Flow cytometry and real-time quantitative PCR as tools for assessing plasmid persistence.
Loftie-Eaton, Wesley; Tucker, Allison; Norton, Ann; Top, Eva M
2014-09-01
The maintenance of a plasmid in the absence of selection for plasmid-borne genes is not guaranteed. However, plasmid persistence can evolve under selective conditions. Studying the molecular mechanisms behind the evolution of plasmid persistence is key to understanding how plasmids are maintained under nonselective conditions. Given the current crisis of rapid antibiotic resistance spread by multidrug resistance plasmids, this insight is of high medical relevance. The conventional method for monitoring plasmid persistence (i.e., the fraction of plasmid-containing cells in a population over time) is based on cultivation and involves differentiating colonies of plasmid-containing and plasmid-free cells on agar plates. However, this technique is time-consuming and does not easily lend itself to high-throughput applications. Here, we present flow cytometry (FCM) and real-time quantitative PCR (qPCR) as alternative tools for monitoring plasmid persistence. For this, we measured the persistence of a model plasmid, pB10::gfp, in three Pseudomonas hosts and in known mixtures of plasmid-containing and -free cells. We also compared three performance criteria: dynamic range, resolution, and variance. Although not without exceptions, both techniques generated estimates of overall plasmid loss rates that were rather similar to those generated by the conventional plate count (PC) method. They also were able to resolve differences in loss rates between artificial plasmid persistence assays. Finally, we briefly discuss the advantages and disadvantages for each technique and conclude that, overall, both FCM and real-time qPCR are suitable alternatives to cultivation-based methods for routine measurement of plasmid persistence, thereby opening avenues for high-throughput analyses. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Hansen, Lars Hestbjerg; Ferrari, Belinda; Sørensen, Anders Hay; Veal, Duncan; Sørensen, Søren Johannes
2001-01-01
Combining the high specificity of bacterial biosensors and the resolution power of fluorescence-activated cell sorting (FACS) provided qualitative detection of oxytetracycline production by Streptomyces rimosus in soil microcosms. A plasmid containing a transcriptional fusion between the tetR-regulated Ptet promoter from Tn10 and a FACS-optimized gfp gene was constructed. When harbored by Escherichia coli, this plasmid produces large amounts of green fluorescent protein (GFP) in the presence of tetracycline. This tetracycline biosensor was used to detect the production of oxytetracycline by S. rimosus introduced into sterile soil. The tetracycline-induced GFP-producing biosensors were detected by FACS analysis, enabling the detection of oxytetracycline encounters by single biosensor cells. This approach can be used to study interactions between antibiotic producers and their target organisms in soil. PMID:11133451
Efficient production of antibody Fab fragment by transient gene expression in insect cells.
Mori, Keita; Hamada, Hirotsugu; Ogawa, Takafumi; Ohmuro-Matsuyama, Yuki; Katsuda, Tomohisa; Yamaji, Hideki
2017-08-01
Transient gene expression allows a rapid production of diverse recombinant proteins in early-stage preclinical and clinical developments of biologics. Insect cells have proven to be an excellent platform for the production of functional recombinant proteins. In the present study, the production of an antibody Fab fragment by transient gene expression in lepidopteran insect cells was investigated. The DNA fragments encoding heavy-chain (Hc; Fd fragment) and light-chain (Lc) genes of an Fab fragment were individually cloned into the plasmid vector pIHAneo, which contained the Bombyx mori actin promoter downstream of the B. mori nucleopolyhedrovirus (BmNPV) IE-1 transactivator and the BmNPV HR3 enhancer for high-level expression. Trichoplusia ni BTI-TN-5B1-4 (High Five) cells were co-transfected with the resultant plasmid vectors using linear polyethyleneimine. When the transfection efficiency was evaluated, a plasmid vector encoding an enhanced green fluorescent protein (EGFP) gene was also co-transfected. Transfection and culture conditions were optimized based on both the flow cytometry of the EGFP expression in transfected cells and the yield of the secreted Fab fragments determined by enzyme-linked immunosorbent assay (ELISA). Under optimal conditions, a yield of approximately 120 mg/L of Fab fragments was achieved in 5 days in a shake-flask culture. Transient gene expression in insect cells may offer a promising approach to the high-throughput production of recombinant proteins. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
A novel fluorescent sensor for measurement of CFTR function by flow cytometry.
Vijftigschild, Lodewijk A W; van der Ent, Cornelis K; Beekman, Jeffrey M
2013-06-01
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis. CFTR-dependent iodide transport measured by fluorescent quenching of ectopically expressed halide-sensitive yellow fluorescent protein (YFP) is widely being used to study CFTR function by microscopy or plate readers. Since YFP fluorescence in these systems is dependent on YFP expression levels and iodide concentration, differences in sensor expression level between experimental units are normalized at the start of each experiment. To allow accurate measurement of CFTR function by flow cytometry, we reasoned that co-expression of an iodide insensitive fluorescent protein would allow for normalization of sensor expression levels and more accurate quantification of CFTR function. Our data indicated that dsRed and mKate fluorescence are iodide insensitive, and we determined an optimal format for co-expression of these fluorescent proteins with halide-sensitive YFP. We showed using microscopy that ratiometric measurement (YFP/mKate) corrects for differences in sensor expression levels. Ratiometric measurements were essential to accurately measure CFTR function by flow cytometry that we here describe for the first time. Mixing of wild type or mutant CFTR expressing cells indicated that addition of approximately 10% of wild type CFTR expressing cells could be distinguished by ratiometric YFP quenching. Flow cytometric ratiometric YFP quenching also allowed us to study CFTR mutants associated with differential residual function upon ectopic expression. Compared with conventional plate-bound CFTR function assays, the flow cytometric approach described here can be used to study CFTR function in suspension cells. It may be further adapted to study CFTR function in heterologous cell populations using cell surface markers and selection of cells that display high CFTR function by cell sorting. Copyright © 2013 International Society for Advancement of Cytometry.
Expression Plasmids for Use in Candida glabrata
Zordan, Rebecca E.; Ren, Yuxia; Pan, Shih-Jung; Rotondo, Giuseppe; Peñas, Alejandro De Las; Iluore, Joseph; Cormack, Brendan P.
2013-01-01
We describe a series of CEN/ARS episomal plasmids containing different Candida glabrata promoters, allowing for a range of constitutive or regulated expression of proteins in C. glabrata. The set of promoters includes three constitutive promoters (EGD2pr, HHT2pr, PDC1pr), two macrophage/phagocytosis-induced promoters (ACO2pr, LYS21pr), and one nutritionally regulated promoter (MET3pr). Each promoter was cloned into two plasmid backbones that differ in their selectable marker, URA3, or the dominant-selectable NAT1 gene, which confers resistance to the drug nourseothricin. Expression from the 12 resulting plasmids was assessed using GFP as a reporter and flow cytometry or quantitative reverse-transcription polymerase chain reaction to assess expression levels. Together this set of plasmids expands the toolkit of expression vectors available for use with C. glabrata. PMID:23934995
Maslennikova, I L; Kuznetsova, M V; Toplak, N; Nekrasova, I V; Žgur Bertok, D; Starčič Erjavec, M
2018-05-07
The efficiency of the bacteriocin, colicin ColE7, bacterial conjugation-based "kill" - "anti-kill" antimicrobial system, was assessed using real-time PCR, flow cytometry and bioluminescence. The ColE7 antimicrobial system consists of the genetically modified Escherichia coli strain Nissle 1917 harbouring a conjugative plasmid (derivative of the F-plasmid) encoding the "kill" gene (ColE7 activity gene) and a chromosomally encoded "anti-kill" gene (ColE7 immunity gene). On the basis of traJ gene expression in the killer donor cells, our results showed that the efficiency of the here studied antimicrobial system against target E. coli was higher at 4 than at 24 h. Flow cytometry was used to indirectly estimate DNase activity of the antimicrobial system, as lysis of target E. coli cells in the conjugative mixture with the killer donor strain led to reduction in cell cytosol fluorescence. According to a lux assay, E. coli TG1 (pXen lux + Ap r ) with constitutive luminescence were killed already after 2 h of treatment. Target sensor E. coli C600 with DNA damage SOS-inducible luminescence showed significantly lower SOS induction 6 and 24 h following treatment with the killer donor strain. Our results thus showed that bioluminescent techniques are quick and suitable for estimation of the ColE7 bacterial conjugation-based antimicrobial system antibacterial activity. Bacterial antimicrobial resistance is worldwide rising and causing deaths of thousands of patients infected with multi-drug resistant bacterial strains. In addition, there is a lack of efficient alternative antimicrobial agents. The significance of our research is the use of a number of methods (real-time PCR, flow cytometry and bioluminescence-based technique) to assess the antibacterial activity of the bacteriocin, colicin ColE7, bacterial conjugation-based "kill" - "anti-kill" antimicrobial system. Bioluminescent techniques proved to be rapid and suitable for estimation of antibacterial activity of ColE7 bacterial conjugation-based antimicrobial system and possibly other related systems. © 2018 The Society for Applied Microbiology.
Hunt, Michelle A.; Currie, Margaret J.; Robinson, Bridget A.; Dachs, Gabi U.
2010-01-01
Primary cells, such as HUVEC, are notoriously difficult to transfect and are susceptible to the toxic effects of transfection reagents. A transfection reagent with a high transfection efficiency and low cytotoxicity was sought to retain sufficient viability of transfected HUVEC for subsequent assays. Nine chemical transfection reagents, currently commercially available, were compared for their ability to transfect HUVEC in vitro. A plasmid expressing the enhanced GFP (EGFP) was used for transfection, followed by flow cytometry of transfected HUVEC to determine the proportion of EGFP-expressing cells as a measure of transfection efficiency. Lipofectamine 2000 and Lipofectamine LTX (Invitrogen, Carlsbad, CA, USA) gave the highest transfection efficiencies of the reagents tested. Lipofectamine LTX was identified as the optimal transfection reagent as a result of its higher transfection efficiency at shorter periods of time following transfection when cytotoxicity was limited, allowing sufficient yield of transfected HUVEC for use in subsequent assays. PMID:20592869
ELF5 in epithelial ovarian carcinoma tissues and biological behavior in ovarian carcinoma cells.
Yan, Hongchao; Qiu, Linglin; Xie, Xiaolei; Yang, He; Liu, Yongli; Lin, Xiaoman; Huang, Hongxiang
2017-03-01
The expression of E74-like factor 5 (ELF5) in epithelial ovarian carcinoma tissues and its effects on biological behavior in ovarian carcinoma cells were assessed in search for a new approach for gene treatment of epithelial ovarian carcinoma. RT-PCR technology was applied to detect the expression of ELF5 mRNA in epithelial ovarian carcinoma (n=49), borderline ovarian epithelial tumor (n=19), benign ovarian epithelial tumor (n=31) and normal ovarian tissues (n=40). Then, we transfected recombinant plasmid pcDNA3.1‑ELF5+EGFP into human ovarian carcinoma SKOV3 cells (recombinant plasmid group) in vitro and screened out stably transfected cells to conduct multiplication culture. Western blot analysis was performed to detect the expression of ELF5 protein in the different groups. Flow cytometry was employed to detect cell apoptosis and cycles. ELF5 mRNA in epithelial ovarian carcinoma and borderline ovarian epithelial tumor tissues were significantly lower (P<0.05) than those in benign ovarian epithelial tumor and normal ovarian tissues. ELF5 protein expression in the cells of recombinant plasmid group was significantly higher compared with empty plasmid and blank control groups. The capacity of cell reproductive recombinant plasmid group at each time point decreased (P<0.05). Flow cytometry detection showed that 67.03% of cells in recombinant plasmid group was blocked in G0/G1 phase (P<0.05), compared with empty plasmid group (37.17%) and blank control group (38.24%). Apoptotic rate of recombinant plasmid group was significantly lower (31.4±1.9%; P<0.05), compared with that of empty plasmid group (9.1±2.2%) and blank control group (8.7±1.5%), and the differences were statistically significant. In conclusion, ELF5 interfered with cell cycle of human ovarian carcinoma SKOV3 cells and promoted apoptosis of human ovarian carcinoma SKOV3 cells inhibiting their growth and invasive capacity; and thus providing a new approach to gene treatment of ovarian carcinoma.
Lab-on-Chip Cytometry Based on Magnetoresistive Sensors for Bacteria Detection in Milk
Fernandes, Ana C.; Duarte, Carla M.; Cardoso, Filipe A.; Bexiga, Ricardo.; Cardoso, Susana.; Freitas, Paulo P.
2014-01-01
Flow cytometers have been optimized for use in portable platforms, where cell separation, identification and counting can be achieved in a compact and modular format. This feature can be combined with magnetic detection, where magnetoresistive sensors can be integrated within microfluidic channels to detect magnetically labelled cells. This work describes a platform for in-flow detection of magnetically labelled cells with a magneto-resistive based cell cytometer. In particular, we present an example for the validation of the platform as a magnetic counter that identifies and quantifies Streptococcus agalactiae in milk. PMID:25196163
Lab-on-chip cytometry based on magnetoresistive sensors for bacteria detection in milk.
Fernandes, Ana C; Duarte, Carla M; Cardoso, Filipe A; Bexiga, Ricardo; Cardoso, Susana; Freitas, Paulo P
2014-08-21
Flow cytometers have been optimized for use in portable platforms, where cell separation, identification and counting can be achieved in a compact and modular format. This feature can be combined with magnetic detection, where magnetoresistive sensors can be integrated within microfluidic channels to detect magnetically labelled cells. This work describes a platform for in-flow detection of magnetically labelled cells with a magneto-resistive based cell cytometer. In particular, we present an example for the validation of the platform as a magnetic counter that identifies and quantifies Streptococcus agalactiae in milk.
Van Meervenne, Eva; Van Coillie, Els; Kerckhof, Frederiek-Maarten; Devlieghere, Frank; Herman, Lieve; De Gelder, Leen S. P.; Top, Eva M.; Boon, Nico
2012-01-01
Pathogens resistant to multiple antibiotics are rapidly emerging, entailing important consequences for human health. This study investigated if the broad-host-range multiresistance plasmid pB10, isolated from a wastewater treatment plant, harbouring amoxicillin, streptomycin, sulfonamide, and tetracycline resistance genes, was transferable to the foodborne pathogens Salmonella spp. or E. coli O157:H7 and how this transfer alters the phenotype of the recipients. The transfer ratio was determined by both plating and flow cytometry. Antibiotic resistance profiles were determined for both recipients and transconjugants using the disk diffusion method. For 14 of the 15 recipient strains, transconjugants were detected. Based on plating, transfer ratios were between 6.8 × 10−9 and 3.0 × 10−2 while using flow cytometry, transfer ratios were between <1.0 × 10−5 and 1.9 × 10−2. With a few exceptions, the transconjugants showed phenotypically increased resistance, indicating that most of the transferred resistance genes were expressed. In summary, we showed that an environmental plasmid can be transferred into foodborne pathogenic bacteria at high transfer ratios. However, the transfer ratio seemed to be recipient strain dependent. Moreover, the newly acquired resistance genes could turn antibiotic susceptible strains into resistant ones, paving the way to compromise human health. PMID:22791963
Morell, Montse; Espargaro, Alba; Aviles, Francesc Xavier; Ventura, Salvador
2008-01-01
We present a high-throughput approach to study weak protein-protein interactions by coupling bimolecular fluorescent complementation (BiFC) to flow cytometry (FC). In BiFC, the interaction partners (bait and prey) are fused to two rationally designed fragments of a fluorescent protein, which recovers its function upon the binding of the interacting proteins. For weak protein-protein interactions, the detected fluorescence is proportional to the interaction strength, thereby allowing in vivo discrimination between closely related binders with different affinity for the bait protein. FC provides a method for high-speed multiparametric data acquisition and analysis; the assay is simple, thousands of cells can be analyzed in seconds and, if required, selected using fluorescence-activated cell sorting (FACS). The combination of both methods (BiFC-FC) provides a technically straightforward, fast and highly sensitive method to validate weak protein interactions and to screen and identify optimal ligands in biologically synthesized libraries. Once plasmids encoding the protein fusions have been obtained, the evaluation of a specific interaction, the generation of a library and selection of active partners using BiFC-FC can be accomplished in 5 weeks.
A novel bicistronic sensor vector for detecting caspase-3 activation.
Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah
2015-01-01
Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.
Development of Tat-Conjugated Dendrimer for Transdermal DNA Vaccine Delivery.
Bahadoran, Azadeh; Moeini, Hassan; Bejo, Mohd Hair; Hussein, Mohd Zobir; Omar, Abdul Rahman
In order to enhance cellular uptake and to facilitate transdermal delivery of DNA vaccine, polyamidoamine (PAMAM) dendrimers conjugated with HIV transactivator of transcription (TAT) was developed. First, the plasmid DNA (pIRES-H5/GFP) nanoparticle was formulated using PAMAM dendrimer and TAT peptide and then characterized for surface charge, particle size, DNA encapsulation and protection of the pIRES-H5/GFP DNA plasmid to enzymatic digestion. Subsequently, the potency of the TAT-conjugated dendrimer for gene delivery was evaluated through in vitro transfection into Vero cells followed by gene expression analysis including western blotting, fluorescent microscopy and PCR. The effect of the TAT peptide on cellular uptake of DNA vaccine was studied by qRT-PCR and flow cytometry. Finally, the ability of TAT-conjugated PAMAM dendrimer for transdermal delivery of the DNA plasmid was assessed through artificial membranes followed by qRT-PCR and flow cytometry. TAT-conjugated PAMAM dendrimer showed the ability to form a compact and nanometre-sized polyplexes with the plasmid DNA, having the size range of 105 to 115 nm and a positive charge of +42 to +45 mV over the N/P ratio of 6:1(+/-). In vitro transfection analysis into Vero cells confirms the high potency of TAT-conjugated PAMAM dendrimer to enhance the cellular uptake of DNA vaccine. The permeability value assay through artificial membranes reveals that TAT-conjugated PAMAM has more capacity for transdermal delivery of the DNA compared to unmodified PAMAM dendrimer (P<0.05). The findings of this study suggest that TAT-conjugated PAMAM dendrimer is a promising non-viral vector for transdermal use.This article is open to POST-PUBLICATION REVIEW. Registered readers (see "For Readers") may comment by clicking on ABSTRACT on the issue's contents page.
Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.
Dad, A-B K; Ramakrishna, S; Song, M; Kim, H
2014-11-01
Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.
Chen, Yu-Hua; Zhou, Bi-Yun; Wu, Guo-Cai; Liao, De-Quan; Li, Jing; Liang, Si-Si; Wu, Xian-Jin; Xu, Jun-Fa; Chen, Yong-Hua; Di, Xiao-Qing; Lin, Qiong-Yan
2018-02-14
This study aims to investigate the effects of exogenous interleukin (IL)-37 on the biological characteristics of human lung adenocarcinoma A549 cells and the chemotaxis of regulatory T (Treg) cells. After isolating the CD4+ CD25+ Treg cells from the peripheral blood, flow cytometry was used to detect the purity of the Treg cells. A549 cells were divided into blank (no transfection), empty plasmid (transfection with pIRES2-EGFP empty plasmid) or IL-37 group (transfection with pIRES2-EGFP-IL-37 plasmid). RT-PCR was used to detect mRNA expression of IL-37 and ELISA to determine IL-37 and MMP-9 expressions. Western blotting was applied to detect the protein expressions of PCNA, Ki-67, Cyclin D1, CDK4, cleaved caspase-3 and cleaved caspase-9. MTT assay, flow cytometry, scratch test and transwell assay were performed to detect cell proliferation, cycle, apoptosis, migration and invasion. Effect of exogenous IL-37 on the chemotaxis of Treg cells was measured through transwell assay. Xenograft models in nude mice were eastablished to detect the impact of IL-37 on A549 cells. The IL-37 group had a higher IL-37 expression, cell apoptosis in the early stage and percentage of cells in the G0/G1 phase than the blank and empty plasmid groups. The IL-37 group had a lower MMP-9 expression, optical density (OD), percentage of cells in the S and G2/M phases, migration, invasion and chemotaxis of CD4+CD25+ Foxp3+ Treg cells. The xenograft volume and weight of nude mice in the IL-37 group were lower than those in the blank and empty plasmid groups. Compared with the blank and empty plasmid groups, the IL-37 group had significantly reduced expression of PCNA, Ki-67, Cyclin D1 and CDK4 but elevated expression of cleaved caspase-3 and cleaved caspase-9. Therefore, exogenous IL-37 inhibits the proliferation, migration and invasion of human lung adenocarcinoma A549 cells as well as the chemotaxis of Treg cells while promoting the apoptosis of A549 cells.
Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja
2017-01-01
Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.
Doucette, Jaimee; Zhao, Ziyan; Geyer, Rory J; Barra, Melanie M; Balunas, Marcy J; Zweifach, Adam
2016-07-01
Genetically encoded sensors based on intramolecular FRET between CFP and YFP are used extensively in cell biology research. Flow cytometry has been shown to offer a means to measure CFP-YFP FRET; we suspected it would provide a unique way to conduct multiplexed measurements from cells expressing different FRET sensors, which is difficult to do with microscopy, and that this could be used for screening. We confirmed that flow cytometry accurately measures FRET signals using cells transiently transfected with an ERK activity reporter, comparing responses measured with imaging and cytometry. We created polyclonal long-term transfectant lines, each expressing a different intramolecular FRET sensor, and devised a way to bar-code four distinct populations of cells. We demonstrated the feasibility of multiplexed measurements and determined that robust multiplexed measurements can be conducted in plate format. To validate the suitability of the method for screening, we measured responses from a plate of bacterial extracts that in unrelated experiments we had determined contained the protein kinase C (PKC)-activating compound teleocidin A-1. The multiplexed assay correctly identifying the teleocidin A-1-containing well. We propose that multiplexed cytometric FRET measurements will be useful for analyzing cellular function and for screening compound collections. © 2016 Society for Laboratory Automation and Screening.
Ma, Hongyan; Bryers, James D.
2012-01-01
Biofilms cause much of all human microbial infections. Attempts to eradicate biofilm-based infections rely on disinfectants and antibiotics. Unfortunately, biofilm bacteria are significantly less responsive to antibiotic stressors than their planktonic counterparts. Sublethal doses of antibiotics can actually enhance biofilm formation. Here, we have developed a non-invasive microscopic image analyses to quantify plasmid conjugation within a developing biofilm. Corroborating destructive samples were analyzed by a cultivation-independent flow cytometry analysis and a selective plate count method to cultivate transconjugants. Increases in substrate loading altered biofilm 3-D architecture and subsequently affected the frequency of plasmid conjugation (decreases at least two times) in the absence of any antibiotic selective pressure. More importantly, donor populations in biofilms exposed to a sublethal dose of kanamycin exhibited enhanced transfer efficiency of plasmids containing the kanamycin resistance gene, up to tenfold. However, when stressed with a different antibiotic, imipenem, transfer of plasmids containing the kanR+ gene was not enhanced. These preliminary results suggest biofilm bacteria “sense” antibiotics to which they are resistant, which enhances the spread of that resistance. Confocal scanning microscopy coupled with our non-invasive image analysis was able to estimate plasmid conjugative transfer efficiency either averaged over the entire biofilm landscape or locally with individual biofilm clusters. PMID:22669634
Rainbow Vectors for Broad-Range Bacterial Fluorescence Labeling.
Barbier, Mariette; Damron, F Heath
2016-01-01
Since their discovery, fluorescent proteins have been widely used to study protein function, localization or interaction, promoter activity and regulation, drug discovery or for non-invasive imaging. They have been extensively modified to improve brightness, stability, and oligomerization state. However, only a few studies have focused on understanding the dynamics of fluorescent proteins expression in bacteria. In this work, we developed a set plasmids encoding 12 fluorescent proteins for bacterial labeling to facilitate the study of pathogen-host interactions. These broad-spectrum plasmids can be used with a wide variety of Gram-negative microorganisms including Escherichia coli, Pseudomonas aeruginosa, Burkholderia cepacia, Bordetella bronchiseptica, Shigella flexneri or Klebsiella pneumoniae. For comparison, fluorescent protein expression and physical characteristics in Escherichia coli were analyzed using fluorescence microscopy, flow cytometry and in vivo imaging. Fluorescent proteins derived from the Aequorea Victoria family showed high photobleaching, while proteins form the Discosoma sp. and the Fungia coccina family were more photostable for microscopy applications. Only E2-Crimson, mCherry and mKeima were successfully detected for in vivo applications. Overall, E2-Crimson was the fastest maturing protein tested in E. coli with the best overall performance in the study parameters. This study provides a unified comparison and comprehensive characterization of fluorescent protein photostability, maturation and toxicity, and offers general recommendations on the optimal fluorescent proteins for in vitro and in vivo applications.
Development of a novel rDNA based plasmid for enhanced cell surface display on Yarrowia lipolytica.
Bulani, Siyavuya Ishmael; Moleleki, Lucy; Albertyn, Jacobus; Moleleki, Ntsane
2012-05-20
In this study, a novel rDNA based plasmid was developed for display of heterologous proteins on the cell surface of Yarrowia lipolytica using the C-terminal end of the glycosylphosphatidylinositol (GPI) anchored Y. lipolytica cell wall protein 1 (YlCWP1). mCherry was used as a model protein to assess the efficiency of the constructed plasmid. Y. lipolytica transformants harbouring the expression cassettes showed a purple colour phenotype on selective YNB-casamino plates as compared to control cells indicating that mCherry was displayed on the cells. Expression of mCherry on cells of Y. lipolytica was confirmed by both fluorescent microscopy and flow cytometry. Furthermore, SDS-PAGE analysis and matrix-assisted laser desorption/ionization (MALDI)-time-of (TOF)-mass spectrometry (MS) peptide mass fingerprinting (PMF) confirmed that the protein cleaved from the yeast cells using enterokinase was mCherry. Efficient cleavage of mCherry reported in this work offers an alternative purification method for displayed heterologous proteins on Y. lipolytica cells using the plasmid constructed in this study. The developed displaying system offers great potential for industrial production and purification of heterologous proteins at low cost.
Improvement of electroporation to deliver plasmid DNA into dental follicle cells
Yao, Shaomian; Rana, Samir; Liu, Dawen; Wise, Gary E.
2010-01-01
Electroporation DNA transfer is a simple and versatile approach to deliver genes. To develop an optimal electroporation protocol to deliver DNA into cells, we conducted square wave electroporation experiments with using rat dental follicle cells as follows: 1) the cells were electroporated at different electric field strengths with lac Z plasmid; 2) plasmid concentrations were tested to determine the optimal doses; 3) various concentrations of bovine serum albumin or fetal bovine serum were added to the pulsing buffer; and, 4) the pulsing durations were studied to determine the optimal duration. These experiments indicated that the optimal electroporation electric field strength was 375 V/cm, and that plasmid concentrations greater than 0.18 μg/μl were required to achieve high transfection efficiency. BSA or FBS in the pulsing buffer significantly improved cell survival and increased the number of transfected cells. The optimal pulsing duration was in the range of 45 to 120 milliseconds (ms) at 375 V/cm. Thus, an improved electroporation protocol was established by optimizing the above parameters. In turn, this electroporation protocol can be used to deliver DNA into dental follicle cells to study the roles of candidate genes in regulating tooth eruption. PMID:19830717
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-01-01
Summary The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications. PMID:25541598
Yen-Ting-Liu; Sau, Saumitra; Ma, Chien-Hui; Kachroo, Aashiq H; Rowley, Paul A; Chang, Keng-Ming; Fan, Hsiu-Fang; Jayaram, Makkuni
2014-10-01
The multi-copy 2 micron plasmid of Saccharomyces cerevisiae, a resident of the nucleus, is remarkable for its high chromosome-like stability. The plasmid does not appear to contribute to the fitness of the host, nor does it impose a significant metabolic burden on the host at its steady state copy number. The plasmid may be viewed as a highly optimized selfish DNA element whose genome design is devoted entirely towards efficient replication, equal segregation and copy number maintenance. A partitioning system comprised of two plasmid coded proteins, Rep1 and Rep2, and a partitioning locus STB is responsible for equal or nearly equal segregation of plasmid molecules to mother and daughter cells. Current evidence supports a model in which the Rep-STB system promotes the physical association of the plasmid with chromosomes and thus plasmid segregation by a hitchhiking mechanism. The Flp site-specific recombination system housed by the plasmid plays a critical role in maintaining steady state plasmid copy number. A decrease in plasmid population due to rare missegregation events is rectified by plasmid amplification via a recombination induced rolling circle replication mechanism. Appropriate plasmid amplification, without runaway increase in copy number, is ensured by positive and negative regulation of FLP gene expression by plasmid coded proteins and by the control of Flp level/activity through host mediated post-translational modification(s) of Flp. The Flp system has been successfully utilized to understand mechanisms of site-specific recombination, to bring about directed genetic alterations for addressing fundamental problems in biology, and as a tool in biotechnological applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Junyong, E-mail: zhangmachine@hotmail.com; Guo, Shipeng, E-mail: guoshipeng2008@126.com; Zhang, Wenfeng, E-mail: Sadengren8881@163.com
The currently available techniques for transferring exogenous genes into macrophages, especially the targeted import of exogenous genes into Kupffer cells (KCs) in vivo, are inefficient and achieve only low targeting. Novel Large-Pore Mesoporous Silica Nanospheres (LPMSNs) may be a promising gene transfection agent for KCs because of their superior biodegradation and hypotoxic characteristics, as well as their ability to retain the biological function of KCs and the high loading-rate of exogenous plasmid. LPMSNs were able to completely adsorb shRNA-TRAF3 (tumor necrosis factor receptor-associated factor-3) plasmid at a mass ratio as low as 30:1, and exhibited a low cytotoxicity for KCs. LPMSNsmore » were detected in KC cytoplasm in vitro, and transmission electron microscopy (TEM) revealed that they were present only in KCs in liver tissue in vivo. The max KC transfection efficiency with LPMSNs was 34.8± 0.07%, as evaluated using flow cytometry, and the protein and mRNA levels of TRAF3 were significantly inhibited (P < 0.05) by shRNA-TRAF3 plasmid transfection after 24 h in vitro and 48 h in vivo. In conclusion, KC targeted transfection was achieved successfully by LPMSNs carrying shRNA-TRAF3 plasmids in vitro and vivo. The protein and mRNA levels of TRAF3 were suppressed significantly. These results suggest that LPMSNs are a promising vehicle for delivering exogenous genes into KCs in vitro and vivo. - Highlights: • We constructed Large-Pore Mesoporous Silica Nanospheres (LPMSNs). • LPMSNs adsorbed high quantity of plasmid. • Low cytotoxicity of LPMSNs to Kupffer cells. • LPMSNs delivered plasmid into Kupffer cells.« less
Enhancing Malaria Vaccine Development by the Naval Medical Research Center
2003-03-01
optimized in Milestone 1 of this Phase II project. Reduction in particle size of the biopolymeric carrier was sufficient for intramuscular administration of...glycolide) (PLGA) with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in...with incorporated DNA plasmid were developed for systemic administration of DNA plasmids for use as a malaria vaccine. Objectives in Milestone 1
Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin
2010-02-01
This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.
Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori
2018-01-01
Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.
Shaver, Aaron C; Greig, Bruce W; Mosse, Claudio A; Seegmiller, Adam C
2015-05-01
Optimizing a clinical flow cytometry panel can be a subjective process dependent on experience. We develop a quantitative method to make this process more rigorous and apply it to B lymphoblastic leukemia/lymphoma (B-ALL) minimal residual disease (MRD) testing. We retrospectively analyzed our existing three-tube, seven-color B-ALL MRD panel and used our novel method to develop an optimized one-tube, eight-color panel, which was tested prospectively. The optimized one-tube, eight-color panel resulted in greater efficiency of time and resources with no loss in diagnostic power. Constructing a flow cytometry panel using a rigorous, objective, quantitative method permits optimization and avoids problems of interdependence and redundancy in a large, multiantigen panel. Copyright© by the American Society for Clinical Pathology.
NASA Astrophysics Data System (ADS)
Hutcheson, Joshua A.; Majid, Aneeka A.; Powless, Amy J.; Muldoon, Timothy J.
2015-09-01
Linear image sensors have been widely used in numerous research and industry applications to provide continuous imaging of moving objects. Here, we present a widefield fluorescence microscope with a linear image sensor used to image translating objects for image cytometry. First, a calibration curve was characterized for a custom microfluidic chamber over a span of volumetric pump rates. Image data were also acquired using 15 μm fluorescent polystyrene spheres on a slide with a motorized translation stage in order to match linear translation speed with line exposure periods to preserve the image aspect ratio. Aspect ratios were then calculated after imaging to ensure quality control of image data. Fluorescent beads were imaged in suspension flowing through the microfluidics chamber being pumped by a mechanical syringe pump at 16 μl min-1 with a line exposure period of 150 μs. The line period was selected to acquire images of fluorescent beads with a 40 dB signal-to-background ratio. A motorized translation stage was then used to transport conventional glass slides of stained cellular biospecimens. Whole blood collected from healthy volunteers was stained with 0.02% (w/v) proflavine hemisulfate was imaged to highlight leukocyte morphology with a 1.56 mm × 1.28 mm field of view (1540 ms total acquisition time). Oral squamous cells were also collected from healthy volunteers and stained with 0.01% (w/v) proflavine hemisulfate to demonstrate quantifiable subcellular features and an average nuclear to cytoplasmic ratio of 0.03 (n = 75), with a resolution of 0.31 μm pixels-1.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hutcheson, Joshua A.; Majid, Aneeka A.; Powless, Amy J.
Linear image sensors have been widely used in numerous research and industry applications to provide continuous imaging of moving objects. Here, we present a widefield fluorescence microscope with a linear image sensor used to image translating objects for image cytometry. First, a calibration curve was characterized for a custom microfluidic chamber over a span of volumetric pump rates. Image data were also acquired using 15 μm fluorescent polystyrene spheres on a slide with a motorized translation stage in order to match linear translation speed with line exposure periods to preserve the image aspect ratio. Aspect ratios were then calculated aftermore » imaging to ensure quality control of image data. Fluorescent beads were imaged in suspension flowing through the microfluidics chamber being pumped by a mechanical syringe pump at 16 μl min{sup −1} with a line exposure period of 150 μs. The line period was selected to acquire images of fluorescent beads with a 40 dB signal-to-background ratio. A motorized translation stage was then used to transport conventional glass slides of stained cellular biospecimens. Whole blood collected from healthy volunteers was stained with 0.02% (w/v) proflavine hemisulfate was imaged to highlight leukocyte morphology with a 1.56 mm × 1.28 mm field of view (1540 ms total acquisition time). Oral squamous cells were also collected from healthy volunteers and stained with 0.01% (w/v) proflavine hemisulfate to demonstrate quantifiable subcellular features and an average nuclear to cytoplasmic ratio of 0.03 (n = 75), with a resolution of 0.31 μm pixels{sup −1}.« less
Grégori, Gérald; Rajwa, Bartek; Patsekin, Valery; Jones, James; Furuki, Motohiro; Yamamoto, Masanobu; Paul Robinson, J
2014-01-01
Hyperspectral cytometry is an emerging technology for single-cell analysis that combines ultrafast optical spectroscopy and flow cytometry. Spectral cytometry systems utilize diffraction gratings or prism-based monochromators to disperse fluorescence signals from multiple labels (organic dyes, nanoparticles, or fluorescent proteins) present in each analyzed bioparticle onto linear detector arrays such as multianode photomultipliers or charge-coupled device sensors. The resultant data, consisting of a series of characterizing every analyzed cell, are not compensated by employing the traditional cytometry approach, but rather are spectrally unmixed utilizing algorithms such as constrained Poisson regression or non-negative matrix factorization. Although implementations of spectral cytometry were envisioned as early as the 1980s, only recently has the development of highly sensitive photomultiplier tube arrays led to design and construction of functional prototypes and subsequently to introduction of commercially available systems. This chapter summarizes the historical efforts and work in the field of spectral cytometry performed at Purdue University Cytometry Laboratories and describes the technology developed by Sony Corporation that resulted in release of the first commercial spectral cytometry system-the Sony SP6800. A brief introduction to spectral data analysis is also provided, with emphasis on the differences between traditional polychromatic and spectral cytometry approaches.
