carcinomas, and 31 pleomorphic adenomas. All 11 PLGAs (100 %) were positive for p63 but completely negative for p40. Among adenoid cystic carcinomas, 91 of 101 (90 %) were positive for p63 and 90/101 (89 %) were positive for p40. The single discordant p63+/p40- adenoid cystic carcinoma exhibited solid architecture and high grade features not typically seen in PLGA. Among pleomorphic adenomas, 21/31 (68 %) were positive for p63 and 13/31 (42 %) were positive for p40. For the pleomorphic adenomas, the discordant p63+/p40- staining pattern was seen only in the overtly mesenchymal chondromyxoid stroma. The cellular epithelial component of the pleomorphic adenomas demonstrated concordant p63+/p40+ or p63-/p40- immunophenotypes. PLGA consistently exhibits a p63+/p40- immunophenotype that can help distinguish it from adenoid cystic carcinoma and cellular pleomorphic adenoma, tumors that characteristically demonstrate concordant p63 and p40 immunostaining patterns. A p63/p40 immunohistochemical panel can provide a valuable tool for making the distinction between these morphologically similar but clinically divergent entities.

Renal cell tumors with clear cell histology and intact VHL and chromosome 3p: a histological review of tumors from the Cancer Genome Atlas database.

PubMed

Favazza, Laura; Chitale, Dhananjay A; Barod, Ravi; Rogers, Craig G; Kalyana-Sundaram, Shanker; Palanisamy, Nallasivam; Gupta, Nilesh S; Williamson, Sean R

2017-11-01

Clear cell renal cell carcinoma is by far the most common form of kidney cancer; however, a number of histologically similar tumors are now recognized and considered distinct entities. The Cancer Genome Atlas published data set was queried (http://cbioportal.org) for clear cell renal cell carcinoma tumors lacking VHL gene mutation and chromosome 3p loss, for which whole-slide images were reviewed. Of the 418 tumors in the published Cancer Genome Atlas clear cell renal cell carcinoma database, 387 had VHL mutation, copy number loss for chromosome 3p, or both (93%). Of the remaining, 27/31 had whole-slide images for review. One had 3p loss based on karyotype but not sequencing, and three demonstrated VHL promoter hypermethylation. Nine could be reclassified as distinct or emerging entities: translocation renal cell carcinoma (n=3), TCEB1 mutant renal cell carcinoma (n=3), papillary renal cell carcinoma (n=2), and clear cell papillary renal cell carcinoma (n=1). Of the remaining, 6 had other clear cell renal cell carcinoma-associated gene alterations (PBRM1, SMARCA4, BAP1, SETD2), leaving 11 specimens, including 2 high-grade or sarcomatoid renal cell carcinomas and 2 with prominent fibromuscular stroma (not TCEB1 mutant). One of the remaining tumors exhibited gain of chromosome 7 but lacked histological features of papillary renal cell carcinoma. Two tumors previously reported to harbor TFE3 gene fusions also exhibited VHL mutation, chromosome 3p loss, and morphology indistinguishable from clear cell renal cell carcinoma, the significance of which is uncertain. In summary, almost all clear cell renal cell carcinomas harbor VHL mutation, 3p copy number loss, or both. Of tumors with clear cell histology that lack these alterations, a subset can now be reclassified as other entities. Further study will determine whether additional entities exist, based on distinct genetic pathways that may have implications for treatment.

3D-printing aided resection of intratracheal adenoid cystic carcinoma and mediastinal mature cystic teratoma in a 26-year-old female: a case report.

PubMed

Lu, Di; Feng, Siyang; Liu, Xiguang; Dong, Xiaoying; Li, Mei; Wu, Hua; Ren, Pengfei; Diao, Dingwei; Cai, Kaican

2018-02-01

Complete resection remains the ideal treatment for most patients with primary intratracheal tumors. Due to the limit in the resection length, the localization of the tumor during the surgery could be rather difficult if it hasn't invaded out of the trachea, which might be more difficult when there's another tumor in the anterior mediastinum. A 26-year-old woman with intratracheal adenoid cystic carcinoma (ACC) presented with dyspnea. CT scan revealed not only an ACC without extension out of trachea, but also a mediastinal teratoma (MT) near aorta, making the operation much more complicated than usual. To solve this problem, 3D-printing was applied for facilitating surgery plan making and intraoperative locating of ACC. And as we expected, the operation went successfully and the patient achieved full recovery without complications. To the best of our knowledge, the case of both intratracheal ACC and MT in one patient has not been previously reported.

Giant hydronephrosis mimicking progressive malignancy

PubMed Central

Schrader, Andres Jan; Anderer, Georgia; von Knobloch, Rolf; Heidenreich, Axel; Hofmann, Rainer

2003-01-01

Background Cases of giant hydronephroses are rare and usually contain no more than 1–2 litres of fluid in the collecting system. We report a remarkable case of giant hydronephrosis mimicking a progressive malignant abdominal tumour. Case presentation A 78-year-old cachectic woman presented with an enormous abdominal tumour, which, according to the patient, had slowly increased in diameter. Medical history was unremarkable except for a hysterectomy >30 years before. A CT scan revealed a giant cystic tumour filling almost the entire abdominal cavity. It was analysed by two independent radiologists who suspected a tumour originating from the right kidney and additionally a cystic ovarian neoplasm. Subsequently, a diagnostic and therapeutic laparotomy was performed: the tumour presented as a cystic, 35 × 30 × 25 cm expansive structure adhesive to adjacent organs without definite signs of invasive growth. The right renal hilar vessels could finally be identified at its basis. After extirpation another tumourous structure emerged in the pelvis originating from the genital organs and was also resected. The histopathological examination revealed a >15 kg hydronephrotic right kidney, lacking hardly any residual renal cortex parenchyma. The second specimen was identified as an ovary with regressive changes and a large partially calcified cyst. There was no evidence of malignant growth. Conclusion Although both clinical symptoms and the enormous size of the tumour indicated malignant growth, it turned out to be a giant hydronephrosis. Presumably, a chronic obstruction of the distal ureter had caused this extraordinary hydronephrosis. As demonstrated in our case, an accurate diagnosis of giant hydronephrosis remains challenging due to the atrophy of the renal parenchyma associated with chronic obstruction. Therefore, any abdominal cystic mass even in the absence of other evident pathologies should include the differential diagnosis of a possible hydronephrosis. Diagnostic accuracy might be increased by a combination of endourological techniques such as retrograde pyelography and modern imaging modalities. PMID:14565853

Extrahepatic Blood Supply to Hepatocellular Carcinoma: Angiographic Demonstration and Transcatheter Arterial Chemoembolization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miyayama, Shiro; Matsui, Osamu; Taki, Keiichi

2006-02-15

Purpose. To evaluate the incidence of each extrahepatic collateral pathway to hepatocellular carcinoma (HCC) and to assess technical success rates and complications of transcatheter arterial chemoembolization (TACE) through each collateral. Methods. We retrospective evaluated extrahepatic collateral pathways to HCC on angiography in 386 procedures on 181 consecutive patients. One hundred and seventy patients had previously undergone TACE. TACE through extrahepatic collaterals using iodized oil and gelatin sponge particles was performed when a catheter was advanced into the tumor-feeding branch to avoid nontarget embolization. Results. A single collateral was revealed in 275 TACE procedures, two were revealed in 74, and threemore » or more were revealed in 34. Incidences of collateral source to HCC were 83% from the right inferior phrenic artery (IPA), 24% from the cystic artery, 13% from the omental artery, 12% from the right renal capsular artery (RCA) and left IPA, 8% from the right internal mammary artery (IMA) and right intercostal artery (ICA), and 7% from the right inferior adrenal artery (IAA). Technical success rates of TACE were 53% in the right ICA, 70% in the cystic artery, 74% in the omental artery, 93% in the left IPA, 96% in the right IPA, and 100% in the right RCA, right IMA, and right IAA. Complications included skin necrosis after TACE through the right IMA (n = 1), cholecystitis after TACE through the cystic artery (n = 1), and ulcer formation after TACE through the right gastric artery (n = 1), in addition to pleural effusion and basal atelectasis after TACE through the IPA and IMA. Conclusion. Our study suggests that TACE through extrahepatic collaterals is possible with high success rates, and is also relatively safe.« less

Mucinous Cystic Neoplasm of the Liver or Intraductal Papillary Mucinous Neoplasm of the Bile Duct? A Case Report and a Review of Literature.

PubMed

Kunovsky, Lumir; Kala, Zdenek; Svaton, Roman; Moravcik, Petr; Mazanec, Jan; Husty, Jakub; Prochazka, Vladimir

2018-01-01

Mucinous cystic neoplasm of the liver (MCN-L) and intraductal papillary mucinous neoplasm of the bile duct (IPMN-B) are diagnoses that were classified by the World Health Organization in 2010 as mucin-producing bile duct tumors of the hepatobiliary system. The preoperative differential diagnosis between these two entities is difficult; the presence of a communication with the bile duct is usually considered as a typical sign of IPMN-B. However, the presence of an ovarian-like stroma (OLS) has been established to define the diagnosis of MCN-L. We present the case of a 33-year-old woman with a rapid progression of a cystic tumor of the liver. In 2 years, the lesion increased from 27 to 64 mm and a dilation of the left hepatic duct appeared. Percutaneous transhepatic drainage with a biopsy was performed. No malignant cells were found on biopsy. Because of the rapid progression of the cystic tumor and unclear malignant potential, left hemihepatectomy was performed. Even though tumor masses were present in the biliary duct, on the basis of the presence of OLS, histology finally confirmed MCN-L with intermediate-grade intraepithelial dysplasia to high-grade intraepithelial dysplasia. The patient is currently under oncologic follow-up with no signs of recurrence of the disease. We present a rare case where MCN-L caused a dilation of the left hepatic duct, a sign that is usually a characteristic of IPMN-B.

Desmoplastic fibroma of the rib with cystic change: a case report and literature review.

PubMed

Okubo, Taketo; Saito, Tsuyoshi; Takagi, Tatsuya; Suehara, Yoshiyuki; Kaneko, Kazuo

2014-05-01

Desmoplastic fibroma (DF) is a rare, locally aggressive, solitary tumor microscopically composed of well-differentiated myofibroblasts with abundant dense collagen deposition. The most common sites are the long tubular bones and mandible. To our knowledge, only five cases of DF in the ribs have been reported. Here, we report a case of DF in this rare location with unusual radiological findings. A 40-year-old man presented with a 4-year history of swelling of the right chest wall. Radiographs revealed a mass at the right 9th rib, and computed tomography demonstrated a mass of 14 × 12 × 8 cm at the right 9th rib with expanded cystic change and marked calcification that appeared to have arisen from the bone. Open biopsy suggested DF. Total excision was performed, and the chest wall was reconstructed. The surgical specimen was a yellowish tumor with multilocular cystic change containing a viscous liquid. The tumor was composed of a proliferation of less-atypical spindle-shaped cells in a collagenous background. The cystic change was observed in the extra-osseous lesion. No β-catenin cytoplasmic/nuclear accumulation was detected, and no β-catenin or GNAS genetic mutations were detected. A final diagnosis of DF was made on the basis of the pathological and radiological findings. The patient was successfully treated with total excision of the tumor with no evidence of recurrence 6 months after surgery.

Cystic lesions of the salivary glands: cytologic features in fine-needle aspiration biopsies.

PubMed

Layfield, Lester J; Gopez, Evelyn V

2002-10-01

A variety of neoplastic and nonneoplastic lesions of the salivary glands have a predominantly cystic architecture. Fine-needle aspirates of these lesions yield watery or mucoid material, frequently of low cellularity. Such aspirates may be obtained from mucus retention cysts, lymphoepithelial cysts, cystadenomas, Warthin's tumors, cystic pleomorphic adenomas, low-grade mucoepidermoid carcinomas, cystadenocarcinomas, and examples of polycystic disease of the parotid gland. The cellular component within the fluid obtained from these lesions may be exceedingly scant or absent, making cytologic diagnosis difficult and, at times, impossible. We studied a series of 56 cystic lesions of the salivary glands, including 38 Warthin's tumors, 6 benign cysts, 2 lymphoepithelial cysts, 5 low-grade mucoepidermoid carcinomas, 1 cystic pleomorphic adenoma, 2 cystadenomas, and 2 cystadenocarcinomas. Careful attention to the cellular elements present often allowed definitive cytologic diagnosis, with an overall accuracy rate of 84%. The presence of atypical squamous metaplasia in oncocytic lesions was a significant cause of false-positive diagnoses of carcinoma (4 cases, 7%). Aspirates of low-grade mucoepidermoid carcinoma may contain no epithelial cells and result in false-negative diagnoses (1 case, 2%). Copyright 2002 Wiley-Liss, Inc.

Renal Cell Carcinoma: Comparison of RENAL Nephrometry and PADUA Scores with Maximum Tumor Diameter for Prediction of Local Recurrence after Thermal Ablation.

PubMed

Maxwell, Aaron W P; Baird, Grayson L; Iannuccilli, Jason D; Mayo-Smith, William W; Dupuy, Damian E

2017-05-01

Purpose To evaluate the performance of the radius, exophytic or endophytic, nearness to collecting system or sinus, anterior or posterior, and location relative to polar lines (RENAL) nephrometry and preoperative aspects and dimensions used for anatomic classification (PADUA) scoring systems and other tumor biometrics for prediction of local tumor recurrence in patients with renal cell carcinoma after thermal ablation. Materials and Methods This HIPAA-compliant study was performed with a waiver of informed consent after institutional review board approval was obtained. A retrospective evaluation of 207 consecutive patients (131 men, 76 women; mean age, 71.9 years ± 10.9) with 217 biopsy-proven renal cell carcinoma tumors treated with thermal ablation was conducted. Serial postablation computed tomography (CT) or magnetic resonance (MR) imaging was used to evaluate for local tumor recurrence. For each tumor, RENAL nephrometry and PADUA scores were calculated by using imaging-derived tumor morphologic data. Several additional tumor biometrics and combinations thereof were also measured, including maximum tumor diameter. The Harrell C index and hazard regression techniques were used to quantify associations with local tumor recurrence. Results The RENAL (hazard ratio, 1.43; P = .003) and PADUA (hazard ratio, 1.80; P < .0001) scores were found to be significantly associated with recurrence when regression techniques were used but demonstrated only poor to fair discrimination according to Harrell C index results (C, 0.68 and 0.75, respectively). Maximum tumor diameter showed the highest discriminatory strength of any individual variable evaluated (C, 0.81) and was also significantly predictive when regression techniques were used (hazard ratio, 2.98; P < .0001). For every 1-cm increase in diameter, the estimated rate of recurrence risk increased by 198%. Conclusion Maximum tumor diameter demonstrates superior performance relative to existing tumor scoring systems and other evaluated biometrics for prediction of local tumor recurrence after renal cell carcinoma ablation. © RSNA, 2016.

Aggressive Renal Angiomyolipoma in a Patient with Tuberous Sclerosis Resulting in Pulmonary Tumor Embolus and Pulmonary Infarction.

PubMed

Mettler, John; Al-Katib, Sayf

2018-06-07

Renal angiomyolipoma (AML) is the most commonly encountered mesenchymal tumor of the kidney which can present spontaneously or in association with tuberous sclerosis complex. Rarely, renal AMLs may demonstrate aggressive features such as renal vein invasion. This common entity and its uncommon complications are diagnosed based on physical examination and computed tomography results. Here we report imaging findings of a renal AML with renal vein and inferior vena cava invasion resulting in pulmonary tumor embolus and pulmonary infarction. Copyright © 2018. Published by Elsevier Inc.

Giant mesenteric cystic lymphangioma presenting with abdominal pain and masquerading as a gynecologic malignancy

PubMed Central

Maa, John; Wa, Christianne; Jaigirdir, Adnan; Cho, Soo-Jin; Corvera, Carlos U

2009-01-01

Lymphangiomas are congenital malformations of the lymphatic system that account for about 5% of all benign tumors in infants and children.1 The most common sites are the neck and axilla, which account for 95% of cases.2 Abdominal cystic lymphangiomas are quite rare, and can arise from either the retroperitoneum, gastrointestinal tract, or the mesentery of the abdominal viscera.3 The presenting symptoms are painless abdominal distension, a palpable mass, or secondary complications in the abdomen such as intestinal obstruction, volvulus, intestinal infarction, or bleeding.4 Typically diagnosed during childhood, these tumors prompt surgical intervention. We describe an atypical case of an abdominal cystic lymphangioma, which did not manifest until adulthood, with atypical symptoms of a rapidly expanding and symptomatic mass. PMID:21139927

Ewing’s Sarcoma Family Tumors in the Jaws: Case Report, Immunohistochemical Analysis and Literature Review

PubMed Central

CASAROTO, ANA REGINA; SAMPIERI, MARCELO BONIFACIO DA SILVA; SOARES, CLEVERSON TEIXEIRA; SANTOS, PAULO SERGIO DA SILVA; YAEDU, RENATO YASSUTAKA FARIA; DAMANTE, JOSÉ HUMBERTO; LARA, VANESSA SOARES

2017-01-01

Due to the low incidence of the Ewing’s Sarcoma (ES) family tumors, the available epidemiology is likely to be unreliable, and at present, there are no standard diagnostic or clinical guidelines outlining their management. This report describes a case of peripheral primitive neuroectodermal tumor (ES/pPNET) which initially mimicked cystic lesions, and describes a comparison between ES and ES/pPNET in the jaws by the World Health Organization classification. This review addressed 63 cases published in the English literature between 1950 and 2016. The majority of cases were ES. Both ES and ES/pPNET mimicked other benign entities such as traumatic, cystic and inflammatory lesions. The patients who died of their disease had a history of metastatic tumors, and primary tumor located in the mandible and maxilla for ES and ES/pPNET, respectively. The differentiation of the ES family tumors from other small blue-cell tumors may be difficult and requires familiarity with histological and immunohistochemical features. PMID:28438883

Clinical application of calculated split renal volume using computed tomography-based renal volumetry after partial nephrectomy: Correlation with technetium-99m dimercaptosuccinic acid renal scan data.

PubMed

Lee, Chan Ho; Park, Young Joo; Ku, Ja Yoon; Ha, Hong Koo

2017-06-01

To evaluate the clinical application of computed tomography-based measurement of renal cortical volume and split renal volume as a single tool to assess the anatomy and renal function in patients with renal tumors before and after partial nephrectomy, and to compare the findings with technetium-99m dimercaptosuccinic acid renal scan. The data of 51 patients with a unilateral renal tumor managed by partial nephrectomy were retrospectively analyzed. The renal cortical volume of tumor-bearing and contralateral kidneys was measured using ImageJ software. Split estimated glomerular filtration rate and split renal volume calculated using this renal cortical volume were compared with the split renal function measured with technetium-99m dimercaptosuccinic acid renal scan. A strong correlation between split renal function and split renal volume of the tumor-bearing kidney was observed before and after surgery (r = 0.89, P < 0.001 and r = 0.94, P < 0.001). The preoperative and postoperative split estimated glomerular filtration rate of the operated kidney showed a moderate correlation with split renal function (r = 0.39, P = 0.004 and r = 0.49, P < 0.001). The correlation between reductions in split renal function and split renal volume of the operated kidney (r = 0.87, P < 0.001) was stronger than that between split renal function and percent reduction in split estimated glomerular filtration rate (r = 0.64, P < 0.001). The split renal volume calculated using computed tomography-based renal volumetry had a strong correlation with the split renal function measured using technetium-99m dimercaptosuccinic acid renal scan. Computed tomography-based split renal volume measurement before and after partial nephrectomy can be used as a single modality for anatomical and functional assessment of the tumor-bearing kidney. © 2017 The Japanese Urological Association.

Laparoscopic partial nephrectomy for renal tumor: Nagoya experience.

PubMed

Yoshikawa, Yoko; Ono, Yoshinari; Hattori, Ryohei; Gotoh, Momokazu; Yoshino, Yasushi; Katsuno, Satoshi; Katoh, Masashi; Ohshima, Shinichi

2004-08-01

To clarify the indication for a vascular clamp during laparoscopic partial nephrectomy, the clinical results of 17 patients who underwent the procedure for small renal tumors were reviewed. Seventeen patients with renal tumors were enrolled in our laparoscopic partial nephrectomy program between October 1999 and November 2003. During laparoscopy, a vascular clamp was used to remove the tumor mass and suture the incised renal parenchyma and urinary collecting system in 8 patients who had less-than-1-cm-thick renal parenchyma between the mass and the renal sinus or calices. In the remaining 9 patients, who had 1-cm-or-more-thick renal parenchyma between the mass and sinus or calices, renal bleeding was controlled using ultrasonic scissors, gauze tampon, argon beam coagulator, and fibrin glue. Sixteen patients were successfully treated with laparoscopy; one required conversion to open surgery because of uncontrollable bleeding. The average operative time was 4.5 hours, and average estimated bleeding volume was 301 mL. In the 8 patients requiring vascular clamping by forceps, the average ischemic time was 25 minutes. In all patients, the tumor mass was completely removed with negative surgical margins, and renal function was preserved. Three patients had prolonged urinary leakage for a mean of 21 days. Laparoscopic partial nephrectomy offers many advantages, including surgery that is both nephron sparing and minimally invasive. A vascular clamp was indicated for patients with less-than-1-cm-thick renal parenchyma between the tumor mass and renal sinus or calices.

Dynamic Contrast-Enhanced CT Characterization of Xp11.2 Translocation/TFE3 Gene Fusions versus Papillary Renal Cell Carcinomas.

PubMed

He, Jian; Zhou, Kefeng; Zhu, Bin; Zhang, Gutian; Li, Xiaogong; Guo, Hongqian; Gan, Weidong; Zhou, Zhengyang; Liu, Tian

2015-01-01

To compare the differences of CT characteristics between renal cell carcinomas (RCCs) associated with Xp11.2 translocation/TFE3 gene fusions (Xp11.2 RCCs) and papillary cell renal cell carcinomas (PRCCs). CT images and clinical records of 64 patients (25 Xp11.2 RCCs, 15 type 1 and 24 type 2 PRCCs) were analyzed and compared retrospectively. Xp11.2 RCC more frequently affected young (30.7 ± 8.7 years) women (16/25, 64%) with gross hematuria (12/25, 48%), while PRCC more frequently involved middle-aged (54.8 ± 11.1 years) men (28/39, 71.8%) asymptomatically. Xp11.2 RCC tended to be heterogeneous density with some showing circular calcification. Lesion sizes of Xp11.2 RCC (5.4 ± 2.2 cm) and type 2 PRCC (5.7 ± 2.5 cm) were significantly larger than that of type 1 PRCC (3.8 ± 1.8 cm). Xp11.2 RCC contained more cystic components (22/25, 88%) than type 1 PRCC (all solid) and type 2 PRCC (9/24, 36.0%). Type 1 PRCC (13/15, 86.7%) and Xp11.2 RCC (21/25, 84.0%) showed more clear boundary than type 2 PRCC (12/24, 50.0%). CT features including diameter, boundary, attenuation, nature, and circular calcification of the tumor, combined with demographic information and symptoms, may be useful to differentiate Xp11.2 RCC from different subtypes of PRCC.

Laparoscopic radical nephrectomy for a right renal tumor with renal vein tumor thrombus in a patient with situs inversus totalis.

PubMed

Ito, Jun; Kaiho, Yasuhiro; Iwamura, Hiromichi; Anan, Go; Sato, Makoto

2018-05-23

Situs inversus totalis (SIT) is a rare congenital anomaly characterized by complete inversion of the thoracic and abdominal organs. Many intra-abdominal and vessel anomalies have been reported in association with SIT. However, there have been no reports on the use of laparoscopic radical nephrectomy with thrombectomy for renal vein thrombus, which is considered as a safe and feasible procedure, in patients with SIT. We herein present the case of an 80-year-old man with SIT who was preoperatively diagnosed with a right renal tumor and renal vein tumor thrombus. The patient underwent laparoscopic right nephrectomy and tumor thrombectomy with no intraoperative complications. To ensure a safe procedure, the anatomy and vessels were carefully evaluated preoperatively using 3-D multiplanar reconstructed CT imaging. Assessing anatomical structures leads to safer laparoscopic radical nephrectomy for renal cell carcinoma with venous tumor thrombus in patients with SIT. © 2018 Japan Society for Endoscopic Surgery, Asia Endosurgery Task Force and John Wiley & Sons Australia, Ltd.

CT-Guided Microwave Ablation of 45 Renal Tumors: Analysis of Procedure Complexity Utilizing a Percutaneous Renal Ablation Complexity Scoring System.

PubMed

Mansilla, Alberto V; Bivins, Eugene E; Contreras, Francisco; Hernandez, Manuel A; Kohler, Nathan; Pepe, Julie W

2017-02-01

To develop a scoring system that stratifies complexity of percutaneous ablation of renal tumors. Analysis was performed of 36 consecutive patients (mean age, 64 y; range, 30-89 y) who underwent CT-guided microwave (MW) ablation of 45 renal tumors (mean tumor diameter, 2.4 cm; range, 1.2-4.0 cm). Technical success and effectiveness were determined based on intraprocedural and follow-up imaging studies. The RENAL score and the proposed percutaneous renal ablation complexity (P-RAC) score were calculated for each tumor. Technical success was 93.3% (n = 42). Biopsy of 38 of 45 renal tumors revealed 23 renal cell carcinomas. Median follow-up period was 9.7 months (range, 2.9-46.8 months). There were no tumor recurrences. One major complication, ureteropelvic junction stricture, occurred (2.6%). The P-RAC score was found to differ statistically from the RENAL score (t = 3.754, df = 44, P = .001). A positive correlation was found between the P-RAC score and number of antenna insertions (r = .378, n = 45, P = .011) and procedure duration (r = .328, n = 45, P = .028). No correlation was found between the RENAL score and number of MW antenna insertions (r = .110, n = 45, P = .472) or procedure duration (r = .263, n = 45, P = .081). Hydrodissection was significantly more common in the P-RAC high-complexity category than in low-complexity category (χ 2 = 12.073, df = 2, P = .002). The P-RAC score may be useful in stratifying percutaneous renal ablation complexity. Further studies with larger sample sizes are necessary to validate the P-RAC score and to determine if it can predict risk of complications. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

Clinical and Molecular Features of Renal and Pheochromocytoma/Paraganglioma Tumor Association Syndrome (RAPTAS): Case Series and Literature Review.

PubMed

Casey, Ruth T; Warren, Anne Y; Martin, Jose Ezequiel; Challis, Benjamin G; Rattenberry, Eleanor; Whitworth, James; Andrews, Katrina A; Roberts, Thomas; Clark, Graeme R; West, Hannah; Smith, Philip S; Docquier, France M; Rodger, Fay; Murray, Vicki; Simpson, Helen L; Wallis, Yvonne; Giger, Olivier; Tran, Maxine; Tomkins, Susan; Stewart, Grant D; Park, Soo-Mi; Woodward, Emma R; Maher, Eamonn R

2017-11-01

The co-occurrence of pheochromocytoma (PC) and renal tumors was linked to the inherited familial cancer syndrome von Hippel-Lindau (VHL) disease more than six decades ago. Subsequently, other shared genetic causes of predisposition to renal tumors and to PC, paraganglioma (PGL), or head and neck paraganglioma (HNPGL) have been described, but case series of non-VHL-related cases of renal tumor and pheochromocytoma/paraganglioma tumor association syndrome (RAPTAS) are rare. To determine the clinical and molecular features of non-VHL RAPTAS by literature review and characterization of a case series. A review of the literature was performed and a retrospective study of referrals for investigation of genetic causes of RAPTAS. Literature review revealed evidence of an association, in addition to VHL disease, between germline mutations in SDHB, SDHC, SDHD, TMEM127, and MAX genes and RAPTAS [defined here as the co-occurrence of tumors from both classes (PC/PGL/HNPGL and renal tumors) in the same individual or in first-degree relatives]. In both the literature review and our case series of 22 probands with non-VHL RAPTAS, SDHB mutations were the most frequent cause of non-VHL RAPTAS. A genetic cause was identified in 36.3% (8/22) of kindreds. Renal tumors and PC/PGL/HNPGL tumors share common molecular features and their co-occurrence in an individual or family should prompt genetic investigations. We report a case of MAX-associated renal cell carcinoma and confirm the role of TMEM127 mutations with renal cell carcinoma predisposition. Copyright © 2017 Endocrine Society

Early ultrasonographic evaluation of tumor thrombus level during sunitinib therapy for renal cell carcinoma.

PubMed

Sano, Futoshi; Fusayasu, Syusei; Otake, Shinji; Yamanaka, Hiroyuki; Tatenuma, Tomoyuki; Sakata, Ryoko; Makiyama, Kazuhide; Nakaigawa, Noboru; Yao, Masahiro; Kubota, Yoshinobu

2013-10-01

A 72-year-old man presenting with a 14-cm left renal mass, an inferior vena cava (IVC) tumor thrombus, and pulmonary metastases underwent renal mass biopsy that revealed clear cell renal cell carcinoma. Because of metastases and the extent of the tumor thrombus, sunitinib was administered, which resulted in a marked reduction in the tumor thrombus (from level III to level II after 11 weeks of treatment). Ultrasonography, preceding computed tomography, showed a slight shrinkage of the tumor thrombus level in the first 2 weeks. Therefore, ultrasound may be advantageous to monitor the IVC tumor thrombus level during the early phase of targeted therapy.

A reformed surgical treatment modality for children with giant cystic craniopharyngioma.

PubMed

Zhu, Wanchun; Li, Xiang; He, Jintao; Sun, Tao; Li, Chunde; Gong, Jian

2017-09-01

Surgical removal plays an important role in treating children's craniopharyngioma. For a safe and minimally invasive craniotomy, a reformed surgical modality was proposed in this paper by combining the insertion of an Ommaya reservoir system (ORS) by stereotactic puncture, aspiration of cystic fluid in 2-day interval for consecutive 7-10 days, and the delayed tumor resection. Eleven patients (aged from 5 to 9 years old) with giant cystic craniopharyngiomas who had undergone the reformed surgical modality during November 2014 and December 2015 were collected as group A. In contrast, seven patients (aged from 5 to 11 years old) who had undergone the traditional directed operation without any prior management from January 2014 to October 2014 were collected into group B. A retrospective analysis was performed for both groups at one institution. The preoperative and postoperative clinical presentations, neuroimaging, early postoperative outcome, and the surgery-related complications of both groups were reviewed. For group A, the mean value of the maximum tumor diameters shank from 52.36 to 23.82 mm after implementing aspiration of the cystic fluid in 1-day interval for consecutive 8.23 days. Eight patients (72.73%) in group A underwent a gross total resection (GTR), while two (28.57%) patients underwent GTR in group B. The postoperative electrolyte disturbance rate and endocrine disorder rate of group B were significantly higher than those of group A (42.86 vs 36.36%; 71.43 vs 45.45%). Postoperative long-term diabetes insipidus only occurred in one patient of group B, and postoperative visual deterioration occurred in two patients of group B. Besides, one patient of group B died of severe postoperative hypothalamus dysfunction. Patients with residual tumors were applied with additional adjuvant radiotherapy, and no recurrence was observed in follow-up examinations. A favorable outcome can be achieved by combining the insertion of an ORS by stereotactic puncture, aspiration of cystic fluid in 2-day interval for continuously 7-10 days, and the delayed tumor resection. This combined treatment modality maybe an effective method to treat children with giant cystic craniopharyngiomas.

[Case report of rare co-occurrence of renal cell carcinoma and crossed renal dystopia (L-shaped kidney)].

PubMed

Bakov, V N; Los, M S

2017-10-01

L-shaped kidney refers to a rare anomaly of the relative kidney positioning. Due to low prevalence, the literature on the co-occurrence of this anomaly with malignancy is lacking. And, if the diagnosis of a renal anomaly does not present difficulties, if a tumor is detected in such a kidney, even MSCT does not always help differentiate a pelvic tumor from a tumor of the renal parenchyma spreading to the pelvicalyceal system. This has important implications for choosing an appropriate surgical strategy. A feature of the presented clinical observation is the co-occurrence of the rare anomaly of kidney position and locally advanced renal cell carcinoma spreading to the renal pelvis. Due to the massive spread of the tumor, an organ-sparing surgery was not feasible. Due to the suspicion of tumor spread to the renal pelvis, the patient underwent nephrureterectomy of the L-shaped kidney. Introduction to renoprival state with transfer to chronic hemodialysis became the only option to maintain homeostasis and extend the patients life. Histological examination revealed clear cell renal cell carcinoma with invasion of the pelvis and renal capsule, with no clear demarcation between the fused kidneys.

Clinical and molecular features of Joubert syndrome and related disorders

PubMed Central

Parisi, Melissa A.

2009-01-01

Joubert syndrome (JBTS; OMIM 213300) is a rare, autosomal recessive disorder characterized by a specific congenital malformation of the hindbrain and a broad spectrum of other phenotypic findings that is now known to be caused by defects in the structure and/or function of the primary cilium. The complex hindbrain malformation that is characteristic of JBTS can be identified on axial magnetic resonance imaging and is known as the molar tooth sign (MTS); other diagnostic criteria include intellectual disability, hypotonia, and often, abnormal respiratory pattern and/or abnormal eye movements. In addition, a broad spectrum of other anomalies characterize Joubert syndrome and related disorders (JSRD), and may include retinal dystrophy, ocular coloboma, oral frenulae and tongue tumors, polydactyly, cystic renal disease (including cystic dysplasia or juvenile nephronophthisis), and congenital hepatic fibrosis. The clinical course can be variable, but most children with this condition survive infancy to reach adulthood. At least 8 genes cause JSRD, with some genotype-phenotype correlations emerging, including the association between mutations in the MKS3 gene and hepatic fibrosis characteristic of the JSRD subtype known as COACH syndrome. Several of the causative genes for JSRD are implicated in other ciliary disorders, such as juvenile nephronophthisis and Meckel syndrome, illustrating the close association between these conditions and their overlapping clinical features that reflect a shared etiology involving the primary cilium. PMID:19876931

Microarray gene expression profiling using core biopsies of renal neoplasia.

PubMed

Rogers, Craig G; Ditlev, Jonathon A; Tan, Min-Han; Sugimura, Jun; Qian, Chao-Nan; Cooper, Jeff; Lane, Brian; Jewett, Michael A; Kahnoski, Richard J; Kort, Eric J; Teh, Bin T

2009-01-01

We investigate the feasibility of using microarray gene expression profiling technology to analyze core biopsies of renal tumors for classification of tumor histology. Core biopsies were obtained ex-vivo from 7 renal tumors-comprised of four histological subtypes-following radical nephrectomy using 18-gauge biopsy needles. RNA was isolated from these samples and, in the case of biopsy samples, amplified by in vitro transcription. Microarray analysis was then used to quantify the mRNA expression patterns in these samples relative to non-diseased renal tissue mRNA. Genes with significant variation across all non-biopsy tumor samples were identified, and the relationship between tumor and biopsy samples in terms of expression levels of these genes was then quantified in terms of Euclidean distance, and visualized by complete linkage clustering. Final pathologic assessment of kidney tumors demonstrated clear cell renal cell carcinoma (4), oncocytoma (1), angiomyolipoma (1) and adrenalcortical carcinoma (1). Five of the seven biopsy samples were most similar in terms of gene expression to the resected tumors from which they were derived in terms of Euclidean distance. All seven biopsies were assigned to the correct histological class by hierarchical clustering. We demonstrate the feasibility of gene expression profiling of core biopsies of renal tumors to classify tumor histology.

Pre-Clinical Evaluation of UAB30 in Pediatric Renal and Hepatic Malignancies

PubMed Central

Waters, Alicia M.; Stewart, Jerry E.; Atigadda, Venkatram R.; Mroczek-Musulman, Elizabeth; Muccio, Donald D.; Grubbs, Clinton J.; Beierle, Elizabeth A.

2016-01-01

Rare tumors of solid organs remain some of the most difficult pediatric cancers to cure. These difficult tumors include rare pediatric renal malignancies such as malignant rhabdoid kidney tumors (MRKT) and non-osseous renal Ewing sarcoma, and hepatoblastoma, a pediatric liver tumor that arises from immature liver cells. There are data in adult renal and hepatic malignancies demonstrating the efficacy of retinoid therapy. The investigation of retinoic acid therapy in cancer is not a new strategy, but the widespread adoption of this therapy has been hindered by toxicities. Our laboratory has been investigating a novel synthetic rexinoid, UAB30, which exhibits a more favorable side effect profile. In this current study, we hypothesized that UAB30 would diminish the growth of tumor cells from both rare renal and liver tumors in vitro and in vivo. We successfully demonstrated decreased cellular proliferation, invasion and migration, cell cycle arrest and increased apoptosis after treatment with UAB30. Additionally, in in vivo murine models of human hepatoblastoma or rare human renal tumors, there were significantly decreased tumor xenograft growth and increased animal survival after UAB30 treatment. UAB30 should further be investigated as a developing therapeutic in these rare and difficult to treat, pediatric solid organ tumors. PMID:26873726

Syndrome of fetal gigantism, renal hamartomas, and nephroblastomatosis with Wilms' tumor.

PubMed

Perlman, M; Levin, M; Wittels, B

1975-04-01

A new case of the fetal gigantism-renal hamartomas-nephroblastomatosis syndrome is described, in which a Wilms' tumor occurred. It is considered that this observation provides strong evidence for the interrelationship between renal dysplasia and renal neoplasia.

Pancreatic cystic neoplasms: Review of current knowledge, diagnostic challenges, and management options

PubMed Central

Jana, Tanima; Shroff, Jennifer; Bhutani, Manoop S.

2015-01-01

Pancreatic cystic lesions are being detected with increasing frequency, largely due to advances in cross-sectional imaging. The most common neoplasms include serous cystadenomas, mucinous cystic neoplasms, intraductal papillary mucinous neoplasms, solid pseudopapillary neoplasms, and cystic pancreatic endocrine neoplasms. Computed tomography (CT), magnetic resonance imaging (MRI), and endoscopic ultrasound (EUS) are currently used as imaging modalities. EUS-guided fine needle aspiration has proved to be a useful diagnostic tool, and enables an assessment of tumor markers, cytology, chemistries, and DNA analysis. Here, we review the current literature on pancreatic cystic neoplasms, including classification, diagnosis, treatment, and recommendations for surveillance. Data for this manuscript was acquired via searching the literature from inception to December 2014 on PubMed and Ovid MEDLINE. PMID:25821410

Stereotactic Body Radiotherapy (SBRT) for Pulmonary Metastases in Ewing Sarcoma, Rhabdomyosarcoma, and Wilms Tumors

ClinicalTrials.gov

2018-01-31

Ewing Sarcoma; Rhabdomyosarcoma; Wilms Tumor; Osteosarcoma; Non-Rhabdomyosarcoma Soft Tissue Sarcoma, Nos; Renal Tumor; Rhabdoid Tumor; Clear Cell Renal Cell Carcinoma; Sarcoma; Sarcoma, Ewing; Soft Tissue Sarcoma

[A clinical study of associated bladder tumor in patients with renal pelvic and ureteral tumor].

PubMed

Sugano, O; Shouji, N; Horigome, T; Uchi, K; Katou, H

1995-08-01

We investigated the incidence of associated bladder tumor and prognosis in 101 cases with a pathological diagnosis of transitional cell carcinoma, selected from those with renal pelvic and ureteral tumor whom we had encountered over the 18 years between April 1976 and March 1993. Among these 101 cases, the incidence of associated bladder tumor was noted in 42 (41.6%), 23 (22.8%) with coexistence and 19 (18.8%) with subsequence. As for the primary site of renal pelvis and ureter, the coexistence was 15.4% and subsequence 20.5% in renal pelvis, and the coexistence was 24.6% and subsequence 19.3% in ureter, and the coexistence was 60.0% and subsequence 0.0% in both renal pelvis and ureter. The incidence of coexistent bladder tumor was high in both renal pelvis and ureter, but no significant difference was noted. As for the stage, the incidence of coexistence was high in T1, while subsequence was high in T2, but no significant difference was noted. As for the grade, the incidence of coexistence was high in G2, but no significant difference was noted. The 5 year survival rate was 58.2% in those without, 54.2% with coexistence, and 82.5% with subsequent bladder tumor, with a significant difference (p < 0.05) between the last two groups. The interval of subsequent bladder tumor ranged from 4 to 164 months (mean 27.7 months), with the incidence within 2 years being approximately 70.0%. It was found that the renal pelvic and ureteral tumors are frequently associated bladder tumor while associated bladder tumor dose not appear to have an ill effect on the prognosis. Therefore it is necessary that patients with renal pelvic and ureteral tumor be observed closely for 5 years, especially for the initial 2 years.

Microdissecting the Genetic Events in Nephrogenic Rests and Wilms’ Tumor Development

PubMed Central

Charles, Adrian K.; Brown, Keith W.; Berry, P. Jeremy

1998-01-01

Nephrogenic rests are precursor lesions associated with about 40% of Wilms’ tumors. This study identifies genetic steps occurring in the development of Wilms’ tumor. Thirty-four Wilms’ tumors with nephrogenic rests and/or areas of anaplasia were microdissected from paraffin sections to determine whether and at what stage loss of heterozygosity (LOH) occurred, using polymerase chain reaction-based polymorphic markers at 11p13, 11p15, and 16q. LOH at these loci have been identified in Wilms’ tumors and are associated with identified or putative tumor suppressor genes. Three cystic nephromas/cystic partially differentiated nephroblastomas were also examined. LOH was detected in six cases at 11p13 and in six cases at 11p15, and two of these cases had LOH at both loci. All intralobar rests showing LOH also showed LOH in the tumor. A case with a small perilobar rest showed LOH of 11p13 only in the tumor. Five cases showing LOH at 16q were identified (this was identified only in the tumor, and not in the associated rest), and three of these had recurrence of the tumor. Two cases had a WT1 mutation (one germline and the other somatic), as well as LOH in both the intralobar rest and the tumor. A cystic partially differentiated nephroblastoma showed loss at 11p13 and 11p15, as well as at 16q. This study suggests that LOH at 11p13 and 11p15 and WT1 mutations are early events but that LOH at 16q occurs late in the pathogenesis of Wilms’ tumor. Intralobar and perilobar nephrogenic rests are known to have different biological behaviors, and this study suggests that they are genetically different. A multistep model of Wilms’ tumor pathogenesis is supported by these findings. PMID:9736048

Caenorhabditis elegans as a model to study renal development and disease: sexy cilia.

PubMed

Barr, Maureen M

2005-02-01

The nematode Caenorhabditis elegans has no kidney per se, yet "the worm" has proved to be an excellent model to study renal-related issues, including tubulogenesis of the excretory canal, membrane transport and ion channel function, and human genetic diseases including autosomal dominant polycystic kidney disease (ADPKD). The goal of this review is to explain how C. elegans has provided insight into cilia development, cilia function, and human cystic kidney diseases.

Expression and function of CLC and cystic fibrosis transmembrane conductance regulator chloride channels in renal epithelial tubule cells: pathophysiological implications.

PubMed

Vandewalle, Alain

2007-01-01

Cl(-) channels play important roles in the regulation of a variety of functions, including electrical excitability, cell volume regulation, transepithelial transport and acidification of cellular organelles. They are expressed in plasma membranes or reside in intracellular organelles. A large number of Cl(-) channels with different functions have been identified. Some of them are highly expressed in the kidney. They include members of the CLC Cl(-) channel family: ClC-K1 (or ClC-Ka), ClC-K2 (or ClC-Kb) and ClC-5. The identification of mutations responsible for human inherited diseases (Bartter syndrome for ClC-Kb and Dent's disease for ClC-5) and studies on knockout mice models have evidenced the physiological importance of these CLC Cl(-) channels, permitting better understanding on their functions in renal tubule epithelial cells. The cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel, also expressed in renal tubule epithelial cells, is involved in the transepithelial transport of Cl(-) in the distal nephron. This short review focuses on intrarenal distribution, subcellular localization and function of the ClK(-1), ClC-K2 and ClC-5 Cl(-) channels in renal tubule epithelial cells, and the role of the CFTR Cl(-) channel in chloride fluxes elicited by vasopressin in the distal nephron.

Pediatric Renal Neoplasms.

PubMed

Ranganathan, Sarangarajan

2009-03-01

Renal tumors in childhood consist of a diverse group of tumors ranging from the most common Wilms' tumor, to the uncommon and often fatal rhabdoid tumor. Diagnosis is based on morphologic features and aided by ancillary techniques such as immunohistochemistry and cytogenetics. Molecular techniques have helped identify a group of pediatric renal cell carcinomas that have specific translocations, called translocation-associated carcinomas. Differential diagnosis of the various tumors is discussed. Pathogenesis and nephroblastomatosis, the precursor lesions of Wilms tumor, also are discussed briefly, as are the handling of these tumor specimens and prognostic factors. Copyright © 2009 Elsevier Inc. All rights reserved.

Prospective Evaluation of (99m)Tc-sestamibi SPECT/CT for the Diagnosis of Renal Oncocytomas and Hybrid Oncocytic/Chromophobe Tumors.

PubMed

Gorin, Michael A; Rowe, Steven P; Baras, Alexander S; Solnes, Lilja B; Ball, Mark W; Pierorazio, Phillip M; Pavlovich, Christian P; Epstein, Jonathan I; Javadi, Mehrbod S; Allaf, Mohamad E

2016-03-01

Nuclear imaging offers a potential noninvasive means of determining the histology of renal tumors. The aim of this study was to evaluate the accuracy of technetium-99m ((99m)Tc)-sestamibi single-photon emission computed tomography/x-ray computed tomography (SPECT/CT) for the differentiation of oncocytomas and hybrid oncocytic/chromophobe tumors (HOCTs) from other renal tumor histologies. In total, 50 patients with a solid clinical T1 renal mass were imaged with (99m)Tc-sestamibi SPECT/CT prior to surgical resection. Preoperative SPECT/CT scans were reviewed by two blinded readers, and their results were compared with centrally reviewed surgical pathology data. Following surgery, 6 (12%) tumors were classified as renal oncocytomas and 2 (4%) as HOCTs. With the exception of 1 (2%) angiomyolipoma, all other tumors were renal cell carcinomas (82%). (99m)Tc-sestamibi SPECT/CT correctly identified 5 of 6 (83.3%) oncocytomas and 2 of 2 (100%) HOCTs, resulting in an overall sensitivity of 87.5% (95% confidence interval [CI], 47.4-99.7%). Only two tumors were falsely positive on SPECT/CT, resulting in a specificity of 95.2% (95% CI, 83.8-99.4%). In summary, (99m)Tc-sestamibi SPECT/CT is a promising imaging test for the noninvasive diagnosis of renal oncocytomas and HOCTs. We found that the imaging test (99m)Tc-sestamibi SPECT/CT can be used to accurately diagnose two types of benign kidney tumors. This test may be eventually used to help better evaluate patients diagnosed with a renal tumor. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Renal cell -like carcinoma of the nasal cavity: a case report and review of the literature.

PubMed

Zhenwei-Chen; Zhaoming-Wang; Hongqi-Shi; Qinwei-Liu

2017-10-17

Sinonasal renal cell-like carcinoma (SRCLC) is an extremely rare low malignant tumor arising in the sinonasal tract, with histological mimicry of renal cell carcinoma. We present a case of sinonasal renal cell-like carcinoma in a 63-year-old male patient. Computer tomography(CT) scanning revealed a soft tissue mass at the left nasal cavity and choana. Histologically, the predominant tumor architecture was follicular to glandular with intervening fibrous septa. The tumor cells were uniform cuboidal to polyhedral with abundant clear or eosinophilic cytoplasm. Immunohistochemically, the tumor cells were strongly positive for CK7, EMA, vimentin, SOX10, S-100, and focally positive for CA9. During 6 months of follow-up, there was no clinical or radiological evidence of recurrence or metastasis. SRCLC has microscopic features which overlap with tumors that contain clear cells. Thus, several other tumors must be considered in the differential diagnosis of a tumor of the sinonasal region with clear cells, especially metastatic renal clear cell carcinoma. SRCLC is an indolent tumor and none of the reported SRCLC patients had metastatic disease.

Cystic pancreatic tumors (CPT): predictors of malignant behavior.

PubMed

Javle, Milind; Shah, Pankaj; Yu, Jihnhee; Bhagat, Vishal; Litwin, Alan; Iyer, Renuka; Gibbs, John

2007-03-01

Due to widespread use of imaging studies, increasing cystic pancreatic tumor (CPT) cases are being detected. The diagnosis of malignancy in CPT cases requires pancreatectomy. Clinical and laboratory characteristics of CPT may predict underlying malignancy. CPT cases treated between 1994 and 2004 at our institution were included. Pseudocysts were excluded. Serous cystadenoma (SCA), mucinous cystadenoma (MCA), intrapapillary mucinous tumor, cystic endocrine tumor, and lymphoepithelial cysts were classified as benign or pre-malignant. Serous cystadenocarcinoma (SCACA), mucinous cystadenocarcinoma (MCACA), and adenocarcinoma (ACA) were classified as malignant. Thirty-five patients had histological confirmation. Median age was 65 years. Male/female ratio was higher in malignant group (P = 0.0284). Weight loss and abdominal mass were more prevalent in malignant group (P = 0.042 and 0.028, respectively). Malignant lesions were larger, associated with local invasion (superior mesenteric artery (SMA), superior mesenteric vein (SMV), portal vein (PV) complex or celiac encasement) and CA 19-9 elevation. On univariate analyses, local invasion (P = 0.0029), negative surgical intervention (P = 0.0010), presence of ACA (P = 0.0044), or malignant CPT (P = 0.0018) were associated with shorter survival. On a multivariate analysis, local invasion was associated with shorter survival [Hazard ratio (HR) = 4.322, P = 0.0218], while surgical intervention was associated with improved survival (HR = 0.179, P = 0.0124). Male sex, abdominal mass, weight loss, larger tumor size, local invasion, and elevated CA 19-9 were associated with malignant CPT.

Primary Renal Rhabdomyosarcoma in an Adolescent With Tumor Thrombosis in the Inferior Vena Cava and Right Atrium: A Case Report and Review of the Literature.

PubMed

Lin, Wei-Ching; Chen, Jeon-Hor; Westphalen, Antonio; Chang, Han; Chiang, I-Ping; Chen, Cheng-Hong; Wu, Hsi-Chin; Lin, Chien-Heng

2016-05-01

Although the second peak of the age distribution of rhabdomyosarcoma (RMS) is at adolescence, renal RMS is extremely rare at this age group. This tumor is indistinguishable from other renal tumors based on clinical and imaging findings, and the diagnosis relies on histology and immunohistochemical staining. We report a unique case of adolescent renal RMS associated with tumor thrombus extending into the inferior vena cava (IVC) and right atrium.An 18-year-old female adolescent presented with shortness of breath and palpitations, associated with right flank discomfort, and hematuria. A pleomorphic-type renal RMS with Budd-Chiari syndrome and arrhythmia induced by IVC and RA thrombosis was diagnosed. Despite complete tumor resection, the patient developed multiple lung metastases a month after surgery. Chemotherapy was recommended, but the patient declined. She died within a year of the initial operation.Adolescent renal RMS is rare and associated with poor outcome. Early aggressive multimodal therapy seems to be appropriate, in particular, in the presence of tumor thrombosis.

Microarray gene expression profiling using core biopsies of renal neoplasia

PubMed Central

Rogers, Craig G.; Ditlev, Jonathon A.; Tan, Min-Han; Sugimura, Jun; Qian, Chao-Nan; Cooper, Jeff; Lane, Brian; Jewett, Michael A.; Kahnoski, Richard J.; Kort, Eric J.; Teh, Bin T.

2009-01-01

We investigate the feasibility of using microarray gene expression profiling technology to analyze core biopsies of renal tumors for classification of tumor histology. Core biopsies were obtained ex-vivo from 7 renal tumors—comprised of four histological subtypes—following radical nephrectomy using 18-gauge biopsy needles. RNA was isolated from these samples and, in the case of biopsy samples, amplified by in vitro transcription. Microarray analysis was then used to quantify the mRNA expression patterns in these samples relative to non-diseased renal tissue mRNA. Genes with significant variation across all non-biopsy tumor samples were identified, and the relationship between tumor and biopsy samples in terms of expression levels of these genes was then quantified in terms of Euclidean distance, and visualized by complete linkage clustering. Final pathologic assessment of kidney tumors demonstrated clear cell renal cell carcinoma (4), oncocytoma (1), angiomyolipoma (1) and adrenalcortical carcinoma (1). Five of the seven biopsy samples were most similar in terms of gene expression to the resected tumors from which they were derived in terms of Euclidean distance. All seven biopsies were assigned to the correct histological class by hierarchical clustering. We demonstrate the feasibility of gene expression profiling of core biopsies of renal tumors to classify tumor histology. PMID:19966938

Gamma Knife Radiosurgery for the Treatment of Cystic Cerebral Metastases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebinu, Julius O.; Lwu, Shelly; Monsalves, Eric

Purpose: To assess the role of Gamma Knife radiosurgery (GKRS) in the treatment of nonsurgical cystic brain metastasis, and to determine predictors of response to GKRS. Methods: We reviewed a prospectively maintained database of brain metastases patients treated at our institution between 2006 and 2010. All lesions with a cystic component were identified, and volumetric analysis was done to measure percentage of cystic volume on day of treatment and consecutive follow-up MRI scans. Clinical, radiologic, and dosimetry parameters were reviewed to establish the overall response of cystic metastases to GKRS as well as identify potential predictive factors of response. Results:more » A total of 111 lesions in 73 patients were analyzed; 57% of lesions received prior whole-brain radiation therapy (WBRT). Lung carcinoma was the primary cancer in 51% of patients, 10% breast, 10% colorectal, 4% melanoma, and 26% other. Fifty-seven percent of the patients were recursive partitioning analysis class 1, the remainder class 2. Mean target volume was 3.3 mL (range, 0.1-23 mL). Median prescription dose was 21 Gy (range, 15-24 Gy). Local control rates were 91%, 63%, and 37% at 6, 12, and 18 months, respectively. Local control was improved in lung primary and worse in patients with prior WBRT (univariate). Only lung primary predicted local control in multivariate analysis, whereas age and tumor volume did not. Lesions with a large cystic component did not show a poorer response compared with those with a small cystic component. Conclusions: This study supports the use of GKRS in the management of nonsurgical cystic metastases, despite a traditionally perceived poorer response. Our local control rates are comparable to a matched cohort of noncystic brain metastases, and therefore the presence of a large cystic component should not deter the use of GKRS. Predictors of response included tumor subtype. Prior WBRT decreased effectiveness of SRS for local control rates.« less

Is near infrared fluorescence imaging using indocyanine green dye useful in robotic partial nephrectomy: a prospective comparative study of 94 patients.

PubMed

Krane, L Spencer; Manny, Theodore B; Hemal, Ashok K

2012-07-01

To compare a consecutive prospective cohort of patients who underwent robotic partial nephrectomy (RPN) with near infrared fluorescence (NIRF) imaging with indocyanine green dye (ICG) with a previous consecutive patient cohort. A total of 47 consecutive patients with renal masses suspicious for malignancy undergoing RPN were given 5-7.5 mg of ICG before hilar clamping or tumor excision. This cohort of patients was compared with 47 immediate previous consecutive patients who had undergone RPN without NIRF real-time imaging using ICG. The intraoperative, perioperative, and postoperative parameters were collected in an institutional review board-approved prospective database. The preoperative demographics and tumor complexity according to the nephrometry or preoperative aspects and dimensions used for an anatomic (PADUA) scores were similar. The mean warm ischemia time was significantly decreased in the ICG group (15 vs 17 minutes, P = .01). The median hospital stay was 2 days in both groups. No significant difference was seen in the positive margin rate (ICG, 6% vs control, 8.5%; P = .69) or observed Clavien grade III-IV complications in these 2 cohorts (ICG, 4% vs control, 15%; P = .07). No adverse events were associated with ICG dye administration. Differential ICG uptake was observed with selective clamping or in patients with cystic tumors, hypofluorescent tumors with exophytic components, and angiomyelolipomas, but these benefits could not be quantified. NIRF-ICG was transiently helpful to identify the vascular anatomy and not helpful at all for endophytic tumors. RPN using NIRF-ICG can be performed safely and effectively. A decreased warm ischemia time in the ICG cohort was observed without specific measured advantages. Differential ICG uptake by different tumors did not lead to significant differences in the positive margin rate. Copyright © 2012 Elsevier Inc. All rights reserved.

A Survey of Mesenchyme-related Tumors of the Rat Kidney in the National Toxicology Program Archives, with Particular Reference to Renal Mesenchymal Tumor.

PubMed

Hard, Gordon C; Seely, John Curtis; Betz, Laura J

2016-08-01

In order to harmonize diagnostic terminology, confirm diagnostic criteria, and describe aspects of tumor biology characteristic of different tumor types, a total of 165 cases of mesenchyme-related tumors and nephroblastomas of the rat kidney were reexamined from the National Toxicology Program (NTP) Archives. This survey demonstrated that renal mesenchymal tumor (RMT) was the most common spontaneous nonepithelial tumor in the rat kidney, also occurring more frequently in the NTP studies than nephroblastoma. Renal sarcoma was a distinct but very rare tumor entity, representing a malignant, monomorphous population of densely crowded, fibroblast-like cells, in which, unlike RMT, preexisting tubules did not persist. Nephroblastoma was characterized by early death of affected animals, suggesting an embryonal origin for this tumor type. Male and female rats were equally disposed to developing RMT, but most of the cases of nephroblastoma occurred in female rats and liposarcoma occurred mostly in male rats. This survey confirmed discrete histopathological and biological differences between the mesenchyme-related renal tumor types and between RMT and nephroblastoma. Statistical analysis also demonstrated a lack of any relationship of these renal tumor types to test article administration in the NTP data bank. © 2016 by The Author(s) 2016.

[Surgical management of minor salivary gland tumors].

PubMed

Zhou, Liang; Chen, Xiaoling; Huang, Weiting; Li, Kelan; Zhang, Xiaotong; Wang, Wei

2007-11-01

To study the clinical features of minor salivary gland tumors and to discuss the treatment modalities for these tumors. Retrospective analysis of 54 cases with minor salivary gland tumor operated in our hospital from 1997 to 2004. Among 54 cases with minor salivary gland tumors in this series, 16 patients lost of follow up. Among the remaining 38 patients, 2 patients with nasal cavity adenoid cystic carcinoma died of tumor recurrence 2 and 3 years after the surgery respectively, one patient with laryngeal myoepithelial carcinoma died of tumor recurrence 3 years after the surgery and one patient with paranasal sinus mucoepidermoid carcinoma died of recurrence 17 months after the surgery. Two patients with paranasal sinus adenoid cystic carcinoma recurred after the primary surgery and were survived without tumor after salvage surgery. The other patients survived with no tumor recurrence. While different histopathology of minor salivary gland tumors were found in this group, malignant tumors were predominant, accounting for 81.4%. The choice of treatment for minor salivary gland tumors depends upon the location and the histopathology of the tumors. The treatment policy for benign tumors is simple tumor excision, while that for malignant tumors is surgery combined with pre- or post-operative radiation therapy. Complete surgical resection of tumor masses and tumor free margin is essential for successful treatment of malignant minor salivary gland tumors.

Can computerized tomography accurately stage childhood renal tumors?