The Role of BRCA1 Domains and Motifs in Tumor Suppression
2009-08-01
parental as negative. Lane3 and 4 HCC1937 tet infected with plentiBRCA1WT plasmid respectively before and after addition of tetracycline. 1 2 3 4 H1...histone H3 (mitotic marker) and analyzed th em by flow cytometry. As expected Hela cells presented 80% decrease in the mitotic cell population 1h...analyze spindle assembly checkpoint for each case. In conclusion, we are on track to complete the tasks in the time proposed. Our expectations are
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.
Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR
Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz
2017-01-01
Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908
An end-to-end workflow for engineering of biological networks from high-level specifications.
Beal, Jacob; Weiss, Ron; Densmore, Douglas; Adler, Aaron; Appleton, Evan; Babb, Jonathan; Bhatia, Swapnil; Davidsohn, Noah; Haddock, Traci; Loyall, Joseph; Schantz, Richard; Vasilev, Viktor; Yaman, Fusun
2012-08-17
We present a workflow for the design and production of biological networks from high-level program specifications. The workflow is based on a sequence of intermediate models that incrementally translate high-level specifications into DNA samples that implement them. We identify algorithms for translating between adjacent models and implement them as a set of software tools, organized into a four-stage toolchain: Specification, Compilation, Part Assignment, and Assembly. The specification stage begins with a Boolean logic computation specified in the Proto programming language. The compilation stage uses a library of network motifs and cellular platforms, also specified in Proto, to transform the program into an optimized Abstract Genetic Regulatory Network (AGRN) that implements the programmed behavior. The part assignment stage assigns DNA parts to the AGRN, drawing the parts from a database for the target cellular platform, to create a DNA sequence implementing the AGRN. Finally, the assembly stage computes an optimized assembly plan to create the DNA sequence from available part samples, yielding a protocol for producing a sample of engineered plasmids with robotics assistance. Our workflow is the first to automate the production of biological networks from a high-level program specification. Furthermore, the workflow's modular design allows the same program to be realized on different cellular platforms simply by swapping workflow configurations. We validated our workflow by specifying a small-molecule sensor-reporter program and verifying the resulting plasmids in both HEK 293 mammalian cells and in E. coli bacterial cells.
Xiang, Xi; Tang, Yuanjiao; Leng, Qianying; Zhang, Lingyan; Qiu, Li
2016-02-01
The purpose of this study was to optimize an ultrasound-targeted microbubble destruction (UTMD) technique to improve the in vivo transfection efficiency of the gene encoding enhanced green fluorescent protein (EGFP) in the synovial pannus in an antigen-induced arthritis rabbit model. A mixture of microbubbles and plasmids was locally injected into the knee joints of an antigen-induced arthritis (AIA) rabbits. The plasmid concentrations and ultrasound conditions were varied in the experiments. We also tested local articular and intravenous injections. The rabbits were divided into five groups: (1) ultrasound+microbubbles+plasmid; (2) ultrasound+plasmid; (3) microbubble+plasmid; (4) plasmid only; (5) untreated controls. EGFP expression was observed by fluorescent microscope and immunohistochemical staining in the synovial pannus of each group. The optimal plasmid dosage and ultrasound parameter were determined based on the results of EGFP expression and the present and absent of tissue damage under light microscopy. The irradiation procedure was performed to observe the duration of the EGFP expression in the synovial pannus and other tissues and organs, as well as the damage to the normal cells. The optimal condition was determined to be a 1-MHz ultrasound pulse applied for 5 min with a power output of 2 W/cm(2) and a 20% duty cycle along with 300 μg of plasmid. Under these conditions, the synovial pannus showed significant EGFP expression without significant damage to the surrounding normal tissue. The EGFP expression induced by the local intra-articular injection was significantly more increased than that induced by the intravenous injection. The EGFP expression in the synovial pannus of the ultrasound+microbubbles+plasmid group was significantly higher than that of the other four groups (P<0.05). The expression peaked on day 5, remained detectable on day 40 and disappeared on day 60. No EGFP expression was detected in the other tissues and organs. The UTMD technique can significantly enhance the in vivo gene transfection efficiency without significant tissue damage in the synovial pannus of an AIA model. Thus, this could become a safe and effective non-viral gene transfection procedure for arthritis therapy. Copyright © 2015 Elsevier B.V. All rights reserved.
Modulation of ColE1-like Plasmid Replication for Recombinant Gene Expression
Camps, Manel
2010-01-01
ColE1-like plasmids constitute the most popular vectors for recombinant protein expression. ColE1 plasmid replication is tightly controlled by an antisense RNA mechanism that is highly dynamic, tuning plasmid metabolic burden to the physiological state of the host. Plasmid homeostasis is upset upon induction of recombinant protein expression because of non-physiological levels of expression and because of the frequently biased amino acid composition of recombinant proteins. Disregulation of plasmid replication is the main cause of collapse of plasmid-based expression systems because of a simultaneous increase in the metabolic burden (due to increased average copy number) and in the probability of generation of plasmid-free cells (due to increased copy number variation). Interference between regulatory elements of co-resident plasmids causes comparable effects on plasmid stability (plasmid incompatibility). Modulating plasmid copy number for recombinant gene expression aims at achieving a high gene dosage while preserving the stability of the expression system. Here I present strategies targeting plasmid replication for optimizing recombinant gene expression. Specifically, I review approaches aimed at modulating the antisense regulatory system (as well as their implications for plasmid incompatibility) and innovative strategies involving modulation of host factors, of R-loop formation, and of the timing of recombinant gene expression. PMID:20218961
Marjanovič, Igor; Kandušer, Maša; Miklavčič, Damijan; Keber, Mateja Manček; Pavlin, Mojca
2014-12-01
In this study, we compared three different methods used for quantification of gene electrotransfer efficiency: fluorescence microscopy, flow cytometry and spectrofluorometry. We used CHO and B16 cells in a suspension and plasmid coding for GFP. The aim of this study was to compare and analyse the results obtained by fluorescence microscopy, flow cytometry and spectrofluorometry and in addition to analyse the applicability of spectrofluorometry for quantifying gene electrotransfer on cells in a suspension. Our results show that all the three methods detected similar critical electric field strength, around 0.55 kV/cm for both cell lines. Moreover, results obtained on CHO cells showed that the total fluorescence intensity and percentage of transfection exhibit similar increase in response to increase electric field strength for all the three methods. For B16 cells, there was a good correlation at low electric field strengths, but at high field strengths, flow cytometer results deviated from results obtained by fluorescence microscope and spectrofluorometer. Our study showed that all the three methods detected similar critical electric field strengths and high correlations of results were obtained except for B16 cells at high electric field strengths. The results also demonstrated that flow cytometry measures higher values of percentage transfection compared to microscopy. Furthermore, we have demonstrated that spectrofluorometry can be used as a simple and consistent method to determine gene electrotransfer efficiency on cells in a suspension.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Williams, L.E.; Detter, C,; Barrie, K.
2006-06-01
Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less
Conjugative DNA Transfer Is Enhanced by Plasmid R1 Partitioning Proteins
Gruber, Christian J.; Lang, Silvia; Rajendra, Vinod K. H.; Nuk, Monika; Raffl, Sandra; Schildbach, Joel F.; Zechner, Ellen L.
2016-01-01
Bacterial conjugation is a form of type IV secretion used to transport protein and DNA directly to recipient bacteria. The process is cell contact-dependent, yet the mechanisms enabling extracellular events to trigger plasmid transfer to begin inside the cell remain obscure. In this study of plasmid R1 we investigated the role of plasmid proteins in the initiation of gene transfer. We find that TraI, the central regulator of conjugative DNA processing, interacts physically, and functionally with the plasmid partitioning proteins ParM and ParR. These interactions stimulate TraI catalyzed relaxation of plasmid DNA in vivo and in vitro and increase ParM ATPase activity. ParM also binds the coupling protein TraD and VirB4-like channel ATPase TraC. Together, these protein-protein interactions probably act to co-localize the transfer components intracellularly and promote assembly of the conjugation machinery. Importantly these data also indicate that the continued association of ParM and ParR at the conjugative pore is necessary for plasmid transfer to start efficiently. Moreover, the conjugative pilus and underlying secretion machinery assembled in the absence of Par proteins mediate poor biofilm formation and are completely dysfunctional for pilus specific R17 bacteriophage uptake. Thus, functional integration of Par components at the interface of relaxosome, coupling protein, and channel ATPases appears important for an optimal conformation and effective activation of the transfer machinery. We conclude that low copy plasmid R1 has evolved an active segregation system that optimizes both its vertical and lateral modes of dissemination. PMID:27486582
Towards the construction of high-quality mutagenesis libraries.
Li, Heng; Li, Jing; Jin, Ruinan; Chen, Wei; Liang, Chaoning; Wu, Jieyuan; Jin, Jian-Ming; Tang, Shuang-Yan
2018-07-01
To improve the quality of mutagenesis libraries in directed evolution strategy. In the process of library transformation, transformants which have been shown to take up more than one plasmid might constitute more than 20% of the constructed library, thereby extensively impairing the quality of the library. We propose a practical transformation method to prevent the occurrence of multiple-plasmid transformants while maintaining high transformation efficiency. A visual library model containing plasmids expressing different fluorescent proteins was used. Multiple-plasmid transformants can be reduced through optimizing plasmid DNA amount used for transformation based on the positive correlation between the occurrence frequency of multiple-plasmid transformants and the logarithmic ratio of plasmid molecules to competent cells. This method provides a simple solution for a seemingly common but often neglected problem, and should be valuable for improving the quality of mutagenesis libraries to enhance the efficiency of directed evolution strategies.
Fehér, Tamás; Libis, Vincent; Carbonell, Pablo; Faulon, Jean-Loup
2015-01-01
Production of value-added chemicals in microorganisms is regarded as a viable alternative to chemical synthesis. In the past decade, several engineered pathways producing such chemicals, including plant secondary metabolites in microorganisms have been reported; upscaling their production yields, however, was often challenging. Here, we analyze a modular device designed for sensing malonyl-CoA, a common precursor for both fatty acid and flavonoid biosynthesis. The sensor can be used either for high-throughput pathway screening in synthetic biology applications or for introducing a feedback circuit to regulate production of the desired chemical. Here, we used the sensor to compare the performance of several predicted malonyl-CoA-producing pathways, and validated the utility of malonyl-CoA reductase and malonate-CoA transferase for malonyl-CoA biosynthesis. We generated a second-order dynamic linear model describing the relation of the fluorescence generated by the sensor to the biomass of the host cell representing a filter/amplifier with a gain that correlates with the level of induction. We found the time constants describing filter dynamics to be independent of the level of induction but distinctively clustered for each of the production pathways, indicating the robustness of the sensor. Moreover, by monitoring the effect of the copy-number of the production plasmid on the dose-response curve of the sensor, we managed to coarse-tune the level of pathway expression to maximize malonyl-CoA synthesis. In addition, we provide an example of the sensor's use in analyzing the effect of inducer or substrate concentrations on production levels. The rational development of models describing sensors, supplemented with the power of high-throughput optimization provide a promising potential for engineering feedback loops regulating enzyme levels to maximize productivity yields of synthetic metabolic pathways.
Karimi, Shokoufeh; Ahl, David; Vågesjö, Evelina; Holm, Lena; Phillipson, Mia; Jonsson, Hans; Roos, Stefan
2016-01-01
Lactobacillus reuteri is a symbiont that inhabits the gastrointestinal (GI) tract of mammals, and several strains are used as probiotics. After introduction of probiotic strains in a complex ecosystem like the GI tract, keeping track of them is a challenge. The main objectives of this study were to introduce reporter proteins that would enable in vivo and in vitro detection of L. reuteri and increase knowledge about its interactions with the host. We describe for the first time cloning of codon-optimized reporter genes encoding click beetle red luciferase (CBRluc) and red fluorescent protein mCherry in L. reuteri strains ATCC PTA 6475 and R2LC. The plasmid persistence of mCherry-expressing lactobacilli was evaluated by both flow cytometry (FCM) and conventional plate count (PC), and the plasmid loss rates measured by FCM were lower overall than those determined by PC. Neutralization of pH and longer induction duration significantly improved the mCherry signal. The persistency, dose-dependent signal intensity and localization of the recombinant bacteria in the GI tract of mice were studied with an in vivo imaging system (IVIS), which allowed us to detect fluorescence from 6475-CBRluc-mCherry given at a dose of 1×1010 CFU and luminescence signals at doses ranging from 1×105 to 1×1010 CFU. Both 6475-CBRluc-mCherry and R2LC-CBRluc were localized in the colon 1 and 2 h after ingestion, but the majority of the latter were still found in the stomach, possibly reflecting niche specificity for R2LC. Finally, an in vitro experiment showed that mCherry-producing R2LC adhered efficiently to the intra cellular junctions of cultured IPEC-J2 cells. In conclusion, the two reporter genes CBRluc and mCherry were shown to be suitable markers for biophotonic imaging (BPI) of L. reuteri and may provide useful tools for future studies of in vivo and in vitro interactions between the bacteria and the host. PMID:27002525
piggyBac Transposon-Mediated Transgenesis in the Apicomplexan Parasite Eimeria tenella
Su, Huali; Liu, Xianyong; Yan, Wenchao; Shi, Tuanyuan; Zhao, Xinxin; Blake, Damer P.; Tomley, Fiona M.; Suo, Xun
2012-01-01
piggyBac, a type II transposon that is useful for efficient transgenesis and insertional mutagenesis, has been used for effective and stable transfection in a wide variety of organisms. In this study we investigate the potential use of the piggyBac transposon system for forward genetics studies in the apicomplexan parasite Eimeria tenella. Using the restriction enzyme-mediated integration (REMI) method, E. tenella sporozoites were electroporated with a donor plasmid containing the enhanced yellow fluorescent protein (EYFP) gene flanked by piggyBac inverted terminal repeats (ITRs), an Asc I-linearized helper plasmid containing the transposase gene and the restriction enzyme Asc I. Subsequently, electroporated sporozoites were inoculated into chickens via the cloacal route and transfected progeny oocysts expressing EYFP were sorted by flow cytometry. A transgenic E. tenella population was selected by successive in vivo passage. Southern-blotting analysis showed that exogenous DNA containing the EYFP gene was integrated into the parasite genome at a limited number of integration sites and that the inserted part of the donor plasmid was the fragment located between the 5′ and 3′ ITRs as indicated by primer-specific PCR screening. Genome walking revealed that the insertion sites were TTAA-specific, which is consistent with the transposition characteristics of piggyBac. PMID:22768223
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
Koo, Ok Jae; Park, Sol Ji; Lee, Choongil; Kang, Jung Taek; Kim, Sujin; Moon, Joon Ho; Choi, Ji Yei; Kim, Hyojin; Jang, Goo; Kim, Jin-Soo; Kim, Seokjoong; Lee, Byeong-Chun
2014-03-01
To facilitate the construction of genetically-modified pigs, we produced cloned embryos derived from porcine fibroblasts transfected with a pair of engineered zinc finger nuclease (ZFN) plasmids to create targeted mutations and enriched using a reporter plasmid system. The reporter expresses RFP and eGFP simultaneously when ZFN-mediated site-specific mutations occur. Thus, double positive cells (RFP(+)/eGFP(+)) were selected and used for somatic cell nuclear transfer. Two types of reporter based enrichment systems were used in this study; the cloned embryos derived from cells enriched using a magnetic sorting-based system showed better developmental competence than did those derived from cells enriched by flow cytometry. Mutated sequences, such as insertions, deletions, or substitutions, together with the wild-type sequence, were found in the cloned porcine blastocysts. Therefore, genetic mutations can be achieved in cloned porcine embryos reconstructed with ZFN-treated cells that were enriched by a reporter-based system.
Liu, Yen-Ting; Chang, Keng-Ming; Ma, Chien-Hui; Jayaram, Makkuni
2016-09-30
The yeast 2-micron plasmid epitomizes the evolutionary optimization of selfish extra-chromosomal genomes for stable persistence without jeopardizing their hosts' fitness. Analyses of fluorescence-tagged single-copy reporter plasmids and/or the plasmid partitioning proteins in native and non-native hosts reveal chromosome-hitchhiking as the likely means for plasmid segregation. The contribution of the partitioning system to equal segregation is bipartite- replication-independent and replication-dependent. The former nearly eliminates 'mother bias' (preferential plasmid retention in the mother cell) according to binomial distribution, thus limiting equal segregation of a plasmid pair to 50%. The latter enhances equal segregation of plasmid sisters beyond this level, elevating the plasmid close to chromosome status. Host factors involved in plasmid partitioning can be functionally separated by their participation in the replication-independent and/or replication-dependent steps. In the hitchhiking model, random tethering of a pair of plasmids to chromosomes signifies the replication-independent component of segregation; the symmetric tethering of plasmid sisters to sister chromatids embodies the replication-dependent component. The 2-micron circle broadly resembles the episomes of certain mammalian viruses in its chromosome-associated propagation. This unifying feature among otherwise widely differing selfish genomes suggests their evolutionary convergence to the common logic of exploiting, albeit via distinct molecular mechanisms, host chromosome segregation machineries for self-preservation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Liu, Yen-Ting; Chang, Keng-Ming; Ma, Chien-Hui; Jayaram, Makkuni
2016-01-01
The yeast 2-micron plasmid epitomizes the evolutionary optimization of selfish extra-chromosomal genomes for stable persistence without jeopardizing their hosts’ fitness. Analyses of fluorescence-tagged single-copy reporter plasmids and/or the plasmid partitioning proteins in native and non-native hosts reveal chromosome-hitchhiking as the likely means for plasmid segregation. The contribution of the partitioning system to equal segregation is bipartite- replication-independent and replication-dependent. The former nearly eliminates ‘mother bias’ (preferential plasmid retention in the mother cell) according to binomial distribution, thus limiting equal segregation of a plasmid pair to 50%. The latter enhances equal segregation of plasmid sisters beyond this level, elevating the plasmid close to chromosome status. Host factors involved in plasmid partitioning can be functionally separated by their participation in the replication-independent and/or replication-dependent steps. In the hitchhiking model, random tethering of a pair of plasmids to chromosomes signifies the replication-independent component of segregation; the symmetric tethering of plasmid sisters to sister chromatids embodies the replication-dependent component. The 2-micron circle broadly resembles the episomes of certain mammalian viruses in its chromosome-associated propagation. This unifying feature among otherwise widely differing selfish genomes suggests their evolutionary convergence to the common logic of exploiting, albeit via distinct molecular mechanisms, host chromosome segregation machineries for self-preservation. PMID:27492289
Rapid DNA transformation in Salmonella Typhimurium by the hydrogel exposure method.
Elabed, Hamouda; Hamza, Rim; Bakhrouf, Amina; Gaddour, Kamel
2016-07-01
Even with advances in molecular cloning and DNA transformation, new or alternative methods that permit DNA penetration in Salmonella enterica subspecies enterica serovar Typhimurium are required in order to use this pathogen in biotechnological or medical applications. In this work, an adapted protocol of bacterial transformation with plasmid DNA based on the "Yoshida effect" was applied and optimized on Salmonella enterica serovar Typhimurium LT2 reference strain. The plasmid transference based on the use of sepiolite as acicular materials to promote cell piercing via friction forces produced by spreading on the surface of a hydrogel. The transforming mixture containing sepiolite nanofibers, bacterial cells to be transformed and plasmid DNA were plated directly on selective medium containing 2% agar. In order to improve the procedure, three variables were tested and the transformation of Salmonella cells was accomplished using plasmids pUC19 and pBR322. Using the optimized protocol on Salmonella LT2 strain, the efficiency was about 10(5) transformed cells per 10(9) subjected to transformation with 0.2μg plasmid DNA. In summary, the procedure is fast, offers opportune efficiency and promises to become one of the widely used transformation methods in laboratories. Copyright © 2016 Elsevier B.V. All rights reserved.
Optimizing transformations for automated, high throughput analysis of flow cytometry data
2010-01-01
Background In a high throughput setting, effective flow cytometry data analysis depends heavily on proper data preprocessing. While usual preprocessing steps of quality assessment, outlier removal, normalization, and gating have received considerable scrutiny from the community, the influence of data transformation on the output of high throughput analysis has been largely overlooked. Flow cytometry measurements can vary over several orders of magnitude, cell populations can have variances that depend on their mean fluorescence intensities, and may exhibit heavily-skewed distributions. Consequently, the choice of data transformation can influence the output of automated gating. An appropriate data transformation aids in data visualization and gating of cell populations across the range of data. Experience shows that the choice of transformation is data specific. Our goal here is to compare the performance of different transformations applied to flow cytometry data in the context of automated gating in a high throughput, fully automated setting. We examine the most common transformations used in flow cytometry, including the generalized hyperbolic arcsine, biexponential, linlog, and generalized Box-Cox, all within the BioConductor flowCore framework that is widely used in high throughput, automated flow cytometry data analysis. All of these transformations have adjustable parameters whose effects upon the data are non-intuitive for most users. By making some modelling assumptions about the transformed data, we develop maximum likelihood criteria to optimize parameter choice for these different transformations. Results We compare the performance of parameter-optimized and default-parameter (in flowCore) data transformations on real and simulated data by measuring the variation in the locations of cell populations across samples, discovered via automated gating in both the scatter and fluorescence channels. We find that parameter-optimized transformations improve visualization, reduce variability in the location of discovered cell populations across samples, and decrease the misclassification (mis-gating) of individual events when compared to default-parameter counterparts. Conclusions Our results indicate that the preferred transformation for fluorescence channels is a parameter- optimized biexponential or generalized Box-Cox, in accordance with current best practices. Interestingly, for populations in the scatter channels, we find that the optimized hyperbolic arcsine may be a better choice in a high-throughput setting than current standard practice of no transformation. However, generally speaking, the choice of transformation remains data-dependent. We have implemented our algorithm in the BioConductor package, flowTrans, which is publicly available. PMID:21050468
Optimizing transformations for automated, high throughput analysis of flow cytometry data.
Finak, Greg; Perez, Juan-Manuel; Weng, Andrew; Gottardo, Raphael
2010-11-04
In a high throughput setting, effective flow cytometry data analysis depends heavily on proper data preprocessing. While usual preprocessing steps of quality assessment, outlier removal, normalization, and gating have received considerable scrutiny from the community, the influence of data transformation on the output of high throughput analysis has been largely overlooked. Flow cytometry measurements can vary over several orders of magnitude, cell populations can have variances that depend on their mean fluorescence intensities, and may exhibit heavily-skewed distributions. Consequently, the choice of data transformation can influence the output of automated gating. An appropriate data transformation aids in data visualization and gating of cell populations across the range of data. Experience shows that the choice of transformation is data specific. Our goal here is to compare the performance of different transformations applied to flow cytometry data in the context of automated gating in a high throughput, fully automated setting. We examine the most common transformations used in flow cytometry, including the generalized hyperbolic arcsine, biexponential, linlog, and generalized Box-Cox, all within the BioConductor flowCore framework that is widely used in high throughput, automated flow cytometry data analysis. All of these transformations have adjustable parameters whose effects upon the data are non-intuitive for most users. By making some modelling assumptions about the transformed data, we develop maximum likelihood criteria to optimize parameter choice for these different transformations. We compare the performance of parameter-optimized and default-parameter (in flowCore) data transformations on real and simulated data by measuring the variation in the locations of cell populations across samples, discovered via automated gating in both the scatter and fluorescence channels. We find that parameter-optimized transformations improve visualization, reduce variability in the location of discovered cell populations across samples, and decrease the misclassification (mis-gating) of individual events when compared to default-parameter counterparts. Our results indicate that the preferred transformation for fluorescence channels is a parameter- optimized biexponential or generalized Box-Cox, in accordance with current best practices. Interestingly, for populations in the scatter channels, we find that the optimized hyperbolic arcsine may be a better choice in a high-throughput setting than current standard practice of no transformation. However, generally speaking, the choice of transformation remains data-dependent. We have implemented our algorithm in the BioConductor package, flowTrans, which is publicly available.
Mannelli, Ilaria; Minunni, Maria; Tombelli, Sara; Mascini, Marco
2003-03-01
A DNA piezoelectric sensor has been developed for the detection of genetically modified organisms (GMOs). Single stranded DNA (ssDNA) probes were immobilised on the sensor surface of a quartz crystal microbalance (QCM) device and the hybridisation between the immobilised probe and the target complementary sequence in solution was monitored. The probe sequences were internal to the sequence of the 35S promoter (P) and Nos terminator (T), which are inserted sequences in the genome of GMOs regulating the transgene expression. Two different probe immobilisation procedures were applied: (a) a thiol-dextran procedure and (b) a thiol-derivatised probe and blocking thiol procedure. The system has been optimised using synthetic oligonucleotides, which were then applied to samples of plasmidic and genomic DNA isolated from the pBI121 plasmid, certified reference materials (CRM), and real samples amplified by the polymerase chain reaction (PCR). The analytical parameters of the sensor have been investigated (sensitivity, reproducibility, lifetime etc.). The results obtained showed that both immobilisation procedures enabled sensitive and specific detection of GMOs, providing a useful tool for screening analysis in food samples.
Tracking protein aggregation and mislocalization in cells with flow cytometry.
Ramdzan, Yasmin M; Polling, Saskia; Chia, Cheryl P Z; Ng, Ivan H W; Ormsby, Angelique R; Croft, Nathan P; Purcell, Anthony W; Bogoyevitch, Marie A; Ng, Dominic C H; Gleeson, Paul A; Hatters, Danny M
2012-03-18
We applied pulse-shape analysis (PulSA) to monitor protein localization changes in mammalian cells by flow cytometry. PulSA enabled high-throughput tracking of protein aggregation, translocation from the cytoplasm to the nucleus and trafficking from the plasma membrane to the Golgi as well as stress-granule formation. Combining PulSA with tetracysteine-based oligomer sensors in a cell model of Huntington's disease enabled further separation of cells enriched with monomers, oligomers and inclusion bodies.
Reibetanz, Uta; Halozan, David; Brumen, Milan; Donath, Edwin
2007-06-01
Polyelectrolyte multilayer sensor capsules, 5 microm in diameter, which contained fluorescein-labeled poly(acrylic acid) (PAAAF) as pH-sensitive reporter molecules, were fabricated and employed to explore their endocytotic uptake into HEK 293T cells by flow cytometry. The percentage of capsules residing in the endolysosomal compartment was estimated from the fluorescence intensity decrease caused by acidification. Capsules attached to the extracellular surface of the plasma membrane were identified by trypan blue quenching. The number of capsules in the cytoplasm was rather small, being below the detection limit of the method. The advantages of polyelectrolyte multilayer capsules are that the fluorophore is protected from interaction with cellular compartments and that the multilayer can be equipped with additional functions.
Li, Zhe; Qu, Hongnan; Li, Chun; Zhou, Xiaohong
2013-12-01
In this study, four engineered Saccharomyces cerevisiae carrying xylanase, β-xylosidase and xylose reductase genes by different transcriptional regulations were constructed to directly convert xylan to xylitol. According to the results, the high-copy number plasmid required a rigid selection for promoter characteristics, on the contrast, the selection of promoters could be more flexible for low-copy number plasmid. For cell growth and xylitol production, glucose and galactose were found more efficient than other sugars. The semi-aerobic condition and feeding of co-substrates were taken to improve the yield of xylitol. It was found that the strain containing high-copy number plasmid had the highest xylitol yield, but it was sensitive to the change of fermentation. However, the strain carrying low-copy number plasmid was more adaptable to different processes. By optimization of the transcriptional regulation and fermentation processes, the xylitol concentration could be increased of 1.7 folds and the yield was 0.71 g xylitol/g xylan. Copyright © 2013 Elsevier Ltd. All rights reserved.
Gaber, Rok; Majerle, Andreja; Jerala, Roman; Benčina, Mojca
2013-01-01
To effectively fight against the human immunodeficiency virus infection/acquired immunodeficiency syndrome (HIV/AIDS) epidemic, ongoing development of novel HIV protease inhibitors is required. Inexpensive high-throughput screening assays are needed to quickly scan large sets of chemicals for potential inhibitors. We have developed a Förster resonance energy transfer (FRET)-based, HIV protease-sensitive sensor using a combination of a fluorescent protein pair, namely mCerulean and mCitrine. Through extensive in vitro characterization, we show that the FRET-HIV sensor can be used in HIV protease screening assays. Furthermore, we have used the FRET-HIV sensor for intracellular quantitative detection of HIV protease activity in living cells, which more closely resembles an actual viral infection than an in vitro assay. We have developed a high-throughput method that employs a ratiometric flow cytometry for analyzing large populations of cells that express the FRET-HIV sensor. The method enables FRET measurement of single cells with high sensitivity and speed and should be used when subpopulation-specific intracellular activity of HIV protease needs to be estimated. In addition, we have used a confocal microscopy sensitized emission FRET technique to evaluate the usefulness of the FRET-HIV sensor for spatiotemporal detection of intracellular HIV protease activity. PMID:24287545
Probing Tumor Microenvironment With In Vivo Phage Display
2014-10-01
C). (C) Dot plots showing mCherry expression on the X axis and fibroblast activation protein ( FAP ) or rabbit isotype control staining in the Y...by flow cytometry-based cell sorting using an antibody against fibroblast activation protein ( FAP ). During the optimization steps, flow cytometry...expression of αvβ3 and αvβ5 integrins, neuropilin-1 (NRP-1), and fibroblast activation protein ( FAP ) in hb6011 CAFs was analyzed by flow cytometry
Gibert, Marta; Paytubi, Sonia; Beltrán, Sergi; Juárez, Antonio; Balsalobre, Carlos; Madrid, Cristina
2016-12-01
Plasmids of the incompatibility group HI1 (IncHI1) have been isolated from several Gram-negative pathogens and are associated with the spread of multidrug resistance. Their conjugation is tightly regulated and it is inhibited at temperatures higher than 30°C, indicating that conjugation occurs outside warm-blooded hosts. Using R27, the prototype of IncHI1 plasmids, we report that plasmid transfer efficiency in E. coli strongly depends on the physiological state of the donor cells. Conjugation frequency is high when cells are actively growing, dropping sharply when cells enter the stationary phase of growth. Accordingly, our transcriptomic assays show significant downregulation of numerous R27 genes during the stationary phase, including several tra (transfer) genes. Growth phase-dependent regulation of tra genes transcription is independent of H-NS, a silencer of horizontal gene transfer, and ppGpp and RpoS, regulators of the stationary phase, but highly dependent on the plasmid-encoded regulatory circuit TrhR/TrhY-HtdA. The metabolic sensor cAMP, whose synthesis is chromosomally encoded, is also involved in the growth phase regulation of R27 conjugation by modulating htdA expression. Our data suggest that the involvement of regulators encoded by both chromosome and plasmid are required for efficient physiological control of IncHI1 plasmid conjugation. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.
Fu, Pengfei; Pan, Xinlong; Han, Qiao; Yang, Xingwu; Zhu, Qianlei; Guo, Xiaoqing; Zhang, Yu; Chen, Hongying
2016-03-01
In order to develop a combined live vaccine that will be used to prevent against porcine parvovirus (PPV) and Pseudorabies virus (PRV) infection, the VP2 gene of PPV was inserted into the transfer vector plasmid pG to produce the recombinant plasmid pGVP2. The plasmid pGVP2 and the genome of PRV HB98 attenuated vaccine were transfected by using lipofectamine into swine testis cells for the homologous recombination. The recombinant virus rPRV-VP2 was purified by selection of green fluorescence plaques for five cycles. 6-week-old female Kunming mice were immunized intramuscularly with attenuated PRV parent HB98 strain, commercial inactivated vaccine against PPV, recombinant virus, DMEM culture solution. The injections were repeated with an equivalent dose after 2 weeks in all of the groups, and then challenged with the virulent PRV NY strain at 7 weeks after the first immunization. The recombinant virus rPRV-VP2 was successfully generated, and the recombinant virus could effectively elicite anti-PPV and PRV antibody and significant cellular immune response as indicated by anti-PPV ELISA and HI, PRV-neutralizing assay and flow cytometry. The challenge assay indicated that recombinant virus could protect the mice against the virulent PRV challenge. These results demonstrated that the recombinant virus can be a candidate recombinant vaccine strain for the prevention of PRV and PPV.
Expression and use of the green fluorescent protein as a reporter system in Legionella pneumophila.
Köhler, R; Bubert, A; Goebel, W; Steinert, M; Hacker, J; Bubert, B
2000-01-01
The gene encoding the green fluorescent protein (GFP) was used as a reporter gene in Legionella pneumophila. To analyze GFP expression in Legionella, transcriptional fusions of gfp with the Legionella-specific mip (Macrophage Infectivity Potentiator) promoter (P(mip)) and the sod (SuperOxide Dismutase) promoter (P(sod)) derived from Listeria monocytogenes were constructed. Following transformation into the virulent L. pneumophila strain JR 32, strong GFP-mediated fluorescence was detected with both plasmids, although the sod promoter was associated with a 1ten-fold higher intensity. No fluorescence was observed in L. pneumophila transformed with the promoterless gfp gene. Comparison of fluorescence yields between various L. pneumophila strains that differ in their virulence characteristics and were transformed with the P(mip)-gfp carrying plasmid revealed no differences in GFP expression. Infection studies using Acanthamoeba castellanii as host and recombinant L. pneumophila strains carrying the P(mip)-gfp and P(sod)-gfp fusions indicated that the mip promoter was expressed when the bacteria replicated intracellularly. GFP expression was also used to monitor, in infected A. castellanii cells, the intracellular survival of, and incidence of host-cell killing by. L. pneumophila strains that vary in their virulence properties. As quantified by flow cytometry the highly virulent L. pneumophila strain Corby was twice as infectious to A. castellanii as the Philadelphia strain JR 32. Using the avirulent Philadelphia derivative 25D invasion but no intracellular multiplication was observed. In addition, we examined by flow cytometry the influence of cytochalasin D, cycloheximide, and methylamine on the uptake of Legionella by A. castellanii. In conclusion, gfp appears to be a convenient reporter gene whose expression in Legionella can be followed in real time and allows analysis of promoter activities in Legionella and monitoring of the infection process.