PubMed

Abdelhalim, Ahmed; Helmy, Tamer E; Harraz, Ahmed M; Abou-El-Ghar, Mohamed E; Dawaba, Mohamed E; Hafez, Ashraf T

2014-07-01

Staging of childhood renal tumors is crucial for treatment planning and outcome prediction. We sought to identify whether computerized tomography could accurately predict the local stage of childhood renal tumors. We retrospectively reviewed our database for patients diagnosed with childhood renal tumors and treated surgically between 1990 and 2013. Inability to retrieve preoperative computerized tomography, intraoperative tumor spillage and nonWilms childhood renal tumors were exclusion criteria. Local computerized tomography stage was assigned by a single experienced pediatric radiologist blinded to the pathological stage, using a consensus similar to the Children's Oncology Group Wilms tumor staging system. Tumors were stratified into up-front surgery and preoperative chemotherapy groups. The radiological stage of each tumor was compared to the pathological stage. A total of 189 tumors in 179 patients met inclusion criteria. Computerized tomography staging matched pathological staging in 68% of up-front surgery (70 of 103), 31.8% of pre-chemotherapy (21 of 66) and 48.8% of post-chemotherapy scans (42 of 86). Computerized tomography over staged 21.4%, 65.2% and 46.5% of tumors in the up-front surgery, pre-chemotherapy and post-chemotherapy scans, respectively, and under staged 10.7%, 3% and 4.7%. Computerized tomography staging was more accurate in tumors managed by up-front surgery (p <0.001) and those without extracapsular extension (p <0.001). The validity of computerized tomography staging of childhood renal tumors remains doubtful. This staging is more accurate for tumors treated with up-front surgery and those without extracapsular extension. Preoperative computerized tomography can help to exclude capsular breach. Treatment strategy should be based on surgical and pathological staging to avoid the hazards of inaccurate staging. Copyright © 2014 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Correlation between apparent diffusion coefficient and histopathology subtypes of osteosarcoma after neoadjuvant chemotherapy.

PubMed

Wang, Jifei; Sun, Meili; Liu, Dawei; Hu, Xiaoshu; Pui, Margaret H; Meng, Quanfei; Gao, Zhenhua

2017-08-01

Background Neoadjuvant chemotherapy has made limb-salvage surgery possible for the patients with osteosarcoma. Diffusion-weighted magnetic resonance imaging (DWI) has been used to monitor chemotherapy response. Purpose To correlate the apparent diffusion coefficient (ADC) values with histopathology subtypes of osteosarcoma after neoadjuvant chemotherapy. Material and Methods Twelve patients with osteoblastic (n = 7), chondroblastic (n = 4), and fibroblastic (n = 1) osteosarcomas underwent post-chemotherapy DWI before limb-salvage surgery. ADCs corresponding to 127 histological tissue samples from the 12 resected specimens were compared to histological features. Results The mean ADC value of non-cartilaginous viable tumor (38/91, ADC = 1.22 ± 0.03 × 10 -3  mm 2 /s) was significantly ( P < 0.001) lower than that of non-cartilaginous tumor cell necrosis without stroma disintegration (25/91, ADC =1.77 ± 0.03 × 10 -3  mm 2 /s), cartilaginous viable tumor (14/91, ADC = 2.19 ± 0.04 × 10 -3  mm 2 /s), and cystic areas including liquefied necrosis, blood space, and secondary aneurysmal bone cyst (14/91, ADC = 2.29 ± 0.05 × 10 -3  mm 2 /s). The mean ADC value of non-cartilaginous tumor cell necrosis was also significantly ( P < 0.001) smaller than those of viable cartilaginous tumor and cystic/hemorrhagic necrosis whereas the mean ADC values were not significantly ( P > 0.05) different between viable cartilaginous tumor and cystic/hemorrhagic necrosis. Conclusion DWI allows assessment of tumor necrosis after neoadjuvant chemotherapy by ADC differences between viable tumor and necrosis in fibroblastic and osteoblastic osteosarcomas whereas viable chondroblastic osteosarcoma has high ADC and cannot be distinguished reliably from necrosis.

Cystic lesions of the pancreas

PubMed Central

Karoumpalis, Ioannis; Christodoulou, Dimitrios K.

2016-01-01

Different types of benign or malignant cystic lesions can be observed in the pancreas. Pancreatic cystic lesions are classified under pathology terms into simple retention cysts, pseudocysts and cystic neoplasms. Mucinous cystic neoplasm is a frequent type of cystic neoplasm and has a malignant potential. Serous cystadenoma follows in frequency and is usually benign. Intraductal papillary mucinous neoplasms are the most commonly resected cystic pancreatic neoplasms characterized by dilated segments of the main pancreatic duct and/or side branches, the wall of which is covered by mucus secreting cells. These neoplasms can occupy the pancreatic head or any part of the organ. Solid pseudopapillary tumor is rare, has a low tendency for malignancy, and is usually located in the pancreatic body or tail. Endoscopic ultrasound with the use of fine-needle aspiration and cytology permits discrimination of those lesions. In this review, the main characteristics of those lesions are presented, as well as recommendations regarding their follow up and management according to recent guidelines. PMID:27065727

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis

PubMed Central

Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-01-01

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in “high-risk” category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01). In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands. PMID:28206977

Prognostic significance of p53 immunohistochemical expression in adenoid cystic carcinoma of the salivary glands: a meta-analysis.

PubMed

Li, Qinglin; Huang, Ping; Zheng, Chuanming; Wang, Jiafeng; Ge, Minghua

2017-04-25

Adenoid cystic carcinoma of salivary glands is a rare adenocarcinoma and has been placed in "high-risk" category as poor long-term prognosis. The purpose of this study was to investigate p53 protein expression in adenoid cystic carcinoma of salivary glands and its correlation with clinicopathological parameters and prognosis. Literatures were searched from PubMed, Embase, Cochrane Library and Web of Science, which investigated the relationships between p53 expression and pathological type, clinical stage, local recurrence, metastasis, nerve infiltration and overall survival. A total of 1,608 patients from 36 studies were included in the analysis. The results showed that p53-postive expression rate was 49% in adenoid cystic carcinoma of salivary glands (OR=10.34, 95%CI: 4.93-21.71, P < 0.0001). The p53-postive expression was closely related to tumor types (OR=0.30, 95%CI: 0.14-0.65, P < 0.0001). The tumor with solid histological subtype had a strong positive correlation with p53 expression. The combined analysis revealed that the p53-positive expression rate among patients in T1and T2 stage was 41.4%, compared to 53.2% among those in T3 and T4 stage. However, there was no significant correlation between tumor stage and p53 expression (OR=0.47, 95% CI: 0.17-1.29, P = 0.14). Besides, compared to patients with p53-negative expression, those with p53-positive expression had a greater chance of developing metastasis, local recurrence and nerve infiltration as well as poorer 5-year overall survival (P < 0.01).In conclusion, the p53 expression is related to the survival of adenoid cystic carcinoma of salivary glands. It can be considered as the auxiliary detection index in treatment and prognosis of adenoid cystic carcinoma of salivary glands.

Detection of tumor angiogenesis factor in adenocarcinoma of kidney.

PubMed

Bard, R H; Mydlo, J H; Freed, S Z

1986-05-01

Implantation of human renal adenocarcinoma in the rabbit cornea has resulted in new vascular growth from the limbus toward the tumor implant. This suggests that renal adenocarcinoma elaborates tumor angiogenesis factor (TAF) which stimulates endothelial cell growth. Such a substance could conceivably be responsible for the luxuriant vascularity of most renal adenocarcinomas. Conversely, absence or diminished secretion of TAF may be responsible for the hypovascular papillary renal adenocarcinomas and their recognized relatively benign clinical behavior.

Program for the Chronically Ill.

ERIC Educational Resources Information Center

Schoenherr, Arline; Schnarr, Barbara

The program for chronically ill students in the Detroit public schools is described. Forms are presented listing needed information and implications for teachers of the following conditions: diabetes, sickle cell anemia, chronic renal failure, congenital heart disease, hemophilia, rheumatoid arthritis, asthma, leukemia, and cystic fibrosis. The…

Anatomic features of enhancing renal masses predict malignant and high-grade pathology: a preoperative nomogram using the RENAL Nephrometry score.

PubMed

Kutikov, Alexander; Smaldone, Marc C; Egleston, Brian L; Manley, Brandon J; Canter, Daniel J; Simhan, Jay; Boorjian, Stephen A; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

2011-08-01

Counseling patients with enhancing renal mass currently occurs in the context of significant uncertainty regarding tumor pathology. We evaluated whether radiographic features of renal masses could predict tumor pathology and developed a comprehensive nomogram to quantitate the likelihood of malignancy and high-grade pathology based on these features. We retrospectively queried Fox Chase Cancer Center's prospectively maintained database for consecutive renal masses where a Nephrometry score was available. All patients in the cohort underwent either partial or radical nephrectomy. The individual components of Nephrometry were compared with histology and grade of resected tumors. We used multiple logistic regression to develop nomograms predicting the malignancy of tumors and likelihood of high-grade disease among malignant tumors. Nephrometry score was available for 525 of 1750 renal masses. Nephrometry score correlated with both tumor grade (p < 0.0001) and histology (p < 0.0001), such that small endophytic nonhilar tumors were more likely to represent benign pathology. Conversely, large interpolar and hilar tumors more often represented high-grade cancers. The resulting nomogram from these data offers a useful tool for the preoperative prediction of tumor histology (area under the curve [AUC]: 0.76) and grade (AUC: 0.73). The model was subjected to out-of-sample cross-validation; however, lack of external validation is a limitation of the study. The current study is the first to objectify the relationship between tumor anatomy and pathology. Using the Nephrometry score, we developed a tool to quantitate the preoperative likelihood of malignant and high-grade pathology of an enhancing renal mass. Copyright © 2011 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Adenoid cystic carcinoma of the submandibular gland with rare metastasis to the sternum in a 52-year-old male.

PubMed

Alshammari, Abdullah; Eldeib, Omar Jamal; Eldeib, Ahmed Jamal; Saleh, Waleed

2016-01-01

Adenoid cystic carcinoma (ACC) is a rare tumor, described as being one of the most biologically destructive tumors of the head and neck. It is the most common malignancy that affects the minor salivary glands. Lung and bones are the most common regions of ACC distant metastasis. To the best of our knowledge, herein, we report the first ever case of latent isolated sternal metastasis from ACC in a 52-year-old gentleman, who was diagnosed to have ACC of the submandibular gland, excised 10 years ago.

Complete Recovery of Visual Disorder Following Surgical Resection of Adenoid Cystic Carcinoma Arising in the Pterygopalatine Fossa

PubMed Central

Du, Wei; Cui, Meng; Li, Peng; Wang, Jiheng; Luo, Ruihua; Qi, Jinxing; Zhao, Ming; Lou, Weihua

2015-01-01

Abstract Adenoid cystic carcinoma (ACC) arising in the pterygopalatine fossa was rare, only 3 cases have been reported. In previous literature, few authors reported whether the visual deficit could be resolved following the resection of the tumor. One patient with visual dysfunction induced by ACC arising in the pterygopalatine fossa was reported. Complete visual recovery was achieved following the operation. And the patient was satisfied with the appearance and the functional results in the follow-up. Visual loss contributed by the tumor in the pterygopalatine fossa could recover in selected patients. PMID:26039119

Mini-flank supra-12th rib incision for open partial nephrectomy for renal tumor with RENAL nephrometry score ≥10: an innovation of traditional open surgery.

PubMed

Wang, Hang; Sun, Li-an; Wang, Yiwei; Xiang, Zhuoyi; Zhou, Lin; Guo, Jianming; Wang, Guomin

2015-04-01

The skill of supra-12th rib mini-flank approach for open partial nephrectomy (MI-OPN) provides an advanced operative method for renal tumor. Compared with laparoscopic and robotic surgery, it may be a feasible selection for the complex renal tumors. We describe our techniques and results of MI-OPN in complex renal tumors with high RENAL nephrometry score (RENAL nephrometry score ≥10). Fifty-five patients diagnosed with renal tumors between January 2009 and July 2013 were included in this study. Eligibility criteria comprised of patients with complex renal tumor (RENAL score ≥10) being candidates for partial nephrectomy (PN). All patients received MI-OPN and all surgeries were performed by a single urologist. The preoperative workup comprised of medical history, physical examination, and routine laboratory tests. Serum creatinine was recorded preoperatively and 2 to 3 months after operation. Operative time, ischemia time, blood loss, operative and postoperative complications, renal function, and pathology parameters were recorded. MI-OPN was successfully performed in all cases. Mean tumor size was 4.7 cm (range: 2.5-8.1). Mean warm ischemia time was 28.1 minutes (range: 21-39), mean operative time was 105 minutes (range: 70-150) and mean estimated blood loss was 68 mL (range: 10-400). Mean postoperative hospital stay was 6.5 days (range: 5-12). Postoperative complications were found in 3 patients (5.5%). The mean pre- and postoperative serum creatinine levels were 76.2 μmol/L (range: 47-132) and 87.1 μmol/L (range: 61-189) with significant difference (P = 0.004). The mean pre- and postoperative estimated glomerular filtration rate (eGFR) were 91.5 (range: 34-133) and 82.5 (range: 22-126.5), respectively with significant difference (P = 0.024). In an average follow-up of 19.9 months (range: 8-50), no local recurrence or systemic progression occurred. In conclusion, MI-OPN can combine the benefits of both minimal invasive and traditional open partial nephrectomy (OPN) techniques with a smaller incision. It is an innovation of traditional OPN and suitable for the complex renal tumors with high RENAL nephrometry score safely and effectively.

Renal Tumors: Technical Success and Early Clinical Experience with Radiofrequency Ablation of 18 Tumors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sabharwal, Rohan, E-mail: rohan50000@yahoo.com; Vladica, Philip

2006-04-15

Purpose. To evaluate the feasibility, safety, and technical efficacy of image-guided radiofrequency ablation (RFA) for the treatment of small peripheral renal tumors and to report our early results with this treatment modality. Methods. Twenty-two RFA sessions for 18 tumors were performed in 11 patients with renal tumors. Indications included coexistent morbidity, high surgical or anesthetic risk, solitary kidney, and hereditary predisposition to renal cell carcinoma. Ten patients had CT-guided percutaneous RFA performed on an outpatient basis. One patient had open intraoperative ultrasound-guided RFA. Technical success was defined as elimination of areas that enhanced at imaging within the entire tumor. Withmore » the exception of one patient with renal insufficiency who required gadolinium-enhanced MRI, the remaining patients underwent contrast-enhanced CT for post-treatment follow-up assessment. Follow-up was performed after 2-4 weeks and then at 3, 6, 12 months, and every 12 months thereafter. Results. Fourteen (78%) of 18 tumors were successfully ablated with one session. Three of the remaining four tumors required two sessions for successful ablation. One tumor will require a third session for areas of persistent enhancement. Mean patient age was 72.82 {+-} 10.43 years. Mean tumor size was 1.95 {+-} 0.79 cm. Mean follow-up time was 10.91 months. All procedures were performed without any major complications. Conclusions. Our early experience with percutaneous image-guided radiofrequency ablation demonstrates it to be a feasible, safe, noninvasive, and effective treatment of small peripheral renal tumors.« less

Cystic hygroma of the neck: single center experience and literature review.

PubMed

Damaskos, C; Garmpis, N; Manousi, M; Garmpi, A; Margonis, G-A; Spartalis, E; Doula, C; Michail-Strantzia, C; Patelis, N; Schizas, D; Arkoumanis, P-T; Andreatos, N; Tsourouflis, G; Zavras, N; Markatos, K; Kontzoglou, K; Antoniou, E A

2017-11-01

Malformations of the lymphatic system are recognized as benign congenital tumors that affect infant and children in the perinatal era. In children, these abnormalities usually found in the neck and the axillary region, but they can present in other parts of the body such as mediastinum, pelvis, retroperitoneum as well as in solid organs (e.g., adrenal glands, pancreas, stomach). Our aim is to report our experience on cystic hygromas via two cases and review the literature. Herein we present two cases of cystic hygroma, the first of female children and the second of a female adult patient respectively. Both of these patients underwent surgical excision of the masses. After the procedure, both patients have recovered well, and no recurrence of the lesion has been noted during the follow-up period. Surgical treatment remains the gold-standard treatment for these tumors, while other modalities have been used with mixed results.

Adenoid cystic carcinoma of the head and neck--An update.

PubMed

Coca-Pelaz, Andrés; Rodrigo, Juan P; Bradley, Patrick J; Vander Poorten, Vincent; Triantafyllou, Asterios; Hunt, Jennifer L; Strojan, Primož; Rinaldo, Alessandra; Haigentz, Missak; Takes, Robert P; Mondin, Vanni; Teymoortash, Afshin; Thompson, Lester D R; Ferlito, Alfio

2015-07-01

This article provides an update on the current understanding of adenoid cystic carcinoma of the head and neck, including a review of its epidemiology, clinical behavior, pathology, molecular biology, diagnostic workup, treatment and prognosis. Adenoid cystic carcinoma is an uncommon salivary gland tumor that may arise in a wide variety of anatomical sites in the head and neck, often with an advanced stage at diagnosis. The clinical course is characterized by very late recurrences; consequently, clinical follow-up should extend at least >15 years. The optimal treatment is generally considered to be surgery with postoperative radiotherapy to optimize local disease control. Much effort has been invested into understanding the tumor's molecular biological processes, aiming to identify patients at high risk of recurrence, in hopes that they could benefit from other, still unproven treatment modalities such as chemotherapy or biological therapy. Copyright © 2015 Elsevier Ltd. All rights reserved.

The perioperative outcomes between renal hilar and non-hilar tumors following robotic-assisted partial nephrectomy (RAPN).

PubMed

Lu, Shih-Yen; Chung, Hsiao-Jen; Huang, Eric Yi-Hsiu; Lin, Tzu-Pin; Lin, Alex T L

2018-03-15

The aim of this study was to compare the perioperative outcomes between renal hilar tumors and non-hilar tumors after robotic-assisted partial nephrectomy (RAPN). A retrospective review of consecutive patients who underwent RAPN from December 2009 to September 2015 at our institution was recruited. Perioperative outcomes including demographic characteristics, perioperative, pathological and renal function outcomes were compared between the hilar group (n = 30) and non-hilar group (n = 170). In characteristics, hilar group was younger (52.4 vs. 58 years, p = 0.04) and had less body mass index (23.7 vs. 25.4 kg/m 2 , p = 0.018). Hilar group had larger tumor size (4.8 vs. 3.7 cm, p = 0.009), higher Preoperative Aspects and Dimensions Used for an Anatomical (PADUA) score (10.7 vs. 8.5, p < 0.001) and higher RENAL (radius, exophytic/endophytic properties of the tumor, nearness of tumor deepest portion to the collecting system or sinus, anterior/posterior description and the location relative to polar lines) score (9.0 vs. 7.4, p < 0.001). Hilar tumor was associated with longer operative time (293.6 vs. 240.5 min, p = 0.001) and warm ischemia time (39.9 vs. 21.8 min, p < 0.001). But there was no statistically difference in estimated blood loss (EBL), postoperative stay and complication rate. For pathological outcomes, there was no difference of positive margin rate and pathological T stage between these groups. For renal function outcomes, hilar tumor patients had no difference of the change of creatinine and estimated glomerular filtration rate (eGFR) at postoperative 6 and 12 month as compared with non-hilar tumor patients. For renal hilar tumor, RAPN could provide acceptable results of perioperative, pathological and renal function outcome as compared with non-hilar tumor group. Thus RAPN is a safe and effective nephron-sparing surgery technique for renal hilar tumors. Copyright © 2018. Published by Elsevier Taiwan LLC.

[Effect of a modified low protein and low fat diet on histologic changes and metabolism in kidneys in an experimental model of polycystic kidney disease].

PubMed

Banković-Calić, Neda; Ogbori, Malkom R; Nicman, Evin

2002-01-01

Dietary protein restriction slows progression in numerous animal models of renal diseases. Flax seed has also demonstrated useful anti-inflammatory properties in a number of animal models and human diseases. We undertook several studies to determine if feeding with low protein casein, soy diet and flax seed diet would ameliorate renal injury in Han:SPRD-cy rat model of polycystic kidney disease. Male offspring of Han:SPRD-cy heterozygotes received protein modified diet: ad libidum LP 8% casein in test or 20% casein in control group for 8 weeks; 20% heat treated soy protein or 20% casein in control group two separate studies for 8 weeks ad libidum and pair feeding in 6 weeks; and 10% flax seed diet or control rat chow for 8 weeks from weaning. Tissue was harvested for histological assessment and metabolic changes in lipids, citric acid metabolites and osmolytes. Morphometrically after histochemical and immunohistochemical staining cystic changes, renal tubular proliferation and apoptosis, number of interstitial cells/macrophages infiltration and interstitial fibrosis were measured. Gas chromatography was used for lipid analysis in renal and liver tissue. 1-HNMR spectroscopy was used for urine and tissue organic anion and osmolytes content analysis. RESULTS IN PROTEIN MODIFIED DIET: Casein low protein as well as soy protein fed animals demonstrated reduced PKD pathology: significant reduction in cystic changes, interstitial inflammation and fibrosis and also reduction in tubular cells proliferation and apoptosis. Pair feeding protocol in second soy diet study confirmed that significant effect on renal histology was not because of protein deprivation and growth retardation. 1-H NMR spectroscopy revealed that progression of chronic renal failure in Han:SPRD-cy rat PKD is associated with renal depletion of citric acid cycle metabolite and betaine. Amelioration of PKD by soy protein diet is associated with renal retention of citric acid cycle anions, despite increased excretion and preservation of betaine in renal tissue. Soy feeding increased both hepatic and renal content of linoleic acid and increased renal alpha linolenic acid content, while decreased arachidonic hepatic content. RESULTS IN FLAX SEED SUPPLEMENTATION IN DIET: Flax seed fed animals had moderate decrease in cystic size and less interstitial inflammation and fibrosis while there were no differences in epithelial cell apoptosis and proliferation. Lipid analysis revealed significant renal enrichment of 18 and 20 carbon omega 3 polyunsaturated fatty acids. In flax fed animals there was an increased urinary citrate excretion without significant changes in urinary ammonia excretion, so increased citrate excretion was not due to alkaline effect of the diet. Kidney tissue 1H NMR spectroscopy revealed that disease amelioration was associated with tissue retention of succinate and betaine. Effect on histology: Low casein and soy feeding ameliorates Han: SPRD-cy rat polycystic kidney disease reducing both tubular remodeling and interstitial inflammation and fibrosis, while flax seed diet effect appears to be through moderation of associated interstitial nephritis. Metabolic effect: Soy diet alters the renal content of polyunsaturated fatty acids and enriched renal betaine content with retention of citric acid cycle metabolites despite increased excretion. Flax seed diet alters renal content of polyunsaturated fatty acids and promotes the formation of less inflammatory classes of renal prostanoides. Flax seed diet also enriched renal content of betaine and succinate. Amelioration of Hans:SPRD-cy rat polycystic kidney disease by diet is associated with alteration in the handling of citric acid cycle metabolites and betaine, and also in content of polyunsaturated fatty acids in kidneys and liver. Metabolic pathways in dietary modified renal pathology have to be established.

Duodenum-preserving total pancreatic head resection for benign cystic neoplastic lesions.

PubMed

Beger, Hans G; Schwarz, Michael; Poch, Bertram

2012-11-01

Cystic neoplasms of the pancreas are diagnosed frequently due to early use of abdominal imaging techniques. Intraductal papillary mucinous neoplasm, mucinous cystic neoplasm, and serous pseudopapillary neoplasia are considered pre-cancerous lesions because of frequent transformation to cancer. Complete surgical resection of the benign lesion is a pancreatic cancer preventive treatment. The application for a limited surgical resection for the benign lesions is increasingly used to reduce the surgical trauma with a short- and long-term benefit compared to major surgical procedures. Duodenum-preserving total pancreatic head resection introduced for inflammatory tumors in the pancreatic head transfers to the patient with a benign cystic lesion located in the pancreatic head, the advantages of a minimalized surgical treatment. Based on the experience of 17 patients treated for cystic neoplastic lesions with duodenum-preserving total pancreatic head resection, the surgical technique of total pancreatic head resection for adenoma, borderline tumors, and carcinoma in situ of cystic neoplasm is presented. A segmental resection of the peripapillary duodenum is recommended in case of suspected tissue ischemia of the peripapillary duodenum. In 305 patients, collected from the literature by PubMed search, in about 40% of the patients a segmental resection of the duodenum and 60% a duodenum and common bile duct-preserving total pancreatic head resection has been performed. Hospital mortality of the 17 patients was 0%. In 305 patients collected, the hospital mortality was 0.65%, 13.2% experienced a delay of gastric emptying and a pancreatic fistula in 18.2%. Recurrence of the disease was 1.5%. Thirty-two of 175 patients had carcinoma in situ. Duodenum-preserving total pancreatic head resection for benign cystic neoplastic lesions is a safe surgical procedure with low post-operative morbidity and mortality.

Mixed epithelial and stromal tumor of the middle ear: The first case report.

PubMed

Michal, Michael; Skálová, Alena; Kazakov, Dmitry V; Pecková, Květoslava; Heidenreich, Filip; Grossmann, Petr; Michal, Michal

2017-03-01

We report a tumor arising in the middle ear of a 65-year-old female patient that was composed of an ovarian-type stroma (OS) and an epithelial component. The tumor consisted of irregular, polypoid masses containing multiple variably sized cystic spaces, which were invariably surrounded by the OS. The cystic spaces were lined by flat, cuboidal, or columnar epithelial cells, in most parts showing mucinous differentiation. The epithelial lining of the cysts strongly expressed cytokeratins AE1-3, CK7, CK8, CK18, CK19, EMA, and S100 protein. The stroma expressed CD34 and smooth muscle actin. No cytological atypia or mitoses were present, and the proliferative activity was less than 1% in both components. The clonality analysis proved the clonal nature of the neoplasm. We believe that this tumor is a new member in the family of neoplasms containing the OS, and therefore we propose the term mixed epithelial and stromal tumor of the middle ear. Copyright © 2017 Elsevier Inc. All rights reserved.

Computed tomography findings of ovarian metastases from colon cancer: comparison with primary malignant ovarian tumors.

PubMed

Choi, Hyuck Jae; Lee, Joo-Hyuk; Seo, Sang-Soo; Lee, Sun; Kim, Seok Ki; Kim, Joo-Young; Lee, Jong Seok; Park, Sang-Yoon; Kim, Young Hoon

2005-01-01

The computed tomography (CT) findings of ovarian metastases from colon cancer were evaluated and were compared with those of primary malignant ovarian tumors. Sixteen patients with 21 masses from colon cancer and 20 patients with 31 primary malignant ovarian tumors were included in this study. The CT findings (laterality, size, margin, shape, mass characteristic, strong enhancement of cyst wall, enhancement of solid portion, amount of ascites, peritoneal seeding, lymph node enlargement, and metastasis) and ages of the patients in both groups were compared. Univariate analysis, the Pearson chi test, and the independent-samples t test were used to distinguish them. A smooth margin of the tumor (odds ratio=24.3, 95% confidence interval: 2.9-204.2) and cystic nature of the mass (Pearson chi=12.96, P=0.005) were strong predictors of ovarian metastasis from colon cancer. Ovarian metastases from colon cancer show a smooth margin and more cystic nature on CT compared with primary malignant ovarian tumors.

Integrin Alpha 8 Recessive Mutations Are Responsible for Bilateral Renal Agenesis in Humans

PubMed Central

Humbert, Camille; Silbermann, Flora; Morar, Bharti; Parisot, Mélanie; Zarhrate, Mohammed; Masson, Cécile; Tores, Frédéric; Blanchet, Patricia; Perez, Marie-José; Petrov, Yuliya; Khau Van Kien, Philippe; Roume, Joelle; Leroy, Brigitte; Gribouval, Olivier; Kalaydjieva, Luba; Heidet, Laurence; Salomon, Rémi; Antignac, Corinne; Benmerah, Alexandre; Saunier, Sophie; Jeanpierre, Cécile

2014-01-01

Renal hypodysplasia (RHD) is a heterogeneous condition encompassing a spectrum of kidney development defects including renal agenesis, hypoplasia, and (cystic) dysplasia. Heterozygous mutations of several genes have been identified as genetic causes of RHD with various severity. However, these genes and mutations are not associated with bilateral renal agenesis, except for RET mutations, which could be involved in a few cases. The pathophysiological mechanisms leading to total absence of kidney development thus remain largely elusive. By using a whole-exome sequencing approach in families with several fetuses with bilateral renal agenesis, we identified recessive mutations in the integrin α8-encoding gene ITGA8 in two families. Itga8 homozygous knockout in mice is known to result in absence of kidney development. We provide evidence of a damaging effect of the human ITGA8 mutations. These results demonstrate that mutations of ITGA8 are a genetic cause of bilateral renal agenesis and that, at least in some cases, bilateral renal agenesis is an autosomal-recessive disease. PMID:24439109

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report.

PubMed

Zhu, Guanchen; Qiu, Xuefeng; Chen, Xianchen; Liu, Guangxiang; Zhang, Gutian; Gan, Weidong; Guo, Hongqian

2015-12-01

Renal cell carcinoma (RCC) accounts for 85-90% of kidney cancers, which in turn account for 2-3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7-10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC.

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report

PubMed Central

ZHU, GUANCHEN; QIU, XUEFENG; CHEN, XIANCHEN; LIU, GUANGXIANG; ZHANG, GUTIAN; GAN, WEIDONG; GUO, HONGQIAN

2015-01-01

Renal cell carcinoma (RCC) accounts for 85–90% of kidney cancers, which in turn account for 2–3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7–10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC. PMID:26788164

Application and analysis of retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping for patients with multiple renal tumor: initial experience.

PubMed

Zhu, Jundong; Jiang, Fan; Li, Pu; Shao, Pengfei; Liang, Chao; Xu, Aiming; Miao, Chenkui; Qin, Chao; Wang, Zengjun; Yin, Changjun

2017-09-11

To explore the feasibility and safety of retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping for the patients with multiple renal tumor of who have solitary kidney or contralateral kidney insufficiency. Nine patients who have undergone retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping between October 2010 and January 2017 were retrospectively analyzed. Clinical materials and parameters during and after the operation were summarized. Nineteen tumors were resected in nine patients and the operations were all successful. The operation time ranged from 100 to 180 min (125 min); clamping time of segmental renal artery was 10 ~ 30 min (23 min); the amount of blood loss during the operation was 120 ~ 330 ml (190 ml); hospital stay after the operation is 3 ~ 6d (5d). There was no complication during the perioperative period, and the pathology diagnosis after the surgery showed that there were 13 renal clear cell carcinomas, two papillary carcinoma and four perivascular epithelioid cell tumors with negative margins from the 19 tumors. All patients were followed up for 3 ~ 60 months, and no local recurrence or metastasis was detected. At 3-month post-operation follow-up, the mean serum creatinine was 148.6 ± 28.1 μmol/L (p = 0.107), an increase of 3.0 μmol/L from preoperative baseline. For the patients with multiple renal tumors and solitary kidney or contralateral kidney insufficiency, retroperitoneal laparoscopic partial nephrectomy with sequential segmental renal artery clamping was feasible and safe, which minimized the warm ischemia injury to the kidney and preserved the renal function effectively.

Renal arteriography

MedlinePlus

Renal angiogram; Angiography - kidney; Renal angiography; Renal artery stenosis - arteriography ... an artery by a blood clot Renal artery stenosis Renal cell cancer Angiomyolipomas (noncancerous tumors of the ...

[Transient enlargement of craniopharyngioma cysts after stereotactic radiotherapy and radiosurgery].

PubMed

Mazerkina, N A; Savateev, A N; Gorelyshev, S K; Konovalov, A N; Trunin, Yu Yu; Golanov, A V; Medvedeva, O A; Kalinin, P L; Kutin, M A; Astafieva, L I; Krasnova, T S; Ozerova, V I; Serova, N K; Butenko, E I; Strunina, Yu V

Stereotactic radiotherapy/radiosurgery (RT/ES) is an effective technique for treating craniopharyngiomas (CPs). However, enlargement of the cystic part of the tumor occurs in some cases after irradiation. The enlargement may be transient and not require treatment or be a true relapse requiring treatment. In this study, we performed a retrospective analysis of 79 pediatric patients who underwent stereotactic RT or RS after resection of craniopharyngioma. Five-year relapse-free survival after complex treatment of CP was 86%. In the early period after irradiation, 3.5 months (2.7-9.4) on average, enlargement of the cystic component of the tumor was detected in 10 (12.7%) patients; in 9 (11.4%) of them, the enlargement was transient and did not require treatment; in one case, the patient underwent surgery due to reduced visual acuity. In 8 (10.1%) patients, an increase in the residual tumor (a solid component of the tumor in 2 cases and a cystic component of the tumor in 6 cases) occurred in the long-term period after irradiation - after 26.3 months (16.6-48.9) and did not decrease during follow-up in none of the cases, i.e. continued growth of the tumor was diagnosed. A statistical analysis revealed that differences in the terms of transient enlargement and true continued growth were statistically significant (p<0.01). Enlargement of a craniopharyngioma cyst in the early period (up to 1 year) after RT/RS is usually transient and does not require surgical treatment (except cases where worsening of neurological symptoms occurs, or occlusive hydrocephalus develops).

Need for intraoperative ultrasound and surgical recommendation for partial nephrectomy: correlation with tumor imaging features and urologist practice patterns.

PubMed

Sun, Maryellen R M; Wagner, Andrew A; San Francisco, Ignacio F; Brook, Alexander; Kavoussi, Louis; Russo, Paul; Steele, Graeme; Viterbo, Rosalia; Pedrosa, Ivan

2012-03-01

This study aimed to evaluate the need for intraoperative ultrasound (IOUS) and recommendation for surgical approach in the resection of renal tumors through a survey of practicing urologists, with correlation to tumor imaging features and urologist practice pattern. An institutional review board-approved retrospective review, compliant with the Health Insurance Portability and Accountability Act, of 44 renal tumors that underwent laparoscopic partial nephrectomy at the study institution was performed. The numeric component of the RENAL nephrometry score (radius [diameter], % exophytic, nearness [to collecting system/renal sinus], location) was calculated for each case using preoperative computed tomography/magnetic resonance imaging. Five anonymized images of each tumor were presented to 4 academic urologists with varying practice patterns. Reviewers independently scored each case for its need for IOUS, for recommendation of a surgical technique, and for the difficulty of the proposed surgery. The RENAL scores were as follows: RENAL 1 (low complexity, score 4-6; n = 19); RENAL 2 (moderate complexity, score 7-9; n = 23); RENAL 3 (high complexity, score 10-12; n = 2). The only RENAL score component significantly influencing need for IOUS was percentage exophytic (P = 0.00002). There was an inverse relationship between normalized and averaged need for IOUS and percentage exophytic (P < 0.0001). The predominant influence for recommendation of surgical method was the reviewer him/herself, with each reviewer's recommendations closely matching his/her practice pattern. Size and percentage exophytic represented the only tumor features significantly (P = 0.03) influencing surgical recommendation. There was a significant difference in the perceived need for IOUS and surgical recommendation when 4 academic urologists reviewed a series of renal masses requiring resection. Percentage exophytic correlated inversely with need for IOUS. Urologist's practice pattern and tumor size and percentage exophytic were most predictive of surgical recommendation.

Targeting MDM2 for Treatment of Adenoid Cystic Carcinoma

PubMed Central

Warner, Kristy A.; Nör, Felipe; Acasigua, Gerson A.; Martins, Manoela D.; Zhang, Zhaocheng; McLean, Scott A.; Spector, Matthew E.; Chepeha, Douglas B.; Helman, Joseph; Wick, Michael J.; Moskaluk, Christopher A.; Castilho, Rogerio M.; Pearson, Alexander T.; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose There are no effective treatment options for patients with advanced adenoid cystic carcinoma (ACC). Here, we evaluated the effect of a new small molecule inhibitor of the MDM2-p53 interaction (MI-773) in preclinical models of ACC. Experimental Design To evaluate the anti-tumor effect of MI-773, we administered it to mice harboring 3 different patient-derived xenograft (PDX) models of ACC expressing functional p53. The effect of MI-773 on MDM2, p53, phospho-p53 and p21 was examined by Western blots in 5 low passage primary human ACC cell lines and in MI-773-treated PDX tumors. Results Single agent MI-773 caused tumor regression in the 3 PDX models of ACC studied here. For example, we observed a tumor growth inhibition (TGI) index of 127% in UM-PDX-HACC-5 tumors that was associated with an increase in the fraction of apoptotic cells (p=0.015). The number of p53-positive cells was increased in MI-773-treated PDX tumors (p<0.001), with a correspondent shift in p53 localization from the nucleus to the cytoplasm. Western blots demonstrated that MI-773 potently induced expression of p53 and its downstream targets p21, MDM2 and induced phosphorylation of p53 (serine 392) in low passage primary human ACC cells. Notably, MI-773 induced a dose-dependent increase in the fraction of apoptotic ACC cells and in the fraction of cells in the G1 phase of cell cycle (p<0.05). Conclusions Collectively, these data demonstrate that therapeutic inhibition of the MDM2-p53 interaction with MI-773 activates downstream effectors of apoptosis and causes robust tumor regression in preclinical models of adenoid cystic carcinoma. PMID:26936915

Dynamic Contrast-Enhanced CT Characterization of Xp11.2 Translocation/TFE3 Gene Fusions versus Papillary Renal Cell Carcinomas

PubMed Central

He, Jian; Zhou, Kefeng; Zhu, Bin; Zhang, Gutian; Li, Xiaogong; Guo, Hongqian; Gan, Weidong; Zhou, Zhengyang; Liu, Tian

2015-01-01

Purpose. To compare the differences of CT characteristics between renal cell carcinomas (RCCs) associated with Xp11.2 translocation/TFE3 gene fusions (Xp11.2 RCCs) and papillary cell renal cell carcinomas (PRCCs). Methods. CT images and clinical records of 64 patients (25 Xp11.2 RCCs, 15 type 1 and 24 type 2 PRCCs) were analyzed and compared retrospectively. Results. Xp11.2 RCC more frequently affected young (30.7 ± 8.7 years) women (16/25, 64%) with gross hematuria (12/25, 48%), while PRCC more frequently involved middle-aged (54.8 ± 11.1 years) men (28/39, 71.8%) asymptomatically. Xp11.2 RCC tended to be heterogeneous density with some showing circular calcification. Lesion sizes of Xp11.2 RCC (5.4 ± 2.2 cm) and type 2 PRCC (5.7 ± 2.5 cm) were significantly larger than that of type 1 PRCC (3.8 ± 1.8 cm). Xp11.2 RCC contained more cystic components (22/25, 88%) than type 1 PRCC (all solid) and type 2 PRCC (9/24, 36.0%). Type 1 PRCC (13/15, 86.7%) and Xp11.2 RCC (21/25, 84.0%) showed more clear boundary than type 2 PRCC (12/24, 50.0%). Conclusion. CT features including diameter, boundary, attenuation, nature, and circular calcification of the tumor, combined with demographic information and symptoms, may be useful to differentiate Xp11.2 RCC from different subtypes of PRCC. PMID:26636097

RT-06GAMMA KNIFE SURGERY AFTER NAVIGATION-GUIDED ASPIRATION FOR CYSTIC METASTATIC BRAIN TUMORS

PubMed Central

Chiba, Yasuyoshi; Mori, Kanji; Toyota, Shingo; Kumagai, Tetsuya; Yamamoto, Shota; Sugano, Hirofumi; Taki, Takuyu

2014-01-01

Metastatic brain tumors over 3 cm in diameter (volume of 14.1ml) are generally considered poor candidates for Gamma Knife surgery (GKS). We retrospectively assessed the method and efficacy of GKS for large cystic metastatic brain tumors after navigation-guided aspiration under local anesthesia. From September 2007 to April 2014, 38 cystic metastatic brain tumors in 32 patients (12 males, 20 females; mean age, 63.2 years) were treated at Kansai Rosai Hospital. The patients were performed navigation-guided cyst aspiration under local anesthesia, then at the day or the next day, were performed GKS and usually discharged on the day. The methods for preventing of leptomeningeal dissemination are following: 1) puncture from the place whose cerebral thickness is 1 cm or more; 2) avoidance of Ommaya reservoir implantation; and 3) placement of absorbable gelatin sponge to the tap tract. Tumor volume, including the cystic component, decreased from 25.4 ml (range 8.7-84.7 ml) to 11.4 ml (range 2.9-36.7 ml) following aspiration; the volume reduction was approximately 51.6%. Follow-up periods in the study population ranged from 0 to 24 months (median 3.5 months). The overall median survival was 6.7 months. There was no leptomeningeal dissemination related to the aspiration. One patient experienced radiation necrosis after GKS, one patient experienced re-aspiration by failure of aspiration, and two patients experienced surgical resections and one patient experienced re-aspiration by cyst regrowth after GKS. Long-term hospitalization is not desirable for the patients with brain metastases. In japan, Long-term hospitalization is required for surgical resection or whole brain radiation therapy, but only two days hospitalization is required for GKS after navigation-guided aspiration at our hospital. This GKS after navigation-guided aspiration is more effective and less invasive than surgical resection or whole brain radiation therapy.

[Multifocal tubulopapillary tumors of the kidney. Morphologic features and prognosis. Three cases].

PubMed

Abdelmoula, N B; Boudawara, T; Bahloul, A; Hmida, M B; Hachicha, J; Rebai, T; Mhiri, N; Jlidi, R

1999-01-01

Tubulopapillary tumors of the kidney represent a particular group of renal tumors characterized by their less aggressive behavior. These tumors are distinguished from non papillary tumors by their morphologic, cytochemical and genotypic features. They correspond to a continuous spectrum of tumors ranging from papillary renal cell adenoma to papillary renal cell carcinoma. These TTPR show multifocal, bilateral development and chronic lesions of the kidney parenchyma in nearly all cases. The authors report three cases of multifocal TTPR, including one bilateral case. Based on analysis of these cases and a review of the literature, they discuss the histogenetic features and prognosis of TTPR.

MUTATIONS IN THE VHL GENE FRIOM POTASSIUM BROMATE-INDUCED RAT CLEAR CELL RENAL TUMORS

EPA Science Inventory

Potassium bromate (KBrO3) is a rat renal carcinogen and a major drinking water disinfection by-product in water disinfected with ozone. Clear cell renal tumors, the most common form of human renal epithelial neoplasm, are rare in animals but are inducible by KBrO3 in F344 rats. ...

POTASSIUM BROMATE-INDUCED RAT CLEAR CELL RENAL TUMOR IS INDEPENDENT OF CODING REGION MUTATIONS IN THE VON HIPPEL- LINDAU GENE

EPA Science Inventory

Potassium bromate (KBr03) is a rat renal carcinogen and a major drinking water disinfection by-product from ozonization. While KBr03 is a human nephro- and neuro-toxicant, its carcinogenicity in humans is unknown. Clear cell renal tumors, the common form of human renal carcinomas...

Glomerular and Tubular Renal Function after Repeated Once-Daily Tobramycin Courses in Cystic Fibrosis Patients.

PubMed

Stehling, Florian; Büscher, Rainer; Grosse-Onnebrink, Jörg; Hoyer, Peter F; Mellies, Uwe

2017-01-01

Introduction . Antibiotic treatment regimens against Pseudomonas aeruginosa lung infection in cystic fibrosis (CF) patients often include aminoglycoside antibiotics that may cause chronic renal failure after repeated courses. Aminoaciduria is an early marker of acute aminoglycoside-induced renal tubular dysfunction. We hypothesized that urinary amino acid reabsorption is decreased after repeated once-daily tobramycin therapies. Methods . In this prospective cross-sectional study creatinine clearance was estimated by the Schwartz and the Cockcroft-Gault formula. Tubular amino acid reabsorption was determined by ion exchange chromatography in 46 patients with CF who received multiple tobramycin courses (6.3 ± 10.1 (1-57)) in a once-daily dosing regimen and 10 who did not. Results . Estimated creatinine clearance employing the Cockcroft-Gault was mildly reduced in 17/46 (37%) of the patients who received tobramycin and 5/10 (50%) of the patients who did not but in none using the Schwartz formula. No association with lifetime tobramycin courses was found. Tubular amino acid reabsorption was not influenced by the amount of once-daily tobramycin courses. Conclusion . Clinically not significant reduction of eCCL occurred in a minority of CF patients. However, chronic tubular dysfunction was not present in patients with CF repeatedly treated with tobramycin in the once-daily dosing scheme.

Retrospective evaluation of ultrasound-indeterminate renal multilocular cystic masses by using neutrophil-lymphocyte ratio and computed tomography.

PubMed

Wang, Hanfeng; Gu, Liangyou; Jia, Rui; Zeng, Jing; Liu, Xiaoxia; Zhang, Dawei; Wu, Yongjie; Luo, Guangda; Zhang, Xu

2017-01-01

To evaluate the clinical usefulness of neutrophil-lymphocyte ratio (NLR) in differentiating the ultrasound-indeterminate renal multilocular cystic masses (RMCM) in comparison with computed tomography (CT) and whether NLR has additional benefits to CT on sensitivity of detecting the malignant. Overall, 93 patients who underwent normal ultrasound with a conclusion of indeterminate RMCM were examined by NLR and CT within 30 days before surgery or follow-up from March to September 2014 at PLA General Hospital and enrolled in this retrospective study. Logistic regression model was performed to find independent predictors for differentiating true nature of RMCM; differences in the validity parameters and diagnostic power of CT, NLR, and their combination were compared using McNemar tests and AUC model, respectively. The final diagnoses of the 93 patients consisted of 36 patients with benign complex cysts, 16 with multilocular cystic renal cell carcinoma, 9 with multilocular cystic nephroma, and 32 with clear cell renal cell carcinoma. Higher NLR were strongly associated with malignant masses. Multivariate logistic regression analysis revealed that NLR could be an independent predictor for differentiating true nature of these masses (OR = 3.617; 95% CI: 1.219-10.727; P = 0.020). For detecting the malignant masses, the sensitivity, specificity, and accuracy were 71.9%, 80.6%, and 75.3% for CT and 57.9%, 88.9%, and 69.9% for NLR under cutoff value of 2.31, respectively, whereas those of CT+NLR were 89.5%, 69.4%, and 81.7%. No significant difference was found between CT and NLR in sensitivity (P = 0.185), specificity (P = 0.549), and accuracy (P = 0.428). But the sensitivity of CT+NLR was significantly higher than those of CT (P = 0.002) and NLR (P<0.001), respectively; AUC model analysis indicated that CT+NLR got the largest area of 0.795 (P<0.001, 95% CI: 0.693-0.896) in comparison with those of CT (area = 0.795, P<0.001, 95% CI: 0.661-0.864) and NLR (area = 0.734, P<0.001, 95% CI: 0.631-0.836). Given that NLR, under cutoff value of 2.31, had no diagnostic difference with CT in evaluating the ultrasound-indeterminate RMCM. However, combination of CT and NLR could increase the sensitivity of detecting malignant masses and acquire the best diagnostic power. Prospectively larger cohort and multicenter studies are still necessary. Copyright © 2017 Elsevier Inc. All rights reserved.

Cytoplasmic expression of Twist1, an EMT-related transcription factor, is associated with higher grades renal cell carcinomas and worse progression-free survival in clear cell renal cell carcinoma.

PubMed

Rasti, Arezoo; Madjd, Zahra; Abolhasani, Maryam; Mehrazma, Mitra; Janani, Leila; Saeednejad Zanjani, Leili; Asgari, Mojgan

2018-05-01

Twist1 is a key transcription factor, which confers tumor cells with cancer stem cell (CSC)-like characteristics and enhances epithelial-mesenchymal transition in pathological conditions including tumor malignancy and metastasis. This study aimed to evaluate the expression patterns and clinical significance of Twist1 in renal cell carcinoma (RCC). The cytoplasmic and nuclear expression of Twist1 were examined in 252 well-defined renal tumor tissues, including 173 (68.7%) clear cell renal cell carcinomas (ccRCC), 45 (17.9%) papillary renal cell carcinomas (pRCC) and 34 (13.5%) chromophobe renal cell carcinoma, by immunohistochemistry on a tissue microarray. The association between expression of this marker and clinicopathologic parameters and survival outcomes were then analyzed. Twist1 was mainly localized to the cytoplasm of tumor cells (98.8%). Increased cytoplasmic expression of Twist1 was associated with higher grade tumors (P = 0.045), renal vein invasion (P = 0.031) and microvascular invasion (P = 0.044) in RCC. It was positively correlated with higher grade tumors (P = 0.026), shorter progression-free survival time (P = 0.027) in patients with ccRCC, and also with higher stage in pRCC patients (P = 0.036). Significantly higher cytoplasmic expression levels of Twist1 were found in ccRCC and pRCC subtypes, due to their more aggressive tumor behavior. Increased cytoplasmic expression of Twist1 had a critical role in worse prognosis in ccRCC. These findings suggest that cytoplasmic, rather than nuclear expression of Twist1 can be considered as a prognostic and therapeutic marker for targeted therapy of RCC, especially for ccRCC patients.

[Molecular biology of renal cancer: bases for genetic directed therapy in advanced disease].

PubMed

Maroto Rey, José Pablo; Cillán Narvaez, Elena

2013-06-01

There has been expansion of therapeutic options in the management of metastatic renal cell carcinoma due to a better knowledge of the molecular biology of kidney cancers. There are different tumors grouped under the term renal cell carcinoma, being clear cell cancer the most frequent and accounting for 80% of kidney tumors. Mutations in the Von Hippel-Lindau gene can be identified in up to 80% of sporadic clear cell cancer, linking a genetically inheritable disease where vascular tumors are frequent, with renal cell cancer. Other histologic types present specific alterations in molecular pathways, like c-MET in papillary type I tumors, and Fumarase Hydratase in papillary type II tumors. Identification of the molecular alteration for a specific tumor may offer an opportunity for treatment selection based on biomarkers, and, in the future, for developing an engineering designed genetic treatment.

Everolimus affects vasculogenic mimicry in renal carcinoma resistant to sunitinib

PubMed Central

Serova, Maria; Tijeras-Raballand, Annemilaï; Santos, Celia Dos; Martinet, Matthieu; Neuzillet, Cindy; Lopez, Alfred; Mitchell, Dianne C.; Bryan, Brad A.; Gapihan, Guillaume; Janin, Anne; Bousquet, Guilhem; Riveiro, Maria Eugenia; Bieche, Ivan; Faivre, Sandrine

2016-01-01

Angiogenesis is hallmark of clear cell renal cell carcinogenesis. Anti-angiogenic therapies have been successful in improving disease outcome; however, most patients treated with anti-angiogenic agents will eventually progress. In this study we report that clear cell renal cell carcinoma was associated with vasculogenic mimicry in both mice and human with tumor cells expressing endothelial markers in the vicinity of tumor vessels. We show that vasculogenic mimicry was efficiently targeted by sunitinib but eventually associated with tumor resistance and a more aggressive phenotype both in vitro and in vivo. Re-challenging these resistant tumors in mice, we showed that second-line treatment with everolimus particularly affected vasculogenic mimicry and tumor cell differentiation compared to sorafenib and axitinib. Finally, our results highlighted the phenotypic and genotypic changes at the tumor cell and microenvironment levels during sunitinib response and progression and the subsequent improvement second-line therapies bring to the current renal cell carcinoma treatment paradigm. PMID:27509260

Multifocal hepatic cystic mass as first manifestation of metastatic spinal hemangiopericytoma

PubMed Central

Balibrea, José M.; Rovira-Argelagués, Montserrat; Otero-Piñeiro, Ana M.; Julián, Juan F.; Carrato, Cristina; Navinés, Jordi; Sánchez, M. Carmen; Fernández-Llamazares, Jaime

2012-01-01

INTRODUCTION Hemangiopericytomas (HPCs) are rare vascular tumors with a high malignant potential. Hepatic metastases from HPC are very infrequent and usually show a distinctive solid aspect with a surrounding pseudocapsule. PRESENTATION OF CASE A 37-year-old man with a previous medical history of recurrent spinal hemangiopericytoma with a 9 cm × 7 cm cystic hepatic mass detected on follow-up. Contrast enhanced US and MRI confirmed the presence the lesion showing mixed (solid and cystic) content. Parasitic and viral serology plus serum tumoral markers (CEA, ca 19.9, ca 125, AFP) tests, upper and lower endoscopy and general laboratory tests were normal and extended left lobectomy was performed. Histopathologic study confirmed the diagnosis of multifocal metastasic hemangiopericytoma with moderate CD-34, CD-99 and Bcl-2 positivity after immunohistochemical staining. After 1-year follow-up the patient does not present any evidence of abdominal recurrence but a skull base recurrence has been detected. DISCUSSION Liver metastasis from spinal HPC are uncommon and do not have cystic appearance so radiologic diagnosis can be challenging. In spite of the presence of previously diagnosed HPC context, the presence of a liver cystic mass in a young patient makes necessary to discard a number much more frequent benign and malignant diagnosis before metastatic disease can be confirmed. CONCLUSION The presence of a cystic hepatic mass makes it mandatory to rule out a number neoplasms other than metastasic HPC before a definitive diagnosis is made. In addition to local radiotherapy and antiangiogenic agents, surgery can be useful to treat liver dissemination. PMID:23103627

Analysis of MYB oncogene in transformed adenoid cystic carcinomas reveals distinct pathways of tumor progression.

PubMed

Costa, Ana F; Altemani, Albina; García-Inclán, Cristina; Fresno, Florentino; Suárez, Carlos; Llorente, José L; Hermsen, Mario

2014-06-01

Adenoid cystic carcinomas can occasionally undergo dedifferentiation, a phenomenon also referred to as high-grade transformation. However, cases of adenoid cystic carcinomas have been described showing transformation to adenocarcinomas that are not poorly differentiated, indicating that high-grade transformation may not necessarily reflect a more advanced stage of tumor progression, but rather a transformation to another histological form, which may encompass a wide spectrum of carcinomas in terms of aggressiveness. The aim of this study was to gain more insight in the biology of this pathological phenomenon by means of genetic profiling of both histological components. Using microarray comparative genomic hybridization, we compared the genome-wide DNA copy-number changes of the conventional and transformed area of eight adenoid cystic carcinomas with high-grade transformation, comprising four with transformation into moderately differentiated adenocarcinomas and four into poorly differentiated carcinomas. In general, the poorly differentiated carcinoma cases showed a higher total number of copy-number changes than the moderately differentiated adenocarcinoma cases, and this correlated with a worse clinical course. Special attention was given to chromosomal translocation and protein expression of MYB, recently being considered to be an early and major oncogenic event in adenoid cystic carcinomas. Our data showed that the process of high-grade transformation is not always accompanied by an accumulation of genetic alterations; both conventional and transformed components harbored unique genetic alterations, which indicate a parallel progression. Our data further demonstrated that the MYB/NFIB translocation is not necessarily an early event or fundamental for the progression to adenoid cystic carcinoma with high-grade transformation.

miR-24-3p Suppresses Malignant Behavior of Lacrimal Adenoid Cystic Carcinoma by Targeting PRKCH to Regulate p53/p21 Pathway.

PubMed

Zhang, Ming-Xue; Zhang, Jie; Zhang, Hong; Tang, Hua

2016-01-01

MicroRNA (miRNA) may function as an oncogene or a tumor suppressor in tumorigenesis. However, the mechanism of miRNAs in adenoid cystic carcinoma (ACC) is unclear. Here, we provide evidence that miR-24-3p was downreglated and functions as a tumor suppressor in human lacrimal adenoid cystic carcinoma by suppressing proliferation and migration/invasion while promoting apoptosis. miR-24-3p down-regulated protein kinase C eta (PRKCH) by binding to its untranslated region (3'UTR). PRKCH increased the of the cell growth and migration/invasion in ACC cells and suppressed the expression of p53 and p21 in both mRNA and protein level. The overexpression of miR-24-3p decreased its malignant phenotype. Ectopic expression of PRKCH counteracted the suppression of malignancy induced by miR-24-3p, as well as ectopic expression of miR-24-3p rescued the suppression of PRKCH in the p53/p21 pathway. These results suggest that miR-24-3p promotes the p53/p21 pathway by down-regulating PRKCH expression in lacrimal adenoid cystic carcinoma cells.

Pathogenesis of dysplastic kidney associated with urinary tract obstruction in utero.

PubMed

Nagata, Michio; Shibata, Sawako; Shu, Yujin

2002-01-01

Renal dysplasia is the major cause of chronic renal failure in children, and is commonly associated with urinary tract obstruction. There are two phenotypes of renal dysplasia associated with urinary tract abnormality, multicystic dysplastic kidney (MCDK) and obstructive dysplasia (ORD). Previous observations by Potter and co-workers suggested that cystic dilatation of the ureteric bud ampula was the cause of renal dysplasia. In this context, our recent investigation of human fetal dysplastic kidneys provided an alternative explanation for the evolution of renal dysplasia. We suggested that in utero urinary tract obstruction may cause urine retention in functioning nephrons and lead to glomerular cysts in the nephrogenic zone. The mechanism was common to MCDK and ORD, albeit at different sites of obstruction. Expansion of glomerular cysts with tubular dilatation (cysts) disturbs the subsequent nephron induction and may contribute to the abnormal development of fetal kidneys.

Renal transplantation-related risk factors for the development of uterine adenomatoid tumors.

PubMed

Mizutani, Teruyuki; Yamamuro, Osamu; Kato, Noriko; Hayashi, Kazumasa; Chaya, Junya; Goto, Norihiko; Tsuzuki, Toyonori

2016-08-01

•We analyzed the epidemiological factors for clinical manifestations of uterine adenomatoid tumors.•Renal transplantation with immunosuppression therapy is risk factor for the development of uterine adenomatoid tumors.•The length of time on dialysis is risk factor for the development of uterine adenomatoid tumors.

[The WHO/ISUP grading system for renal carcinoma].

PubMed

Moch, H

2016-07-01

Histological tumor grading is an accepted prognostic parameter of renal cell carcinoma (RCC). In 2012, the International Society of Urologic Pathologists (ISUP) proposed a novel grading system for RCC, mainly based on the evaluation of nucleoli: grade 1 tumors have nucleoli that are inconspicuous and basophilic at ×400 magnification; grade 2 tumors have nucleoli that are clearly visible at ×400 magnification and eosinophilic; grade 3 tumors have clearly visible nucleoli at ×100 magnification; and grade 4 tumors have extreme pleomorphism or rhabdoid and/or sarcomatoid morphology. This grading system was validated for clear cell renal cell carcinoma and papillary renal cell carcinoma. At the same time, the ISUP proposed not grading chromophobe renal cell carcinomas according to this system. At a consensus conference in Zurich the World Health Organization (WHO) recommended the ISUP grading system; thus, the WHO/ISUP grading system is now going to be implemented internationally. The ISUP/WHO grading system has not been validated as a prognostic parameter for other tumor subtypes, but can be used for descriptive purposes.

Comparing renal function preservation after laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy for clinical T1a renal tumor: using a 3D parenchyma measurement system.