Kinetics of Innate Immune Response to Yersinia pestis after Intradermal Infection in a Mouse Model
Jarrett, Clayton O.; Gardner, Donald; Hinnebusch, B. Joseph
2012-01-01
A hallmark of Yersinia pestis infection is a delayed inflammatory response early in infection. In this study, we use an intradermal model of infection to study early innate immune cell recruitment. Mice were injected intradermally in the ear with wild-type (WT) or attenuated Y. pestis lacking the pYV virulence plasmid (pYV−). The inflammatory responses in ear and draining lymph node samples were evaluated by flow cytometry and immunohistochemistry. As measured by flow cytometry, total neutrophil and macrophage recruitment to the ear in WT-infected mice did not differ from phosphate-buffered saline (PBS) controls or mice infected with pYV−, except for a transient increase in macrophages at 6 h compared to the PBS control. Limited inflammation was apparent even in animals with high bacterial loads (105 to 106 CFU). In addition, activation of inflammatory cells was significantly reduced in WT-infected mice as measured by CD11b and major histocompatibility complex class II (MHC-II) expression. When mice infected with WT were injected 12 h later at the same intradermal site with purified LPS, Y. pestis did not prevent recruitment of neutrophils. However, significant reduction in neutrophil activation remained compared to that of PBS and pYV− controls. Immunohistochemistry revealed qualitative differences in neutrophil recruitment to the skin and draining lymph node, with WT-infected mice producing a diffuse inflammatory response. In contrast, focal sites of neutrophil recruitment were sustained through 48 h postinfection in pYV−-infected mice. Thus, an important feature of Y. pestis infection is reduced activation and organization of inflammatory cells that is at least partially dependent on the pYV virulence plasmid. PMID:22966041
Du, Yong-Zhong; Lu, Ping; Yuan, Hong; Zhou, Jian-Ping; Hu, Fu-Qiang
2011-01-01
Quaternary complexes with condensed core of plasmid DNA, protamine, fish sperm DNA and shell of stearic acid grafted chitosan oligosaccharide (CSO-SA), were prepared. The CSO-SA could self-assemble to form nano-sized micelles in aqueous solution and demonstrated excellent internalization ability of tumor cells. Dynamic light scattering (DLS) measurement and transmission electrostatic microscope (TEM) images showed that quaternary complexes had spherical shape with about 25 nm number average diameter, and the size of quaternary complexes was smaller than that of CSO-SA micelles and CSO-SA micelles/plasmid DNA binary complexes. The transfection efficiencies of quaternary complexes on HEK293 and MCF-7 cells increased with incubation time, and were significantly higher than that of CSO-SA micelles/plasmid DNA binary complexes. The optimal transfection efficiency of quaternary complexes on HEK293 and MCF-7 cells measured by flow cytometer after 96 h was 23.82% and 41.43%, respectively. Whereas, the transfection efficiency of Lipofectamine™ 2000 on HEK293 and MCF-7 cells after 96 h was 32.45% and 33.23%, respectively. The data of luciferease activity measurement showed that the optimal ratio of plasmid DNA:fish sperm DNA:protamine:CSO-SA was 1:1:5:5. The results indicated that the present quaternary complexes were potential non-viral gene delivery system. Copyright © 2010 Elsevier B.V. All rights reserved.
Sensor Systems for Biological Agent Attacks: Protecting Buildings and Military Bases
2004-01-01
simple aerosol detectors, to those that identify an agent based on its genetic, structural, or chemical properties , to so- called "functional...Cytometry, 122 Target Binding That Changes Detectable Properties of Smart Sensor Surfaces, 124 Colorimetric Detection, 124 Fluorescence Detection, 125 One...microscopy. In addition to particles directly derived from living organisms, other particles in air may also share properties with the bioaerosols
USDA-ARS?s Scientific Manuscript database
The molecular biological techniques for plasmid-based assembly and cloning of synthetic assembled gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. These techniques involve the production of full-length cDNA libraries as a source of plasmid-bas...
Cheng, Mingrong; Zhi, Kangkang; Gao, Xiaoyan; He, Bing; Li, Yingchun; Han, Jiang; Zhang, Zhiping; Wu, Yan
2013-12-18
Cancer is both a systemic and a genetic disease. The pathogenesis of cancer might be related to dampened immunity. Host immunity recognizes nascent malignant cells - a process referred to as immune surveillance. Augmenting immune surveillance and suppressing immune escape are crucial in tumor immunotherapy. A recombinant plasmid capable of co-expressing granulocyte-macrophage colony- stimulating factor (GM-SCF), interleukin-21 (IL-21), and retinoic acid early transcription factor-1 (Rae-1) was constructed, and its effects determined in a mouse model of subcutaneous liver cancer. Serum specimens were assayed for IL-2 and INF-γ by ELISA. Liver cancer specimens were isolated for Rae-1 expression by RT-PCR and Western blot, and splenocytes were analyzed by flow cytometry. The recombinant plasmid inhibited the growth of liver cancer and prolonged survival of tumor-loaded mice. Activation of host immunity might have contributed to this effect by promoting increased numbers and cytotoxicity of natural killer (NK) cells and cytotoxic T lymphocytes (CTL) following expression of GM-SCF, IL-21, and Rae-1. By contrast, the frequency of regulatory T cells was decreased, Consequently, activated CTL and NK cells enhanced their secretion of INF-γ, which promoted cytotoxicity of NK cells and CTL. Moreover, active CTL showed dramatic secretion of IL-2, which stimulates CTL. The recombinant expression plasmid also augmented Rae-1 expression by liver cancer cells. Rae-1 receptor expressing CTL and NK cells removed liver cancer. The recombinant expression plasmid inhibited liver cancer by a mechanism that involved activation of cell-mediated immunity and Rae-1 in liver cancer.
Plasmid DNA vaccination using skin electroporation promotes poly-functional CD4 T-cell responses.
Bråve, Andreas; Nyström, Sanna; Roos, Anna-Karin; Applequist, Steven E
2011-03-01
Plasmid DNA vaccination using skin electroporation (EP) is a promising method able to elicit robust humoral and CD8(+) T-cell immune responses while limiting invasiveness of delivery. However, there is still only limited data available on the induction of CD4(+) T-cell immunity using this method. Here, we compare the ability of homologous prime/boost DNA vaccinations by skin EP and intramuscular (i.m.) injection to elicit immune responses by cytokine enzyme-linked immunosorbent spot (ELISPOT) assay, as well as study the complexity of CD4(+) T-cell responses to the human immunodeficiency virus antigen Gag, using multiparamater flow cytometry. We find that DNA vaccinations by skin EP and i.m. injection are capable of eliciting both single- and poly-functional vaccine-specific CD4(+) T cells. However, although DNA delivered by skin EP was administered at a five-fold lower dose it elicited significant increases in the magnitude of multiple-cytokine producers compared with i.m. immunization suggesting that the skin EP could provide greater poly-functional T-cell help, a feature associated with successful immune defense against infectious agents.
NASA Astrophysics Data System (ADS)
Klueva, Svetlana N.; Korsukov, Vladimir N.; Schukovskaya, Tatyana N.; Kravtsov, Alexander L.
2004-08-01
Using flow cytometry (FCM) the influence of exogenous serotonin on culture growth, DNA content and fluorescence intensity of cells binding FITC-labelled plague polyclonal immunoglobulins was studied in Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-), Yersinia pestis KM 216 (pFra-, pCad-, pPst+). The results have been obtained by FCM showed serotonin accelerated Yersinia pestis EV (pFra+, pCad+, pPst+), Yersinia pestis KM218 (pFra-, pCad-, pPst-) culture growth during cultivation in Hottinger broth pH 7.2 at 28°C at concentration of 10-5 M. The presence of 10-5 M serotonin in nutrient broth could modulate DNA content in 37°C growing population of plague microbe independently of their plasmid content. Serotonin have been an impact on the distribution pattern of the cells according to their phenotypical characteristics, which was reflected in the levels of population heterogeneity in the intensity of specific immunofluorescence determined by FMC.
The pPSU Plasmids for Generating DNA Molecular Weight Markers.
Henrici, Ryan C; Pecen, Turner J; Johnston, James L; Tan, Song
2017-05-26
Visualizing nucleic acids by gel electrophoresis is one of the most common techniques in molecular biology, and reference molecular weight markers or ladders are commonly used for size estimation. We have created the pPSU1 & pPSU2 pair of molecular weight marker plasmids which produce both 100 bp and 1 kb DNA ladders when digested with two common restriction enzymes. The 100 bp ladder fragments have been optimized to migrate appropriately on both agarose and native polyacrylamide, unlike many currently available DNA ladders. Sufficient plasmid DNA can be isolated from 100 ml E. coli cultures for the two plasmids to produce 100 bp or 1 kb ladders for 1000 gels. As such, the pPSU1 and pPSU2 plasmids provide reference fragments from 50 to 10000 bp at a fraction of the cost of commercial DNA ladders. The pPSU1 and pPSU2 plasmids are available without licensing restrictions to nonprofit academic users, affording freely available high-quality, low-cost molecular weight standards for molecular biology applications.
Yoon, Younggun; Chung, Hay Jung; Wen Di, Doris Yoong; Dodd, Michael C; Hur, Hor-Gil; Lee, Yunho
2017-10-15
This study assessed the inactivation efficiency of plasmid-encoded antibiotic resistance genes (ARGs) both in extracellular form (e-ARG) and present within Escherichia coli (intracellular form, i-ARG) during water treatment with chlorine, UV (254 nm), and UV/H 2 O 2 . A quantitative real-time PCR (qPCR) method was used to quantify the ARG damage to amp R (850 bp) and kan R (806 bp) amplicons, both of which are located in the pUC4K plasmid. The plate count and flow cytometry methods were also used to determine the bacterial inactivation parameters, such as culturability and membrane damage, respectively. In the first part of the study, the kinetics of E. coli inactivation and ARG damage were determined in phosphate buffered solutions. The ARG damage occurred much more slowly than E. coli inactivation in all cases. To achieve 4-log reduction of ARG concentration at pH 7, the required chlorine exposure and UV fluence were 33-72 (mg × min)/L for chlorine and 50-130 mJ/cm 2 for UV and UV/H 2 O 2 . After increasing pH from 7 to 8, the rates of ARG damage decreased for chlorine, while they did not vary for UV and UV/H 2 O 2 . The i-ARGs mostly showed lower rates of damage compared to the e-ARGs due to the protective roles of cellular components against oxidants and UV. The contribution of OH radicals to i-ARG damage was negligible in UV/H 2 O 2 due to significant OH radical scavenging by cellular components. In all cases, the ARG damage rates were similar for amp R versus kan R , except for the chlorination of e-ARGs, in which the damage to amp R occurred faster than that to kan R . Chlorine and UV dose-dependent ARG inactivation levels determined in a wastewater effluent matrix could be reasonably explained by the kinetic data obtained from the phosphate buffered solutions and the expected oxidant (chlorine and OH radicals) demands by water matrix components. These results can be useful in optimizing chlorine and UV-based disinfection systems to achieve ARG inactivation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Detection of Sirtuin-1 protein expression in peripheral blood leukocytes in dogs.
Yoshimura, Kuniko; Matsuu, Aya; Sasaki, Kai; Momoi, Yasuyuki
2018-05-11
Sirtuin-1 (SIRT1) is a nicotinamide adenine dinucleotide (NAD + )-dependent histone deacetylase with a large number of protein substrates. It has attracted a lot of attention in association with extending lifespan. The objective of this study was to enable the evaluation of SIRT1 expression in peripheral blood mononuclear cells (PBMCs) from dogs by flow cytometry. Three transcript variants were amplified from PBMCs by reverse transcription PCR and the nucleotide sequences were analyzed. On the basis deduced amino acid sequence, a monoclonal antibody against human SIRT1, 1F3, was selected to detect canine SIRT1. Canine SIRT1 in peripheral blood mononuclear cells was successfully detected by western blotting using this antibody. Intracellular canine SIRT1 was also detected in permeabilized 293T cells transfected with a canine SIRT1 expression plasmid by flow cytometry using this antibody. SIRT1 was detected in all leukocyte subsets including lymphocytes, granulocytes and monocytes. The expression level was markedly different among individual dogs. These results indicated that the method applied in this study is useful for evaluating canine SIRT1 levels in PBMCs from dogs.
Soh, Kah Teong; Tario, Joseph D.; Wallace, Paul K.
2018-01-01
Synopsis Plasma cell dyscrasia (PCD) is a heterogeneous disease which has seen a tremendous change in outcomes due to improved therapies. Over the last few decades, multiparametric flow cytometry has played an important role in the detection and monitoring of PCDs. Flow cytometry is a high sensitivity assay for early detection of minimal residual disease (MRD) that correlates well with progression-free survival and overall survival. Before flow cytometry can be effectively implemented in the clinical setting sample preparation, panel configuration, analysis, and gating strategies must be optimized to ensure accurate results. Current consensus methods and reporting guidelines for MRD testing are discussed. PMID:29128071
Anti-cancer efficacy of biotinylated chitosan nanoparticles in liver cancer
Dai, Dejian; Hou, Yiming
2017-01-01
The present study investigated the synthesis of biotinylated chitosan (Bio-CS) from chitosan using a nanomaterial skeleton with biotin and the successful targeting of the formulation in liver cancer cells. Bio-CS was validated by fourier transformed infrared spectroscopy and hydrogen-1 nuclear magnetic resonance spectroscopy. Bio-CS and plasmid DNA were used to construct Bio-CS/plasmid DNA nanoparticles according to the optimal molar ratio of 1:1 and the optimal pH-value of 5.5. Under these conditions, the parameters mean particle size, potential, encapsulation rate and drug loading, were 82.9 nm, +21.8 mV, 85.7% and 35.4%, respectively. Bio-CS exhibited an apparent liver cancer targeting effect in vitro and in vivo, as demonstrated by confocal laser scanning, green fluorescent protein transfection, and in vivo imaging assays. In addition, the Bio-CS/plasmid DNA nanoparticles significantly increased the survival period of the orthotropic liver cancer mouse model compared with the plasmid DNA, with no apparent side effects on the cells. Bio-CS nanomaterials stimulated an immune response in hepatoma cells via increased expression of GM-CSF, IL-21 and Rae-1 markers. The data suggest that Bio-CS increased the inhibition of liver cancer cell proliferation in vitro and the activation of the cellular immunity in vivo. PMID:28938619
Engineering bacterial thiosulfate and tetrathionate sensors for detecting gut inflammation.
Daeffler, Kristina N-M; Galley, Jeffrey D; Sheth, Ravi U; Ortiz-Velez, Laura C; Bibb, Christopher O; Shroyer, Noah F; Britton, Robert A; Tabor, Jeffrey J
2017-04-03
There is a groundswell of interest in using genetically engineered sensor bacteria to study gut microbiota pathways, and diagnose or treat associated diseases. Here, we computationally identify the first biological thiosulfate sensor and an improved tetrathionate sensor, both two-component systems from marine Shewanella species, and validate them in laboratory Escherichia coli Then, we port these sensors into a gut-adapted probiotic E. coli strain, and develop a method based upon oral gavage and flow cytometry of colon and fecal samples to demonstrate that colon inflammation (colitis) activates the thiosulfate sensor in mice harboring native gut microbiota. Our thiosulfate sensor may have applications in bacterial diagnostics or therapeutics. Finally, our approach can be replicated for a wide range of bacterial sensors and should thus enable a new class of minimally invasive studies of gut microbiota pathways. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.
Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.
Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z
2015-12-28
Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.
Arenskötter, Matthias; Baumeister, Dirk; Kalscheuer, Rainer; Steinbüchel, Alexander
2003-01-01
Gene transfer systems for Gordonia polyisoprenivorans strains VH2 and Y2K based on electroporation and conjugation, respectively, were established. Several parameters were optimized, resulting in transformation efficiencies of >4 × 105 CFU/μg of plasmid DNA. In contrast to most previously described electroporation protocols, the highest efficiencies were obtained by applying a heat shock after the intrinsic electroporation. Under these conditions, transfer and autonomous replication of plasmid pNC9503 was also demonstrated to proceed in G. alkanivorans DSM44187, G. nitida DSM44499T, G. rubropertincta DSM43197T, G. rubropertincta DSM46038, and G. terrae DSM43249T. Conjugational plasmid DNA transfer to G. polyisoprenivorans resulted in transfer frequencies of up to 5 × 10−6 of the recipient cells. Recombinant strains capable of polyhydroxyalkanoate synthesis from alkanes were constructed. PMID:12902293
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
MacDonald, Chris; Piper, Robert C.
2015-01-01
Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547
EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells.
Chen, Peijie; Huang, Yan; Zhang, Bo; Wang, Qiuquan; Bai, Peiming
2014-07-01
EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro . Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer.
AJUBA increases the cisplatin resistance through hippo pathway in cervical cancer.
Bi, Lihong; Ma, Feng; Tian, Rui; Zhou, Yanli; Lan, Weiguang; Song, Quanmao; Cheng, Xiankui
2018-02-20
Though LIM-domain protein AJUBA was identified as a putative oncogene, the function and underlying mechanisms of AJUBA in cervical cancer remain largely unknown. Firstly, AJUBA expression was detected via real-time quantitative PCR in patients' samples. Furthermore, Hela and Siha cells were transfected with AJUBA-overexpressing plasmids, and then exposed to cisplatin, the apoptosis was measured by cytometry assay. In addition, the expression of YAP and TAZ was disclosed through western blot assay. Our results revealed that AJUBA expression was significantly higher in the cervical cancer patients resistant to cisplatin treatment compared with cervical cancer patients sensitive to cisplatin treatment. In addition, overall survival time was significantly shorter in the cervical cancer patients with high AJUBA expression compare with those with low AJUBA expression using kaplan-meier analysis. Hela and Siha cells transfected with AJUBA-expressing plasmids exposed to cisplatin treatment had higher survival rate compared with the cells transfected with empty vector control. Mechanistic studies revealed the AJUBA upregulated the downstream targets YAP and TAZ. These results suggest that high AJUBA level enhances cervical cancer cells drug resistance to cisplatin, also associates with decreased patient survival times. Copyright © 2017 Elsevier B.V. All rights reserved.
Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus
2016-02-01
Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Anti-quorum sensing activity of essential oils from Colombian plants.
Jaramillo-Colorado, Beatriz; Olivero-Verbel, Jesus; Stashenko, Elena E; Wagner-Döbler, Irene; Kunze, Brigitte
2012-01-01
Essential oils from Colombian plants were characterised by GC-MS, and assayed for anti-quorum sensing activity in bacteria sensor strains. Two major chemotypes were found for Lippia alba, the limonene-carvone and the citral (geranial-neral). For other species, the main components included α-pinene (Ocotea sp.), β-pinene (Swinglea glutinosa), cineol (Elettaria cardamomun), α-zingiberene (Zingiber officinale) and pulegone (Minthostachys mollis). Several essential oils presented promising inhibitory properties for the short chain AHL quorum sensing (QS) system, in Escherichia coli containing the biosensor plasmid pJBA132, in particular Lippia alba. Moderate activity as anti-QS using the same plasmid, were also found for selected constituents of essential oils studied here, such as citral, carvone and α-pinene, although solely at the highest tested concentration (250 µg mL(-1)). Only citral presented some activity for the long chain AHL QS system, in Pseudomonas putida containing the plasmid pRK-C12. In short, essential oils from Colombian flora have promising properties as QS modulators.
Godovikova, Valentina; Goetting-Minesky, M. Paula; Shin, Jae M.; Kapila, Yvonne L.; Rickard, Alexander H.
2015-01-01
Oral pathogens, including Treponema denticola, initiate the dysregulation of tissue homeostasis that characterizes periodontitis. However, progress of research on the roles of T. denticola in microbe-host interactions and signaling, microbial communities, microbial physiology, and molecular evolution has been hampered by limitations in genetic methodologies. This is typified by an extremely low transformation efficiency and inability to transform the most widely studied T. denticola strain with shuttle plasmids. Previous studies have suggested that robust restriction-modification (R-M) systems in T. denticola contributed to these problems. To facilitate further molecular genetic analysis of T. denticola behavior, we optimized existing protocols such that shuttle plasmid transformation efficiency was increased by >100-fold over prior reports. Here, we report routine transformation of T. denticola ATCC 35405 with shuttle plasmids, independently of both plasmid methylation status and activity of the type II restriction endonuclease encoded by TDE0911. To validate the utility of this methodological advance, we demonstrated expression and activity in T. denticola of a flavin mononucleotide-based fluorescent protein (FbFP) that is active under anoxic conditions. Addition of routine plasmid-based fluorescence labeling to the Treponema toolset will enable more-rigorous and -detailed studies of the behavior of this organism. PMID:26162875
[Establishment of RAW264.7 cell strain stably expressing RFP-GFP-LC3].
Wang, Wan; Zhang, Qing; Zhao, Runpeng; Xu, Xuewei; Xing, Yingru; Zhang, Rongbo; Wu, Jing; Hu, Dong
2015-09-01
To establish murine macrophage RAW264.7 cell strain with stable expression of red fluorescent protein-green fluorescent protein-microtubule associated protein light chain 3 (RFP-GFP-LC3). A lentiviral vector containing RFP-GFP-LC3 gene was constructed and then packaged in HEK293T cells with the packaging plasmids. The viral supernatant was collected to infect RAW264.7 cells. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 was screened with puromycin and analyzed with flow cytometry and fluorescent microscopy for infection efficiency. The number of RFP-GFP-LC3 puncta was observed using florescence microscopy following starvation treatment. The recombinant lentivirus pLV-CMV-RFP-GFP-LC3 was successfully constructed. The RAW264.7 cells with stable expression of RFP-GFP-LC3 were obtained by viral infection and puromycin screening. Fluorescent microscopy and flow cytometry demonstrated the expression rates of RFP and GFP reached to 100%. The number of autophagic puncta significantly increased after starvation treatment. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 has been successfully constructed, which provides a reliable cellular platform for autophagy research.
Selection of optimal sensors for predicting performance of polymer electrolyte membrane fuel cell
NASA Astrophysics Data System (ADS)
Mao, Lei; Jackson, Lisa
2016-10-01
In this paper, sensor selection algorithms are investigated based on a sensitivity analysis, and the capability of optimal sensors in predicting PEM fuel cell performance is also studied using test data. The fuel cell model is developed for generating the sensitivity matrix relating sensor measurements and fuel cell health parameters. From the sensitivity matrix, two sensor selection approaches, including the largest gap method, and exhaustive brute force searching technique, are applied to find the optimal sensors providing reliable predictions. Based on the results, a sensor selection approach considering both sensor sensitivity and noise resistance is proposed to find the optimal sensor set with minimum size. Furthermore, the performance of the optimal sensor set is studied to predict fuel cell performance using test data from a PEM fuel cell system. Results demonstrate that with optimal sensors, the performance of PEM fuel cell can be predicted with good quality.
Addressing the malaria drug resistance challenge using flow cytometry to discover new antimalarials.
Grimberg, Brian T; Jaworska, Maria M; Hough, Lindsay B; Zimmerman, Peter A; Phillips, James G
2009-09-15
A new flow cytometry method that uses an optimized DNA and RNA staining strategy to monitor the growth and development of the Plasmodium falciparum strain W2mef has been used in a pilot study and has identified Bay 43-9006 1, SU 11274 2, and TMC 125 5 as compounds that exhibit potent (<1 microM) overall and ring stage in vitro antimalarial activity.
Kim, Bieong-Kil; Seu, Young-Bae; Choi, Jong-Soo; Park, Jong-Won; Doh, Kyung-Oh
2015-09-15
Cholesterol-based fluorescent lipids with ether linker were synthesized using NBD (Chol-E-NBD) or Rhodamine B (Chol-E-Rh), and the usefulnesses as fluorescent probes for tracing cholesterol-based liposomes were validated. The fluorescent intensities of liposomes containing these modified lipids were measured and observed under a microscope. Neither compound interfered with the expression of GFP plasmid, and live cell images were obtained without interferences. Changes in the fluorescent intensity of liposomes containing Chol-E-NBD were followed by flow cytometry for up to 24h. These fluorescent lipids could be useful probes for trafficking of cationic liposome-mediated gene delivery. Copyright © 2015 Elsevier Ltd. All rights reserved.
Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer
Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.
2015-01-01
ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514
Optimal Sensor Fusion for Structural Health Monitoring of Aircraft Composite Components
2011-09-01
sensor networks combine or fuse different types of sensors. Fiber Bragg Grating ( FBG ) sensors can be inserted in layers of composite structures to...consideration. This paper describes an example of optimal sensor fusion, which combines FBG sensors and PZT sensors. Optimal sensor fusion tries to find...Fiber Bragg Grating ( FBG ) sensors can be inserted in layers of composite structures to provide local damage detection, while surface mounted
An efficient procedure for the expression and purification of HIV-1 protease from inclusion bodies.
Nguyen, Hong-Loan Thi; Nguyen, Thuy Thi; Vu, Quy Thi; Le, Hang Thi; Pham, Yen; Trinh, Phuong Le; Bui, Thuan Phuong; Phan, Tuan-Nghia
2015-12-01
Several studies have focused on HIV-1 protease for developing drugs for treating AIDS. Recombinant HIV-1 protease is used to screen new drugs from synthetic compounds or natural substances. However, large-scale expression and purification of this enzyme is difficult mainly because of its low expression and solubility. In this study, we constructed 9 recombinant plasmids containing a sequence encoding HIV-1 protease along with different fusion tags and examined the expression of the enzyme from these plasmids. Of the 9 plasmids, pET32a(+) plasmid containing the HIV-1 protease-encoding sequence along with sequences encoding an autocleavage site GTVSFNF at the N-terminus and TEV plus 6× His tag at the C-terminus showed the highest expression of the enzyme and was selected for further analysis. The recombinant protein was isolated from inclusion bodies by using 2 tandem Q- and Ni-Sepharose columns. SDS-PAGE of the obtained HIV-1 protease produced a single band of approximately 13 kDa. The enzyme was recovered efficiently (4 mg protein/L of cell culture) and had high specific activity of 1190 nmol min(-1) mg(-1) at an optimal pH of 4.7 and optimal temperature of 37 °C. This procedure for expressing and purifying HIV-1 protease is now being scaled up to produce the enzyme on a large scale for its application. Copyright © 2015 Elsevier Inc. All rights reserved.
Nassar, Ala F; Wisnewski, Adam V; Raddassi, Khadir
2017-03-01
Analysis of multiplexed assays is highly important for clinical diagnostics and other analytical applications. Mass cytometry enables multi-dimensional, single-cell analysis of cell type and state. In mass cytometry, the rare earth metals used as reporters on antibodies allow determination of marker expression in individual cells. Barcode-based bioassays for CyTOF are able to encode and decode for different experimental conditions or samples within the same experiment, facilitating progress in producing straightforward and consistent results. Herein, an integrated protocol for automated sample preparation for barcoding used in conjunction with mass cytometry for clinical bioanalysis samples is described; we offer results of our work with barcoding protocol optimization. In addition, we present some points to be considered in order to minimize the variability of quantitative mass cytometry measurements. For example, we discuss the importance of having multiple populations during titration of the antibodies and effect of storage and shipping of labelled samples on the stability of staining for purposes of CyTOF analysis. Data quality is not affected when labelled samples are stored either frozen or at 4 °C and used within 10 days; we observed that cell loss is greater if cells are washed with deionized water prior to shipment or are shipped in lower concentration. Once the labelled samples for CyTOF are suspended in deionized water, the analysis should be performed expeditiously, preferably within the first hour. Damage can be minimized if the cells are resuspended in phosphate-buffered saline (PBS) rather than deionized water while waiting for data acquisition.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Rhee, Mun Su; Kim, Jin-Woo; Qian, Yilei; Ingram, L O; Shanmugam, K T
2007-07-01
Bacillus coagulans is a sporogenic lactic acid bacterium that ferments glucose and xylose, major components of plant biomass, a potential feedstock for cellulosic ethanol. The temperature and pH for optimum rate of growth of B. coagulans (50 to 55 degrees C, pH 5.0) are very similar to that of commercially developed fungal cellulases (50 degrees C; pH 4.8). Due to this match, simultaneous saccharification and fermentation (SSF) of cellulose to products by B. coagulans is expected to require less cellulase than needed if the SSF is conducted at a sub-optimal temperature, such as 30 degrees C, the optimum for yeast, the main biocatalyst used by the ethanol industry. To fully exploit B. coagulans as a platform organism, we have developed an electroporation method to transfer plasmid DNA into this genetically recalcitrant bacterium. We also constructed a B. coagulans/E. coli shuttle vector, plasmid pMSR10 that contains the rep region from a native plasmid (pMSR0) present in B. coagulans strain P4-102B. The native plasmid, pMSR0 (6823bp), has 9 ORFs, and replicates by rolling-circle mode of replication. Plasmid pNW33N, developed for Geobacillus stearothermophilus, was also transformed into this host and stably maintained while several other Bacillus/Escherichia coli shuttle vector plasmids were not transformed into B. coagulans. The transformation efficiency of B. coagulans strain P4-102B using the plasmids pNW33N or pMSR10 was about 1.5x10(16) per mole of DNA. The availability of shuttle vectors and an electroporation method is expected to aid in genetic and metabolic engineering of B. coagulans.
Flow cytometric HyPer-based assay for hydrogen peroxide.
Lyublinskaya, O G; Antonov, S A; Gorokhovtsev, S G; Pugovkina, N A; Kornienko, Ju S; Ivanova, Ju S; Shatrova, A N; Aksenov, N D; Zenin, V V; Nikolsky, N N
2018-05-30
HyPer is a genetically encoded fluorogenic sensor for hydrogen peroxide which is generally used for the ratiometric imaging of H 2 O 2 fluxes in living cells. Here, we demonstrate the advantages of HyPer-based ratiometric flow cytometry assay for H 2 O 2 , by using K562 and human mesenchymal stem cell lines expressing HyPer. We show that flow cytometry analysis is suitable to detect HyPer response to submicromolar concentrations of extracellularly added H 2 O 2 that is much lower than concentrations addressed previously in the other HyPer-based assays (such as cell imaging or fluorimetry). Suggested technique is also much more sensitive to hydrogen peroxide than the widespread flow cytometry assay exploiting H 2 O 2 -reactive dye H 2 DCFDA and, contrary to the H 2 DCFDA-based assay, can be employed for the kinetic studies of H 2 O 2 utilization by cells, including measurements of the rate constants of H 2 O 2 removal. In addition, flow cytometry multi-parameter ratiometric measurements enable rapid and high-throughput detection of endogenously generated H 2 O 2 in different subpopulations of HyPer-expressing cells. To sum up, HyPer can be used in multi-parameter flow cytometry studies as a highly sensitive indicator of intracellular H 2 O 2 . Copyright © 2018. Published by Elsevier Inc.
Design and Application of Sensors for Chemical Cytometry.
Vickerman, Brianna M; Anttila, Matthew M; Petersen, Brae V; Allbritton, Nancy L; Lawrence, David S
2018-02-08
The bulk cell population response to a stimulus, be it a growth factor or a cytotoxic agent, neglects the cell-to-cell variability that can serve as a friend or as a foe in human biology. Biochemical variations among closely related cells furnish the basis for the adaptability of the immune system but also act as the root cause of resistance to chemotherapy by tumors. Consequently, the ability to probe for the presence of key biochemical variables at the single-cell level is now recognized to be of significant biological and biomedical impact. Chemical cytometry has emerged as an ultrasensitive single-cell platform with the flexibility to measure an array of cellular components, ranging from metabolite concentrations to enzyme activities. We briefly review the various chemical cytometry strategies, including recent advances in reporter design, probe and metabolite separation, and detection instrumentation. We also describe strategies for improving intracellular delivery, biochemical specificity, metabolic stability, and detection sensitivity of probes. Recent applications of these strategies to small molecules, lipids, proteins, and other analytes are discussed. Finally, we assess the current scope and limitations of chemical cytometry and discuss areas for future development to meet the needs of single-cell research.
Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza
2015-01-01
Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938
Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem
2017-12-16
To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).
Norman, Anders; Hansen, Lars Hestbjerg; Sørensen, Søren J
2006-02-28
Whole-cell biosensors have become popular tools for detection of ecotoxic compounds in environmental samples. We have developed an assay optimized for flow cytometry with detection of genotoxic compounds in mind. The assay features extended pre-incubation and a cell density of only 10(6)-10(7) cells/mL, and proved far more sensitive than a previously published assay using the same biosensor strain. By applying the SOS-green fluorescent protein (GFP) whole-cell biosensor directly to soil microcosms we were also able to evaluate both the applicability and sensitivity of a biosensor based on SOS-induction in whole soil samples. Soil microcosms were spiked with a dilution-series of crude broth extract from the mitomycin C-producing streptomycete Streptomyces caespitosus. Biosensors extracted from these microcosms after 1 day of incubation at 30 degrees C were easily distinguished from extracts of non-contaminated soil particles when using flow cytometry, and induction of the biosensor by mitomycin C was detectable at concentrations as low as 2.5 ng/g of soil.
Serror, Pascale; Sasaki, Takashi; Ehrlich, S. Dusko; Maguin, Emmanuelle
2002-01-01
We describe, for the first time, a detailed electroporation procedure for Lactobacillus delbrueckii. Three L. delbrueckii strains were successfully transformed. Under optimal conditions, the transformation efficiency was 104 transformants per μg of DNA. Using this procedure, we identified several plasmids able to replicate in L. delbrueckii and integrated an integrative vector based on phage integrative elements into the L. delbrueckii subsp. bulgaricus chromosome. These vectors provide a good basis for developing molecular tools for L. delbrueckii and open the field of genetic studies in L. delbrueckii. PMID:11772607
Flow cytometry for receptor analysis from ex-vivo brain tissue in adult rat.
Benoit, A; Guillamin, M; Aitken, P; Smith, P F; Philoxene, B; Sola, B; Poulain, L; Coquerel, A; Besnard, S
2018-07-01
Flow cytometry allows single-cell analysis of peripheral biological samples and is useful in many fields of research and clinical applications, mainly in hematology, immunology, and oncology. In the neurosciences, the flow cytometry separation method was first applied to stem cell extraction from healthy or cerebral tumour tissue and was more recently tested in order to phenotype brain cells, hippocampal neurogenesis, and to detect prion proteins. However, it remains sparsely applied in quantifying membrane receptors in relation to synaptic plasticity. We aimed to optimize a flow cytometric procedure for receptor quantification in neurons and non-neurons. A neural dissociation process, myelin separation, fixation, and membrane permeability procedures were optimized to maximize cell survival and analysis in hippocampal tissue obtained from adult rodents. We then aimed to quantify membrane muscarinic acetylcholine receptors (mAChRs) in rats with and without bilateral vestibular loss (BVL). mAChR's were quantified for neuronal and non-neuronal cells in the hippocampus and striatum following BVL. At day 30 but not at day 7 following BVL, there was a significant increase (P ≤ 0.05) in the percentage of neurons expressing M 2/4 mAChRs in both the hippocampus and the striatum. Here, we showed that flow cytometry appears to be a reliable method of membrane receptor quantification in ex-vivo brain tissue. Copyright © 2018 Elsevier B.V. All rights reserved.
EphA2 enhances the proliferation and invasion ability of LNCaP prostate cancer cells
CHEN, PEIJIE; HUANG, YAN; ZHANG, BO; WANG, QIUQUAN; BAI, PEIMING
2014-01-01
EphA2 is persistently overexpressed and functionally changed in numerous human cancers. However, to the best of our knowledge, the role that EphA2 plays in prostate cancer is not entirely clear. To investigate the roles of EphA2 in the development and progression of prostate cancer, the present study initially evaluated the roles of the EphA2 protein in LNCaP prostate cancer cells using recombinant plasmid, western blot analysis, flow cytometry, Matrigel invasion chamber and the cell counting kit-8 assay. An immunohistochemistry assay was also conducted to observe the effects of EphA2 in prostate cancer tissues. The results demonstrated that the LNCaP human prostate cancer cells that were transfected with pcDNA3.1(+) plasmid-mediated pcDNA3.1(+)-EphA2, markedly enhanced the cell growth and invasion in vitro. Additionally, EphA2 was overexpressed in prostate cancer specimens and the expression of EphA2 was significantly associated with Gleason grade, total prostate-specific antigen, advanced clinical stage and lymph node metastasis. Collectively, these results demonstrate that EphA2 is involved in malignant cell behavior and is a potential therapeutic target in human prostate cancer. PMID:24959216
Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F
2016-01-01
Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.
Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.