PubMed

Zhu, Liangsong; Wu, Guangyu; Huang, Jiwei; Wang, Jianfeng; Zhang, Ruiyun; Kong, Wen; Xue, Wei; Huang, Yiran; Chen, Yonghui; Zhang, Jin

2017-05-01

To compare the renal function preservation between laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy. Data were analyzed from 246 patients who underwent laparoscopic radio frequency ablation assisted tumor enucleation and laparoscopic partial nephrectomy for solitary cT1a renal cell carcinoma from January 2013 to July 2015. To reduce the intergroup difference, we used a 1:1 propensity matching analysis. The functional renal parenchyma volume preservation were measured preoperative and 12 months after surgery. The total renal function recovery and spilt GFR was compared. Multivariable logistic analysis was used for predictive factors for renal function decline. After 1:1 propensity matching, each group including 100 patients. Patients in the laparoscopic radio frequency ablation assisted tumor enucleation had a smaller decrease in estimate glomerular filtration rate at 1 day (-7.88 vs -20.01%, p < 0.001), 3 months (-2.31 vs -10.39%, p < 0.001), 6 months (-2.16 vs -7.99%, p = 0.015), 12 months (-3.26 vs -8.03%, p = 0.012) and latest test (-3.24 vs -8.02%, p = 0.040), also had better functional renal parenchyma volume preservation (89.19 vs 84.27%, p < 0.001), lower decrease of the spilt glomerular filtration rate (-9.41 vs -17.13%, p < 0.001) at 12 months. The functional renal parenchyma volume preservation, warm ischemia time and baseline renal function were the important independent factors in determining long-term functional recovery. The laparoscopic radio frequency ablation assisted tumor enucleation technology has unique advantage and potential in preserving renal parenchyma without ischemia damage compared to conventional laparoscopic partial nephrectomy, and had a better outcome, thus we recommend this technique in selected T1a patients.

Laparoscopic partial nephrectomy for hilar tumors: oncologic and renal functional outcomes.

PubMed

George, Arvin K; Herati, Amin S; Rais-Bahrami, Soroush; Waingankar, Nikhil; Kavoussi, Louis R

2014-01-01

To present our experience with laparoscopic partial nephrectomy (LPN) for hilar tumors and evaluate intermediate oncologic and renal functional outcomes. A retrospective review of LPN cases performed in 488 patients was performed. Hilar lesions were defined as renal cortical tumors in direct physical contact with the renal artery, vein, or both, as identified on preoperative imaging and confirmed intraoperatively. The clinicopathologic parameters, perioperative course, complications, and oncologic and 6-month renal functional outcomes were analyzed. A total of 488 patients underwent LPN, of which 43 were hilar. The mean tumor size for hilar and nonhilar tumors was 3.6 cm and 3.1 cm, respectively. The mean operative time was shorter for hilar as compared with nonhilar tumors (129.1 minutes vs 141.8 minutes). Mean estimated blood loss was greater in LPN for hilar tumors (311.65 mL vs 298.4 mL). There were no statistically significant differences noted in any of the perioperative parameters investigated despite a higher nephrometry complexity score in the hilar group. Change in estimated glomerular filtration rate at 6 months showed a decrease of 10.9 mL/min and 8.8 mL/min for hilar and nonhilar tumors, respectively (P = NS). There was 1 recurrence detected in the hilar group, with a median follow-up of 41.6 months. In the hands of an experienced laparoscopist, LPN can safely be performed for hilar tumors, with preservation of perioperative outcomes and durable renal functional and oncologic outcomes. Copyright © 2014 Elsevier Inc. All rights reserved.

Hilar Parenchymal Oversew: a novel technique for robotic partial nephrectomy hilar tumor renorrhaphy.

PubMed

Chavali, Jaya Sai S; Nelson, Ryan; Maurice, Matthew J; Kara, Onder; Mouracade, Pascal; Dagenais, Julien; Reese, Jeremy; Bayona, Pilar; Haber, Georges-Pascal; Stein, Robert J

2018-01-01

A renorrhaphy technique which is effective for hemostasis but does not place undue tension on the branch vessels of the renal sinus remains one of the challenging steps after hilar tumor resection during robotic partial nephrectomy (RPN). The published V-hilar suture (VHS) technique is one option for reconstruction after an RPN involving the hilum. The objective of this video is to show a novel renorrhaphy technique, Hilar Parenchymal Oversew that has been effective for such cases. We present two cases of RPN for renal hilar tumors. The first case depicts use of the VHS renorrhaphy technique for a tumor that abuts the renal hilum along 20% of its diameter. The second case demonstrates tumor resection and reconstruction for a tumor that has >50% involvement of the hilum along its diameter. After tumor resection, individual sinus vessels can be selectively oversewn with 2-0 Vicryl suture on SH needle. The remaining exposed parenchyma is controlled using the Hilar Parenchymal Oversew technique with a #0 Vicryl on CT-1 needle. For the Hilar Parenchymal Oversew surgery operative time was 225 min, estimated blood loss was 140 ml, warm ischemia time was 19 minutes, and there were no intraoperative complications. Pathology was consistent with clear cell renal cancer with negative margins. Robotic partial nephrectomy with the Hilar Parenchymal Oversew technique is a good alternative to VHS renorrhaphy in the management of renal hilar tumors "bulging" into the renal sinus with >50% of the tumor diameter abutting the hilum. Copyright® by the International Brazilian Journal of Urology.

Robotic partial nephrectomy with selective parenchymal compression (Simon clamp).

PubMed

Castillo, O A; Rodriguez-Carlin, A; Lopez-Fontana, G; Aleman, E

2013-01-01

To present our initial experience using selective renal parenchymal ischemia, without hilar clamping, in robotic-assisted partial nephrectomy. In four patients with T1a renal tumor we performed robotic-assisted partial nephrectomy, using the Simon's clamp (Aesculap). It provides selective parenchymal compression without the need of vascular clamping. All patients had exofitic renal tumors in polar location. Renal parenchymal reconstruction was done as the standard technique. The median age was 49.6 years (42-59), 3 male and 1 female patient. Median operative time was 71,6 minutes (40-120). Mean stimated bleeding was 250 ml (50-400). Average tumor size was 3,25 cm (1,5-5,3). There were no complications and the average hospital stay was 3,5 days (1-7). The pathology was informed as renal cell carcinoma in three patients and one hemorrhagic cyst. The surgical margins were negative. Our preliminary results shows that selective renal parenchymal compression, with the Simon's clamp, provides an alternative to vascular control in selected patients with polar renal tumors. Copyright © 2012 AEU. Published by Elsevier Espana. All rights reserved.

Testis tumor associated to microlithiasis.

PubMed

Jesus, Lisieux Eyer de; Maciel, Felipe; Monnerat, Andrea Lima C; Fernandes, Marcia Antunes; Dekermache, Samuel

2013-12-01

To discuss the relationship between testicular microlithiasis and testis tumors in children and to consider the chances of testis preserving surgery in specific cases. Pre-adolescent presenting testicular microlithiasis and a larger left testis, corresponding to a cystic testicular tumor. The tumor was excised, with ipsilateral testis preservation. Histology diagnosed a testis dermoid tumor. The relationship between testis tumors and testicular microlithiasis is ill defined in children. Pediatric urologists need to develop specific follow-up protocols for pre-pubertal children.

The Molecular Biology of Adenoid Cystic Carcinoma

PubMed Central

Liu, Jia; Shao, Chunbo; Tan, Marietta L.; Mu, David; Ferris, Robert L.; Ha, Patrick K.

2011-01-01

Background Adenoid cystic carcinoma (ACC) is an unusual salivary gland malignancy that remains poorly understood. Standard treatment, including surgery with postoperative radiation therapy have attained reasonable local control rates, but the propensity for distant metastases has limited any improvement in survival over time. Our understanding of the molecular mechanisms driving adenoid cystic carcinoma is quite rudimentary, due to the infrequent nature of its occurrence. Methods An extensive literature review was performed on salivary gland adenoid cystic carcinoma and basic science research findings. Results This review highlights many findings that are emerging about the carcinogenesis of ACC including cytogenetics, tumor suppressor genes, oncogenes, epigenetic alterations, mitochondrial alterations, and biomarker studies. Conclusions While there have been many discoveries, much still remains unknown about this rare malignancy. PMID:22006498

Metastasis of breast carcinoma to a primary mucinous cystadenocarcinoma of the ovary.

PubMed

Twaalfhoven, F C; Fleuren, G J; Cornelisse, C J; Peters, A A; Trimbos, J B; Hogendoorn, P C

1994-01-01

A case of a patient with breast cancer metastatic within the tumor stroma of a primary ovarian carcinoma is presented. This finding is to the best of our knowledge the first case reported. The encountered diagnostic problems are discussed. A distinct peroperative frozen section diagnosis on the large, cystic, partially necrotic ovarian mass was not possible because of sampling problems. A comparable immunohistochemical staining pattern of cells being CEA negative, OC-125 negative, and HMFG-1 positive was found in both the primary breast tumor and in the solid epithelial parts in the tumor stroma of the left-sided ovarian carcinoma, as well as in the stroma of the right ovary. Immunohistochemical findings in the left-sided epithelial cystic ovarian tumor showed, as expected, apical reactivity with antibodies directed against CEA, whereas OC-125 and HMFG-1 were negative. Ploidy analysis showed that the primary breast carcinoma and the stromal part of left ovarian malignancy had the same aneuploid stemlines (DNA index = 1.18). The epithelial lining of the cystic ovarium carcinoma not showing the presence of metastatic lesion in the stroma showed the presence of a diploid GO,1 population only. These results show that DNA flow cytometry and immunohistochemistry may be helpful in assessing the origin of the malignancies in this unusual double presentation of both metastatic breast cancer and primary ovarian carcinoma.

WHOLE-GENOME SEQUENCING OF SALIVARY GLAND ADENOID CYSTIC CARCINOMA

PubMed Central

Rettig, Eleni M; Talbot, C Conover; Sausen, Mark; Jones, Sian; Bishop, Justin A; Wood, Laura D; Tokheim, Collin; Niknafs, Noushin; Karchin, Rachel; Fertig, Elana J; Wheelan, Sarah J; Marchionni, Luigi; Considine, Michael; Ling, Shizhang; Fakhry, Carole; Papadopoulos, Nickolas; Kinzler, Kenneth W; Vogelstein, Bert; Ha, Patrick K; Agrawal, Nishant

2016-01-01

Adenoid cystic carcinomas (ACCs) of the salivary glands are challenging to understand, treat, and cure. To better understand the genetic alterations underlying the pathogenesis of these tumors, we performed comprehensive genome analyses of 25 fresh-frozen tumors, including whole genome sequencing, expression and pathway analyses. In addition to the well-described MYB-NFIB fusion which was found in 11 tumors (44%), we observed five different rearrangements involving the NFIB transcription factor gene in seven tumors (28%). Taken together, NFIB translocations occurred in 15 of 25 samples (60%, 95%CI=41–77%). In addition, mRNA expression analysis of 17 tumors revealed overexpression of NFIB in ACC tumors compared with normal tissues (p=0.002). There was no difference in NFIB mRNA expression in tumors with NFIB fusions compared to those without. We also report somatic mutations of genes involved in the axonal guidance and Rho family signaling pathways. Finally, we confirm previously described alterations in genes related to chromatin regulation and Notch signaling. Our findings suggest a separate role for NFIB in ACC oncogenesis and highlight important signaling pathways for future functional characterization and potential therapeutic targeting. PMID:26862087

Gamma-Secretase/Notch Signalling Pathway Inhibitor RO4929097 and Temsirolimus in Treating Patients With Advanced Solid Tumors

ClinicalTrials.gov

2014-05-29

Endometrial Papillary Serous Carcinoma; Recurrent Endometrial Carcinoma; Recurrent Renal Cell Cancer; Stage III Endometrial Carcinoma; Stage III Renal Cell Cancer; Stage IV Endometrial Carcinoma; Stage IV Renal Cell Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Challenges in Pathologic Staging of Renal Cell Carcinoma: A Study of Interobserver Variability Among Urologic Pathologists.

PubMed

Williamson, Sean R; Rao, Priya; Hes, Ondrej; Epstein, Jonathan I; Smith, Steven C; Picken, Maria M; Zhou, Ming; Tretiakova, Maria S; Tickoo, Satish K; Chen, Ying-Bei; Reuter, Victor E; Fleming, Stewart; Maclean, Fiona M; Gupta, Nilesh S; Kuroda, Naoto; Delahunt, Brett; Mehra, Rohit; Przybycin, Christopher G; Cheng, Liang; Eble, John N; Grignon, David J; Moch, Holger; Lopez, Jose I; Kunju, Lakshmi P; Tamboli, Pheroze; Srigley, John R; Amin, Mahul B; Martignoni, Guido; Hirsch, Michelle S; Bonsib, Stephen M; Trpkov, Kiril

2018-06-06

Staging criteria for renal cell carcinoma differ from many other cancers, in that renal tumors are often spherical with subtle, finger-like extensions into veins, renal sinus, or perinephric tissue. We sought to study interobserver agreement in pathologic stage categories for challenging cases. An online survey was circulated to urologic pathologists interested in kidney tumors, yielding 89% response (31/35). Most questions included 1 to 4 images, focusing on: vascular and renal sinus invasion (n=24), perinephric invasion (n=9), and gross pathology/specimen handling (n=17). Responses were collapsed for analysis into positive and negative/equivocal for upstaging. Consensus was regarded as an agreement of 67% (2/3) of participants, which was reached in 20/33 (61%) evaluable scenarios regarding renal sinus, perinephric, or vein invasion, of which 13/33 (39%) had ≥80% consensus. Lack of agreement was especially encountered regarding small tumor protrusions into a possible vascular lumen, close to the tumor leading edge. For gross photographs, most were interpreted as suspicious but requiring histologic confirmation. Most participants (61%) rarely used special stains to evaluate vascular invasion, usually endothelial markers (81%). Most agreed that a spherical mass bulging well beyond the kidney parenchyma into the renal sinus (71%) or perinephric fat (90%) did not necessarily indicate invasion. Interobserver agreement in pathologic staging of renal cancer is relatively good among urologic pathologists interested in kidney tumors, even when selecting cases that test the earliest and borderline thresholds for extrarenal extension. Disagreements remain, however, particularly for tumors with small, finger-like protrusions, closely juxtaposed to the main mass.

[Pleural metastases of renal carcinoma].

PubMed

Giigoruk, O G; Lazarev, A F; Doroshenko, V S

2007-01-01

Metastases in renal carcinoma are diagnosed at initial diagnosis in 25% examinees. Traditional renal carcinoma has higher metastatic potential, is associated with worse survival of the patients compared to papillary cancer. We studied cytological characteristics of renal carcinoma metastases to the pleura in comparison with histological studies of the primary lesion using immunohistochemical findings. We examined cytologically pleural liquid in renal carcinoma metastases to the pleura in 6 patients (2.3% of carcinomatous pleuricies). High efficacy was shown by a cytocentrifuge CYTOSPIN-4. In 3 cases initial cancer was renal cell carcinoma, pleural exudation developed 2 years later, clear cell carcinoma appeared 6 years later and papillary cancer--10 years later. In the other 3 cases malignant cells were detected in new-onset cases. Renal carcinoma was diagnosed in one case. Cytological preparations were studied with identification of cytological signs typical for classic clear cell, granulocell and papillary renal cancer. Immunohistochemical examination of primary tumor lesion in the kidney discovered high proliferative activity of tumor cells by Ki-67 index to 5.28%. The tumors had solitary Bcl-2 positive cells. Expression of mutant p-53 took place in 0.93%. Her-2/neu hyperexpression was not found in the tumors of the above patients. Such immunohistochemical parameters point to poor prognosis. This is confirmed by renal carcinoma metastases to the pleura.

Inhibition of Focal Adhesion Kinase (FAK) Leads to Abrogation of the Malignant Phenotype in Aggressive Pediatric Renal Malignancies

PubMed Central

Megison, Michael L.; Gillory, Lauren A.; Stewart, Jerry E.; Nabers, Hugh C.; Mrozcek-Musulman, Elizabeth; Beierle, Elizabeth A.

2014-01-01

Despite the tremendous advances in the treatment of childhood kidney tumors, there remain subsets of pediatric renal tumors that continue to pose a therapeutic challenge, mainly malignant rhabdoid kidney tumors and non-osseous renal Ewing sarcoma. Children with advanced, metastatic or relapsed disease have a disease-free survival rate under 30%. Focal adhesion kinase (FAK) is a nonreceptor tyrosine kinase that is important in many facets of tumor development and progression. FAK has been found in other pediatric solid tumors and in adult renal cellular carcinoma, leading us to hypothesize that FAK would be present in pediatric kidney tumors and would impact their cellular survival. In the current study, we showed that FAK was present and phosphorylated in pediatric kidney tumor specimens. We also examined the effects of FAK inhibition upon G401 and SK-NEP-1 cell lines utilizing a number of parallel approaches to block FAK including RNAi and small molecule FAK inhibitors. FAK inhibition resulted in decreased cellular survival, invasion and migration, and increased apoptosis. Further, small molecule inhibition of FAK led to decreased tumor growth in a nude mouse SK-NEP-1 xenograft model. The findings from this study will help to further our understanding of the regulation of tumorigenesis in rare pediatric renal tumors, and may provide desperately needed novel therapeutic strategies and targets for these rare, but difficult to treat, malignancies. PMID:24464916

Metastatic tonsillar squamous cell carcinoma masquerading as a pancreatic cystic tumor and diagnosed by EUS-guided FNA.

PubMed

Glass, Ryan; Andrawes, Sherif A; Hamele-Bena, Diane; Tong, Guo-Xia

2017-11-01

Metastatic carcinoma to the pancreas is uncommon and head and neck squamous carcinoma metastatic to the pancreas is extremely rare. Metastatic squamous cell carcinoma to the pancreas presents a unique diagnostic challenge: in addition to mimicking the rare primary squamous cell carcinoma of the pancreas based on cytologic, histologic, and immunohistochemical features, it may be mistaken for a cystic neoplasm of the pancreas because of its high predilection for cystic degeneration in metastatic sites. Herein, we report a case of tonsillar squamous cell carcinoma with a cystic pancreatic metastasis diagnosed by ultrasound-guided fine needle aspiration biopsy (EUS-FNA). This represents a third reported case of metastatic squamous cell carcinoma to the pancreas from the head and neck region. Metastatic squamous cell carcinoma should be considered in the differential diagnosis of EUS-FNA during evaluation of pancreatic cystic lesion. © 2017 Wiley Periodicals, Inc.

Adenoid cystic carcinoma of the urethra/Cowper's gland with concurrent high-grade prostatic adenocarcinoma: a detailed clinicopathologic case report and review of the literature.

PubMed

Zhang, Miao; Pettaway, Curtis; Vikram, Raghu; Tamboli, Pheroze

2016-12-01

Primary adenoid cystic carcinoma of the urethra is uncommon with only 9 cases reported in the medical literature; all tumors arose from Cowper's glands. Herein, we report the histological features and immunohistochemical characteristics of 1 patient with primary adenoid cystic carcinoma involving the entire posterior urethra, prostate gland, corpus spongiosum, corpora cavernosa, urogenital diaphragm, perianal soft tissue, and muscularis propria layer of rectum. We also review other published cases to evaluate the prognosis and treatment. Copyright © 2016 Elsevier Inc. All rights reserved.

Hand-assisted laparoscopic radical nephrectomy in the treatment of a renal cell carcinoma with a level II vena cava thrombus.

PubMed

Kovac, Jason R; Luke, Patrick P

2010-01-01

Excision of renal cell carcinoma (RCC) with corresponding vena cava thrombus is a technical challenge requiring open resection and vascular clamping. A 58 year old male with a right kidney tumor presented with a thrombus extending 1 cm into the vena cava. Using a hand-assisted transperitoneal approach through a 7 cm gel-port, the right kidney was dissected and the multiple vascular collaterals supplying the tumor were identified and isolated. The inferior vena cava was mobilized 4 cm cephalad and 4 cm caudal to the right renal vein. Lateral manual traction was applied to the right kidney allowing the tumor thrombus to be retracted into the renal vein, clear of the vena cava. After laparoscopic ultrasonographic confirmation of the location of the tip of the tumor thrombus, an articulating laparoscopic vascular stapler was used to staple the vena cava at the ostium of the right renal vein. This allowed removal of the tumor thrombus without the need for a Satinsky clamp. The surgery was completed in 243 minutes with no intra-operative complications. The entire kidney and tumor thrombus was removed with negative surgical margins. Estimated blood loss was 300 cc. We present a laparoscopic resection of a renal mass with associated level II thrombus using a hand-assisted approach. In patients with minimal caval involvement, our surgical approach presents an option to the traditional open resection of a renal mass.

Lung transplantation in patients with cystic fibrosis.

PubMed

Morton, Judith; Glanville, Allan R

2009-10-01

Cystic fibrosis is one of the most common indications for lung transplantation worldwide and certainly the most common indication for all pediatric lung transplants and for bilateral lung transplantation irrespective of age. Outcomes are outstanding when compared with other indications for lung transplantation, and an increasing number of centers now report mean survival of greater than 10 years posttransplant. Hence it is important to concentrate on the broad panoply of potential systemic complications of cystic fibrosis and address proactively issues that may be associated with adverse outcomes. Optimum management of infectious, nutritional, diabetic, renal, bone, and gut complications is critical to long-term success so that recipients may realize their full potential. Timing of referral for consideration of active listing should allow sufficient time for the patient and lung transplant team to develop a productive working relationship based on best available evidence and mutual trust, which will culminate in a long-term successful outcome. Copyright Thieme Medical Publishers.

Biomarkers of Renal Tumor Burden and Progression in TSC

DTIC Science & Technology

2012-09-01

code) Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 Biomarkers of Renal Tumor Burden and Progression in TSC Dr. Elahna Paul 1...appearance and growth rates) and renal function parameters (e.g. blood pressure, serum chemistries, urinalysis and urine chemistries). (2) Measure...and renal function parameters (e.g. blood pressure, serum chemistries, urinalysis and urine chemistries). (2) Measure soluble growth factors

Magnetic resonance imaging characteristics and the prediction of outcome of vestibular schwannomas following Gamma Knife radiosurgery.

PubMed

Wu, Chih-Chun; Guo, Wan-Yuo; Chung, Wen-Yuh; Wu, Hisu-Mei; Lin, Chung-Jung; Lee, Cheng-Chia; Liu, Kang-Du; Yang, Huai-Che

2017-12-01

OBJECTIVE Gamma Knife surgery (GKS) is a promising treatment modality for patients with vestibular schwannomas (VSs), but a small percentage of patients have persistent postradiosurgical tumor growth. The aim of this study was to determine the clinical and quantitative MRI features of VS as predictors of long-term tumor control after GKS. METHODS The authors performed a retrospective study of all patients with VS treated with GKS using the Leksell Gamma Knife Unit between 2005 and 2013 at their institution. A total of 187 patients who had a minimum of 24 months of clinical and radiological assessment after radiosurgery were included in this study. Those who underwent a craniotomy with tumor removal before and after GKS were excluded. Study patients comprised 85 (45.5%) males and 102 (54.5%) females, with a median age of 52.2 years (range 20.4-82.3 years). Tumor volumes, enhancing patterns, and apparent diffusion coefficient (ADC) values were measured by region of interest (ROI) analysis of the whole tumor by serial MRI before and after GKS. RESULTS The median follow-up period was 60.8 months (range 24-128.9 months), and the median treated tumor volume was 3.54 cm 3 (0.1-16.2 cm 3 ). At last follow-up, imaging studies indicated that 150 tumors (80.2%) showed decreased tumor volume, 20 (10.7%) had stabilized, and 17 (9.1%) continued to grow following radiosurgery. The postradiosurgical outcome was not significantly correlated with pretreatment volumes or postradiosurgical enhancing patterns. Tumors that showed regression within the initial 12 months following radiosurgery were more likely to have a larger volume reduction ratio at last follow-up than those that did not (volume reduction ratio 55% vs 23.6%, respectively; p < 0.001). Compared with solid VSs, cystic VSs were more likely to regress or stabilize in the initial postradiosurgical 6-12-month period and during extended follow-up. Cystic VSs exhibited a greater volume reduction ratio at last follow-up (cystic vs solid: 67.6% ± 24.1% vs 31.8% ± 51.9%; p < 0.001). The mean preradiosurgical maximum ADC (ADC max ) values of all VSs were significantly higher for those with tumor regression or stabilization at last follow-up compared with those with progression (2.391 vs 1.826 × 10 -3 mm 2 /sec; p = 0.010). CONCLUSIONS Loss of central enhancement after radiosurgery was a common phenomenon, but it did not correlate with tumor volume outcome. Preradiosurgical MRI features including cystic components and ADC max values can be helpful as predictors of treatment outcome.

Multiple Renal Artery Pseudoaneurysms in Patients Undergoing Renal Artery Embolization Following Partial Nephrectomy: Correlation with RENAL Nephrometry Scores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta, Nakul; Patel, Anish; Ensor, Joe

PurposeTo describe the incidence of multiple renal artery pseudoaneurysms (PSA) in patients referred for renal artery embolization following partial nephrectomy and to study its relationship to RENAL nephrometry scores.Materials and MethodsThe medical records of 25 patients referred for renal artery embolization after partial nephrectomy were retrospectively reviewed for the following parameters: size and number of tumors, RENAL nephrometry scores, angiographic abnormalities, technical and clinical outcomes, and estimated glomerular filtration rates (eGFRs) after embolization.ResultsTwenty-four patients had primary renal tumors, while 1 patient had a pancreatic tumor invading the kidney. Multiple tumors were resected in 4 patients. Most patients (92 %) were symptomatic,more » presenting with gross hematuria, flank pain, or both. Angiography revealed PSA with (n = 5) or without (n = 20) AV fistulae. Sixteen patients (64 %) had multiple PSA involving multiple renal vessels. Higher RENAL nephrometry scores were associated with an increasing likelihood of multiple PSA. Multiple vessels were embolized in 14 patients (56 %). Clinical success was achieved after one (n = 22) or two (n = 3) embolization sessions in all patients. Post-embolization eGFR values at different time points after embolization were not significantly different from the post-operative eGFR.ConclusionA majority of patients requiring renal artery embolization following partial nephrectomy have multiple pseudoaneurysms, often requiring selective embolization of multiple vessels. Higher RENAL nephrometry score is associated with an increasing likelihood of multiple pseudoaneurysms. We found transarterial embolization to be a safe and effective treatment option with no long-term adverse effect on renal function in all but one patient with a solitary kidney.« less

Testis tumor associated to microlithiasis

PubMed Central

de Jesus, Lisieux Eyer; Maciel, Felipe; Monnerat, Andrea Lima C.; Fernandes, Marcia Antunes; Dekermache, Samuel

2013-01-01

OBJECTIVE: To discuss the relationship between testicular microlithiasis and testis tumors in children and to consider the chances of testis preserving surgery in specific cases. CASE DESCRIPTION: Pre-adolescent presenting testicular microlithiasis and a larger left testis, corresponding to a cystic testicular tumor. The tumor was excised, with ipsilateral testis preservation. Histology diagnosed a testis dermoid tumor. COMMENTS: The relationship between testis tumors and testicular microlithiasis is ill defined in children. Pediatric urologists need to develop specific follow-up protocols for pre-pubertal children. PMID:24473964

Impact of Ischemia and Procurement Conditions on Gene Expression in Renal Cell Carcinoma

PubMed Central

Liu, Nick W.; Sanford, Thomas; Srinivasan, Ramaprasad; Liu, Jack L.; Khurana, Kiranpreet; Aprelikova, Olga; Valero, Vladimir; Bechert, Charles; Worrell, Robert; Pinto, Peter A.; Yang, Youfeng; Merino, Maria; Linehan, W. Marston; Bratslavsky, Gennady

2013-01-01

Purpose Previous studies have shown that ischemia alters gene expression in normal and malignant tissues. There are no studies that evaluated effects of ischemia in renal tumors. This study examines the impact of ischemia and tissue procurement conditions on RNA integrity and gene expression in renal cell carcinoma. Experimental Design Ten renal tumors were resected without renal hilar clamping from 10 patients with renal clear cell carcinoma. Immediately after tumor resection, a piece of tumor was snap frozen. Remaining tumor samples were stored at 4C, 22C and 37C and frozen at 5, 30, 60, 120, and 240 minutes. Histopathologic evaluation was performed on all tissue samples, and only those with greater than 80% tumor were selected for further analysis. RNA integrity was confirmed by electropherograms and quantitated using RIN index. Altered gene expression was assessed by paired, two-sample t-test between the zero time point and aliquots from various conditions obtained from the same tumor. Results One hundred and forty microarrays were performed. Some RNA degradation was observed 240 mins after resection at 37C. The expression of over 4,000 genes was significantly altered by ischemia times or storage conditions. The greatest gene expression changes were observed with longer ischemia time and warmer tissue procurement conditions. Conclusion RNA from kidney cancer remains intact for up to 4 hours post surgical resection regardless of storage conditions. Despite excellent RNA preservation, time after resection and procurement conditions significantly influence gene expression profiles. Meticulous attention to pre-acquisition variables is of paramount importance for accurate tumor profiling. PMID:23136194

[Treatment of lymphangiomas with picibanil in the first year of life].

PubMed

Subotic, U; Hosie, S; Waag, K L; Reinshagen, K

2008-01-01

The therapeutic gold standard of cystic hygroma is its complete resection. Because of its growth pattern and its main location in the head and neck region complete resection is not always possible. An alternative is the local injection of Picibanil, but only few cases have been published about its use in infants. We retrospectively analyzed the data of 8 infants (age: 2 weeks-12 months) who got Picibanil therapy because of cystic hygroma in the time period 2002 until 2006. Follow up ranged from 3 months up to 3 years. During the postoperative period all patients had local swelling, in 4 cases accompanied with local inflammation and fever. Tumor reduction of >50% was obtained in 7 of 8 patients. Local injection of Picibanil in infants with cystic hygroma seems to be a safe alternative to surgical therapy, especially when complete tumor resection means damage of important neighbouring structures. Prospective trials are necessary to confirm the better outcome after therapy with Picibanil compare to primary surgery.

Expression and clinical value of the soluble major histocompatibility complex class I-related chain A molecule in the serum of patients with renal tumors.

PubMed

Zhao, Y-K; Jia, C-M; Yuan, G-J; Liu, W; Qiu, Y; Zhu, Q-G

2015-06-29

We investigated the expression and clinical value of the soluble major histocompatibility complex class I-related chain A (sMICA) molecule in the serum of patients with renal tumors. Sixty patients diagnosed with renal tumors were enrolled in the experimental group, whereas 20 healthy volunteers served as the control group. The sMICA levels were measured via enzyme-linked immunosorbent assay, and the results were analyzed in combination with data from pathol-ogy examination. The experimental group had a statistically significant higher sMICA level (P < 0.05) than the control group. The sMICA level was higher in patients with malignant tumors than in those with be-nign tumors. We also observed a positive relationship among different tumor-node-metastasis (TNM) pathological stages with more advanced diseases exhibiting higher sMICA levels. As a tumor-associated antigen, MICA has a close relationship with renal tumorigenesis and immune es-cape. Our results indicated that sMICA levels were related to tumor pathol-ogy, TNM stage, and metastasis. Therefore, sMICA might be a potential marker for tumor characteristics, prognosis, and recurrence prediction.

/sup 75/Se-selenomethionine scintigraphy in mediastinal diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Masaoka, A.; Kyo, S.

1978-03-01

Chest scanning with /sup 75/Se-selenomethionine was performed in 59 cases of mediastinal diseases. All cases of vascular diseases, cystic tumors, and benign neurogenic tumor were negatively scanned. Parenchymatous teratoma, thymoma, malignant lymphoma, Castleman's tumor, epithelial tumors, tuberculous lymphadenitis, and sarcoidosis showed high positive rates. In myasthenic thymus without thymoma two out of 15 cases were positive. The scan images of the resected specimens and preoperative chest scannings coincided.

Renal cell carcinoma: the influence of new diagnostic imaging techniques on the size and stage of tumors diagnosed over the past 26 years.

PubMed

Touloupidis, Stavros; Papathanasiou, Athanasios; Kalaitzis, Christos; Fatles, Georgios; Manavis, Ioannis; Rombis, Vassilios

2006-01-01

We have analyzed data collected over a 26-year period for influences of new diagnostic imaging techniques (ultrasound, computed tomography, and magnetic resonance imaging) on the size, stage, and other parameters of renal cell carcinomas at the time of first diagnosis. We reviewed retrospectively the records of 203 patients who underwent operations at our institutions from 1973 to 1999. All the patients suffered from renal cell carcinoma. With this study we attempted to answer four questions regarding changes over this time span: (1) have new imaging techniques lead to a reduction in the median diameter of the tumor upon first diagnosis, (2) has the tumor stage decreased due to earlier diagnosis, (3) is there any correlation between tumor size and tumor stage, and (4) are the patient's early diagnoses at a younger age? Other parameters such as infiltration of the renal pelvis and the cell type were also examined. The tumor size and stage at the time of diagnosis and treatment are positively correlated, and both decrease significantly over the time span examined. There is also a strong association between tumor size and infiltration of the renal pelvis. The median age of the patients did not significantly change over time. The wider use of improved imaging techniques has significantly changed the clinical appearance of the renal cell carcinoma. The question is whether these techniques have also affected the prognosis of the disease.

Coexistence between renal cell cancer and Hodgkin's lymphoma: A rare coincidence

PubMed Central

Jimenez I, Victor H

2006-01-01

Background Renal cell carcinoma is the most common kidney tumor in adults and accounts for approximately 3% of adult malignancies. An increased incidence of second malignancies has been well documented in a number of different disorders, such as head and neck tumors, and hairy cell leukemia. In addition, treatment associated second malignancies (usually leukemias and lymphomas but also solid tumors) have been described in long term survivors of Hodgkin's lymphoma (HL), Non Hodgkin's lymphoma and in various pediatric tumors. Case presentation We present the case of a 66 year-old woman with abdominal pain and dyspnea. We performed a thorax CT scan that showed lymph nodes enlargement and subsequently by presence of abdominal pain was performed an abdominal and pelvis CT scan that showed a right kidney tumor of 4 × 5 cms besides of abdominal lymph nodes enlargement. A radical right nephrectomy was designed and Hodgkin's lymphoma was diagnosed in the abdominal lymph nodes while renal cell tumor exhibited a renal cell cancer. Patient received EVA protocol achieving complete response. Conclusion We described the first case reported in the medical literature of the coexistence between Hodgkin's lymphoma and renal cell cancer. Previous reports have shown the relationship of lymphoid neoplasms with solid tumors, but they have usually described secondary forms of cancer related to chemotherapy. PMID:16549035

Metastatic Adenoid Cystic Carcinoma Mimicking Butterfly Glioblastoma: A Rare Presentation in the Splenium of the Corpus Callosum.

PubMed

Garber, Sarah T; Khoury, Laith; Bell, Diana; Schomer, Donald F; Janku, Filip; McCutcheon, Ian E

2016-11-01

Intracranial spread of an adenoid cystic carcinoma (ACC) of the parotid gland is rare, and metastatic ACC to the splenium of the corpus callosum mimicking butterfly glioblastoma (GBM) has not been reported previously. We report a rare case of metastasis to the splenium of the corpus callosum from ACC of the parotid gland. The tumor occupied the splenium and mimicked the presentation of a butterfly glioma. The patient had undergone parotidectomy 5 years before presentation with this intracranial lesion. On magnetic resonance imaging, the lesion was separate from the pineal gland and displaced the internal cerebral veins downward. Ventricular obstruction and increased cellularity were also suggested, and multiple fluid-filled cystic spaces were observed. The tumor was partially resected, because the extreme lateral boundary could not be visualized. Histological analysis with anti-c-kit antibody showed strong expression of the epithelial component; immunohistochemistry with anti-p63 antibody revealed nests of positive tumor cells, highlighting the myoepithelial component. The tumor also stained positive for anti-Myb antibody. The treatment for this lesion is surgical debulking followed by radiation therapy; however, the overall prognosis remains grim because of limited chemotherapy options and a propensity for recurrence in both local and distant fashions. When a tumor with adenoid histological features and a "butterfly" phenotype grows in the corpus callosum in a patient with known parotid ACC, both metastasis and adenoid variant GBM should be considered. Careful clinical and radiological correlation is required to diagnose and treat this rare lesion. Copyright © 2016 Elsevier Inc. All rights reserved.

[Recurrent duodenal ulcer bleeding as the first manifestation of a solid pseudopapillary neoplasm of the pancreas with hepatic metastases].

PubMed

Schlitter, A M; Konukiewitz, B; Kleeff, J; Klöppel, G; Esposito, I

2013-05-01

In a 17-year-old girl recurrent duodenal ulcer bleeding had led to severe anemia. Sonography and computed tomography revealed a partially cystic tumour of the pancreatic head and suspicious hepatic lesions. TREATMENT AND PATHOLOGICAL DIAGNOSIS: A partial duodenopancreatectomy was performed and two liver metastases were resected. Histological examination of the resected pancreatic specimen revealed a solid pseudopapillary neoplasm of the pancreas (SPN) with hepatic metastases. CLINICAL COURSE AND PROGNOSIS: The seven remaining liver metastases were removed in a second procedure (right hepatectomy). One year later two new liver metastases were treated by radiofrequency ablation. Two years after the initial operation, the patient is well and tumor-free. SPN is a rare cystic tumor that is mainly found in young women. Direct tumor infiltration of stomach or duodenum can cause gastrointestinal bleedings in rare cases. Resection of the primary tumor and surgical or interventional removal of metastases are the treatment of choice. © Georg Thieme Verlag KG Stuttgart · New York.

[Secondary telangiectatic osteosarcoma of the left femur. A case presentation of an unusual course of disease].

PubMed

Zajonz, D; Werner, M; Panzert, S; Strübing, A S; Tiepolt, S; Fabsits, E; Brandmaier, P; Heyde, C-E; Prietzel, T

2014-05-01

This article presents the unusual case of a 73-year-old male patient who was treated with primary interlocking nailing after a pathological femoral fracture. Despite comprehensive diagnostics including several biopsies, a tumor could not be detected. In 2008 when progressive cystic femoral destruction leading to loosening of the nail necessitated a partial femoral prosthesis, an osteosarcoma could first be diagnosed in the resected bone. Advanced progression of the tumor required an extended hip exarticulation. During the current restaging of the now 84-year-old patient no tumor could be detected. When a malignancy cannot be excluded even by repeated biopsies of radiologically suspicious structures, an adequate tumor staging followed by close monitoring should be carried out. For a clinically silent, long-term course of cystic destruction of a long bone over several years, an age over 60 years and a lack of distant metastases, an atypical osteosarcoma should be considered in the differential diagnosis.

Adenoid cystic carcinoma: A review of recent advances, molecular targets, and clinical trials.

PubMed

Dillon, Patrick M; Chakraborty, Samhita; Moskaluk, Christopher A; Joshi, Prashant J; Thomas, Christopher Y

2016-04-01

Adenoid cystic carcinoma (ACC) is a rare tumor of secretory glands. In this study, recent advances in molecular characterization and in therapeutics are reviewed. A search of articles in PubMed and of abstracts from national meetings was performed regarding ACC. Recent genetic analyses found that recurrent chromosome 6:9 translocations in ACC generate an MYB:NFIB gene fusion resulting in overexpression of the MYB oncoprotein. Several other frequent mutations are recently published that may be relevant for drug development. Several trials of targeted drugs are reviewed. Some agents delay tumor progression, but tumor responses remain rare. ACCs have a characteristic chromosomal translocation, but also frequently pick up additional mutations. Clinical research is limited by the rarity and slow growth of ACC. Several ongoing trials are testing agents that inhibit fibroblast growth factor receptor signaling or other signaling pathways. Novel treatments based on the recently sequenced tumor genome are under development. © 2015 Wiley Periodicals, Inc.

Schwannomatosis presenting as pancreatic and submandibular gland schwannoma.

PubMed

Val-Bernal, José Fernando; Mayorga, Marta; Sedano-Tous, María José

2013-12-01

Schwannomatosis is a well-established third form of neurofibromatosis, characterized by the presence of multiple non-vestibular, non-intradermal schwannomas, often associated with chronic pain. Herein, we report a 41-year-old man with a history of paternal neurofibromatosis 1, who presented with partially cystic tumors in the pancreas and in the right submandibular gland. Besides, he complained of neuropathic pain in the right inguinal and suprapubic area. Magnetic resonance imaging revealed multiple intradural-extramedullary tumors at the cervical, thoracic and lumbar spinal canal, suggestive of schwannomas. The vestibular nerves were not involved. Pathological examination of the glandular tumors disclosed benign schwannomas. These tumors had substantial myxoid stroma and prominent cystic change, and showed a mosaic pattern of loss of INI1/SMARCB1 expression by immunohistochemistry. Later, the patient developed three nodules in the right lung which were interpreted as schwannomas. To our knowledge, this is the first report of schwannomatosis presenting as pancreatic and salivary gland schwannomas. Copyright © 2013 Elsevier GmbH. All rights reserved.

Significant impact of R.E.N.A.L. nephrometry score on changes in postoperative renal function early after robot-assisted partial nephrectomy.

PubMed

Miyake, Hideaki; Furukawa, Junya; Hinata, Nobuyuki; Muramaki, Mototsugu; Tanaka, Kazushi; Fujisawa, Masato

2015-06-01

Our objective was to evaluate the significance of the R.E.N.A.L. nephrometry score (RNS)--developed to quantitatively evaluate the complexity of renal tumors in a reproducible manner--in perioperative and renal functional outcomes following robot-assisted partial nephrectomy (RAPN). This study assessed 48 consecutive patients with renal tumors who underwent RAPN. Preoperative RNS for each patient was calculated, and its impact on several parameters associated with perioperative outcomes, including postoperative renal function, was investigated with Spearman's rank correlation test. Mean RNS in the 48 patients was 6.8; of these 48 patients, 21 (43.7%), 24 (50.0%), and three (6.3%) were classified into low-, moderate-, and high-complexity groups, respectively. The RNS was significantly correlated with resected tumor weight and postoperative changes in estimated glomerular filtration rate (eGFR) at both 1 and 4 weeks--but not age, body mass index (BMI), preoperative eGFR, operative time, warm ischemia time, estimated blood loss, postoperative complications, or eGFR-- after RAPN. No component of the RNS (R: radius; E: exophytic/endophytic properties; N: nearness of tumor to the collecting system or sinus; A: anterior/posterior; L: location relative to polar lines) alone had a significant impact on postoperative changes in eGFR at 1 and 4 weeks, whereas resected tumor weight was significantly associated with the R and E subcategories. Measurement of total RNS is useful for predicting renal functional outcomes early after RAPN.

Lung Cancers Associated with Cystic Airspaces: Underrecognized Features of Early Disease.

PubMed

Sheard, Sarah; Moser, Joanna; Sayer, Charlie; Stefanidis, Konstantinos; Devaraj, Anand; Vlahos, Ioannis

2018-01-01

Early lung cancers associated with cystic airspaces are increasingly being recognized as a cause of delayed diagnoses-owing to data gathered from screening trials and encounters in routine clinical practice as more patients undergo serial imaging. Several morphologic subtypes of cancers associated with cystic airspaces exist and can exhibit variable patterns of progression as the solid elements of the tumor grow. Current understanding of the pathogenesis of these malignancies is limited, and the numbers of cases reported in the literature are small. However, several tumor cell types are represented in these lesions, with adenocarcinoma predominating. The features of cystic airspaces differ among cases and include emphysematous bullae, congenital or fibrotic cysts, subpleural blebs, bronchiectatic airways, and distended distal airspaces. Once identified, these cystic lesions pose management challenges to radiologists in terms of distinguishing them from benign mimics of cancer that are commonly seen in patients who also are at increased risk of lung cancer. Rendering a definitive tissue-based diagnosis can be difficult when the lesions are small, and affected patients tend to be in groups that are at higher risk of requiring biopsy or resection. In addition, the decision to monitor these cases can add to patient anxiety and cause the additional burden of strained departmental resources. The authors have drawn from their experience, emerging evidence from international lung cancer screening trials, and large databases of lung cancer cases from other groups to analyze the prevalence and evolution of lung cancers associated with cystic airspaces and provide guidance for managing these lesions. Although there are insufficient data to support specific management guidelines similar to those for managing small solid and ground-glass lung nodules, these data and guidelines should be the direction for ongoing research on early detection of lung cancer. © RSNA, 2018.

Acid, basic, and neutral peptidases present different profiles in chromophobe renal cell carcinoma and in oncocytoma.

PubMed

Blanco, Lorena; Larrinaga, Gorka; Pérez, Itxaro; López, José I; Gil, Javier; Agirregoitia, Ekaitz; Varona, Adolfo

2008-04-01

Renal cell carcinomas (RCCs) are neoplasias with high prevalence and mortality. We previously reported that several peptidases may be involved in the pathophysiology of clear cell renal cell carcinoma (CCRCC). Now, to gain insight into the reasons that lead the various RCC types to behave very differently with regard to aggressiveness and response to anticancer treatments, we analyzed subsets of chromophobe renal cell carcinoma (ChRCC), and renal oncocytoma (RO), a benign tumor; as well as different grades and stages of CCRCCs. Particulate APN, APB, and APA activities were decreased in both ChRCC and RO (tumor vs. nontumor tissues). Interestingly, activities were downregulated in a tumor-type specific way and the intensities of the decreases were stronger in the benign tumor than in the malignant type. Moreover, when two key histopathological parameters for tumor prognosis (high vs. low stage and grade) were analyzed, increases of activity were also observed in several of these cell surface peptidases (APN, APB). Some soluble activities (APB, Asp-AP) were also downregulated in the RCCs. With respect to genetic expression, PSA and APN were in a positive correlation related to their activities in both ChRCC and RO; but not APB, Asp-AP, APA, and PGI. These results may suggest an involvement of several peptidases in the pathophysiology of renal cancer, since they presented different patterns of activity and expression in tumors with different behaviors.

Network for Early Onset Cystic Kidney Diseases—A Comprehensive Multidisciplinary Approach to Hereditary Cystic Kidney Diseases in Childhood

PubMed Central

König, Jens Christian; Titieni, Andrea; Konrad, Martin; Bergmann, C.

2018-01-01

Hereditary cystic kidney diseases comprise a complex group of genetic disorders representing one of the most common causes of end-stage renal failure in childhood. The main representatives are autosomal recessive polycystic kidney disease, nephronophthisis, Bardet–Biedl syndrome, and hepatocyte nuclear factor-1beta nephropathy. Within the last years, genetic efforts have brought tremendous progress for the molecular understanding of hereditary cystic kidney diseases identifying more than 70 genes. Yet, genetic heterogeneity, phenotypic variability, a lack of reliable genotype–phenotype correlations and the absence of disease-specific biomarkers remain major challenges for physicians treating children with cystic kidney diseases. To tackle these challenges comprehensive scientific approaches are urgently needed that match the ongoing “revolution” in genetics and molecular biology with an improved efficacy of clinical data collection. Network for early onset cystic kidney diseases (NEOCYST) is a multidisciplinary, multicenter collaborative combining a detailed collection of clinical data with translational scientific approaches addressing the genetic, molecular, and functional background of hereditary cystic kidney diseases. Consisting of seven work packages, including an international registry as well as a biobank, NEOCYST is not only dedicated to current scientific questions, but also provides a platform for longitudinal clinical surveillance and provides precious sources for high-quality research projects and future clinical trials. Funded by the German Federal Government, the NEOCYST collaborative started in February 2016. Here, we would like to introduce the rationale, design, and objectives of the network followed by a short overview on the current state of progress. PMID:29497606

Network for Early Onset Cystic Kidney Diseases-A Comprehensive Multidisciplinary Approach to Hereditary Cystic Kidney Diseases in Childhood.

PubMed

König, Jens Christian; Titieni, Andrea; Konrad, Martin

2018-01-01

Hereditary cystic kidney diseases comprise a complex group of genetic disorders representing one of the most common causes of end-stage renal failure in childhood. The main representatives are autosomal recessive polycystic kidney disease, nephronophthisis, Bardet-Biedl syndrome, and hepatocyte nuclear factor-1beta nephropathy. Within the last years, genetic efforts have brought tremendous progress for the molecular understanding of hereditary cystic kidney diseases identifying more than 70 genes. Yet, genetic heterogeneity, phenotypic variability, a lack of reliable genotype-phenotype correlations and the absence of disease-specific biomarkers remain major challenges for physicians treating children with cystic kidney diseases. To tackle these challenges comprehensive scientific approaches are urgently needed that match the ongoing "revolution" in genetics and molecular biology with an improved efficacy of clinical data collection. Network for early onset cystic kidney diseases (NEOCYST) is a multidisciplinary, multicenter collaborative combining a detailed collection of clinical data with translational scientific approaches addressing the genetic, molecular, and functional background of hereditary cystic kidney diseases. Consisting of seven work packages, including an international registry as well as a biobank, NEOCYST is not only dedicated to current scientific questions, but also provides a platform for longitudinal clinical surveillance and provides precious sources for high-quality research projects and future clinical trials. Funded by the German Federal Government, the NEOCYST collaborative started in February 2016. Here, we would like to introduce the rationale, design, and objectives of the network followed by a short overview on the current state of progress.

[A case of xp11.2 translocation renal cell carcinoma].

PubMed

Horie, Kengo; Kikuchi, Mina; Miwa, Kosei; Minamidate, Yuzuru; Yokoi, Shigeaki; Nakano, Masahiro; Deguchi, Takashi; Ehara, Hidetoshi; Asano, Nami; Hirose, Yoshinobu

2011-03-01

Xp11.2/TFE3 translocation renal cell carcinoma (RCC), a recently classified distinct subtype, is a rare tumor that usually affects children and adolescents. The morphology and biological behavior are not widely recognized, Xp11.2 translocation RCC is suggestive of early metastases despite the small tumor size. The definitive diagnosis requires the evidence of several different reciprocal translocations involving the TFE3 gene located on chromosome Xp11.2. Here, we present a case of Xp11.2 translocation RCC in an 18-yearold male. He was referred to our hospital because of a right renal tumor with macroscopic hematuria and right flank colic. The radiographic evaluation including magnetic resonance imaging (MRI) suggested it to be a typical papillary renal cell carcinoma or benign renal tumor. He underwent laparoscopic nephrectomy against the repeat symptom in spite of small tumor (3.5 cm in diameter). The immunohistochemical study revealed nuclear staining for TFE3 protein in the cancer cells. The urologic and radiologic outcomes were satisfactory after more than 1 year of follow-up.

Bosniak classification system: a prospective comparison of CT, contrast-enhanced US, and MR for categorizing complex renal cystic masses.

PubMed

Graumann, Ole; Osther, Susanne Sloth; Karstoft, Jens; Hørlyck, Arne; Osther, Palle Jörn Sloth

2016-11-01

Background The Bosniak classification was originally based on computed tomographic (CT) findings. Magnetic resonance (MR) and contrast-enhanced ultrasonography (CEUS) imaging may demonstrate findings that are not depicted at CT, and there may not always be a clear correlation between the findings at MR and CEUS imaging and those at CT. Purpose To compare diagnostic accuracy of MR, CEUS, and CT when categorizing complex renal cystic masses according to the Bosniak classification. Material and Methods From February 2011 to June 2012, 46 complex renal cysts were prospectively evaluated by three readers. Each mass was categorized according to the Bosniak classification and CT was chosen as gold standard. Kappa was calculated for diagnostic accuracy and data was compared with pathological results. Results CT images found 27 BII, six BIIF, seven BIII, and six BIV. Forty-three cysts could be characterized by CEUS, 79% were in agreement with CT (κ = 0.86). Five BII lesions were upgraded to BIIF and four lesions were categorized lower with CEUS. Forty-one lesions were examined with MR; 78% were in agreement with CT (κ = 0.91). Three BII lesions were upgraded to BIIF and six lesions were categorized one category lower. Pathologic correlation in six lesions revealed four malignant and two benign lesions. Conclusion CEUS and MR both up- and downgraded renal cysts compared to CT, and until these non-radiation modalities have been refined and adjusted, CT should remain the gold standard of the Bosniak classification.

Ultrasound diagnosis and evaluation of fetal tumors.

PubMed

Kurjak, A; Zalud, I; Jurković, D; Alfirević, Z; Tomić, K

1989-01-01

Fetal tumors represent a rare and heterogeneous group of abnormalities. A significant proportion of them can now be diagnosed by using modern high resolution ultrasonic equipment. During 15 years there were 57 fetal tumours detected prenatally. Hygroma colli is the most frequent fetal tumor. It should be emphasized that cystic hygroma generally carries poor prognosis, and after an early diagnosis, termination of pregnancy is most logical approach. Contrary to the general opinion our own experience showed that there are cases in which prognosis could be much better as illustrated with our 4 cases. All of the treated fetuses, after surgical resection, had normal development and are now on the age of 5, 4, 3 and 2 years of life. An ovarian cyst can be suspected if a fluid-filled structure is visualized next to a fetal kidney and female external genitalia are recognizable. The ultrasound finding suggestive of an ovarian cyst is that of a pelvic cystic or complex mass in a female fetus with normal kidneys and urinary bladder and a normal gastrointestinal tract. In most cases, the normal course of fetal ovarian cyst is a spontaneous intrauterine or postnatal involution. Prenatal diagnosis improves neonatal outcome by allowing an appropriate choice of the optimal time, mode and place of delivery in order to avoid accidental and unexpected intrapartum and postnatal complications. The management of a fetus affected by an ovarian cyst depends on the size and on the echo-pattern of the cyst. It remains unclear whether in utero puncture of the cyst and evacuation of its content should be justified in cases of particularly large ovarian cyst. In our opinion intrauterine procedure can be attempted in the presence of large cyst fulfilling the fetal abdomen. We have treated actively two cases of large ovarian cysts by ultrasonically guided puncture before delivery and both fetuses underwent surgery later without complications. If properly performed puncture of the cyst seems to be a low risk procedure in comparison to potential problems that cyst may cause to the fetus or by causing dystocia. Sacrococcygeal teratoma represents the most frequent tumor in the fetuses and newborns. Prenatal diagnosis is usually simple and based on the visualization of tumor of variable size and internal structure. Tumors may appear as completely cystic, mixed or predominantly solid with obvious calcifications. Cystic and calcified tumors are most likely to be benign. Obstetrical management of sacrococcygeal teratoma depends on numerous parameters which include size and texture of the tumor, and gestational age.(ABSTRACT TRUNCATED AT 400 WORDS)

Postnatal outcome of congenital anomalies in low resource setting.

PubMed

Kumar, Manisha; Sharma, Sumedha; Bhagat, Manisha; Gupta, Usha; Anand, Rama; Puri, Archana; Singh, Anuradha; Singh, Abha

2013-10-01

This study aimed to determine the postnatal outcome of congenital malformations in a tertiary care hospital of India. This was a prospective study of all women with prenatally detected major congenital malformations. Postnatal follow-up of live born babies was carried out for 1 year. There were 574 cases with major congenital anomalies, 523 of which were fully followed. Only 69 women (13.6%) had the initial scan before 20 weeks of gestation. Craniospinal defects were the most common (42.7%), followed by genitourinary anomalies (28%). There was no live birth in cases such as anencephaly, iniencephaly, bilateral renal agenesis, gastroschisis, and cystic hygroma. Survival at 1 year was less than 25% in spina bifida, bilateral cystic kidneys, complex cardiac disease, and non-immune hydrops fetalis. In cases with mild hydrocephalus or unilateral and mild renal disease, the survival was over 75%. In India, the majority of congenital anomalies present late in gestation. Although fetal outcome is invariably poor for severe defects, existing legislation in the country leaves pregnancy continuation as the only option. © 2013 John Wiley & Sons, Ltd.

Epithelioid PEComa (epithelioid angiomyolipoma) of the kidney: a rare tumor subtype for patients presenting with an enhancing renal mass.

PubMed

Shrewsberry, Adam B; Sica, Gabriel L; Osunkoya, Adeboye O; Canter, Daniel J

2013-02-01

Epithelioid angiomyolipomas, or perivascular epithelioid cell tumors (epithelioid PEComas) of the kidney, are histologically related to renal angiomyolipomas (AMLs). However, in contrast to typical AMLs, this rare tumor can exhibit an aggressive clinical course with approximately 50% of reported cases demonstrating disease progression. In this report, we present a case of a 24-year-old female with a history of stone disease who was incidentally found to have a 9.0 cm right renal mass that was difficult to characterize radiographically preoperatively. The patient underwent a right radical nephrectomy, and pathology revealed a renal epithelioid PEComa.

Adenoid cystic carcinoma of submandibular gland metastatic to great toes: case report and literature review.

PubMed

Rafael, Oana C; Paul, Doru; Chen, Sheng; Kraus, Dennis

2016-08-01

Adenoid cystic carcinoma (ACC) is a rare malignant tumor of the salivary glands, with higher frequency in the submandibular gland, a prolonged clinical course, and poor long-term survival. It tends to metastasize to lungs, bone, liver, brain, and rarely to skin. Comprehensive skin examination and appropriate follow-up is recommended, since cutaneous metastasis represents disease progression, requiring management and prognosis adjustment.

Frontal dermoid cyst coexisting with suprasellar craniopharyngioma: a spectrum of ectodermally derived epithelial-lined cystic lesions?

PubMed

Abou-Al-Shaar, Hussam; Abd-El-Barr, Muhammad M; Zaidi, Hasan A; Russell-Goldman, Eleanor; Folkerth, Rebecca D; Laws, Edward R; Chiocca, E Antonio

2016-12-01

There is a wide group of lesions that may exist in the sellar and suprasellar regions. Embryologically, there is varying evidence that many of these entities may in fact represent a continuum of pathology deriving from a common ectodermal origin. The authors report a case of a concomitant suprasellar craniopharyngioma invading the third ventricle with a concurrent frontal lobe cystic dermoid tumor. A 21-year-old man presented to the authors' service with a 3-day history of worsening headache, nausea, vomiting, and blurry vision. Magnetic resonance imaging depicted a right frontal lobe lesion associated with a separate suprasellar cystic lesion invading the third ventricle. The patient underwent a right pterional craniotomy for resection of both lesions. Gross-total resection of the right frontal lesion was achieved, and subtotal resection of the suprasellar lesion was accomplished with some residual tumor adherent to the walls of the third ventricle. Histopathological examination of the resected right frontal lesion documented a diagnosis of dermoid cyst and, for the suprasellar lesion, a diagnosis of adamantinomatous craniopharyngioma. The occurrence of craniopharyngioma with dermoid cyst has not been reported in the literature before. Such an association might indeed suggest the previously reported hypothesis that these lesions represent a spectrum of ectodermally derived epithelial-lined cystic lesions.