2016-01-01
Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731
Qiu, Yong; Zhang, Jing; Li, Bing; Wen, Xianghua; Liang, Peng; Huang, Xia
2018-06-14
Antibiotic resistance genes (ARGs) in environment have become a growing public concern, due to their potential to be obtained by pathogens and their duplication along cell division. Horizontal gene transfer (HGT) was reported to be responsible for ARGs dissemination in microbes, but the HGT feature in environmental biofilm was still unclear due to insufficient assay tools. To address this challenge, we applied a novel microfluidic system to cultivate thin biofilm by continuous supply of nutrients and close contact between cells. Resembling the living state of biofilm in open environment, this chip visualized the transfer of ARG-encoded plasmids RP4 and pKJK5 to the receptors, e.g., activated sludge bacteria. The average plasmid transfer frequency per receptor (T/R) from RP4-hosted Pseudomonas putida KT2440 to activated sludge bacteria was quantified to be 2.5 × 10 -3 via flow cytometry, and T/R for pKJK5-hosted Escherichia coli MG1655 was 8.9 × 10 -3 , while the corresponding average frequencies per donor (T/D) were diverse for the two host strains as 4.3 × 10 -3 and 1.4 × 10 -1 respectively. The difference between T/R and T/D was explained by the plasmid transfer kinetics, implying specific purposes of the two calculations. Finally, we collected the transconjugants by fluorescent activated cell sorting and further sequenced their 16S rDNA. Bacteria from phyla Proteobacteria and Firmicutes were found more susceptible to be transconjugants than those from Bacteroidetes. Our work demonstrated that microfluidic system was advantageous in biofilm HGT study, which can provide more insights into environmental ARG control. Copyright © 2018 Elsevier B.V. All rights reserved.
Structural damage detection-oriented multi-type sensor placement with multi-objective optimization
NASA Astrophysics Data System (ADS)
Lin, Jian-Fu; Xu, You-Lin; Law, Siu-Seong
2018-05-01
A structural damage detection-oriented multi-type sensor placement method with multi-objective optimization is developed in this study. The multi-type response covariance sensitivity-based damage detection method is first introduced. Two objective functions for optimal sensor placement are then introduced in terms of the response covariance sensitivity and the response independence. The multi-objective optimization problem is formed by using the two objective functions, and the non-dominated sorting genetic algorithm (NSGA)-II is adopted to find the solution for the optimal multi-type sensor placement to achieve the best structural damage detection. The proposed method is finally applied to a nine-bay three-dimensional frame structure. Numerical results show that the optimal multi-type sensor placement determined by the proposed method can avoid redundant sensors and provide satisfactory results for structural damage detection. The restriction on the number of each type of sensors in the optimization can reduce the searching space in the optimization to make the proposed method more effective. Moreover, how to select a most optimal sensor placement from the Pareto solutions via the utility function and the knee point method is demonstrated in the case study.
Enhancing magnetic nanoparticle-based DNA transfection: Intracellular-active cassette features
NASA Astrophysics Data System (ADS)
Vernon, Matthew Martin
Efficient plasmid DNA transfection of embryonic stem cells, mesenchymal stem cells, neural cell lines and the majority of primary cell lines is a current challenge in gene therapy research. Magnetic nanoparticle-based DNA transfection is a gene vectoring technique that is promising because it is capable of outperforming most other non-viral transfection methods in terms of both transfection efficiency and cell viability. The nature of the DNA vector implemented depends on the target cell phenotype, where the particle surface chemistry and DNA binding/unbinding kinetics of the DNA carrier molecule play a critical role in the many steps required for successful gene transfection. Accordingly, Neuromag, an iron oxide/polymer nanoparticle optimized for transfection of neural phenotypes, outperforms many other nanoparticles and lipidbased DNA carriers. Up to now, improvements to nanomagnetic transfection techniques have focused mostly on particle functionalization and transfection parameter optimization (cell confluence, growth media, serum starvation, magnet oscillation parameters, etc.). None of these parameters are capable of assisting the nuclear translocation of delivered plasmid DNA once the particle-DNA complex is released from the endosome and dissociates in the cell's cytoplasm. In this study, incorporation of a DNA targeting sequence (DTS) feature in the transfecting plasmid DNA confers improved nuclear translocation, demonstrating significant improvement in nanomagnetic transfection efficiency in differentiated SH-SY5Y neuroblastoma cells. Other parameters, such as days in vitro, are also found to play a role and represent potential targets for further optimization.
Rapid protein production from stable CHO cell pools using plasmid vector and the cumate gene-switch.
Poulain, Adeline; Perret, Sylvie; Malenfant, Félix; Mullick, Alaka; Massie, Bernard; Durocher, Yves
2017-08-10
To rapidly produce large amounts of recombinant proteins, the generation of stable Chinese Hamster Ovary (CHO) cell pools represents a useful alternative to large-scale transient gene expression (TGE). We have developed a cell line (CHO BRI/rcTA ) allowing the inducible expression of recombinant proteins, based on the cumate gene switch. After the identification of optimal plasmid DNA topology (supercoiled vs linearized plasmid) for PEIpro™ mediated transfection and of optimal conditions for methionine sulfoximine (MSX) selection, we were able to generate CHO BRI/rcTA pools producing high levels of recombinant proteins. Volumetric productivities of up to 900mg/L were reproducibly achieved for a Fc fusion protein and up to 350mg/L for an antibody after 14days post-induction in non-optimized fed-batch cultures. In addition, we show that CHO pool volumetric productivities are not affected by a freeze-thaw cycle or following maintenance in culture for over one month in the presence of MSX. Finally, we demonstrate that volumetric protein production with the CR5 cumate-inducible promoter is three- to four-fold higher than with the human CMV or hybrid EF1α-HTLV constitutive promoters. These results suggest that the cumate-inducible CHO BRI/rcTA stable pool platform is a powerful and robust system for the rapid production of gram amounts of recombinant proteins. Crown Copyright © 2017. Published by Elsevier B.V. All rights reserved.
Optimization of a one-step heat-inducible in vivo mini DNA vector production system.
Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.
Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System
Wettig, Shawn; Slavcev, Roderick A.
2014-01-01
While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704
Data-driven sensor placement from coherent fluid structures
NASA Astrophysics Data System (ADS)
Manohar, Krithika; Kaiser, Eurika; Brunton, Bingni W.; Kutz, J. Nathan; Brunton, Steven L.
2017-11-01
Optimal sensor placement is a central challenge in the prediction, estimation and control of fluid flows. We reinterpret sensor placement as optimizing discrete samples of coherent fluid structures for full state reconstruction. This permits a drastic reduction in the number of sensors required for faithful reconstruction, since complex fluid interactions can often be described by a small number of coherent structures. Our work optimizes point sensors using the pivoted matrix QR factorization to sample coherent structures directly computed from flow data. We apply this sampling technique in conjunction with various data-driven modal identification methods, including the proper orthogonal decomposition (POD) and dynamic mode decomposition (DMD). In contrast to POD-based sensors, DMD demonstrably enables the optimization of sensors for prediction in systems exhibiting multiple scales of dynamics. Finally, reconstruction accuracy from pivot sensors is shown to be competitive with sensors obtained using traditional computationally prohibitive optimization methods.
O'Mahony, Kevin; Freitag, Ruth; Hilbrig, Frank; Müller, Patrick; Schumacher, Ivo
2005-09-23
The paper addresses the question of how to achieve bacterial lysis in large-scale plasmid DNA production processes, where conventional alkaline lysis may become awkward to handle. Bacteria were grown in shaker flasks and a bioreactor. Suboptimal growth conditions were found advantageous for stable plasmid production at high copy numbers (up to 25mg/L could be achieved). Cells were harvested by filtration in the presence of a filter aid. A linear relationship between the biomass and the optimal filter aid concentration in terms of back pressure could be established. Bacteria-containing filter cakes were washed with isotonic buffer and lysis was achieved in situ by a two-step protocol calling for fragilisation of the cells followed by heat lysis in a suitable buffer. RNA and other soluble cell components where washed out of the cake during this step, while the plasmid DNA was retained. Afterwards a clear lysate containing relatively pure plasmid DNA could be eluted from the cake mostly as the desired supercoiled topoisomer, while cell debris and genomic DNA were retained. Lysis is, thus, integrated not only with cell capture but also with a significant degree of isolation/purification, as most impurities were considerably reduced during the procedure.
Niu, Ying; Li, Jian-Sheng; Luo, Xian-Run
2014-01-25
This work aimed to study a novel transgenic expression system of the CD/TK double suicide genes enhanced by the nuclear matrix attachment region (MAR) for gene therapy. The recombinant vector pMS-CD/TK containing the MAR-survivin promoter-CD/TK cassette was developed and transfected into human gastric cancer SGC-7901 cells. Expression of the CD/TK genes was detected by quantitative real-time PCR (qPCR) and Western blot. Cell viability and apoptosis were measured using the methyl thiazolyl tetrazolium (MTT) assay and flow cytometry. When the MAR fragment was inserted into the upstream of the survivin promoter, the qPCR result showed that the expression of the CD/TK genes significantly increased 7.7-fold in the transgenic SGC-7901 cells with plasmid pMS-CD/TK compared with that without MAR. MTT and flow cytometry analyses indicated that treatment with the prodrugs (5-FC+GCV) significantly decreased the cellular survival rate and enhanced the cellular apoptosis in the SGC-7901 cells. The expression of the CD/TK double suicide genes driven by the survivin promoter can be enhanced by the MAR fragment in human gastric cancer cells. Copyright © 2013 Elsevier B.V. All rights reserved.
Chen, Yuncong; Zhu, Chengcheng; Cen, Jiajie; Bai, Yang; He, Weijiang; Guo, Zijian
2015-05-01
The homeostasis of mitochondrial pH (pH m ) is crucial in cell physiology. Developing small-molecular fluorescent sensors for the ratiometric detection of pH m fluctuation is highly demanded yet challenging. A ratiometric pH sensor, Mito-pH , was constructed by integrating a pH-sensitive FITC fluorophore with a pH-insensitive hemicyanine group. The hemicyanine group also acts as the mitochondria targeting group due to its lipophilic cationic nature. Besides its ability to target mitochondria, this sensor provides two ratiometric pH sensing modes, the dual excitation/dual emission mode (D ex /D em ) and dual excitation (D ex ) mode, and its linear and reversible ratiometric response range from pH 6.15 to 8.38 makes this sensor suitable for the practical tracking of pH m fluctuation in live cells. With this sensor, stimulated pH m fluctuation has been successfully tracked in a ratiometric manner via both fluorescence imaging and flow cytometry.
NASA Astrophysics Data System (ADS)
Lehner, Roman; Liu, Kegang; Wang, Xueya; Wolf, Marc; Hunziker, Patrick
2017-04-01
Cationic polymers as non-viral gene delivery carriers are widely used because of their strong condensing properties and long-term safety, but acute cytotoxicity is a persistent challenge. In this study, two types of polyplexes were prepared by co-formulating plasmid DNA and two cationic diblock copolymers PABOXA5-b-PMOXA33-PA (primary amine) and PABOXA5-b-PMOXA33-TA (tertiary amine) to check their transfection efficacies in HeLa cells and HEK293T cells, respectively. The plasmid DNA/PABOXA5-b-PMOXA33-PA polyplex showed higher transfection efficacy compared to the plasmid DNA/PABOXA5-b-PMOXA33-TA polyplex under an N/P ratio of 40. Both polymers exhibited low toxicity, attributed to the shielding effect of a hydrophilic, noncharged block. Mechanistic insight into differential transfection efficiencies of the polymers were gained by visualization and comparison of the condensates via transmission electron and atomic force microscopy. The results provide information suited for further structure optimization of polymers that are aimed for targeted gene delivery.
Almeida, A M; Queiroz, J A; Sousa, F; Sousa, A
2015-01-26
The progress of DNA vaccines is dependent on the development of suitable chromatographic procedures to successfully purify genetic vectors, such as plasmid DNA. Human Papillomavirus is associated with the development of tumours due to the oncogenic power of E6 and E7 proteins, produced by this virus. The supercoiled HPV-16 E6/E7 plasmid-based vaccine was recently purified with the arginine monolith, with 100% of purity, but only 39% of recovery was achieved. Therefore, the present study describes the application of experimental design tools, a newly explored methodology in preparative chromatography, in order to improve the supercoiled plasmid DNA recovery with the arginine monolith, maintaining the high purity degree. In addition, the importance and influence of pH in the pDNA retention to the arginine ligand was also demonstrated. The Composite Central Face design was validated and the recovery of the target molecule was successfully improved from 39% to 83.5%, with an outstanding increase of more than double, while maintaining 100% of purity. Copyright © 2014 Elsevier B.V. All rights reserved.
Optimization of kinetic parameters for the degradation of plasmid DNA in rat plasma
NASA Astrophysics Data System (ADS)
Chaudhry, Q. A.
2014-12-01
Biotechnology is a rapidly growing area of research work in the field of pharmaceutical sciences. The study of pharmacokinetics of plasmid DNA (pDNA) is an important area of research work. It has been observed that the process of gene delivery faces many troubles on the transport of pDNA towards their target sites. The topoforms of pDNA has been termed as super coiled (S-C), open circular (O-C) and linear (L), the kinetic model of which will be presented in this paper. The kinetic model gives rise to system of ordinary differential equations (ODEs), the exact solution of which has been found. The kinetic parameters, which are responsible for the degradation of super coiled, and the formation of open circular and linear topoforms have a great significance not only in vitro but for modeling of further processes as well, therefore need to be addressed in great detail. For this purpose, global optimization techniques have been adopted, thus finding the optimal results for the said model. The results of the model, while using the optimal parameters, were compared against the measured data, which gives a nice agreement.
Viral Diversity Threshold for Adaptive Immunity in Prokaryotes
Weinberger, Ariel D.; Wolf, Yuri I.; Lobkovsky, Alexander E.; Gilmore, Michael S.; Koonin, Eugene V.
2012-01-01
ABSTRACT Bacteria and archaea face continual onslaughts of rapidly diversifying viruses and plasmids. Many prokaryotes maintain adaptive immune systems known as clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (Cas). CRISPR-Cas systems are genomic sensors that serially acquire viral and plasmid DNA fragments (spacers) that are utilized to target and cleave matching viral and plasmid DNA in subsequent genomic invasions, offering critical immunological memory. Only 50% of sequenced bacteria possess CRISPR-Cas immunity, in contrast to over 90% of sequenced archaea. To probe why half of bacteria lack CRISPR-Cas immunity, we combined comparative genomics and mathematical modeling. Analysis of hundreds of diverse prokaryotic genomes shows that CRISPR-Cas systems are substantially more prevalent in thermophiles than in mesophiles. With sequenced bacteria disproportionately mesophilic and sequenced archaea mostly thermophilic, the presence of CRISPR-Cas appears to depend more on environmental temperature than on bacterial-archaeal taxonomy. Mutation rates are typically severalfold higher in mesophilic prokaryotes than in thermophilic prokaryotes. To quantitatively test whether accelerated viral mutation leads microbes to lose CRISPR-Cas systems, we developed a stochastic model of virus-CRISPR coevolution. The model competes CRISPR-Cas-positive (CRISPR-Cas+) prokaryotes against CRISPR-Cas-negative (CRISPR-Cas−) prokaryotes, continually weighing the antiviral benefits conferred by CRISPR-Cas immunity against its fitness costs. Tracking this cost-benefit analysis across parameter space reveals viral mutation rate thresholds beyond which CRISPR-Cas cannot provide sufficient immunity and is purged from host populations. These results offer a simple, testable viral diversity hypothesis to explain why mesophilic bacteria disproportionately lack CRISPR-Cas immunity. More generally, fundamental limits on the adaptability of biological sensors (Lamarckian evolution) are predicted. PMID:23221803
Palumbo, R. Noelle; Zhong, Xiao; Panus, David; Han, Wenqing; Ji, Weihang; Wang, Chun
2012-01-01
DNA vaccination using cationic polymers as carriers has the potential to be a very powerful method of immunotherapy, but typical immune responses generated have been less than robust. To better understand the details of DNA vaccine delivery in vivo, we prepared polymer/DNA complexes using three structurally distinct cationic polymers and fluorescently labeled plasmid DNA and injected them intradermally into mice. We analyzed transgene expression (luciferase) and the local tissue distribution of the labeled plasmid at the injection site at various time points (from hours to days). Comparable numbers of luciferase expressing cells were observed in the skin of mice receiving naked plasmid or polyplexes one day after transfection. At day 4, however, the polyplexes appeared to result in more transfected skin cells than naked plasmid. Live animal imaging revealed that naked plasmid dispersed quickly in the skin of mice after injection and had a wider distribution than any of the three types of polyplexes. However, naked plasmid level dropped to below detection limit after 24 h, whereas polyplexes persisted for up to 2 weeks. The PEGylated polyplexes had a significantly wider distribution in the tissue than the nonPEGylated polyplexes. PEGylated polyplexes also distributed more broadly among dermal fibroblasts and allowed greater interaction with antigen-presenting cells (APCs) (dendritic cells and macrophages) starting at around 24 h post-injection. By day 4, co-localization of polyplexes with APCs was observed at the injection site regardless of polymer structure, whereas small amounts of polyplexes were found in the draining lymph nodes. These in vivo findings demonstrate the superior stability of PEGylated polyplexes in physiological milieu and provide important insight on how cationic polymers could be optimized for DNA vaccine delivery. PMID:22300619
Optimal Sensor Allocation for Fault Detection and Isolation
NASA Technical Reports Server (NTRS)
Azam, Mohammad; Pattipati, Krishna; Patterson-Hine, Ann
2004-01-01
Automatic fault diagnostic schemes rely on various types of sensors (e.g., temperature, pressure, vibration, etc) to measure the system parameters. Efficacy of a diagnostic scheme is largely dependent on the amount and quality of information available from these sensors. The reliability of sensors, as well as the weight, volume, power, and cost constraints, often makes it impractical to monitor a large number of system parameters. An optimized sensor allocation that maximizes the fault diagnosibility, subject to specified weight, volume, power, and cost constraints is required. Use of optimal sensor allocation strategies during the design phase can ensure better diagnostics at a reduced cost for a system incorporating a high degree of built-in testing. In this paper, we propose an approach that employs multiple fault diagnosis (MFD) and optimization techniques for optimal sensor placement for fault detection and isolation (FDI) in complex systems. Keywords: sensor allocation, multiple fault diagnosis, Lagrangian relaxation, approximate belief revision, multidimensional knapsack problem.
Microfluidic flow rate detection based on integrated optical fiber cantilever.
Lien, Victor; Vollmer, Frank
2007-10-01
We demonstrate an integrated microfluidic flow sensor with ultra-wide dynamic range, suitable for high throughput applications such as flow cytometry and particle sorting/counting. A fiber-tip cantilever transduces flow rates to optical signal readout, and we demonstrate a dynamic range from 0 to 1500 microL min(-1) for operation in water. Fiber-optic sensor alignment is guided by preformed microfluidic channels, and the dynamic range can be adjusted in a one-step chemical etch. An overall non-linear response is attributed to the far-field angular distribution of single-mode fiber output.
Davidsson, Marcus; Diaz-Fernandez, Paula; Schwich, Oliver D.; Torroba, Marcos; Wang, Gang; Björklund, Tomas
2016-01-01
Detailed characterization and mapping of oligonucleotide function in vivo is generally a very time consuming effort that only allows for hypothesis driven subsampling of the full sequence to be analysed. Recent advances in deep sequencing together with highly efficient parallel oligonucleotide synthesis and cloning techniques have, however, opened up for entirely new ways to map genetic function in vivo. Here we present a novel, optimized protocol for the generation of universally applicable, barcode labelled, plasmid libraries. The libraries are designed to enable the production of viral vector preparations assessing coding or non-coding RNA function in vivo. When generating high diversity libraries, it is a challenge to achieve efficient cloning, unambiguous barcoding and detailed characterization using low-cost sequencing technologies. With the presented protocol, diversity of above 3 million uniquely barcoded adeno-associated viral (AAV) plasmids can be achieved in a single reaction through a process achievable in any molecular biology laboratory. This approach opens up for a multitude of in vivo assessments from the evaluation of enhancer and promoter regions to the optimization of genome editing. The generated plasmid libraries are also useful for validation of sequencing clustering algorithms and we here validate the newly presented message passing clustering process named Starcode. PMID:27874090
Poon, S K; Peacock, L; Gibson, W; Gull, K; Kelly, S
2012-02-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes.
Poon, S. K.; Peacock, L.; Gibson, W.; Gull, K.; Kelly, S.
2012-01-01
Here, we present a simple modular extendable vector system for introducing the T7 RNA polymerase and tetracycline repressor genes into Trypanosoma brucei. This novel system exploits developments in our understanding of gene expression and genome organization to produce a streamlined plasmid optimized for high levels of expression of the introduced transgenes. We demonstrate the utility of this novel system in bloodstream and procyclic forms of Trypanosoma brucei, including the genome strain TREU927/4. We validate these cell lines using a variety of inducible experiments that recapture previously published lethal and non-lethal phenotypes. We further demonstrate the utility of the single marker (SmOx) TREU927/4 cell line for in vivo experiments in the tsetse fly and provide a set of plasmids that enable both whole-fly and salivary gland-specific inducible expression of transgenes. PMID:22645659
Copper-resistant halophilic bacterium isolated from the polluted Maruit Lake, Egypt.
Osman, O; Tanguichi, H; Ikeda, K; Park, P; Tanabe-Hosoi, S; Nagata, S
2010-04-01
To isolate and characterize copper-resistant halophilic bacteria from the polluted Maruit Lake, Egypt and identify the role of plasmids in toxic metal resistance. We isolated strain MA2, showing high copper resistance up to the 1.5 mmol l(-1) concentration; it was also resistant to other metals such as nickel, cobalt and zinc and a group of antibiotics. Partial 16S rRNA analysis revealed that strain MA2 belonged to the genus Halomonas. Copper uptake, measured by atomic absorption spectrophotometery, was higher in the absence of NaCl than in the presence of 0.5-1.0 mol l(-1) NaCl during 5-15 min of incubation. Cell fractionation and electron microscopic observation clarified that most of the copper accumulated in the outer membrane and periplasmic fractions of the cells. Plasmid screening yielded two plasmids: pMA21 (11 kb) and pMA22 (5 kb). Plasmid curing resulted in a strain that lost both the plasmids and was sensitive to cobalt and chromate but not copper, nickel and zinc. This cured strain also showed weak growth in the presence of 0.5-1.0 mol l(-1) NaCl. Partial sequencing of both plasmids led to the identification of different toxic metals transporters but copper transporters were not identified. The highest cell viability was found in the presence of 1.0 mol l(-1) NaCl at different copper concentrations, and copper uptake was optimal in the absence of NaCl. Plasmid pMA21 encoded chromate, cobalt, zinc and cadmium transporters, whereas pMA22 encoded specific zinc and RND (resistance, nodulation, cell division) efflux transporters as well as different kinds of metabolic enzymes. Copper resistance was mainly incorporated in the chromosome. Strain MA2 is a fast and efficient tool for copper bioremediation and the isolated plasmids show significant characteristics of both toxic metal and antibiotic resistance.
Development of new plasmid DNA vaccine vectors with R1-based replicons
2012-01-01
Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338
Thermophilic Gram-Positive Biocatalysts for Biomass Conversion to Ethanol
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shanmugam, K.T.; Ingram, L.O.; Maupin-Furlow, J.A.
2003-12-01
Production of energy from renewable sources is receiving increased attention due to the finite nature of fossil fuels and the environmental impact associated with the continued large scale use of fossil energy sources. Biomass, a CO2-neutral abundant resource, is an attractive alternate source of energy. Biomass-derived sugars, such as glucose, xylose, and other minor sugars, can be readily fermented to fuel ethanol and commodity chemicals. Extracellular cellulases produced by fungi are commercially developed for depolymerization of cellulose in biomass to glucose for fermentation by appropriate biocatalysts in a simultaneous saccharification and fermentation (SSF) process. Due to the differences in themore » optimum conditions for the activity of the fungal cellulases and the growth and fermentation characteristics of the current industrial biocatalysts, SSF of cellulose is envisioned at conditions that are not optimal for the fungal cellulase activity leading to higher than required cost of cellulase in SSF. We have isolated bacterial biocatalysts whose growth and fermentation requirements match the optimum conditions for commercial fungal cellulase activity (pH 5.0 and 50 deg. C). These isolates fermented both glucose and xylose, major components of cellulose and hemicellulose, respectively, to L(+)-lactic acid. Xylose was metabolized through the pentose-phosphate pathway by these organisms as evidenced by the fermentation profile and analysis of the fermentation products of 13C1-xylose by NMR. As expected for the metabolism of xylose by the pentose-phosphate pathway, 13C-lactate accounted for more than 90% of the total 13C-labeled products. All three strains fermented crystalline cellulose to lactic acid with the addition of fungal cellulase (Spezyme CE) (SSF) at an optimum of about 10 FPU/g cellulose. These isolates also fermented cellulose and sugar cane bagasse hemicellulose acid hydrolysate simultaneously. Based on fatty acid profile and 16S rRNA sequence, these isolates cluster with Bacillus coagulans although B. coagulans type strain, ATCC 7050, failed to utilize xylose as a carbon source. For successful production of ethanol from pyruvate, both pyruvate decarboxylase (PDC) and alcohol dehydrogenase (AHD) need to be produced at optimal levels in these biocatalysts. A plasmid containing the S. ventriculi pdc gene and the adh gene from geobacillus stearothermophilus was constructed using plasmid pWH1520 that was successfully used for expression of pdc in B. megaterium. The resulting portable ethanol (PET) plasmid, pJAM423, was transformed into B. megaterium. After xylose induction, a significant fraction of cell cytoplasm was composed of the S. ventriculi PDC and G. stearothermophilus ADH proteins. In preliminary experiments, the amount of ethanol produced by b. megaterium with plasmid pJAM423 was about twice (20 mM) of the bacterium without the plasmid. These results show that the PET operon is functional in B. megaterium but high level ethanol production needs further genetic and metabolic engineering. A genetic transfer system for the second generation biocatalysts needs to be developed for transferring the plasmid pJAM423 and its derivatives for engineering these organisms for ethanol production from biomass derived sugars and cellulose to ethanol. One of the new biocatalysts, strain P4-102B was found to be transformable with plasmids and the method for introducing plasmid pJAM423 into this strain and expression of the encoded DNA is being optimized. These new second generation biocatalysts have the potential to reduce the cost of SSF by minimizing the amount of fungal cellulases, a significant cost component in the use of biomass as a renewable resource for production of fuels and chemicals.« less
Nowell, Victoria J; Kropinski, Andrew M; Songer, J Glenn; MacInnes, Janet I; Parreira, Valeria R; Prescott, John F
2012-01-01
Clostridium perfringens is a common inhabitant of the avian and mammalian gastrointestinal tracts and can behave commensally or pathogenically. Some enteric diseases caused by type A C. perfringens, including bovine clostridial abomasitis, remain poorly understood. To investigate the potential basis of virulence in strains causing this disease, we sequenced the genome of a type A C. perfringens isolate (strain F262) from a case of bovine clostridial abomasitis. The ∼3.34 Mbp chromosome of C. perfringens F262 is predicted to contain 3163 protein-coding genes, 76 tRNA genes, and an integrated plasmid sequence, Cfrag (∼18 kb). In addition, sequences of two complete circular plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), and two incomplete plasmid fragments, pF262A (48.5 kb) and pF262B (50.0 kb), were identified. Comparison of the chromosome sequence of C. perfringens F262 to complete C. perfringens chromosomes, plasmids and phages revealed 261 unique genes. No novel toxin genes related to previously described clostridial toxins were identified: 60% of the 261 unique genes were hypothetical proteins. There was a two base pair deletion in virS, a gene reported to encode the main sensor kinase involved in virulence gene activation. Despite this frameshift mutation, C. perfringens F262 expressed perfringolysin O, alpha-toxin and the beta2-toxin, suggesting that another regulation system might contribute to the pathogenicity of this strain. Two complete plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), unique to this strain of C. perfringens were identified.
Nowell, Victoria J.; Kropinski, Andrew M.; Songer, J. Glenn; MacInnes, Janet I.; Parreira, Valeria R.; Prescott, John F.
2012-01-01
Clostridium perfringens is a common inhabitant of the avian and mammalian gastrointestinal tracts and can behave commensally or pathogenically. Some enteric diseases caused by type A C. perfringens, including bovine clostridial abomasitis, remain poorly understood. To investigate the potential basis of virulence in strains causing this disease, we sequenced the genome of a type A C. perfringens isolate (strain F262) from a case of bovine clostridial abomasitis. The ∼3.34 Mbp chromosome of C. perfringens F262 is predicted to contain 3163 protein-coding genes, 76 tRNA genes, and an integrated plasmid sequence, Cfrag (∼18 kb). In addition, sequences of two complete circular plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), and two incomplete plasmid fragments, pF262A (48.5 kb) and pF262B (50.0 kb), were identified. Comparison of the chromosome sequence of C. perfringens F262 to complete C. perfringens chromosomes, plasmids and phages revealed 261 unique genes. No novel toxin genes related to previously described clostridial toxins were identified: 60% of the 261 unique genes were hypothetical proteins. There was a two base pair deletion in virS, a gene reported to encode the main sensor kinase involved in virulence gene activation. Despite this frameshift mutation, C. perfringens F262 expressed perfringolysin O, alpha-toxin and the beta2-toxin, suggesting that another regulation system might contribute to the pathogenicity of this strain. Two complete plasmids, pF262C (4.8 kb) and pF262D (9.1 kb), unique to this strain of C. perfringens were identified. PMID:22412860
Plasmids with a Chromosome-Like Role in Rhizobia ▿ †
Landeta, Cristina; Dávalos, Araceli; Cevallos, Miguel Ángel; Geiger, Otto; Brom, Susana; Romero, David
2011-01-01
Replicon architecture in bacteria is commonly comprised of one indispensable chromosome and several dispensable plasmids. This view has been enriched by the discovery of additional chromosomes, identified mainly by localization of rRNA and/or tRNA genes, and also by experimental demonstration of their requirement for cell growth. The genome of Rhizobium etli CFN42 is constituted by one chromosome and six large plasmids, ranging in size from 184 to 642 kb. Five of the six plasmids are dispensable for cell viability, but plasmid p42e is unusually stable. One possibility to explain this stability would be that genes on p42e carry out essential functions, thus making it a candidate for a secondary chromosome. To ascertain this, we made an in-depth functional analysis of p42e, employing bioinformatic tools, insertional mutagenesis, and programmed deletions. Nearly 11% of the genes in p42e participate in primary metabolism, involving biosynthetic functions (cobalamin, cardiolipin, cytochrome o, NAD, and thiamine), degradation (asparagine and melibiose), and septum formation (minCDE). Synteny analysis and incompatibility studies revealed highly stable replicons equivalent to p42e in content and gene order in other Rhizobium species. A systematic deletion analysis of p42e allowed the identification of two genes (RHE_PE00001 and RHE_PE00024), encoding, respectively, a hypothetical protein with a probable winged helix-turn-helix motif and a probable two-component sensor histidine kinase/response regulator hybrid protein, which are essential for growth in rich medium. These data support the proposal that p42e and its homologous replicons (pA, pRL11, pRLG202, and pR132502) merit the status of secondary chromosomes. PMID:21217003
Cheloni, Giulia; Slaveykova, Vera I
2013-10-01
Lipid oxidation is a recognized end point for the study of oxidative stress and is an important parameter to describe the mode of micropollutant action on aquatic microorganisms. Therefore, the development of quick and reliable methodologies probing the oxidative stress and damage in living cells is highly sought. In the present proof-of-concept work, we examined the potential of the fluorescent dye C11-BODIPY(591/581) to probe lipid oxidation in the green microalga Chlamydomonas reinhardtii. C11-BODIPY(591/581) staining was combined with flow cytometry measurements to obtain multiparameter information on cellular features and oxidative stress damage within single cells. First, staining conditions were optimized by exploring the capability of the dye to stain algal cells under increasing cell and dye concentrations and different staining procedures. Then lipid oxidation in algae induced by short- and long-term exposures to the three metallic micropollutants, copper, mercury, and nanoparticulate copper oxide, and the two organic contaminants, diethyldithiocarbamate (DDC) and diuron was determined. In this work we pointed out C11-BODIPY(591/581) applicability in a wide range of exposure conditions, including studies of oxidation as a function of time and that it is suitable for in vivo measurements of lipid oxidation due to its high permeation and stability in cells and its low interference with algal autofluorescence. © 2013 International Society for Advancement of Cytometry. Copyright © 2013 International Society for Advancement of Cytometry.
SPOT-A SENSOR PLACEMENT OPTIMIZATION TOOL FOR ...
journal article This paper presents SPOT, a Sensor Placement Optimization Tool. SPOT provides a toolkit that facilitates research in sensor placement optimization and enables the practical application of sensor placement solvers to real-world CWS design applications. This paper provides an overview of SPOT’s key features, and then illustrates how this tool can be flexibly applied to solve a variety of different types of sensor placement problems.
An FPGA Noise Resistant Digital Temperature Sensor with Auto Calibration
2012-03-01
temperature sensor [6] . . . . . . . . . . . . . . 14 9 Two different digital temperature sensor placement algorithms: (a) Grid placement (b) Optimal...create a grid over the FPGA. While this method works reasonably well, it requires many sensors, some of which are unnecessary. The optimal placement, on...temperature sensor placement algorithms: (a) Grid placement (b) Optimal Placement [7] 16 2.4 Summary Integrated circuits’ sensitivity to temperatures has
3D sensor placement strategy using the full-range pheromone ant colony system
NASA Astrophysics Data System (ADS)
Shuo, Feng; Jingqing, Jia
2016-07-01
An optimized sensor placement strategy will be extremely beneficial to ensure the safety and cost reduction considerations of structural health monitoring (SHM) systems. The sensors must be placed such that important dynamic information is obtained and the number of sensors is minimized. The practice is to select individual sensor directions by several 1D sensor methods and the triaxial sensors are placed in these directions for monitoring. However, this may lead to non-optimal placement of many triaxial sensors. In this paper, a new method, called FRPACS, is proposed based on the ant colony system (ACS) to solve the optimal placement of triaxial sensors. The triaxial sensors are placed as single units in an optimal fashion. And then the new method is compared with other algorithms using Dalian North Bridge. The computational precision and iteration efficiency of the FRPACS has been greatly improved compared with the original ACS and EFI method.
McKeone, Richard; Wikstrom, Matthew; Kiel, Christina
2014-01-01
Purpose Following a previous study that demonstrated a correlation between rhodopsin stability and the severity of retinitis pigmentosa (RP), we investigated whether predictions of severity can be improved with a regional analysis of this correlation. The association between changes to the stability of the protein and the relative amount of rhodopsin reaching the plasma membrane was assessed. Methods Crystallography-based estimations of mutant rhodopsin stability were compared with descriptions in the scientific literature of the visual function of mutation carriers to determine the extent of associations between rhodopsin stability and clinical phenotype. To test the findings of this analysis, three residues of a green fluorescent protein (GFP) tagged rhodopsin plasmid were targeted with site-directed random mutagenesis to generate mutant variants with a range of stability changes. These plasmids were transfected into HEK-293 cells, and then flow cytometry was used to measure rhodopsin on the cells’ plasma membrane. The GFP signal was used to measure the ratio between this membrane-bound rhodopsin and total cellular rhodopsin. FoldX stability predictions were then compared with the surface staining data and clinical data from the database to characterize the relationship between rhodopsin stability, the severity of RP, and the expression of rhodopsin at the cell surface. Results There was a strong linear correlation between the scale of the destabilization of mutant variants and the severity of retinal disease. A correlation was also seen in vitro between stability and the amount of rhodopsin at the plasma membrane. Rhodopsin is drastically reduced on the surface of cells transfected with variants that differ in their inherent stability from the wild-type by more than 2 kcal/mol. Below this threshold, surface levels are closer to those of the wild-type. Conclusions There is a correlation between the stability of rhodopsin mutations and disease severity and levels of membrane-bound rhodopsin. Measuring membrane-bound rhodopsin with flow cytometry could improve prognoses for poorly characterized mutations and could provide a platform for measuring the effectiveness of treatments. PMID:24520188
An improved method for large-scale preparation of negatively and positively supercoiled plasmid DNA.
Barth, Marita; Dederich, Debra; Dedon, Peter
2009-07-01
A rigorous understanding of the biological function of superhelical tension in cellular DNA requires the development of new tools and model systems for study. To this end, an ethidium bromide[#x02013]free method has been developed to prepare large quantities of either negatively or positively super-coiled plasmid DNA. The method is based upon the known effects of ionic strength on the direction of binding of DNA to an archaeal histone, rHMfB, with low and high salt concentrations leading to positive and negative DNA supercoiling, respectively. In addition to fully optimized conditions for large-scale (>500 microg) supercoiling reactions, the method is advantageous in that it avoids the use of mutagenic ethidium bromide, is applicable to chemically modified plasmid DNA substrates, and produces both positively and negatively supercoiled DNA using a single set of reagents.
Yu, Yun-Zhou; Ma, Yao; Xu, Wen-Hui; Wang, Shuang; Sun, Zhi-Wei
2015-08-01
DNA vaccines are generally weak stimulators of the immune system. Fortunately, their efficacy can be improved using a viral replicon vector or by the addition of immunostimulatory CpG motifs, although the design of these engineered DNA vectors requires optimization. Our results clearly suggest that multiple copies of three types of CpG motifs or combinations of various types of CpG motifs cloned into a viral replicon vector backbone with strong immunostimulatory activities on human PBMC are efficient adjuvants for these DNA vaccines to modulate and enhance protective immunity against anthrax, although modifications with these different CpG forms in vivo elicited inconsistent immune response profiles. Modification with more copies of CpG motifs elicited more potent adjuvant effects leading to the generation of enhanced immunity, which indicated a CpG motif dose-dependent enhancement of antigen-specific immune responses. Notably, the enhanced and/or synchronous adjuvant effects were observed in modification with combinations of two different types of CpG motifs, which provides not only a contribution to the knowledge base on the adjuvant activities of CpG motifs combinations but also implications for the rational design of optimal DNA vaccines with combinations of CpG motifs as "built-in" adjuvants. We describe an efficient strategy to design and optimize DNA vaccines by the addition of combined immunostimulatory CpG motifs in a viral replicon DNA plasmid to produce strong immune responses, which indicates that the CpG-modified viral replicon DNA plasmid may be desirable for use as vector of DNA vaccines.
Hernandez, Wilmar
2007-01-01
In this paper a survey on recent applications of optimal signal processing techniques to improve the performance of mechanical sensors is made. Here, a comparison between classical filters and optimal filters for automotive sensors is made, and the current state of the art of the application of robust and optimal control and signal processing techniques to the design of the intelligent (or smart) sensors that today's cars need is presented through several experimental results that show that the fusion of intelligent sensors and optimal signal processing techniques is the clear way to go. However, the switch between the traditional methods of designing automotive sensors and the new ones cannot be done overnight because there are some open research issues that have to be solved. This paper draws attention to one of the open research issues and tries to arouse researcher's interest in the fusion of intelligent sensors and optimal signal processing techniques.
Wireless Sensor Network Optimization: Multi-Objective Paradigm.
Iqbal, Muhammad; Naeem, Muhammad; Anpalagan, Alagan; Ahmed, Ashfaq; Azam, Muhammad
2015-07-20
Optimization problems relating to wireless sensor network planning, design, deployment and operation often give rise to multi-objective optimization formulations where multiple desirable objectives compete with each other and the decision maker has to select one of the tradeoff solutions. These multiple objectives may or may not conflict with each other. Keeping in view the nature of the application, the sensing scenario and input/output of the problem, the type of optimization problem changes. To address different nature of optimization problems relating to wireless sensor network design, deployment, operation, planing and placement, there exist a plethora of optimization solution types. We review and analyze different desirable objectives to show whether they conflict with each other, support each other or they are design dependent. We also present a generic multi-objective optimization problem relating to wireless sensor network which consists of input variables, required output, objectives and constraints. A list of constraints is also presented to give an overview of different constraints which are considered while formulating the optimization problems in wireless sensor networks. Keeping in view the multi facet coverage of this article relating to multi-objective optimization, this will open up new avenues of research in the area of multi-objective optimization relating to wireless sensor networks.
Topology Optimization for Energy Management in Underwater Sensor Networks
2015-02-01
1 To appear in International Journal of Control as a regular paper Topology Optimization for Energy Management in Underwater Sensor Networks ⋆ Devesh...K. Jha1 Thomas A. Wettergren2 Asok Ray1 Kushal Mukherjee3 Keywords: Underwater Sensor Network , Energy Management, Pareto Optimization, Adaptation...Optimization for Energy Management in Underwater Sensor Networks 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d
Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J
2018-02-01
Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.
Datta, Dibyadyuti; Bansal, Geetha P; Gerloff, Dietlind L; Ellefsen, Barry; Hannaman, Drew; Kumar, Nirbhay
2017-01-05
Pfs48/45 and Pfs25 are leading candidates for the development of Plasmodium falciparum transmission blocking vaccines (TBV). Expression of Pfs48/45 in the erythrocytic sexual stages and presentation to the immune system during infection in the human host also makes it ideal for natural boosting. However, it has been challenging to produce a fully folded, functionally active Pfs48/45, using various protein expression platforms. In this study, we demonstrate that full-length Pfs48/45 encoded by DNA plasmids is able to induce significant transmission reducing immune responses. DNA plasmids encoding Pfs48/45 based on native (WT), codon optimized (SYN), or codon optimized and mutated (MUT1 and MUT2), to prevent any asparagine (N)-linked glycosylation were compared with or without intramuscular electroporation (EP). EP significantly enhanced antibody titers and transmission blocking activity elicited by immunization with SYN Pfs48/45 DNA vaccine. Mosquito membrane feeding assays also revealed improved functional immunogenicity of SYN Pfs48/45 (N-glycosylation sites intact) as compared to MUT1 or MUT2 Pfs48/45 DNA plasmids (all N-glycosylation sites mutated). Boosting with recombinant Pfs48/45 protein after immunization with each of the different DNA vaccines resulted in significant boosting of antibody response and improved transmission reducing capabilities of all four DNA vaccines. Finally, immunization with a combination of DNA plasmids (SYN Pfs48/45 and SYN Pfs25) also provides support for the possibility of combining antigens targeting different life cycle stages in the parasite during transmission through mosquitoes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.
2014-01-01
Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120
High-Throughput Screening Assay for Embryoid Body Differentiation of Human Embryonic Stem Cells
Outten, Joel T.; Gadue, Paul; French, Deborah L.; Diamond, Scott L.
2012-01-01
Serum-free human pluripotent stem cell media offer the potential to develop reproducible clinically applicable differentiation strategies and protocols. The vast array of possible growth factor and cytokine combinations for media formulations makes differentiation protocol optimization both labor and cost-intensive. This unit describes a 96-well plate, 4-color flow cytometry-based screening assay to optimize pluripotent stem cell differentiation protocols. We provide conditions both to differentiate human embryonic stem cells (hESCs) to the three primary germ layers, ectoderm, endoderm, and mesoderm, and to utilize flow cytometry to distinguish between them. This assay exhibits low inter-well variability and can be utilized to efficiently screen a variety of media formulations, reducing cost, incubator space, and labor. Protocols can be adapted to a variety of differentiation stages and lineages. PMID:22415836
High throughput RNAi assay optimization using adherent cell cytometry.
Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W
2011-04-25
siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.
High throughput RNAi assay optimization using adherent cell cytometry
2011-01-01
Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450
NASA Astrophysics Data System (ADS)
Shah, Amy T.; Cannon, Taylor M.; Higginbotham, Jim N.; Skala, Melissa C.
2016-02-01
Tumor heterogeneity poses challenges for devising optimal treatment regimens for cancer patients. In particular, subpopulations of cells can escape treatment and cause relapse. There is a need for methods to characterize tumor heterogeneity of treatment response. Cell metabolism is altered in cancer (Warburg effect), and cells use the autofluorescent cofactor NADH in numerous metabolic reactions. Previous studies have shown that microscopy measurements of NADH autofluorescence are sensitive to treatment response in breast cancer, and these techniques typically assess hundreds of cells per group. An alternative approach is flow cytometry, which measures fluorescence on a single-cell level and is attractive for characterizing tumor heterogeneity because it achieves high-throughput analysis and cell sorting in millions of cells per group. Current applications for flow cytometry rely on staining with fluorophores. This study characterizes flow cytometry measurements of NADH autofluorescence in breast cancer cells. Preliminary results indicate flow cytometry of NADH is sensitive to cyanide perturbation, which inhibits oxidative phosphorylation, in nonmalignant MCF10A cells. Additionally, flow cytometry is sensitive to higher NADH intensity for HER2-positive SKBr3 cells compared with triple-negative MDA-MB-231 cells. These results agree with previous microscopy studies. Finally, a mixture of SKBr3 and MDA-MB-231 cells were sorted into each cell type using NADH intensity. Sorted cells were cultured, and microscopy validation showed the expected morphology for each cell type. Ultimately, flow cytometry could be applied to characterize tumor heterogeneity based on treatment response and sort cell subpopulations based on metabolic profile. These achievements could enable individualized treatment strategies and improved patient outcomes.
Elsässer, Thilo; Brons, Stephan; Psonka, Katarzyna; Scholz, Michael; Gudowska-Nowak, Ewa; Taucher-Scholz, Gisela
2008-06-01
The investigation of fragment length distributions of plasmid DNA gives insight into the influence of localized energy distribution on the induction of DNA damage, particularly the clustering of double-strand breaks. We present an approach that determines the fragment length distributions of plasmid DNA after heavy-ion irradiation by using the Local Effect Model. We find a good agreement of our simulations with experimental fragment distributions derived from atomic force microscopy (AFM) studies by including experimental constraints typical for AFM. Our calculations reveal that by comparing the fragmentation in terms of fluence, we can uniquely distinguish the effect of different radiation qualities. For very high-LET irradiation using nickel or uranium ions, no difference between their fragment distributions can be expected for the same dose level. However, for carbon ions with an intermediate LET, the fragmentation pattern differs from the distribution for very high-LET particles. The results of the model calculations can be used to determine the optimal experimental parameters for a demonstration of the influence of track structure on primary radiation damage. Additionally, we compare the results of our model for two different plasmid geometries.
2017-01-01
Experiments in synthetic biology and microbiology can benefit from protein expression systems with low cell-to-cell variability (noise) and expression levels precisely tunable across a useful dynamic range. Despite advances in understanding the molecular biology of microbial gene regulation, many experiments employ protein-expression systems exhibiting high noise and nearly all-or-none responses to induction. I present an expression system that incorporates elements known to reduce gene expression noise: negative autoregulation and bicistronic transcription. I show by stochastic simulation that while negative autoregulation can produce a more gradual response to induction, bicistronic expression of a repressor and gene of interest can be necessary to reduce noise below the extrinsic limit. I synthesized a plasmid-based system incorporating these principles and studied its properties in Escherichia coli cells, using flow cytometry and fluorescence microscopy to characterize induction dose-response, induction/repression kinetics and gene expression noise. By varying ribosome binding site strengths, expression levels from 55–10,740 molecules/cell were achieved with noise below the extrinsic limit. Individual strains are inducible across a dynamic range greater than 20-fold. Experimental comparison of different regulatory networks confirmed that bicistronic autoregulation reduces noise, and revealed unexpectedly high noise for a conventional expression system with a constitutively expressed transcriptional repressor. I suggest a hybrid, low-noise expression system to increase the dynamic range. PMID:29084263
Bao, Xu; Li, Haijian; Qin, Lingqiao; Xu, Dongwei; Ran, Bin; Rong, Jian
2016-10-27
To obtain adequate traffic information, the density of traffic sensors should be sufficiently high to cover the entire transportation network. However, deploying sensors densely over the entire network may not be realistic for practical applications due to the budgetary constraints of traffic management agencies. This paper describes several possible spatial distributions of traffic information credibility and proposes corresponding different sensor information credibility functions to describe these spatial distribution properties. A maximum benefit model and its simplified model are proposed to solve the traffic sensor location problem. The relationships between the benefit and the number of sensors are formulated with different sensor information credibility functions. Next, expanding models and algorithms in analytic results are performed. For each case, the maximum benefit, the optimal number and spacing of sensors are obtained and the analytic formulations of the optimal sensor locations are derived as well. Finally, a numerical example is proposed to verify the validity and availability of the proposed models for solving a network sensor location problem. The results show that the optimal number of sensors of segments with different model parameters in an entire freeway network can be calculated. Besides, it can also be concluded that the optimal sensor spacing is independent of end restrictions but dependent on the values of model parameters that represent the physical conditions of sensors and roads.
Bao, Xu; Li, Haijian; Qin, Lingqiao; Xu, Dongwei; Ran, Bin; Rong, Jian
2016-01-01
To obtain adequate traffic information, the density of traffic sensors should be sufficiently high to cover the entire transportation network. However, deploying sensors densely over the entire network may not be realistic for practical applications due to the budgetary constraints of traffic management agencies. This paper describes several possible spatial distributions of traffic information credibility and proposes corresponding different sensor information credibility functions to describe these spatial distribution properties. A maximum benefit model and its simplified model are proposed to solve the traffic sensor location problem. The relationships between the benefit and the number of sensors are formulated with different sensor information credibility functions. Next, expanding models and algorithms in analytic results are performed. For each case, the maximum benefit, the optimal number and spacing of sensors are obtained and the analytic formulations of the optimal sensor locations are derived as well. Finally, a numerical example is proposed to verify the validity and availability of the proposed models for solving a network sensor location problem. The results show that the optimal number of sensors of segments with different model parameters in an entire freeway network can be calculated. Besides, it can also be concluded that the optimal sensor spacing is independent of end restrictions but dependent on the values of model parameters that represent the physical conditions of sensors and roads. PMID:27801794
Optimal Magnetic Sensor Vests for Cardiac Source Imaging
Lau, Stephan; Petković, Bojana; Haueisen, Jens
2016-01-01
Magnetocardiography (MCG) non-invasively provides functional information about the heart. New room-temperature magnetic field sensors, specifically magnetoresistive and optically pumped magnetometers, have reached sensitivities in the ultra-low range of cardiac fields while allowing for free placement around the human torso. Our aim is to optimize positions and orientations of such magnetic sensors in a vest-like arrangement for robust reconstruction of the electric current distributions in the heart. We optimized a set of 32 sensors on the surface of a torso model with respect to a 13-dipole cardiac source model under noise-free conditions. The reconstruction robustness was estimated by the condition of the lead field matrix. Optimization improved the condition of the lead field matrix by approximately two orders of magnitude compared to a regular array at the front of the torso. Optimized setups exhibited distributions of sensors over the whole torso with denser sampling above the heart at the front and back of the torso. Sensors close to the heart were arranged predominantly tangential to the body surface. The optimized sensor setup could facilitate the definition of a standard for sensor placement in MCG and the development of a wearable MCG vest for clinical diagnostics. PMID:27231910
Giant magnetoresistive biosensors for molecular diagnosis: surface chemistry and assay development
NASA Astrophysics Data System (ADS)
Yu, Heng; Osterfeld, Sebastian J.; Xu, Liang; White, Robert L.; Pourmand, Nader; Wang, Shan X.
2008-08-01
Giant magnetoresistive (GMR) biochips using magnetic nanoparticle as labels were developed for molecular diagnosis. The sensor arrays consist of GMR sensing strips of 1.5 μm or 0.75 μm in width. GMR sensors are exquisitely sensitive yet very delicate, requiring ultrathin corrosion-resistive passivation and efficient surface chemistry for oligonucleotide probe immobilization. A mild and stable surface chemistry was first developed that is especially suitable for modifying delicate electronic device surfaces, and a practical application of our GMR biosensors was then demonstrated for detecting four most common human papillomavirus (HPV) subtypes in plasmids. We also showed that the DNA hybridization time could potentially be reduced from overnight to about ten minutes using microfluidics.
Wireless Sensor Network Optimization: Multi-Objective Paradigm
Iqbal, Muhammad; Naeem, Muhammad; Anpalagan, Alagan; Ahmed, Ashfaq; Azam, Muhammad
2015-01-01
Optimization problems relating to wireless sensor network planning, design, deployment and operation often give rise to multi-objective optimization formulations where multiple desirable objectives compete with each other and the decision maker has to select one of the tradeoff solutions. These multiple objectives may or may not conflict with each other. Keeping in view the nature of the application, the sensing scenario and input/output of the problem, the type of optimization problem changes. To address different nature of optimization problems relating to wireless sensor network design, deployment, operation, planing and placement, there exist a plethora of optimization solution types. We review and analyze different desirable objectives to show whether they conflict with each other, support each other or they are design dependent. We also present a generic multi-objective optimization problem relating to wireless sensor network which consists of input variables, required output, objectives and constraints. A list of constraints is also presented to give an overview of different constraints which are considered while formulating the optimization problems in wireless sensor networks. Keeping in view the multi facet coverage of this article relating to multi-objective optimization, this will open up new avenues of research in the area of multi-objective optimization relating to wireless sensor networks. PMID:26205271
2013-03-01
tissue have been optimized • Optimization of flow cytometry-based analyses to characterize co- incident expression of multiple MSC-related markers on a...CA). Mouse anti-human vimentin (clone LN-6) was purchased from Sigma-Aldrich (St. Louis, MO). Goat anti-mouse Alexa Fluor 488, Roswell Park
The optimal location of piezoelectric actuators and sensors for vibration control of plates
NASA Astrophysics Data System (ADS)
Kumar, K. Ramesh; Narayanan, S.
2007-12-01
This paper considers the optimal placement of collocated piezoelectric actuator-sensor pairs on a thin plate using a model-based linear quadratic regulator (LQR) controller. LQR performance is taken as objective for finding the optimal location of sensor-actuator pairs. The problem is formulated using the finite element method (FEM) as multi-input-multi-output (MIMO) model control. The discrete optimal sensor and actuator location problem is formulated in the framework of a zero-one optimization problem. A genetic algorithm (GA) is used to solve the zero-one optimization problem. Different classical control strategies like direct proportional feedback, constant-gain negative velocity feedback and the LQR optimal control scheme are applied to study the control effectiveness.
Masks in Imaging Flow Cytometry
Dominical, Venina; Samsel, Leigh; McCoy, J. Philip
2016-01-01
Data analysis in imaging flow cytometry incorporates elements of flow cytometry together with other aspects of morphological analysis of images. A crucial early step in this analysis is the creation of a mask to distinguish the portion of the image upon which further examination of specified features can be performed. Default masks are provided by the manufacturer of the imaging flow cytometer but additional custom masks can be created by the individual user for specific applications. Flawed or inaccurate masks can have a substantial negative impact on the overall analysis of a sample, thus great care must be taken to ensure the accuracy of masks. Here we discuss various types of masks and cite examples of their use. Furthermore we provide our insight for how to approach selecting and assessing the optimal mask for a specific analysis. PMID:27461256
Alves, L P S; Almeida, A T; Cruz, L M; Pedrosa, F O; de Souza, E M; Chubatsu, L S; Müller-Santos, M; Valdameri, G
2017-01-16
The conventional method for quantification of polyhydroxyalkanoates based on whole-cell methanolysis and gas chromatography (GC) is laborious and time-consuming. In this work, a method based on flow cytometry of Nile red stained bacterial cells was established to quantify poly-3-hydroxybutyrate (PHB) production by the diazotrophic and plant-associated bacteria, Herbaspirillum seropedicae and Azospirillum brasilense. The method consists of three steps: i) cell permeabilization, ii) Nile red staining, and iii) analysis by flow cytometry. The method was optimized step-by-step and can be carried out in less than 5 min. The final results indicated a high correlation coefficient (R2=0.99) compared to a standard method based on methanolysis and GC. This method was successfully applied to the quantification of PHB in epiphytic bacteria isolated from rice roots.
Joint Optimal Placement and Energy Allocation of Underwater Sensors in a Tree Topology
2014-03-10
underwater acoustic sensor nodes with respect to the capacity of the wireless links between the... underwater acoustic sensor nodes with respect to the capacity of the wireless links between the nodes. We assumed that the energy consumption of...nodes’ optimal placements. We achieve the optimal placement of the underwater acoustic sensor nodes with respect to the capacity of the wireless
Cui, Huanqing; Shu, Minglei; Song, Min; Wang, Yinglong
2017-03-01
Localization is a key technology in wireless sensor networks. Faced with the challenges of the sensors' memory, computational constraints, and limited energy, particle swarm optimization has been widely applied in the localization of wireless sensor networks, demonstrating better performance than other optimization methods. In particle swarm optimization-based localization algorithms, the variants and parameters should be chosen elaborately to achieve the best performance. However, there is a lack of guidance on how to choose these variants and parameters. Further, there is no comprehensive performance comparison among particle swarm optimization algorithms. The main contribution of this paper is three-fold. First, it surveys the popular particle swarm optimization variants and particle swarm optimization-based localization algorithms for wireless sensor networks. Secondly, it presents parameter selection of nine particle swarm optimization variants and six types of swarm topologies by extensive simulations. Thirdly, it comprehensively compares the performance of these algorithms. The results show that the particle swarm optimization with constriction coefficient using ring topology outperforms other variants and swarm topologies, and it performs better than the second-order cone programming algorithm.
Modular Engineering of l-Tyrosine Production in Escherichia coli
Juminaga, Darmawi; Baidoo, Edward E. K.; Redding-Johanson, Alyssa M.; Batth, Tanveer S.; Burd, Helcio; Mukhopadhyay, Aindrila; Petzold, Christopher J.
2012-01-01
Efficient biosynthesis of l-tyrosine from glucose is necessary to make biological production economically viable. To this end, we designed and constructed a modular biosynthetic pathway for l-tyrosine production in E. coli MG1655 by encoding the enzymes for converting erythrose-4-phosphate (E4P) and phosphoenolpyruvate (PEP) to l-tyrosine on two plasmids. Rational engineering to improve l-tyrosine production and to identify pathway bottlenecks was directed by targeted proteomics and metabolite profiling. The bottlenecks in the pathway were relieved by modifications in plasmid copy numbers, promoter strength, gene codon usage, and the placement of genes in operons. One major bottleneck was due to the bifunctional activities of quinate/shikimate dehydrogenase (YdiB), which caused accumulation of the intermediates dehydroquinate (DHQ) and dehydroshikimate (DHS) and the side product quinate; this bottleneck was relieved by replacing YdiB with its paralog AroE, resulting in the production of over 700 mg/liter of shikimate. Another bottleneck in shikimate production, due to low expression of the dehydroquinate synthase (AroB), was alleviated by optimizing the first 15 codons of the gene. Shikimate conversion to l-tyrosine was improved by replacing the shikimate kinase AroK with its isozyme, AroL, which effectively consumed all intermediates formed in the first half of the pathway. Guided by the protein and metabolite measurements, the best producer, consisting of two medium-copy-number, dual-operon plasmids, was optimized to produce >2 g/liter l-tyrosine at 80% of the theoretical yield. This work demonstrates the utility of targeted proteomics and metabolite profiling in pathway construction and optimization, which should be applicable to other metabolic pathways. PMID:22020510
Improving Kinematic Accuracy of Soft Wearable Data Gloves by Optimizing Sensor Locations
Kim, Dong Hyun; Lee, Sang Wook; Park, Hyung-Soon
2016-01-01
Bending sensors enable compact, wearable designs when used for measuring hand configurations in data gloves. While existing data gloves can accurately measure angular displacement of the finger and distal thumb joints, accurate measurement of thumb carpometacarpal (CMC) joint movements remains challenging due to crosstalk between the multi-sensor outputs required to measure the degrees of freedom (DOF). To properly measure CMC-joint configurations, sensor locations that minimize sensor crosstalk must be identified. This paper presents a novel approach to identifying optimal sensor locations. Three-dimensional hand surface data from ten subjects was collected in multiple thumb postures with varied CMC-joint flexion and abduction angles. For each posture, scanned CMC-joint contours were used to estimate CMC-joint flexion and abduction angles by varying the positions and orientations of two bending sensors. Optimal sensor locations were estimated by the least squares method, which minimized the difference between the true CMC-joint angles and the joint angle estimates. Finally, the resultant optimal sensor locations were experimentally validated. Placing sensors at the optimal locations, CMC-joint angle measurement accuracies improved (flexion, 2.8° ± 1.9°; abduction, 1.9° ± 1.2°). The proposed method for improving the accuracy of the sensing system can be extended to other types of soft wearable measurement devices. PMID:27240364
Osorio, Johan S; Bionaz, Massimo
2017-08-30
Gene reporter technology (GRT) has opened several new avenues for monitoring biological events including the activation of transcription factors, which are central to the study of nutrigenomics. However, this technology relies heavily on the insertion of foreign plasmid DNA into the nuclei of cells (i.e., transfection), which can be very challenging and highly variable among cell types. The objective of this study was to investigate the optimal conditions to generate reliable GRT assay data on bovine immortalized cell lines, Madin Darby Bovine Kidney (MDBK) and bovine mammary epithelial alveolar (MACT) cells. Results are reported for two experiments. In Experiment 1, using 96 well-plate and a robotic inverted fluorescent microscope, we compared transfection efficiency among commercially available transfection reagents (TR) Lipofectamine® 3000 (Lipo3), Lipofectamine® LTX (LipoLTX), and TransIT-X2® (TransX2), three doses of TR (i.e., 0.15, 0.3, and 0.4μL/well), and three doses of Green Fluorescent Protein plasmid DNA (i.e., 10, 25, and 50ng/well). Transfection efficiency and mortality rate were analyzed using CellProfiler software. Transfection efficiency increased until the end of the experiment (20h post-transfection) at which point MACT had greater transfection than MDBK cells (16.3% vs. 2.2%). It is unclear the reason for the low transfection in MDBK cells. Maximal transfection efficiency was obtained with 0.3μL/well of LipoLTX plus 25ng/well of plasmid DNA (ca. 29.5±1.9%) and 0.15μL/well of LipoLTX plus 25ng/well of plasmid DNA (ca. 4.0±0.4%) for MACT and MDBK cells, respectively. The higher amount of TR and DNA was generally associated with higher cell mortality. Using high, medium, and low transfection efficiency conditions determined in Experiment 1, we performed a GRT assay for peroxisome proliferator-activated response element (PPRE) luciferase in MACT and MDBK cells treated with 10nM or 100nM of synthetic Peroxisome Proliferator-activated Receptor β/σ (PPARβ/σ) agonist. The GRT assay was unaffected by poor transfection in MACT cells although the high transfection hampered the possibility of detecting differences between 10 and 100nM of the PPARβ/δ agonist. In MDBK cells, low transfection efficiency (<2.0%) failed to detect any differences with GRT assay. The level of transfection was positively associated with a lower coefficient of variation of GRT data. Overall, our data indicates that results of GRT assays are affected by transfection efficiency and a minimum transfection of 2% is required. Thus, factors such as TR type, TR amount, and DNA plasmid amount need to be optimized for a specific cell type before performing GRT assays. Copyright © 2017 Elsevier B.V. All rights reserved.
A Java-based tool for the design of classification microarrays.
Meng, Da; Broschat, Shira L; Call, Douglas R
2008-08-04
Classification microarrays are used for purposes such as identifying strains of bacteria and determining genetic relationships to understand the epidemiology of an infectious disease. For these cases, mixed microarrays, which are composed of DNA from more than one organism, are more effective than conventional microarrays composed of DNA from a single organism. Selection of probes is a key factor in designing successful mixed microarrays because redundant sequences are inefficient and limited representation of diversity can restrict application of the microarray. We have developed a Java-based software tool, called PLASMID, for use in selecting the minimum set of probe sequences needed to classify different groups of plasmids or bacteria. The software program was successfully applied to several different sets of data. The utility of PLASMID was illustrated using existing mixed-plasmid microarray data as well as data from a virtual mixed-genome microarray constructed from different strains of Streptococcus. Moreover, use of data from expression microarray experiments demonstrated the generality of PLASMID. In this paper we describe a new software tool for selecting a set of probes for a classification microarray. While the tool was developed for the design of mixed microarrays-and mixed-plasmid microarrays in particular-it can also be used to design expression arrays. The user can choose from several clustering methods (including hierarchical, non-hierarchical, and a model-based genetic algorithm), several probe ranking methods, and several different display methods. A novel approach is used for probe redundancy reduction, and probe selection is accomplished via stepwise discriminant analysis. Data can be entered in different formats (including Excel and comma-delimited text), and dendrogram, heat map, and scatter plot images can be saved in several different formats (including jpeg and tiff). Weights generated using stepwise discriminant analysis can be stored for analysis of subsequent experimental data. Additionally, PLASMID can be used to construct virtual microarrays with genomes from public databases, which can then be used to identify an optimal set of probes.
Chang, Yuchao; Tang, Hongying; Cheng, Yongbo; Zhao, Qin; Yuan, Baoqing Li andXiaobing
2017-07-19
Routing protocols based on topology control are significantly important for improving network longevity in wireless sensor networks (WSNs). Traditionally, some WSN routing protocols distribute uneven network traffic load to sensor nodes, which is not optimal for improving network longevity. Differently to conventional WSN routing protocols, we propose a dynamic hierarchical protocol based on combinatorial optimization (DHCO) to balance energy consumption of sensor nodes and to improve WSN longevity. For each sensor node, the DHCO algorithm obtains the optimal route by establishing a feasible routing set instead of selecting the cluster head or the next hop node. The process of obtaining the optimal route can be formulated as a combinatorial optimization problem. Specifically, the DHCO algorithm is carried out by the following procedures. It employs a hierarchy-based connection mechanism to construct a hierarchical network structure in which each sensor node is assigned to a special hierarchical subset; it utilizes the combinatorial optimization theory to establish the feasible routing set for each sensor node, and takes advantage of the maximum-minimum criterion to obtain their optimal routes to the base station. Various results of simulation experiments show effectiveness and superiority of the DHCO algorithm in comparison with state-of-the-art WSN routing algorithms, including low-energy adaptive clustering hierarchy (LEACH), hybrid energy-efficient distributed clustering (HEED), genetic protocol-based self-organizing network clustering (GASONeC), and double cost function-based routing (DCFR) algorithms.
Priority design parameters of industrialized optical fiber sensors in civil engineering
NASA Astrophysics Data System (ADS)
Wang, Huaping; Jiang, Lizhong; Xiang, Ping
2018-03-01
Considering the mechanical effects and the different paths for transferring deformation, optical fiber sensors commonly used in civil engineering have been systematically classified. Based on the strain transfer theory, the relationship between the strain transfer coefficient and allowable testing error is established. The proposed relationship is regarded as the optimal control equation to obtain the optimal value of sensors that satisfy the requirement of measurement precision. Furthermore, specific optimization design methods and priority design parameters of the classified sensors are presented. This research indicates that (1) strain transfer theory-based optimization design method is much suitable for the sensor that depends on the interfacial shear stress to transfer the deformation; (2) the priority design parameters are bonded (sensing) length, interfacial bonded strength, elastic modulus and radius of protective layer and thickness of adhesive layer; (3) the optimization design of sensors with two anchor pieces at two ends is independent of strain transfer theory as the strain transfer coefficient can be conveniently calibrated by test, and this kind of sensors has no obvious priority design parameters. Improved calibration test is put forward to enhance the accuracy of the calibration coefficient of end-expanding sensors. By considering the practical state of sensors and the testing accuracy, comprehensive and systematic analyses on optical fiber sensors are provided from the perspective of mechanical actions, which could scientifically instruct the application design and calibration test of industrialized optical fiber sensors.
Interleukin-12 plasmid DNA delivery using l-thyroxine-conjugated polyethylenimine nanocarriers
NASA Astrophysics Data System (ADS)
Dehshahri, Ali; Sadeghpour, Hossein; Kazemi Oskuee, Reza; Fadaei, Mahin; Sabahi, Zahra; Alhashemi, Samira Hossaini; Mohazabieh, Erfaneh
2014-05-01
In this study, l-thyroxine was covalently grafted on 25 kDa branched polyethylenimine (PEI), and the ability of the nano-sized polyplexes for transferring plasmid encoding interleukin-12 (IL-12) gene was evaluated. As there are several problems in systemic administration of recombinant IL-12 protein, local expression of the plasmid encoding IL-12 gene inside the tumor tissue has been considered as an effective alternative approach. The l-thyroxine-conjugated PEI polyplexes were prepared using pUMVC3-hIL12 plasmid, and their transfection activity was determined in HepG2 human liver carcinoma and Neuro2A neuroblastoma cell lines. The polyplexes characterized in terms of DNA condensation ability, particle size, zeta potential, and buffering capacity as well as cytotoxicity and resistance to enzyme digestion. The results revealed that l-thyroxine conjugation of PEI increased gene transfer ability by up to two fold relative to unmodified 25 kDa PEI, the gold standard for non-viral gene delivery, with the highest increase occurring at degrees of conjugation around 10 %. pDNA condensation tests and dynamic light scattering measurements exhibited the ability of PEI conjugates to optimally condense the plasmid DNA into polyplexes in the size range around 200 nm. The modified polymers showed remarkable buffering capacity and protection against enzymatic degradation comparable to that of unmodified PEI. These results suggest that l-thyroxine conjugation of PEI is a simple modification strategy for future investigations aimed at developing a targeting gene vehicle.
Self-deployable mobile sensor networks for on-demand surveillance
NASA Astrophysics Data System (ADS)
Miao, Lidan; Qi, Hairong; Wang, Feiyi
2005-05-01
This paper studies two interconnected problems in mobile sensor network deployment, the optimal placement of heterogeneous mobile sensor platforms for cost-efficient and reliable coverage purposes, and the self-organizable deployment. We first develop an optimal placement algorithm based on a "mosaicked technology" such that different types of mobile sensors form a mosaicked pattern uniquely determined by the popularity of different types of sensor nodes. The initial state is assumed to be random. In order to converge to the optimal state, we investigate the swarm intelligence (SI)-based sensor movement strategy, through which the randomly deployed sensors can self-organize themselves to reach the optimal placement state. The proposed algorithm is compared with the random movement and the centralized method using performance metrics such as network coverage, convergence time, and energy consumption. Simulation results are presented to demonstrate the effectiveness of the mosaic placement and the SI-based movement.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanungo, Jyotshna
RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less
Cosma, Georgina; McArdle, Stéphanie E; Reeder, Stephen; Foulds, Gemma A; Hood, Simon; Khan, Masood; Pockley, A Graham
2017-01-01
Determining whether an asymptomatic individual with Prostate-Specific Antigen (PSA) levels below 20 ng ml -1 has prostate cancer in the absence of definitive, biopsy-based evidence continues to present a significant challenge to clinicians who must decide whether such individuals with low PSA values have prostate cancer. Herein, we present an advanced computational data extraction approach which can identify the presence of prostate cancer in men with PSA levels <20 ng ml -1 on the basis of peripheral blood immune cell profiles that have been generated using multi-parameter flow cytometry. Statistical analysis of immune phenotyping datasets relating to the presence and prevalence of key leukocyte populations in the peripheral blood, as generated from individuals undergoing routine tests for prostate cancer (including tissue biopsy) using multi-parametric flow cytometric analysis, was unable to identify significant relationships between leukocyte population profiles and the presence of benign disease (no prostate cancer) or prostate cancer. By contrast, a Genetic Algorithm computational approach identified a subset of five flow cytometry features ( CD 8 + CD 45 RA - CD 27 - CD 28 - ( CD 8 + Effector Memory cells); CD 4 + CD 45 RA - CD 27 - CD 28 - ( CD 4 + Terminally Differentiated Effector Memory Cells re-expressing CD45RA); CD 3 - CD 19 + (B cells); CD 3 + CD 56 + CD 8 + CD 4 + (NKT cells)) from a set of twenty features, which could potentially discriminate between benign disease and prostate cancer. These features were used to construct a prostate cancer prediction model using the k-Nearest-Neighbor classification algorithm. The proposed model, which takes as input the set of flow cytometry features, outperformed the predictive model which takes PSA values as input. Specifically, the flow cytometry-based model achieved Accuracy = 83.33%, AUC = 83.40%, and optimal ROC points of FPR = 16.13%, TPR = 82.93%, whereas the PSA-based model achieved Accuracy = 77.78%, AUC = 76.95%, and optimal ROC points of FPR = 29.03%, TPR = 82.93%. Combining PSA and flow cytometry predictors achieved Accuracy = 79.17%, AUC = 78.17% and optimal ROC points of FPR = 29.03%, TPR = 85.37%. The results demonstrate the value of computational intelligence-based approaches for interrogating immunophenotyping datasets and that combining peripheral blood phenotypic profiling with PSA levels improves diagnostic accuracy compared to using PSA test alone. These studies also demonstrate that the presence of cancer is reflected in changes in the peripheral blood immune phenotype profile which can be identified using computational analysis and interpretation of complex flow cytometry datasets.