Comprehensive Molecular Characterization of Papillary Renal Cell Carcinoma

PubMed Central

Linehan, W. Marston; Spellman, Paul T.; Ricketts, Christopher J.; Creighton, Chad J.; Fei, Suzanne S.; Davis, Caleb; Wheeler, David A.; Murray, Bradley A.; Schmidt, Laura; Vocke, Cathy D.; Peto, Myron; Al Mamun, Abu Amar M.; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W. Kimryn; Brooks, Angela N.; Hoadley, Katherine A.; Robertson, A. Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J.; Bootwalla, Moiz; Baylin, Stephen B.; Laird, Peter W.; Cherniack, Andrew D.; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B.; Akbani, Rehan; Leiserson, Mark D.M.; Raphael, Benjamin J.; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K.; Czerniak, Bogdan; Godwin, Andrew K.; Hakimi, A. Ari; Ho, Thai; Hsieh, James; Ittmann, Michael; Kim, William Y.; Krishnan, Bhavani; Merino, Maria J.; Mills Shaw, Kenna R.; Reuter, Victor E.; Reznik, Ed; Shelley, Carl Simon; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D.; Penny, Robert J.; Shelton, Candace; Shelton, W. Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T.; Bowen, Jay; Gastier-Foster, Julie M.; Gerken, Mark; Leraas, Kristen M.; Lichtenberg, Tara M.; Ramirez, Nilsa C.; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A.; Felau, Ina; Hutter, Carolyn M.; Sheth, Margi; Sofia, Heidi J.; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C.; Zhang, Jiashan (Julia); Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S.N.; Carlsen, Rebecca; Carter, Scott L.; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R.; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, HarshaVardhan; Drummond, Jennifer; Gabriel, Stacey B.; Gibbs, Richard A.; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D. Neil; Holt, Robert A.; Hoyle, Alan P.; Jefferys, Stuart R.; Jones, Steven J.M.; Jones, Corbin D.; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A.; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A.; Moore, Richard A.; Morton, Donna; Mose, Lisle E.; Mungall, Andrew J.; Muzny, Donna; Parker, Joel S.; Perou, Charles M.; Roach, Jeffrey; Schein, Jacqueline E.; Schumacher, Steven E.; Shi, Yan; Simons, Janae V.; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G.; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D.; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N.; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J. Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L.; Boice, Lori; Bollag, Roni J.; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C.; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K.; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L.; Slaton, Joel; Stanton, Melissa; Thompson, R. Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M.; Winemiller, Cythnia; Zach, Leigh Anne; Zuna, Rosemary

2016-01-01

Background Papillary renal cell carcinoma, accounting for 15% of renal cell carcinoma, is a heterogeneous disease consisting of different types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal cell carcinoma; no effective forms of therapy for advanced disease exist. Methods We performed comprehensive molecular characterization utilizing whole-exome sequencing, copy number, mRNA, microRNA, methylation and proteomic analyses of 161 primary papillary renal cell carcinomas. Results Type 1 and Type 2 papillary renal cell carcinomas were found to be different types of renal cancer characterized by specific genetic alterations, with Type 2 further classified into three individual subgroups based on molecular differences that influenced patient survival. MET alterations were associated with Type 1 tumors, whereas Type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-ARE pathway. A CpG island methylator phenotype (CIMP) was found in a distinct subset of Type 2 papillary renal cell carcinoma characterized by poor survival and mutation of the fumarate hydratase (FH) gene. Conclusions Type 1 and Type 2 papillary renal cell carcinomas are clinically and biologically distinct. Alterations in the MET pathway are associated with Type 1 and activation of the NRF2-ARE pathway with Type 2; CDKN2A loss and CIMP in Type 2 convey a poor prognosis. Furthermore, Type 2 papillary renal cell carcinoma consists of at least 3 subtypes based upon molecular and phenotypic features. PMID:26536169

Odontogenic Cysts and Neoplasms.

PubMed

Bilodeau, Elizabeth Ann; Collins, Bobby M

2017-03-01

This article reviews a myriad of common and uncommon odontogenic cysts and tumors. The clinical presentation, gross and microscopic features, differential diagnosis, prognosis, and diagnostic pitfalls are addressed for inflammatory cysts (periapical cyst, mandibular infected buccal cyst/paradental cyst), developmental cysts (dentigerous, lateral periodontal, glandular odontogenic, orthokeratinized odontogenic cyst), benign tumors (keratocystic odontogenic tumor, ameloblastoma, adenomatoid odontogenic tumor, calcifying epithelial odontogenic tumor, ameloblastic fibroma and fibroodontoma, odontoma, squamous odontogenic tumor, calcifying cystic odontogenic tumor, primordial odontogenic tumor, central odontogenic fibroma, and odontogenic myxomas), and malignant tumors (clear cell odontogenic carcinoma, ameloblastic carcinoma, ameloblastic fibrosarcoma). Copyright © 2016 Elsevier Inc. All rights reserved.

Active surveillance of renal masses: an analysis of growth kinetics and clinical outcomes stratified by radiological characteristics at diagnosis.

PubMed

Dorin, Ryan; Jackson, Max; Cusano, Antonio; Haddock, Peter; Kiziloz, Halil; Meraney, Anoop; Shichman, Steven

2014-01-01

To determine the growth rate of renal masses (RMs) under active surveillance (AS), and to describe the clinical outcome of AS patients. We conducted a retrospective review of an AS database to obtain demographics, radiological and pathologic characteristics and RM size of patients. RMs were followed at 6-12 month intervals for ≥1 year with computed tomography (CT), magnetic resonance imaging (MRI), or renal ultrasound. Kaplan-Meier analysis determined the annual likelihood of intervention. RMs were divided into 3 radiographic subcategories (solid, cystic, and angiomyolipoma). A linear regression model determined RM growth rates. 131 RMs in 114 patients were included. Median age, Charlson Comorbidity Index score and mean follow-up were 69.1 years, 4.0 and 4.2±2.6 years, respectively. Maximal tumor diameter (MTD) at diagnosis was 2.1 ± 1.3 cm. 49 RMs exhibited negative or zero net growth. Mean MTD growth rate for all RMs was 0.72±3.2 (95% CI: 0.16-1.28) mm/year. When stratified by MTD at diagnosis, mean RM growth rates were 0.84, 0.84, 0.44, 0.74 and 0.71 mm/year for RMs ≤1 cm, 1-≤2cm, 2-≤ 3cm, 3-≤ 4cm and ≥4cm, respectively (p≤0.01). The 5 and 10-year freedom from intervention rates were 93.1% and 88.5%, respectively. There was a single case of suspected metastases, but no deaths related to kidney cancer. RMs under AS grew slowly, and had a low incidence of requiring surgical intervention and progression. Solid enhancing masses grew slowly, and were more likely to trigger intervention. AS should be considered for selected patients with small RMs.

Intensity ratio curve analysis of small renal masses on T2-weighted magnetic resonance imaging: Differentiation of fat-poor angiomyolipoma from renal cell carcinoma.

PubMed

Moriyama, Shingo; Yoshida, Soichiro; Tanaka, Hajime; Tanaka, Hiroshi; Yokoyama, Minato; Ishioka, Junichiro; Matsuoka, Yoh; Saito, Kazutaka; Kihara, Kazunori; Fujii, Yasuhisa

2018-03-25

To assess the diagnostic ability of a pixel intensity-based analysis in evaluating the magnetic resonance imaging characteristics of small renal masses, especially in differentiating fat-poor angiomyolipoma from renal cell carcinoma. T2-weighted images from 121 solid small renal masses (<4 cm) without visible fat (14 fat-poor angiomyolipomas, 92 clear cell renal cell carcinomas, six chromophobe renal cell carcinomas and nine papillary renal cell carcinomas) were retrospectively evaluated. An intensity ratio curve was plotted using intensity ratios, which were ratios of signal intensities of tumor pixels (each pixel along a linear region of interest drawn across the renal tumor on T2-weighted image) to the signal intensity of a normal renal cortex. The diagnostic ability of the intensity ratio curve analysis was evaluated. The tumors were classified into three types: intensity ratio fat-poor angiomyolipoma (n = 19) with no pseudocapsule, iso-low intensity and no heterogeneity; intensity ratio clear cell renal cell carcinoma (n = 76) with a pseudocapsule, iso-high intensity and heterogeneity; and other type of intensity ratio (n = 26), including tumors that did not fall into the above two categories. The sensitivity/specificity/accuracy of the intensity ratio curve analysis in diagnosing fat-poor angiomyolipoma was 93%/94%/94%, respectively. When the intensity ratio curve analysis was applied only to the tumor with undetermined radiological diagnosis, the sensitivity for diagnosing fat-poor angiomyolipoma compared with subjective reading alone significantly improved (93% vs 50%; P = 0.014). Our novel semiquantitative model for combined assessment of key features of fat-poor angiomyolipoma, including low intensity, homogeneity and absence of a pseudocapsule on T2-weighted image, might make diagnosis of fat-poor angiomyolipoma more accurate. © 2018 The Japanese Urological Association.

Immunohistochemical characterization of neoplastic cells of breast origin.

PubMed

Noriega, Mariadelasmercedes; Paesani, Fernando; Perazzo, Florencia; Lago, Néstor; Krupitzki, Hugo; Nieto, Silvana; Garcia, Alejandro; Avagnina, Alejandra; Elsner, Boris; Denninghoff, Valeria Cecilia

2012-06-22

After skin cancer, breast cancer is the most common malignancy in women. Tumors of unknown origin account for 5-15% of malignant neoplasms, with 1.5% being breast cancer. An immunohistochemical panel with conventional and newer markers, such as mammaglobin, was selected for the detection of neoplastic cells of breast origin. The specific objectives are: 1) to determine the sensitivity and specificity of the panel, with a special emphasis on the inclusion of the mammaglobin marker, and 2) to compare immunohistochemistry performed on whole tissue sections and on tissue micro-array. Twenty-nine metastatic breast tumors were included and assumed as tumors of unknown origin. Other 48 biopsies of diverse tissues were selected and assumed as negative controls. Tissue Micro-Array was performed. Immunohistochemistry for mammaglobin, gross cystic disease fluid protein-15, estrogen receptor, progesterone receptor and cytokeratin 7 was done. Mammaglobin positive staining was observed in 10/29 cases, in 13/29 cases for gross cystic disease fluid protein-15, in 20/29 cases for estrogen receptor, in 9/29 cases for progesterone receptor, and in 25/29 cases for cytokeratin 7. Among the negative controls, mammaglobin was positive in 2/48, and gross cystic disease fluid protein-15 in 4/48. The inclusion of MAG antibody in the immunohistochemical panel for the detection of tumors of unknown origin contributed to the detection of metastasis of breast cancer. The diagnostic strategy with the highest positive predictive value (88%) included hormone receptors and mammaglobin in serial manner.

Primary Renal Sarcomas in the Intergroup Rhabdomyosarcoma Study Group (IRSG) Experience, 1972–2005: A Report from the Children’s Oncology Group

PubMed Central

Raney, Beverly; Anderson, James; Arndt, Carola; Crist, Willam; Maurer, Harold; Qualman, Stephen; Wharam, Moody; Meyer, William

2009-01-01

Purpose To describe clinical and pathologic characteristics and outcome of patients with renal sarcomas. Patients/Methods The IRSG database includes newly diagnosed patients <21 years old with rhabdomyosarcoma (RMS) or undifferentiated sarcoma (UDS). We identified patients with renal sarcoma and reviewed their charts. Results Ten of the 5,746 eligible IRSG patients enrolled from 1972–2005 had primary renal embryonal RMS (N=6) or UDS (N=4). Anaplasia was present in six (60%) of the tumors. Patients’ ages ranged from 2.6–17.8 years. Tumor diameters ranged from 7–15 cm (median, 12 cm). At diagnosis, seven patients had localized disease: four underwent complete removal of tumor (Group I), two had microscopic residual (Group II), and one had gross residual tumor (Group III). Three patients had distant metastases (Group IV) in lungs and bone. Nine patients received vincristine, actinomycin D and cyclophosphamide (VAC). Two Group I patients received no radiation therapy (XRT); others received XRT to the primary tumor and to some metastatic sites. Nine patients achieved complete disappearance of tumor, six due to the initial operation. Tumors recurred in lung (N=2) or brain (N=1) in Group IV patients; each died within 16 months. The Group III patient died of Aspergillus pneumonia. The six Group I and II patients survive, continuously disease-free, at 2.7 to 17.3 years (median, 4.7 years). Conclusions Patients with renal sarcomas often present with large tumors, many of them containing anaplastic features. Removing all gross disease at diagnosis, if feasible, is a critical component of treatment to curing patients with renal sarcoma. PMID:18523987

Radioimmunoassay of tumor markers in serum of patients with renal carcinoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cordoni-Voutsas, M.; Glaubitt, D.; Wagner, W.

1984-01-01

Having noted an increased serum level of TPA and CEA in patients with renal carcinoma the authors extended these studies by using a larger number of tumor markers. In 15 patients (11 men and 4 women after menopause) aged 33 to 74 years who had renal carcinoma, among them 3 with tumor metastases, the serum concentration of TPA, CA 12-5, CEA, AFP, ferritin, prolactin, ..beta..-HCG, and ..beta../sub 2/-microglobulin was measured by radioimmunoassay. Monoclonal antibodies were used in the determination of serum CA 12-5 and CEA. In all patients surgical treatment, irradiation, or cytostatic therapy had not been performed. In serummore » the normal range was exceeded by TPA in 7 patients, CA 12-5 in 3, CEA and AFP in one each, ferritin in 12, prolactin in 2, and ..beta../sub 2/-microglobulin in 10 patients. In one man serum prolactin was reduced. Serum ..beta..-HCG was normal in all patients. According to these results serum ferritin, TPA, and ..beta../sub 2/-microglobulin are of great value as tumor markers in patients with renal carcinoma. In several patients the increase of serum ..beta../sub 2/-microglobulin may be ascribed partly to deterioration of renal function. As no consistent patterns of tumor markers in serum were observed it is recommended to determine several tumor markers and not only one of them during the follow-up of patients. Radioimmunoassays for measuring the serum level of tumor markers, especially ferritin, TPA, and ..beta../sub 2/-microglobulin, may considerably assist in the management of patients with renal carcinoma by providing early information about tumor recurrence or metastases.« less

Evaluation of anatomic and morphologic nomogram to predict malignant and high-grade disease in a cohort of patients with small renal masses.

PubMed

Bagrodia, Aditya; Harrow, Brian; Liu, Zhuo-Wei; Olweny, Ephrem O; Faddegon, Stephen; Yin, Gang; Tan, Yung Khan; Han, Woong Kyu; Lotan, Yair; Margulis, Vitaly; Cadeddu, Jeffrey A

2014-01-01

To evaluate a nomogram using the RENAL Nephrometry Score (RENAL-NS) that was developed to characterize masses as benign vs. malignant and high vs. low grade in our patients with small renal masses treated with partial nephrectomy (PN). The nomogram was previously developed and validated in patients with widely variable tumor sizes. Retrospective review of PN performed between 1/2003 and 7/2011. Imaging was reviewed by a urologic surgeon for RENAL-NS. Final pathology was used to classify tumors as benign or malignant and low (I/II) or high (III/IV) Fuhrman grade. Patient age, gender, and RENAL score were entered into the nomogram described by Kutikov et al. to determine probabilities of cancer and high-grade disease. Area under the curve was determined to assess agreement between observed and expected outcomes for prediction of benign vs. malignant disease and for prediction of high- vs. low-grade or benign disease. A total of 250 patients with 252 masses underwent PN during the study period; 179/250 (71.6%) had preoperative imaging available. RENAL-NS was assigned to 181 masses. Twenty-two percent of tumors were benign. Eighteen percent of tumors were high grade. Area under the curve was 0.648 for predicting benign vs. malignant disease and 0.955 for predicting low-grade or benign vs. high-grade disease. The RENAL-NS score nomogram by Kutikov does not discriminate well between benign and malignant disease for small renal masses. The nomogram may potentially be useful in identifying high-grade tumors. Further validation is required where the nomogram probability and final pathologic specimen are available. Copyright © 2014 Elsevier Inc. All rights reserved.

Congenital renal rhabdoid tumor with placental metastases: immunohistochemistry, cytogenetic, and ultrastructural findings.

PubMed

de Tar, Michael; Sanford Biggerstaff, Julie

2006-01-01

Malignant congenital tumors of fetal origin are rare lesions, the most common type being congenital neuroblastoma. Although prenatal diagnosis is possible in large tumors, occasionally the tumor will be diagnosed first by its metastatic involvement of the placenta. Placental metastases can reflect either maternal or fetal primary sites, and each has relatively specific patterns of placental involvement. We describe the clinical and pathologic features of a widely metastatic congenital renal rhabdoid tumor with its placental and autopsy findings, and include the immunohistochemical, cytogenetic, and ultrastructural features. The pathologic features of the placenta in congenital renal rhabdoid tumor with placental metastasis have not been previously described. The examination of the placenta in this case led to the initial diagnosis and obviated the need for additional diagnostic procedures.

Embolization of renal angiomyolipomas: short-term and long-term outcomes, complications, and tumor shrinkage.

PubMed

Lee, Shen-Yang; Hsu, Hsiang-Hao; Chen, Yung-Chang; Huang, Chen-Chih; Wong, Yon-Cheong; Wang, Li-Jen; Chuang, Cheng-Keng; Yang, Chih-Wei

2009-11-01

This study retrospectively evaluated outcomes, complications, and tumor shrinkage in renal angiomyolipomas after transcatheter arterial embolization (TAE). All renal angiomyolipoma patients who underwent TAE between August 2000 and December 2008 and had short-term (6 months) follow-up images were evaluated. Complications and tumor relapse after TAE were reviewed. The sizes of embolized tumors were measured to calculate size reductions and reduction rates after TAE. Differences in tumor size, size reduction, and reduction rate between different time points (pre-TAE, short-term follow-up, and long-term follow-up) and groups (completely and incompletely embolized) were determined. Eleven renal angiomyolipoma patients who had undergone TAE were included. Seven (63.6%) patients had postembolization syndrome and one had abscess formation following TAE. Two patients had a tumor relapse (18.2%). The mean tumor size was 8.57+/-2.66 cm on pre-TAE images. The mean size reduction was 3.1 cm (33.3%) and 3.8 cm (43.0%) at short-term and long-term follow-up. Tumor sizes differed significantly between pre-TAE and short-term (p=0.004) or long-term images (p=0.022) but not between short-term and long-term images (p=0.059). Results stratified by the completeness of embolization indicate that only the short-term size reduction rate differed significantly (p=0.025), while the long-term reduction rate and short- and long-term follow-up tumor size and size reduction were comparable between the two groups. In conclusion, selective TAE is effective for tumor shrinkage in most renal angiomyolipomas, with acceptable complication and relapse rates. Tumor shrinkage occurring within 6 months after TAE may reflect the long-term effect of TAE.

Apical Plasma Membrane Mispolarization of NaK-ATPase in Polycystic Kidney Disease Epithelia Is Associated with Aberrant Expression of the β2 Isoform

PubMed Central

Wilson, Patricia D.; Devuyst, Olivier; Li, Xiaohong; Gatti, Laura; Falkenstein, Doris; Robinson, Shawn; Fambrough, Douglas; Burrow, Christopher R.

2000-01-01

Autosomal dominant polycystic kidney disease (ADPKD) is a common genetic disease of the kidney, characterized by cystic enlargement of renal tubules, aberrant epithelial proliferation, and ion and fluid secretion into the lumen. Previous studies have shown abnormalities in polarization of membrane proteins, including mislocalization of the NaK-ATPase to the apical plasma membranes of cystic epithelia. Apically located NaK-ATPase has previously been shown to be fully functional in vivo and in membrane-grown ADPKD epithelial cells in vitro, where basal-to-apical 22Na transport was inhibited by application of ouabain to the apical membrane compartment. Studies were conducted with polymerase chain reaction-generated specific riboprobes and polyclonal peptide antibodies against human sequences of α1, α3, β1, and β2 subunits of NaK-ATPase. High levels of expression of α1 and β1 messenger RNA were detected in ADPKD and age-matched normal adult kidneys in vivo, whereas β2 messenger RNA was detected only in ADPKD kidneys. Western blot analysis and immunocytochemical studies showed that, in normal adult kidneys, peptide subunit-specific antibodies against α1 and β1 localized to the basolateral membranes of normal renal tubules, predominantly thick ascending limbs of Henle’s loop. In ADPKD kidneys, α1 and β2 subunits were localized to the apical epithelial cell membranes, whereas β1 was distributed throughout the cytoplasm and predominantly in the endoplasmic reticulum, but was not seen associated with cystic epithelial cell membranes or in cell membrane fractions. Polarizing, renal-derived epithelial Madin Darby canine kidney cells, stably expressing normal or N-terminally truncated chicken β1 subunits, showed selective accumulation in the basolateral Madin Darby canine kidney cell surface, whereas c-myc epitope-tagged chicken β2 or human β2 subunits accumulated selectively in the apical cell surface. Similarly, human ADPKD epithelial cell lines, which endogenously expressed α1 and β2 NaK-ATPase subunits, showed colocalization at the apical cell surface and coassociation by immunoprecipitation analysis. These results are consistent with a model in which the additional transcription and translation of the β2 subunit of NaK-ATPase may result in the apical mislocalization of NaK-ATPase in ADPKD cystic epithelia. PMID:10623674

The value of ultrasonography alone in screening surveys of cystic echinococcosis in children in Turkey.

PubMed

Kilimcioğlu, Ali A; Ozkol, Mine; Bayindir, Petek; Girginkardeşler, Nogay; Ostan, Ipek; Ok, Ulgen Z

2006-12-01

A total of 1,205 primary school children were examined for cystic echinococcosis in five villages of Manisa, Turkey, to evaluate the efficacy of diagnostic methods of this infection in community-based screening surveys. Six hundred and thirty children from three villages, examined by a portable ultrasound scanner, chest microfilm and serological methods (ELISA, indirect hemagglutination) in our previous study, were designated as Study Group 1; and 575 children, from two adjacent villages, examined by ultrasonography alone in the present study, were designated as Study Group 2. In Study Group 1, hepatic cystic echinococcosis was detected in two cases (0.3%) by ultrasonography, while 43 (8.9%) and 49 (10.1%) cases were found to be positive for cystic echinococcosis by ELISA and indirect hemagglutination, respectively. Three of 575 children (0.5%) were diagnosed with cystic echinococcosis (two hepatic and one renal involvement) by ultrasonography alone in Study Group 2; and lung lesions were later detected in both cases with liver involvement by chest radiography. Our results suggested that serological tests may be beneficial in suspected cases for confirmation and differential diagnosis, but have some drawbacks, such as discrepancy in results and high false seropositivity rates. Chest microfilm is not easy in field studies and exposure to X-ray is undesirable. As a reliable, simple, inexpensive and rapid technique, ultrasonography alone is recommended to be used in community-based screening surveys for cystic echinococcosis with confirmatory tests for suspected cases found during the screening program.

Everolimus and Vatalanib in Treating Patients With Advanced Solid Tumors

ClinicalTrials.gov

2018-01-12

Gastrinoma; Glucagonoma; Insulinoma; Metastatic Gastrointestinal Carcinoid Tumor; Metastatic Pheochromocytoma; Pancreatic Polypeptide Tumor; Recurrent Gastrointestinal Carcinoid Tumor; Recurrent Islet Cell Carcinoma; Recurrent Melanoma; Recurrent Neuroendocrine Carcinoma of the Skin; Recurrent Non-small Cell Lung Cancer; Recurrent Pheochromocytoma; Recurrent Renal Cell Cancer; Somatostatinoma; Stage III Neuroendocrine Carcinoma of the Skin; Stage IV Melanoma; Stage IV Non-small Cell Lung Cancer; Stage IV Renal Cell Cancer; Thyroid Gland Medullary Carcinoma; Unspecified Adult Solid Tumor, Protocol Specific

Frequent NFIB-associated Gene Rearrangement in Adenoid Cystic Carcinoma of the Vulva.

PubMed

Xing, Deyin; Bakhsh, Salwa; Melnyk, Nataliya; Isacson, Christina; Ho, Julie; Huntsman, David G; Gilks, C Blake; Ronnett, Brigitte M; Horlings, Hugo M

2017-05-01

Adenoid cystic carcinoma is a rare malignant tumor that usually arises in the major and minor salivary glands and other locations containing secretory glands, including the lower female genital tract. Lower female genital tract carcinomas with adenoid cystic differentiation can be subclassified into 2 distinct groups based on the presence or absence of high-risk HPV. Cervical mixed carcinomas with some adenoid cystic differentiation are high-risk HPV-related but pure adenoid cystic carcinomas of vulvar and cervical origin appear to be unrelated to high-risk HPV. Mechanisms by which normal cells give rise to an HPV-unrelated adenoid cystic carcinoma remain largely unknown. Studies demonstrate that chromosomal translocation involving the genes encoding the transcription factors MYB and NFIB functions as a driving force of adenoid cystic carcinomas development regardless of anatomic site. The current study used fluorescence in situ hybridization with 3 different probes including MYB break-apart probe, NFIB break-apart probe, and MYB-NFIB fusion probe to assess for the presence of gene rearrangements in adenoid cystic carcinomas of the vulva. Six (66.7%) of 9 vulvar adenoid cystic carcinomas demonstrated NFIB rearrangement. Of these 6 cases with a disturbed NFIB, only 2 cases (33.3%) were positive for a MYB rearrangement that was also confirmed by a positive MYB-NFIB fusion pattern. NFIB-associated gene rearrangement is a frequent genetic event in vulvar adenoid cystic carcinomas. Chromosome translocations involving NFIB but with an intact MYB indicate the presence of novel oncogenic mechanisms for the development of adenoid cystic carcinomas of the vulva.

Renin-secreting tumors.

PubMed

Roswell, R H

1990-02-01

Hypertension resulting from a renin-secreting tumor was first reported in 1967 by Robertson et al. Kihara and coworkers subsequently coined the term juxtaglomerular cell tumor for a similar tumor in a young woman with hyperreninemic hypertension. Since the description of these first two cases, it has become clear that renin-secreting tumors of both renal and nonrenal origin can cause surgically curable hypertension. Primary reninism has been suggested as a more appropriate term for the clinical syndrome associated with renin-secreting tumors, both renal and extrarenal, whether benign or malignant.

Renal proximal tubule function is preserved in Cftrtm2camΔF508 cystic fibrosis mice

PubMed Central

Kibble, J D; Balloch, K J D; Neal, A M; Hill, C; White, S; Robson, L; Green, R; Taylor, C J

2001-01-01

Changes in proximal tubule function have been reported in cystic fibrosis patients. The aim of this study was to investigate proximal tubule function in the Cftrtm2camΔF508 cystic fibrosis (CF) mouse model. A range of techniques were used including renal clearance studies, in situ microperfusion, RT-PCR and whole-cell patch clamping. Renal Na+ clearance was similar in wild-type (1.4 ± 0.3 μl min−1, number of animals, N= 12) and CF mice (1.6 ± 0.4 μl min−1, N= 7) under control conditions. Acute extracellular volume expansion resulted in significant natriuresis in wild-type (7.0 ± 0.8 μl min−1, N= 8) and CF mice (9.3 ± 1.4 μl min−1, N= 9); no difference between genotypes was observed. In situ microperfusion revealed that fluid absorptive rate (Jv) was similar under control conditions between wild-type (2.2 ± 0.4 nl mm−1 min−1, n= 10) and CF mice (1.9 ± 0.3 nl mm−1 min−1, n= 11). Addition of a forskolin-dibutyryl cAMP (db-cAMP) cocktail to the perfusate caused no significant change in Jv in either wild-type (2.6 ± 0.7 nl mm−1 min−1, n= 10) or Cftrtm2camΔF508 mice (2.0 ± 0.5 nl mm−1 min−1, n= 10). CFTR expression was confirmed in samples of outer cortex using RT-PCR. However, no evidence for functional CFTR was obtained when outer cortical cells were stimulated with protein kinase A or forskolin-db-cAMP using whole-cell patch clamping. In conclusion, no functional deficit in proximal tubule function was found in Cftrtm2camΔF508 mice. This may be a consequence of a lack of whole-cell cAMP-dependent Cl− conductance in mouse proximal tubule cells. PMID:11306663

Renal Sinus Fat Invasion and Tumoral Thrombosis of the Inferior Vena Cava-Renal Vein: Only Confined to Renal Cell Carcinoma

PubMed Central

Harman, Mustafa; Guneyli, Serkan; Sen, Sait; Elmas, Nevra

2014-01-01

Epithelioid angiomyolipoma (E-AML), accounting for 8% of renal angiomyolipoma, is usually associated with tuberous sclerosis (TS) and demonstrates aggressive behavior. E-AML is macroscopically seen as a large infiltrative necrotic tumor with occasional extension into renal vein and/or inferior vena cava. However, without history of TS, renal sinus and venous invasion E-AML would be a challenging diagnosis, which may lead radiologists to misinterpret it as a renal cell carcinoma (RCC). In this case presentation, we aimed to report cross-sectional imaging findings of two cases diagnosed as E-AML and pathological correlation of these aforementioned masses mimicking RCC. PMID:25506021

Renal sinus fat invasion and tumoral thrombosis of the inferior vena cava-renal vein: only confined to renal cell carcinoma.

PubMed

Acar, Turker; Harman, Mustafa; Guneyli, Serkan; Sen, Sait; Elmas, Nevra

2014-01-01

Epithelioid angiomyolipoma (E-AML), accounting for 8% of renal angiomyolipoma, is usually associated with tuberous sclerosis (TS) and demonstrates aggressive behavior. E-AML is macroscopically seen as a large infiltrative necrotic tumor with occasional extension into renal vein and/or inferior vena cava. However, without history of TS, renal sinus and venous invasion E-AML would be a challenging diagnosis, which may lead radiologists to misinterpret it as a renal cell carcinoma (RCC). In this case presentation, we aimed to report cross-sectional imaging findings of two cases diagnosed as E-AML and pathological correlation of these aforementioned masses mimicking RCC.

PO-60 - Renal tumors with extensive vascular disease: management challenges in a pediatric series from the Hospital for Sick Children.

PubMed

Zamperlini-Netto, G; Zanette, A; Wehbi, E; Williams, S; Grant, R M; Brandao, L R

2016-04-01

Venous thrombotic events (VTE) are becoming more and more common in children, particularly in the hospital setting. To date, 1 in 200 children admitted to tertiary pediatric hospitals are now being recognized to develop VTE. Amongst those patients with an identified thrombotic occlusion, pediatric patients diagnosed with renal tumors have long been recognized, but their ideal management in the instances of vascular invasion remains controversial. We describe the clinical behavior of patients diagnosed with renal tumors and extra renal vascular involvement at The Hospital for Sick Children in Toronto, Canada. A retrospective analysis was conducted in patients diagnosed from 1990 to 2012. Data collected included: age, gender, symptoms at presentation, staging, pathology report, radiological evidence of intravascular thrombus [i.e. renal veins (RV), inferior vena cava (IVC) and right atrium (RA)], intraoperative findings, therapeutic protocol implemented and anticoagulation; for outcomes, tumor and/or thrombus recurrence, thromboembolic phenomena [i.e. pulmonary embolism (PE)] and survival. Of 299 patients with renal tumors identified, 292 were included: Wilms (219), Renal Cell Carcinoma (RCC, 29), Clear Cell Sarcoma of the Kidney (CCSK, 12), others (32). The median age of the group was 4.53years (4days - 18 years). Extra renal vascular disease was identified in 29 patients, with a median age 7.05years (0.6-16 years; p=0.03), including Wilms tumors (22/219, 10%), RCC (2/29, 7%), CCSK (1/12, 8.3%) and others (4/32, 12.5%; p=0.01). Vascular involvement comprised exclusive evidence of RV disease (7), IVC disease (19; 15 infra-hepatic), RA disease (3) and PE (5).Treatment escalation because of vascular disease included neo-adjuvant chemotherapy (12; Wilms [11], RCC [1]), intraoperative cavectomy/ thrombectomy (1; Wilms), and cavotomies (11 Wilms [7], RCC [1], CCSK [1], PNET [1], sarcoma [1]). Four patients were placed under cardiopulmonary bypass. Anticoagulation was administered in 9/29 patients for their tumor-related thrombus, and one had a minor bleeding complications (oozing from the central venous line insertion site). Renal tumors with vascular invasion are a rare and challenging entity. Treatment included mostly cancer-related therapies and the role of vascular surgical approaches and/or systemic anticoagulation remains to be clarified. © 2016 Elsevier Ltd. All rights reserved.

Analysis of papillary renal adenocarcinoma.

PubMed

Mydlo, J H; Bard, R H

1987-12-01

A retrospective review was conducted comparing the angiographic findings, tumor volumes, staging, and survival of patients with papillary renal adenocarcinoma as compared with the more common clear and granular cell renal adenocarcinoma. The data suggest that the papillary histopathologic organization confers an improved prognosis, which concurs with previous findings. We speculate on why this tumor behaves differently from clear cell carcinoma.

Extraordinarily Large Renal Cell Carcinoma With Metasynchronous Neuroendocrine Tumor of the Ileocecal Valve: A Rare Presentation of Disease.

PubMed

Edwards, Daniel C; Gitman, Robert; May, Noah R; Amster, Melanie I

2017-01-01

A 71-year-old female presented with a large, protuberant abdominal mass, and was found to have both a left renal mass and a biopsy-proven neuroendocrine tumor of the ileocecal valve. Ultimately, right hemicolectomy revealed a well-differentiated and low-grade neuroendocrine tumor of the ileocecal valve, whereas left radical nephrectomy revealed a 23 cm × 22 cm × 15 cm renal cell carcinoma, chromophobe-type (RCC-CT) weighing 3564 g. RCC-CT represents a small portion of diagnosed RCC, and generally portends a more favorable prognosis than other variants. Modern reports of renal tumors exceeding 20 cm are exceedingly rare. In spite of massive size, favorable histology may allow for surgical cure. Copyright © 2016 Elsevier Inc. All rights reserved.

Sunitinib Malate and Bevacizumab in Treating Patients With Kidney Cancer or Advanced Solid Malignancies

ClinicalTrials.gov

2014-04-01

Clear Cell Renal Cell Carcinoma; Recurrent Renal Cell Cancer; Stage I Renal Cell Cancer; Stage II Renal Cell Cancer; Stage III Renal Cell Cancer; Stage IV Renal Cell Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Improved safety and efficacy of 213Bi-DOTATATE-targeted alpha therapy of somatostatin receptor-expressing neuroendocrine tumors in mice pre-treated with L-lysine.

PubMed

Chan, Ho Sze; Konijnenberg, Mark W; Daniels, Tamara; Nysus, Monique; Makvandi, Mehran; de Blois, Erik; Breeman, Wouter A; Atcher, Robert W; de Jong, Marion; Norenberg, Jeffrey P

2016-12-01

Targeted alpha therapy (TAT) offers advantages over current β-emitting conjugates for peptide receptor radionuclide therapy (PRRT) of neuroendocrine tumors. PRRT with 177 Lu-DOTATATE or 90 Y-DOTATOC has shown dose-limiting nephrotoxicity due to radiopeptide retention in the proximal tubules. Pharmacological protection can reduce renal uptake of radiopeptides, e.g., positively charged amino acids, to saturate in the proximal tubules, thereby enabling higher radioactivity to be safely administered. The aim of this preclinical study was to evaluate the therapeutic effect of 213 Bi-DOTATATE with and without renal protection using L-lysine in mice. Tumor uptake and kinetics as a function of injected mass of peptide (range 0.03-3 nmol) were investigated using 111 In-DOTATATE. These results allowed estimation of the mean radiation absorbed tumor dose for 213 Bi-DOTATATE. Pharmacokinetics and dosimetry of 213 Bi-DOTATATE was determined in mice, in combination with renal protection. A dose escalation study with 213 Bi-DOTATATE was performed to determine the maximum tolerated dose (MTD) with and without pre-administration of L-lysine as for renal protection. Neutrophil gelatinase-associated lipocalin (NGAL) served as renal biomarker to determine kidney injury. The maximum mean radiation absorbed tumor dose occurred at 0.03 nmol and the minimum at 3 nmol. Similar mean radiation absorbed tumor doses were determined for 0.1 and 0.3 nmol with a mean radiation absorbed dose of approximately 0.5 Gy/MBq 213 Bi-DOTATATE. The optimal mass of injected peptide was found to be 0.3 nmol. Tumor uptake was similar for 111 In-DOTATATE and 213 Bi-DOTATATE at 0.3 nmol peptide. Lysine reduced the renal uptake of 213 Bi-DOTATATE by 50% with no effect on the tumor uptake. The MTD was <13.0 ± 1.6 MBq in absence of L-lysine and 21.7 ± 1.9 MBq with L-lysine renal protection, both imparting an LD 50 mean renal radiation absorbed dose of 20 Gy. A correlation was found between the amount of injected radioactivity and NGAL levels. The therapeutic potential of 213 Bi-DOTATATE was illustrated by significantly decreased tumor burden and improved overall survival. Renal protection with L-lysine immediately prior to TAT with 213 Bi-DOTATATE prolonged survival providing substantial evidence for pharmacological nephron blockade to mitigate nephrotoxicity.

Hilar location is an independent prognostic factor for recurrence in T1 renal cell carcinoma after nephrectomy.

PubMed

Shim, Myungsun; Song, Cheryn; Park, Sejun; Kim, Aram; Choi, Seung-Kwon; Kim, Choung-Soo; Ahn, Hanjong

2015-01-01

We investigated the prognostic significance of tumor location at the renal hilum near the sinus structure on the recurrence in T1 renal cell carcinoma (RCC). A total of 1,818 T1 RCC patients who underwent radical (RN) or partial nephrectomy (PN) from 1997 to 2011 were retrospectively reviewed. A hilar tumor was defined as a tumor abutting the main renal artery and/or vein or its segmental branches, without invasion. We compared the recurrence-free survival (RFS) rates between hilar and nonhilar T1 RCC and analyzed predictors of RFS after nephrectomy. Patients with hilar tumors showed a poorer 5-year RFS compared with nonhilar tumors both in T1a (89.7 vs. 98.5 %, p < 0.001) and T1b (81.6 vs. 95.1 %, p < 0.001) RCCs. Among patients who underwent RN and PN, hilar tumors were associated with lower 5-year RFS (87.6 vs. 97.2 % for RN, 78.1 vs. 98.2 % for PN, both p < 0.001). In T1a hilar tumor, PN was associated with poorer 5-year RFS than RN (79.5 vs. 93.0 %, p < 0.001). In multivariate analysis, a hilar location remained as an independent predictor of recurrence in both T1a and T1b tumors (both p = 0.001). Hilar tumors show a higher recurrence rate than nonhilar counterparts in T1 RCC. In T1a hilar tumors, PN demonstrated poorer RFS than RN. Potential intrinsic renal anatomical or lymphovascular structural differences as well as differences in cancer characteristics need further investigations.

Close pathological correlations between chronic kidney disease and reproductive organ-associated abnormalities in female cotton rats.

PubMed

Ichii, Osamu; Nakamura, Teppei; Irie, Takao; Kouguchi, Hirokazu; Sotozaki, Kozue; Horino, Taro; Sunden, Yuji; Elewa, Yaser Hosny Ali; Kon, Yasuhiro

2018-03-01

Cotton rat ( Sigmodon hispidus) is a useful experimental rodent for the study of human infectious diseases. We previously clarified that cotton rats, particularly females, developed chronic kidney disease characterized by cystic lesions, inflammation, and fibrosis. The present study investigated female-associated factors for chronic kidney disease development in cotton rats. Notably, female cotton rats developed separation of the pelvic symphysis and hypertrophy in the vaginal parts of the cervix with age, which strongly associated with pyometra. The development of pyometra closely associated with the deterioration of renal dysfunction or immunological abnormalities was indicated by blood urea nitrogen and serum creatinine or spleen weight and serum albumin/globulin ratio, respectively. These parameters for renal dysfunction and immunological abnormalities were statistically correlated. These phenotypes found in the female reproductive organs were completely inhibited by ovariectomy. Further, the female cotton rats with pyometra tended to show more severe chronic kidney disease phenotypes and immunological abnormalities than those without pyometra; these changes were inhibited in ovariectomized cotton rats. With regard to renal histopathology, cystic lesions, inflammation, and fibrosis were ameliorated by ovariectomy. Notably, the immunostaining intensity of estrogen receptor α and estrogen receptor β were weak in the healthy kidneys, but both estrogen receptors were strongly induced in the renal tubules showing cystic changes. In conclusion, the close correlations among female reproductive organ-associated abnormalities, immunological abnormalities, and renal dysfunction characterize the chronic kidney disease features of female cotton rats. Thus, the cotton rat is a unique rodent model to elucidate the pathological crosstalk between chronic kidney disease and sex-related factors. Impact statement The increasing number of elderly individuals in the overall population has led to a concomitant age-related increase in chronic kidney disease. Moreover, the global prevalence of patients with chronic kidney disease is gradually increasing, which poses a serious public health problem. The limited number of spontaneous chronic kidney disease animal models, which resemble chronic kidney disease pathogenesis in elderly individuals, is a major limitation in the development of experimental and curative medicines for chronic kidney disease. This pathological study clarified that sex-related factors, including hormones, and abnormalities of the female reproductive system, such as pyometra, are closely associated with chronic kidney disease development by using cotton rats ( Sigmodon hispidus). Further, ovariectomy inhibited the phenotypes of the female reproductive system, immunological abnormalities, and chronic kidney disease. Thus, this laboratory rodent serves as a novel and useful spontaneous chronic kidney disease model to elucidate the candidate disease factors and the pathogenesis of chronic kidney disease both in human and experimental medicine.

Birt-Hogg-Dubé syndrome: Clinical and molecular aspects of recently identified kidney cancer syndrome.

PubMed

Hasumi, Hisashi; Baba, Masaya; Hasumi, Yukiko; Furuya, Mitsuko; Yao, Masahiro

2016-03-01

Birt-Hogg-Dubé syndrome is an autosomal dominantly inherited disease that predisposes patients to develop fibrofolliculoma, lung cysts and bilateral multifocal renal tumors, histologically hybrid oncocytic/chromophobe tumors, chromophobe renal cell carcinoma, oncocytoma, papillary renal cell carcinoma and clear cell renal cell carcinoma. The predominant forms of Birt-Hogg-Dubé syndrome-associated renal tumors, hybrid oncocytic/chromophobe tumors and chromophobe renal cell carcinoma are typically less aggressive, and a therapeutic principle for these tumors is a surgical removal with nephron-sparing. The timing of surgery is the most critical element for postoperative renal function, which is one of the important prognostic factors for Birt-Hogg-Dubé syndrome patients. The folliculin gene (FLCN) that is responsible for Birt-Hogg-Dubé syndrome was isolated as a novel tumor suppressor for kidney cancer. Recent studies using murine models for FLCN, a protein encoded by the FLCN gene, and its two binding partners, folliculin-interacting protein 1 (FNIP1) and folliculin-interacting protein 2 (FNIP2), have uncovered important roles for FLCN, FNIP1 and FNIP2 in cell metabolism, which include AMP-activated protein kinase-mediated energy sensing, Ppargc1a-driven mitochondrial oxidative phosphorylation and mTORC1-dependent cell proliferation. Birt-Hogg-Dubé syndrome is a hereditary hamartoma syndrome, which is triggered by metabolic alterations under a functional loss of FLCN/FNIP1/FNIP2 complex, a critical regulator of kidney cell proliferation rate; a mechanistic insight into the FLCN/FNIP1/FNIP2 pathway could provide us a basis for developing new therapeutics for kidney cancer. © 2015 The Japanese Urological Association.

Technical difficulties in retro-peritoneoscopic radical nephrectomy. Is tumor location important?

PubMed

Lucan, M; Lucan, V; Ghervan, L; Elec, F; Iacob, G; Barbos, A

2007-01-01

Tumor location on the posterior aspect of the kidney or close to the renal hilum could increase the difficulty of the retro-peritoneoscopic radical nephrectomy. The aim of our study was to assess how tumor location influences the difficulty of the retro-peritoneoscopic radical nephrectomy. We performed a nonrandomized prospective study in 116 patients with localized renal cell carcinoma who underwent RRN, between Jan. 2000 and Jan. 2005. Twenty-nine patients with a tumor located close to the renal hilum or on the posterior aspect of the kidney (Gr.A) were compared with 87 patients with a tumor at a distance from the renal hilum (Gr.B) in terms of operative time, intraoperative blood loss, and difficulty of the dissection. The difficulty of the dissection was subjectively estimated by the main surgeon using a three degree scale (G1-easy, G2-medium, and G3-difficult). All the operations were finalized by retro-peritoneoscopy and G4-very difficult degree--was not recorded. In the Gr. A, the operative time was longer (117.28 min vs. 94.63 min, p < 0.001) and blood loss was higher (291.86 ml vs. 199.54 ml, p < 0.001). The dissection of the renal pedicle was also more difficult in the Gr. A either for artery dissection (G3 27.59% vs. 11.49%, p = 0.0202) or for vein dissection (G3 20.69% vs. 8.05%, p = 0.0321), while peri-fascial dissection was less frequently difficult (G3 10.34% vs. 28.74%, p = 0.0237). Tumor location close to the renal hilum or on the posterior aspect of the kidney increases the difficulty of renal pedicle dissection.

Transcatheter Arterial Embolization with a Mixture of Absolute Ethanol and Iodized Oil for Poorly Visualized Endophytic Renal Masses Prior to CT-Guided Percutaneous Cryoablation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michimoto, Kenkichi, E-mail: michikoo@jikei.ac.jp; Shimizu, Kanichiro; Kameoka, Yoshihiko

PurposeTo retrospectively evaluate the feasibility of transcatheter arterial embolization (TAE) using a mixture of absolute ethanol and iodized oil to improve localization of endophytic renal masses on unenhanced computed tomography (CT) prior to CT-guided percutaneous cryoablation (PCA).Materials and MethodsOur institutional review board approved this retrospective study. From September 2011 to June 2015, 17 patients (mean age, 66.8 years) with stage T1a endophytic renal masses (mean diameter, 26.5 mm) underwent TAE using a mixture of absolute ethanol and iodized oil to improve visualization of small and endophytic renal masses on unenhanced CT prior to CT-guided PCA. TAE was considered successful that accumulated iodizedmore » oil depicted whole of the tumor edge on CT. PCA was considered successful when the iceball covered the entire tumor with over a 5 mm margin. Oncological and renal functional outcomes and complications were also evaluated.ResultsTAE was successfully performed in 16 of 17 endophytic tumors. The 16 tumors were performed under CT-guided PCA with their distinct visualization of localization and safe ablated margin. During the mean follow-up period of 15.4 ± 5.1 months, one patient developed local recurrence. Estimated glomerular filtration rate declined by 8 % with statistical significance (P = 0.01). There was no procedure-related significant complication.ConclusionTAE using a mixture of absolute ethanol and iodized oil to improve visualization of endophytic renal masses facilitated tumor localization on unenhanced CT, permitting depiction of the tumor edge as well as a safe margin for ablation during CT-guided PCA, with an acceptable decline in renal function.« less

Early impact of robot-assisted partial nephrectomy on renal function as assessed by renal scintigraphy.

PubMed

Luciani, Lorenzo G; Chiodini, Stefano; Donner, Davide; Cai, Tommaso; Vattovani, Valentino; Tiscione, Daniele; Giusti, Guido; Proietti, Silvia; Chierichetti, Franca; Malossini, Gianni

2016-06-01

To measure the early impact of robot-assisted partial nephrectomy (RAPN) on renal function as assessed by renal scan (Tc 99m-DTPA), addressing the issue of risk factors for ischemic damage to the kidney. All patients undergoing RAPN for cT1 renal masses between June 2013 and May 2014 were included in this prospective study. Renal function as expressed by glomerular filtration rate (GFR) was assessed by Technetium 99m-diethylenetriaminepentaacetic acid (Tc 99m-DTPA) renal scan preoperatively and postoperatively at 1 month in every patient. A multivariable analysis was used for the determination of independent factors predictive of GFR decrease of the operated kidney. Overall, 32 patients underwent RAPN in the time interval. Median tumor size, blood loss, and ischemia time were 4 cm, 200 mL, and 24 min, respectively. Two grade III complications occurred (postoperative bleeding in the renal fossa, urinoma). The GFR of the operated kidney decreased significantly from 51.7 ± 15.1 mL/min per 1.73 m(2) preoperatively to 40, 12 ± 12.4 mL/min per 1.73 m(2) 1 month postoperatively (p = 0.001) with a decrease of 22.4 %. On multivariable analysis, only tumor size (p = 0.05) was a predictor of GFR decrease of the operated kidney. Robotic-assisted partial nephrectomy had a detectable impact on early renal function in a series of relatively large tumors and prevailing intermediate nephrometric risk. A mean decrease of 22 % of GFR as assessed by renal scan in the operated kidney was found at 1 month postoperatively. In multivariable analysis, tumor size only was a significant predictor of renal function loss.

Comprehensive Molecular Characterization of Papillary Renal-Cell Carcinoma.

PubMed

Linehan, W Marston; Spellman, Paul T; Ricketts, Christopher J; Creighton, Chad J; Fei, Suzanne S; Davis, Caleb; Wheeler, David A; Murray, Bradley A; Schmidt, Laura; Vocke, Cathy D; Peto, Myron; Al Mamun, Abu Amar M; Shinbrot, Eve; Sethi, Anurag; Brooks, Samira; Rathmell, W Kimryn; Brooks, Angela N; Hoadley, Katherine A; Robertson, A Gordon; Brooks, Denise; Bowlby, Reanne; Sadeghi, Sara; Shen, Hui; Weisenberger, Daniel J; Bootwalla, Moiz; Baylin, Stephen B; Laird, Peter W; Cherniack, Andrew D; Saksena, Gordon; Haake, Scott; Li, Jun; Liang, Han; Lu, Yiling; Mills, Gordon B; Akbani, Rehan; Leiserson, Mark D M; Raphael, Benjamin J; Anur, Pavana; Bottaro, Donald; Albiges, Laurence; Barnabas, Nandita; Choueiri, Toni K; Czerniak, Bogdan; Godwin, Andrew K; Hakimi, A Ari; Ho, Thai H; Hsieh, James; Ittmann, Michael; Kim, William Y; Krishnan, Bhavani; Merino, Maria J; Mills Shaw, Kenna R; Reuter, Victor E; Reznik, Ed; Shelley, Carl S; Shuch, Brian; Signoretti, Sabina; Srinivasan, Ramaprasad; Tamboli, Pheroze; Thomas, George; Tickoo, Satish; Burnett, Kenneth; Crain, Daniel; Gardner, Johanna; Lau, Kevin; Mallery, David; Morris, Scott; Paulauskis, Joseph D; Penny, Robert J; Shelton, Candace; Shelton, W Troy; Sherman, Mark; Thompson, Eric; Yena, Peggy; Avedon, Melissa T; Bowen, Jay; Gastier-Foster, Julie M; Gerken, Mark; Leraas, Kristen M; Lichtenberg, Tara M; Ramirez, Nilsa C; Santos, Tracie; Wise, Lisa; Zmuda, Erik; Demchok, John A; Felau, Ina; Hutter, Carolyn M; Sheth, Margi; Sofia, Heidi J; Tarnuzzer, Roy; Wang, Zhining; Yang, Liming; Zenklusen, Jean C; Zhang, Jiashan; Ayala, Brenda; Baboud, Julien; Chudamani, Sudha; Liu, Jia; Lolla, Laxmi; Naresh, Rashi; Pihl, Todd; Sun, Qiang; Wan, Yunhu; Wu, Ye; Ally, Adrian; Balasundaram, Miruna; Balu, Saianand; Beroukhim, Rameen; Bodenheimer, Tom; Buhay, Christian; Butterfield, Yaron S N; Carlsen, Rebecca; Carter, Scott L; Chao, Hsu; Chuah, Eric; Clarke, Amanda; Covington, Kyle R; Dahdouli, Mahmoud; Dewal, Ninad; Dhalla, Noreen; Doddapaneni, Harsha V; Drummond, Jennifer A; Gabriel, Stacey B; Gibbs, Richard A; Guin, Ranabir; Hale, Walker; Hawes, Alicia; Hayes, D Neil; Holt, Robert A; Hoyle, Alan P; Jefferys, Stuart R; Jones, Steven J M; Jones, Corbin D; Kalra, Divya; Kovar, Christie; Lewis, Lora; Li, Jie; Ma, Yussanne; Marra, Marco A; Mayo, Michael; Meng, Shaowu; Meyerson, Matthew; Mieczkowski, Piotr A; Moore, Richard A; Morton, Donna; Mose, Lisle E; Mungall, Andrew J; Muzny, Donna; Parker, Joel S; Perou, Charles M; Roach, Jeffrey; Schein, Jacqueline E; Schumacher, Steven E; Shi, Yan; Simons, Janae V; Sipahimalani, Payal; Skelly, Tara; Soloway, Matthew G; Sougnez, Carrie; Tam, Angela; Tan, Donghui; Thiessen, Nina; Veluvolu, Umadevi; Wang, Min; Wilkerson, Matthew D; Wong, Tina; Wu, Junyuan; Xi, Liu; Zhou, Jane; Bedford, Jason; Chen, Fengju; Fu, Yao; Gerstein, Mark; Haussler, David; Kasaian, Katayoon; Lai, Phillip; Ling, Shiyun; Radenbaugh, Amie; Van Den Berg, David; Weinstein, John N; Zhu, Jingchun; Albert, Monique; Alexopoulou, Iakovina; Andersen, Jeremiah J; Auman, J Todd; Bartlett, John; Bastacky, Sheldon; Bergsten, Julie; Blute, Michael L; Boice, Lori; Bollag, Roni J; Boyd, Jeff; Castle, Erik; Chen, Ying-Bei; Cheville, John C; Curley, Erin; Davies, Benjamin; DeVolk, April; Dhir, Rajiv; Dike, Laura; Eckman, John; Engel, Jay; Harr, Jodi; Hrebinko, Ronald; Huang, Mei; Huelsenbeck-Dill, Lori; Iacocca, Mary; Jacobs, Bruce; Lobis, Michael; Maranchie, Jodi K; McMeekin, Scott; Myers, Jerome; Nelson, Joel; Parfitt, Jeremy; Parwani, Anil; Petrelli, Nicholas; Rabeno, Brenda; Roy, Somak; Salner, Andrew L; Slaton, Joel; Stanton, Melissa; Thompson, R Houston; Thorne, Leigh; Tucker, Kelinda; Weinberger, Paul M; Winemiller, Cynthia; Zach, Leigh Anne; Zuna, Rosemary

2016-01-14

Papillary renal-cell carcinoma, which accounts for 15 to 20% of renal-cell carcinomas, is a heterogeneous disease that consists of various types of renal cancer, including tumors with indolent, multifocal presentation and solitary tumors with an aggressive, highly lethal phenotype. Little is known about the genetic basis of sporadic papillary renal-cell carcinoma, and no effective forms of therapy for advanced disease exist. We performed comprehensive molecular characterization of 161 primary papillary renal-cell carcinomas, using whole-exome sequencing, copy-number analysis, messenger RNA and microRNA sequencing, DNA-methylation analysis, and proteomic analysis. Type 1 and type 2 papillary renal-cell carcinomas were shown to be different types of renal cancer characterized by specific genetic alterations, with type 2 further classified into three individual subgroups on the basis of molecular differences associated with patient survival. Type 1 tumors were associated with MET alterations, whereas type 2 tumors were characterized by CDKN2A silencing, SETD2 mutations, TFE3 fusions, and increased expression of the NRF2-antioxidant response element (ARE) pathway. A CpG island methylator phenotype (CIMP) was observed in a distinct subgroup of type 2 papillary renal-cell carcinomas that was characterized by poor survival and mutation of the gene encoding fumarate hydratase (FH). Type 1 and type 2 papillary renal-cell carcinomas were shown to be clinically and biologically distinct. Alterations in the MET pathway were associated with type 1, and activation of the NRF2-ARE pathway was associated with type 2; CDKN2A loss and CIMP in type 2 conveyed a poor prognosis. Furthermore, type 2 papillary renal-cell carcinoma consisted of at least three subtypes based on molecular and phenotypic features. (Funded by the National Institutes of Health.).

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma.

PubMed

Ambrosio, Maria R; Rocca, Bruno J; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T; Tripodi, Sergio A; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis.

Expression of Translationally Controlled Tumor Protein in Human Kidney and in Renal Cell Carcinoma

PubMed Central

Ambrosio, Maria R.; Rocca, Bruno J.; Barone, Aurora; Onorati, Monica; Mundo, Lucia; Crivelli, Filippo; Di Nuovo, Franca; De Falco, Giulia; del Vecchio, Maria T.; Tripodi, Sergio A.; Tosi, Piero

2015-01-01

Translationally controlled tumor protein is a multifaceted protein involved in several physiological and biological functions. Its expression in normal kidney and in renal carcinomas, once corroborated by functional data, may add elements to elucidate renal physiology and carcinogenesis. In this study, translationally controlled tumor protein expression was evaluated by quantitative real time polymerase chain reaction and western blotting, and its localization was examined by immunohistochemistry on 84 nephrectomies for cancer. In normal kidney protein expression was found in the cytoplasm of proximal and distal tubular cells, in cells of the thick segment of the loop of Henle, and in urothelial cells of the pelvis. It was also detectable in cells of renal carcinoma with different pattern of localization (membranous and cytoplasmic) depending on tumor histotype. Our data may suggest an involvement of translationally controlled tumor protein in normal physiology and carcinogenesis. However, functional in vitro and in vivo studies are needed to verify this hypothesis. PMID:26425551

Kidney Cancer in Children

MedlinePlus

What is Kidney Cancer in Children? Kidney (renal) tumors are very rare in children. Still, the three most common renal tumors ... treatable and curable. What are the Types of Kidney Cancer in Children? Male urinary tract Medical Illustration ...

Zonal NePhRO scoring system: a superior renal tumor complexity classification model.

PubMed

Hakky, Tariq S; Baumgarten, Adam S; Allen, Bryan; Lin, Hui-Yi; Ercole, Cesar E; Sexton, Wade J; Spiess, Philippe E

2014-02-01

Since the advent of the first standardized renal tumor complexity system, many subsequent scoring systems have been introduced, many of which are complicated and can make it difficult to accurately measure data end points. In light of these limitations, we introduce the new zonal NePhRO scoring system. The zonal NePhRO score is based on 4 anatomical components that are assigned a score of 1, 2, or 3, and their sum is used to classify renal tumors. The zonal NePhRO scoring system is made up of the (Ne)arness to collecting system, (Ph)ysical location of the tumor in the kidney, (R)adius of the tumor, and (O)rganization of the tumor. In this retrospective study, we evaluated patients exhibiting clinical stage T1a or T1b who underwent open partial nephrectomy performed by 2 genitourinary surgeons. Each renal unit was assigned both a zonal NePhRO score and a RENAL (radius, exophytic/endophytic properties, nearness of tumor to the collecting system or sinus in millimeters, anterior/posterior, location relative to polar lines) score, and a blinded reviewer used the same preoperative imaging study to obtain both scores. Additional data points gathered included age, clamp time, complication rate, urine leak rate, intraoperative blood loss, and pathologic tumor size. One hundred sixty-six patients underwent open partial nephrectomy. There were 37 perioperative complications quantitated using the validated Clavien-Dindo system; their occurrence was predicted by the NePhRO score on both univariate and multivariate analyses (P = .0008). Clinical stage, intraoperative blood loss, and tumor diameter were all correlated with the zonal NePhRO score on univariate analysis only. The zonal NePhRO scoring system is a simpler tool that accurately predicts the surgical complexity of a renal lesion. Copyright © 2014 Elsevier Inc. All rights reserved.

Pattern multiplicity and fumarate hydratase (FH)/S-(2-succino)-cysteine (2SC) staining but not eosinophilic nucleoli with perinucleolar halos differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas from kidney tumors without FH gene alteration.

PubMed

Muller, Marie; Guillaud-Bataille, Marine; Salleron, Julia; Genestie, Catherine; Deveaux, Sophie; Slama, Abdelhamid; de Paillerets, Brigitte Bressac; Richard, Stéphane; Benusiglio, Patrick R; Ferlicot, Sophie

2018-02-06

Hereditary leiomyomatosis and renal cell carcinoma syndrome is characterized by an increased risk of agressive renal cell carcinoma, often of type 2 papillary histology, and is caused by FH germline mutations. A prominent eosinophilic macronucleolus with a perinucleolar clear halo is distinctive of hereditary leiomyomatosis and renal cell carcinoma syndrome-associated renal cell carcinoma according to the 2012 ISUP and 2016 WHO kidney tumor classification. From an immunohistochemistry perspective, tumors are often FH-negative and S-(2-succino)-cysteine (2SC) positive. We performed a pathology review of 24 renal tumors in 23 FH mutation carriers, and compared them to 12 type 2 papillary renal cell carcinomas from FH wild-type patients. Prominent eosinophilic nucleoli with perinucleolar halos were present in almost all FH-deficient renal cell carcinomas (23/24). Unexpectedly, they were also present in 58% of type 2 papillary renal cell carcinomas from wild-type patients. Renal cell carcinoma in mutation carriers displayed a complex architecture with multiple patterns, typically papillary, tubulopapillary, and tubulocystic, but also sarcomatoid and rhabdoid. Such pattern diversity was not seen in non-carriers. FH/2SC immunohistochemistry was informative as all hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinomas were either FH- or 2SC+. For FH and 2SC immunohistochemistries taken separately, sensitivity of negative anti-FH immunohistochemistry was 87.5% and specificity was 100%. For positive anti-2SC immunohistochemistry, sensitivity, and specificity were 91.7% and 91.7%, respectively. All FH wild-type renal cell carcinoma were FH-positive, and all but one were 2SC-negative. In conclusion, multiplicity of architectural patterns, rhabdoid/sarcomatoid components and combined FH/2SC staining, but not prominent eosinophilic nucleoli with perinucleolar halos, differentiate hereditary leiomyomatosis and renal cell carcinoma-associated renal cell carcinoma from type 2 papillary renal cell carcinoma with efficient FH gene. Our findings are crucial in identifying who should be referred to Cancer Genetics clinics for genetic counseling and testing.

Adenocarcinoma arising from intracranial recurrent mature teratoma and featuring mutated KRAS and wild-type BRAF genes.

PubMed

Kim, Eun Soo; Kwon, Mi Jung; Song, Joon Ho; Kim, Dong Hoon; Park, Hye-Rim

2015-02-01

Malignant transformation or recurrence of intracranial mature teratoma is an extremely rare occurrence, compared to the usual ovarian counterpart. Previously, yolk sac tumor elements have been considered to be selective progenitors of enteric-type adenocarcinoma arising from intracranial germ cell tumors. However, the present case demonstrates the occurrence of enteric-type adenocarcinoma in recurrent intracranial mature cystic teratoma 12 years after gross total removal, a case of which has not previously been documented in the literature. The 11.5-cm long, dura mater-based tumor on the right fronto-temporal lobe displaced the brain; however, the patient had no neurologic symptoms or discomfort other than pus-like discharge on the scalp. Microscopic examinations revealed a small focus of adenocarcinoma and dysplastic colonic mucosa in the mature cystic teratoma. No immature elements were seen. The cystic wall was almost denuded and showed an exuberant xanthogranulomatous reaction with foreign-body type giant cells engulfing keratin materials and cholesterol clefts, suggesting that chronic inflammation due to repeated cyst wall rupture and the previous resection may contribute to malignant transformation. The adenocarcinoma showed strong immunohistochemical expression of CK20 and p53, but CK7 in patches. The molecular profile of the adenocarcinoma showed a mutation in KRAS and wild-type BRAF, which might be associated with malignant transformation of intracranial mature teratomas. In conclusion, the intracranial mature teratomas should require long-term follow-up, and clinicians, radiologists and pathologists should be aware of the potential for malignant progression of recurrent intracranial mature cystic teratoma despite gross total resection and no neurologic symptoms. © 2014 Japanese Society of Neuropathology.

A complex case of congenital cystic renal disease

PubMed Central

Cordiner, David S; Evans, Clair A; Brundler, Marie-Anne; McPhillips, Maeve; Murio, Enric; Darling, Mark; Taheri, Sepideh

2012-01-01

This case outlines the potential complexity of autosomal recessive polycystic kidney disease (ARPKD). It highlights the challenges involved in managing this condition, some of the complications faced and areas of uncertainty in the decision making process. With a paucity of published paediatric cases on this subject, this should add to the pool of information currently available. PMID:22605879

Dual Pathology Causing Congenital Bladder Outlet Obstruction.

PubMed

Kwong, Ruth; Johal, Navroop S; Upasani, Anand; Paul, Anu; Cuckow, Peter

2017-12-07

Anterior urethral syringocele is an uncommon congenital deformity characterised by cystic dilatation of bulbo-urethral gland ducts and is usually asymptomatic. We present a case on 4-day-old male neonate who presented with bilateral antenatal hydroureteronephrosis and renal impairment and found to have urethral syringocele and posterior urethral valves (PUV). Copyright © 2017. Published by Elsevier Inc.

Psychologic Effects of Illness in Adolescence. II. Impact of Illness in Adolescents--Crucial Issues and Coping Styles.

ERIC Educational Resources Information Center

Zeltzer, Lonnie; And Others

1980-01-01

Adolescent perceptions of the impact of illness were measured through the administration of an original questionnaire to 345 healthy adolescents and 168 adolescents (mean age of both groups, 15) with diabetes mellitus, cystic fibrosis, cancer, and cardiac, renal, or rheumatologic diseases. Journal availability: C. V. Mosby Co; 11830 Westline…

Quantitative Contour Analysis as an Image-based Discriminator Between Benign and Malignant Renal Tumors.

PubMed

Yap, Felix Y; Hwang, Darryl H; Cen, Steven Y; Varghese, Bino A; Desai, Bhushan; Quinn, Brian D; Gupta, Megha Nayyar; Rajarubendra, Nieroshan; Desai, Mihir M; Aron, Manju; Liang, Gangning; Aron, Monish; Gill, Inderbir S; Duddalwar, Vinay A

2018-04-01

To investigate whether morphologic analysis can differentiate between benign and malignant renal tumors on clinically acquired imaging. Between 2009 and 2014, 3-dimensional tumor volumes were manually segmented from contrast-enhanced computerized tomography (CT) images from 150 patients with predominantly solid, nonmacroscopic fat-containing renal tumors: 100 renal cell carcinomas and 50 benign lesions (eg, oncocytoma and lipid-poor angiomyolipoma). Tessellated 3-dimensional tumor models were created from segmented voxels using MATLAB code. Eleven shape descriptors were calculated: sphericity, compactness, mean radial distance, standard deviation of the radial distance, radial distance area ratio, zero crossing, entropy, Feret ratio, convex hull area and convex hull perimeter ratios, and elliptic compactness. Morphometric parameters were compared using the Wilcoxon rank-sum test to investigate whether malignant renal masses demonstrate more morphologic irregularity than benign ones. Only CHP in sagittal orientation (median 0.96 vs 0.97) and EC in coronal orientation (median 0.92 vs 0.93) differed significantly between malignant and benign masses (P = .04). When comparing these 2 metrics between coronal and sagittal orientations, similar but nonsignificant trends emerged (P = .07). Other metrics tested were not significantly different in any imaging plane. Computerized image analysis is feasible using shape descriptors that otherwise cannot be visually assessed and used without quantification. Shape analysis via the transverse orientation may be reasonable, but encompassing all 3 planar dimensions to characterize tumor contour can achieve a more comprehensive evaluation. Two shape metrics (CHP and EC) may help distinguish benign from malignant renal tumors, an often challenging goal to achieve on imaging and biopsy. Copyright © 2017 Elsevier Inc. All rights reserved.

Orchitis reveals an extragonadal primary mediastinal thymic seminoma: a coincidence or not?

PubMed

Tampakis, Athanasios; Tampaki, Ekaterini Christina; Damaskos, Christos; Feretis, Themistoklis; Thymara, Irene; Kontzoglou, Konstantinos; Tomos, Periklis; Kouraklis, Gregory

2017-04-13

Mediastinal thymic seminomas are rare male germ cell tumors with extragonadal origin that appear predominately with a cystic appearance. A 22-year-old male was referred to our department for further investigation of a mediastinal mass discovered incidentally during routine chest X-ray. The patient has denied any symptoms including dyspnea, chest pain, cough, fever, dysphagia, hemoptysis, weight loss, and weakness. His past medical history was remarkable for orchitis, for which he had undergone a bilateral testicular biopsy, without the latter however, indicating the presence of a germ cell tumor or a premalignant lesion. Contrast-enhanced chest computed tomography revealed a lobulated and well-marginated cystic lesion in the anterior mediastinum. Differential diagnosis included mostly a multilocular thymic cyst, a lymphoma, a seminoma, or a soft tissue tumor. Resection of the mass revealed a primary thymic seminoma. A surgical approach for the management of these tumors might be reasonable considering that an extensive sampling is mandatory to gain an appropriate biopsy preoperatively in order to securely confirm or refute the presence of a mediastinal extragonadal tumor. Orchitis might be a sign of a general disorder of the germ cells which might transform in time.

Calcium Stone Growth in Urine from Cystic Fibrosis Patients and Healthy Controls

NASA Astrophysics Data System (ADS)

McSorley, Anita; Jones, Andrew M.; Webb, A. Kevin; Rao, P. Nagaraj; Kavanagh, John P.

2007-04-01

Cystic fibrosis patients have an increased risk of renal stone disease. There is some evidence that this may be related to a different excretory pattern of stone risk factors, but an alternative hypothesis, that the urine of cystic fibrosis patients is deficient in urinary inhibitors of crystallization and stone formation has not been tested. Here we have grown calcium stones, in vitro, in the presence of urine from healthy controls and compared this with growth in the presence of urine from cystic fibrosis patients. A stone farm was used to grow twelve calcium stones simultaneously, firstly in artificial urine for about 200 hours and then in 90% whole human urine for another 500 hours. Six of the stones received urine from healthy controls and six received urine from adult cystic fibrosis patients. There were no significant differences in stone mass at any of the key time points or in the overall growth pattern (p>0.05) between stones destined for, or treated with, urine from CF patients and the controls. Human urine greatly inhibited stone growth in vitro but there was no difference in the growth rate in urine from healthy controls and CF patients. This refutes the hypothesis that a tendency for a higher prevalence of urinary stones in CF patients is related to a deficiency in inhibitory activity.

A Literature Review of Renal Surgical Anatomy and Surgical Strategies for Partial Nephrectomy

PubMed Central

Klatte, Tobias; Ficarra, Vincenzo; Gratzke, Christian; Kaouk, Jihad; Kutikov, Alexander; Macchi, Veronica; Mottrie, Alexandre; Porpiglia, Francesco; Porter, James; Rogers, Craig G.; Russo, Paul; Thompson, R. Houston; Uzzo, Robert G.; Wood, Christopher G.; Gill, Inderbir S.

2016-01-01

Context A detailed understanding of renal surgical anatomy is necessary to optimize preoperative planning and operative technique and provide a basis for improved outcomes. Objective To evaluate the literature regarding pertinent surgical anatomy of the kidney and related structures, nephrometry scoring systems, and current surgical strategies for partial nephrectomy (PN). Evidence acquisition A literature review was conducted. Evidence synthesis Surgical renal anatomy fundamentally impacts PN surgery. The renal artery divides into anterior and posterior divisions, from which approximately five segmental terminal arteries originate. The renal veins are not terminal. Variations in the vascular and lymphatic channels are common; thus, concurrent lymphadenectomy is not routinely indicated during PN for cT1 renal masses in the setting of clinically negative lymph nodes. Renal-protocol contrast-enhanced computed tomography or magnetic resonance imaging is used for standard imaging. Anatomy-based nephrometry scoring systems allow standardized academic reporting of tumor characteristics and predict PN outcomes (complications, remnant function, possibly histology). Anatomy-based novel surgical approaches may reduce ischemic time during PN; these include early unclamping, segmental clamping, tumor-specific clamping (zero ischemia), and unclamped PN. Cancer cure after PN relies on complete resection, which can be achieved by thin margins. Post-PN renal function is impacted by kidney quality, remnant quantity, and ischemia type and duration. Conclusions Surgical renal anatomy underpins imaging, nephrometry scoring systems, and vascular control techniques that reduce global renal ischemia and may impact post-PN function. A contemporary ideal PN excises the tumor with a thin negative margin, delicately secures the tumor bed to maximize vascularized remnant parenchyma, and minimizes global ischemia to the renal remnant with minimal complications. Patient summary In this report we review renal surgical anatomy. Renal mass imaging allows detailed delineation of the anatomy and vasculature and permits nephrometry scoring, and thus precise, patient-specific surgical planning. Novel off-clamp techniques have been developed that may lead to improved outcomes. PMID:25911061

A Literature Review of Renal Surgical Anatomy and Surgical Strategies for Partial Nephrectomy.

PubMed

Klatte, Tobias; Ficarra, Vincenzo; Gratzke, Christian; Kaouk, Jihad; Kutikov, Alexander; Macchi, Veronica; Mottrie, Alexandre; Porpiglia, Francesco; Porter, James; Rogers, Craig G; Russo, Paul; Thompson, R Houston; Uzzo, Robert G; Wood, Christopher G; Gill, Inderbir S

2015-12-01

A detailed understanding of renal surgical anatomy is necessary to optimize preoperative planning and operative technique and provide a basis for improved outcomes. To evaluate the literature regarding pertinent surgical anatomy of the kidney and related structures, nephrometry scoring systems, and current surgical strategies for partial nephrectomy (PN). A literature review was conducted. Surgical renal anatomy fundamentally impacts PN surgery. The renal artery divides into anterior and posterior divisions, from which approximately five segmental terminal arteries originate. The renal veins are not terminal. Variations in the vascular and lymphatic channels are common; thus, concurrent lymphadenectomy is not routinely indicated during PN for cT1 renal masses in the setting of clinically negative lymph nodes. Renal-protocol contrast-enhanced computed tomography or magnetic resonance imaging is used for standard imaging. Anatomy-based nephrometry scoring systems allow standardized academic reporting of tumor characteristics and predict PN outcomes (complications, remnant function, possibly histology). Anatomy-based novel surgical approaches may reduce ischemic time during PN; these include early unclamping, segmental clamping, tumor-specific clamping (zero ischemia), and unclamped PN. Cancer cure after PN relies on complete resection, which can be achieved by thin margins. Post-PN renal function is impacted by kidney quality, remnant quantity, and ischemia type and duration. Surgical renal anatomy underpins imaging, nephrometry scoring systems, and vascular control techniques that reduce global renal ischemia and may impact post-PN function. A contemporary ideal PN excises the tumor with a thin negative margin, delicately secures the tumor bed to maximize vascularized remnant parenchyma, and minimizes global ischemia to the renal remnant with minimal complications. In this report we review renal surgical anatomy. Renal mass imaging allows detailed delineation of the anatomy and vasculature and permits nephrometry scoring, and thus precise, patient-specific surgical planning. Novel off-clamp techniques have been developed that may lead to improved outcomes. Copyright © 2015 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Sarcoma-like mural nodules in mucinous cystic tumors of the ovary revisited: a clinicopathologic analysis of 10 additional cases.

PubMed

Bagué, Sílvia; Rodríguez, Ingrid M; Prat, Jaime

2002-11-01

Ten mucinous cystic ovarian tumors that contained sarcoma-like mural nodules are described. The nodules were studied by conventional and immunohistochemical methods. The sarcoma-like mural nodules occurred predominantly in middle-aged women, were multiple and sharply demarcated from the adjacent mucinous tumor, had small size, and exhibited a heterogeneous cell population. Distinction of these lesions from true sarcomatous nodules and foci of anaplastic carcinoma is important because of the worse prognosis of the two latter tumors compared with the favorable behavior of the sarcoma-like mural nodules. Six of the eight patients with follow-up information were alive and clinically free of recurrence at a mean follow-up interval of 12 years. Two patients died of other causes (thyroid and breast carcinomas). The nature of the nodules is not clear. Sarcoma-like mural nodules probably represent a reactive and self-limited phenomenon within a neoplasia. Their coexpression of vimentin and cytokeratins is consistent with an origin from submesothelial mesenchymal cells, which undergo partial transformation into epithelial cells.

Immunoexpression of GLUT-1 and angiogenic index in pleomorphic adenomas, adenoid cystic carcinomas, and mucoepidermoid carcinomas of the salivary glands.

PubMed

de Souza, Lélia Batista; de Oliveira, Lucileide Castro; Nonaka, Cassiano Francisco Weege; Lopes, Maria Luiza Diniz de Sousa; Pinto, Leão Pereira; Queiroz, Lélia Maria Guedes

2017-06-01

This study aimed to evaluate and compare the immunoexpression of glucose transporter-1 (GLUT-1) and angiogenic index between pleomorphic adenomas (PAs), adenoid cystic carcinomas (ACCs), and mucoepidermoid carcinomas (MECs) of the salivary glands, and establish associations with the respective subtype/histological grade. Twenty PAs, 20 ACCs, and 10 MECs were submitted to morphological and immunohistochemical analysis. GLUT-1 expression was semi-quantitatively evaluated and angiogenic index was assessed by microvessel counts using anti-CD34 antibody. Higher GLUT-1 immunoexpression was observed in the MECs compared to PAs and ACCs (p = 0.022). Mean number of microvessels was 66.5 in MECs, 40.4 in PAs, and 21.2 in ACCs (p < 0.001). GLUT-1 expression and angiogenic index showed no significant correlation in the tumors studied. Results suggest that differences in biological behavior of the studied tumors are related to GLUT-1. Benign and malignant salivary gland tumors differ in the angiogenic index; however, angiogenesis may be independent of the tumor cell's metabolic demand.

Efficacy, tolerance, and pharmacokinetics of once daily tobramycin for pseudomonas exacerbations in cystic fibrosis.

PubMed

Vic, P; Ategbo, S; Turck, D; Husson, M O; Launay, V; Loeuille, G A; Sardet, A; Deschildre, A; Druon, D; Arrouet-Lagande, C

1998-06-01

To compare once daily with thrice daily tobramycin for treatment of Pseudomonas aeruginosa infection in patients with cystic fibrosis. 22 patients with cystic fibrosis, mean (SD) age 11 (3.4) years (range 5.6-19.3), with pulmonary pseudomonas exacerbations were randomly assigned to receive a 14 day course of tobramycin (15 mg/kg/day) either in three infusions (group A) (n = 10) or a single daily infusion (group B) (n = 12), combined with ceftazidime (200 mg/kg/day as three intravenous injections). Efficacy was assessed by comparison of pulmonary, nutritional, and inflammatory indices on days 1 and 14. Cochlear and renal tolerance were assessed on days 1 and 14. Tobramycin concentration was measured in serum and sputum 1, 2, 3, 4, 8, and 24 hours after the start of the infusion. Analysis was by non-parametric Wilcoxon test. Variables improving (p < 0.05) in both groups A and B were, respectively: weight/height (+4% and +3.1%), plasma prealbumin (+66 and +63 mg/l), forced vital capacity (FVC) (+14% and +11%), forced expiratory volume in one second (+15% and +14%), and forced expiratory flow between 25% and 75% of FVC (+13% and +21%). Improvement was not significantly different between groups. Renal and cochlear indices remained within the normal range. Serum peak concentration of tobramycin on day 1 was 13.2 (7.1) mg/l in group A and 42.5 (11.2) mg/l in group B (p < 0.001); serum trough was 1.1 (0.8) mg/l in group A and 0.3 (0.2) mg/l in group B (p < 0.01). Tobramycin concentrations in sputum were two to three times higher in group B than group A. Once daily tobramycin combined with three injections of ceftazidime is safe and effective for the treatment of pseudomonas exacerbations in cystic fibrosis patients.

Removal of ureteral calculi in two geldings via a standing flank approach.

PubMed

Frederick, Jeremy; Freeman, David E; MacKay, Robert J; Matyjaszek, Sarah; Lewis, Jordan; Sanchez, L Chris; Meyer, Stephanie

2012-11-01

Two geldings, aged 11 and 17 years, were examined for treatment of ureteroliths located approximately 10 cm proximal to the bladder. Ureteral obstruction was an incidental finding in 1 horse that was referred because of urinary tract obstruction and a cystic calculus. This horse did not have clinical or laboratory evidence of renal failure, although severe hydronephrosis was evident on transabdominal ultrasonography. The second patient had a serum creatinine concentration of 6.3 mg/dL (reference range, 0.8 to 2.2 mg/dL) and mild hydronephrosis of the affected left kidney. In both patients, the obstructed ureter was exteriorized through a flank incision as a standing procedure, and the calculus was crushed and removed with a uterine biopsy forceps introduced through a ureterotomy approximately 25 cm proximal to the calculus. The cystic calculus was removed through a perineal urethrostomy by lithotripsy, piecemeal extraction, and lavage. The horse without azotemia developed pyelonephritis in the affected kidney and was euthanatized because of complications of a nephrectomy 13 months later. In the horse with azotemia, the serum creatinine concentration decreased after surgery, and the horse returned to its intended use. However, it was euthanatized approximately 2 years after surgery because of progressive renal failure, and a large nephrolith was found in the previously unobstructed right kidney. The technique used for ureterolith removal was successful in both horses in this report, did not require sophisticated equipment, and could be effective in the early stages of ureteral obstruction as a means of restoring urine flow and renal function. The outcome in the horse with advanced unilateral renal disease without azotemia would suggest that nephrectomy should be considered as a treatment in such patients.

Adenoid Cystic Carcinoma Metastatic to the Pituitary: A Case Report and Discussion of Potential Diagnostic Value of Magnetic Resonance Elastography in Pituitary Tumors.

PubMed

D Hughes, Joshua; Retzlaff, Amber; Sims, John; O'Brien, Erin; Giannini, Caterina; Huston, John; Van Gompel, Jamie J

2016-07-01

Adenoid cystic carcinoma (ACC) is an exocrine gland tumor accounting for approximately 10%-15% of all epithelial salivary neoplasms and occurs most often in the parotid and submandibular glands. Metastatic pituitary tumors are rare, and there is only 1 previously reported case of parotid ACC metastatic to the pituitary. Magnetic resonance elastography (MRE) is a dynamic magnetic resonance imaging (MRI)-based technique that measures the propagation of mechanically induced shear waves through a particular tissue to determine stiffness and offers a method to evaluate tissue consistency. We present the case of a 72-year-old woman with a remote history of parotid gland ACC and subsequent lung metastases presented after a fall that resulted in facial trauma. A non-contrast head computed tomography scan revealed a sellar/suprasellar mass, and follow-up MRI revealed a well-defined, enhancing 3.8-cm lesion. MRE showed the tumor to be firm. The tumor was resected through a transsphenoidal approach and was consistent with the MRE findings. Pathology returned as metastatic ACC. We report the second case of ACC metastatic to pituitary and the first firm pituitary tumor found by MRE and discuss the potential diagnostic value of MRE in pituitary lesions. Copyright © 2016 Elsevier Inc. All rights reserved.

Giant multilocular cystadenoma of the prostate: a rare cause of huge cystic pelvic mass.

PubMed

Olgun, Deniz Cebi; Onal, Bulent; Mihmanli, Ismail; Kantarci, Fatih; Durak, Haydar; Demir, Hale; Cetinel, Bulent

2012-03-01

Giant multilocular prostatic cystadenoma is a rare benign tumor that evolves from the prostate gland. Obstructive voiding symptoms occur in all reported cases. These lesions do not invade adjacent structures. Preoperative radiologic evaluation can define the benign nature of the lesion. Here we report a case of large cystic lesions identified by magnetic resonance imaging and sonographic findings that caused an extensive mass effect in the pelvis. When retrovesical, huge cystic lesions fill the pelvis completely in young men, with high levels of serum prostate-specific antigen, giant multilocular prostatic cystadenoma should be considered as a differential diagnosis. To our knowledge, this is the youngest case of prostatic cystadenoma reported in the literature.

Transferrin receptor 1 upregulation in primary tumor and downregulation in benign kidney is associated with progression and mortality in renal cell carcinoma patients

PubMed Central

Greene, Christopher J.; Attwood, Kristopher; Sharma, Nitika J.; Gross, Kenneth W.; Smith, Gary J.; Xu, Bo; Kauffman, Eric C.

2017-01-01

The central dysregulated pathway of clear cell (cc) renal cell carcinoma (RCC), the von Hippel Lindau/hypoxia inducible factor-α axis, is a key regulator of intracellular iron levels, however the role of iron uptake in human RCC tumorigenesis and progression remains unknown. We conducted a thorough, large-scale investigation of the expression and prognostic significance of the primary iron uptake protein, transferrin receptor 1 (TfR1/CD71/TFRC), in RCC patients. TfR1 immunohistochemistry was performed in over 1500 cores from 574 renal cell tumor patient tissues (primary tumors, matched benign kidneys, metastases) and non-neoplastic tissues from 36 different body sites. TfR1 levels in RCC tumors, particularly ccRCC, were significantly associated with adverse clinical prognostic features (anemia, lower body mass index, smoking), worse tumor pathology (size, stage, grade, multifocality, sarcomatoid dedifferentiation) and worse survival outcomes, including after adjustments for tumor pathology. Highest TfR1 tissue levels in the non-gravid body were detected in benign renal tubule epithelium. Opposite to TfR1 changes in the primary tumor, TfR1 levels in benign kidney dropped during tumor progression and were inversely associated with worse survival outcomes, independent of tumor pathology. Quantitative measurement of TfR1 subcellular localization in cell lines demonstrated mixed cytoplasmic and membranous expression with increased TfR1 in clusters in ccRCC versus benign renal cell lines. Results of this study support an important role for TfR1 in RCC progression and identify TfR1 as a novel RCC biomarker and therapeutic target. PMID:29291011

Biology of Adenoid Cystic Carcinoma of the Tracheobronchial Tree and Principles of Management.

PubMed

Maziak, Donna E

2018-05-01

Adenoid cystic carcinoma of the trachea is a rare tumor. The mainstay of treatment remains surgical resection, even in the presence of positive margins or metastatic disease. Perineural involvement commonly causes positive margins and should not deter from resection. Knowledge of releasing maneuvers is essential for surgical success. Long-term follow-up is required with patients presenting late and surviving with recurrent disease for years. Copyright © 2018 Elsevier Inc. All rights reserved.

Renal mass biopsy using Raman spectroscopy identifies malignant and benign renal tumors: potential for pre-operative diagnosis.

PubMed

Liu, Yufei; Du, Zhebin; Zhang, Jin; Jiang, Haowen

2017-05-30

The accuracy of renal mass biopsy to diagnose malignancy can be affected by multiple factors. Here, we investigated the feasibility of Raman spectroscopy to distinguish malignant and benign renal tumors using biopsy specimens. Samples were collected from 63 patients who received radical or partial nephrectomy, mass suspicious of cancer and distal parenchyma were obtained from resected kidney using an 18-gauge biopsy needle. Four Raman spectra were obtained for each sample, and Discriminant Analysis was applied for data analysis. A total of 383 Raman spectra were eventually gathered and each type of tumor had its characteristic spectrum. Raman could separate tumoral and normal tissues with an accuracy of 82.53%, and distinguish malignant and benign tumors with a sensitivity of 91.79% and specificity of 71.15%. It could classify low-grade and high-grade tumors with an accuracy of 86.98%. Besides, clear cell renal carcinoma was differentiated with oncocytoma and angiomyolipoma with accuracy of 100% and 89.25%, respectively. And histological subtypes of cell carcinoma were distinguished with an accuracy of 93.48%. When compared with final pathology and biopsy, Raman spectroscopy was able to correctly identify 7 of 11 "missed" biopsy diagnoses. These results suggested that Raman may serve as a promising non-invasive approach in the future for pre-operative diagnosis.

Molecular Genetics and Clinical Features of Birt-Hogg-Dubé-Syndrome

PubMed Central

Schmidt, Laura S.; Linehan, W. Marston

2016-01-01

Birt-Hogg-Dubé (BHD) syndrome is an inherited renal cancer syndrome in which affected individuals are at risk to develop benign, cutaneous fibrofolliculomas, bilateral pulmonary cysts and spontaneous pneumothoraces, and kidney tumors. Bilateral multifocal renal tumors that develop in BHD syndrome are most frequently hybrid oncocytic tumors and chromophobe renal carcinoma, but may present with other histologies. Germline mutations in the FLCN gene on chromosome 17 are responsible for BHD syndrome. BHD-associated renal tumors show inactivation of the wild-type FLCN allele by somatic mutation or chromosomal loss, confirming that FLCN is a tumor suppressor gene that fits the classic two-hit model. FLCN interacts with two novel proteins, FNIP1 and FNIP2, and with AMPK, a negative regulator of mTOR. Studies with FLCN-deficient cell and animal models support a role for FLCN in modulating the AKT-mTOR pathway. Emerging evidence links FLCN with a number of other molecular pathways and cellular processes important for cell homeostasis that are frequently deregulated in cancer, including regulation of TFE3/TFEB transcriptional activity, amino acid-dependent mTOR activation through Rag GTPases, TGF-β signaling, PGC1α-driven mitochondrial biogenesis, and autophagy. Currently, surgical intervention is the only therapy available for BHD-associated renal tumors. Further understanding of the FLCN pathway will hopefully lead to the development of effective forms of therapy for this disease. PMID:26334087

Unicameral bone cyst of a cervical vertebral body and lateral mass with associated pathological fracture in a child. Case report and review of the literature.

PubMed

Snell, B E; Adesina, A; Wolfla, C E

2001-10-01

The authors present the case of a 10-year-old girl with a history of cervical trauma in whom a cystic lesion was found to involve all three columns of C-7 with evidence of pathological fracture. Computerized tomography scanning revealed a lytic lesion with sclerotic margins involving the left vertebral body, pedicle, lateral mass, and lamina of C-7 with an associated pathological compression fracture. Magnetic resonance imaging demonstrated mixed signal on both T1- and T2-weighted sequences, with cystic and enhancing solid portions. Magnetic resonance angiography demonstrated anterior displacement of the left vertebral artery at C-7. The patient underwent C-7 subtotal corpectomy and posterior resection of the tumor mass; anterior and posterior fusion were performed in which instrumentation was placed. Histological examination disclosed cystic areas lined by fibromembranous tissue with calcification and osteoid deposits consistent with unicameral bone cyst. Of the four previously reported cases of unicameral bone cysts in the cervical spine, none involved all three columns simultaneously or was associated with pathological fracture. The most common differential diagnostic considerations for cystic lesions in the spine are aneurysmal bone cyst, osteoblastoma, or giant cell tumor of bone. Unicameral bone cyst, in this location, although rare, must be considered in the differential diagnosis and may require resection and spinal reconstruction.

Melanotic MiT family translocation neoplasms: Expanding the clinical and molecular spectrum of this unique entity of tumors.

PubMed

Saleeb, Rola M; Srigley, John R; Sweet, Joan; Doucet, Cedric; Royal, Virginie; Chen, Ying-Bei; Brimo, Fadi; Evans, Andrew

2017-11-01

MiT family translocation tumors are a group of neoplasms characterized by translocations involving MiT family transcription factors. The translocation renal cell carcinomas, TFE3 (Xp11.2) and TFEB (t6;11) are known members of this family. Melanotic Xp11 translocation renal cancer is a more recently described entity. To date only 14 cases have been described. It is characterized by a distinct set of features including a nested epithelioid morphology, melanin pigmentation, labeling for markers of melanocytic differentiation, lack of labeling for markers of renal tubular differentiation, predominance in a younger age population and association with aggressive clinical behavior. There are noted similarities between that entity and TFE3 associated PEComas. There are no cases reported of equivalent melanotic TFEB translocation renal cancer. We report 2 rare cases of melanotic translocation renal neoplasms. The first is a melanotic TFE3 translocation renal cancer with an indolent clinical course, occurring in a patient more than 3-decades older than the usual average age in which such tumors have been described. The other case is, to our knowledge, the first reported melanotic TFEB translocation cancer of the kidney. Both cases exhibit the same H&E morphology as previously reported in melanotic translocation renal cancers and label accordingly with HMB45 and Melan-A. While the TFE3 melanotic tumor lacked any evidence of renal tubular differentiation, the TFEB melanotic cancer exhibited some staining for renal tubular markers. Based on the unique features noted above, these two cases expand the clinical and molecular spectrum of the melanotic translocation renal cancers. Copyright © 2017 Elsevier GmbH. All rights reserved.

Permanent renal loss following tumor necrosis factor α antagonists for arthritis.

PubMed

Chen, Tzu-Jen; Yang, Ya-Fei; Huang, Po-Hao; Lin, Hsin-Hung; Huang, Chiu-Ching

2010-06-01

Tumor necrosis factor alpha (TNF-alpha) antagonists are now widely used in the treatment of aggressive rheumatoid arthritis and are generally well tolerated. Although rare, they could induce systemic lupus erythematosus, glomerulonephritis, and antineutrophil cytoplasmic antibody associated systemic vasculitis. Tumor necrosis factor alpha antagonists associated glomerulonephritis usually subsides after discontinuation of the therapy and subsequent initiation of corticosteroids and immunosuppressive agents. Here we describe crescentic glomerulonephritis progression to end-stage renal disease in a patient following two doses of TNF-alpha antagonists for the treatment of reactive arthritis. To our knowledge, dialysis dependent permanent renal loss after TNF-alpha antagonists has not yet been reported. We suggest the renal function should be closely monitored in patients treated with TNF-alpha antagonists by rheumatologists.

Anatomic renal artery branch microdissection to facilitate zero-ischemia partial nephrectomy.

PubMed

Ng, Casey K; Gill, Inderbir S; Patil, Mukul B; Hung, Andrew J; Berger, Andre K; de Castro Abreu, Andre Luis; Nakamoto, Masahiko; Eisenberg, Manuel S; Ukimura, Osamu; Thangathurai, Duraiyah; Aron, Monish; Desai, Mihir M

2012-01-01

Robot-assisted and laparoscopic partial nephrectomies (PNs) for medial tumors are technically challenging even with the hilum clamped and, until now, were impossible to perform with the hilum unclamped. Evaluate whether targeted vascular microdissection (VMD) of renal artery branches allows zero-ischemia PN to be performed even for challenging medial tumors. A prospective cohort evaluation of 44 patients with renal masses who underwent robot-assisted or laparoscopic zero-ischemia PN either with anatomic VMD (group 1; n=22) or without anatomic VMD (group 2; n=22) performed by a single surgeon from April 2010 to January 2011. Zero-ischemia PN with VMD incorporates four maneuvers: (1) preoperative computed tomographic reconstruction of renal arterial branch anatomy, (2) anatomic dissection of targeted, tumor-specific tertiary or higher-order renal arterial branches, (3) neurosurgical aneurysm microsurgical bulldog clamp(s) for superselective tumor devascularization, and (4) transient, controlled reduction of blood pressure, if necessary. Baseline, perioperative, and postoperative data were collected prospectively. Group 1 tumors were larger (4.3 vs 2.6 cm; p=0.011), were more often hilar (41% vs 9%; p=0.09), were medial (59% and 23%; p=0.017), were closer to the hilum (1.46 vs 3.26 cm; p=0.0002), and had a lower C index score (2.1 vs 3.9; p=0.004) and higher RENAL nephrometry scores (7.7 vs 6.2; p=0.013). Despite greater complexity, no group 1 tumor required hilar clamping, and perioperative outcomes were similar to those of group 2: operating room time (4.7 and 4.1h), median blood loss (200 and 100ml), surgical margins for cancer (all negative), major complications (0% and 9%), and minor complications (18% and 14%). The median serum creatinine level was similar 2 mo postoperatively (1.2 and 1.3mg/dl). The study was limited by the relatively small sample size. Anatomic targeted dissection and superselective control of tumor-specific renal arterial branches facilitate zero-ischemia PN. Even challenging medial and hilar tumors can be excised without hilar clamping. Global surgical renal ischemia has been eliminated for most patients undergoing PN at our institution. Copyright © 2011 European Association of Urology. Published by Elsevier B.V. All rights reserved.

Family Caregiver Palliative Care Intervention in Supporting Caregivers of Patients With Stage II-IV Gastrointestinal, Gynecologic, Urologic and Lung Cancers

ClinicalTrials.gov

2018-02-12

Healthy Subject; Localized Transitional Cell Cancer of the Renal Pelvis and Ureter; Metastatic Transitional Cell Cancer of the Renal Pelvis and Ureter; Psychosocial Effects of Cancer and Its Treatment; Recurrent Bladder Cancer; Recurrent Cervical Cancer; Recurrent Colon Cancer; Recurrent Gastric Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Ovarian Germ Cell Tumor; Recurrent Pancreatic Cancer; Recurrent Rectal Cancer; Recurrent Renal Cell Cancer; Recurrent Transitional Cell Cancer of the Renal Pelvis and Ureter; Recurrent Urethral Cancer; Recurrent Uterine Sarcoma; Regional Transitional Cell Cancer of the Renal Pelvis and Ureter; Stage II Bladder Cancer; Stage II Renal Cell Cancer; Stage II Urethral Cancer; Stage IIA Cervical Cancer; Stage IIA Colon Cancer; Stage IIA Gastric Cancer; Stage IIA Ovarian Epithelial Cancer; Stage IIA Ovarian Germ Cell Tumor; Stage IIA Pancreatic Cancer; Stage IIA Rectal Cancer; Stage IIA Uterine Sarcoma; Stage IIB Cervical Cancer; Stage IIB Colon Cancer; Stage IIB Gastric Cancer; Stage IIB Ovarian Epithelial Cancer; Stage IIB Ovarian Germ Cell Tumor; Stage IIB Pancreatic Cancer; Stage IIB Rectal Cancer; Stage IIB Uterine Sarcoma; Stage IIC Colon Cancer; Stage IIC Ovarian Epithelial Cancer; Stage IIC Ovarian Germ Cell Tumor; Stage IIC Rectal Cancer; Stage III Bladder Cancer; Stage III Pancreatic Cancer; Stage III Renal Cell Cancer; Stage III Urethral Cancer; Stage IIIA Cervical Cancer; Stage IIIA Colon Cancer; Stage IIIA Gastric Cancer; Stage IIIA Ovarian Epithelial Cancer; Stage IIIA Ovarian Germ Cell Tumor; Stage IIIA Rectal Cancer; Stage IIIA Uterine Sarcoma; Stage IIIB Cervical Cancer; Stage IIIB Colon Cancer; Stage IIIB Gastric Cancer; Stage IIIB Ovarian Epithelial Cancer; Stage IIIB Ovarian Germ Cell Tumor; Stage IIIB Rectal Cancer; Stage IIIB Uterine Sarcoma; Stage IIIC Colon Cancer; Stage IIIC Gastric Cancer; Stage IIIC Ovarian Epithelial Cancer; Stage IIIC Ovarian Germ Cell Tumor; Stage IIIC Rectal Cancer; Stage IIIC Uterine Sarcoma; Stage IV Bladder Cancer; Stage IV Gastric Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Ovarian Germ Cell Tumor; Stage IV Pancreatic Cancer; Stage IV Renal Cell Cancer; Stage IV Urethral Cancer; Stage IVA Cervical Cancer; Stage IVA Colon Cancer; Stage IVA Rectal Cancer; Stage IVA Uterine Sarcoma; Stage IVB Cervical Cancer; Stage IVB Colon Cancer; Stage IVB Rectal Cancer; Stage IVB Uterine Sarcoma; Ureter Cancer; Stage IIA Lung Carcinoma; Stage IIB Lung Carcinoma; Stage IIIA Lung Carcinoma; Stage IIIB Lung Carcinoma

Dedifferentiated adenoid cystic carcinoma of the trachea: a case report with respect to the immunohistochemical analyses of mammalian target of rapamycin pathway proteins.

PubMed

Ishida, Mitsuaki; Okabe, Hidetoshi

2013-08-01

Dedifferentiated adenoid cystic carcinoma is an extremely rare and highly aggressive tumor. We describe the first reported case of dedifferentiated adenoid cystic carcinoma of the trachea and analyze the expression profiles of mammalian target of rapamycin pathway proteins. A 66-year-old Japanese man was incidentally found to have stenosis of the trachea, and a bronchial biopsy revealed low-grade adenoid cystic carcinoma. The resected specimen revealed dedifferentiated adenoid cystic carcinoma, which was composed of conventional low-grade adenoid cystic carcinoma with tubular and cribriform patterns, and a dedifferentiated carcinoma component (poorly differentiated adenocarcinoma). Immunohistochemical study showed that mammalian target of rapamycin and 4E-BP1 were expressed in both components; however, phosphorylated 4E-BP1 was expressed only in the dedifferentiated carcinoma component. This report clearly demonstrates that mammalian target of rapamycin pathway proteins were activated in dedifferentiated carcinoma. Mammalian target of rapamycin is a central protein involved in carcinogenesis, and administration of its inhibitors prolonged survival in some types of carcinoma. Therefore, mammalian target of rapamycin inhibitors may be a potential candidate for treatment of this highly aggressive carcinoma. Copyright © 2013 Elsevier Inc. All rights reserved.

Adenoid cystic carcinoma of cervix in younger women: report of two new cases.

PubMed

Sinaa, Mohamed; Oukabli, Mohamed; Albouzidi, Abderahmane

2014-01-01

Adenoid cystic carcinoma is a malignant epithelial neoplasm derived from the salivary glands. Primary adenoid cystic carcinoma of the cervix is extremely rare, accounting for less than 1% of all cervical carcinomas. Its origin is debatable. It generally presents in elderly age group, however only twenty three cases have been reported in women less than age 45 years old. In this paper we report two new cases of primary adenoid cystic carcinoma in younger women and include the cytopathology and histopathology findings. A 36, 41 year-old women were admitted with signs and symptoms suggestive of a cervical cancer. Speculum examination showed a firm mass in the uterine cervix. The diagnosis of adenoid cystic carcinoma was confirmed by the histopathology examination of the biopsy specimen in the two patients, which characteristically revealed the presence of a cribriform pattern and cylindromatous structures of the tumor cells, adhered around hyaline stoma. They were managed successfully by concurrent radiotherapy. Adenoid cystic carcinoma of the cervix is a rare disease. It usually occurs in an elderly age group. We report these two cases because of its rarity in young patients, with description of illustrative pathology and discussion on the histological diagnosis.

Molecular Analyses Reveal Inflammatory Mediators in the Solid Component and Cyst Fluid of Human Adamantinomatous Craniopharyngioma.

PubMed

Donson, Andrew M; Apps, John; Griesinger, Andrea M; Amani, Vladimir; Witt, Davis A; Anderson, Richard C E; Niazi, Toba N; Grant, Gerald; Souweidane, Mark; Johnston, James M; Jackson, Eric M; Kleinschmidt-DeMasters, Bette K; Handler, Michael H; Tan, Aik-Choon; Gore, Lia; Virasami, Alex; Gonzalez-Meljem, Jose Mario; Jacques, Thomas S; Martinez-Barbera, Juan Pedro; Foreman, Nicholas K; Hankinson, Todd C

2017-09-01

Pediatric adamantinomatous craniopharyngioma (ACP) is a highly solid and cystic tumor, often causing substantial damage to critical neuroendocrine structures such as the hypothalamus, pituitary gland, and optic apparatus. Paracrine signaling mechanisms driving tumor behavior have been hypothesized, with IL-6R overexpression identified as a potential therapeutic target. To identify potential novel therapies, we characterized inflammatory and immunomodulatory factors in ACP cyst fluid and solid tumor components. Cytometric bead analysis revealed a highly pro-inflammatory cytokine pattern in fluid from ACP compared to fluids from another cystic pediatric brain tumor, pilocytic astrocytoma. Cytokines and chemokines with particularly elevated concentrations in ACPs were IL-6, CXCL1 (GRO), CXCL8 (IL-8) and the immunosuppressive cytokine IL-10. These data were concordant with solid tumor compartment transcriptomic data from a larger cohort of ACPs, other pediatric brain tumors and normal brain. The majority of receptors for these cytokines and chemokines were also over-expressed in ACPs. In addition to IL-10, the established immunosuppressive factor IDO-1 was overexpressed by ACPs at the mRNA and protein levels. These data indicate that ACP cyst fluids and solid tumor components are characterized by an inflammatory cytokine and chemokine expression pattern. Further study regarding selective cytokine blockade may inform novel therapeutic interventions. © 2017 American Association of Neuropathologists, Inc. All rights reserved.

Clear cell papillary renal cell carcinoma as part of histologically discordant multifocal renal cell carcinoma: A case report and review of literature.

PubMed

Shao, Tiffany; Yousef, Peter; Shipilova, Irina; Saleeb, Rola; Lee, Jason Y; Krizova, Adriana

2016-03-01

Multifocal renal cell carcinoma of different histological subtypes within a single kidney is rare. We report a recently classified clear cell (tubulo) papillary renal cell carcinoma as part of an unusual case of multifocal renal cell carcinoma of discordant histological subtypes. A 57 year-old-man was found to have multiple renal tumors and cysts on imaging and underwent a laparoscopic left radical nephrectomy. Pathological review showed multifocal renal cell carcinoma (clear cell (tubulo) papillary, clear cell and papillary renal cell carcinomas and papillary adenomas). Morphology of clear cell papillary renal cell carcinoma was supported by immunohistochemical profile (CK7+, HMWK+, CAIX+, AMACR-, CD10-, TFE3-). This is the first report of clear cell papillary renal cell carcinoma as part of multifocal renal cell carcinoma of different histological subtypes. Related lineage of clear cell renal cell carcinoma and papillary renal cell carcinoma is supported by the highest prevalence of their combination within multifocal renal cell carcinoma of different histological subtypes along with their molecular interconnection. Clear cell papillary renal cell carcinoma may be uniquely placed between clear cell and papillary renal cell carcinomas since it shows morphological features intermediate between clear cell and papillary renal cell carcinoma along with overlapping but unique immunohistochemical profile. Clear cell papillary renal cell carcinoma may be molecularly related to clear cell and papillary renal cell carcinomas since the tumors overexpress markers of HIF pathway activation with normal/elevated VHL mRNA expression and some tumors show losses of chromosome 3. Due to the overlapping morphology, it is possible that cases of clear cell papillary renal cell carcinoma may have been misclassified as papillary or clear cell renal cell carcinoma in the literature, incorrectly increasing their reported prevalence. Identification of multifocal RCCs may be related to the extent of pathological sampling. Copyright © 2016 Elsevier GmbH. All rights reserved.

Renal pelvic anatomy is associated with incidence, grade, and need for intervention for urine leak following partial nephrectomy.

PubMed

Tomaszewski, Jeffrey J; Cung, Bic; Smaldone, Marc C; Mehrazin, Reza; Kutikov, Alexander; Viterbo, Rosalia; Chen, David Y T; Greenberg, Richard E; Uzzo, Robert G

2014-11-01

Although the effect of tumor complexity on perioperative outcome measures is well established, the impact of renal pelvic anatomy on perioperative outcomes remains poorly defined. To evaluate renal pelvic anatomy as an independent predictor of urine leak in moderate- and high-complexity tumors undergoing nephron-sparing surgery. Patients undergoing open partial nephrectomy (PN) for localized RCC were stratified into intermediate- and high-complexity groups using a nephrometry score (7-9 and 10-12, respectively). A renal pelvic score (RPS) was defined by the percentage of renal pelvis contained inside the volume of the renal parenchyma. On this basis, patients were categorized as having an intraparenchymal (>50%) or extraparenchymal (<50%) renal pelvis. Characteristics of patients with and without an intraparenchymal renal pelvic anatomy were compared. Inclusion criteria were met by 255 patients undergoing PN for intermediate (73.6%) and complex (26.4%) localized renal tumors (mean size: 4.6±2.9cm). Twenty-four (9.6%) renal pelves were classified as completely intraparenchymal. Following stratification by RPS, groups differed with respect to Charlson comorbidity index, body mass index, and largest tumor size, while no differences were observed between hospital length of stay, nephrometry score, estimated blood loss, operative time, and age. Intrarenal pelvic anatomy was associated with a markedly increased risk of urine leak (75% vs 6.5%; p=0.001), secondary intervention (37.5% vs 3.9%; p<0.001), and prolonged duration of urine leak (93±62 d vs 56±29 d; p=0.025). Intraparenchymal renal pelvic anatomy is an uncommon anatomic variant associated with an increased rate of urine leak following PN. Elevated pressures within a small intraparenchymal renal pelvis might explain the increased risk. Preoperative imaging characteristics suggestive of increased risk for urine leak should be considered in perioperative management algorithms. Copyright © 2013. Published by Elsevier B.V.

Xp11.2 translocation tumor: a rare cause of gross hematuria.

PubMed

Asaki, Howard E; Moshero, Gianni; Stanton, Melissa L; Humphreys, Mitchell R

2014-02-01

Xp11.2 translocation tumor is a rare but aggressive form of renal cell carcinoma that predominantly occurs in children but also may be found in young adults. Because this type of cancer is diagnosed via histologic and chromosomal analysis, clinicians should consider translocation tumor in the differential diagnosis of patients with renal lesions and gross hematuria.

A 13-year-old female with Xp11.2 translocation renal cell carcinoma; the first case diagnosed at Siriraj Hospital.

PubMed

Hanamornroongruang, Suchanan; Treetipsatit, Jitsupa; Pongtanakul, Bunchoo; Seangchai, Napakorn

2012-07-01

Xp11.2 translocation renal cell carcinomas are rare tumors characterized by translocations involving chromosome Xp11.2. These tumors are predominantly reported in pediatric patients. The authors report Xp11.2 translocation renal cell carcinoma in a 13-year-old girl who presented with asymptomatic palpable right renal mass. Right radical nephrectomy was performed and revealed a well-defined solid mass at the lower pole of the kidney. Microscopically, the tumor was composed of sheets and nests of clear to pale eosinophilic cells with some alveolar growth pattern. Psammoma bodies were detected. Immunohistochemically, the tumor cells marked with TFE3, focally marked with smooth muscle actin, HMB-45, CD68, progesterone receptor (PR) and CD10 but did not mark with epithelial markers (AE1/AE3, EMA and CAM5.2), vimentin, S-100 and p53. The presence of psammoma bodies is an important diagnostic clue for these tumors. Cytogenetic study and/or immunohistochemistry for TFE3 protein are needed for confirming the diagnosis. Currently, surgery seems to be the most effective therapy Pediatric patients with these tumors are believed to have a favorable prognosis.

A case of huge colon carcinoma and right renal angiomyolipoma accompanied by proximal deep venous thrombosis, pulmonary embolism and tumor thrombus in the renal vein.

PubMed

Ban, Daisuke; Yamamoto, Seiichiro; Kuno, Hirofumi; Fujimoto, Hiroyuki; Fujita, Shin; Akasu, Takayuki; Moriya, Yoshihiro

2008-10-01

A preoperative inferior vena cava (IVC) filter is reported to be effective in surgical cases with proximal deep venous thrombosis (DVT) or in which pulmonary embolism (PE) has already developed, and considered to be at high risk of developing secondary fatal PE during or after surgery. However, guidelines for using an IVC filter have yet to be established. The patient in the present report had two huge tumors, ascending colon cancer and renal angiomyolipoma, which occupied the entire right half of the abdomen, coexisting PE, DVT and tumor thrombus in the right renal vein. Secondary PE is fatal in the perioperative period, therefore, the vena cava filters were preoperatively inserted into the supra- and the infrarenal IVC. We successfully removed the tumors without complications. The patient is alive without tumor recurrence and PE or recurrent DVT 1 year and 6 months after surgery. The coexistence of two huge abdominal tumors as potential causes of PE and DVT is extremely rare, and we could have safely undergone the operation, using two vena cava filters in the supra- and infrarenal IVC.

A Case of New Familiar Genetic Variant of Autosomal Dominant Polycystic Kidney Disease-2: A Case Study.

PubMed

Litvinchuk, Tetiana; Tao, Yunxia; Singh, Ruchi; Vasylyeva, Tetyana L

2015-01-01

Autosomal dominant polycystic kidney disease (ADPKD) is characterized by renal cyst formation due to mutations in genes coding for polycystin-1 [PKD1 (85-90% of cases), on ch 16p13.3] and polycystin-2 [PKD2 (10-15% of cases), on ch 4q13-23] and PKD3 gene (gene unmapped). It is also associated with TSC2/PKD1 contiguous gene syndrome. ADPKD is usually inherited, but new mutations without a family history occur in approximately 10% of the cases. A 17-year-old boy was followed up for bilateral cystic kidney disease, hypertension, and obesity since he was 13 years old. The diagnosis was an accidental finding during abdominal CT at age 13 to rule out appendicitis. A renal ultrasonogram also demonstrated a multiple bilateral cysts. Because of parental history of bilateral renal cysts, PKD1 and PKD2, genetic testing was ordered. Results showed, PKD2 variant 1:3 bp deletion of TGT; nucleotide position: 1602-1604; codon position: 512-513; mRNA reading frame maintained. The same mutation was later identified in his father. A smaller number of patients have a defect in the PKD2 locus on chromosome 4 (resulting in PKD2 disease). There are no known published cases on this familiar genetic variant of ADPKD-2 cystic kidney disease. In this case, the disease is present unusually early in life.

Hypervitaminosis A causing hypercalcemia in cystic fibrosis. Case report and focused review.

PubMed

Safi, Khalid H; Filbrun, Amy G; Nasr, Samya Z

2014-10-01

Hypercalcemia is a rare complication of hypervitaminosis A. We report a pediatric patient with cystic fibrosis (CF) and pancreatic insufficiency who was found to have hypervitaminosis A causing hypercalcemia, complicated by nephrocalcinosis and renal impairment. The patient is a 4-year-old girl with pancreatic-insufficient CF, gastroesophageal reflux, oral aversion, and failure to thrive requiring gastrostomy tube placement. She was prescribed Source CF vitamins, but rarely received the full dose, due to emesis and intolerance. She had routine annual labs that revealed hypercalcemia with elevated blood urea nitrogen and creatinine, which were not present in her previous annual labs. Upon further questioning, her mother reported that she seemed more fatigued for a few weeks, had abdominal pain, and was urinating more frequently. Upon admission to the hospital, laboratory results revealed elevated HCO3, while serum levels of potassium, phosphorus, and albumin were within normal limits. Vitamin D (25-hydroxy) level was low, and vitamin A level was elevated. Extensive metabolic and hormonal workup for the etiology of the hypercalcemia revealed evidence of chronic renal insufficiency and elevated vitamin A levels. She had a renal ultrasound that revealed bilateral nephrocalciosis. Diagnosis of chronic hypervitaminosis A complicated by hypercalcemia was made and was managed by holding vitamin A supplements, aggressive diuresis, and prednisolone. This case emphasizes the importance of regular vitamin A monitoring in patients with CF. There is a wide variability for the lowest intake required to cause toxicity, and the lower limit to cause toxicity has not been determined.

Renal, hepatic, pulmonary and adrenal tumors induced by prenatal inorganic arsenic followed by dimethylarsinic acid in adulthood in CD1 mice

PubMed Central

Tokar, Erik J.; Diwan, Bhalchandra A.; Waalkes, Michael P.

2012-01-01

Inorganic arsenic, an early life carcinogen in humans and mice, can initiate lesions promotable by other agents in later life. The biomethylation product of arsenic, dimethylarsinic acid (DMA), is a multi-site tumor promoter. Thus, pregnant CD1 mice were given drinking water (0 or 85 ppm arsenic) from gestation day 8 to 18 and after weaning male offspring received DMA (0 or 200 ppm; drinking water) for up to 2 years. No renal tumors occurred in controls or DMA alone treated mice while gestational arsenic exposure plus later DMA induced a significant renal tumor incidence of 17% (primarily renal cell carcinoma). Arsenic plus DMA or arsenic alone also increased renal hyperplasia over control but DMA alone did not. Arsenic alone, DMA alone and arsenic plus DMA all induced urinary bladder hyperplasia (33–35%) versus control (2%). Compared to control (6%), arsenic alone tripled hepatocellular carcinoma (20%), and arsenic plus DMA doubled this rate again (43%), but DMA alone had no effect. DMA alone, arsenic alone, and arsenic plus DMA increased lung adenocarcinomas and adrenal adenomas versus control. Overall, DMA in adulthood promoted tumors/lesions initiated by prenatal arsenic in the kidney and liver, but acted independently in the urinary bladder, lung and adrenal. PMID:22230260

Aortic intimal sarcoma masquerading as bilateral renal artery stenosis.

PubMed

Sethi, Supreet; Pothineni, Naga Krishna; Syal, Gaurav; Ali, Syed Mujtaba; Krause, Michelle W

2013-01-01

Aortic intimal sarcoma is a rare tumor with poor prognosis. The most common manifestations are thromboembolic phenomena and vascular obstruction. We present a case of aortic intimal sarcoma causing bilateral renal artery stenosis which manifested as resistant hypertension and acute kidney inury. Multiple attempts to stent the renal arteries were unsuccessful. Eventually the patient developed acute limb ischemia and oliguric kidney failure as complications of the primary tumor.

Pharmacokinetically Guided Everolimus in Patients With Breast Cancer, Pancreatic Neuroendocrine Tumors, or Kidney Cancer

ClinicalTrials.gov

2016-12-09

Estrogen Receptor-positive Breast Cancer; Gastrinoma; Glucagonoma; HER2-negative Breast Cancer; Insulinoma; Mucositis; Oral Complications; Pancreatic Polypeptide Tumor; Progesterone Receptor-positive Breast Cancer; Recurrent Breast Cancer; Recurrent Islet Cell Carcinoma; Recurrent Renal Cell Cancer; Somatostatinoma; Stage III Renal Cell Cancer; Stage IIIA Breast Cancer; Stage IIIB Breast Cancer; Stage IIIC Breast Cancer; Stage IV Breast Cancer; Stage IV Renal Cell Cancer

Surgical planning and manual image fusion based on 3D model facilitate laparoscopic partial nephrectomy for intrarenal tumors.

PubMed

Chen, Yuanbo; Li, Hulin; Wu, Dingtao; Bi, Keming; Liu, Chunxiao

2014-12-01

Construction of three-dimensional (3D) model of renal tumor facilitated surgical planning and imaging guidance of manual image fusion in laparoscopic partial nephrectomy (LPN) for intrarenal tumors. Fifteen patients with intrarenal tumors underwent LPN between January and December 2012. Computed tomography-based reconstruction of the 3D models of renal tumors was performed using Mimics 12.1 software. Surgical planning was performed through morphometry and multi-angle visual views of the tumor model. Two-step manual image fusion superimposed 3D model images onto 2D laparoscopic images. The image fusion was verified by intraoperative ultrasound. Imaging-guided laparoscopic hilar clamping and tumor excision was performed. Manual fusion time, patient demographics, surgical details, and postoperative treatment parameters were analyzed. The reconstructed 3D tumor models accurately represented the patient's physiological anatomical landmarks. The surgical planning markers were marked successfully. Manual image fusion was flexible and feasible with fusion time of 6 min (5-7 min). All surgeries were completed laparoscopically. The median tumor excision time was 5.4 min (3.5-10 min), whereas the median warm ischemia time was 25.5 min (16-32 min). Twelve patients (80 %) demonstrated renal cell carcinoma on final pathology, and all surgical margins were negative. No tumor recurrence was detected after a media follow-up of 1 year (3-15 months). The surgical planning and two-step manual image fusion based on 3D model of renal tumor facilitated visible-imaging-guided tumor resection with negative margin in LPN for intrarenal tumor. It is promising and moves us one step closer to imaging-guided surgery.