An EGO-like optimization framework for sensor placement optimization in modal analysis
NASA Astrophysics Data System (ADS)
Morlier, Joseph; Basile, Aniello; Chiplunkar, Ankit; Charlotte, Miguel
2018-07-01
In aircraft design, ground/flight vibration tests are conducted to extract aircraft’s modal parameters (natural frequencies, damping ratios and mode shapes) also known as the modal basis. The main problem in aircraft modal identification is the large number of sensors needed, which increases operational time and costs. The goal of this paper is to minimize the number of sensors by optimizing their locations in order to reconstruct a truncated modal basis of N mode shapes with a high level of accuracy in the reconstruction. There are several methods to solve sensors placement optimization (SPO) problems, but for this case an original approach has been established based on an iterative process for mode shapes reconstruction through an adaptive Kriging metamodeling approach so called efficient global optimization (EGO)-SPO. The main idea in this publication is to solve an optimization problem where the sensors locations are variables and the objective function is defined by maximizing the trace of criteria so called AutoMAC. The results on a 2D wing demonstrate a reduction of sensors by 30% using our EGO-SPO strategy.
SUMOylation regulates TGF-β1/Smad4 signalling in-resistant glioma cells.
Wang, Zhengfeng; Wang, Kai; Wang, Ruihua; Liu, Xianzhi
2017-12-18
The aim of this study was to explore the role of TGF-β1/Smad4 signalling in the DNA damage-induced ionization radiation (IR) resistance of glioma cells. T98G cells were assigned to the IR group (treated with IR) or the Blank group (with no treatment). The IR-treated cells were also treated/transfected with the TGF-β receptor inhibitor SB431542, SUMO1-overexpressing plasmids (SUMO1 group), SUMO1-interfering plasmids (si-SUMO1 group) or negative control plasmids group. The wound-healing capacity, cell proliferation and cell apoptosis were evaluated by the scratch assay, flow cytometry and the CCK-8 assay, respectively, and protein interactions were investigated by coimmunoprecipitation and colocalization assays. IR-treated T98G cells had DNA damage, but the wound-healing capacity and cell apoptosis were not significantly suppressed. DNA damage also induced TGF-β1, Smad4, SUMO1, SUMO2/3 and Ubc9 expression. In IR-treated cells cultured with SB431542, the wound-healing capacity and proliferation were promoted. SUMO1 and Smad4 colocalized in the nucleus of T98G cells, and the IR-treated cells had a significantly higher expression of the SUMO1-Smad4 protein complex. Smad4 expression in the nucleus was significantly reduced in the si-SUMO1 group, but was markedly increased in the SUMO1 group; the SUMO1 group had significantly elevated apoptotic activity, whereas the si-SUMO1 group showed significantly suppressed apoptotic activity and the si-SUMO1+SB41542 group had the lowest levels of cell apoptosis. DNA damage may activate Smad4 SUMOylation and the SUMOylation of Smad4 participates in the activation of TGF-β/Smad4 signalling; therefore, enhanced Smad4 SUMOylation is critical for the damage-induced activation of IR resistance.
A market-based optimization approach to sensor and resource management
NASA Astrophysics Data System (ADS)
Schrage, Dan; Farnham, Christopher; Gonsalves, Paul G.
2006-05-01
Dynamic resource allocation for sensor management is a problem that demands solutions beyond traditional approaches to optimization. Market-based optimization applies solutions from economic theory, particularly game theory, to the resource allocation problem by creating an artificial market for sensor information and computational resources. Intelligent agents are the buyers and sellers in this market, and they represent all the elements of the sensor network, from sensors to sensor platforms to computational resources. These agents interact based on a negotiation mechanism that determines their bidding strategies. This negotiation mechanism and the agents' bidding strategies are based on game theory, and they are designed so that the aggregate result of the multi-agent negotiation process is a market in competitive equilibrium, which guarantees an optimal allocation of resources throughout the sensor network. This paper makes two contributions to the field of market-based optimization: First, we develop a market protocol to handle heterogeneous goods in a dynamic setting. Second, we develop arbitrage agents to improve the efficiency in the market in light of its dynamic nature.
Non-linear optical flow cytometry using a scanned, Bessel beam light-sheet.
Collier, Bradley B; Awasthi, Samir; Lieu, Deborah K; Chan, James W
2015-05-29
Modern flow cytometry instruments have become vital tools for high-throughput analysis of single cells. However, as issues with the cellular labeling techniques often used in flow cytometry have become more of a concern, the development of label-free modalities for cellular analysis is increasingly desired. Non-linear optical phenomena (NLO) are of growing interest for label-free analysis because of the ability to measure the intrinsic optical response of biomolecules found in cells. We demonstrate that a light-sheet consisting of a scanned Bessel beam is an optimal excitation geometry for efficiently generating NLO signals in a microfluidic environment. The balance of photon density and cross-sectional area provided by the light-sheet allowed significantly larger two-photon fluorescence intensities to be measured in a model polystyrene microparticle system compared to measurements made using other excitation focal geometries, including a relaxed Gaussian excitation beam often used in conventional flow cytometers.
Alves, L.P.S.; Almeida, A.T.; Cruz, L.M.; Pedrosa, F.O.; de Souza, E.M.; Chubatsu, L.S.; Müller-Santos, M.; Valdameri, G.
2017-01-01
The conventional method for quantification of polyhydroxyalkanoates based on whole-cell methanolysis and gas chromatography (GC) is laborious and time-consuming. In this work, a method based on flow cytometry of Nile red stained bacterial cells was established to quantify poly-3-hydroxybutyrate (PHB) production by the diazotrophic and plant-associated bacteria, Herbaspirillum seropedicae and Azospirillum brasilense. The method consists of three steps: i) cell permeabilization, ii) Nile red staining, and iii) analysis by flow cytometry. The method was optimized step-by-step and can be carried out in less than 5 min. The final results indicated a high correlation coefficient (R2=0.99) compared to a standard method based on methanolysis and GC. This method was successfully applied to the quantification of PHB in epiphytic bacteria isolated from rice roots. PMID:28099582
Ding, Xu; Shi, Lei; Han, Jianghong; Lu, Jingting
2016-01-01
Wireless sensor networks deployed in coal mines could help companies provide workers working in coal mines with more qualified working conditions. With the underground information collected by sensor nodes at hand, the underground working conditions could be evaluated more precisely. However, sensor nodes may tend to malfunction due to their limited energy supply. In this paper, we study the cross-layer optimization problem for wireless rechargeable sensor networks implemented in coal mines, of which the energy could be replenished through the newly-brewed wireless energy transfer technique. The main results of this article are two-fold: firstly, we obtain the optimal relay nodes’ placement according to the minimum overall energy consumption criterion through the Lagrange dual problem and KKT conditions; secondly, the optimal strategies for recharging locomotives and wireless sensor networks are acquired by solving a cross-layer optimization problem. The cyclic nature of these strategies is also manifested through simulations in this paper. PMID:26828500
Ding, Xu; Shi, Lei; Han, Jianghong; Lu, Jingting
2016-01-28
Wireless sensor networks deployed in coal mines could help companies provide workers working in coal mines with more qualified working conditions. With the underground information collected by sensor nodes at hand, the underground working conditions could be evaluated more precisely. However, sensor nodes may tend to malfunction due to their limited energy supply. In this paper, we study the cross-layer optimization problem for wireless rechargeable sensor networks implemented in coal mines, of which the energy could be replenished through the newly-brewed wireless energy transfer technique. The main results of this article are two-fold: firstly, we obtain the optimal relay nodes' placement according to the minimum overall energy consumption criterion through the Lagrange dual problem and KKT conditions; secondly, the optimal strategies for recharging locomotives and wireless sensor networks are acquired by solving a cross-layer optimization problem. The cyclic nature of these strategies is also manifested through simulations in this paper.
Optimal Deployment of Sensor Nodes Based on Performance Surface of Underwater Acoustic Communication
Choi, Jee Woong
2017-01-01
The underwater acoustic sensor network (UWASN) is a system that exchanges data between numerous sensor nodes deployed in the sea. The UWASN uses an underwater acoustic communication technique to exchange data. Therefore, it is important to design a robust system that will function even in severely fluctuating underwater communication conditions, along with variations in the ocean environment. In this paper, a new algorithm to find the optimal deployment positions of underwater sensor nodes is proposed. The algorithm uses the communication performance surface, which is a map showing the underwater acoustic communication performance of a targeted area. A virtual force-particle swarm optimization algorithm is then used as an optimization technique to find the optimal deployment positions of the sensor nodes, using the performance surface information to estimate the communication radii of the sensor nodes in each generation. The algorithm is evaluated by comparing simulation results between two different seasons (summer and winter) for an area located off the eastern coast of Korea as the selected targeted area. PMID:29053569
Tang, Hongying; Cheng, Yongbo; Zhao, Qin; Li, Baoqing; Yuan, Xiaobing
2017-01-01
Routing protocols based on topology control are significantly important for improving network longevity in wireless sensor networks (WSNs). Traditionally, some WSN routing protocols distribute uneven network traffic load to sensor nodes, which is not optimal for improving network longevity. Differently to conventional WSN routing protocols, we propose a dynamic hierarchical protocol based on combinatorial optimization (DHCO) to balance energy consumption of sensor nodes and to improve WSN longevity. For each sensor node, the DHCO algorithm obtains the optimal route by establishing a feasible routing set instead of selecting the cluster head or the next hop node. The process of obtaining the optimal route can be formulated as a combinatorial optimization problem. Specifically, the DHCO algorithm is carried out by the following procedures. It employs a hierarchy-based connection mechanism to construct a hierarchical network structure in which each sensor node is assigned to a special hierarchical subset; it utilizes the combinatorial optimization theory to establish the feasible routing set for each sensor node, and takes advantage of the maximum–minimum criterion to obtain their optimal routes to the base station. Various results of simulation experiments show effectiveness and superiority of the DHCO algorithm in comparison with state-of-the-art WSN routing algorithms, including low-energy adaptive clustering hierarchy (LEACH), hybrid energy-efficient distributed clustering (HEED), genetic protocol-based self-organizing network clustering (GASONeC), and double cost function-based routing (DCFR) algorithms. PMID:28753962
Varicella Zoster Virus Promoter Sequences
1994-01-01
Fragments from each of the recombinant plasmids were excised to determine the optimal sequences used for promoter function. The ExonucleaseIII/ Mung ...activation o f these two herpesvirus l ate promoters by vzv is str i kingly similar . 4 . Definition of the functional promo ter for the early/late ILl
Bio-mimic optimization strategies in wireless sensor networks: a survey.
Adnan, Md Akhtaruzzaman; Abdur Razzaque, Mohammd; Ahmed, Ishtiaque; Isnin, Ismail Fauzi
2013-12-24
For the past 20 years, many authors have focused their investigations on wireless sensor networks. Various issues related to wireless sensor networks such as energy minimization (optimization), compression schemes, self-organizing network algorithms, routing protocols, quality of service management, security, energy harvesting, etc., have been extensively explored. The three most important issues among these are energy efficiency, quality of service and security management. To get the best possible results in one or more of these issues in wireless sensor networks optimization is necessary. Furthermore, in number of applications (e.g., body area sensor networks, vehicular ad hoc networks) these issues might conflict and require a trade-off amongst them. Due to the high energy consumption and data processing requirements, the use of classical algorithms has historically been disregarded. In this context contemporary researchers started using bio-mimetic strategy-based optimization techniques in the field of wireless sensor networks. These techniques are diverse and involve many different optimization algorithms. As far as we know, most existing works tend to focus only on optimization of one specific issue of the three mentioned above. It is high time that these individual efforts are put into perspective and a more holistic view is taken. In this paper we take a step in that direction by presenting a survey of the literature in the area of wireless sensor network optimization concentrating especially on the three most widely used bio-mimetic algorithms, namely, particle swarm optimization, ant colony optimization and genetic algorithm. In addition, to stimulate new research and development interests in this field, open research issues, challenges and future research directions are highlighted.
[Effects of ezrin silencing on pancreatic cancer cell line Panc-1].
Meng, Yun-xiao; Yu, Shuang-ni; Lu, Zhao-hui; Chen, Jie
2012-12-01
To explore the effects of ezrin silencing on pancreatic cancer cell line Panc-1. Pancreatic cancer cell line Panc-1 was transfected with ezrin silencing plasmid. The proliferation and the cell cycle status were determined by CCK-8 assay and flow cytometry analysis, respectively. Cellular membrane protrusions/microvilli formation were visualized by scanning election microscopy. Colony formation assay was used to determine the cell anchor-independent growth ability in vitro. Trans-filter migration and invasion assays were performed with 8 µm pore inserts in a 24-well BioCoat chamber with/without Matrigel. Ezrin silencing decreased cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion, but had no effects on cell proliferation in vitro and cell cycle, in pancreatic cancer cell line Panc-1. Ezrin expression affects the cellular protrusions/microvilli formation, anchorage-independent growth, cell migration and invasion in pancreatic cancer cell line Panc-1.
Alexander, C J; Hammer, J A
2016-01-01
We present a simple and efficient method to knock down proteins specifically in Purkinje neurons (PN) present in mixed mouse primary cerebellar cultures. This method utilizes the introduction via nucleofection of a plasmid encoding a specific miRNA downstream of the L7/Pcp2 promoter, which drives PN-specific expression. As proof-of-principle, we used this plasmid to knock down the motor protein myosin Va, which is required for the targeting of smooth endoplasmic reticulum (ER) into PN spines. Consistent with effective knockdown, transfected PNs robustly phenocopied PNs from dilute-lethal (myosin Va-null) mice with regard to the ER targeting defect. Importantly, our plasmid-based approach is less challenging technically and more specific to PNs than several alternative methods (e.g., biolistic- and lentiviral-based introduction of siRNAs). We also present a number of improvements for generating mixed cerebellar cultures that shorten the procedure and improve the total yield of PNs, and of transfected PNs, considerably. Finally, we present a method to rescue cerebellar cultures that develop large cell aggregates, a common problem that otherwise precludes the further use of the culture. Copyright © 2016 Elsevier Inc. All rights reserved.
2016-04-01
phosphate use by these recombinant strains was evaluated because carbon use by these strains is still undergoing optimization by LBNL. The E . coli ...plasmids, had successful growth when transformed into a different E . coli background, which correlated with IMPA degradation. Ultimately, the...transformed E . coli strains, optimized at ECBC, were able to grow using IMPA as the phosphate source. 15. SUBJECT TERMS Acetylcholinesterase (AChE
Homann, Stefanie; Hofmann, Christian; Gorin, Aleksandr M.; Nguyen, Huy Cong Xuan; Huynh, Diana; Hamid, Phillip; Maithel, Neil; Yacoubian, Vahe; Mu, Wenli; Kossyvakis, Athanasios; Sen Roy, Shubhendu; Yang, Otto Orlean
2017-01-01
Transfection is one of the most frequently used techniques in molecular biology that is also applicable for gene therapy studies in humans. One of the biggest challenges to investigate the protein function and interaction in gene therapy studies is to have reliable monospecific detection reagents, particularly antibodies, for all human gene products. Thus, a reliable method that can optimize transfection efficiency based on not only expression of the target protein of interest but also the uptake of the nucleic acid plasmid, can be an important tool in molecular biology. Here, we present a simple, rapid and robust flow cytometric method that can be used as a tool to optimize transfection efficiency at the single cell level while overcoming limitations of prior established methods that quantify transfection efficiency. By using optimized ratios of transfection reagent and a nucleic acid (DNA or RNA) vector directly labeled with a fluorochrome, this method can be used as a tool to simultaneously quantify cellular toxicity of different transfection reagents, the amount of nucleic acid plasmid that cells have taken up during transfection as well as the amount of the encoded expressed protein. Finally, we demonstrate that this method is reproducible, can be standardized and can reliably and rapidly quantify transfection efficiency, reducing assay costs and increasing throughput while increasing data robustness. PMID:28863132
Energy optimization in mobile sensor networks
NASA Astrophysics Data System (ADS)
Yu, Shengwei
Mobile sensor networks are considered to consist of a network of mobile robots, each of which has computation, communication and sensing capabilities. Energy efficiency is a critical issue in mobile sensor networks, especially when mobility (i.e., locomotion control), routing (i.e., communications) and sensing are unique characteristics of mobile robots for energy optimization. This thesis focuses on the problem of energy optimization of mobile robotic sensor networks, and the research results can be extended to energy optimization of a network of mobile robots that monitors the environment, or a team of mobile robots that transports materials from stations to stations in a manufacturing environment. On the energy optimization of mobile robotic sensor networks, our research focuses on the investigation and development of distributed optimization algorithms to exploit the mobility of robotic sensor nodes for network lifetime maximization. In particular, the thesis studies these five problems: 1. Network-lifetime maximization by controlling positions of networked mobile sensor robots based on local information with distributed optimization algorithms; 2. Lifetime maximization of mobile sensor networks with energy harvesting modules; 3. Lifetime maximization using joint design of mobility and routing; 4. Optimal control for network energy minimization; 5. Network lifetime maximization in mobile visual sensor networks. In addressing the first problem, we consider only the mobility strategies of the robotic relay nodes in a mobile sensor network in order to maximize its network lifetime. By using variable substitutions, the original problem is converted into a convex problem, and a variant of the sub-gradient method for saddle-point computation is developed for solving this problem. An optimal solution is obtained by the method. Computer simulations show that mobility of robotic sensors can significantly prolong the lifetime of the whole robotic sensor network while consuming negligible amount of energy for mobility cost. For the second problem, the problem is extended to accommodate mobile robotic nodes with energy harvesting capability, which makes it a non-convex optimization problem. The non-convexity issue is tackled by using the existing sequential convex approximation method, based on which we propose a novel procedure of modified sequential convex approximation that has fast convergence speed. For the third problem, the proposed procedure is used to solve another challenging non-convex problem, which results in utilizing mobility and routing simultaneously in mobile robotic sensor networks to prolong the network lifetime. The results indicate that joint design of mobility and routing has an edge over other methods in prolonging network lifetime, which is also the justification for the use of mobility in mobile sensor networks for energy efficiency purpose. For the fourth problem, we include the dynamics of the robotic nodes in the problem by modeling the networked robotic system using hybrid systems theory. A novel distributed method for the networked hybrid system is used to solve the optimal moving trajectories for robotic nodes and optimal network links, which are not answered by previous approaches. Finally, the fact that mobility is more effective in prolonging network lifetime for a data-intensive network leads us to apply our methods to study mobile visual sensor networks, which are useful in many applications. We investigate the joint design of mobility, data routing, and encoding power to help improving the video quality while maximizing the network lifetime. This study leads to a better understanding of the role mobility can play in data-intensive surveillance sensor networks.
Ding, Xu; Han, Jianghong; Shi, Lei
2015-01-01
In this paper, the optimal working schemes for wireless sensor networks with multiple base stations and wireless energy transfer devices are proposed. The wireless energy transfer devices also work as data gatherers while charging sensor nodes. The wireless sensor network is firstly divided into sub networks according to the concept of Voronoi diagram. Then, the entire energy replenishing procedure is split into the pre-normal and normal energy replenishing stages. With the objective of maximizing the sojourn time ratio of the wireless energy transfer device, a continuous time optimization problem for the normal energy replenishing cycle is formed according to constraints with which sensor nodes and wireless energy transfer devices should comply. Later on, the continuous time optimization problem is reshaped into a discrete multi-phased optimization problem, which yields the identical optimality. After linearizing it, we obtain a linear programming problem that can be solved efficiently. The working strategies of both sensor nodes and wireless energy transfer devices in the pre-normal replenishing stage are also discussed in this paper. The intensive simulations exhibit the dynamic and cyclic working schemes for the entire energy replenishing procedure. Additionally, a way of eliminating “bottleneck” sensor nodes is also developed in this paper. PMID:25785305
Ding, Xu; Han, Jianghong; Shi, Lei
2015-03-16
In this paper, the optimal working schemes for wireless sensor networks with multiple base stations and wireless energy transfer devices are proposed. The wireless energy transfer devices also work as data gatherers while charging sensor nodes. The wireless sensor network is firstly divided into sub networks according to the concept of Voronoi diagram. Then, the entire energy replenishing procedure is split into the pre-normal and normal energy replenishing stages. With the objective of maximizing the sojourn time ratio of the wireless energy transfer device, a continuous time optimization problem for the normal energy replenishing cycle is formed according to constraints with which sensor nodes and wireless energy transfer devices should comply. Later on, the continuous time optimization problem is reshaped into a discrete multi-phased optimization problem, which yields the identical optimality. After linearizing it, we obtain a linear programming problem that can be solved efficiently. The working strategies of both sensor nodes and wireless energy transfer devices in the pre-normal replenishing stage are also discussed in this paper. The intensive simulations exhibit the dynamic and cyclic working schemes for the entire energy replenishing procedure. Additionally, a way of eliminating "bottleneck" sensor nodes is also developed in this paper.
Lee, HyungJune; Kim, HyunSeok; Chang, Ik Joon
2014-01-01
We propose a technique to optimize the energy efficiency of data collection in sensor networks by exploiting a selective data compression. To achieve such an aim, we need to make optimal decisions regarding two aspects: (1) which sensor nodes should execute compression; and (2) which compression algorithm should be used by the selected sensor nodes. We formulate this problem into binary integer programs, which provide an energy-optimal solution under the given latency constraint. Our simulation results show that the optimization algorithm significantly reduces the overall network-wide energy consumption for data collection. In the environment having a stationary sink from stationary sensor nodes, the optimized data collection shows 47% energy savings compared to the state-of-the-art collection protocol (CTP). More importantly, we demonstrate that our optimized data collection provides the best performance in an intermittent network under high interference. In such networks, we found that the selective compression for frequent packet retransmissions saves up to 55% energy compared to the best known protocol. PMID:24721763
Information Fusion for High Level Situation Assessment and Prediction
2007-03-01
procedure includes deciding a sensor set that achieves the optimal trade -off between its cost and benefit, activating the identified sensors, integrating...and effective decision can be made by dynamic inference based on selecting a subset of sensors with the optimal trade -off between their cost and...first step is achieved by designing a sensor selection criterion that represents the trade -off between the sensor benefit and sensor cost. This is then
Choosing Sensor Configuration for a Flexible Structure Using Full Control Synthesis
NASA Technical Reports Server (NTRS)
Lind, Rick; Nalbantoglu, Volkan; Balas, Gary
1997-01-01
Optimal locations and types for feedback sensors which meet design constraints and control requirements are difficult to determine. This paper introduces an approach to choosing a sensor configuration based on Full Control synthesis. A globally optimal Full Control compensator is computed for each member of a set of sensor configurations which are feasible for the plant. The sensor configuration associated with the Full Control system achieving the best closed-loop performance is chosen for feedback measurements to an output feedback controller. A flexible structure is used as an example to demonstrate this procedure. Experimental results show sensor configurations chosen to optimize the Full Control performance are effective for output feedback controllers.
Penders, J; Pop, V; Caballero, L; van de Molengraft, J; van Schaijk, R; Vullers, R; Van Hoof, C
2010-01-01
Recent advances in ultra-low-power circuits and energy harvesters are making self-powered body sensor nodes a reality. Power optimization at the system and application level is crucial in achieving ultra-low-power consumption for the entire system. This paper reviews system-level power optimization techniques, and illustrates their impact on the case of autonomous wireless EMG monitoring. The resulting prototype, an Autonomous wireless EMG sensor power by PV-cells, is presented.
Optimization Strategies for Sensor and Actuator Placement
NASA Technical Reports Server (NTRS)
Padula, Sharon L.; Kincaid, Rex K.
1999-01-01
This paper provides a survey of actuator and sensor placement problems from a wide range of engineering disciplines and a variety of applications. Combinatorial optimization methods are recommended as a means for identifying sets of actuators and sensors that maximize performance. Several sample applications from NASA Langley Research Center, such as active structural acoustic control, are covered in detail. Laboratory and flight tests of these applications indicate that actuator and sensor placement methods are effective and important. Lessons learned in solving these optimization problems can guide future research.
Geometrical optimization of a local ballistic magnetic sensor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kanda, Yuhsuke; Hara, Masahiro; Nomura, Tatsuya
2014-04-07
We have developed a highly sensitive local magnetic sensor by using a ballistic transport property in a two-dimensional conductor. A semiclassical simulation reveals that the sensitivity increases when the geometry of the sensor and the spatial distribution of the local field are optimized. We have also experimentally demonstrated a clear observation of a magnetization process in a permalloy dot whose size is much smaller than the size of an optimized ballistic magnetic sensor fabricated from a GaAs/AlGaAs two-dimensional electron gas.
Design optimization of an ironless inductive position sensor for the LHC collimators
NASA Astrophysics Data System (ADS)
Danisi, A.; Masi, A.; Losito, R.; Perriard, Y.
2013-09-01
The Ironless Inductive Position Sensor (I2PS) is an air-cored displacement sensor which has been conceived to be totally immune to external DC/slowly-varying magnetic fields. It can thus be used as a valid alternative to Linear Variable Differential Transformers (LVDTs), which can show a position error in magnetic environments. In addition, since it retains the excellent properties of LVDTs, the I2PS can be used in harsh environments, such as nuclear plants, plasma control and particle accelerators. This paper focuses on the design optimization of the sensor, considering the CERN LHC Collimators as application. In particular, the optimization comes after a complete review of the electromagnetic and thermal modeling of the sensor, as well as the proper choice of the reading technique. The design optimization stage is firmly based on these preliminary steps. Therefore, the paper summarises the sensor's complete development, from its modeling to its actual implementation. A set of experimental measurements demonstrates the sensor's performances to be those expected in the design phase.
LinkMind: link optimization in swarming mobile sensor networks.
Ngo, Trung Dung
2011-01-01
A swarming mobile sensor network is comprised of a swarm of wirelessly connected mobile robots equipped with various sensors. Such a network can be applied in an uncertain environment for services such as cooperative navigation and exploration, object identification and information gathering. One of the most advantageous properties of the swarming wireless sensor network is that mobile nodes can work cooperatively to organize an ad-hoc network and optimize the network link capacity to maximize the transmission of gathered data from a source to a target. This paper describes a new method of link optimization of swarming mobile sensor networks. The new method is based on combination of the artificial potential force guaranteeing connectivities of the mobile sensor nodes and the max-flow min-cut theorem of graph theory ensuring optimization of the network link capacity. The developed algorithm is demonstrated and evaluated in simulation.
LinkMind: Link Optimization in Swarming Mobile Sensor Networks
Ngo, Trung Dung
2011-01-01
A swarming mobile sensor network is comprised of a swarm of wirelessly connected mobile robots equipped with various sensors. Such a network can be applied in an uncertain environment for services such as cooperative navigation and exploration, object identification and information gathering. One of the most advantageous properties of the swarming wireless sensor network is that mobile nodes can work cooperatively to organize an ad-hoc network and optimize the network link capacity to maximize the transmission of gathered data from a source to a target. This paper describes a new method of link optimization of swarming mobile sensor networks. The new method is based on combination of the artificial potential force guaranteeing connectivities of the mobile sensor nodes and the max-flow min-cut theorem of graph theory ensuring optimization of the network link capacity. The developed algorithm is demonstrated and evaluated in simulation. PMID:22164070
Comparison of multiple gene assembly methods for metabolic engineering
Chenfeng Lu; Karen Mansoorabadi; Thomas Jeffries
2007-01-01
A universal, rapid DNA assembly method for efficient multigene plasmid construction is important for biological research and for optimizing gene expression in industrial microbes. Three different approaches to achieve this goal were evaluated. These included creating long complementary extensions using a uracil-DNA glycosylase technique, overlap extension polymerase...
Optimization of mNeonGreen for Homo sapiens increases its fluorescent intensity in mammalian cells.
Tanida-Miyake, Emiko; Koike, Masato; Uchiyama, Yasuo; Tanida, Isei
2018-01-01
Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.
A self-optimizing scheme for energy balanced routing in Wireless Sensor Networks using SensorAnt.
Shamsan Saleh, Ahmed M; Ali, Borhanuddin Mohd; Rasid, Mohd Fadlee A; Ismail, Alyani
2012-01-01
Planning of energy-efficient protocols is critical for Wireless Sensor Networks (WSNs) because of the constraints on the sensor nodes' energy. The routing protocol should be able to provide uniform power dissipation during transmission to the sink node. In this paper, we present a self-optimization scheme for WSNs which is able to utilize and optimize the sensor nodes' resources, especially the batteries, to achieve balanced energy consumption across all sensor nodes. This method is based on the Ant Colony Optimization (ACO) metaheuristic which is adopted to enhance the paths with the best quality function. The assessment of this function depends on multi-criteria metrics such as the minimum residual battery power, hop count and average energy of both route and network. This method also distributes the traffic load of sensor nodes throughout the WSN leading to reduced energy usage, extended network life time and reduced packet loss. Simulation results show that our scheme performs much better than the Energy Efficient Ant-Based Routing (EEABR) in terms of energy consumption, balancing and efficiency.
Synergistic effect of ultrasound and PEI on DNA transfection in vitro
Deshpande, Mangesh C.; Prausnitz, Mark R.
2007-01-01
Ultrasound and poly(ethylenimine) (PEI) have each separately been shown to increase DNA transfection efficiency. This study tested the hypothesis that the combination of ultrasound and PEI can have a synergistic effect to increase DNA transfection. This in vitro study assessed transfection efficiency of two different DNA plasmids encoding green fluorescent protein and firefly luciferase in two different cells types, a primary culture of human aortic smooth muscle cells and an immortal line of human prostrate cancer cells. We found that ultrasound sonication increased transfection up to 18-fold, DNA complexation with PEI increased transfection up to 90-fold, and the combination of ultrasound and PEI synergistically increased transfection up to 200-fold, which resulted in reporter gene expression by 34% of cells. Kinetic measurements found that the effects of ultrasound alone acted quickly, whereas increased transfection by PEI either alone or in combination with ultrasound strongly benefited from a 4-h incubation with the DNA plasmid after sonication. Although serum reduced absolute expression levels, it did not affect the relative increase in transfection when ultrasound was added to PEI enhancement. Flow cytometry measurements showed that sonication increased intracellular uptake of labelled DNA complexed to PEI by 55% relative to PEI complexation alone. Electrophoresis assay showed no damage to DNA or PEI-DNA complexes after sonication. Overall, these results suggest that the combination of ultrasound and PEI can have a synergistic effect to increase DNA transfection. PMID:17258835
De Filette, Marina; Soehle, Silke; Ulbert, Sebastian; Richner, Justin; Diamond, Michael S.; Sinigaglia, Alessandro; Barzon, Luisa; Roels, Stefan; Lisziewicz, Julianna; Lorincz, Orsolya; Sanders, Niek N.
2014-01-01
West Nile virus (WNV) is a mosquito-borne flavivirus that is endemic in Africa, the Middle East, Europe and the United States. There is currently no antiviral treatment or human vaccine available to treat or prevent WNV infection. DNA plasmid-based vaccines represent a new approach for controlling infectious diseases. In rodents, DNA vaccines have been shown to induce B cell and cytotoxic T cell responses and protect against a wide range of infections. In this study, we formulated a plasmid DNA vector expressing the ectodomain of the E-protein of WNV into nanoparticles by using linear polyethyleneimine (lPEI) covalently bound to mannose and examined the potential of this vaccine to protect against lethal WNV infection in mice. Mice were immunized twice (prime – boost regime) with the WNV DNA vaccine formulated with lPEI-mannose using different administration routes (intramuscular, intradermal and topical). In parallel a heterologous boost with purified recombinant WNV envelope (E) protein was evaluated. While no significant E-protein specific humoral response was generated after DNA immunization, protein boosting of DNA-primed mice resulted in a marked increase in total neutralizing antibody titer. In addition, E-specific IL-4 T-cell immune responses were detected by ELISPOT after protein boost and CD8+ specific IFN-γ expression was observed by flow cytometry. Challenge experiments using the heterologous immunization regime revealed protective immunity to homologous and virulent WNV infection. PMID:24503579
Zhang, P; Wang, J G; Wan, J G; Liu, W Q
2010-01-01
The frequent disease outbreaks caused by avian influenza virus not only affect the poultry industry but also pose a threat to human safety. To address the problem, RNA interference (RNAi) has recently been widely used as a potential antiviral approach. Transgenesis in combination with RNAi to specifically inhibit avian enza virus gene expression has been proposed to make chickens resistant to the infection. For the transgenic breeding, screening in vitro efficient siRNAs as the candidate genes is one of the most important tasks. Here, we combined an online search tool and a series of bioinformatics programs with a set of rules for designing siRNAs targeted towards different mRNA regions of H5N1 avian influenza virus. Five rational siRNAs were chosen by this method, five U6 promoter-driven shRNA expression plasmids containing the siRNA genes were constructed and used for producing stably transfected MDCK cells. The data obtained by virus titration, IFA, PI-stained flow cytometry, real-time quantitative RT-PCR, and DAS-ELISA analyses showed that all five stably transfected cell lines we re resistant to virusreplication when exposed to 100 CCID50 of avian influenza virus H5N1. Finally, most effective plasmids (pSi-604i and pSi-1597i) as the candidates for making the transgenic chickens were chosen. These findings provide baseline information on use of RNAi technique for breeding transgenic chickens resistant to avian influenza virus.
Autophagy in anti-apoptotic effect of augmenter of liver regeneration in HepG2 cells.