Mapping of Carboxypeptidase M in Normal Human Kidney and Renal Cell Carcinoma

PubMed Central

Denis, Catherine J.; Van Acker, Nathalie; De Schepper, Stefanie; De Bie, Martine; Andries, Luc; Fransen, Erik; Hendriks, Dirk; Kockx, Mark M.

2013-01-01

Although the kidney generally has been regarded as an excellent source of carboxypeptidase M (CPM), little is known about its renal-specific expression level and distribution. This study provides a detailed localization of CPM in healthy and diseased human kidneys. The results indicate a broad distribution of CPM along the renal tubular structures in the healthy kidney. CPM was identified at the parietal epithelium beneath the Bowman’s basement membrane and in glomerular mesangial cells. Capillaries, podocytes, and most interstitial cells were CPM negative. Tumor cells of renal cell carcinoma subtypes lose CPM expression upon dedifferentiation. Tissue microarray analysis demonstrated a correlation between low CPM expression and tumor cell type. CPM staining was intense on phagocytotic tumor-associated macrophages. Immunoreactive CPM was also detected in the tumor-associated vasculature. The absence of CPM in normal renal blood vessels points toward a role for CPM in angiogenesis. Coexistence of CPM and the epidermal growth factor receptor (EGFR) was detected in papillary renal cell carcinoma. However, the different subcellular localization of CPM and EGFR argues against an interaction between these h proteins. The description of the distribution of CPM in human kidney forms the foundation for further study of the (patho)physiological activities of CPM in the kidney. PMID:23172796

Rapidly progressing renal cell carcinoma associated with Xp11.2 translocations: a case report

PubMed Central

2012-01-01

Introduction Renal cell carcinoma associated with Xp11.2 translocations is frequently reported in children, but adult-onset is rare. Here, the case of an adult male who developed a renal cell carcinoma associated with Xp11.2 translocations is presented. Case presentation A 38-year-old Asian man presented with left back pain and macroscopic hematuria. Computed tomography revealed a left renal tumor (T3N2M0), and a left radical nephrectomy was performed. Hematoxylin-eosin staining revealed papillary architecture and clear or eosinophilic cytoplasm, and the diagnosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion was made by the immunohistochemical determination of transcription factor E3 protein. In spite of adjuvant therapy with α-interferon, a recurrent tumor was found in his left lung by computed tomography three months after the nephrectomy. Interleukin-2, tyrosine kinase inhibitors and mammalian target of rapamycin inhibitors showed no effect on tumor progression. Conclusions Renal cell carcinomas associated with Xp11.2 translocations have an aggressive clinical course in adults. Strict diagnosis using the immunohistochemistry of transcription factor E3 protein is important to predict the prognosis of such patients and new strategies need to be determined to treat patients with these tumors PMID:22738297

Rapidly progressing renal cell carcinoma associated with Xp11.2 translocations: a case report.

PubMed

Morii, Akihiro; Fujiuchi, Yasuyoshi; Nomoto, Kazuhiro; Komiya, Akira; Fuse, Hideki

2012-06-27

Renal cell carcinoma associated with Xp11.2 translocations is frequently reported in children, but adult-onset is rare. Here, the case of an adult male who developed a renal cell carcinoma associated with Xp11.2 translocations is presented. A 38-year-old Asian man presented with left back pain and macroscopic hematuria. Computed tomography revealed a left renal tumor (T3N2M0), and a left radical nephrectomy was performed. Hematoxylin-eosin staining revealed papillary architecture and clear or eosinophilic cytoplasm, and the diagnosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion was made by the immunohistochemical determination of transcription factor E3 protein. In spite of adjuvant therapy with α-interferon, a recurrent tumor was found in his left lung by computed tomography three months after the nephrectomy. Interleukin-2, tyrosine kinase inhibitors and mammalian target of rapamycin inhibitors showed no effect on tumor progression. Renal cell carcinomas associated with Xp11.2 translocations have an aggressive clinical course in adults. Strict diagnosis using the immunohistochemistry of transcription factor E3 protein is important to predict the prognosis of such patients and new strategies need to be determined to treat patients with these tumors.

Unusual Severe Complication Following Transarterial Chemoembolization for Metastatic Malignant Melanoma: Giant Intrahepatic Cyst and Fatal Hepatic Failure

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ataergin, Selmin, E-mail: sataergin@superonline.co; Tasar, Mustafa; Solchaga, Luis

2009-03-15

We describe a 45-year-old male patient with malignant melanoma who underwent hepatic arterial chemoembolization due to liver metastases. Four months after the procedure, the patient developed a giant cystic cavity in the liver. Cytologic examination of the cystic fluid retention revealed necrotic tumor material. The fluid was drained by percutaneous catheter, but the patient developed hepatic failure. This case represents another rare complication of transarterial chemoembolization and shows that transarterial chemoembolization may have rare fatal complications.

Cytotoxic effect of the Her-2/Her-1 inhibitor PKI-166 on renal cancer cells expressing the connexin 32 gene.

PubMed

Fujimoto, Eriko; Yano, Tomohiro; Sato, Hiromi; Hagiwara, Kiyokazu; Yamasaki, Hiroshi; Shirai, Sumiko; Fukumoto, Keiko; Hagiwara, Hiromi; Negishi, Etsuko; Ueno, Koichi

2005-02-01

We have reported that connexin (Cx) 32 acts as a tumor suppressor gene in renal cancer cells partly due to Her-2 inactivation. Here, we determined if a Her-2/Her-1 inhibitor (PKI-166) can enhance the tumor-suppressive effect of Cx32 in Caki-2 cells from human renal cell carcinoma. The expression of Cx32 in Caki-2 cells was required for PKI-166-induced cytotoxic effect at lower doses. The cyctotoxicity was dependent on the occurrence of apoptosis and partly mediated by Cx32-driven gap junction intercellular communications. These results suggest that PKI-166 further supports the tumor-suppressive effect of the Cx32 gene in renal cancer cells through the induction of apoptosis.

Genetic analysis results of mature cystic teratomas of the ovary in Taiwan disagree with the previous origin theory of this tumor.

PubMed

Wang, Wen-Chung; Lai, Yen-Chein

2016-06-01

The most accepted theory regarding mature cystic teratomas of the ovary is that they are of parthenogenetic origin from oocyte after the completion of first division. Our previous study demonstrated that the origin of mature cystic teratoma of the uterus is not related to the parthenogenetic process, but is most likely pluripotential stem cell or primordial germ cell before meiosis I. Further studies are needed to clarify the origin of benign mature cystic teratomas of the ovary in Taiwan. In the present study, we investigated the DNA profiles of 9 mature cystic teratomas of the ovary using short tandem repeat analysis with AmpFLSTR SGM Plus, Profiler PCR amplification kits. The methylation statuses of the HhaI sites in the SNRPN, H19DMR, and KvDMR regions were determined on methylation-sensitive multiplex ligation-dependent probe amplification analysis. DNA profiling data from the 9 mature cystic teratomas of the ovary excluded parthenogenetic origin, as most of the 15 short tandem repeat loci were heterozygous on genotyping. There were varying degrees of hypermethylation of SNRPN gene and KvDMR locus in the presence of maternal uniparental disomy in all 9 mature cystic teratomas of the ovary. In light of these results, we further postulated that the origin of these mature cystic teratomas of the ovary is oogonia or primary oocyte before germinal vesicle stage failure of meiosis I. Copyright © 2016 Elsevier Inc. All rights reserved.

Stages of Renal Cell Cancer

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

Renal Tumors

PubMed Central

Tan, Puay Hoon; Cheng, Liang; Rioux-Leclercq, Nathalie; Merino, Maria J.; Netto, George; Reuter, Victor E.; Shen, Steven S.; Grignon, David J.; Montironi, Rodolfo; Egevad, Lars; Srigley, John R.; Delahunt, Brett; Moch, Holger

2016-01-01

The International Society of Urological Pathology convened a consensus conference on renal cancer, preceded by an online survey, to address issues relating to the diagnosis and reporting of renal neoplasia. In this report, the role of biomarkers in the diagnosis and assessment of prognosis of renal tumors is addressed. In particular we focused upon the use of immunohistochemical markers and the approach to specific differential diagnostic scenarios. We enquired whether cytogenetic and molecular tools were applied in practice and asked for views on the perceived prognostic role of biomarkers. Both the survey and conference voting results demonstrated a high degree of consensus in participants’ responses regarding prognostic/predictive markers and molecular techniques, whereas it was apparent that biomarkers for these purposes remained outside the diagnostic realm pending clinical validation. Although no individual antibody or panel of antibodies reached consensus for classifying renal tumors, or for confirming renal metastatic disease, it was noted from the online survey that 87% of respondents used immunohistochemistry to subtype renal tumors sometimes or occasionally, and a majority (87%) used immunohistochemical markers (Pax 2 or Pax 8, renal cell carcinoma [RCC] marker, panel of pan-CK, CK7, vimentin, and CD10) in confirming the diagnosis of metastatic RCC. There was consensus that immunohistochemistry should be used for histologic subtyping and applied before reaching a diagnosis of unclassified RCC. At the conference, there was consensus that TFE3 and TFEB analysis ought to be requested when RCC was diagnosed in a young patient or when histologic appearances were suggestive of the translocation subtype; whereas Pax 2 and/or Pax 8 were considered to be the most useful markers in the diagnosis of a renal primary. PMID:24025522

Localized chromophobe renal cell carcinoma: preoperative imaging judgment and laparoscopic simple enucleation for treatment.

PubMed

Ren, Wenbiao; Xue, Bichen; Qu, Jiandong; Liu, Longfei; Li, Chao; Zu, Xiongbing

2018-04-30

To evaluate the preoperative imaging manifestation and therapeutic effect of laparoscopic simple enucleation (SE) for localized chromophobe renal cell carcinoma (chRCC). Clinical data of 36 patients who underwent laparoscopic SE of localized chRCC at our institute were retrospectively analyzed. All patients underwent preoperative renal protocol CT (unenhanced, arterial, venous, and delayed images). CT scan characteristics were evaluated. After intraoperative occlusion of the renal artery, the tumor was free bluntly along the pseudocapsule and enucleated totally. The patients were followed up regularly after the operation. Mean tumor diameter was 3.9±1.0 cm, 80% of tumors were homogeneous and all the tumors had complete pseudocapsule. The attenuation values were slightly lower than normal renal cortex and degree of enhancement of the tumors were significantly lower than normal renal cortex. Mean operation time was 104.3±18.2 min. Mean warm ischemia time (WIT) was 21.3±3.5 min. Mean blood loss was 78.6±25.4 mL. No positive surgical margin was identified. Mean postoperative hospital stay was 5.3±1.5 d. Hematuria occurred in 3 patients and all disappeared within 3 days. After a mean follow-up of 32.1±20.6 months, no patient had local recurrence or metastatic progression. Localized chRCCs have a great propensity for homogeneity and complete pseudocapsule. The attenuation values were slightly lower than normal renal cortex and small degree of enhancement. Laparoscopic SE is a safe and effective treatment for localized chRCC. The oncological results were satisfactory. Copyright® by the International Brazilian Journal of Urology.

Multi-Quadrant Biopsy Technique Improves Diagnostic Ability in Large Heterogeneous Renal Masses.

PubMed

Abel, E Jason; Heckman, Jennifer E; Hinshaw, Louis; Best, Sara; Lubner, Meghan; Jarrard, David F; Downs, Tracy M; Nakada, Stephen Y; Lee, Fred T; Huang, Wei; Ziemlewicz, Timothy

2015-10-01

Percutaneous biopsy obtained from a single location is prone to sampling error in large heterogeneous renal masses, leading to nondiagnostic results or failure to detect poor prognostic features. We evaluated the accuracy of percutaneous biopsy for large renal masses using a modified multi-quadrant technique vs a standard biopsy technique. Clinical and pathological data for all patients with cT2 or greater renal masses who underwent percutaneous biopsy from 2009 to 2014 were reviewed. The multi-quadrant technique was defined as multiple core biopsies from at least 4 separate solid enhancing areas in the tumor. The incidence of nondiagnostic findings, sarcomatoid features and procedural complications was recorded, and concordance between biopsy specimens and nephrectomy pathology was compared. A total of 122 biopsies were performed for 117 tumors in 116 patients (46 using the standard biopsy technique and 76 using the multi-quadrant technique). Median tumor size was 10 cm (IQR 8-12). Biopsy was nondiagnostic in 5 of 46 (10.9%) standard and 0 of 76 (0%) multi-quadrant biopsies (p=0.007). Renal cell carcinoma was identified in 96 of 115 (82.0%) tumors and nonrenal cell carcinoma tumors were identified in 21 (18.0%). One complication occurred using the standard biopsy technique and no complications were reported using the multi-quadrant technique. Sarcomatoid features were present in 23 of 96 (23.9%) large renal cell carcinomas studied. Sensitivity for identifying sarcomatoid features was higher using the multi-quadrant technique compared to the standard biopsy technique at 13 of 15 (86.7%) vs 2 of 8 (25.0%) (p=0.0062). The multi-quadrant percutaneous biopsy technique increases the ability to identify aggressive pathological features in large renal tumors and decreases nondiagnostic biopsy rates. Copyright © 2015 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Radio frequency ablation of small renal tumors:: intermediate results.

PubMed

Hwang, J J; Walther, M M; Pautler, S E; Coleman, J A; Hvizda, J; Peterson, James; Linehan, W M; Wood, B J

2004-05-01

With evolving radio frequency technology, the clinical application of radio frequency ablation (RFA) has been actively investigated in the treatment for small renal tumors. We present our intermediate patient outcomes after RFA. Since January 2001, 17 patients with a total of 24 hereditary renal tumors ranging from 1.2 to 2.85 cm were treated with RFA using the 200 W Cool-tip RF System (Radionics, Burlington, Massachusetts) under laparoscopic (9) or percutaneous (8) guidance and had a minimum 1-year followup. A percutaneous approach was considered unsuitable if kidney tumors were contiguous to bowel, ureter or large vessels. Treatment eligibility criteria included an average tumor diameter of less than 3.0 cm, tumor growth during 1 year and solid appearance with contrast enhancement (HU change greater than 20) on computerized tomography (CT). Postoperative followup consisted of CT with and without intravenous contrast, and renal function assessment at regular intervals. Median patient age was 38 years (range 20 to 51). At a median followup of 385 days (range 342 to 691), median tumor or thermal lesion diameter decreased from 2.26 to 1.62 cm (p = 0.0013), and only 1 lesion (4%), which was located centrally near the hilum, exhibited contrast enhancement (HU change greater than 10) on CT at 12 months. Of the 15 renal tumors ablated laparoscopically, 13 were in direct contact with the bowel and 2 were abutting the ureter, necessitating mobilization before RFA. Laparoscopic ultrasound was used to guide radio frequency electrode placement and monitor the ablation process in these cases. Operative time and intraoperative blood loss (mean +/- standard mean of error) were 243 +/- 29 minutes and 67 +/- 9 cc, respectively. In 1 patient whose ureter was adherent to the tumor a ureteropelvic junction obstruction developed after laparoscopic RFA, requiring open repair. At the minimum 1-year followup 23 of 24 ablated tumors lacked contrast uptake on CT, meeting our radiographic criteria of successful RFA treatment. RFA treatment of small renal tumors using the Radionics system appears to result in superior treatment outcomes compared to those of earlier series with lower radio frequency power generators. A high wattage generator might attain more consistent energy deposition with subsequent cell death in the targeted tissue due to less convective heat loss.

Treatment Options for Renal Cell Cancer

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

Treatment Option Overview (Renal Cell Cancer)

MedlinePlus

... Tumors Treatment Genetics of Kidney Cancer Research Renal Cell Cancer Treatment (PDQ®)–Patient Version General Information About Renal Cell Cancer Go to Health Professional Version Key Points ...

Laparoscopic partial nephrectomy for endophytic hilar tumors: feasibility and outcomes.

PubMed

Di Pierro, G B; Tartaglia, N; Aresu, L; Polara, A; Cielo, A; Cristini, C; Grande, P; Gentile, V; Grosso, G

2014-06-01

To analyze feasibility and outcomes of laparoscopic partial nephrectomy (LPN) for endophytic hilar tumors in low-intermediate (ASA I-II) risk patients. This is a single centre retrospective study. From May 2009 to September 2011, 208 LPNs were performed at our institution. Overall 11 (5.2%) elective LPNs were for hilar tumors not visible on kidney surface. Hilar tumor was defined as a mass located in the renal hilum and in contact with a major renal vessel on preoperative imaging. Procedures were carried out by a single experienced surgeon (G.G.) via retroperitoneal approach by clamping the only main renal artery. Mean (range) age of patients was 45.3 years (38.2-64.1), tumor size 1.6 cm (1.2-2.0), warm ischemia time 24 min (19-32), operative time 140 min (110-200) and estimated blood loss 270 ml (100-750). Two collecting system injuries were observed and repaired intraoperatively. No conversion to open surgery was required. Final pathological examination revealed 10 renal cell carcinomas and 1 oncocytoma. A negative surgical margin was obtained in 10/11 (91%) patients. Renal function and serum hemoglobin were nearly unaltered pre and post-surgery. No tumor recurrence was observed at mean (range) follow-up of 34 months (15-43). In experienced hands, LPN represents a feasible, safe and effective treatment for selected patients diagnosed with endophytic hilar masses. A larger number of patients and longer follow-up are required to draw definitive conclusions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Use of three-dimensional time-resolved phase-contrast magnetic resonance imaging with vastly undersampled isotropic projection reconstruction to assess renal blood flow in a renal cell carcinoma patient treated with sunitinib: a case report.

PubMed

Takayama, Tatsuya; Takehara, Yasuo; Sugiyama, Masataka; Sugiyama, Takayuki; Ishii, Yasuo; Johnson, Kevin E; Wieben, Oliver; Wakayama, Tetsuya; Sakahara, Harumi; Ozono, Seiichiro

2014-08-14

New imaging modalities to assess the efficacy of drugs that have molecular targets remain under development. Here, we describe for the first time the use of time-resolved three-dimensional phase-contrast magnetic resonance imaging to monitor changes in blood supply to a tumor during sunitinib treatment in a patient with localized renal cell carcinoma. A 43-year-old Japanese woman with a tumor-bearing but functional single kidney presented at our hospital in July 2012. Computed tomography and magnetic resonance imaging revealed a cT1aN0M0 renal cell carcinoma embedded in the upper central region of the left kidney. She was prescribed sunitinib as neoadjuvant therapy for 8 months, and then underwent partial nephrectomy. Tumor monitoring during this time was done using time-resolved three-dimensional phase-contrast magnetic resonance imaging, a recent technique which specifically measures blood flow in the various vessels of the kidney. This imaging allowed visualization of the redistribution of renal blood flow during treatment, and showed that flow to the tumor was decreased and flows to other areas increased. Of note, this change occurred in the absence of any change in tumor size. The ability of time-resolved three-dimensional phase-contrast magnetic resonance imaging to provide quantitative information on blood supply to tumors may be useful in monitoring the efficacy of sunitinib treatment.

NEK8 Links the ATR-regulated Replication Stress Response and S-phase CDK Activity to Renal Ciliopathies

PubMed Central

Choi, Hyo Jei Claudia; Lin, Jia-Ren; Vannier, Jean-Baptiste; Slaats, Gisela G.; Kile, Andrew C.; Paulsen, Renee D.; Manning, Danielle K.; Beier, David R.; Giles, Rachel H.; Boulton, Simon J.; Cimprich, Karlene A.

2013-01-01

Summary Renal ciliopathies are a leading cause of kidney failure, but their exact etiology is poorly understood. NEK8/NPHP9 is a ciliary kinase associated with two renal ciliopathies in humans and mice, nephronophthisis (NPHP) and polycystic kidney disease. Here, we identify NEK8 as a key effector of the ATR-mediated replication stress response. Cells lacking NEK8 form spontaneous DNA double-strand breaks (DSBs) which further accumulate when replication forks stall, and they exhibit reduced fork rates, unscheduled origin firing, and increased replication fork collapse. NEK8 suppresses DSB formation by limiting cyclin A-associated CDK activity. Strikingly, a mutation in NEK8 that is associated with renal ciliopathies affects its genome maintenance functions. Moreover, kidneys of NEK8 mutant mice accumulate DNA damage, and loss of NEK8 or replication stress similarly disrupts renal cell architecture in a 3D-culture system. Thus, NEK8 is a critical component of the DNA damage response that links replication stress with cystic kidney disorders. PMID:23973373

Mature Cystic Teratoma with Co-existent Mucinous Cystadenocarcinoma in the same Ovary-A Diagnostic Dilemma

PubMed Central

Roy, Sanjeet; Gupta, Mayank; Chandramohan, Anuradha

2016-01-01

Mature cystic teratoma co-existing with a mucinous cystadenocarcinoma is an infrequently encountered entity with only a handful of cases reported till date. The possibilities in such a case are either a malignant transformation of a benign teratoma into adenocarcinoma or a collision tumor between a mature cystic teratoma and a mucinous tumour of either a primary ovarian surface epithelial-stromal origin or a secondary from a primary gastrointestinal tract tumour. The importance of distinguishing between the two entities has significant bearing on subsequent therapeutic management. We report a rare case of a mature cystic teratoma co-existing with a mucinous cystadenocarcinoma in the same ovary in a 44-year-old lady. Contrast Enhanced Computed Tomography (CECT) imaging of the left ovarian mass was suggestive of a teratoma but an intra-operative frozen section examination was reported as an adenocarcinoma with a cystic teratoma. Gross examination of the surgical specimen revealed a dermoid cyst with another multi-septated cystic lesion containing mucoid material. Histopathological examination showed a mature cystic teratoma and an associated well differentiated mucinous cystadenocarcinoma. The latter displayed a CK7-ve/CK20+ve immunoprofile. In absence of clinical, biochemical or radiological findings of a primary lower gastrointestinal tract tumour, the immunoprofile suggested the possibility of adenocarcinomatous transformation in a benign teratoma. PMID:28208869

Wilms' tumor blastemal stem cells dedifferentiate to propagate the tumor bulk.

PubMed

Shukrun, Rachel; Pode-Shakked, Naomi; Pleniceanu, Oren; Omer, Dorit; Vax, Einav; Peer, Eyal; Pri-Chen, Sara; Jacob, Jasmine; Hu, Qianghua; Harari-Steinberg, Orit; Huff, Vicki; Dekel, Benjamin

2014-07-08

An open question remains in cancer stem cell (CSC) biology whether CSCs are by definition at the top of the differentiation hierarchy of the tumor. Wilms' tumor (WT), composed of blastema and differentiated renal elements resembling the nephrogenic zone of the developing kidney, is a valuable model for studying this question because early kidney differentiation is well characterized. WT neural cell adhesion molecule 1-positive (NCAM1(+)) aldehyde dehydrogenase 1-positive (ALDH1(+)) CSCs have been recently isolated and shown to harbor early renal progenitor traits. Herein, by generating pure blastema WT xenografts, composed solely of cells expressing the renal developmental markers SIX2 and NCAM1, we surprisingly show that sorted ALDH1(+) WT CSCs do not correspond to earliest renal stem cells. Rather, gene expression and proteomic comparative analyses disclose a cell type skewed more toward epithelial differentiation than the bulk of the blastema. Thus, WT CSCs are likely to dedifferentiate to propagate WT blastema.

Wilms’ Tumor Blastemal Stem Cells Dedifferentiate to Propagate the Tumor Bulk

PubMed Central

Shukrun, Rachel; Pode-Shakked, Naomi; Pleniceanu, Oren; Omer, Dorit; Vax, Einav; Peer, Eyal; Pri-Chen, Sara; Jacob, Jasmine; Hu, Qianghua; Harari-Steinberg, Orit; Huff, Vicki; Dekel, Benjamin

2014-01-01

Summary An open question remains in cancer stem cell (CSC) biology whether CSCs are by definition at the top of the differentiation hierarchy of the tumor. Wilms’ tumor (WT), composed of blastema and differentiated renal elements resembling the nephrogenic zone of the developing kidney, is a valuable model for studying this question because early kidney differentiation is well characterized. WT neural cell adhesion molecule 1-positive (NCAM1+) aldehyde dehydrogenase 1-positive (ALDH1+) CSCs have been recently isolated and shown to harbor early renal progenitor traits. Herein, by generating pure blastema WT xenografts, composed solely of cells expressing the renal developmental markers SIX2 and NCAM1, we surprisingly show that sorted ALDH1+ WT CSCs do not correspond to earliest renal stem cells. Rather, gene expression and proteomic comparative analyses disclose a cell type skewed more toward epithelial differentiation than the bulk of the blastema. Thus, WT CSCs are likely to dedifferentiate to propagate WT blastema. PMID:25068119

Ochratoxin a and mitotic disruption: mode of action analysis of renal tumor formation by ochratoxin A.

PubMed

Mally, Angela

2012-06-01

The mycotoxin and food contaminant ochratoxin A (OTA) is a potent renal carcinogen in rodents, but its mode of action (MoA) is still poorly defined. In 2006, the European Food Safety Authority concluded that there is a "lack of evidence for the existence of OTA-DNA adducts" and thus insufficient evidence to establish DNA reactivity as a MoA for tumor formation by OTA. In reviewing the available database on OTA toxicity, a MoA for renal carcinogenicity of OTA is developed that involves a combination of genetic instability and increased proliferative drive as consequences of OTA-mediated disruption of mitosis, whereby the organ- and site-specificity of tumor formation by OTA is determined by selective renal uptake of OTA into the proximal tubule epithelium. The proposed MoA is critically assessed with respect to concordance of dose-response of the suggested key events and tumor formation, their temporal association, consistency, and biological plausibility. Uncertainties, data gaps and needs for further research are highlighted.

[Non-metastatic clear cell renal cancer: dependence of the tumour stage on clinico-anatomic and morphologic factors; prognostic value of macro- and karyometric characteristics].

PubMed

Iurin, A G

2010-01-01

Non-metastatic clear-cell renal cancer: dependence of the tumour stage on clinico-anatomic and morphologic factors; prognostic value of macro- and karyometric characteristics Sankt Peterburg Pathology Bureau, Sankt Peterburg It was shown based on multivariate regression analysis that pT1a3bN0MO stages of non-metastatic clear-cell renal cancer significantly correlate not only with the tumor size and invasion into the fatty tissue and/or renal vein but also with the invasion into the renal capsule and with the mean maximum diameter and mean nucleus area of tumor cells. There was no correlation of clear-cell renal cancer stages with tumor proliferative activity, gene p53 mutation, oncosuppressor gene PTEN expression, fraction of tumour clear-cell component, and such clinical characteristics as patients' sex, age, and body mass index. Taking into account statistically significant differences between the patients' survival rates, the regression equations developed in this work may be used for the prediction of disease outcome.

Emergent Embolization of a Very Late Detected Pseudoaneurysm at a Lower Pole Subsegmental Artery of the Kidney after Clampless Laparoscopic Partial Nephrectomy

PubMed Central

Chiancone, Francesco; Fedelini, Maurizio; Pucci, Luigi; Di Lorenzo, Domenico; Meccariello, Clemente; Fedelini, Paolo

2017-01-01

Renal artery pseudoaneurysm is a rare but life-threatening condition. Its incidence is higher after minimally invasive partial nephrectomy (PN) than after the open approach. We reported a case of a renal artery pseudoaneurysm occurred about four months after a clampless laparoscopic PN. A 49-year-old female underwent a clampless laparoscopic PN for a right renal tumor with high surgical complexity. The patient experienced an intraoperative blood loss from renal bed and the surgeons performed a deep medullary absorbable suture. Three months after surgery the patient underwent a renal ultrasonography with good results. The patient came to our emergency department 115 days after surgery with a hypovolemic shock stage 3. Her CT scan showed a pseudoaneurysm of a lower pole vessel of the right kidney. She underwent a superselective embolization of the segmental renal artery. The surgical complexity of the tumor, the anatomical relationships with the renal sinus and the deep medullary suture could be responsible for the development of the pseudoaneurysm. The authors presented an unusual case of a very late detected pseudoaneurysm of a renal vessel, suggesting that all very complex renal tumors removed with a minimally invasive technique should be followed up closely at least during the first six-months in order to early detect this major complication. PMID:28785196

Use of quantitative SPECT/CT reconstruction in 99mTc-sestamibi imaging of patients with renal masses.

PubMed

Jones, Krystyna M; Solnes, Lilja B; Rowe, Steven P; Gorin, Michael A; Sheikhbahaei, Sara; Fung, George; Frey, Eric C; Allaf, Mohamad E; Du, Yong; Javadi, Mehrbod S

2018-02-01

Technetium-99m ( 99m Tc)-sestamibi single-photon emission computed tomography/computed tomography (SPECT/CT) has previously been shown to allow for the accurate differentiation of benign renal oncocytomas and hybrid oncocytic/chromophobe tumors (HOCTs) apart from other malignant renal tumor histologies, with oncocytomas/HOCTs showing high uptake and renal cell carcinoma (RCC) showing low uptake based on uptake ratios from non-quantitative single-photon emission computed tomography (SPECT) reconstructions. However, in this study, several tumors fell close to the uptake ratio cutoff, likely due to limitations in conventional SPECT/CT reconstruction methods. We hypothesized that application of quantitative SPECT/CT (QSPECT) reconstruction methods developed by our group would provide more robust separation of hot and cold lesions, serving as an imaging framework on which quantitative biomarkers can be validated for evaluation of renal masses with 99m Tc-sestamibi. Single-photon emission computed tomography data were reconstructed using the clinical Flash 3D reconstruction and QSPECT methods. Two blinded readers then characterized each tumor as hot or cold. Semi-quantitative uptake ratios were calculated by dividing lesion activity by background renal activity for both Flash 3D and QSPECT reconstructions. The difference between median (mean) hot and cold tumor uptake ratios measured 0.655 (0.73) with the QSPECT method and 0.624 (0.67) with the conventional method, resulting in increased separation between hot and cold tumors. Sub-analysis of 7 lesions near the separation point showed a higher absolute difference (0.16) between QPSECT and Flash 3D mean uptake ratios compared to the remaining lesions. Our finding of improved separation between uptake ratios of hot and cold lesions using QSPECT reconstruction lays the foundation for additional quantitative SPECT techniques such as SPECT-UV in the setting of renal 99m Tc-sestamibi and other SPECT/CT exams. With robust quantitative image reconstruction and biomarker analysis, there may be an expanded role for SPECT/CT imaging in renal masses and other pathologic conditions.

Renal Cell Carcinoma, Unclassified with Medullary Phenotype and Synchronous Renal Clear Cell Carcinoma Present in a Patient with No Sickle Cell Trait/Disease: Diagnostic and Therapeutic Challenges.

PubMed

Lai, Jenny Z; Lai, H Henry; Cao, Dengfeng

2018-06-01

Renal medullary carcinoma (RMC) is an aggressive high-grade renal cell carcinoma (RCC) associated almost exclusively with sickle cell trait or sickle cell disease. However, RCC with RMC features has rarely been reported in patients with no sickle cell trait or disease. Renal cell carcinoma unclassified with medullary phenotype (RCCU-MP) is a newly-coined term used by an international panel of experts to describe renal cell carcinoma showing morphologic and immunohistochemical features of renal medullary carcinoma in patients without sickle cell trait/disease. So far, only one study in the English literature has described five such cases. Here, we report a case with unique clinical and pathological features in a 76-year-old male patient without sickle cell trait. The patient had a history of colon cancer with liver and lung metastases and was found to have a new renal mass in his right kidney during the follow up. A right nephrectomy was performed and showed two separate masses (tumor 1 and tumor 2). Tumor 1 had histologic features of RMC and the tumor cells were positive for CK7, Pax8, and OCT4 and showed loss of nuclear INI1 expression. Tumor 1 was diagnosed as RCCU-MP (6.3 cm, pT3aNx, WHO/ISUP nuclear grade 3). Tumor 2 showed features of clear cell type of RCC (0.6 cm, pT1aNx, WHO/ISUP grade 2) with intact nuclear INI1 expression. Three-months post-nephrectomy, the patient developed lung metastasis of RCCU-MP. To the best of our knowledge, this was the first documented case with synchronous RCCU-MP and clear cell RCC presenting in a patient without sickle cell trait. Careful histologic assessment with a panel of immunohistochemical biomarkers was helpful to render a correct diagnosis for early aggressive treatment. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

Obesity as defined by waist circumference but not body mass index is associated with higher renal mass complexity.

PubMed

Bertrand, Laura A; Thomas, Lewis J; Li, Peng; Buchta, Claire M; Boi, Shannon K; Orlandella, Rachael M; Brown, James A; Nepple, Kenneth G; Norian, Lyse A

2017-11-01

Obesity, typically defined as a body mass index (BMI)≥30kg/m 2 , is an established risk factor for renal cell carcinoma (RCC) but is paradoxically linked to less advanced disease at diagnosis and improved outcomes. However, BMI has inherent flaws, and alternate obesity-defining metrics that emphasize abdominal fat are available. We investigated 3 obesity-defining metrics, to better examine the associations of abdominal fat vs. generalized obesity with renal tumor stage, grade, or R.E.N.A.L. nephrometry score. In a prospective cohort of 99 subjects with renal masses undergoing resection and no evidence of metastatic disease, obesity was assessed using 3 metrics: body mass index (BMI), radiographic waist circumference (WC), and retrorenal fat (RRF) pad distance. R.E.N.A.L. nephrometry scores were calculated based on preoperative CT or MRI. Univariate and multivariate analyses were performed to identify associations between obesity metrics and nephrometry score, tumor grade, and tumor stage. In the 99 subjects, surgery was partial nephrectomy in 51 and radical nephrectomy in 48. Pathology showed benign masses in 11 and RCC in 88 (of which 20 had stage T3 disease). WC was positively correlated with nephrometry score, even after controlling for age, sex, race, and diabetes status (P = 0.02), whereas BMI and RRF were not (P = 0.13, and P = 0.57, respectively). WC in stage T2/T3 subjects was higher than in subjects with benign masses (P = 0.03). In contrast, subjects with Fuhrman grade 1 and 2 tumors had higher BMI (P<0.01) and WC (P = 0.04) than subjects with grade 3 and 4 tumors. Our data suggest that obesity measured by WC, but not BMI or RRF, is associated with increased renal mass complexity. Tumor Fuhrman grade exhibited a different trend, with both high WC and BMI associated with lower-grade tumors. Our findings indicate that WC and BMI are not interchangeable obesity metrics. Further evaluation of RCC-specific outcomes using WC vs. BMI is warranted to better understand the complex relationship between general vs. abdominal obesity and RCC characteristics. Copyright © 2017. Published by Elsevier Inc.

Mitochondrial ASncmtRNA-1 and ASncmtRNA-2 as potent targets to inhibit tumor growth and metastasis in the RenCa murine renal adenocarcinoma model

PubMed Central

Borgna, Vincenzo; Villegas, Jaime; Burzio, Verónica A.; Belmar, Sebastián; Araya, Mariela; Jeldes, Emanuel; Lobos-González, Lorena; Silva, Verónica; Villota, Claudio; Oliveira-Cruz, Luciana; Lopez, Constanza; Socias, Teresa; Castillo, Octavio; Burzio, Luis O.

2017-01-01

Knockdown of antisense noncoding mitochondrial RNAs (ASncmtRNAs) induces apoptosis in several human and mouse tumor cell lines, but not normal cells, suggesting this approach for a selective therapy against different types of cancer. Here we show that in vitro knockdown of murine ASncmtRNAs induces apoptotic death of mouse renal adenocarcinoma RenCa cells, but not normal murine kidney epithelial cells. In a syngeneic subcutaneous RenCa model, treatment delayed and even reversed tumor growth. Since the subcutaneous model does not reflect the natural microenviroment of renal cancer, we used an orthotopic model of RenCa cells inoculated under the renal capsule. These studies showed inhibition of tumor growth and metastasis. Direct metastasis assessment by tail vein injection of RenCa cells also showed a drastic reduction in lung metastatic nodules. In vivo treatment reduces survivin, N-cadherin and P-cadherin levels, providing a molecular basis for metastasis inhibition. In consequence, the treatment significantly enhanced mouse survival in these models. Our results suggest that the ASncmtRNAs could be potent and selective targets for therapy against human renal cell carcinoma. PMID:28620146

Mitochondrial ASncmtRNA-1 and ASncmtRNA-2 as potent targets to inhibit tumor growth and metastasis in the RenCa murine renal adenocarcinoma model.

PubMed

Borgna, Vincenzo; Villegas, Jaime; Burzio, Verónica A; Belmar, Sebastián; Araya, Mariela; Jeldes, Emanuel; Lobos-González, Lorena; Silva, Verónica; Villota, Claudio; Oliveira-Cruz, Luciana; Lopez, Constanza; Socias, Teresa; Castillo, Octavio; Burzio, Luis O

2017-07-04

Knockdown of antisense noncoding mitochondrial RNAs (ASncmtRNAs) induces apoptosis in several human and mouse tumor cell lines, but not normal cells, suggesting this approach for a selective therapy against different types of cancer. Here we show that in vitro knockdown of murine ASncmtRNAs induces apoptotic death of mouse renal adenocarcinoma RenCa cells, but not normal murine kidney epithelial cells. In a syngeneic subcutaneous RenCa model, treatment delayed and even reversed tumor growth. Since the subcutaneous model does not reflect the natural microenviroment of renal cancer, we used an orthotopic model of RenCa cells inoculated under the renal capsule. These studies showed inhibition of tumor growth and metastasis. Direct metastasis assessment by tail vein injection of RenCa cells also showed a drastic reduction in lung metastatic nodules. In vivo treatment reduces survivin, N-cadherin and P-cadherin levels, providing a molecular basis for metastasis inhibition. In consequence, the treatment significantly enhanced mouse survival in these models. Our results suggest that the ASncmtRNAs could be potent and selective targets for therapy against human renal cell carcinoma.

Surgical management of renal cell cancer with tumor thrombus through an exclusive transabdominal approach.

PubMed

González, Javier; Angulo, J; Ciancio, G

2011-04-01

Renal cell cancer with tumor thrombus is present in 4-15% of cases. The prognostic significance of this entity has been object of intense debate. Nowadays, it is considered, that the presence of thrombus itself does not have a negative prognostic impact on survival rates if the thrombus could be excised satisfactorily. Complete removal of renal malignant tissue is the only curative strategy for the treatment of this kind of tumors. During the last three decades, there has been steady improvements in surgical technique and preoperative care fields that have favorably modified the surgeons' ability to safely excise these tumors. In this sense, the experience provided by multiorgan, kidney-pancreas and liver procurement and transplantation techniques led the urologists reexamine their approaches to the inferior vena cava and retroperitoneum, thus they could result useful in the always challenging resection of these complex tumors with neoplasic extension into the vena cava.

EphA2 silencing promotes growth, migration, and metastasis in salivary adenoid cystic carcinoma: in vitro and in vivo study.

PubMed

Wang, Meng; Zhao, Xiao-Ping; Xu, Zhi; Yan, Ting-Lin; Song, Yong; Song, Kai; Huang, Chun-Ming; Wang, Lin; Zhou, Xiao-Cheng; Jiang, Er-Hui; Shao, Zhe; Shang, Zheng-Jun

2016-01-01

EphA2 is associated with tumor growth and distant metastasis in numerous human tumors. Considering the controversial effects of EphA2 in different tumors and the lack of reports in salivary adenoid cystic carcinoma (SACC), we evaluated the effects of EphA2 inhibition by short hairpin RNA on SACC through in vivo and in vitro researches for the first time. Real-time reverse transcriptase-PCR and western blot analysis were conducted to verify the interference effect on SACC cells. Using Cell Counting Kit-8, wound healing, Transwell and Matrigel adhesion assays, we confirm that inhibition of EphA2 promotes the migration, invasion and adhesion ability of SACC cells. In vivo research, we prove that silencing of EphA2 significantly accelerates tumor growth and lung metastasis ability by establishing xenograft models in mice, including subcutaneous inoculation and tail vein injection. In addition, immunostaining of EphA2, E-cadherin and Slug from 40 specimens and in vitro simulation of perineural invasion (PNI) assay imply that suppression of EphA2 partially contribute to epithelial-mesenchymal transition and enhancement of PNI in SACC. In conclusion, all the data suggest that EphA2 may act as a tumor suppressor in SACC progression.

EphA2 silencing promotes growth, migration, and metastasis in salivary adenoid cystic carcinoma: in vitro and in vivo study

PubMed Central

Wang, Meng; Zhao, Xiao-Ping; Xu, Zhi; Yan, Ting-Lin; Song, Yong; Song, Kai; Huang, Chun-Ming; Wang, Lin; Zhou, Xiao-Cheng; Jiang, Er-Hui; Shao, Zhe; Shang, Zheng-Jun

2016-01-01

EphA2 is associated with tumor growth and distant metastasis in numerous human tumors. Considering the controversial effects of EphA2 in different tumors and the lack of reports in salivary adenoid cystic carcinoma (SACC), we evaluated the effects of EphA2 inhibition by short hairpin RNA on SACC through in vivo and in vitro researches for the first time. Real-time reverse transcriptase-PCR and western blot analysis were conducted to verify the interference effect on SACC cells. Using Cell Counting Kit-8, wound healing, Transwell and Matrigel adhesion assays, we confirm that inhibition of EphA2 promotes the migration, invasion and adhesion ability of SACC cells. In vivo research, we prove that silencing of EphA2 significantly accelerates tumor growth and lung metastasis ability by establishing xenograft models in mice, including subcutaneous inoculation and tail vein injection. In addition, immunostaining of EphA2, E-cadherin and Slug from 40 specimens and in vitro simulation of perineural invasion (PNI) assay imply that suppression of EphA2 partially contribute to epithelial-mesenchymal transition and enhancement of PNI in SACC. In conclusion, all the data suggest that EphA2 may act as a tumor suppressor in SACC progression. PMID:27186278

p53 and PCNA Expression in Keratocystic Odontogenic Tumors Compared with Selected Odontogenic Cysts

PubMed Central

Seyedmajidi, Maryam; Nafarzadeh, Shima; Siadati, Sepideh; Shafaee, Shahryar; Bijani, Ali; Keshmiri, Nazanin

2013-01-01

p53 and PCNA expression in keratocystic odontogenic tumors compared with selected odontogenic cysts Summary: The aim of this study was to evaluate p53 and PCNA expression in different odontogenic lesions regarding their different clinical behaviors. Slices prepared from 94 paraffin-embedded tissue blocks (25 radicular cysts (RC), 23 dentigerous cysts (DC), 23 keratocystic odontogenic tumors (KCOT) and 23 calcifying cystic odontogenic tumors (CCOT)) were stained with p53 and PCNA antibodies using immunohistochemistry procedure. The highest level of p53 expression was in the basal layer of RC, and the highest level of PCNA expression was in the suprabasal layer of KCOT. The differences of p53 expression in basal and suprabasal layers as well as PCNA expression in the suprabasal layer were significant but there was no significant difference in PCNA expression in the basal layer of these lesions. The expression of p53 in the basal layer of RC was higher than in other cysts. This may be due to intensive inflammatory infiltration. Also, the high level of PCNA expression in the suprabasal layer of KCOT may justify its neoplastic nature and tendency to recurrence. KCOT and calcifying cystic odontogenic tumors did not show similar expression of studied biomarkers. PMID:24551811

Soy Protein Alleviates Hypertension and Fish Oil Improves Diastolic Heart Function in the Han:SPRD-Cy Rat Model of Cystic Kidney Disease.

PubMed

Ibrahim, Naser H M; Thandapilly, Sijo J; Jia, Yong; Netticadan, Thomas; Aukema, Harold

2016-05-01

Abnormalities in cardiac structure and function are very common among people with chronic kidney disease, in whom cardiovascular disease is the major cause of death. Dietary soy protein and fish oil reduce kidney disease progression in the Han:SPRD-Cy model of cystic renal disease. However, the effects of these dietary interventions in preventing alterations in cardiac structure and function due to kidney disease (reno-cardiac syndrome) in a cystic kidney disease model are not known. Therefore, weanling Han:SPRD-Cy diseased (Cy/+) and normal (+/+) rats were given diets containing either casein or soy protein, and either soy or fish oil in a three-way design for 8 weeks. Diseased rats had larger hearts, augmented left ventricular mass, and higher systolic and mean arterial blood pressure compared to the normal rats. Assessment of cardiac function using two-dimensional guided M-mode and pulse-wave Doppler echocardiography revealed that isovolumic relaxation time was prolonged in the diseased compared to normal rats, reflecting a diastolic heart dysfunction, and fish oil prevented this elevation. Soy protein resulted in a small improvement in systolic and mean arterial pressure but did not improve diastolic heart function, while fish oil prevented diastolic heart dysfunction in this model of cystic kidney disease.

Glucose metabolism via the pentose phosphate pathway, glycolysis and Krebs cycle in an orthotopic mouse model of human brain tumors.

PubMed

Marin-Valencia, Isaac; Cho, Steve K; Rakheja, Dinesh; Hatanpaa, Kimmo J; Kapur, Payal; Mashimo, Tomoyuki; Jindal, Ashish; Vemireddy, Vamsidhara; Good, Levi B; Raisanen, Jack; Sun, Xiankai; Mickey, Bruce; Choi, Changho; Takahashi, Masaya; Togao, Osamu; Pascual, Juan M; Deberardinis, Ralph J; Maher, Elizabeth A; Malloy, Craig R; Bachoo, Robert M

2012-10-01

It has been hypothesized that increased flux through the pentose phosphate pathway (PPP) is required to support the metabolic demands of rapid malignant cell growth. Using orthotopic mouse models of human glioblastoma (GBM) and renal cell carcinoma metastatic to brain, we estimated the activity of the PPP relative to glycolysis by infusing [1,2-(13) C(2) ]glucose. The [3-(13) C]lactate/[2,3-(13) C(2) ]lactate ratio was similar for both the GBM and brain metastasis and their respective surrounding brains (GBM, 0.197 ± 0.011 and 0.195 ± 0.033, respectively (p = 1); metastasis: 0.126 and 0.119 ± 0.033, respectively). This suggests that the rate of glycolysis is significantly greater than the PPP flux in these tumors, and that the PPP flux into the lactate pool is similar in both tumors. Remarkably, (13) C-(13) C coupling was observed in molecules derived from Krebs cycle intermediates in both tumor types, denoting glucose oxidation. In the renal cell carcinoma, in contrast with GBM, (13) C multiplets of γ-aminobutyric acid (GABA) differed from its precursor glutamate, suggesting that GABA did not derive from a common glutamate precursor pool. In addition, the orthotopic renal tumor, the patient's primary renal mass and brain metastasis were all strongly immunopositive for the 67-kDa isoform of glutamate decarboxylase, as were 84% of tumors on a renal cell carcinoma tissue microarray of the same histology, suggesting that GABA synthesis is cell autonomous in at least a subset of renal cell carcinomas. Taken together, these data demonstrate that (13) C-labeled glucose can be used in orthotopic mouse models to study tumor metabolism in vivo and to ascertain new metabolic targets for cancer diagnosis and therapy. Copyright © 2012 John Wiley & Sons, Ltd.

Melanotic Xp11 translocation renal cancer: report of a case with a unique intratumoral sarcoid-like reaction.

PubMed

Ritterhouse, Lauren L; Cykowski, Matthew D; Hassell, Lewis A; Slobodov, Gennady; Bane, Barbara L

2014-04-15

Melanotic Xp11 translocation renal cancer is a rare tumor belonging to the family of microphthalmia-associated transcription factor (MiTF)/transcription factor E (TFE) neoplasms. This tumor family also includes alveolar soft part sarcoma, perivascular epithelioid cell neoplasms, Xp11 translocation renal cell carcinoma, and melanoma. To date, six confirmed melanotic Xp11 translocation cancers (five renal, one ovarian) have been reported in the literature. Here, we report the clinical, histologic, immunohistochemical, and molecular features of a unique melanotic Xp11 translocation renal cancer arising in a 34-year-old African-American female. Histologically, the tumor was composed of epithelioid tumor cells arranged in a nested pattern. The cells had clear to eosinophilic granular cytoplasm, vesicular nuclear chromatin, and prominent nucleoli. Multifocal intracytoplasmic deposits of granular brown melanin pigment were identified and confirmed by Fontana-Masson stain. An unusual histologic feature, not previously reported in melanotic Xp11 translocation renal cancer, was a sarcoid-like granulomatous reaction consisting of tight epithelioid granulomas with lymphocytic cuffing, numerous giant cells, and calcifications. Nuclear transcription factor E3 expression was identified by immunohistochemistry and TFE3 rearrangement was confirmed by fluorescence in situ hybridization. Additional immunohistochemical findings included immunoreactivity for HMB45, cathepsin K, and progesterone receptor; negative staining was seen with actin, desmin, cytokeratins, epithelial membrane antigen, CD10, vimentin, and PAX-8. The patient is currently free of disease, two years following initial clinicoradiologic presentation and twenty-two months following partial nephrectomy without additional therapy. This report further expands the spectrum of morphologic and clinical findings previously described in melanotic Xp11 translocation renal cancer, a distinctive tumor showing overlapping features between Xp11 translocation renal cell carcinoma, melanoma, and perivascular epithelioid cell neoplasms. The virtual slide(s) for this article can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/7225796341180634.

Achievement of trifecta in minimally invasive partial nephrectomy correlates with functional preservation of operated kidney: a multi-institutional assessment using MAG3 renal scan.

PubMed

Zargar, Homayoun; Porpiglia, Francesco; Porter, James; Quarto, Giuseppe; Perdona, Sisto; Bertolo, Riccardo; Autorino, Riccardo; Kaouk, Jihad H

2016-07-01

To validate and compare the values of "MIC" and "trifecta" as predictors of operated kidney functional preservation in a multi-institutional cohort of patients undergoing minimally invasive PN. We retrospectively reviewed records of consecutive cases of minimally invasive PN performed for cT1 renal masses in 4 centers from 2009 to 2013. Inclusion criteria consisted of availability of a renal scan obtained within 2 weeks prior to surgery and follow-up renal scan 3-6 months after the surgery. The primary endpoint of the study was to compare the degree of ipsilateral renal function preservation assessed by MAG3 renal scan in relation to achievement of MIC and trifecta. Total of 351 patients met our inclusion criteria. The rates of trifecta achievement for cT1a and cT1b tumors were 78.9 and 60.6 %, respectively. The rate of MIC achievement for cT1a tumors and cT1b tumors was 60.3 and 31.7 %, respectively. On multivariable linear regression model, only the degree of tumor complexity assessed by R.E.N.A.L nephrometry score [coefficient B -1.8 (-2.7, -0.9); p < 0.0001] and the achievement of trifecta [coefficient B 6.1 (2.4,9.8); p = 0.014] or MIC (coefficient B 7.2 (3.8,0.6); p < 0.0001) were significant clinical factors predicting ipsilateral split function preservation. Achievement of both MIC and "trifecta" is associated with higher proportion of split renal function preservation for cT1 tumors after minimally invasive PN. Thus, these outcome measures can be regarded not only as markers of surgical quality, but also as reliable surrogates for predicting functional outcome in the operated kidney.

Combined Interhemispheric and Transsylvian Approach for Resection of Craniopharyngioma.

PubMed

Inoue, Tomohiro; Ono, Hideaki; Tamura, Akira; Saito, Isamu

2018-04-01

We present a 37-year-old male case of cystic suprasellar huge craniopharyngioma, who presented with significant memory disturbance due to obstructive hydrocephalus. Combined interhemispheric and pterional approach was chosen to resect huge suprasellar tumor. Interhemispheric trans-lamina terminalis approach was quite effective to resect third ventricular tumor, while pterional approach was useful to dissect tumor out of basilar perforators and stalk. The link to the video can be found at: https://youtu.be/BoYIPa96kdo .

Aflac ST0901 CHOANOME - Sirolimus in Solid Tumors

ClinicalTrials.gov

2018-05-15

Ewing's Sarcoma; Osteosarcoma; Astrocytoma; Atypical Teratoid/Rhabdoid Tumor; Ependymoma; Germ Cell Tumor; Glioma; Medulloblastoma; Rhabdoid Tumor; Retinoblastoma; Clear Cell Sarcoma; Renal Cell Carcinoma; Wilms Tumor; Hepatoblastoma; Neuroblastoma; Rhabdomyosarcoma

Vanishing Parotid Tumors on MR Imaging

PubMed Central

Matsusue, Eiji; Fujihara, Yoshio; Matsuda, Eiken; Tokuyasu, Yusuke; Nakamoto, Shu; Nakamura, Kazuhiko; Ogawa, Toshihide

2018-01-01

Background Of all parotid gland tumors, only oncocytoma has been reported to appear isointense to the parotid gland, namely vanishing, on fat-saturated T2 and T1 postcontrast gadolinium-enhanced magnetic resonance imaging (MRI). The purpose of this study was to evaluate vanishing of parotid tumors on conventional MRI with and/or without postcontrast gadolinium-enhancement and on diffusion weighted imaging (DWI). Methods In 8 of 51 patients, ten parotid gland tumors had homogeneously enhanced lesions and were retrospectively analysed. Comparisons of signal intensity between those parotid tumors and parotid glands and evaluations of vanishing were performed on T1-weighted imaging (T1WI), T2-weighted imaging (T2WI), fat-suppressed T2WI (FS-T2WI), postcontrast gadolinium-enhanced T1WI (CE-T1WI) and fat-suppressed CE-T1WI (FS-CE-T1WI), DWI as well as apparent diffusion coefficient (ADC). Results Ten parotid gland tumors consisted of five Warthin tumors, two pleomorphic adenomas, two parotid carcinomas (small cell carcinoma and adenoid cystic carcinoma) and one oncocytoma. All tumors showed hypointensity on T1WI and hyperintensity on DWI. Nine of ten tumors showed vanishing on the other MR sequences. All Warthin tumors showed vanishing on FS-T2WI, FS-CE-T1WI and the ADC map. One oncocytoma showed vanishing on FS-T2WI and the ADC map and hyperintensity on FS-CE-T1WI. All pleomorphic adenomas showed vanishing on T2WI and CE-T1WI. One adenoid cystic carcinoma showed vanishing only on CE-T1WI. Conclusion Vanishing of parotid tumors can be observed not only on FS-T2WI and FS-CE-T1WI but also on T2WI, CE-T1WI and ADC mapping. PMID:29599620

Differences in MYB expression and gene abnormalities further confirm that salivary cribriform basal cell tumors and adenoid cystic carcinoma are two distinct tumor entities.

PubMed

Tian, Zhen; Li, Lei; Zhang, Chun-Ye; Gu, Ting; Li, Jiang

2016-10-01

In practices, some cases of salivary basal cell tumors that consist mainly of cribriform growth pattern are difficult to differentiate from adenoid cystic carcinoma (AdCC). Identification of reliable molecular biomarkers for the differential diagnosis between them is required. Twenty-two cases of cribriform salivary basal cell tumors (at least 10% cribriform pattern present in each tumor) comprising 18 cases of basal cell adenoma (BCA) and four cases of basal cell adenocarcinoma (BcAC) were collected between 1985 and 2008. Twenty cases of cribriform AdCC were retrieved from our archives. MYB protein expression and gene abnormalities were detected in all cases by immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH) analyses, respectively. Neither MYB protein nor split genes were detected in any of the cases of cribriform basal cell tumors, while 55% (11/20) of cases of cribriform AdCC had MYB protein expression. High MYB expression was detected in 81.8% (9/11) cases, while low expression was found in the remaining cases. FISH analysis indicated that nine AdCC tumors with high MYB protein expression were split gene-positive, while MYB gene splitting was not detected in the 11 cases with low or absent MYB protein expression. The molecular changes in AdCC differ from those associated with cribriform basal cell tumors, which further confirms that cribriform basal cell tumors and AdCC are two distinct tumor entities. Simultaneous detection of MYB protein expression and the associated molecular changes could be beneficial in differentiating salivary cribriform basal cell tumors from AdCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Renal cell carcinoma with Xp11.2 translocation in a 7-year-old boy.

PubMed

Jayasinghe, C; Siegler, N; Leuschner, I; Fleischhack, G; Born, M; Müller, A M

2010-05-01

More than 90% of pediatric renal tumors are nephroblastomas while renal cell carcinomas (RCC) are rare in children (< 5%). According to the clinical diagnoses of a nephroblastoma stage IV a 7-year-old boy with a kidney tumor and peripheral pulmonary lesion was preoperatively treated for 8 weeks with Vincristine, Actinomycin D and Adriamycin. The resected kidney displayed a RCC with Xp11.2 translocation. There was no tumor regression and the pulmonary lesion was no longer detectable. Hence chemotherapy was put to a halt. Fine needle aspiration biopsy (FNA) would have allowed to adjust the tumor subtype. Prognosis of pediatric RCC with translocation seems more favourable than without translocation though definitive evidence will only be possible by documentation in a clinical diagnose-related register.

Apocrine cystadenoma and apocrine hidrocystoma: examination of 21 cases with emphasis on nomenclature according to proliferative features.

PubMed

Sugiyama, Akiko; Sugiura, Mitsuhiro; Piris, Adriano; Tomita, Yasushi; Mihm, Martin C

2007-12-01

Apocrine cystadenoma (AC) and apocrine hidrocystoma (AH) have been used interchangeably in the literature to designate cystic lesions of apocrine glands. We reviewed 21 cases with biopsies of apocrine cystic lesions diagnosed as AH or AC stained by hematoxylin and eosin. The following histological characteristics were recorded: (a) number of cysts, (b) predominant architectural growth pattern of cyst wall, (c) tumor circumscription, (d) nuclear atypia, (e) mitotic activity, counted per 1 mm2 and (f) Ki-67 staining pattern. Our findings clearly show that there is a non-proliferative group and a proliferative group among the lesions. In the non-proliferative group, one may see some structures that resemble papillary projections but lack a fibrous core. In the proliferative group, we found true papillae, and this change was associated with atypia, mitotic activity and increased Ki-67 staining. Apocrine cystic lesions with true papillary projections should be referred to as AC rather than AH, to emphasize the proliferative adenomatous growth and depicted by their frequency of cytological atypia and high mitotic activity. Furthermore, we suggest complete excision of AC that are proliferative tumors.

Renal hemangiopericytoma secondary to refractory hypertension in a child: A case report.

PubMed

Hu, Qingfeng; Fang, Zujun; Zhou, Zhongwen; Zheng, Jie

2014-12-01

Hemangiopericytoma is a rare perivascular tumor that often involves the extremities, pelvis, head and neck, and meninges, but rarely occurs in the kidney. The differentiation from renal cancer prior to surgery is extremely challenging; therefore, almost all cases of renal hemangiopericytoma are diagnosed by pathological examination. The majority of cases are identified in patients between the ages of 20 and 50 years of age, and a considerable proportion of patients exhibit hypertension, hypoglycaemia or additional paraneoplastic syndromes. The current study reports a rare case of renal hemangiopericytoma with drug refractory hypertension in a 14-year-old female. Following the complete resection of the tumor, the patient's blood pressure returned to normal. No evidence of recurrence or metastasis was observed during a follow-up of 12 months following surgery. The present case indicated that surgery provides satisfactory outcomes and appears to be the most effective modality of treatment for renal hemangiopericytoma. Furthermore, this case also demonstrated that secondary hypertension may also recover following tumor excision.

Retro-peritoneoscopic assisted cryoablation for small renal tumors: the first cases treated in Romania.

PubMed

Ghervan, L; Lucan, V; Elec, F; Suciu, M; Bologa, F; Iacob, Gh; Lucan, M

2007-01-01

Nephron-sparing surgery (NSS), has been demonstrated to be a safe and effective alternative to radical nephrectomy for selected cases. Retro-peritoneoscopic cryoablation (RCA), combine the benefits of minimal invasiveness of the laparoscopy with the advantage of preserving renal function of the nephron sparing surgery. The aim of our study was to assess the initial results with RCA of small renal tumors. Since Jan 2007, twelve consecutive patients, with small renal tumors (mean tumor size 3.89 cm) underwent RCA at our institution. The patients were assessed using: clinical exam, lab exam, ultrasound, contrast enhanced CT scan. For cryoablation, we used the Galil Medical SeedNet with 17 Gauge cryoprobes, under combined retro-peritoneoscopic and ultrasound guidance. Protocol follow-up design includes clinical exam, lab exam and contrast enhanced CT scan at 3,6 and 12 months and annually thereafter. Mean surgical time was 145.42 min. and mean blood loss was 179.17 ml. Two patients presented: bleeding at the extraction of the cryoprobes and urinary fistula which healed with surgical treatment. Histological examination of the core biopsy revealed clear cell carcinoma in 8 patients, papillary carcinoma in 3 patients and angiomyolipoma in 1 patient. Cryosurgical ablation of small renal tumors using multiple ultrathin 17 Gauge cryoprobes is a feasible treatment option. Retro-peritoneoscopic approach allows optimal access to the kidney and endoscopic real-time ultrasound control of the freezing process.

Reduction of renal uptake of 111In-DOTA-labeled and A700-labeled RAFT-RGD during integrin αvβ3 targeting using single photon emission computed tomography and optical imaging.

PubMed

Briat, Arnaud; Wenk, Christiane H F; Ahmadi, Mitra; Claron, Michael; Boturyn, Didier; Josserand, Véronique; Dumy, Pascal; Fagret, Daniel; Coll, Jean-Luc; Ghezzi, Catherine; Sancey, Lucie; Vuillez, Jean-Philippe

2012-06-01

Integrin α(v)β(3) expression is upregulated during tumor growth and invasion in newly formed endothelial cells in tumor neovasculature and in some tumor cells. A tetrameric RGD-based peptide, regioselectively addressable functionalized template-(cyclo-[RGDfK])4 (RAFT-RGD), specifically targets integrin α(v)β(3) in vitro and in vivo. When labeled with indium-111, the RAFT-RGD is partially reabsorbed and trapped in the kidneys, limiting its use for further internal targeted radiotherapy and imaging investigations. We studied the effect of Gelofusine on RAFT-RGD renal retention in tumor-bearing mice. Mice were imaged using single photon emission computed tomography and optical imaging 1 and 24 h following tracer injection. Distribution of RAFT-RGD was further investigated by tissue removal and direct counting of the tracer. Kidney sections were analyzed by confocal microscopy. Gelofusine significantly induced a >50% reduction of the renal reabsorption of (111)In-DOTA-RAFT-RGD and A700-RAFT-RGD, without affecting tumor uptake. Injection of Gelofusine significantly reduced the renal retention of labeled RAFT-RGD, while increasing the tumor over healthy tissue ratio. These results will lead to the development of future therapeutic approaches. © 2012 Japanese Cancer Association.

Auto Transplant for High Risk or Relapsed Solid or CNS Tumors

ClinicalTrials.gov

2018-04-24

Ewing's Family Tumors; Renal Tumors; Hepatoblastoma; Rhabdomyosarcoma; Soft Tissue Sarcoma; Primary Malignant Brain Neoplasms; Retinoblastoma; Medulloblastoma; Supra-tentorial Primative Neuro-Ectodermal Tumor (PNET); Atypical Teratoid/Rhabdoid Tumor (AT/RT); CNS Tumors; Germ Cell Tumors

Dissecting the roles of aquaporins in renal pathophysiology using transgenic mice

PubMed Central

Verkman, A. S.

2008-01-01

Transgenic mice lacking renal aquaporins (AQPs), or containing mutated AQPs, have been useful in confirming anticipated AQP functions in renal physiology and in discovering new functions. Mice lacking AQPs 1–4 manifest defects in urinary concentrating ability to different extents. Mechanistic studies have confirmed the involvement of AQP1 in near-isosmolar fluid absorption in proximal tubule, and in countercurrent multiplication and exchange mechanisms that produce medullary hypertonicity in the antidiuretic kidney. Deletion of AQPs 2–4 impairs urinary concentrating ability by reduction of transcellular water permeability in collecting duct. Recently created transgenic mouse models of nephrogenic diabetes insipidus produced by AQP2 gene mutation offer exciting possibilities to test new drug therapies. Several unanticipated AQP functions in kidney have been discovered recently that are unrelated to their role in transcellular water transport. There is evidence for involvement of AQP1 in kidney cell migration following renal injury, of AQP7 in renal glycerol clearance, of AQP11 in prevention of renal cystic disease, and possibly of AQP3 in regulation of collecting duct cell proliferation. Future work in renal AQPs will focus on mechanisms responsible for these non-fluid-transporting functions, and on the development of small-molecule AQP inhibitors for use as aquaretic-type diuretics. PMID:18519083

Autofluorescence diagnostic of gynecological diseases ex vivo

NASA Astrophysics Data System (ADS)

Zuev, Vladimir M.; Beliaeva, Ludmila A.; Tevlina, Ekaterina V.; Zaiceva, Galina U.; Loschenov, Victor B.; Stratonnikov, Alexander A.; Volkova, Anna I.

2001-01-01

The method of autofluorescence diagnostic has been applied to study the diseases of uterus and ovaries including tumor of uterus, ovaries and endometriosis. The fluorescence emission spectra of native samples were measured using fiber optics spectrometer. The very high fluorescence in cystic ovaries and tumor ovaries has been observed allowing one to hope that endogenous fluorochromes may play a role of photosensitizes light irradiation.

[Clinical study on patients with renal-cell carcinoma accompanied with Von Hippel-Lindau disease treated with radiofrequency ablation].

PubMed

Nao, Tomoya; Shimamoto, Tsutomu; Karashima, Takashi; Kamei, Maiko; Fukuhara, Hideo; Fukata, Satoshi; Satake, Hirofumi; Ashida, Shingo; Yamasaki, Ichiro; Kamata, Masayuki; Inoue, Keiji; Yamanishi, Tomoaki; Ogawa, Yasuhiro; Ito, Satoshi; Shuin, Taro

2014-09-01

We report 12 renal cell carcinomas in 6 patients with Von Hippel-Lindau (VHL) disease treated with radiofrequency ablation (RFA). The mean age of the patients was 46 (range 38-53) years (male : 4, female : 2). Computed tomography (CT)-guided transcutaneous RFA was performed under conscious sedation with local anesthetics. The mean size of the tumors was 2.4 (range 0.7-8.1) cm. Nine of the 12 tumors (75%) were locally well controlled. However, 3 tumors in 2 patients developed visceral metastases after RFA. While minimal flank pain, nausea, perinephritic hematoma and lumbago were observed, there was no major complication during or after the procedure. The therapy with CT-guided transcutaneous RFA is efficient and minimal invasive for renal cell carcinoma in patients with VHL, leading to preservation of renal function.

Mucinous cystadenocarcinoma of the breast coexisting with infiltrating ductal carcinoma.

PubMed

Chen, Wei-Yu; Chen, Ching-Shyang; Chen, Hsin-Chi; Hung, Yi-Ju; Chu, Jan-Show

2004-10-01

A recently described and rare variant of breast carcinoma, mucinous cystadenocarcinoma (MCA), is reported in a 65-year-old post-menopausal woman. She presented with a gradually enlarged breast tumor. A well-circumscribed tumor measuring about 3 cm in diameter was noted in the mammographic and ultrasonographic examinations. The mammographic and ultrasonographic findings were indistinguishable from more common mucinous carcinoma (colloid carcinoma) of the breast. The gross appearance of the tumor was well-defined and cystic, consisting of abundant transparent to bloody mucin, as well as whitish solid parts. Microscopically, the tumor was characterized by abundant extracellular and intracellular mucin. It looked like a mucinous cystic neoplasm of the ovary and pancreas. Particularly, few microscopic foci of ordinary intermediate-grade infiltrating ductal carcinoma (IDC) and ductal carcinoma in situ (DCIS) were observed around the main lesion in this case. A transition from ordinary DCIS to MCA in situ was found. It might indicate MCA derives from a metaplasia process of ordinary DCIS. MCA can be easily differentiated from mucinous carcinoma by quite different histologic and immunohistochemical findings. According to the previously reported and present cases, MCA of the breast more commonly affects elderly women and has a relatively favorable prognosis.

Ebselen inhibits QSOX1 enzymatic activity and suppresses invasion of pancreatic and renal cancer cell lines.

PubMed

Hanavan, Paul D; Borges, Chad R; Katchman, Benjamin A; Faigel, Douglas O; Ho, Thai H; Ma, Chen-Ting; Sergienko, Eduard A; Meurice, Nathalie; Petit, Joachim L; Lake, Douglas F

2015-07-30

Quiescin sulfhydryl oxidase 1 (QSOX1) is a highly conserved disulfide bond-generating enzyme that is overexpressed in diverse tumor types. Its enzymatic activity promotes the growth and invasion of tumor cells and alters extracellular matrix composition. In a nude mouse-human tumor xenograft model, tumors containing shRNA for QSOX1 grew significantly more slowly than controls, suggesting that QSOX1 supports a proliferative phenotype in vivo. High throughput screening experiments identified ebselen as an in vitro inhibitor of QSOX1 enzymatic activity. Ebselen treatment of pancreatic and renal cancer cell lines stalled tumor growth and inhibited invasion through Matrigel in vitro. Daily oral treatment with ebselen resulted in a 58% reduction in tumor growth in mice bearing human pancreatic tumor xenografts compared to controls. Mass spectrometric analysis of ebselen-treated QSOX1 mechanistically revealed that C165 and C237 of QSOX1 covalently bound to ebselen. This report details the anti-neoplastic properties of ebselen in pancreatic and renal cancer cell lines. The results here offer a "proof-of-principle" that enzymatic inhibition of QSOX1 may have clinical relevancy.

Percutaneous Renal Cryoablation: Short-Axis Ice-Ball Margin as a Predictor of Outcome.

PubMed

Ge, Benjamin H; Guzzo, Thomas J; Nadolski, Gregory J; Soulen, Michael C; Clark, Timothy W I; Malkowicz, Stanley B; Wein, Alan J; Hunt, Stephen J; Stavropoulos, S William

2016-03-01

To determine if CT characteristics of intraprocedural ice balls correlate with outcomes after cryoablation. A retrospective review was performed on 63 consecutive patients treated with renal cryoablation. Preprocedural and intraprocedural images were used to identify the size and location of renal tumors and ice balls as well as the tumor coverage and ice-ball margins. Review of follow-up imaging (1 mo and then 3-6-mo intervals) distinguished successful ablations from cases of residual tumor. Patients who underwent successful ablation (n = 50; 79%) had a mean tumor diameter of 2.5 cm (range, 0.9-4.3 cm) and mean ice-ball margin of 0.4 cm (range, 0.2-1.2 cm). Patients with residual tumor (n = 13; 21%) had a mean tumor diameter of 3.8 cm (range, 1.8-4.5 cm) and mean ice-ball margin of -0.4 cm (range, -0.9 to 0.4 cm). Residual and undertreated tumors were larger and had smaller ice-ball margins than successfully treated tumors (P < .01). Ice-ball diameters were significantly smaller after image reformatting (P < .01). Ice-ball margins of 0.15 cm had 90% sensitivity, 92% specificity, and 98% positive predictive value for successful ablation. Success was independent of tumor location or number of cryoprobes. Ice-ball margin and real-time intraprocedural reformatting could be helpful in predicting renal cryoablation outcomes. Although a 0.5-cm margin is preferred, a well-centered ice ball with a short-axis margin greater than 0.15 cm strongly correlated with successful ablation. Copyright © 2016 SIR. Published by Elsevier Inc. All rights reserved.

Uneven Distribution of Regional Blood Supply Prompts the Cystic Change of Pituitary Adenoma.

PubMed

Zhang, Jianhe; Gu, Jianjun; Ma, Yiming; Huang, Yinxing; Wang, Jiaxing; Wu, Zhifeng; Zhong, Qun; Wang, Shousen

2017-07-01

Previous studies have suggested that the cystic change of pituitary adenoma might be related to the blood supply and metabolism of the tumor; however, the exact pathologic mechanism underlying the cystic change remains unknown. We aimed to assess the features of regional blood supply of pituitary adenoma and examine its relationship with the cystic change of pituitary adenoma. Patients (N = 79) with pituitary adenoma admitted to our hospital were divided into the parenchyma group (n = 40) or the cystic change group (n = 39). Dynamic contrast-enhanced magnetic resonance imaging of the pituitary adenoma was conducted for the parenchyma group and the steepest slopes (SS max , reflecting regional blood supply) at different areas were calculated. The location of cystic change of the pituitary adenoma was recorded and analyzed for the cystic change group. The parenchyma group showed an upper SS max of 2.52 ± 1.18, a lower SS max of 2.89 ± 1.46, a left SS max of 2.71 ± 1.31, and a right SS max of 2.66 ± 1.29. The difference between the upper and lower SS max was statistically significant (P < 0.001), with no difference between the left and right regions (P = 0.668). The location of cystic change of the pituitary adenoma was mainly in the upper region, accounting for 48.7% of cases. Regional blood supply is unevenly distributed in the parenchymal pituitary adenoma, with reduced blood supply in the upper than the lower region. Cystic change mainly occurs in the upper region of pituitary adenoma. Copyright © 2017 Elsevier Inc. All rights reserved.

Pediatric Cystic Nephroma Is Morphologically, Immunohistochemically, and Genetically Distinct From Adult Cystic Nephroma.

PubMed

Li, Yunjie; Pawel, Bruce R; Hill, Dana A; Epstein, Jonathan I; Argani, Pedram

2017-04-01

The term cystic nephroma has traditionally been used to refer to 2 neoplasms, a lesion in adults that is now thought to be part of the spectrum of mixed epithelial stromal tumor (MEST) and a pediatric lesion that has been associated with mutations in the DICER1 gene. A direct detailed morphologic, immunohistochemical, and genetic comparison of these 2 lesions has not been performed. In this study, we compare the morphologic features, immunoreactivity for estrogen receptor and inhibin, and DICER1 genetic status of 12 adult cystic nephroma/MEST (median age 50.5 y, all females) and 7 pediatric cystic nephroma (median age 1.3 y, male:female=6:1). Both lesions (11 of 12 adult cases, 6 of 7 pediatric cases) frequently demonstrated subepithelial accentuation of stromal cellularity, though the increased cellularity frequently included inflammatory cells in the pediatric cases. All adult and pediatric cases labeled for estrogen receptor; however, whereas most (83%) of adult cases labeled for inhibin at least focally, no pediatric case labeled for inhibin. Most adult cases (58%) demonstrated wavy, ropy collagen in association with cellular stroma, whereas this was not found in pediatric cases. 86% of pediatric cases demonstrated DICER1 mutations, whereas only 1 of 10 adult cases demonstrated a DICER1 mutation. In summary, although cellular stroma and estrogen receptor immunoreactivity are commonly present in both adult and pediatric cystic nephroma, ropy collagen and inhibin immunoreactivity are far more common in adult cystic nephroma/MEST, whereas DICER1 mutations are far more prevalent in pediatric cystic nephroma. These results support the current World Health Organization Classification's separation of adult and pediatric cystic nephromas as distinct entities.

Cystic tumors of the pituitary infundibulum: seminal autopsy specimens (1899 to 1904) that allowed clinical-pathological craniopharyngioma characterization.

PubMed

Pascual, José M; Prieto, Ruth; Rosdolsky, Maria; Strauss, Sewan; Castro-Dufourny, Inés; Hofecker, Verena; Winter, Eduard; Carrasco, Rodrigo; Ulrich, Walter

2018-04-21

A heterogeneous group of epithelial cystic tumors developed at the infundibulum and the third ventricle disconcerted pathologists at the dawn of the twentieth century. Very little was known at that time about the physiological role played by the pituitary gland, and there was almost complete ignorance regarding the function of the hypothalamus. Acromegaly, or enlargement of acral body parts, described in 1886 by Pierre Marie, was the only disease linked to primary hypertrophies of the pituitary gland, known as "pituitary strumas". A growing number of young patients manifesting an unexplained combination of physical and mental symptoms, including absent or delayed sexual maturation, progressive obesity, abnormal somnolence, and dementia-like changes in behavior were reported to present large solid-cystic tumors which characteristically expanded within the infundibulum and third ventricle, above an anatomically intact pituitary gland. Between 1899 and 1904, five seminal autopsy studies from different countries thoroughly described the anatomical relationships and histological features of this newly recognized type of infundibular tumors. These cases were instrumental in fostering the systematic investigation of similar lesions by the Austrian pathologist Jakob Erdheim (1874-1937), who in 1904 was able to classify these infundibulo-tuberal cysts under the common category of hypophyseal duct tumors. The pioneering American neurosurgeon Harvey Cushing (1869-1939) unsuccessfully attempted to surgically remove one of these cysts, for the first time in history, in 1902. The term "craniopharyngioma", chosen by Cushing in 1929 to designate these lesions, would eventually prevail over Erdheim's more accurate denomination, which linked their origin to squamous cell remnants derived from the embryological structures that give rise to the pituitary gland. This paper presents a comprehensive, renewed account of the five clinical-pathological reports which laid the groundwork for the proper clinical diagnosis, topographic conceptualization and pathological categorization of craniopharyngiomas.

Therapeutic inhibition of the MDM2-p53 interaction prevents recurrence of adenoid cystic carcinomas

PubMed Central

Nör, Felipe; Warner, Kristy A.; Zhang, Zhaocheng; Acasigua, Gerson A.; Pearson, Alexander T.; Kerk, Samuel A.; Helman, Joseph; Filho, Manoel Sant’Ana; Wang, Shaomeng; Nör, Jacques E.

2016-01-01

Purpose Conventional chemotherapy has modest efficacy in advanced adenoid cystic carcinomas (ACC). Tumor recurrence is a major challenge in the management of ACC patients. Here, we evaluated the anti-tumor effect of a novel small molecule inhibitor of the MDM2-p53 interaction (MI-773) combined with Cisplatin in patient-derived xenograft (PDX) ACC tumors. Experimental design Therapeutic strategies with MI-773 and/or Cisplatin were evaluated in SCID mice harboring PDX ACC tumors (UM-PDX-HACC-5) and in low passage primary human ACC cells (UM-HACC-2A, -2B, -5, -6) in vitro. The effect of therapy on the fraction of cancer stem cells was determined by flow cytometry for ALDH activity and CD44 expression. Results Combined therapy with MI-773 with Cisplatin caused p53 activation, induction of apoptosis, and regression of ACC PDX tumors. Western blots revealed induction of MDM2, p53 and downstream p21 expression, and regulation of apoptosis-related proteins PUMA, BAX, Bcl-2, Bcl-xL and active Caspase-9 upon MI-773 treatment. Both, single-agent MI-773, and MI-773 combined with Cisplatin, decreased the fraction of cancer stem cells in PDX ACC tumors. Notably, neoadjuvant MI-773 and surgery eliminated tumor recurrences during a post-surgical follow-up of more than 300 days. In contrast, 62.5% of mice that received vehicle control presented with palpable tumor recurrences within this time period (p=0.0097). Conclusions Collectively, these data demonstrate that therapeutic inhibition of MDM2-p53 interaction by MI-773 decreased the cancer stem cell fraction, sensitized ACC xenograft tumors to Cisplatin, and eliminated tumor recurrence. These results suggest that patients with ACC might benefit from the therapeutic inhibition of the MDM2-p53 interaction. PMID:27550999

Monoallelic Mutations to DNAJB11 Cause Atypical Autosomal-Dominant Polycystic Kidney Disease.

PubMed

Cornec-Le Gall, Emilie; Olson, Rory J; Besse, Whitney; Heyer, Christina M; Gainullin, Vladimir G; Smith, Jessica M; Audrézet, Marie-Pierre; Hopp, Katharina; Porath, Binu; Shi, Beili; Baheti, Saurabh; Senum, Sarah R; Arroyo, Jennifer; Madsen, Charles D; Férec, Claude; Joly, Dominique; Jouret, François; Fikri-Benbrahim, Oussamah; Charasse, Christophe; Coulibaly, Jean-Marie; Yu, Alan S; Khalili, Korosh; Pei, York; Somlo, Stefan; Le Meur, Yannick; Torres, Vicente E; Harris, Peter C

2018-05-03

Autosomal-dominant polycystic kidney disease (ADPKD) is characterized by the progressive development of kidney cysts, often resulting in end-stage renal disease (ESRD). This disorder is genetically heterogeneous with ∼7% of families genetically unresolved. We performed whole-exome sequencing (WES) in two multiplex ADPKD-like pedigrees, and we analyzed a further 591 genetically unresolved, phenotypically similar families by targeted next-generation sequencing of 65 candidate genes. WES identified a DNAJB11 missense variant (p.Pro54Arg) in two family members presenting with non-enlarged polycystic kidneys and a frameshifting change (c.166_167insTT) in a second family with small renal and liver cysts. DNAJB11 is a co-factor of BiP, a key chaperone in the endoplasmic reticulum controlling folding, trafficking, and degradation of secreted and membrane proteins. Five additional multigenerational families carrying DNAJB11 mutations were identified by the targeted analysis. The clinical phenotype was consistent in the 23 affected members, with non-enlarged cystic kidneys that often evolved to kidney atrophy; 7 subjects reached ESRD from 59 to 89 years. The lack of kidney enlargement, histologically evident interstitial fibrosis in non-cystic parenchyma, and recurring episodes of gout (one family) suggested partial phenotypic overlap with autosomal-dominant tubulointerstitial diseases (ADTKD). Characterization of DNAJB11-null cells and kidney samples from affected individuals revealed a pathogenesis associated with maturation and trafficking defects involving the ADPKD protein, PC1, and ADTKD proteins, such as UMOD. DNAJB11-associated disease is a phenotypic hybrid of ADPKD and ADTKD, characterized by normal-sized cystic kidneys and progressive interstitial fibrosis resulting in late-onset ESRD. Copyright © 2018 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

[Recurrent benign cystic peritoneal mesothelioma].

PubMed

Stroescu, C; Negulescu, Raluca; Herlea, V; David, L; Ivanov, B; Nitipir, Cornelia; Popescu, I

2008-01-01

The benign cystic peritoneal mesothelioma (BCPM) is a rare neoplasm affecting mainly females at reproductive age. The natural history and physiopathology of the BCPM are not entirely known. It is mainly characterized by the lack of malignant elements, no tendency to metastasis and by a pervasive tendency to generate local recurrences after surgical removal. The clinical manifestations are insidious, uncharacteristic; the benign cystic peritoneal mesothelioma is often discovered during a surgical procedure addressing another condition. Imaging tests can raise the suspicion of BCPM but the diagnostic can only be confirmed by histopathological examination corroborated with an immunohistochemical analysis. There are no long term studies dictating a single therapeutic attitude but a high risk of local recurrences and the possibility of transformation into malignant mesothelioma have lead to the current tendency towards an aggressive treatment of the tumor. We present the case of a recurrent benign cystic peritoneal mesothelioma in a 40 years old female patient, emphasizing the therapeutic approach and the role of radical surgery in the treatment of BPCM.

Molecular-Guided Therapy for Childhood Cancer

ClinicalTrials.gov

2017-07-07

Neuroblastoma; Medulloblastoma; Glioma; Ependymoma; Choroid Plexus Neoplasms; Craniopharyngioma; Dysembryoplastic Neuroepithelial Tumor; Meningioma; Primitive Neuroectodermal Tumors (PNETs); Germ Cell Tumors; Rhabdomyosarcoma; Non-rhabdomyosarcoma; Ewings Sarcoma; Osteosarcoma; Wilms Tumor; Renal Cell Carcinoma; Malignant Rhabdoid Tumor; Clear Cell Sarcoma; Liver Tumors

A subserosal, pedunculated, multilocular uterine leiomyoma with ovarian tumor-like morphology and histological architecture of adenomatoid tumors: a case report and review of the literature.

PubMed

Yorita, Kenji; Tanaka, Yu; Hirano, Koki; Kai, Yuka; Arii, Kaoru; Nakatani, Kimiko; Ito, Satoshi; Imai, Toshiya; Fukunaga, Masaharu; Kuroda, Naoto

2016-12-20

Uterine leiomyomas are common uterine tumors, and typical cases of leiomyoma are easily diagnosed by imaging study. However, uterine leiomyomas are often altered by degenerative changes, which can cause difficulty and confusion in their clinical diagnosis. We describe the 17th reported case of a uterine leiomyoma clinically diagnosed as an ovarian tumor; however, the present case shows the most detailed radiological evaluation, including contrast-enhanced magnetic resonance imaging. We first show that a uterine leiomyoma can histologically mimic an adenomatoid tumor. A 47-year-old premenopausal, nulliparous Japanese woman with a history of type 2 diabetes mellitus, hypertension, and hyperlipidemia had lower abdominal pain. Ultrasonography confirmed a 6-cm mass in the right-sided space of the pelvic cavity. Magnetic resonance imaging evaluation showed that a multilocular mass was present near the uterus, and a mucinous ovarian tumor was considered. Emergency surgery due to acute abdomen was performed under the diagnosis of pedicle torsion of the ovarian tumor. During surgery, a pedunculated uterine mass without stalk torsion was seen. The mass grossly contained serous and hemorrhagic fluids in the cavities, and pathology examination confirmed that the mass was a leiomyoma with hydropic and cystic degeneration. Anastomosing thin cord-like arrangements of the leiomyoma cells mimicked the architecture of adenomatoid tumors. The tumor cells were positive for the microphthalmia transcription factor but negative for other melanoma markers. Three days postoperatively, she was discharged without sequelae. Marked intratumoral deposition of fluids may induce the multilocular morphology of a tumor, and the cellular arrangement of the tumor cells with hydropic degeneration mimicked an adenomatoid tumor in this case. Clinicians need to be aware that a subserosal leiomyoma with cystic and hydropic degeneration can mimic an ovarian tumor, and pathologists should be aware that such leiomyomas can mimic adenomatoid tumors. Additionally, perivascular epithelioid cell tumors should not be diagnosed only based on its immunoreactivity for the microphthalmia transcription factor.

Extraskeletal Ewing's sarcoma.

PubMed

El-Essawy, Manar T

2009-06-01

We report 2 rare cases of extraskeletal Ewing's sarcoma, one is arising primarily from the posterior mediastinum in a middle-aged man (patient 1), and the other one is arising from the left kidney in a young male patient (patient 2). The CT in the first case showed a large mass of heterogeneous texture, with areas of cystic changes in the right side of the posterior mediastinum, no underlying bony changes or intra-spinal extension, and this mass was diagnosed as lymphoma. The second case showed almost complete replacement of the left kidney by a mass with extension through the renal vein and inferior vena cava, and it was diagnosed as renal cell carcinoma. The histological analysis of these lesions revealed extraskeletal Ewing's sarcoma.

Clinicopathological analysis of salivary gland tumors over a 15-year period.

PubMed

Vasconcelos, Artur Cunha; Nör, Felipe; Meurer, Luise; Salvadori, Gabriela; Souza, Lélia Batista de; Vargas, Pablo Agustin; Martins, Manoela Domingues

2016-01-01

Salivary gland tumors (SGT) are rare neoplasms that generate interest due to their histopathological diversity and clinical behavior. The aims of the present study were to investigate clinicopathological aspects of SGTs diagnosed at a tertiary health center and compare the findings with epidemiological data from different geographic locations. Cases of tumor in the head and neck region at a single health center in the period between 1995 and 2010 were reviewed. Patient gender, age and ethnic group as well as anatomic location, histological type and clinical behavior of the tumor were recorded. Availability of complete information about these aspects was considered the inclusion criteria. Descriptive statistical analysis of the data was performed using the frequencies of categorical variables. Among the 2168 cases of tumors in the head and neck region, 243 (11.20%) cases were diagnosed in the salivary glands, 109 of which met the inclusion criteria: 85 (78%) benign tumors and 24 (22%) malignant tumors. Mean patient age was 46.47 years. The female gender accounted for 56 cases (51.4%) and the male gender accounted for 53 (48.3%). The major salivary glands were affected more (75.2%) than the minor glands. The most frequent benign and malignant SGTs were pleomorphic adenoma (81.2%) and adenoid cystic carcinoma (58.3%), respectively. In conclusion, pleomorphic adenoma and adenoid cystic carcinoma are the most frequent benign and malignant lesions, respectively. Comparing the present data with previous studies on SGTs, one may infer that some demographic characteristics and the predominance of malignant tumors vary in different geographic regions.

Renal oncocytoma characterized by the defective complex I of the respiratory chain boosts the synthesis of the ROS scavenger glutathione.

PubMed

Kürschner, Gerrit; Zhang, Qingzhou; Clima, Rosanna; Xiao, Yi; Busch, Jonas Felix; Kilic, Ergin; Jung, Klaus; Berndt, Nikolaus; Bulik, Sascha; Holzhütter, Hermann-Georg; Gasparre, Giuseppe; Attimonelli, Marcella; Babu, Mohan; Meierhofer, David

2017-12-01

Renal oncocytomas are rare benign tumors of the kidney and characterized by a deficient complex I (CI) enzyme activity of the oxidative phosphorylation (OXPHOS) system caused by mitochondrial DNA (mtDNA) mutations. Yet, little is known about the underlying molecular mechanisms and alterations of metabolic pathways in this tumor. We compared renal oncocytomas with adjacent matched normal kidney tissues on a global scale by multi-omics approaches, including whole exome sequencing (WES), proteomics, metabolomics, and metabolic pathway simulation. The abundance of proteins localized to mitochondria increased more than 2-fold, the only exception was a strong decrease in the abundance for CI subunits that revealed several pathogenic heteroplasmic mtDNA mutations by WES. We also observed renal oncocytomas to dysregulate main metabolic pathways, shunting away from gluconeogenesis and lipid metabolism. Nevertheless, the abundance of energy carrier molecules such as NAD + , NADH, NADP, ATP, and ADP were significantly higher in renal oncocytomas. Finally, a substantial 5000-fold increase of the reactive oxygen species scavenger glutathione can be regarded as a new hallmark of renal oncocytoma. Our findings demonstrate that renal oncocytomas undergo a metabolic switch to eliminate ATP consuming processes to ensure a sufficient energy supply for the tumor.

Renal oncocytoma characterized by the defective complex I of the respiratory chain boosts the synthesis of the ROS scavenger glutathione

PubMed Central

Clima, Rosanna; Xiao, Yi; Busch, Jonas Felix; Kilic, Ergin; Jung, Klaus; Berndt, Nikolaus; Bulik, Sascha; Holzhütter, Hermann-Georg; Gasparre, Giuseppe; Attimonelli, Marcella; Babu, Mohan; Meierhofer, David

2017-01-01

Renal oncocytomas are rare benign tumors of the kidney and characterized by a deficient complex I (CI) enzyme activity of the oxidative phosphorylation (OXPHOS) system caused by mitochondrial DNA (mtDNA) mutations. Yet, little is known about the underlying molecular mechanisms and alterations of metabolic pathways in this tumor. We compared renal oncocytomas with adjacent matched normal kidney tissues on a global scale by multi-omics approaches, including whole exome sequencing (WES), proteomics, metabolomics, and metabolic pathway simulation. The abundance of proteins localized to mitochondria increased more than 2-fold, the only exception was a strong decrease in the abundance for CI subunits that revealed several pathogenic heteroplasmic mtDNA mutations by WES. We also observed renal oncocytomas to dysregulate main metabolic pathways, shunting away from gluconeogenesis and lipid metabolism. Nevertheless, the abundance of energy carrier molecules such as NAD+, NADH, NADP, ATP, and ADP were significantly higher in renal oncocytomas. Finally, a substantial 5000-fold increase of the reactive oxygen species scavenger glutathione can be regarded as a new hallmark of renal oncocytoma. Our findings demonstrate that renal oncocytomas undergo a metabolic switch to eliminate ATP consuming processes to ensure a sufficient energy supply for the tumor. PMID:29285300

Melanotic Translocation Renal Cell Carcinoma With a Novel ARID1B-TFE3 Gene Fusion.

PubMed

Antic, Tatjana; Taxy, Jerome B; Alikhan, Mir; Segal, Jeremy

2017-11-01

A 36-year-old male was found to have a 7.0 cm left upper pole renal mass on renal ultrasound. Following nephrectomy, the mass was grossly ill-demarcated, friable and red-brown, invading renal parenchyma, hilar fat and the renal vein. Microscopically, the tumor had a nested and papillary architecture. The cells demonstrated abundant clear and eosinophilic cytoplasm and focal intracytoplasmic melanin pigment. Nucleoli were prominent. By immunohistochemistry, the tumor was positive for TFE3; HMB-45 stained approximately 5% of tumor cells corresponding to the histologic melanin pigment, which was confirmed with Fontana-Masson stain with bleach. Immunostains for PAX8, CD10, MiTF, and CAIX were negative; keratins Cam 5.2 and AE1/AE3 were focally positive. Targeted next-generation sequencing revealed an ARID1B-TFE3 gene fusion. Melanotic Xp11 renal cell carcinoma is a rare, pigment containing translocation variant demonstrating overlapping features with melanoma and is usually associated with an SFPQ-TFE3 gene fusion. The patient is alive and without evidence of disease 7 years after his diagnosis. The combination of high grade histopathology, the presence of melanin, absent PAX8, keratin positivity, and relatively indolent clinical behavior with a unique translocation may warrant recognition as a distinct renal cell carcinoma translocation subtype.

Extensive Adenomatoid Odontogenic Tumor of the Maxilla: A Case Report of Conservative Surgical Excision and Orthodontic Alignment of Impacted Canine.

PubMed

Moon, Jee-Won

2014-07-01

The present report describe the surgical therapy, clinical course, orthodontic treatment and morphological characteristics of an adenomatoid odontogenic tumor in the maxilla of an 11-year-old patient. The cystic tumor filled the maxillary sinus and involved a tooth. Marsupialization was accompanied by partial enucleation and applied traction to the affected tooth by a fixed orthodontic appliance. Healing was uneventful and no local recurrence was observed during a 1-year period of follow-up control.

Laparoscopic resection of adult colon duplication causing intussusception

PubMed Central

Kyo, Kennoki; Azuma, Masaki; Okamoto, Kazuya; Nishiyama, Motohiro; Shimamura, Takahiro; Maema, Atsushi; Shirakawa, Motoaki; Nakamura, Toshio; Koda, Kenji; Yokoyama, Hidetaro

2016-01-01

Gastrointestinal duplications are uncommon congenital malformations that can occur anywhere along the gastrointestinal tract. Most cases are recognized before the age of 2 years, and those encountered in adults are rare. We describe here a case of ascending colon duplication in a 20-year-old male that caused intussusception and was treated laparoscopically. Although computed tomography revealed a cystic mass filled with stool-like material, the preoperative diagnosis was a submucosal tumor of the ascending colon. We performed a laparoscopic right colectomy, and the postoperative pathological diagnosis was duplication of the ascending colon, both cystic and tubular components. We conclude that gastrointestinal duplications, although rare, should be considered in the differential diagnosis of all abdominal and submucosal cystic lesions and that laparoscopy is a preferred approach for the surgical treatment of gastrointestinal duplications. PMID:26900303

Treatment of renal nephroblastoma in an adult dog.

PubMed

Seaman, Rebecca L; Patton, Clark S

2003-01-01

An 8-year-old Labrador retriever was diagnosed with a unilateral malignant nephroblastoma and hypertrophic osteopathy. The histopathologically malignant tumor was confined to the renal capsule, but the sarcomatous component was anaplastic, resulting in its classification as a Stage I tumor with unfavorable histopathology. The dog was treated with unilateral nephrectomy, vincristine, and doxorubicin. This dog has remained disease free for >25 months. Reported treatments of renal nephroblastoma in the dog have not described disease-free intervals of >8 months.

Stephen's Second Birthday

ERIC Educational Resources Information Center

Brown, Catherine C.

1977-01-01

A mother relates the first 2 years of development and treatment of her son with cystic hygroma, a rare condition which affects the lymph glands and causes tumors in the neck, tongue, and in more serious cases, the lungs. (SBH)

Differentiation of low- and high-grade clear cell renal cell carcinoma: Tumor size versus CT perfusion parameters.

PubMed

Chen, Chao; Kang, Qinqin; Xu, Bing; Guo, Hairuo; Wei, Qiang; Wang, Tiegong; Ye, Hui; Wu, Xinhuai

To compare the utility of tumor size and CT perfusion parameters for differentiation of low- and high-grade clear cell renal cell carcinoma (RCC). Tumor size, Equivalent blood volume (Equiv BV), permeability surface-area product (PS), blood flow (BF), and Fuhrman pathological grading of clear cell RCC were retrospectively analyzed. High-grade clear cell RCC had significantly higher tumor size and lower PS than low grade. Tumor size positively correlated with Fuhrman grade, but PS negatively did. Tumor size and PS were significantly independent indexes for differentiating high-grade from low-grade clear cell RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

Review of the carcinogenic potential of gasoline.

PubMed Central

Raabe, G K

1993-01-01

This review examines the animal, human, and mechanistic studies that precede the new studies reported in this volume. Wholly vaporized unleaded gasoline was found to produce a dose-dependent increase in renal carcinoma in male rats and an excess above background incidence of hepatocellular tumors in female mice in the high-dose group. Mechanistic studies suggest that gasoline is not mutagenic and that the probable mechanism for the male rat renal tumors involves a rat-specific protein, alpha 2u-globulin, whose binding with highly branched aliphatic compounds results in renal tubule cell death and, in turn, a proliferative sequence that increases renal tubule tumors. Human evidence generated predominantly from studies of refinery workers does not support a kidney or liver cancer risk in humans. The current epidemiologic database is inadequate to access leukemia risk from low-level benzene exposure from gasoline. Studies of gasoline-exposed workers that incorporate quantitative exposure information are needed. PMID:8020448

Successful Endovascular Control of Renal Artery in a Transplant Kidney During Nephron Sparing Surgery (NSS) for Large Centrally Located Tumor.

PubMed

Shprits, Sagi; Moskovits, Boaz; Sachner, Robert; Nativ, Ofer

2016-05-01

Renal cell carcinoma in a transplant kidney is a rare condition. Nephron Sparing Surgery (NSS) is the treatment of choice. One of the main technical challenges is obtaining adequate vascular control. We present a rare case of large centrally located hillar tumor in a kidney 18 years after transplantation treated with NSS. Vascular control was achieved by using a novel approach. Post-operative course was uneventful with minimal decrease in renal function. We believe that this unique choice of treatment can be used in cases of NSS where the access to the renal pedicle is limited.

[Renal angiomyolipoma rupture as a cause of lumbar pain: report of one case].

PubMed

Cifuentes, Melissa; Calleja, Félix; Hola, José; Daviú, Antonio; Jara, Danilo; Vallejos, Humberto

2008-08-01

Renal angiomyolipoma is a benign tumor formed by smooth muscle, adipose tissue and blood vessels. It is commonly found incidentally and its clinical manifestations are pain and abdominal mass or spontaneous tumor rupture with retroperitoneal bleeding. The clinical presentation of a hemorrhagic shock secondary to a retroperitoneal hematoma is uncommon. We report a 40 year-old male who presented to the emergency room with lumbar pain and deterioration of hemodynamic parameters. The CT scan showed a left renal injury associated to an expansive retroperitoneal process. The abdominal exploration, vascular control of the renal pedicle and nephrectomy allowed a successful outcome.

Outcomes of Robot-assisted Partial Nephrectomy for Clinical T2 Renal Tumors: A Multicenter Analysis (ROSULA Collaborative Group).

PubMed

Bertolo, Riccardo; Autorino, Riccardo; Simone, Giuseppe; Derweesh, Ithaar; Garisto, Juan D; Minervini, Andrea; Eun, Daniel; Perdona, Sisto; Porter, James; Rha, Koon Ho; Mottrie, Alexander; White, Wesley M; Schips, Luigi; Yang, Bo; Jacobsohn, Kenneth; Uzzo, Robert G; Challacombe, Ben; Ferro, Matteo; Sulek, Jay; Capitanio, Umberto; Anele, Uzoma A; Tuderti, Gabriele; Costantini, Manuela; Ryan, Stephen; Bindayi, Ahmet; Mari, Andrea; Carini, Marco; Keehn, Aryeh; Quarto, Giuseppe; Liao, Michael; Chang, Kidon; Larcher, Alessandro; De Naeyer, Geert; De Cobelli, Ottavio; Berardinelli, Francesco; Zhang, Chao; Langenstroer, Peter; Kutikov, Alexander; Chen, David; De Luyk, Nicolo; Sundaram, Chandru P; Montorsi, Francesco; Stein, Robert J; Haber, Georges Pascal; Hampton, Lance J; Dasgupta, Prokar; Gallucci, Michele; Kaouk, Jihad; Porpiglia, Francesco

2018-05-18

While partial nephrectomy (PN) represents the standard surgical management for cT1 renal masses, its role for cT2 tumors is controversial. Robot-assisted PN (RAPN) is being increasingly implemented worldwide. To analyze perioperative, functional, and oncological outcomes of RAPN for cT2 tumors. Retrospective analysis of a large multicenter, multinational dataset of patients with nonmetastatic cT2 masses treated with robotic surgery (ROSULA: RObotic SUrgery for LArge renal mass). Robotic-assisted PN. Patients' demographics, lesion characteristics, perioperative variables, renal functional data, pathology, and oncological data were analyzed. Univariable and multivariable regression analyses assessed the relationships with the risk of intra-/postoperative complications, recurrence, and survival. A total of 298 patients were analyzed. Median tumor size was 7.6 (7-8.5) cm. Median RENAL score was 9 (8-10). Median ischemia time was 25 (20-32) min. Median estimated blood loss was 150 (100-300) ml. Sixteen patients had intraoperative complications (5.4%), whereas 66 (22%) had postoperative complications (5% were Clavien grade ≥3). Multivariable analysis revealed that a lower RENAL score (odds ratio [OR] 0.46, 95% confidence interval [CI] 0.21-0.65, p=0.02) and pathological pT2 stage (OR 0.51, 95% CI 0.12-0.86, p=0.001) were protective against postoperative complications. A total of 243 lesions (82%) were malignant. Twenty patients (8%) had positive surgical margins. Ten deaths and 25 recurrences/metastases occurred at a median follow-up of 12 (5-35) mo. At univariable analysis, higher pT stage was predictive of a likelihood of recurrences/metastases (p=0.048). While there was a significant deterioration of renal function at discharge, this remained stable over time at 1-yr follow-up. The main limitation of this study is its retrospective design. RAPN in the setting of select cT2 renal masses can safely be performed with acceptable outcomes. Further studies are warranted to corroborate our findings and to better define the role of robotic nephron sparing for this challenging indication. This report shows that robotic surgery can be used for safe removal of a large renal tumor in a minimally invasive fashion, maximizing preservation of renal function, and without compromising cancer control. Published by Elsevier B.V.

Kidney (Renal Cell) Cancer—Health Professional Version

Cancer.gov

Kidney cancer has three main types. Renal cell cancer, or renal cell adenocarcinoma, forms in the tubules of the kidney. Transitional cell carcinoma forms in the renal pelvis and ureter. Wilms tumors are common in children. Find evidence-based information on kidney cancer treatment, research, genetics, and statistics.

Cystic mucinous adenocarcinoma of the lung: a case report

PubMed Central

2011-01-01

Mucinous cystic tumors of the lung are uncommon, the preoperative pathologic diagnosis is difficult and their biological behavior is still controversial. We report the case of a patient with a clinically benign cystic lesion that post-operatively showed to be consistent with an invasive adenocarcinoma arising in a mucinous cystadenoma of the lung, We underline the difficulty of the clinical pre-operative diagnosis of this cystic neoplasia radiologically mimicking a hydatid cyst, and we report the negative TTF1 immunostaining potentially misleading in the differential diagnosis with metastatic mucinous carcinomas. Finallly, we evidence the presence of a pre-existing mucinous benign lesion suggesting early and complete resection of benign appearing lung cysts because they can undergo malignant transformation if left untreated or they can already harbor foci of invasive carcinoma at the time of the presentation. Even if a good prognosis, better than in other lung carcinomas, with no recurrrence or metastasis after complete surgical exicision, has been reported for cystic mucinous cystoadenocarcinomas, the follow-up showed an aggressive biological behaviour, with the early onset of metastasis, in keeping with P53 positive immunostaining and high Ki-67 proliferation index. PMID:21970610

A Study of CD45RA+ Depleted Haploidentical Stem Cell Transplantation in Children With Relapsed or Refractory Solid Tumors and Lymphomas

ClinicalTrials.gov

2017-08-17

Ewing Sarcoma; Gastrointestinal Tumor; Germ Cell Tumor; Hepatic Tumor; Lymphoma; Wilms Tumor; Rhabdoid Tumor; Clear Cell Carcinoma; Renal Cell Carcinoma; Melanoma; Neuroblastoma; Rhabdomyosarcoma; Non-rhabdomyosarcoma

Bilateral renal oncocytoma in a Greyhound dog.

PubMed

Buergelt, C D; Adjiri-Awere, A

2000-03-01

A bilateral, locally invasive renal oncocytoma was diagnosed in a 10-year-old spayed female Greyhound dog. The diagnosis was based on positive staining of the tumor with the periodic acid-Schiff reaction prior to diastase treatment, on the immunohistochemical expression of cytoplasmic cytokeratin, and on the prominence of mitochondria in the tumor cells.

AFP464 in Treating Patients With Metastatic or Refractory Solid Tumors That Cannot Be Removed By Surgery

ClinicalTrials.gov

2014-02-21

Male Breast Cancer; Recurrent Breast Cancer; Recurrent Ovarian Epithelial Cancer; Recurrent Primary Peritoneal Cavity Cancer; Recurrent Renal Cell Cancer; Stage IV Breast Cancer; Stage IV Ovarian Epithelial Cancer; Stage IV Primary Peritoneal Cavity Cancer; Stage IV Renal Cell Cancer; Unspecified Adult Solid Tumor, Protocol Specific

Sporadic renal angiomyolipoma in a patient with Birt-Hogg-Dubé: chaperones in pathogenesis.

PubMed

Sager, Rebecca A; Woodford, Mark R; Shapiro, Oleg; Mollapour, Mehdi; Bratslavsky, Gennady

2018-04-24

Birt-Hogg-Dubé (BHD) is an autosomal dominant genetic syndrome caused by germline mutations in the FLCN gene that predisposes patients to develop renal tumors. Renal angiomyolipoma (AML) is not a renal tumor sub-type associated with BHD. AML is, however, a common phenotypic manifestation of Tuberous Sclerosis Complex (TSC) syndrome caused by mutations in either the TSC1 or TSC2 tumor suppressor genes. Previous case reports of renal AML in patients with BHD have speculated on the molecular and clinical overlap of these two syndromes as a result of described involvement of the gene products in the mTOR pathway. Our recent work provided a new molecular link between these two syndromes by identifying FLCN and Tsc2 as clients of the molecular chaperone Hsp90. Folliculin interacting proteins FNIP1/2 and Tsc1 are important for FLCN and Tsc2 stability as new Hsp90 co-chaperones. Here we present a case of sporadic AML as a result of somatic Tsc1/2 loss in a patient with BHD. We further demonstrate that FNIP1 and Tsc1 are capable of compensating for each other in the chaperoning of mutated FLCN tumor suppressor. Our findings demonstrate interconnectivity and compensatory mechanisms between the BHD and TSC pathways.

Advances of multidetector computed tomography in the characterization and staging of renal cell carcinoma

PubMed Central

Tsili, Athina C; Argyropoulou, Maria I

2015-01-01

Renal cell carcinoma (RCC) accounts for approximately 90%-95% of kidney tumors. With the widespread use of cross-sectional imaging modalities, more than half of RCCs are detected incidentally, often diagnosed at an early stage. This may allow the planning of more conservative treatment strategies. Computed tomography (CT) is considered the examination of choice for the detection and staging of RCC. Multidetector CT (MDCT) with the improvement of spatial resolution and the ability to obtain multiphase imaging, multiplanar and three-dimensional reconstructions in any desired plane brought about further improvement in the evaluation of RCC. Differentiation of RCC from benign renal tumors based on MDCT features is improved. Tumor enhancement characteristics on MDCT have been found closely to correlate with the histologic subtype of RCC, the nuclear grade and the cytogenetic characteristics of clear cell RCC. Important information, including tumor size, localization, and organ involvement, presence and extent of venous thrombus, possible invasion of adjacent organs or lymph nodes, and presence of distant metastases are provided by MDCT examination. The preoperative evaluation of patients with RCC was improved by depicting the presence or absence of renal pseudocapsule and by assessing the possible neoplastic infiltration of the perirenal fat tissue and/or renal sinus fat compartment. PMID:26120380

Cytologic Features of Renal Carcinoma Associated with Xp11.2 Translocations/ TFE3 Gene Fusions: A Case Report with Voided and Catheterized Urine Cytology and a Literature Review.

PubMed

Kuwamoto, Satoshi; Murai, Yuki; Endo, Yukari; Masago, Toshihiko; Kuroda, Naoto; Horie, Yasushi

2014-01-01

Renal carcinomas associated with Xp11.2 translocations/TFE3 gene fusions are rare subtypes of renal neoplasm that predominantly occur in younger individuals. There are very few reports describing the cytologic features of these tumors. A 27-year-old man presented with hematuria and was found to have a mass in the lower part of the right kidney. Cytology of catheterized urine obtained from the right renal pelvis showed clusters of cells with abundant clear or eosinophilic granular cytoplasm, large round nuclei and prominent nucleoli. Papillary clusters containing thin fibrous stroma were occasionally seen. Voided urine cytology showed similar cell clusters but degeneration made the features obscure. Nephroureterectomy revealed a renal tumor showing a mixed papillary and nested architecture. The diagnosis was confirmed by immunohistochemistry and fluorescence in situ hybridization. The present case indicates that the characteristic features of these tumor subtypes can be retained in urine cytology. Cytology may be enough to suspect these tumors as part of the differential diagnosis when the patient's age and imaging findings are taken into account and may facilitate further studies for a definitive diagnosis. © 2014 S. Karger AG, Basel.

An Xp11.2 translocation renal cell carcinoma with SMARCB1 (INI1) inactivation in adult end-stage renal disease: a case report.

PubMed

Yu, Lu; Li, Jun; Xu, Sanpeng; Navia Miranda, Mariajose; Wang, Guoping; Duan, Yaqi

2016-10-12

Xp11.2 translocation/transcription factor E3 (TFE3) rearrangement renal cell carcinoma (RCC) is a rare subtype of RCC with limited clinical and pathological data. Here we present an unusual high-grade Xp11.2 translocation RCC with a rhabdoid feature and SMARCB1 (INI1) inactivation in a 40-year-old man with end-stage kidney disease. The histological examination of the dissected left renal tumor showed an organoid architecture of the eosinophilic or clear neoplastic cells with necrosis and high mitotic activity. In some areas, non-adhesive tumor cells with eccentric nuclei were observed. Immunohistochemically (IHC), the tumor cells are positive for TFE3 and the renal tubular markers (PAX2 and PAX8), and completely negative for SMARCB1, an oncosuppressor protein. Break-apart florescence in situ hybridization and reverse transcription polymerase chain reaction confirmed TFE3 rearrangement on Xp11.2 and the presence of ASPSCR1-TFE3 fusion gene. DNA sequencing revealed a frameshift mutation in exon 4 of SMARCB1 gene. It is important to recognize this rare RCC with both TFE3 rearrangement and SMARCB1 inactivation, as the prognosis and therapeutic strategies, particularly targeted therapies for such tumors, might be different.

Dual Paraneoplastic Syndromes: Small Cell Lung Carcinoma-related Oncogenic Osteomalacia, and Syndrome of Inappropriate Antidiuretic Hormone Secretion: Report of a Case and Review of the Literature

PubMed Central

Ng, Roland CK

2011-01-01

Acquired isolated renal phosphate wasting associated with a tumor, known as oncogenic osteomalacia or tumor-induced osteomalacia, is a rare paraneoplastic syndrome caused by overproduction of fibroblast growth factor 23. Oncogenic osteomalacia is usually associated with benign mesenchymal tumors. Syndrome of inappropriate antidiuretic hormone secretion (SIADH), on the other hand, is a common paraneoplastic syndrome caused by small cell carcinoma (SCC). Concomitant oncogenic osteomalacia and SIADH associated with SCC is very rare with only 4 other cases reported in the literature. The authors report a case of small cell lung cancer (SCLC)-related renal wasting hypophosphatemia and concurrent SIADH, and review the literature reporting 9 other cases of SCC associated with oncogenic osteomalacia. Almost half of reported cases of renal phosphate wasting associated with SCC concomitantly presented with SIADH. These cases had initial serum phosphorus level lower and survival periods shorter than those without SIADH. This rare combination of a dual paraneoplastic syndrome and low serum phosphorus may be a poor prognostic sign. In addition, both renal phosphate wasting and SIADH usually occur in a short period of time before identification of SCC. Therefore, renal wasting hypophosphatemia with concomitant SIADH/hyponatremia should prompt a search for SCC rather than a benign mesenchymal tumor. PMID:21886301

Dual paraneoplastic syndromes: small cell lung carcinoma-related oncogenic osteomalacia, and syndrome of inappropriate antidiuretic hormone secretion: report of a case and review of the literature.

PubMed

Tantisattamo, Ekamol; Ng, Roland C K

2011-07-01

Acquired isolated renal phosphate wasting associated with a tumor, known as oncogenic osteomalacia or tumor-induced osteomalacia, is a rare paraneoplastic syndrome caused by overproduction of fibroblast growth factor 23. Oncogenic osteomalacia is usually associated with benign mesenchymal tumors. Syndrome of inappropriate antidiuretic hormone secretion (SIADH), on the other hand, is a common paraneoplastic syndrome caused by small cell carcinoma (SCC). Concomitant oncogenic osteomalacia and SIADH associated with SCC is very rare with only 4 other cases reported in the literature. The authors report a case of small cell lung cancer (SCLC)-related renal wasting hypophosphatemia and concurrent SIADH, and review the literature reporting 9 other cases of SCC associated with oncogenic osteomalacia. Almost half of reported cases of renal phosphate wasting associated with SCC concomitantly presented with SIADH. These cases had initial serum phosphorus level lower and survival periods shorter than those without SIADH. This rare combination of a dual paraneoplastic syndrome and low serum phosphorus may be a poor prognostic sign. In addition, both renal phosphate wasting and SIADH usually occur in a short period of time before identification of SCC. Therefore, renal wasting hypophosphatemia with concomitant SIADH/hyponatremia should prompt a search for SCC rather than a benign mesenchymal tumor.

Percutaneous Cryoablation of Solitary, Sporadic Renal Cell Carcinoma: Outcome Analysis Based on Clear-Cell versus Papillary Subtypes.

PubMed

Haddad, Mustafa M; Schmit, Grant D; Kurup, A Nicholas; Schmitz, John J; Boorjian, Stephen A; Geske, Jennifer; Thompson, R Houston; Callstrom, Matthew R; Atwell, Thomas D

2018-06-07

To evaluate treatment outcomes with percutaneous cryoablation (PCA) based on renal cell carcinoma (RCC) histology. Patients treated with PCA for a solitary, sporadic stage T1a RCC from 2003 to 2016 were identified from a single institution's renal ablation registry. Patients with multiple tumors, history of RCC, or genetic syndromes associated with RCC (n = 60); no specific RCC subtype determined from core biopsy (n = 66); RCC subtype other than clear-cell or papillary (n = 7); or less than 3 mo of follow-up imaging (n = 5) were excluded. In total, 173 patients met study inclusion criteria. Oncologic outcomes, clinical outcomes, and complications were evaluated based on tumor subtype. Of the 173 patients who underwent PCA for a stage T1a RCC, 130 (75%) had clear-cell RCC (ccRCC) and 43 (25%) had papillary RCC (pRCC). Median tumor size was 2.9 cm (range, 1.3-4.0 cm). Technically successful cryoablation was achieved in all 173 patients. Local tumor recurrence developed in 6 patients with ccRCC (4.6%), new renal tumors developed in 1 patient (0.8%), and metastatic RCC developed in 1 patient (0.8%) who also had local tumor recurrence. No patients with pRCC showed local tumor recurrence, new renal tumors, or metastatic disease. The 5-year disease-free survival rate in patients with ccRCC was 88%, compared with 100% in patients with pRCC (P = .48). Nine patients (5.2%), all with ccRCC, experienced major complications (P = .11). Percutaneous ablation is a viable treatment option for patients with clinical stage T1a pRCC and ccRCC. Percutaneous ablation may be a very favorable treatment strategy particularly for pRCC. Copyright © 2018 SIR. Published by Elsevier Inc. All rights reserved.

NFκB-mediated cyclin D1 expression by microRNA-21 influences renal cancer cell proliferation.

PubMed

Bera, Amit; Ghosh-Choudhury, Nandini; Dey, Nirmalya; Das, Falguni; Kasinath, Balakuntalam S; Abboud, Hanna E; Choudhury, Goutam Ghosh

2013-12-01

MicroRNAs regulate post-transcriptomic landscape in many tumors including renal cell carcinoma. We have recently shown significantly increased expression of miR-21 in renal tumors and that this miRNA contributes to the proliferation of renal cancer cells in culture. However, the mechanism by which miR-21 regulates renal cancer cell proliferation is poorly understood. Addiction to constitutive NFκB activity is hallmark of many cancers including renal cancer. Using miR-21 Sponge in renal cancer cells to block endogenous function of miR-21, we show inhibition of phosphorylation of p65 subunit of NFκB, IKKβ and IκB, which results in attenuation of NFκB transcriptional activity. Subtle reduction in the tumor suppressor PTEN has been linked to various malignancies. We showed previously that miR-21 targeted PTEN in renal cancer cells. Inhibition of PTEN by siRNAs restored miR-21 Sponge-induced suppression of phosphorylation of p65, IKKβ, IκB and NFκB transcriptional activity along with reversal of miR-21 Sponge-reduced phosphorylation of Akt. Expression of constitutively active Akt protected against miR-21 Sponge- and PTEN-mediated decrease in p65/IKKβ/IκB phosphorylation and NFκB transcriptional activity. Furthermore, IKKβ and p65 were required for miR-21-induced renal cancer cell proliferation. Interestingly, miR-21 controlled the expression of cyclin D1 through NFκB-dependent transcription. Finally, we demonstrate that miR-21-regulated renal cancer cell proliferation is mediated by cyclin D1 and CDK4. Together, our results establish a molecular order of a phosphatase-kinase couple involving PTEN/Akt/IKKβ and NFκB-dependent cyclin D1 expression for renal carcinoma cell proliferation by increased miR-21 levels. © 2013.