Shi, Hong-Bo; Sun, Hai-Qing; Shi, Hong-Lin; Ren, Feng; Chen, Yu; Chen, De-Xi; Lou, Jin-Li; Duan, Zhong-Ping
2015-05-07
To investigate the role of autophagy in the anti-apoptotic effect of augmenter of liver regeneration (ALR). Autophagy was induced through serum deprivation. An ALR-expressing plasmid was transfected into HepG2 cells, and autophagic flux was determined using fluorescence microscopy, electron microscopy, Western blot and quantitative polymerase chain reaction (qPCR) assays. After ALR-expressing plasmid transfection, an autophagy inhibitor [3-methyladenine (3-MA)] was added to HepG2 cells, and apoptosis was observed using fluorescence microscopy and flow cytometry. Autophagy was activated in HepG2 cells, peaking at 24 h after serum deprivation. Microtubule-associated protein light chain three-II levels were higher in HepG2 cells treated with ALR than in control cells, fluorescence microscopy, electron microscopy and qPCR studies showed the similar trend, and p62 levels showed the opposite trend, which indicated that ALR may play an important role in increasing autophagy flux. The numbers of apoptotic cells were substantially higher in HepG2 cells treated with both ALR and 3-MA than in cells treated with ALR alone. Therefore, the protective effect of ALR was significantly attenuated or abolished when autophagy was inhibited, indicating that the anti-apoptotic effect of ALR may be related to autophagy. ALR protects cells from apoptosis partly through increased autophagy in HepG2 cells and may be valuable as a new therapeutic treatment for liver disease.
Zhang, Yongming; Qiu, Binghui; Wang, Jinbiao; Yao, Yi; Wang, Chunlin; Liu, Jiachuan
2017-07-01
The purpose of this study was to investigate the effects of brain-derived neurotrophic factor (BDNF)-transfected bone marrow mesenchymal stem cells (BMSCs) on neural functional recovery and synaptophysin expression in rats with cerebral infarction (CI). A total of 120 healthy Sprague Dawley rats were randomly divided into sham group, control group, and model group. Craniotomy was conducted and neurological function defect scoring was used to verify the model. BDNF containing recombinant plasmid was transfected into rat BMSCs, which was verified by flow cytometry and Western Blot. After injection of the transfected BMSCs, neural functional recovery of the CI rats and synaptophysin expression were measured. After the CI rat model was established, magnetic resonance (MR) imaging, 2, 3, 5- triphenyl tetrazolium chloride (TTC) staining, and the neurological function defect scoring determined the success of the model. CD34 (-), CD45 (-), CD29 (+), and CD90 (+) cells detected showed that the obtained BMSCs have high purity. BDNF protein was highly expressed in the BMSCs successfully transfected with the recombinant plasmid. Balance beam walking score, rotating bar walking score, and screen test score were significantly lower, while synaptophysin expression was higher in the BDNF model group than those in the non-BDNF model group and sham group with time extension. BDNF can increase synaptic plasticity and neurogenesis and have a promotional role in neural functional recovery and synaptophysin expression in rats with CI. BDNF-transfected BMSCs may therefore have better treatment efficacy for CI clinically.
Optimal Design of Multitype Groundwater Monitoring Networks Using Easily Accessible Tools.
Wöhling, Thomas; Geiges, Andreas; Nowak, Wolfgang
2016-11-01
Monitoring networks are expensive to establish and to maintain. In this paper, we extend an existing data-worth estimation method from the suite of PEST utilities with a global optimization method for optimal sensor placement (called optimal design) in groundwater monitoring networks. Design optimization can include multiple simultaneous sensor locations and multiple sensor types. Both location and sensor type are treated simultaneously as decision variables. Our method combines linear uncertainty quantification and a modified genetic algorithm for discrete multilocation, multitype search. The efficiency of the global optimization is enhanced by an archive of past samples and parallel computing. We demonstrate our methodology for a groundwater monitoring network at the Steinlach experimental site, south-western Germany, which has been established to monitor river-groundwater exchange processes. The target of optimization is the best possible exploration for minimum variance in predicting the mean travel time of the hyporheic exchange. Our results demonstrate that the information gain of monitoring network designs can be explored efficiently and with easily accessible tools prior to taking new field measurements or installing additional measurement points. The proposed methods proved to be efficient and can be applied for model-based optimal design of any type of monitoring network in approximately linear systems. Our key contributions are (1) the use of easy-to-implement tools for an otherwise complex task and (2) yet to consider data-worth interdependencies in simultaneous optimization of multiple sensor locations and sensor types. © 2016, National Ground Water Association.
Bio-Mimic Optimization Strategies in Wireless Sensor Networks: A Survey
Adnan, Md. Akhtaruzzaman; Razzaque, Mohammd Abdur; Ahmed, Ishtiaque; Isnin, Ismail Fauzi
2014-01-01
For the past 20 years, many authors have focused their investigations on wireless sensor networks. Various issues related to wireless sensor networks such as energy minimization (optimization), compression schemes, self-organizing network algorithms, routing protocols, quality of service management, security, energy harvesting, etc., have been extensively explored. The three most important issues among these are energy efficiency, quality of service and security management. To get the best possible results in one or more of these issues in wireless sensor networks optimization is necessary. Furthermore, in number of applications (e.g., body area sensor networks, vehicular ad hoc networks) these issues might conflict and require a trade-off amongst them. Due to the high energy consumption and data processing requirements, the use of classical algorithms has historically been disregarded. In this context contemporary researchers started using bio-mimetic strategy-based optimization techniques in the field of wireless sensor networks. These techniques are diverse and involve many different optimization algorithms. As far as we know, most existing works tend to focus only on optimization of one specific issue of the three mentioned above. It is high time that these individual efforts are put into perspective and a more holistic view is taken. In this paper we take a step in that direction by presenting a survey of the literature in the area of wireless sensor network optimization concentrating especially on the three most widely used bio-mimetic algorithms, namely, particle swarm optimization, ant colony optimization and genetic algorithm. In addition, to stimulate new research and development interests in this field, open research issues, challenges and future research directions are highlighted. PMID:24368702
Ren, Jun; Lee, Haram; Yoo, Seung Min; Yu, Myeong-Sang; Park, Hansoo; Na, Dokyun
2017-04-01
DNA transformation that delivers plasmid DNAs into bacterial cells is fundamental in genetic manipulation to engineer and study bacteria. Developed transformation methods to date are optimized to specific bacterial species for high efficiency. Thus, there is always a demand for simple and species-independent transformation methods. We herein describe the development of a chemico-physical transformation method that combines a rubidium chloride (RbCl)-based chemical method and sepiolite-based physical method, and report its use for the simple and efficient delivery of DNA into various bacterial species. Using this method, the best transformation efficiency for Escherichia coli DH5α was 4.3×10 6 CFU/μg of pUC19 plasmid, which is higher than or comparable to the reported transformation efficiencies to date. This method also allowed the introduction of plasmid DNAs into Bacillus subtilis (5.7×10 3 CFU/μg of pSEVA3b67Rb), Bacillus megaterium (2.5×10 3 CFU/μg of pSPAsp-hp), Lactococcus lactis subsp. lactis (1.0×10 2 CFU/μg of pTRKH3-ermGFP), and Lactococcus lactis subsp. cremoris (2.2×10 2 CFU/μg of pMSP3535VA). Remarkably, even when the conventional chemical and physical methods failed to generate transformed cells in Bacillus sp. and Enterococcus faecalis, E. malodoratus and E. mundtii, our combined method showed a significant transformation efficiency (2.4×10 4 , 4.5×10 2 , 2×10 1 , and 0.5×10 1 CFU/μg of plasmid DNA). Based on our results, we anticipate that our simple and efficient transformation method should prove usefulness for introducing DNA into various bacterial species without complicated optimization of parameters affecting DNA entry into the cell. Copyright © 2017. Published by Elsevier B.V.
Zhang, Kang; Su, Lingqia; Duan, Xuguo; Liu, Lina; Wu, Jing
2017-02-20
We recently constructed a Bacillus subtilis strain (CCTCC M 2016536) from which we had deleted the srfC, spoIIAC, nprE, aprE and amyE genes. This strain is capable of robust recombinant protein production and amenable to high-cell-density fermentation. Because the promoter is among the factors that influence the production of target proteins, optimization of the initial promoter, P amyQ from Bacillus amyloliquefaciens, should improve protein expression using this strain. This study was undertaken to develop a new, high-level expression system in B. subtilis CCTCC M 2016536. Using the enzyme β-cyclodextrin glycosyltransferase (β-CGTase) as a reporter protein and B. subtilis CCTCC M 2016536 as the host, nine plasmids equipped with single promoters were screened using shake-flask cultivation. The plasmid containing the P amyQ' promoter produced the greatest extracellular β-CGTase activity; 24.1 U/mL. Subsequently, six plasmids equipped with dual promoters were constructed and evaluated using this same method. The plasmid containing the dual promoter P HpaII -P amyQ' produced the highest extracellular β-CGTase activity (30.5 U/mL) and was relatively glucose repressed. The dual promoter P HpaII -P amyQ' also mediated substantial extracellular pullulanase (90.7 U/mL) and α-CGTase expression (9.5 U/mL) during shake-flask cultivation, demonstrating the general applicability of this system. Finally, the production of β-CGTase using the dual-promoter P HpaII -P amyQ' system was investigated in a 3-L fermenter. Extracellular expression of β-CGTase reached 571.2 U/mL (2.5 mg/mL), demonstrating the potential of this system for use in industrial applications. The dual-promoter P HpaII -P amyQ' system was found to support superior expression of extracellular proteins in B. subtilis CCTCC M 2016536. This system appears generally applicable and is amenable to scale-up.
Mealey, Robert H.; Leib, Steven R.; Littke, Matt H.; Wagner, Bettina; Horohov, David W.; McGuire, Travis C.
2009-01-01
Effective DNA-based vaccines against lentiviruses will likely induce CTL against conserved viral proteins. Equine infectious anemia virus (EIAV) infects horses worldwide, and serves as a useful model for lentiviral immune control. Although attenuated live EIAV vaccines have induced protective immune responses, DNA-based vaccines have not. In particular, DNA-based vaccines have had limited success in inducing CTL responses against intracellular pathogens in the horse. We hypothesized that priming with a codon-optimized plasmid encoding EIAV Gag p15/p26 with co-administration of a plasmid encoding an equine IL-2/IgG fusion protein as a molecular adjuvant, followed by boosting with a vaccinia vector expressing Gag p15/p26, would induce protective Gag-specific CTL responses. Although the regimen induced Gag-specific CTL in four of seven vaccinated horses, CTL were not detected until after the vaccinia boost, and protective effects were not observed in EIAV challenged vaccinates. Unexpectedly, vaccinates had significantly higher viral loads and more severe clinical disease, associated with the presence of vaccine-induced CTL. It was concluded that 1.) further optimization of the timing and route of DNA immunization was needed for efficient CTL priming in vivo, 2.) co-administration of the IL-2/IgG plasmid did not enhance CTL priming by the Gag p15/p26 plasmid, 3.) vaccinia vectors are useful for lentivirus-specific CTL induction in the horse, 4.) Gag-specific CTL alone are either insufficient or a more robust Gag-specific CTL response is needed to limit EIAV viremia and clinical disease, and 5.) CTL-inducing vaccines lacking envelope immunogens can result in lentiviral disease enhancement. Although the mechanisms for enhancement associated with this vaccine regimen remain to be elucidated, these results have important implications for development of lentivirus T cell vaccines. PMID:19368787
2012-01-01
Background Malaria remains a major cause of morbidity and mortality worldwide. Flow cytometry-based assays that take advantage of fluorescent protein (FP)-expressing malaria parasites have proven to be valuable tools for quantification and sorting of specific subpopulations of parasite-infected red blood cells. However, identification of rare subpopulations of parasites using green fluorescent protein (GFP) labelling is complicated by autofluorescence (AF) of red blood cells and low signal from transgenic parasites. It has been suggested that cell sorting yield could be improved by using filters that precisely match the emission spectrum of GFP. Methods Detection of transgenic Plasmodium falciparum parasites expressing either tdTomato or GFP was performed using a flow cytometer with interchangeable optical filters. Parasitaemia was evaluated using different optical filters and, after optimization of optics, the GFP-expressing parasites were sorted and analysed by microscopy after cytospin preparation and by imaging cytometry. Results A new approach to evaluate filter performance in flow cytometry using two-dimensional dot blot was developed. By selecting optical filters with narrow bandpass (BP) and maximum position of filter emission close to GFP maximum emission in the FL1 channel (510/20, 512/20 and 517/20; dichroics 502LP and 466LP), AF was markedly decreased and signal-background improve dramatically. Sorting of GFP-expressing parasite populations in infected red blood cells at 90 or 95% purity with these filters resulted in 50-150% increased yield when compared to the standard filter set-up. The purity of the sorted population was confirmed using imaging cytometry and microscopy of cytospin preparations of sorted red blood cells infected with transgenic malaria parasites. Discussion Filter optimization is particularly important for applications where the FP signal and percentage of positive events are relatively low, such as analysis of parasite-infected samples with in the intention of gene-expression profiling and analysis. The approach outlined here results in substantially improved yield of GFP-expressing parasites, and requires decreased sorting time in comparison to standard methods. It is anticipated that this protocol will be useful for a wide range of applications involving rare events. PMID:22950515
High content analysis of differentiation and cell death in human adipocytes.
Doan-Xuan, Quang Minh; Sarvari, Anitta K; Fischer-Posovszky, Pamela; Wabitsch, Martin; Balajthy, Zoltan; Fesus, Laszlo; Bacso, Zsolt
2013-10-01
Understanding adipocyte biology and its homeostasis is in the focus of current obesity research. We aimed to introduce a high-content analysis procedure for directly visualizing and quantifying adipogenesis and adipoapoptosis by laser scanning cytometry (LSC) in a large population of cell. Slide-based image cytometry and image processing algorithms were used and optimized for high-throughput analysis of differentiating cells and apoptotic processes in cell culture at high confluence. Both preadipocytes and adipocytes were simultaneously scrutinized for lipid accumulation, texture properties, nuclear condensation, and DNA fragmentation. Adipocyte commitment was found after incubation in adipogenic medium for 3 days identified by lipid droplet formation and increased light absorption, while terminal differentiation of adipocytes occurred throughout day 9-14 with characteristic nuclear shrinkage, eccentric nuclei localization, chromatin condensation, and massive lipid deposition. Preadipocytes were shown to be more prone to tumor necrosis factor alpha (TNFα)-induced apoptosis compared to mature adipocytes. Importantly, spontaneous DNA fragmentation was observed at early stage when adipocyte commitment occurs. This DNA damage was independent from either spontaneous or induced apoptosis and probably was part of the differentiation program. © 2013 International Society for Advancement of Cytometry. Copyright © 2013 International Society for Advancement of Cytometry.
Optimization of PZT ceramic IDT sensors for health monitoring of structures.
Takpara, Rafatou; Duquennoy, Marc; Ouaftouh, Mohammadi; Courtois, Christian; Jenot, Frédéric; Rguiti, Mohamed
2017-08-01
Surface acoustic waves (SAW) are particularly suited to effectively monitoring and characterizing structural surfaces (condition of the surface, coating, thin layer, micro-cracks…) as their energy is localized on the surface, within approximately one wavelength. Conventionally, in non-destructive testing, wedge sensors are used to the generation guided waves but they are especially suited to flat surfaces and sized for a given type material (angle of refraction). Additionally, these sensors are quite expensive so it is quite difficult to leave the sensors permanently on the structure for its health monitoring. Therefore we are considering in this study, another type of ultrasonic sensors, able to generate SAW. These sensors are interdigital sensors or IDT sensors for InterDigital Transducer. This paper focuses on optimization of IDT sensors for non-destructive structural testing by using PZT ceramics. The challenge was to optimize the dimensional parameters of the IDT sensors in order to efficiently generate surface waves. Acoustic tests then confirmed these parameters. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Foyle, David C.
1993-01-01
Based on existing integration models in the psychological literature, an evaluation framework is developed to assess sensor fusion displays as might be implemented in an enhanced/synthetic vision system. The proposed evaluation framework for evaluating the operator's ability to use such systems is a normative approach: The pilot's performance with the sensor fusion image is compared to models' predictions based on the pilot's performance when viewing the original component sensor images prior to fusion. This allows for the determination as to when a sensor fusion system leads to: poorer performance than one of the original sensor displays, clearly an undesirable system in which the fused sensor system causes some distortion or interference; better performance than with either single sensor system alone, but at a sub-optimal level compared to model predictions; optimal performance compared to model predictions; or, super-optimal performance, which may occur if the operator were able to use some highly diagnostic 'emergent features' in the sensor fusion display, which were unavailable in the original sensor displays.
Detection of anthrax lef with DNA-based photonic crystal sensors
NASA Astrophysics Data System (ADS)
Zhang, Bailin; Dallo, Shatha; Peterson, Ralph; Hussain, Syed; Weitao, Tao; Ye, Jing Yong
2011-12-01
Bacillus anthracis has posed a threat of becoming biological weapons of mass destruction due to its virulence factors encoded by the plasmid-borne genes, such as lef for lethal factor. We report the development of a fast and sensitive anthrax DNA biosensor based on a photonic crystal structure used in a total-internal-reflection configuration. For the detection of the lef gene, a single-stranded DNA lef probe was biotinylated and immobilized onto the sensor via biotin-streptavidin interactions. A positive control, lef-com, was the complementary strand of the probe, while a negative control was an unrelated single-stranded DNA fragment from the 16S rRNA gene of Acinetobacter baumannii. After addition of the biotinylated lef probe onto the sensor, significant changes in the resonance wavelength of the sensor were observed, resulting from binding of the probe to streptavidin on the sensor. The addition of lef-com led to another significant increase as a result of hybridization between the two DNA strands. The detection sensitivity for the target DNA reached as low as 0.1 nM. In contrast, adding the unrelated DNAs did not cause an obvious shift in the resonant wavelength. These results demonstrate that detection of the anthrax lef by the photonic crystal structure in a total-internal-reflection sensor is highly specific and sensitive.
Systematic Sensor Selection Strategy (S4) User Guide
NASA Technical Reports Server (NTRS)
Sowers, T. Shane
2012-01-01
This paper describes a User Guide for the Systematic Sensor Selection Strategy (S4). S4 was developed to optimally select a sensor suite from a larger pool of candidate sensors based on their performance in a diagnostic system. For aerospace systems, selecting the proper sensors is important for ensuring adequate measurement coverage to satisfy operational, maintenance, performance, and system diagnostic criteria. S4 optimizes the selection of sensors based on the system fault diagnostic approach while taking conflicting objectives such as cost, weight and reliability into consideration. S4 can be described as a general architecture structured to accommodate application-specific components and requirements. It performs combinational optimization with a user defined merit or cost function to identify optimum or near-optimum sensor suite solutions. The S4 User Guide describes the sensor selection procedure and presents an example problem using an open source turbofan engine simulation to demonstrate its application.
Optimal Sensor Location Design for Reliable Fault Detection in Presence of False Alarms
Yang, Fan; Xiao, Deyun; Shah, Sirish L.
2009-01-01
To improve fault detection reliability, sensor location should be designed according to an optimization criterion with constraints imposed by issues of detectability and identifiability. Reliability requires the minimization of undetectability and false alarm probability due to random factors on sensor readings, which is not only related with sensor readings but also affected by fault propagation. This paper introduces the reliability criteria expression based on the missed/false alarm probability of each sensor and system topology or connectivity derived from the directed graph. The algorithm for the optimization problem is presented as a heuristic procedure. Finally, a boiler system is illustrated using the proposed method. PMID:22291524
Modeling and Error Analysis of a Superconducting Gravity Gradiometer.
1979-08-01
fundamental limit to instrument - -1- sensitivity is the thermal noise of the sensor . For the gradiometer design outlined above, the best sensitivity...Mapoles at Stanford. Chapter IV determines the relation between dynamic range, the sensor Q, and the thermal noise of the cryogenic accelerometer. An...C.1 Accelerometer Optimization (1) Development and optimization of the loaded diaphragm sensor . (2) Determination of the optimal values of the
Fu, Yutao; O'Kelly, Charles; Sieracki, Michael; Distel, Daniel L.
2003-01-01
Selective grazing by protists can profoundly influence bacterial community structure, and yet direct, quantitative observation of grazing selectivity has been difficult to achieve. In this investigation, flow cytometry was used to study grazing by the marine heterotrophic flagellate Paraphysomonas imperforata on live bacterial cells genetically modified to express the fluorescent protein markers green fluorescent protein (GFP) and red fluorescent protein (RFP). Broad-host-range plasmids were constructed that express fluorescent proteins in three bacterial prey species, Escherichia coli, Enterobacter aerogenes, and Pseudomonas putida. Micromonas pusilla, an alga with red autofluorescence, was also used as prey. Predator-prey interactions were quantified by using a FACScan flow cytometer and analyzed by using a Perl program described here. Grazing preference of P. imperforata was influenced by prey type, size, and condition. In competitive feeding trials, P. imperforata consumed algal prey at significantly lower rates than FP (fluorescent protein)-labeled bacteria of similar or different size. Within-species size selection was also observed, but only for P. putida, the largest prey species examined; smaller cells of P. putida were grazed preferentially. No significant difference in clearance rate was observed between GFP- and RFP-labeled strains of the same prey species or between wild-type and GFP-labeled strains. In contrast, the common chemical staining method, 5-(4,6-dichloro-triazin-2-yl)-amino fluorescein hydrochloride, depressed clearance rates for bacterial prey compared to unlabeled or RFP-labeled cells. PMID:14602649
[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].
Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min
2015-05-01
To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.
Cui, Huanqing; Shu, Minglei; Song, Min; Wang, Yinglong
2017-01-01
Localization is a key technology in wireless sensor networks. Faced with the challenges of the sensors’ memory, computational constraints, and limited energy, particle swarm optimization has been widely applied in the localization of wireless sensor networks, demonstrating better performance than other optimization methods. In particle swarm optimization-based localization algorithms, the variants and parameters should be chosen elaborately to achieve the best performance. However, there is a lack of guidance on how to choose these variants and parameters. Further, there is no comprehensive performance comparison among particle swarm optimization algorithms. The main contribution of this paper is three-fold. First, it surveys the popular particle swarm optimization variants and particle swarm optimization-based localization algorithms for wireless sensor networks. Secondly, it presents parameter selection of nine particle swarm optimization variants and six types of swarm topologies by extensive simulations. Thirdly, it comprehensively compares the performance of these algorithms. The results show that the particle swarm optimization with constriction coefficient using ring topology outperforms other variants and swarm topologies, and it performs better than the second-order cone programming algorithm. PMID:28257060
NASA Astrophysics Data System (ADS)
Vecherin, Sergey N.; Wilson, D. Keith; Pettit, Chris L.
2010-04-01
Determination of an optimal configuration (numbers, types, and locations) of a sensor network is an important practical problem. In most applications, complex signal propagation effects and inhomogeneous coverage preferences lead to an optimal solution that is highly irregular and nonintuitive. The general optimization problem can be strictly formulated as a binary linear programming problem. Due to the combinatorial nature of this problem, however, its strict solution requires significant computational resources (NP-complete class of complexity) and is unobtainable for large spatial grids of candidate sensor locations. For this reason, a greedy algorithm for approximate solution was recently introduced [S. N. Vecherin, D. K. Wilson, and C. L. Pettit, "Optimal sensor placement with terrain-based constraints and signal propagation effects," Unattended Ground, Sea, and Air Sensor Technologies and Applications XI, SPIE Proc. Vol. 7333, paper 73330S (2009)]. Here further extensions to the developed algorithm are presented to include such practical needs and constraints as sensor availability, coverage by multiple sensors, and wireless communication of the sensor information. Both communication and detection are considered in a probabilistic framework. Communication signal and signature propagation effects are taken into account when calculating probabilities of communication and detection. Comparison of approximate and strict solutions on reduced-size problems suggests that the approximate algorithm yields quick and good solutions, which thus justifies using that algorithm for full-size problems. Examples of three-dimensional outdoor sensor placement are provided using a terrain-based software analysis tool.
Urbanowicz, Richard A; McClure, C Patrick; King, Barnabas; Mason, Christopher P; Ball, Jonathan K; Tarr, Alexander W
2016-09-01
Retrovirus pseudotypes are a highly tractable model used to study the entry pathways of enveloped viruses. This model has been extensively applied to the study of the hepatitis C virus (HCV) entry pathway, preclinical screening of antiviral antibodies and for assessing the phenotype of patient-derived viruses using HCV pseudoparticles (HCVpp) possessing the HCV E1 and E2 glycoproteins. However, not all patient-isolated clones produce particles that are infectious in this model. This study investigated factors that might limit phenotyping of patient-isolated HCV glycoproteins. Genetically related HCV glycoproteins from quasispecies in individual patients were discovered to behave very differently in this entry model. Empirical optimization of the ratio of packaging construct and glycoprotein-encoding plasmid was required for successful HCVpp genesis for different clones. The selection of retroviral packaging construct also influenced the function of HCV pseudoparticles. Some glycoprotein constructs tolerated a wide range of assay parameters, while others were much more sensitive to alterations. Furthermore, glycoproteins previously characterized as unable to mediate entry were found to be functional. These findings were validated using chimeric cell-cultured HCV bearing these glycoproteins. Using the same empirical approach we demonstrated that generation of infectious ebolavirus pseudoviruses (EBOVpv) was also sensitive to the amount and ratio of plasmids used, and that protocols for optimal production of these pseudoviruses are dependent on the exact virus glycoprotein construct. These findings demonstrate that it is crucial for studies utilizing pseudoviruses to conduct empirical optimization of pseudotype production for each specific glycoprotein sequence to achieve optimal titres and facilitate accurate phenotyping.
Optimized signal detection and analysis methods for in vivo photoacoustic flow cytometry
NASA Astrophysics Data System (ADS)
Wang, Qiyan; Zhou, Quanyu; Yang, Ping; Wang, Xiaoling; Niu, Zhenyu; Suo, Yuanzhen; He, Hao; Gao, Wenyuan; Tang, Shuo; Wei, Xunbin
2017-02-01
Melanoma is known as a malignant tumor of melanocytes, which usually appear in the blood circulation at the metastasis stage of cancer. Thus the detection of circulating melanoma cells is useful for early diagnosis and therapy of cancer. Here we have developed an in vivo photoacoustic flow cytometry (PAFC) based on the photoacoustic effect to detect melanoma cells. However, the raw signals we obtain from the target cells contain noises such as environmental sonic noises and electronic noises. Therefore we apply correlation comparison and feature separation methods to the detection and verification of the in vivo signals. Due to similar shape and structure of cells, the photoacoustic signals usually have similar vibration mode. By analyzing the correlations and the signal features in time domain and frequency domain, we are able to provide a method for separating photoacoustic signals generated by target cells from background noises. The method introduced here has proved to optimize the signal acquisition and signal processing, which can improve the detection accuracy in PAFC.
NASA Astrophysics Data System (ADS)
Gao, Dongyue; Wang, Yishou; Wu, Zhanjun; Rahim, Gorgin; Bai, Shengbao
2014-05-01
The detection capability of a given structural health monitoring (SHM) system strongly depends on its sensor network placement. In order to minimize the number of sensors while maximizing the detection capability, optimal design of the PZT sensor network placement is necessary for structural health monitoring (SHM) of a full-scale composite horizontal tail. In this study, the sensor network optimization was simplified as a problem of determining the sensor array placement between stiffeners to achieve the desired the coverage rate. First, an analysis of the structural layout and load distribution of a composite horizontal tail was performed. The constraint conditions of the optimal design were presented. Then, the SHM algorithm of the composite horizontal tail under static load was proposed. Based on the given SHM algorithm, a sensor network was designed for the full-scale composite horizontal tail structure. Effective profiles of cross-stiffener paths (CRPs) and uncross-stiffener paths (URPs) were estimated by a Lamb wave propagation experiment in a multi-stiffener composite specimen. Based on the coverage rate and the redundancy requirements, a seven-sensor array-network was chosen as the optimal sensor network for each airfoil. Finally, a preliminary SHM experiment was performed on a typical composite aircraft structure component. The reliability of the SHM result for a composite horizontal tail structure under static load was validated. In the result, the red zone represented the delamination damage. The detection capability of the optimized sensor network was verified by SHM of a full-scale composite horizontal tail; all the diagnosis results were obtained in two minutes. The result showed that all the damage in the monitoring region was covered by the sensor network.
Plasmid profiling of bacterial isolates from confined environments
NASA Astrophysics Data System (ADS)
van Houdt, Rob; Provoost, Ann; Coninx, Ilse; Leys, Natalie; Mergeay, Max
Plasmid profiling of bacterial isolates from confined environments R. Van Houdt, I. Coninx, A. Provoost, N. Leys, and M. Mergeay Expertise group for Molecular and Cellular Biology, Institute for Environment, Health and Safety, Belgian Nuclear Research Centre (SCK•CEN), Boeretang 200, B-2400 Mol, Belgium. Human exploration of extreme and isolated hostile environments such as space requires special confined small volume habitats to protect and house the crew. However, human confinement in such small volume habitats has restrictions on waste disposal and personal hygiene and inevitably generates a particular community of microorganisms within the habitat. These microorganisms are mainly originating from the crew (skin, mucous membranes, upper respiratory tract, mouth, and gastrointestinal tract) but also include the residing environmental microorganisms. Earth-based confined habitats such as the Antarctic Research Station Concordia are used as test beds for long-duration spaceflights to study the physiologic and psychological adaptation to isolated environments. The dynamics of the environmental microbial population in such a test bed could render additional insights in assessing the potential health risks in long-duration space missions. Not only total bacterial contamination levels are important, but it is essential to identify also the predominant microbial taxa and their mobile genetic elements (MGE). These MGEs could be exchanged between bacteria by horizontal gene transfer and may alter the pathogenic potential since they often carry antibiotic resistance or more in general adaptation-enhancing traits. In this study several bacterial strains isolated in the Concordia research station were examined for their plasmid content. An optimized protocol for extraction of large plasmids showed the present of at least one plasmid in 50% of the strains. For all strains the minimal inhibitory concentration of a range of antibiotics was determined indicating resistance to different classes of antibiotics including aminoglycosides, penicillins, macrolides and chloramphenicol. Whether these antibiotic resistance determinants are plasmid-bound and whether these traits can be transferred to other bacteria is under investigation.
Richardson, Ruth E.; Suzuki, Yo
2015-01-01
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330
Engineered CRISPR/Cas9 system for multiplex genome engineering of polyploid industrial yeast strains
Lian, Jiazhang; Bao, Zehua; Hu, Sumeng; ...
2018-02-20
The CRISPR/Cas9 system has been widely used for multiplex genome engineering of Saccharomyces cerevisiae. Furthermore, its application in manipulating industrial yeast strains is less successful, probably due to the genome complexity and low copy numbers of gRNA expression plasmids. Here we developed an efficient CRISPR/Cas9 system for industrial yeast strain engineering by using our previously engineered plasmids with increased copy numbers. Four genes in both a diploid strain (Ethanol Red, 8 alleles in total) and a triploid strain (ATCC 4124, 12 alleles in total) were knocked out in a single step with 100% efficiency. This system was used to constructmore » xylose-fermenting, lactate-producing industrial yeast strains, in which ALD6, PHO13, LEU2, and URA3 were disrupted in a single step followed by the introduction of a xylose utilization pathway and a lactate biosynthetic pathway on auxotrophic marker plasmids. The optimized CRISPR/Cas9 system provides a powerful tool for the development of industrial yeast based microbial cell factories.« less
Engineered CRISPR/Cas9 system for multiplex genome engineering of polyploid industrial yeast strains
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lian, Jiazhang; Bao, Zehua; Hu, Sumeng
The CRISPR/Cas9 system has been widely used for multiplex genome engineering of Saccharomyces cerevisiae. Furthermore, its application in manipulating industrial yeast strains is less successful, probably due to the genome complexity and low copy numbers of gRNA expression plasmids. Here we developed an efficient CRISPR/Cas9 system for industrial yeast strain engineering by using our previously engineered plasmids with increased copy numbers. Four genes in both a diploid strain (Ethanol Red, 8 alleles in total) and a triploid strain (ATCC 4124, 12 alleles in total) were knocked out in a single step with 100% efficiency. This system was used to constructmore » xylose-fermenting, lactate-producing industrial yeast strains, in which ALD6, PHO13, LEU2, and URA3 were disrupted in a single step followed by the introduction of a xylose utilization pathway and a lactate biosynthetic pathway on auxotrophic marker plasmids. The optimized CRISPR/Cas9 system provides a powerful tool for the development of industrial yeast based microbial cell factories.« less
Liachko, Ivan; Youngblood, Rachel A.; Keich, Uri; Dunham, Maitreya J.
2013-01-01
DNA replication origins are necessary for the duplication of genomes. In addition, plasmid-based expression systems require DNA replication origins to maintain plasmids efficiently. The yeast autonomously replicating sequence (ARS) assay has been a valuable tool in dissecting replication origin structure and function. However, the dearth of information on origins in diverse yeasts limits the availability of efficient replication origin modules to only a handful of species and restricts our understanding of origin function and evolution. To enable rapid study of origins, we have developed a sequencing-based suite of methods for comprehensively mapping and characterizing ARSs within a yeast genome. Our approach finely maps genomic inserts capable of supporting plasmid replication and uses massively parallel deep mutational scanning to define molecular determinants of ARS function with single-nucleotide resolution. In addition to providing unprecedented detail into origin structure, our data have allowed us to design short, synthetic DNA sequences that retain maximal ARS function. These methods can be readily applied to understand and modulate ARS function in diverse systems. PMID:23241746
Lian, Jiazhang; Bao, Zehua; Hu, Sumeng; Zhao, Huimin
2018-06-01
The CRISPR/Cas9 system has been widely used for multiplex genome engineering of Saccharomyces cerevisiae. However, its application in manipulating industrial yeast strains is less successful, probably due to the genome complexity and low copy numbers of gRNA expression plasmids. Here we developed an efficient CRISPR/Cas9 system for industrial yeast strain engineering by using our previously engineered plasmids with increased copy numbers. Four genes in both a diploid strain (Ethanol Red, 8 alleles in total) and a triploid strain (ATCC 4124, 12 alleles in total) were knocked out in a single step with 100% efficiency. This system was used to construct xylose-fermenting, lactate-producing industrial yeast strains, in which ALD6, PHO13, LEU2, and URA3 were disrupted in a single step followed by the introduction of a xylose utilization pathway and a lactate biosynthetic pathway on auxotrophic marker plasmids. The optimized CRISPR/Cas9 system provides a powerful tool for the development of industrial yeast based microbial cell factories. © 2018 Wiley Periodicals, Inc.
He, Weiwei; Mu, Wanmeng; Jiang, Bo; Yan, Xin; Zhang, Tao
2016-04-27
A food grade recombinant Bacillus subtilis that produces d-psicose 3-epimerase (DPEase; EC 5.1.3.30) was constructed by transforming a replicative multicopy plasmid with a d-alanine racemase gene marker into B. subtilis 1A751 with the d-alanine racemase gene knocked out. The DPEase was expressed in B. subtilis without antibiotic resistance genes and without adding antibiotics during fermentation. Whole cells of the food grade recombinant B. subtilis were used to biotransform d-fructose to d-allulose. The two tandem promoters, including the HpaII and P43 promoters, increased expression levels compared to the use of one promoter, HpaII. For large-scale d-allulose production, the optimal enzyme dose was 40 enzyme activity units of dry cells per gram of d-fructose, which produced a 28.5% turnover yield in 60 min. The recombinant plasmid exhibited stability over 100 generations. This food grade recombinant B. subtilis may be used for large-scale d-allulose production in the food industry.
Guimarães, Dayan Adionel; Sakai, Lucas Jun; Alberti, Antonio Marcos; de Souza, Rausley Adriano Amaral
2016-09-20
In this paper, a simple and flexible method for increasing the lifetime of fixed or mobile wireless sensor networks is proposed. Based on past residual energy information reported by the sensor nodes, the sink node or another central node dynamically optimizes the communication activity levels of the sensor nodes to save energy without sacrificing the data throughput. The activity levels are defined to represent portions of time or time-frequency slots in a frame, during which the sensor nodes are scheduled to communicate with the sink node to report sensory measurements. Besides node mobility, it is considered that sensors' batteries may be recharged via a wireless power transmission or equivalent energy harvesting scheme, bringing to the optimization problem an even more dynamic character. We report large increased lifetimes over the non-optimized network and comparable or even larger lifetime improvements with respect to an idealized greedy algorithm that uses both the real-time channel state and the residual energy information.