NFκB-mediated cyclin D1 expression by microRNA-21 influences renal cancer cell proliferation

PubMed Central

Bera, Amit; Ghosh-Choudhury, Nandini; Dey, Nirmalya; Das, Falguni; Kasinath, Balakuntalam S.; Abboud, Hanna E.; Choudhury, Goutam Ghosh

2013-01-01

MicroRNAs regulate post-transcriptomic landscape in many tumors including renal cell carcinoma. We have recently shown significantly increased expression of miR-21 in renal tumors and that this miRNA contributes to the proliferation of renal cancer cells in culture. However, the mechanism by which miR-21 regulates renal cancer cells proliferation is poorly understood. Addiction to constitutive NFκB activity is hallmark of many cancers including renal cancer. Using miR-21 Sponge in renal cancer cells to block endogenous function of miR-21, we show inhibition of phosphorylation of p65 subunit of NFκB, IKKβ and IκB, which results in attenuation of NFκB transcriptional activity. Subtle reduction in the tumor suppressor PTEN has been linked to various malignancies. We showed previously that miR-21 targeted PTEN in renal cancer cells. Inhibition of PTEN by siRNAs restored miR-21 Sponge-induced suppression of phosphorylation of p65, IKKβ, IκB and NFκB transcriptional activity along with reversal of miR-21 Sponge-reduced phosphorylation of Akt. Expression of constitutively active Akt protected against miR-21 Sponge- and PTEN-mediated decrease in p65/IKKβ/IκB phosphorylation and NFκB transcriptional activity. Furthermore, IKKβ and p65 were required for miR-21-induced renal cancer cell proliferation. Interestingly, miR-21 controlled the expression of cyclin D1 through NFκB-dependent transcription. Finally, we demonstrate that miR-21-regulated renal cancer cell proliferation is mediated by cyclin D1 and CDK4. Together, our results establish a molecular order of a phosphatase-kinase couple involving PTEN/Akt/IKKβ and NFκB-dependent cyclin D1 expression for renal carcinoma cell proliferation by increased miR-21 levels. PMID:23981302

Protective and recuperative effects of 3-bromopyruvate on immunological, hepatic and renal homeostasis in a murine host bearing ascitic lymphoma: Implication of niche dependent differential roles of macrophages.

PubMed

Yadav, Saveg; Pandey, Shrish Kumar; Goel, Yugal; Kujur, Praveen Kumar; Maurya, Babu Nandan; Verma, Ashish; Kumar, Ajay; Singh, Rana Pratap; Singh, Sukh Mahendra

2018-03-01

3-bromopyruvate (3-BP) possesses promising antineoplastic potential, however, its effects on immunological homeostasis vis a vis hepatic and renal functions in a tumor bearing host remain unclear. Therefore, the effect of 3-BP administration to a murine host bearing a progressively growing tumor of thymoma origin, designated as Dalton's lymphoma (DL), on immunological, renal and hepatic homeostasis was investigated. Administration of 3-BP (4 mg/kg) to the tumor bearing host reversed tumor growth associated thymic atrophy and splenomegaly, accompanied by altered cell survival and repertoire of splenic, bone marrow and tumor associated macrophages (TAM). TAM displayed augmented phagocytic, tumoricidal activities and production of IL-1 and TNF-α. 3-BP-induced activation of TAM was of indirect nature, mediated by IFN-γ. Blood count of T lymphocytes (CD4 + & CD8 + ) and NK cells showed a rise in 3-BP administered tumor bearing mice. Moreover, 3-BP administration triggered modulation of immunomodulatory cytokines in serum along with refurbished hepatic and renal functions. The study indicates the role of altered cytokines balance, site specific differential macrophage functions and myelopoiesis in restoration of lymphoid organ homeostasis in 3-BP administered tumor bearing host. These observations will have long lasting impact in understanding of alternate mechanisms underlying the antitumor action of 3-BP accompanying appraisal of safety issues for optimizing its antineoplastic actions. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Renal cell carcinoma, unclassified with medullary phenotype: poorly differentiated adenocarcinomas overlapping with renal medullary carcinoma.

PubMed

Sirohi, Deepika; Smith, Steven C; Ohe, Chisato; Colombo, Piergiuseppe; Divatia, Mukul; Dragoescu, Ema; Rao, Priya; Hirsch, Michelle S; Chen, Ying-Bei; Mehra, Rohit; Amin, Mahul B

2017-09-01

Renal medullary carcinoma (RMC) is a highly aggressive renal cell carcinoma arising in the collecting system and requiring careful correlation with status of sickle cell trait. A panel of international experts has recently proposed provisional diagnostic terminology, renal cell carcinoma, unclassified, with medullary phenotype, based on encountering an extraordinarily rare tumor with RMC morphology and immunophenotype in an individual proven not to have a hemoglobinopathy. Herein, we extend this observation to a cohort of 5 such tumors, morphologically similar to RMC, lacking SMARCB1 expression by immunohistochemistry, but each without evidence of a hemoglobinopathy. The tumors arose in 4 men and 1 woman with a mean age of 44 years, occurring in 3 left and 2 right kidneys. Clinically, aggression was apparent with involvement of perinephric adipose tissue in all 5 cases, nodal metastasis in 4 of 5 cases, and death of disease in 4 of 5 cases within 3-27 months. Histologic sections showed poorly differentiated adenocarcinoma, often with solid and nested growth patterns, as well as infiltrative glandular, tubulopapillary, cribriform, or reticular growth. Rhabdoid and sarcomatoid cytomorphology was seen in a subset. All tumors showed PAX8 nuclear positivity and SMARCB1 loss, with OCT3/4 expression in 4 of 5 cases. In summary, this first series of renal cell carcinoma, unclassified, with medullary phenotype documents tumors with morphologic, immunophenotypic, and prognostic features of RMC occurring in individuals without sickle cell trait. Although greater biologic and molecular understanding is needed, the available evidence points to these cases representing a sporadic counterpart to sickle cell trait-associated RMC. Copyright © 2017 Elsevier Inc. All rights reserved.

Haploinsufficiency in tumor predisposition syndromes: altered genomic transcription in morphologically normal cells heterozygous for VHL or TSC mutation

PubMed Central

Peri, Suraj; Caretti, Elena; Tricarico, Rossella; Devarajan, Karthik; Cheung, Mitchell; Sementino, Eleonora; Menges, Craig W.; Nicolas, Emmanuelle; Vanderveer, Lisa A.; Howard, Sharon; Conrad, Peggy; Crowell, James A.; Campbell, Kerry S.; Ross, Eric A.; Godwin, Andrew K.; Yeung, Anthony T.; Clapper, Margie L.; Uzzo, Robert G.; Henske, Elizabeth P.; Ricketts, Christopher J.; Vocke, Cathy D.; Linehan, W. Marston; Testa, Joseph R.; Bellacosa, Alfonso; Kopelovich, Levy; Knudson, Alfred G.

2017-01-01

Tumor suppressor genes and their effector pathways have been identified for many dominantly heritable cancers, enabling efforts to intervene early in the course of disease. Our approach on the subject of early intervention was to investigate gene expression patterns of morphologically normal one-hit cells before they become hemizygous or homozygous for the inherited mutant gene which is usually required for tumor formation. Here, we studied histologically non-transformed renal epithelial cells from patients with inherited disorders that predispose to renal tumors, including von Hippel-Lindau (VHL) disease and Tuberous Sclerosis (TSC). As controls, we studied histologically normal cells from non-cancerous renal epithelium of patients with sporadic clear cell renal cell carcinoma (ccRCC). Gene expression analyses of VHLmut/wt or TSC1/2mut/wt versus wild-type (WT) cells revealed transcriptomic alterations previously implicated in the transition to precancerous renal lesions. For example, the gene expression changes in VHLmut/wt cells were consistent with activation of the hypoxia response, associated, in part, with the Warburg effect. Knockdown of any remaining VHL mRNA using shRNA induced secondary expression changes, such as activation of NF?B and interferon pathways, that are fundamentally important in the development of RCC. We posit that this is a general pattern of hereditary cancer predisposition, wherein haploinsufficiency for VHL or TSC1/2, or potentially other tumor susceptibility genes, is sufficient to promote development of early lesions, while cancer results from inactivation of the remaining normal allele. The gene expression changes identified here are related to the metabolic basis of renal cancer and may constitute suitable targets for early intervention. PMID:27682873

Renin-angiotensin system (RAS) blockade attenuates growth and metastatic potential of renal cell carcinoma in mice.

PubMed

Araújo, Wedson F; Naves, Marcelo A; Ravanini, Juliana N; Schor, Nestor; Teixeira, Vicente P C

2015-09-01

Renal cell carcinoma (RCC) is the most frequent type of cancer among renal neoplasms in adults and responds poorly to radiotherapy and chemotherapy. There is evidence that blockade of the renin-angiotensin system (RAS) might have antineoplastic effects. The aim of this study was to investigate the effects of RAS blockade on RCC in a murine model. Murine renal cancer cells (Renca) were injected (1 × 10(5)) into the subcapsular space of the left kidney of BALB/c mice (8 wk of age). The animals were divided into 4 groups: a control group (no treatment), angiotensin-receptor blockers group (losartan 100mg/kg/d), angiotensin-converting enzyme inhibitor group (captopril 10mg/kg/d), and angiotensin-receptor blockers +angiotensin-converting enzyme inhibitor group (losartan 100mg/kg/d +captopril 10mg/kg/d). The animals received the drugs by gavage for 21 days after inoculation, beginning 2 days before tumor induction, and were then euthanized. After killing the animals, the kidneys and lungs were removed, weighed, and processed for histopathological and immunohistochemical analyses. Angiogenesis and vascular microvessels were assessed with the antibodies anti-vascular endothelial growth factor and anti-CD34. Angiotensin II-inoculated animals developed renal tumors. Treated animals presented smaller tumors, regardless of the therapeutic regimen, and far fewer lung metastases in both quantity and dimension compared with the controls. The expression of vascular endothelial growth factor and CD34 were significantly decreased in renal tumors of treated animals compared with the controls. Our findings suggest that blockade of RAS decreases tumor proliferation and metastatic capacity of RCC in this experimental model. Copyright © 2015 Elsevier Inc. All rights reserved.

The Utility of the Remnant Kidney Volume/Body Surface Area Ratio and Tumor Diameter as Predictors of Postoperative Degree of Renal Functional Decline in Patients With Renal Cell Carcinoma Treated by Radical Nephrectomy.

PubMed

Sejima, Takehiro; Yamaguchi, Noriya; Iwamoto, Hideto; Masago, Toshihiko; Morizane, Shuichi; Ono, Koji; Koumi, Tsutomu; Honda, Masashi; Takenaka, Atsushi

2015-08-01

To characterize the preoperative factors affecting renal cell carcinoma patients as predictive of post-radical nephrectomy (RN) mild (M-decline) or severe (S-decline) renal functional decline and to elucidate the histopathologic features of the resected normal kidney cortex, as well as the occurrence of cardiovascular disease (CVD) in both M-decline and S-decline patients. M-decline and S-decline were categorized as a percentage of postoperative estimated glomerular filtration rate decline of <20 and of >40, respectively. The preoperative factors analyzed were patient demographics, comorbidities, and radiographic findings, including remnant kidney status and tumor size. The factors based on postoperative information analyzed were tumor and normal cortex pathology and CVD events. In 175 patient cohort, 21 and 32 cases were categorized as M-decline and S-decline, respectively. Absence of comorbidities, larger remnant kidney volume (RKV)/body surface area (BSA) ratio, and larger tumor diameter were significantly predictive of M-decline, whereas smaller tumor diameter was significantly predictive of S-decline. The global glomerulosclerosis extent in nephrectomized normal cortex of S-decline cases was significantly higher than in other types of cases. No CVD event was observed in M-decline cases. This is the first report to identify the RKV/BSA ratio as a promising predictor of post-RN degree of renal functional decline. Post-RN prevention of life-threatening outcomes according to preoperative and postoperative information, including the degree of post-RN renal functional decline and histopathology of the nephrectomized normal cortex, should be considerable in future urological tasks. Copyright © 2015 Elsevier Inc. All rights reserved.

Leiomyoma of broad ligament mimicking ovarian malignancy- report of a unique case.

PubMed

Mallick, D; Saha, M; Chakrabarti, S; Chakraborty, J

2014-01-01

Tumors of the broad ligament are uncommon. Leiomyoma, which is the commonest female genital neoplasm, is also the most common solid tumor of the broad ligament. Leiomyomas affect 30% of all women of reproductive age but the incidence of broad-ligament leiomyoma is <1%. These benign tumors are usually asymptomatic. A case is being described where a 52 year old presented with gradual abdominal swelling which was clinically and radiologically diagnosed as ovarian malignancy. On abdominal and bimanual palpation a soft cystic mass was noted in the right pelvic region. CA 125 was mildly raised. CEA, CA 19.9 levels were within normal limit. The radiological diagnosis was ovarian cyst with possibility of malignant changes. Staging laparotomy and histopathological examination of the resected specimen revealed a right sided broad ligament leiomyoma with cystic changes. The degenerative changes in the leiomyoma lead to the clinical and radiological diagnostic confusion. Thus, though uncommon, broad ligament leiomyoma should be considered during evaluation of adnexal masses for optimal patient management. The above description of leiomyoma in the broad ligament is a highly unique case and thus deserves appropriate attention.

Acute lymphoblastic leukemia mimicking Wilms tumor at presentation.

PubMed

Singh, Amitabh; Mandal, Anirban; Guru, Vijay; Seth, Rachna

2016-09-01

Acute lymphoblastic leukemia (ALL), the commonest malignancy of childhood, is known to manifest with a myriad of atypical presentations. Nephromegaly is a rare presentation of childhood ALL with hepatic mass being even rarer. We present a 3 year-old child with unilateral renal mass and hepatic mass lesion with normal blood counts, initially suspected to have metastatic Wilms tumor based on clinical, radiological and WT1 positivity on immunocytochemistry of renal mass. He was later diagnosed as ALL with peripheral blood flowcytometry and bone marrow examination. Renomegaly at presentation of acute leukemia is not necessarily due to leukemic infiltration and rarely leads to renal impairment. The radiological differential of such a renal mass includes both benign and malignant entities including metastasis. Over-expression of WT1 mRNA has been found in a number of solid tumors and hematological malignancies and is far from being diagnostic of Wilms tumor. Again, a small number of children with acute leukemia may have a deceptively normal complete blood count at presentation. Though, initial all (clinical, radiological, hematological, and immunocytological) parameters pointed towards a diagnosis of Wilms tumor in our case, the subsequent development of thrombocytopenia and lymphocytic leukocytosis prompted further investigation and final diagnosis of ALL. WT1 positivity is a known phenomenon in childhood ALL and undifferentiated lymphoblasts may be positive for WT1 and negative for Leucocyte common antigen. Acute leukemia with renal and hepatic mass with normal blood counts at presentation is a diagnostic challenge.

Improved laparoscopic nephron-sparing surgery for renal cell carcinoma based on the precise anatomy of the nephron.

PubMed

Guo, Gang; Cai, Wei; Zhang, Xu

2016-11-01

The aim of the present study was to investigate a method of laparoscopic nephron-sparing surgery (LNSS) for renal cell carcinoma (RCC) based on the precise anatomy of the nephron, and to decrease the incidence of hemorrhage and urinary leakage. Between January 2012 and December 2013, 31 patients who presented to the General Hospital of the People's Liberation Army (Beijing, China) were treated for RCC. The mean tumor size was 3.4±0.7 cm in diameter (range, 1.2-6.0 cm). During surgery, the renal artery was blocked, and subsequently, an incision in the renal capsule and renal cortex was performed, at 3-5 mm from the tumor edge. Subsequent to the incision of the renal parenchyma, scissors with blunt and sharp edge were used to separate the base of the tumor from the normal renal medulla, in the direction of the ray medullary in the renal pyramids. The basal blood vessels were incised following the hemostasis of the region using bipolar coagulation. The minor renal calyces were stripped carefully and the wound was closed with an absorbable sutures. The arterial occlusion time, duration of surgery, intraoperative bleeding volume, post-operative drainage volume, pathological results and complications were recorded. The surgery was successful for all patients. The estimated average intraoperative bleeding volume was 55.7 ml, the average surgical duration was 95.5 min, the average arterial occlusion time was 21.2 min, the average post-operative drainage volume was 92.3 ml and the average post-operative length of hospital stay was 6.1 days. No hemorrhage or urinary leakage was observed in the patients following the surgery. LNSS for RCC based on the precise anatomy of the nephron was concluded to be effective and feasible. The surgery is useful for the complete removal of tumors and guarantees a negative margin, which may also decrease the incidence of hemorrhage and urinary leakage following surgery.

Multi-quadrant biopsy technique improves diagnostic ability in large heterogeneous renal masses. Abel EJ, Heckman JE, Hinshaw L, Best S, Lubner M, Jarrard DF, Downs TM, Nakada SY, Lee FT Jr, Huang W, Ziemlewicz T.J Urol. 2015 Oct;194(4):886-91. [Epub 2015 Mar 30]. doi: 10.1016/j.juro.2015.03.106.

PubMed

Jay, Raman; Heckman, J E; Hinshaw, L; Best, S; Lubner, M; Jarrard, D F; Downs, T M; Nakada, S Y; Lee, F T; Huang, W; Ziemlewicz, T

2017-03-01

Percutaneous biopsy obtained from a single location is prone to sampling error in large heterogeneous renal masses, leading to nondiagnostic results or failure to detect poor prognostic features. We evaluated the accuracy of percutaneous biopsy for large renal masses using a modified multi-quadrant technique vs. a standard biopsy technique. Clinical and pathological data for all patients with cT2 or greater renal masses who underwent percutaneous biopsy from 2009 to 2014 were reviewed. The multi-quadrant technique was defined as multiple core biopsies from at least 4 separate solid enhancing areas in the tumor. The incidence of nondiagnostic findings, sarcomatoid features and procedural complications was recorded, and concordance between biopsy specimens and nephrectomy pathology was compared. A total of 122 biopsies were performed for 117 tumors in 116 patients (46 using the standard biopsy technique and 76 using the multi-quadrant technique). Median tumor size was 10cm (IQR: 8-12). Biopsy was nondiagnostic in 5 of 46 (10.9%) standard and 0 of 76 (0%) multi-quadrant biopsies (P = 0.007). Renal cell carcinoma was identified in 96 of 115 (82.0%) tumors and nonrenal cell carcinoma tumors were identified in 21 (18.0%). One complication occurred using the standard biopsy technique and no complications were reported using the multi-quadrant technique. Sarcomatoid features were present in 23 of 96 (23.9%) large renal cell carcinomas studied. Sensitivity for identifying sarcomatoid features was higher using the multi-quadrant technique compared to the standard biopsy technique at 13 of 15 (86.7%) vs. 2 of 8 (25.0%) (P = 0.0062). The multi-quadrant percutaneous biopsy technique increases the ability to identify aggressive pathological features in large renal tumors and decreases nondiagnostic biopsy rates. Copyright © 2017. Published by Elsevier Inc.

Single-cell genetic analysis validates cytopathological identification of circulating cancer cells in patients with clear cell renal cell carcinoma.

PubMed

Broncy, Lucile; Njima, Basma Ben; Méjean, Arnaud; Béroud, Christophe; Romdhane, Khaled Ben; Ilie, Marius; Hofman, Veronique; Muret, Jane; Hofman, Paul; Bouhamed, Habiba Chaabouni; Paterlini-Bréchot, And Patrizia

2018-04-13

Circulating Rare Cells (CRC) are non-haematological cells circulating in blood. They include Circulating Cancer Cells (CCC) and cells with uncertain malignant features (CRC-UMF) according to cytomorphology. Clear cell renal cell carcinomas frequently bear a mutated Von Hippel-Lindau (VHL) gene. To match blind genetic analysis of CRC and tumor samples with CRC cytopathological diagnosis. 29/30 patients harboured CRC (20 harboured CCC, 29 CRC-UMF) and 25/29 patients carried VHL mutations in their tumour. 205 single CRC (64 CCC, 141 CRC-UMF) provided genetic data. 57/57 CCC and 104/125 CRC-UMF from the 25 patients with VHL-mutated tumor carried the same VHL mutation detected in the tumor. Seven CCC and 16 CRC-UMF did not carry VHL mutations but were found in patients with wild-type VHL tumor tissue. All the CCC and 83,2% (104/125) of the CRC-UMF were found to carry the same VHL mutation identified in the corresponding tumorous tissue, validating cytopathological identification of CCC in patients with clear cell renal cell carcinoma. The blood of 30 patients with clear cell renal cell carcinoma was treated by ISET ® for CRC isolation, cytopathology and single-cell VHL mutations analysis, performed blindly and compared to VHL mutations of corresponding tumor tissues and leukocytes.

Lymphatic Drainage from Renal Tumors In Vivo: A Prospective Sentinel Node Study Using SPECT/CT Imaging.

PubMed

Kuusk, Teele; De Bruijn, Roderick; Brouwer, Oscar R; De Jong, Jeroen; Donswijk, Maarten; Grivas, Nikolaos; Hendricksen, Kees; Horenblas, Simon; Prevoo, Warner; Valdés Olmos, Renato A; Van Der Poel, Henk G; Van Rhijn, Bas W G; Wit, Esther M; Bex, Axel

2018-06-01

Lymphatic drainage from renal tumors is unpredictable. In vivo drainage studies of primary lymphatic landing sites may reveal the variability and dynamics of lymphatic connections. The purpose of this study was to investigate the lymphatic drainage pattern of renal tumors in vivo with single photon emission/computerized tomography after intratumor radiotracer injection. We performed a phase II, prospective, single arm study to investigate the distribution of sentinel nodes from renal tumors on single photon emission/computerized tomography. Patients with cT1-3 (less than 10 cm) cN0M0 renal tumors of any subtype were enrolled in analysis. After intratumor ultrasound guided injection of 0.4 ml 99m Tc-nanocolloid we performed preoperative imaging of sentinel nodes with lymphoscintigraphy and single photon emission/computerized tomography. Sentinel and locoregional nonsentinel nodes were resected with a γ probe combined with a mobile γ camera. The primary study end point was the location of sentinel nodes outside the locoregional retroperitoneal templates on single photon emission/computerized tomography. Using a Simon minimax 2-stage design to detect a 25% extralocoregional retroperitoneal template location of sentinel nodes on imaging at α = 0.05 and 80% power at least 40 patients with sentinel node imaging on single photon emission/computerized tomography were needed. Of the 68 patients 40 underwent preoperative single photon emission/computerized tomography of sentinel nodes and were included in primary end point analysis. Lymphatic drainage outside the locoregional retroperitoneal templates was observed in 14 patients (35%). Eight patients (20%) had supradiaphragmatic sentinel nodes. Sentinel nodes from renal tumors were mainly located in the respective locoregional retroperitoneal templates. Simultaneous sentinel nodes were located outside the suggested lymph node dissection templates, including supradiaphragmatic sentinel nodes in more than a third of the patients. Copyright © 2018 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Congenital dilatation of the intrahepatic bile ducts associated with the development of amyloidosis

PubMed Central

Fevery, J.; Tanghe, W.; Kerremans, R.; Desmet, V.; De Groote, J.

1972-01-01

Two cases of pure congenital dilatation of the intrahepatic bile ducts are presented. One patient developed amyloidosis secondary to suppuration, and had isolated cysts in the renal medulla. The position of congenital dilatation of the intrahepatic bile ducts compared with cysts in the liver and its association with `cystic' diseases of the kidneys is discussed. ImagesFig. 1Fig. 2Fig. 3Fig. 4 PMID:5077171

Renal Mass Biopsy to Guide Treatment Decisions for Small Incidental Renal Tumors: A Cost-effectiveness Analysis1

PubMed Central

Gervais, Debra A.; Hartman, Rebecca I.; Harisinghani, Mukesh G.; Feldman, Adam S.; Mueller, Peter R.; Gazelle, G. Scott

2010-01-01

Purpose: To evaluate the effectiveness, cost, and cost-effectiveness of using renal mass biopsy to guide treatment decisions for small incidentally detected renal tumors. Materials and Methods: A decision-analytic Markov model was developed to estimate life expectancy and lifetime costs for patients with small (≤4-cm) renal tumors. Two strategies were compared: renal mass biopsy to triage patients to surgery or imaging surveillance and empiric nephron-sparing surgery. The model incorporated biopsy performance, the probability of track seeding with malignant cells, the prevalence and growth of benign and malignant tumors, treatment effectiveness and costs, and patient outcomes. An incremental cost-effectiveness analysis was performed to identify strategy preference under a willingness-to-pay threshold of $75 000 per quality-adjusted life-year (QALY). Effects of changes in key parameters on strategy preference were evaluated in sensitivity analysis. Results: Under base-case assumptions, the biopsy strategy yielded a minimally greater quality-adjusted life expectancy (4 days) than did empiric surgery at a lower lifetime cost ($3466), dominating surgery from a cost-effectiveness perspective. Over the majority of parameter ranges tested in one-way sensitivity analysis, the biopsy strategy dominated surgery or was cost-effective relative to surgery based on a $75 000-per-QALY willingness-to-pay threshold. In two-way sensitivity analysis, surgery yielded greater life expectancy when the prevalence of malignancy and propensity for biopsy-negative cancers to metastasize were both higher than expected or when the sensitivity and specificity of biopsy were both lower than expected. Conclusion: The use of biopsy to guide treatment decisions for small incidentally detected renal tumors is cost-effective and can prevent unnecessary surgery in many cases. © RSNA, 2010 Supplemental material: http://radiology.rsna.org/lookup/suppl/doi:10.1148/radiol.10092013/-/DC1 PMID:20720070

Likelihood of Incomplete Kidney Tumor Ablation with Radio Frequency Energy: Degree of Enhancement Matters.

PubMed

Lay, Aaron H; Stewart, Jeremy; Canvasser, Noah E; Cadeddu, Jeffrey A; Gahan, Jeffrey C

2016-07-01

Larger size and clear cell histopathology are associated with worse outcomes for malignant renal tumors treated with radio frequency ablation. We hypothesize that greater tumor enhancement may be a risk factor for radio frequency ablation failure due to increased vascularity. A retrospective review of patients who underwent radio frequency ablation for renal tumors with contrast enhanced imaging available was performed. The change in Hounsfield units (HU) of the tumor from the noncontrast phase to the contrast enhanced arterial phase was calculated. Radio frequency ablation failure rates for biopsy confirmed malignant tumors were compared using the chi-squared test. Multivariate logistic analysis was performed to assess predictive variables for radio frequency ablation failure. Disease-free survival was calculated using Kaplan-Meier analysis. A total of 99 patients with biopsy confirmed malignant renal tumors and contrast enhanced imaging were identified. The incomplete ablation rate was significantly lower for tumors with enhancement less than 60 vs 60 HU or greater (0.0% vs 14.6%, p=0.005). On multivariate logistic regression analysis tumor enhancement 60 HU or greater (OR 1.14, p=0.008) remained a significant predictor of incomplete initial ablation. The 5-year disease-free survival for size less than 3 cm was 100% vs 69.2% for size 3 cm or greater (p <0.01), while 5-year disease-free survival for HU change less than 60 was 100% vs 92.4% for HU change 60 or greater (p=0.24). Biopsy confirmed malignant renal tumors, which exhibit a change in enhancement of 60 HU or greater, experience a higher rate of incomplete initial tumor ablation than tumors with enhancement less than 60 HU. Size 3 cm or greater portends worse 5-year disease-free survival after radio frequency ablation. The degree of enhancement should be considered when counseling patients before radio frequency ablation. Copyright © 2016 American Urological Association Education and Research, Inc. Published by Elsevier Inc. All rights reserved.

Deterministic Evolutionary Trajectories Influence Primary Tumor Growth: TRACERx Renal.

PubMed

Turajlic, Samra; Xu, Hang; Litchfield, Kevin; Rowan, Andrew; Horswell, Stuart; Chambers, Tim; O'Brien, Tim; Lopez, Jose I; Watkins, Thomas B K; Nicol, David; Stares, Mark; Challacombe, Ben; Hazell, Steve; Chandra, Ashish; Mitchell, Thomas J; Au, Lewis; Eichler-Jonsson, Claudia; Jabbar, Faiz; Soultati, Aspasia; Chowdhury, Simon; Rudman, Sarah; Lynch, Joanna; Fernando, Archana; Stamp, Gordon; Nye, Emma; Stewart, Aengus; Xing, Wei; Smith, Jonathan C; Escudero, Mickael; Huffman, Adam; Matthews, Nik; Elgar, Greg; Phillimore, Ben; Costa, Marta; Begum, Sharmin; Ward, Sophia; Salm, Max; Boeing, Stefan; Fisher, Rosalie; Spain, Lavinia; Navas, Carolina; Grönroos, Eva; Hobor, Sebastijan; Sharma, Sarkhara; Aurangzeb, Ismaeel; Lall, Sharanpreet; Polson, Alexander; Varia, Mary; Horsfield, Catherine; Fotiadis, Nicos; Pickering, Lisa; Schwarz, Roland F; Silva, Bruno; Herrero, Javier; Luscombe, Nick M; Jamal-Hanjani, Mariam; Rosenthal, Rachel; Birkbak, Nicolai J; Wilson, Gareth A; Pipek, Orsolya; Ribli, Dezso; Krzystanek, Marcin; Csabai, Istvan; Szallasi, Zoltan; Gore, Martin; McGranahan, Nicholas; Van Loo, Peter; Campbell, Peter; Larkin, James; Swanton, Charles

2018-04-19

The evolutionary features of clear-cell renal cell carcinoma (ccRCC) have not been systematically studied to date. We analyzed 1,206 primary tumor regions from 101 patients recruited into the multi-center prospective study, TRACERx Renal. We observe up to 30 driver events per tumor and show that subclonal diversification is associated with known prognostic parameters. By resolving the patterns of driver event ordering, co-occurrence, and mutual exclusivity at clone level, we show the deterministic nature of clonal evolution. ccRCC can be grouped into seven evolutionary subtypes, ranging from tumors characterized by early fixation of multiple mutational and copy number drivers and rapid metastases to highly branched tumors with >10 subclonal drivers and extensive parallel evolution associated with attenuated progression. We identify genetic diversity and chromosomal complexity as determinants of patient outcome. Our insights reconcile the variable clinical behavior of ccRCC and suggest evolutionary potential as a biomarker for both intervention and surveillance. Copyright © 2018 Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

Leiomyosarcoma of the Inferior Vena Cava - Radical Resection, Vascular Reconstruction and Challenges: A Case Report and Review of Relevant Literature

PubMed Central

Biswas, Saptarshi; Amin, Arpit; Chaudry, Suhaib; Joseph, Saju

2013-01-01

Leiomyosarcomas of the inferior Vena Cava (IVC) are rare soft tissue sarcomas accounting for only 0.5% of all soft tissue sarcomas in adults with fewer than 300 cases reported. Extraluminal tumor growth along the adventitia of the IVC seems to be the common presentation. Intraluminal tumor growth is rare. The origin of the tumor is divided into three levels in relation to the hepatic and renal veins. The presentations and surgical modalities vary accordingly. Retroperitoneal tumors are often not diagnosed until the disease is at an advanced stage with large tumor growth and involvement of surrounding structures. This is partly because of the nonspecific clinical presentation as well as absence of early symptoms. Most patients present with abdominal or flank pain. Symptoms vary according to the dimensions of the tumor, growth pattern and localization of the tumor. Radical en bloc resection of the affected venous segment remains the only therapeutic option associated with prolonged survival. The goals of surgical management of these tumors include the achievement of local tumor control, maintenance of caval flow, and the prevention of recurrence. The involvement of renal or hepatic veins determines the strategy for vascular reconstruction. Reconstruction of the IVC is not always required, because gradual occlusion of the IVC allows the development of venous collaterals. However, when pararenal leiomyosarcoma of the IVC is present, reconstruction of the IVC and the renal vein is necessary to prevent transient or permanent renal dysfunction. Recent study has shown that radical surgery combined with adjuvant multimodal therapy has improved the cumulative survival rate. We report a case of IVC leiomyosarcoma in a young healthy woman along with details of its diagnostic workup and discussion of the surgical options and reconstruction of caval continuity. PMID:29147340

C3 Vertebral Metastases From Tongue Adenoid Cystic Carcinoma: A Rare Case Report.

PubMed

Feng, Helin; Wang, Jin; Guo, Peng; Xu, Jianfa; Feng, Jiangang

2015-07-01

We report a rare case involving a patient with C3 vertebral body metastasis secondary to adenoid cystic carcinoma of the tongue.Five years after local resection of the primary tumor, magnetic resonance imaging showed a metastasis located in the left posterior border of the C3 vertebral body. Additionally, multiple pulmonary metastases were identified by computed tomography. Based on these findings, the patient underwent C2-3, C3-4 discectomy; C3 corpectomy; and titanium mesh fusion with a Zephir plate. The diagnosis was confirmed by the pathology findings. During 6 months of follow-up, the patient showed improvement and return of function of the cervical vertebrae, with no serious complications.Because of the scarcity of cases of vertebral metastases from tumors of the tongue in the literature, we have reported this case to add to the available evidence regarding this rarely encountered condition.

A Type I first branchial cleft cyst masquerading as a parotid tumor.

PubMed

Krishnamurthy, Arvind; Ramshanker, Vijayalakshmi

2014-01-01

Branchial cleft anomalies are caused by incomplete regression of the cervical sinus of "His" during the 6(th) and 7(th) weeks of embryologic development. Although congenital in origin, first branchial cleft cysts (FBCCs) can present later in life. FBCCs are rare causes of parotid swellings, accounting for <1% of all the branchial cleft abnormalities. The diagnosis of FBCCs is a clinical challenge; the condition is often overlooked and mismanaged. We report a case of Type 1 FBCC in a 22-year-old female with an asymptomatic 3.5 cm × 2.5 cm sized cystic mass. It was removed completely under the impression of a cystic tumor of the parotid. On histopathology, the cyst had a squamous epithelium-lined wall with lymphoid aggregation which was characteristic of a branchial cleft cyst. A good understanding of the regional anatomy and embryology can lead to an early diagnosis and thereby effective management of FBCC.

OK-432 injection therapy for cystadenocarcinoma of the parotid gland: A case report.

PubMed

Makiyama, Kiyoshi; Hirai, Ryoji; Iikuni, Fusako; Ikeda, Atsuo; Tomomatsu, Hirotaka

2016-01-01

OK-432 is an immunomodulator that has been reported to be efficacious as an injection therapy for cervical lymphomas and ranulas. We performed OK-432 injection therapy to treat a cystadenocarcinoma of the parotid gland in a 72-year-old man. The 50 × 46-mm tumor was located in the deep lobe of the gland. The tumor had compressed the glossopharyngeal, vagus, and hypoglossal nerves, causing neurally mediated syncope, hoarseness, dysphagia, and dysarthria. A concentration of 5 KE/2 ml of OK-432 was injected. Within 2 months, the cyst had disappeared; no recurrence was apparent during 59 months of follow-up. To the best of our knowledge, no previous report has described injection of OK-432 for malignant cystic disease. We describe the injection method, injection dose, and postinjection course in the hope that this information will prove useful for future applications against malignant cystic disease.

Stereotaxic gamma knife surgery in treatment of critically located pilocytic astrocytoma: preliminary result

PubMed Central

Hafez, Raef FA

2007-01-01

Background Low-grade gliomas are uncommon primary brain tumors, located more often in the posterior fossa, optic pathway, and brain stem and less commonly in the cerebral hemispheres. Case presentations Two patients with diagnosed recurrent cystic pilocytic astrocytoma critically located within the brain (thalamic and brain stem) were treated with gamma knife surgery. Gamma knife surgery (GKS) did improve the patient's clinical condition very much which remained stable later on. Progressive reduction on the magnetic resonance imaging (MRI) studies of the solid part of the tumor and almost disappearance of the cystic component was achieved within the follow-up period of 36 months in the first case with the (thalamic located lesion) and 22 months in the second case with the (brain stem located lesion). Conclusion Gamma knife surgery represents an alternate tool in the treatment of recurrent and/or small postoperative residual pilocytic astrocytoma especially if they are critically located PMID:17394660

Adenoid cystic carcinoma of breast: Recent advances

PubMed Central

Miyai, Kosuke; Schwartz, Mary R; Divatia, Mukul K; Anton, Rose C; Park, Yong Wook; Ayala, Alberto G; Ro, Jae Y

2014-01-01

Adenoid cystic carcinoma (ACC) of the breast is a rare special subtype of breast cancer characterized by the presence of a dual cell population of luminal and basaloid cells arranged in specific growth patterns. Most breast cancers with triple-negative, basal-like breast features (i.e., tumors that are devoid of estrogen receptor, progesterone receptor, and human epidermal growth factor receptor 2 expression, and express basal cell markers) are generally high-grade tumors with an aggressive clinical course. Conversely, while ACCs also display a triple-negative, basal-like phenotype, they are usually low-grade and exhibit an indolent clinical behavior. Many discoveries regarding the molecular and genetic features of the ACC, including a specific chromosomal translocation t(6;9) that results in a MYB-NFIB fusion gene, have been made in recent years. This comprehensive review provides our experience with the ACC of the breast, as well as an overview of clinical, histopathological, and molecular genetic features. PMID:25516849

A laparoscopic approach to treating torsion of a nonpregnant uterus accompanied by a large ovarian cyst in a premenarchal girl.

PubMed

Dutra, Robson Azevedo; Perez-Bóscollo, Adriana Cartafina; Ribeiro, Fernanda Cristina Silva Alves; Vietez, Nádia Bicego

2008-03-01

A 10-year-old premenarchal girl was admitted to our hospital with moderate abdominal pain, although presenting no vomiting or abdominal rebound tenderness. A large abdominal mass was visible and palpable in the periumbilical and epigastric regions. Results of physical examination revealed that the general health status was satisfactory. Computed tomographic scan revealed a large, thin-walled cyst occupying nearly the entire peritoneal cavity. The other viscera were of normal aspect. A laparoscopic approach revealed a left ovarian cystic tumor that was twisted 360 degrees in conjunction with the uterine corpus with hemorrhagic infarction. A partial hysterectomy and a left salpingo-oophorectomy were carried out. The tumor was classified as mature cystic teratoma of the ovary accompanied by hemorrhagic necrosis, not only of the cyst but also of the left uterine tube and the uterine corpus.

Effects of TORC1 Inhibition during the Early and Established Phases of Polycystic Kidney Disease

PubMed Central

Ta, Michelle H. T.; Schwensen, Kristina G.; Foster, Sheryl; Korgaonkar, Mayuresh; Ozimek-Kulik, Justyna E.; Phillips, Jacqueline K.; Peduto, Anthony; Rangan, Gopala K.

2016-01-01

The disease-modifying effects of target of rapamycin complex 1 (TORC1) inhibitors during different stages of polycystic kidney disease (PKD) are not well defined. In this study, male Lewis Polycystic Kidney Disease (LPK) rats (a genetic ortholog of human NPHP9, phenotypically characterised by diffuse distal nephron cystic growth) and Lewis controls received either vehicle (V) or sirolimus (S, 0.2 mg/kg by intraperitoneal injection 5 days per week) during the early (postnatal weeks 3 to 10) or late stages of disease (weeks 10 to 20). In early-stage disease, sirolimus reduced kidney enlargement (by 63%), slowed the rate of increase in total kidney volume (TKV) in serial MRI by 78.2% (LPK+V: 132.3±59.7 vs. LPK+S: 28.8±12.0% per week) but only partly reduced the percentage renal cyst area (by 19%) and did not affect the decline in endogenous creatinine clearance (CrCl) in LPK rats. In late-stage disease, sirolimus reduced kidney enlargement (by 22%) and the rate of increase in TKV by 71.8% (LPK+V: 13.1±6.6 vs. LPK+S: 3.7±3.7% per week) but the percentage renal cyst area was unaltered, and the CrCl only marginally better. Sirolimus reduced renal TORC1 activation but not TORC2, NF-κB DNA binding activity, CCL2 or TNFα expression, and abnormalities in cilia ultrastructure, hypertension and cardiac disease were also not improved. Thus, the relative treatment efficacy of TORC1 inhibition on kidney enlargement was consistent at all disease stages, but the absolute effect was determined by the timing of drug initiation. Furthermore, cystic microarchitecture, renal function and cardiac disease remain abnormal with TORC1 inhibition, indicating that additional approaches to normalise cellular dedifferentiation, inflammation and hypertension are required to completely arrest the progression of PKDs. PMID:27723777

Pharmacokinetic modelling of intravenous tobramycin in adolescent and adult patients with cystic fibrosis using the nonparametric expectation maximization (NPEM) algorithm.

PubMed

Touw, D J; Vinks, A A; Neef, C

1997-06-01

The availability of personal computer programs for individualizing drug dosage regimens has stimulated the interest in modelling population pharmacokinetics. Data from 82 adolescent and adult patients with cystic fibrosis (CF) who were treated with intravenous tobramycin because of an exacerbation of their pulmonary infection were analysed with a non-parametric expectation maximization (NPEM) algorithm. This algorithm estimates the entire discrete joint probability density of the pharmacokinetic parameters. It also provides traditional parametric statistics such as the means, standard deviation, median, covariances and correlations among the various parameters. It also provides graphic-2- and 3-dimensional representations of the marginal densities of the parameters investigated. Several models for intravenous tobramycin in adolescent and adult patients with CF were compared. Covariates were total body weight (for the volume of distribution) and creatinine clearance (for the total body clearance and elimination rate). Because of lack of data on patients with poor renal function, restricted models with non-renal clearance and the non-renal elimination rate constant fixed at literature values of 0.15 L/h and 0.01 h-1 were also included. In this population, intravenous tobramycin could be best described by median (+/-dispersion factor) volume of distribution per unit of total body weight of 0.28 +/- 0.05 L/kg, elimination rate constant of 0.25 +/- 0.10 h-1 and elimination rate constant per unit of creatinine clearance of 0.0008 +/- 0.0009 h-1/(ml/min/1.73 m2). Analysis of populations of increasing size showed that using a restricted model with a non-renal elimination rate constant fixed at 0.01 h-1, a model based on a population of only 10 to 20 patients, contained parameter values similar to those of the entire population and, using the full model, a larger population (at least 40 patients) was needed.

Solid pseudopapillary neoplasm of the pancreas: CT imaging features and radiologic-pathologic correlation.

PubMed

Anil, Gopinathan; Zhang, Junwei; Al Hamar, Nawal Ebrahim; Nga, Min En

2017-01-01

We aimed to evaluate the imaging features of solid pseudopapillary neoplasm (SPN) of the pancreas with an emphasis on radiologic-pathologic correlation. Ten patients (all female; mean age, 32 years) with histologic or cytologic diagnosis of SPN encountered between January 2007 and December 2013 were included in this study. Preoperative computed tomography (CT) images were reviewed for location, attenuation, enhancement pattern, margin, shape, size, morphology, presence of capsule and calcification. CT appearances were correlated with histopathologic findings. Tumors in the distal pancreatic body and tail had a tendency to be larger (mean size 12.6 cm vs. 4.0 cm). Six of the nine tumors that were resected had a fibrous pseudocapsule at histology, five of which could be identified on CT scan. Eight lesions had mixed hypoenhancing solid components and cystic areas corresponding to tumor necrosis and hemorrhage. The two smallest lesions were purely solid and nonencapsulated. Varied patterns of calcification were seen in four tumors. Three of the four pancreatic tail tumors invaded the spleen. At a median follow-up of 53 months, there was no evidence of recurrence in the nine patients who underwent surgical resection of the tumor. A mixed solid and cystic pancreatic mass in a young woman is suggestive of SPN. However, smaller lesions may be completely solid. Splenic invasion can occur in pancreatic tail SPNs; however, in this series it did not adversely affect the long-term outcome.

[Radical Resection of Huge Gastrointestinal Stromal Tumor of the Stomach Following Neoadjuvant Chemotherapy with lmatinib - ACase Report].

PubMed

Hiraki, Yoko; Kato, Hiroaki; Shiraishi, Osamu; Tanaka, Yumiko; Iwama, Mitsuru; Yasuda, Atsushi; Shinkai, Masayuki; Kimura, Yutaka; Imano, Motohiro; Imamoto, Haruhiko; Yasuda, Takushi

2017-11-01

The usefulness and safety of imatinibfor neoadjuvant chemotherapy for resectable gastrointestinal stromal tumor(GIST) has not been established. We reported a case of a huge GIST of the stomach that was safely resected following preoperative imatinibtherapy. A 69-year-old man was hospitalized with abdominal fullness which increased rapidly from a month ago. A CT scan showed a huge tumor containing solid and cystic component which was accompanied by an extra-wall nodule. The tumor was strongly suspected to be originated from the stomach and EUS-FNA revealed GIST. We diagnosed GIST of the stomach and initiated preoperative adjuvant chemotherapy with imatinib because there was a risk for the break of tumor capsule and composite resection of the other organs without prior chemotherapy. After the administration of imatinib4 00 mg/day for 6months, the solid component was decreased in size and its' activity by PET-CT had declined, but the size of the cystic component was not changed and the patient's complaint of fullness was not reduced. Then, after a week cessation of imatinib, we performed surgical removal of the tumor with partial gastrectomy without surgical complication during and after the operation. Imatinibwas resumed 2 weeks later postoperatively and 1 year and 8 months has passed since the operation without recurrence. Neoadjuvant chemotherapy with imatinibhas the potential to become an important therapeutic option for the treatment of huge GISTs.

Microvesicles released from human renal cancer stem cells stimulate angiogenesis and formation of lung premetastatic niche.

PubMed

Grange, Cristina; Tapparo, Marta; Collino, Federica; Vitillo, Loriana; Damasco, Christian; Deregibus, Maria Chiara; Tetta, Ciro; Bussolati, Benedetta; Camussi, Giovanni

2011-08-01

Recent studies suggest that tumor-derived microvesicles (MV) act as a vehicle for exchange of genetic information between tumor and stromal cells, engendering a favorable microenvironment for cancer development. Within the tumor mass, all cell types may contribute to MV shedding, but specific contributions to tumor progression have yet to be established. Here we report that a subset of tumor-initiating cells expressing the mesenchymal stem cell marker CD105 in human renal cell carcinoma releases MVs that trigger angiogenesis and promote the formation of a premetastatic niche. MVs derived only from CD105-positive cancer stem cells conferred an activated angiogenic phenotype to normal human endothelial cells, stimulating their growth and vessel formation after in vivo implantation in immunocompromised severe combined immunodeficient (SCID) mice. Furthermore, treating SCID mice with MVs shed from CD105-positive cells greatly enhanced lung metastases induced by i.v. injection of renal carcinoma cells. Molecular characterization of CD105-positive MVs defines a set of proangiogenic mRNAs and microRNAs implicated in tumor progression and metastases. Our results define a specific source of cancer stem cell-derived MVs that contribute to triggering the angiogenic switch and coordinating metastatic diffusion during tumor progression.

The effects of RNA interference mediated VEGF gene silencing on biological behavior of renal cell carcinoma and transplanted renal tumor in nude mice.

PubMed

Wang, Qi; Wang, Shuai; Sun, Si-Qiao; Cheng, Zhi-Hua; Zhang, Yang; Chen, Guang; Gu, Meng; Yao, Hai-Jun; Wang, Zhong; Zhou, Juan; Peng, Yu-Bing; Xu, Ming-Xi; Zhang, Ke; Sun, Xi-Wei

2016-01-01

This study was to explore the effects of RNA interference mediated vascular endothelial growth factor (VEGF) gene silencing on biological behavior of renal cell carcinoma (RCC), transplanted renal tumor and angiogenesis in nude mice. The specific siRNA sequence targeting VEGF were designed and synthesized to construct hVEGF-siRNA plasmid which was transfected into RCC 786-O cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) was used for the detection of VEGF gene expression and western blot was adopted for the examination of VEGF protein expression. The 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was used to detect cell growth as well as cell migration and invasion. The transplanted renal tumor models in nude mice were established, and the growth condition of nude mice, and VEGF protein expression in transplanted tumor slices and the microvessel density (MVD) were detected. The expression level of VEGF mRNA in VEGF-siRNA group was significant lower than that in the control group and negative group, suggesting that establishment of plasmid specifically inhibited the expression of VEGF gene The expression level of VEGF protein in VEGF-siRNA group was significant lower than that in the control group and negative group. VEGF gene silencing has the significant inhibition effects on proliferation, migration and invasion of RCC 786-O cells. The tumor weight, VEGF protein positive rate and MVD in VEGF-siRNA group were significant lower than those in negative group and blank group. The VEGF gene silencing could inhibit the cell proliferation, migration and invasion of RCC 786-O cells; inhibition of VEGF protein expression could prevent transplanted RCC growth and tumor angiogenesis.

Deregulation of energetic metabolism in the clear cell renal cell carcinoma: A multiple pathway analysis based on microarray profiling.

PubMed

Soltysova, Andrea; Breza, Jan; Takacova, Martina; Feruszova, Jana; Hudecova, Sona; Novotna, Barbora; Rozborilova, Eva; Pastorekova, Silvia; Kadasi, Ludevit; Krizanova, Olga

2015-07-01

Clear cell renal cell carcinoma (ccRCC) is the most frequent type of kidney cancer. In order to better understand the biology of ccRCC, we accomplished the gene profiling of fresh tissue specimens from 11 patients with the renal tumors (9 ccRCCs, 1 oncocytoma and 1 renal B-lymphoma), in which the tumor-related data were compared to the paired healthy kidney tissues from the same patients. All ccRCCs exhibited a considerably elevated transcription of the gene coding for carbonic anhydrase IX (CAIX). Moreover, the ccRCC tumors consistently displayed increased expression of genes encoding the glycolytic pathway enzymes, e.g. hexokinase II (HK2) and lactate dehydrogenase A (LDHA) and a decreased expression of genes for the mitochondrial electron transport chain components, indicating an overall reprogramming of the energetic metabolism in this tumor type. This appears to be accompanied by altered expression of the genes of the pH regulating machinery, including ion and lactate transporters. Immunohistochemical staining of tumor tissue sections confirmed the increased expression of CAIX, HK2 and LDHA in ccRCC, validating the microarray data and supporting their potential as the energetic metabolism-related biomarkers of the ccRCC.

Stent revascularization restores cortical blood flow and reverses tissue hypoxia in atherosclerotic renal artery stenosis but fails to reverse inflammatory pathways or glomerular filtration rate.

PubMed

Saad, Ahmed; Herrmann, Sandra M S; Crane, John; Glockner, James F; McKusick, Michael A; Misra, Sanjay; Eirin, Alfonso; Ebrahimi, Behzad; Lerman, Lilach O; Textor, Stephen C

2013-08-01

Atherosclerotic renal artery stenosis (ARAS) is known to reduce renal blood flow, glomerular filtration rate (GFR) and amplify kidney hypoxia, but the relationships between these factors and tubulointerstitial injury in the poststenotic kidney are poorly understood. The purpose of this study was to examine the effect of renal revascularization in ARAS on renal tissue hypoxia and renal injury. Inpatient studies were performed in patients with ARAS (n=17; >60% occlusion) before and 3 months after stent revascularization, or in patients with essential hypertension (n=32), during fixed Na(+) intake and angiotensin converting enzyme/angiotensin receptors blockers Rx. Single kidney cortical, medullary perfusion, and renal blood flow were measured using multidetector computed tomography, and GFR by iothalamate clearance. Tissue deoxyhemoglobin levels (R(2)*) were measured by blood oxygen level-dependent MRI at 3T, as was fractional kidney hypoxia (percentage of axial area with R(2)*>30/s). In addition, we measured renal vein levels of neutrophil gelatinase-associated lipocalin, monocyte chemoattractant protein-1, and tumor necrosis factor-α. Pre-stent single kidney renal blood flow, perfusion, and GFR were reduced in the poststenotic kidney. Renal vein neutrophil gelatinase-associated lipocalin, tumor necrosis factor-α, monocyte chemoattractant protein-1, and fractional hypoxia were higher in untreated ARAS than in essential hypertension. After stent revascularization, fractional hypoxia fell (P<0.002) with increased cortical perfusion and blood flow, whereas GFR and neutrophil gelatinase-associated lipocalin, monocyte chemoattractant protein-1, and tumor necrosis factor-α remained unchanged. These data demonstrate that despite reversal of renal hypoxia and partial restoration of renal blood flow after revascularization, inflammatory cytokines and injury biomarkers remained elevated and GFR failed to recover in ARAS. Restoration of vessel patency alone failed to reverse tubulointerstitial damage and partly explains the limited clinical benefit of renal stenting. These results identify potential therapeutic targets for recovery of kidney function in renovascular disease.

An Extract of Rhodobacter sphaeroides Reduces Cisplatin-Induced Nephrotoxicity in Mice

PubMed Central

Chang, Wen-Wei; Liu, Jau-Jin; Liu, Chi-Fan; Liu, Wen-Sheng; Lim, Yun-Ping; Cheng, Yu-Jung; Lee, Che-Hsin

2013-01-01

Cisplatin is used as a treatment for various types of solid tumors. Renal injury severely limits the use of cisplatin. Renal cell apoptosis, oxidative stress, and inflammation contribute to cisplatin-induced nephrotoxicity. Previously, we found that an extract of Rhodobacter sphaeroides (Lycogen™) inhibited proinflammatory cytokines and the production of nitric oxide in activated macrophages in a dextran sodium sulfate (DSS)-induced colitis model. Here, we evaluated the effect of Lycogen™, a potent anti-inflammatory agent, in mice with cisplatin-induced renal injury. We found that attenuated renal injury correlated with decreased apoptosis due to a reduction in caspase-3 expression in renal cells. Oral administration of Lycogen™ significantly reduced the expression of tumor necrosis factor-α and interleukin-1β in mice with renal injury. Lycogen™ reduces renal dysfunction in mice with cisplatin-induced renal injury. The protective effects of the treatment included blockage of the cisplatin-induced elevation in serum urea nitrogen and creatinine. Meanwhile, Lycogen™ attenuated body weight loss and significantly prolonged the survival of mice with renal injury. We propose that Lycogen™ exerts anti-inflammatory activities that represent a promising strategy for the treatment of cisplatin-induced renal injury. PMID:24335753

Tumor-Like Liver Abscess Mimicking Malignancy With Lung Metastases in a Patient With Acute Renal Failure: A Case Report.

PubMed

Wang, Chih Hsin; Sun, Cheuk-Kay; Jiang, Jiunn-Song; Tsai, Ming Hsien

2016-03-01

The worldwide incidence of Klebsiella pneumoniae liver abscess (KLA) is increasing. It is important to accurately diagnose this life-threatening disease to provide timely and appropriate treatment. Here we report the case of a 38-year-old man with acute renal failure and a tumor-like liver abscess and septic pulmonary embolism. Initially, his clinical symptoms, laboratory tests, and radiological findings presented equivocal results of malignancy with metastases. Fine needle aspiration of liver tumor was performed, which showed purulent material with a culture positive for K pneumoniae. KLA symptoms are atypical, and radiological findings may mimic a malignancy with tumor necrosis. In some circumstances, liver aspiration biopsy may be necessary to confirm the real etiology, leading to prompt and timely treatment. Moreover, we should be alert for the impression of KLA when facing a diabetic patient with liver mass lesion and acute renal failure.

Tumor-Like Liver Abscess Mimicking Malignancy With Lung Metastases in a Patient With Acute Renal Failure

PubMed Central

Wang, Chih Hsin; Sun, Cheuk-Kay; Jiang, Jiunn-Song; Tsai, Ming Hsien

2016-01-01

Abstract The worldwide incidence of Klebsiella pneumoniae liver abscess (KLA) is increasing. It is important to accurately diagnose this life-threatening disease to provide timely and appropriate treatment. Here we report the case of a 38-year-old man with acute renal failure and a tumor-like liver abscess and septic pulmonary embolism. Initially, his clinical symptoms, laboratory tests, and radiological findings presented equivocal results of malignancy with metastases. Fine needle aspiration of liver tumor was performed, which showed purulent material with a culture positive for K pneumoniae. KLA symptoms are atypical, and radiological findings may mimic a malignancy with tumor necrosis. In some circumstances, liver aspiration biopsy may be necessary to confirm the real etiology, leading to prompt and timely treatment. Moreover, we should be alert for the impression of KLA when facing a diabetic patient with liver mass lesion and acute renal failure. PMID:26986170

Osteomalacia-inducing renal clear cell carcinoma uncovered by 99mTc-Hydrazinonicotinyl-Tyr3-octreotide (99mTc-HYNIC-TOC) scintigraphy.

PubMed

Jin, Xiaona; Jing, Hongli; Li, Fang; Zhuang, Hongming

2013-11-01

Most osteomalacia-causing tumors are small, benign mesenchymal neoplasms, which are commonly located in the extremities or craniofacial regions. An 18-year-old male patient with suspicion of tumor-induced osteomalacia underwent (99m)Tc-HYNIC-TOC scintigraphy to search potential culprit tumor. The images showed a large activity in the region of the left kidney. The lesion was resected and a clear cell renal cell carcinoma was found. One year after the left nephrectomy, the patient was tumor-free without symptoms of osteomalacia.

Simvastatin With Topotecan and Cyclophosphamide in Relapsed and/or Refractory Pediatric Solid and CNS Tumors

ClinicalTrials.gov

2018-05-29

Retinoblastoma; Clear Cell Sarcoma; Renal Cell Carcinoma; Rhabdoid Tumor; Wilms Tumor; Hepatoblastoma; Neuroblastoma; Germ Cell Tumors; Ewings Sarcoma; Non-rhabdomyosarcoma Soft Tissue Sarcoma; Osteosarcoma; Rhabdomyosarcoma

Influence of ribosomal protein L39-L in the drug resistance mechanisms of lacrimal gland adenoid cystic carcinoma cells.

PubMed

Ye, Qing; Ding, Shao-Feng; Wang, Zhi-An; Feng, Jie; Tan, Wen-Bin

2014-01-01

Cancer constitutes a key pressure on public health regardless of the economy state in different countries. As a kind of highly malignant epithelial tumor, lacrimal gland adenoid cystic carcinoma can occur in any part of the body, such as salivary gland, submandibular gland, trachea, lung, breast, skin and lacrimal gland. Chemotherapy is one of the key treatment techniques, but drug resistance, especially MDR, seriously blunts its effects. As an element of the 60S large ribosomal subunit, the ribosomal protein L39-L gene appears to be documented specifically in the human testis and many human cancer samples of different origins. Total RNA of cultured drug-resistant and susceptible lacrimal gland adenoid cystic carcinoma cells was seperated, and real time quantitative RT-PCR were used to reveal transcription differences between amycin resistant and susceptible strains of lacrimal gland adenoid cystic carcinoma cells. Viability assays were used to present the amycin resistance difference in a RPL39-L transfected lacrimal gland adenoid cystic carcinoma cell line as compared to control vector and null-transfected lacrimal gland adenoid cystic carcinoma cell lines. The ribosomal protein L39-L transcription level was 6.5-fold higher in the drug-resistant human lacrimal gland adenoid cystic carcinoma cell line than in the susceptible cell line by quantitative RT-PCR analysis. The ribosomal protein L39-L transfected cells revealed enhanced drug resistance compared to plasmid vector-transfected or null-transfected cells as determined by methyl tritiated thymidine (3H-TdR) incorporation. The ribosomal protein L39-L gene could possibly have influence on the drug resistance mechanism of lacrimal gland adenoid cystic carcinoma cells.