Barucca, A; Capitani, M; Cesca, M; Tomassoni, D; Kazmi, U; Concetti, F; Vincenzetti, L; Concetti, A; Venanzi, F M
2014-11-01
Anti-idiotypic MK2-23 monoclonal antibody (anti-Id MK2-23 mAb), which mimics the high molecular weight melanoma-associated antigen (HMW-MAA), has been used to implement active immunotherapy against melanoma. However, due to safety and standardization issues, this approach never entered extensive clinical trials. In the present study, we investigated the usage of DNA vaccines as an alternative to MK2-23 mAb immunization. MK2-23 DNA plasmids coding for single chain (scFv) MK2-23 antibody were constructed via the insertion of variable heavy (V H) and light (V L) chains of MK2-23 into the pVAC-1mcs plasmids. Two alternative MK2-23 plasmids format V H/V L, and V L/V H were assembled. We demonstrate that both polypeptides expressed by scFv plasmids in vitro retained the ability to mimic HMW-MAA antigen, and to elicit specific anti-HMW-MAA humoral and cellular immunoresponses in immunized mice. Notably, MK2-23 scFv DNA vaccines impaired the onset and growth of transplantable B16 melanoma cells not engineered to express HMW-MAA. This pilot study suggests that optimized MK2-23 scFv DNA vaccines could potentially provide a safer and cost-effective alternative to anti-Id antibody immunization, for melanoma immunotherapy.
Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival
2016-09-01
A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip
2011-08-01
The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.
Near infrared lasers in flow cytometry.
Telford, William G
2015-07-01
Technology development in flow cytometry has closely tracked laser technology, the light source that flow cytometers almost exclusively use to excite fluorescent probes. The original flow cytometers from the 1970s and 1980s used large water-cooled lasers to produce only one or two laser lines at a time. Modern cytometers can take advantage of the revolution in solid state laser technology to use almost any laser wavelength ranging from the ultraviolet to the near infrared. Commercial cytometers can now be equipped with many small solid state lasers, providing almost any wavelength needed for cellular analysis. Flow cytometers are now equipped to analyze 20 or more fluorescent probes simultaneously, requiring multiple laser wavelengths. Instrument developers are now trying to increase this number by designing fluorescent probes that can be excited by laser wavelength at the "edges" of the visible light range, in the near ultraviolet and near-infrared region. A variety of fluorescent probes have been developed that excite with violet and long wavelength ultraviolet light; however, the near-infrared range (660-800 nm) has yet seen only exploitation in flow cytometry. Fortunately, near-infrared laser diodes and other solid state laser technologies appropriate for flow cytometry have been in existence for some time, and can be readily incorporated into flow cytometers to accelerate fluorescent probe development. The near infrared region represents one of the last "frontiers" to maximize the number of fluorescent probes that can be analyzed by flow cytometry. In addition, near infrared fluorescent probes used in biomedical tracking and imaging could also be employed for flow cytometry with the correct laser wavelengths. This review describes the available technology, including lasers, fluorescent probes and detector technology optimal for near infrared signal detection. Published by Elsevier Inc.
Tyler, Christopher J; Pérez-Jeldres, Tamara; Ehinger, Erik; Capaldo, Brian; Karuppuchamy, Thangaraj; Boyer, Joshua D; Patel, Derek; Dulai, Parambir; Boland, Brigid S; Lannigan, Joanne; Eckmann, Lars; Ernst, Peter B; Sandborn, William J; Ho, Samuel B; Rivera-Nieves, Jesús
2018-06-08
Novel therapeutics for inflammatory bowel disease (IBD) are under development, yet mechanistic readouts at the tissue level are lacking. Techniques to assess intestinal immune composition could represent a valuable tool for mechanism of action (MOA) studies of novel drugs. Mass cytometry enables analysis of intestinal inflammatory cell infiltrate and corresponding molecular fingerprints with unprecedented resolution. Here, we aimed to optimize the methodology for isolation and cryopreservation of cells from intestinal tissue to allow for the potential implementation of mass cytometry in MOA studies. We investigated key technical issues, including minimal tissue requirements, cell isolation protocols, and cell storage, using intestinal biopsies and peripheral blood from healthy individuals. High-dimensional mass cytometry was employed for the analyses of biopsy-derived intestinal cellular subsets. Dithiothreitol and mechanical dissociation decreased epithelial cell contamination and allowed for isolation of adequate cell numbers from 2 to 4 colonic or ileal biopsies (6 × 104±2 × 104) after a 20-minute collagenase digestion, allowing for reliable detection of most major immune cell subsets. Biopsies and antibody-labeled mononuclear cells could be cryopreserved for later processing and acquisition (viability > 70%; P < 0.05). Mass cytometry represents a unique tool for deep immunophenotyping intestinal cell composition. This technique has the potential to facilitate analysis of drug actions at the target tissue by identifying specific cellular subsets and their molecular signatures. Its widespread implementation may impact not only IBD research but also other gastrointestinal conditions where inflammatory cells play a role in pathogenesis.
Lab-on-a-chip sensor for measuring Zn by stripping voltammetry
NASA Astrophysics Data System (ADS)
Pei, Xing; Kang, Wenjing; Yue, Wei; Bange, Adam; Wong, Hector R.; Heineman, William R.; Papautsky, Ian
2012-03-01
This work reports on continuing development of a lab-on-a-chip sensor for electrochemical detection of heavy metal zinc in blood serum. The sensor consists of a three electrode system, including an environmentally-friendly bismuth working electrode, a Ag/AgCl reference electrode, and a gold auxiliary electrode. By optimizing the electrodeposition of bismuth film, better control of fabrication steps and improving interface between the sensor and potentiostat, repeatability and sensitivity of the lab-on-a-chip sensor has been improved. Through optimization of electrolyte and stripping voltammetry parameters, limits of detection were greatly improved. The optimized sensor was able to measure zinc in in the physiological range of 65-95 μg/dL. Ultimately, with further development and integrated sample preparation sensor system will permit rapid (min) measurements of zinc from a sub-mL sample (a few drops of blood) for bedside monitoring.
A Sensor Dynamic Measurement Error Prediction Model Based on NAPSO-SVM.
Jiang, Minlan; Jiang, Lan; Jiang, Dingde; Li, Fei; Song, Houbing
2018-01-15
Dynamic measurement error correction is an effective way to improve sensor precision. Dynamic measurement error prediction is an important part of error correction, and support vector machine (SVM) is often used for predicting the dynamic measurement errors of sensors. Traditionally, the SVM parameters were always set manually, which cannot ensure the model's performance. In this paper, a SVM method based on an improved particle swarm optimization (NAPSO) is proposed to predict the dynamic measurement errors of sensors. Natural selection and simulated annealing are added in the PSO to raise the ability to avoid local optima. To verify the performance of NAPSO-SVM, three types of algorithms are selected to optimize the SVM's parameters: the particle swarm optimization algorithm (PSO), the improved PSO optimization algorithm (NAPSO), and the glowworm swarm optimization (GSO). The dynamic measurement error data of two sensors are applied as the test data. The root mean squared error and mean absolute percentage error are employed to evaluate the prediction models' performances. The experimental results show that among the three tested algorithms the NAPSO-SVM method has a better prediction precision and a less prediction errors, and it is an effective method for predicting the dynamic measurement errors of sensors.
Mathew, Ribu; Sankar, A Ravi
2018-05-01
In this paper, we present the design and optimization of a rectangular piezoresistive composite silicon dioxide nanocantilever sensor. Unlike the conventional design approach, we perform the sensor optimization by not only considering its electro-mechanical response but also incorporating the impact of self-heating induced thermal drift in its terminal characteristics. Through extensive simulations first we comprehend and quantify the inaccuracies due to self-heating effect induced by the geometrical and intrinsic parameters of the piezoresistor. Then, by optimizing the ratio of electrical sensitivity to thermal sensitivity defined as the sensitivity ratio (υ) we improve the sensor performance and measurement reliability. Results show that to ensure υ ≥ 1, shorter and wider piezoresistors are better. In addition, it is observed that unlike the general belief that high doping concentration of piezoresistor reduces thermal sensitivity in piezoresistive sensors, to ensure υ ≥ 1 doping concentration (p) should be in the range: 1E18 cm-3 ≤ p ≤ 1E19 cm-3. Finally, we provide a set of design guidelines that will help NEMS engineers to optimize the performance of such sensors for chemical and biological sensing applications.
Unsteady flow sensing and optimal sensor placement using machine learning
NASA Astrophysics Data System (ADS)
Semaan, Richard
2016-11-01
Machine learning is used to estimate the flow state and to determine the optimal sensor placement over a two-dimensional (2D) airfoil equipped with a Coanda actuator. The analysis is based on flow field data obtained from 2D unsteady Reynolds averaged Navier-Stokes (uRANS) simulations with different jet blowing intensities and actuation frequencies, characterizing different flow separation states. This study shows how the "random forests" algorithm is utilized beyond its typical usage in fluid mechanics estimating the flow state to determine the optimal sensor placement. The results are compared against the current de-facto standard of maximum modal amplitude location and against a brute force approach that scans all possible sensor combinations. The results show that it is possible to simultaneously infer the state of flow and to determine the optimal sensor location without the need to perform proper orthogonal decomposition. Collaborative Research Center (CRC) 880, DFG.
Sentient Structures: Optimising Sensor Layouts for Direct Measurement of Discrete Variables
2008-11-01
1 Sentient Structures Optimising Sensor Layouts for Direct Measurement of Discrete Variables Report to US Air Force...TITLE AND SUBTITLE Sentient Structures 5a. CONTRACT NUMBER FA48690714045 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Donald Price...optimal sensor placements is an important requirement for the development of sentient structures. An optimal sensor layout is attained when a limited
Design of portable ultraminiature flow cytometers for medical diagnostics
NASA Astrophysics Data System (ADS)
Leary, James F.
2018-02-01
Design of portable microfluidic flow/image cytometry devices for measurements in the field (e.g. initial medical diagnostics) requires careful design in terms of power requirements and weight to allow for realistic portability. True portability with high-throughput microfluidic systems also requires sampling systems without the need for sheath hydrodynamic focusing both to avoid the need for sheath fluid and to enable higher volumes of actual sample, rather than sheath/sample combinations. Weight/power requirements dictate use of super-bright LEDs with top-hat excitation beam architectures and very small silicon photodiodes or nanophotonic sensors that can both be powered by small batteries. Signal-to-noise characteristics can be greatly improved by appropriately pulsing the LED excitation sources and sampling and subtracting noise in between excitation pulses. Microfluidic cytometry also requires judicious use of small sample volumes and appropriate statistical sampling by microfluidic cytometry or imaging for adequate statistical significance to permit real-time (typically in less than 15 minutes) initial medical decisions for patients in the field. This is not something conventional cytometry traditionally worries about, but is very important for development of small, portable microfluidic devices with small-volume throughputs. It also provides a more reasonable alternative to conventional tubes of blood when sampling geriatric and newborn patients for whom a conventional peripheral blood draw can be problematical. Instead one or two drops of blood obtained by pin-prick should be able to provide statistically meaningful results for use in making real-time medical decisions without the need for blood fractionation, which is not realistic in the doctor's office or field.
An optimized cell culture-immunofluorescence (IFA) procedure, using the HCT-8 cell line, was evaluated in 'blind' trials to determine the sensitivity and reproducibility for measuring infectivity of flow cytometry prepared inocula of C. parvum oocysts. In separate trials, suspens...
The sensor kinase MprB is required for Rhodococcus equi virulence.
MacArthur, Iain; Parreira, Valeria R; Lepp, Dion; Mutharia, Lucy M; Vazquez-Boland, José A; Prescott, John F
2011-01-10
Rhodococcus equi is a soil bacterium and, like Mycobacterium tuberculosis, a member of the mycolata. Through possession of a virulence plasmid, it has the ability to infect the alveolar macrophages of foals, resulting in pyogranulomatous bronchopneumonia. The virulence plasmid has an orphan two-component system (TCS) regulatory gene, orf8, mutation of which completely attenuates virulence. This study attempted to find the cognate sensor kinase (SK) of orf8. Annotation of the R. equi strain 103 genome identified 23 TCSs encoded on the chromosome, which were used in a DNA microarray to compare TCS gene transcription in murine macrophage-like cells to growth in vitro. This identified six SKs as significantly up-regulated during growth in macrophages. Mutants of these SKs were constructed and their ability to persist in macrophages was determined with one SK, MprB, found to be required for intracellular survival. The attenuation of the mprB- mutant, and its complementation, was confirmed in a mouse virulence assay. In silico analysis of the R. equi genome sequence identified an MprA binding box motif homologous to that of M. tuberculosis, on mprA, pepD, sigB and sigE. The results of this study also show that R. equi responds to the macrophage environment differently from M. tuberculosis. MprB is the first SK identified as required for R. equi virulence and intracellular survival. Copyright © 2010 Elsevier B.V. All rights reserved.
Optimization of Thermal Neutron Converter in SiC Sensors for Spectral Radiation Measurements
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krolikowski, Igor; Cetnar, Jerzy; Issa, Fatima
2015-07-01
Optimization of the neutron converter in SiC sensors is presented. The sensors are used for spectral radiation measurements of thermal and fast neutrons and optionally gamma ray at elevated temperature in harsh radiation environment. The neutron converter, which is based on 10B, allows to detect thermal neutrons by means of neutron capture reaction. Two construction of the sensors were used to measure radiation in experiments. Sensor responses collected in experiments have been reproduced by the computer tool created by authors, it allows to validate the tool. The tool creates the response matrix function describing the characteristic of the sensors andmore » it was used for detailed analyses of the sensor responses. Obtained results help to optimize the neutron converter in order to increase thermal neutron detection. Several enhanced construction of the sensors, which includes the neutron converter based on {sup 10}B or {sup 6}Li, were proposed. (authors)« less
NASA Astrophysics Data System (ADS)
Dambreville, Frédéric
2013-10-01
While there is a variety of approaches and algorithms for optimizing the mission of an unmanned moving sensor, there are much less works which deal with the implementation of several sensors within a human organization. In this case, the management of the sensors is done through at least one human decision layer, and the sensors management as a whole arises as a bi-level optimization process. In this work, the following hypotheses are considered as realistic: Sensor handlers of first level plans their sensors by means of elaborated algorithmic tools based on accurate modelling of the environment; Higher level plans the handled sensors according to a global observation mission and on the basis of an approximated model of the environment and of the first level sub-processes. This problem is formalized very generally as the maximization of an unknown function, defined a priori by sampling a known random function (law of model error). In such case, each actual evaluation of the function increases the knowledge about the function, and subsequently the efficiency of the maximization. The issue is to optimize the sequence of value to be evaluated, in regards to the evaluation costs. There is here a fundamental link with the domain of experiment design. Jones, Schonlau and Welch proposed a general method, the Efficient Global Optimization (EGO), for solving this problem in the case of additive functional Gaussian law. In our work, a generalization of the EGO is proposed, based on a rare event simulation approach. It is applied to the aforementioned bi-level sensor planning.
Simulation of an enzyme-based glucose sensor
NASA Astrophysics Data System (ADS)
Sha, Xianzheng; Jablecki, Michael; Gough, David A.
2001-09-01
An important biosensor application is the continuous monitoring blood or tissue fluid glucose concentration in people with diabetes. Our research focuses on the development of a glucose sensor based on potentiostatic oxygen electrodes and immobilized glucose oxidase for long- term application as an implant in tissues. As the sensor signal depends on many design variables, a trial-and-error approach to sensor optimization can be time-consuming. Here, the properties of an implantable glucose sensor are optimized by a systematic computational simulation approach.
Integrated approach for automatic target recognition using a network of collaborative sensors.
Mahalanobis, Abhijit; Van Nevel, Alan
2006-10-01
We introduce what is believed to be a novel concept by which several sensors with automatic target recognition (ATR) capability collaborate to recognize objects. Such an approach would be suitable for netted systems in which the sensors and platforms can coordinate to optimize end-to-end performance. We use correlation filtering techniques to facilitate the development of the concept, although other ATR algorithms may be easily substituted. Essentially, a self-configuring geometry of netted platforms is proposed that positions the sensors optimally with respect to each other, and takes into account the interactions among the sensor, the recognition algorithms, and the classes of the objects to be recognized. We show how such a paradigm optimizes overall performance, and illustrate the collaborative ATR scheme for recognizing targets in synthetic aperture radar imagery by using viewing position as a sensor parameter.
Predictive simulations and optimization of nanowire field-effect PSA sensors including screening
NASA Astrophysics Data System (ADS)
Baumgartner, Stefan; Heitzinger, Clemens; Vacic, Aleksandar; Reed, Mark A.
2013-06-01
We apply our self-consistent PDE model for the electrical response of field-effect sensors to the 3D simulation of nanowire PSA (prostate-specific antigen) sensors. The charge concentration in the biofunctionalized boundary layer at the semiconductor-electrolyte interface is calculated using the propka algorithm, and the screening of the biomolecules by the free ions in the liquid is modeled by a sensitivity factor. This comprehensive approach yields excellent agreement with experimental current-voltage characteristics without any fitting parameters. Having verified the numerical model in this manner, we study the sensitivity of nanowire PSA sensors by changing device parameters, making it possible to optimize the devices and revealing the attributes of the optimal field-effect sensor.
Optimization of wireless sensor networks based on chicken swarm optimization algorithm
NASA Astrophysics Data System (ADS)
Wang, Qingxi; Zhu, Lihua
2017-05-01
In order to reduce the energy consumption of wireless sensor network and improve the survival time of network, the clustering routing protocol of wireless sensor networks based on chicken swarm optimization algorithm was proposed. On the basis of LEACH agreement, it was improved and perfected that the points on the cluster and the selection of cluster head using the chicken group optimization algorithm, and update the location of chicken which fall into the local optimum by Levy flight, enhance population diversity, ensure the global search capability of the algorithm. The new protocol avoided the die of partial node of intensive using by making balanced use of the network nodes, improved the survival time of wireless sensor network. The simulation experiments proved that the protocol is better than LEACH protocol on energy consumption, also is better than that of clustering routing protocol based on particle swarm optimization algorithm.
Wang, Jie-Sheng; Han, Shuang
2015-01-01
For predicting the key technology indicators (concentrate grade and tailings recovery rate) of flotation process, a feed-forward neural network (FNN) based soft-sensor model optimized by the hybrid algorithm combining particle swarm optimization (PSO) algorithm and gravitational search algorithm (GSA) is proposed. Although GSA has better optimization capability, it has slow convergence velocity and is easy to fall into local optimum. So in this paper, the velocity vector and position vector of GSA are adjusted by PSO algorithm in order to improve its convergence speed and prediction accuracy. Finally, the proposed hybrid algorithm is adopted to optimize the parameters of FNN soft-sensor model. Simulation results show that the model has better generalization and prediction accuracy for the concentrate grade and tailings recovery rate to meet the online soft-sensor requirements of the real-time control in the flotation process. PMID:26583034
Optimal sensor placement for spatial lattice structure based on genetic algorithms
NASA Astrophysics Data System (ADS)
Liu, Wei; Gao, Wei-cheng; Sun, Yi; Xu, Min-jian
2008-10-01
Optimal sensor placement technique plays a key role in structural health monitoring of spatial lattice structures. This paper considers the problem of locating sensors on a spatial lattice structure with the aim of maximizing the data information so that structural dynamic behavior can be fully characterized. Based on the criterion of optimal sensor placement for modal test, an improved genetic algorithm is introduced to find the optimal placement of sensors. The modal strain energy (MSE) and the modal assurance criterion (MAC) have been taken as the fitness function, respectively, so that three placement designs were produced. The decimal two-dimension array coding method instead of binary coding method is proposed to code the solution. Forced mutation operator is introduced when the identical genes appear via the crossover procedure. A computational simulation of a 12-bay plain truss model has been implemented to demonstrate the feasibility of the three optimal algorithms above. The obtained optimal sensor placements using the improved genetic algorithm are compared with those gained by exiting genetic algorithm using the binary coding method. Further the comparison criterion based on the mean square error between the finite element method (FEM) mode shapes and the Guyan expansion mode shapes identified by data-driven stochastic subspace identification (SSI-DATA) method are employed to demonstrate the advantage of the different fitness function. The results showed that some innovations in genetic algorithm proposed in this paper can enlarge the genes storage and improve the convergence of the algorithm. More importantly, the three optimal sensor placement methods can all provide the reliable results and identify the vibration characteristics of the 12-bay plain truss model accurately.
Wood, Brent L; Arroz, Maria; Barnett, David; DiGiuseppe, Joseph; Greig, Bruce; Kussick, Steven J; Oldaker, Teri; Shenkin, Mark; Stone, Elizabeth; Wallace, Paul
2007-01-01
Immunophenotyping by flow cytometry has become standard practice in the evaluation and monitoring of patients with hematopoietic neoplasia. However, despite its widespread use, considerable variability continues to exist in the reagents used for evaluation and the format in which results are reported. As part of the 2006 Bethesda Consensus conference, a committee was formed to attempt to define a consensus set of reagents suitable for general use in the diagnosis and monitoring of hematopoietic neoplasms. The committee included laboratory professionals from private, public, and university hospitals as well as large reference laboratories that routinely operate clinical flow cytometry laboratories with an emphasis on lymphoma and leukemia immunophenotyping. A survey of participants successfully identified the cell lineage(s) to be evaluated for each of a variety of specific medical indications and defined a set of consensus reagents suitable for the initial evaluation of each cell lineage. Elements to be included in the reporting of clinical flow cytometric results for leukemia and lymphoma evaluation were also refined and are comprehensively listed. The 2006 Bethesda Consensus conference represents the first successful attempt to define a set of consensus reagents suitable for the initial evaluation of hematopoietic neoplasia. Copyright 2007 Clinical Cytometry Society.
Mennesson, Eric; Erbacher, Patrick; Piller, Véronique; Kieda, Claudine; Midoux, Patrick; Pichon, Chantal
2005-06-01
Following systemic administration, polyplexes must cross the endothelium barrier to deliver genes to the target cells underneath. To design an efficient gene delivery system into lung epithelium, we evaluated capture and transfection efficiencies of DNA complexed with either Jet-PEI (PEI-polyplexes) or histidylated polylysine (His-polyplexes) in human lung microvascular endothelial cells (HLMEC) and tracheal epithelial cells. After optimizing growth conditions to obtain a tight HLMEC monolayer, we characterized uptake of polyplexes by flow cytometry and evaluated their transfection efficiency. Polyplexes were formulated as small particles. YOYO-labelled plasmid fluorescence intensity and luciferase activity were used as readouts for uptake and gene expression, respectively. PEI-polyplexes were more efficiently taken up than His-polyplexes by both non-polarized (2-fold) and polarized HLMEC (10-fold). They were mainly internalized by a clathrin-dependent pathway whatever the cell state. In non-polarized cells, His-polyplexes entered also mainly via a clathrin-dependent pathway but with an involvement of cholesterol. The cell polarization decreased this way and a clathrin-independent pathway became predominant. PEI-polyplexes transfected more efficiently HLMEC than His-polyplexes (10(7) vs. 10(5) relative light units (RLU)/mg of proteins) with a more pronounced difference in polarized cells. In contrast, no negative effect of the cell polarization was observed with tracheal epithelial cells in which both polyplexes had comparable efficiency. We show that the efficiency of polyplex uptake by HLMEC and their internalization mechanism are polymer-dependent. By contrast with His-polyplexes, the HLMEC polarization has little influence on the uptake process and on the transfection efficiency of PEI-polyplexes. Copyright (c) 2005 John Wiley & Sons, Ltd.
Kafetzoglou, Stella; Aristomenopoulos, Giorgos; Papavassiliou, Symeon
2015-08-11
Among the key aspects of the Internet of Things (IoT) is the integration of heterogeneous sensors in a distributed system that performs actions on the physical world based on environmental information gathered by sensors and application-related constraints and requirements. Numerous applications of Wireless Sensor Networks (WSNs) have appeared in various fields, from environmental monitoring, to tactical fields, and healthcare at home, promising to change our quality of life and facilitating the vision of sensor network enabled smart cities. Given the enormous requirements that emerge in such a setting-both in terms of data and energy-data aggregation appears as a key element in reducing the amount of traffic in wireless sensor networks and achieving energy conservation. Probabilistic frameworks have been introduced as operational efficient and performance effective solutions for data aggregation in distributed sensor networks. In this work, we introduce an overall optimization approach that improves and complements such frameworks towards identifying the optimal probability for a node to aggregate packets as well as the optimal aggregation period that a node should wait for performing aggregation, so as to minimize the overall energy consumption, while satisfying certain imposed delay constraints. Primal dual decomposition is employed to solve the corresponding optimization problem while simulation results demonstrate the operational efficiency of the proposed approach under different traffic and topology scenarios.
NASA Astrophysics Data System (ADS)
Loutas, T. H.; Bourikas, A.
2017-12-01
We revisit the optimal sensor placement of engineering structures problem with an emphasis on in-plane dynamic strain measurements and to the direction of modal identification as well as vibration-based damage detection for structural health monitoring purposes. The approach utilized is based on the maximization of a norm of the Fisher Information Matrix built with numerically obtained mode shapes of the structure and at the same time prohibit the sensorization of neighbor degrees of freedom as well as those carrying similar information, in order to obtain a satisfactory coverage. A new convergence criterion of the Fisher Information Matrix (FIM) norm is proposed in order to deal with the issue of choosing an appropriate sensor redundancy threshold, a concept recently introduced but not further investigated concerning its choice. The sensor configurations obtained via a forward sequential placement algorithm are sub-optimal in terms of FIM norm values but the selected sensors are not allowed to be placed in neighbor degrees of freedom providing thus a better coverage of the structure and a subsequent better identification of the experimental mode shapes. The issue of how service induced damage affects the initially nominated as optimal sensor configuration is also investigated and reported. The numerical model of a composite sandwich panel serves as a representative aerospace structure upon which our investigations are based.
Wang, Xue; Wang, Sheng; Ma, Jun-Jie
2007-01-01
The effectiveness of wireless sensor networks (WSNs) depends on the coverage and target detection probability provided by dynamic deployment, which is usually supported by the virtual force (VF) algorithm. However, in the VF algorithm, the virtual force exerted by stationary sensor nodes will hinder the movement of mobile sensor nodes. Particle swarm optimization (PSO) is introduced as another dynamic deployment algorithm, but in this case the computation time required is the big bottleneck. This paper proposes a dynamic deployment algorithm which is named “virtual force directed co-evolutionary particle swarm optimization” (VFCPSO), since this algorithm combines the co-evolutionary particle swarm optimization (CPSO) with the VF algorithm, whereby the CPSO uses multiple swarms to optimize different components of the solution vectors for dynamic deployment cooperatively and the velocity of each particle is updated according to not only the historical local and global optimal solutions, but also the virtual forces of sensor nodes. Simulation results demonstrate that the proposed VFCPSO is competent for dynamic deployment in WSNs and has better performance with respect to computation time and effectiveness than the VF, PSO and VFPSO algorithms.
USDA-ARS?s Scientific Manuscript database
MRS926 is a livestock-associated methicillin-resistant Staphylococcus aureus (MRSA) strain of sequence type (ST) 398. In order to facilitate in vitro and in vivo studies of this strain, we sought to tag it with a fluorescent marker. We cloned a codon-optimized gene for TurboGFP into a shuttle vector...
Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors
Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro
2012-01-01
We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107
RchyOptimyx: Cellular Hierarchy Optimization for Flow Cytometry
Aghaeepour, Nima; Jalali, Adrin; O’Neill, Kieran; Chattopadhyay, Pratip K.; Roederer, Mario; Hoos, Holger H.; Brinkman, Ryan R.
2013-01-01
Analysis of high-dimensional flow cytometry datasets can reveal novel cell populations with poorly understood biology. Following discovery, characterization of these populations in terms of the critical markers involved is an important step, as this can help to both better understand the biology of these populations and aid in designing simpler marker panels to identify them on simpler instruments and with fewer reagents (i.e., in resource poor or highly regulated clinical settings). However, current tools to design panels based on the biological characteristics of the target cell populations work exclusively based on technical parameters (e.g., instrument configurations, spectral overlap, and reagent availability). To address this shortcoming, we developed RchyOptimyx (cellular hieraRCHY OPTIMization), a computational tool that constructs cellular hierarchies by combining automated gating with dynamic programming and graph theory to provide the best gating strategies to identify a target population to a desired level of purity or correlation with a clinical outcome, using the simplest possible marker panels. RchyOptimyx can assess and graphically present the trade-offs between marker choice and population specificity in high-dimensional flow or mass cytometry datasets. We present three proof-of-concept use cases for RchyOptimyx that involve 1) designing a panel of surface markers for identification of rare populations that are primarily characterized using their intracellular signature; 2) simplifying the gating strategy for identification of a target cell population; 3) identification of a non-redundant marker set to identify a target cell population. PMID:23044634
NASA Astrophysics Data System (ADS)
Mitilineos, Stelios A.; Argyreas, Nick D.; Thomopoulos, Stelios C. A.
2009-05-01
A fusion-based localization technique for location-based services in indoor environments is introduced herein, based on ultrasound time-of-arrival measurements from multiple off-the-shelf range estimating sensors which are used in a market-available localization system. In-situ field measurements results indicated that the respective off-the-shelf system was unable to estimate position in most of the cases, while the underlying sensors are of low-quality and yield highly inaccurate range and position estimates. An extensive analysis is performed and a model of the sensor-performance characteristics is established. A low-complexity but accurate sensor fusion and localization technique is then developed, which consists inof evaluating multiple sensor measurements and selecting the one that is considered most-accurate based on the underlying sensor model. Optimality, in the sense of a genie selecting the optimum sensor, is subsequently evaluated and compared to the proposed technique. The experimental results indicate that the proposed fusion method exhibits near-optimal performance and, albeit being theoretically suboptimal, it largely overcomes most flaws of the underlying single-sensor system resulting in a localization system of increased accuracy, robustness and availability.
Proposed evaluation framework for assessing operator performance with multisensor displays
NASA Technical Reports Server (NTRS)
Foyle, David C.
1992-01-01
Despite aggressive work on the development of sensor fusion algorithms and techniques, no formal evaluation procedures have been proposed. Based on existing integration models in the literature, an evaluation framework is developed to assess an operator's ability to use multisensor, or sensor fusion, displays. The proposed evaluation framework for evaluating the operator's ability to use such systems is a normative approach: The operator's performance with the sensor fusion display can be compared to the models' predictions based on the operator's performance when viewing the original sensor displays prior to fusion. This allows for the determination as to when a sensor fusion system leads to: 1) poorer performance than one of the original sensor displays (clearly an undesirable system in which the fused sensor system causes some distortion or interference); 2) better performance than with either single sensor system alone, but at a sub-optimal (compared to the model predictions) level; 3) optimal performance (compared to model predictions); or, 4) super-optimal performance, which may occur if the operator were able to use some highly diagnostic 'emergent features' in the sensor fusion display, which were unavailable in the original sensor displays. An experiment demonstrating the usefulness of the proposed evaluation framework is discussed.
Targeted DNA delivery to cancer cells using a biotinylated chitosan carrier.
Darvishi, Mohammad H; Nomani, Alireza; Hashemzadeh, Hadi; Amini, Mohsen; Shokrgozar, Mohammad A; Dinarvand, Rassoul
2017-05-01
A novel biotinylated chitosan-graft-polyethyleneimine (Bio-Chi-g-PEI) copolymer was synthesized and evaluated as a nonviral gene delivery carrier for improvement of the transfection efficiency, endosomal escape, and targeted gene delivery of a plasmid encoding green fluorescent protein N1 (pEGFP-N1) into two different biotin-overexpressing cell lines including HeLa and OVCAR-3 cells. The structure of the obtained copolymers was confirmed by 1 H nuclear magnetic resonance ( 1 H NMR) and Fourier transform infrared spectroscopy. Physicochemical properties of the Bio-Chi-g-PEI/plasmid DNA (pDNA) complexes such as complex stability, size, zeta potential, and their morphology were investigated at various weight ratios of copolymer to pDNA. Bio-Chi-g-PEI copolymers could effectively condense pDNA into small particles with average diameters less than 164 nm and the zeta potential of +34.8 mV at the N/P ratio of 40/1. As revealed by flow cytometry, Bio-Chi-g-PEI/pDNA complexes had lower cytotoxicity than that of PEI 25 kDa/pDNA complexes in both cell lines. In vitro experiments revealed that the Bio-Chi-gPEI/pDNA complexes not only had much lower cytotoxicity, but also displayed higher transfection efficiency than that of PEI 25kDa/pDNA complexes. High percentage of cancer cells was successfully transfected by Bio-Chi-g-PEI/pDNA and properly expressed GFP protein. This study indicates that this copolymer complex can be a promising gene delivery carrier. © 2016 International Union of Biochemistry and Molecular Biology, Inc.
Geyer, Antonia; Taschauer, Alexander; Alioglu, Fatih; Anton, Martina; Maier, Julia; Drothler, Elisabeth; Simlinger, Manuela; Yavuz, Sümeyye; Sami, Haider; Ogris, Manfred
2017-12-01
Local delivery of anticancer agents or gene therapeutics to lung tumors can circumvent side effects or accumulation in non-target organs, but accessibility via the alveolar side of the blood-air barrier remains challenging. Polyplexes based on plasmid and linear polyethylenimine (LPEI) transfect healthy lung tissue when applied intravenously (i.v.) in the mouse, but direct delivery into the lungs results in low transfection of lung tissue. Nevertheless, LPEI could offer the potential to transfect lung tumors selectively, if accessible from the alveolar side. This study combined near infrared fluorescent protein 720 (iRFP720) and firefly luciferase as reporter genes for detection of tumor lesions and transfection efficiency of LPEI polyplexes, after intratracheal microspraying in mice bearing 4T1 triple negative breast cancer lung metastases. Simultaneous flow cytometric analysis of iRFP720 and enhanced green fluorescent protein expression in vitro demonstrated the potential to combine these reporter genes within transfection studies. Polyplex biophysics was characterized by single nanoparticle tracking analysis (NTA) to monitor physical integrity after microspraying in vitro. 4T1 cells were transduced with iRFP720-encoding lentivirus and evaluated by flow cytometry for stable iRFP720 expression. Growth of 4T1-iRFP720 cells was monitored in Balb/c mice by tomographic near infrared imaging, tissue and tumor morphology by computed tomography and magnetic resonance imaging. In 4T1-iRFP720 tumor-bearing mice, intratracheal administration of luciferase-encoding plasmid DNA by LPEI polyplexes resulted in successful tumor transfection, as revealed by bioluminescence imaging.
Synergistic gene and drug tumor therapy using a chimeric peptide.
Han, Kai; Chen, Si; Chen, Wei-Hai; Lei, Qi; Liu, Yun; Zhuo, Ren-Xi; Zhang, Xian-Zheng
2013-06-01
Co-delivery of gene and drug for synergistic therapy has provided a promising strategy to cure devastating diseases. Here, an amphiphilic chimeric peptide (Fmoc)2KH7-TAT with pH-responsibility for gene and drug delivery was designed and fabricated. As a drug carrier, the micelles self-assembled from the peptide exhibited a much faster doxorubicin (DOX) release rate at pH 5.0 than that at pH 7.4. As a non-viral gene vector, (Fmoc)(2)KH(7)-TAT peptide could satisfactorily mediate transfection of pGL-3 reporter plasmid with or without the existence of serum in both 293T and HeLa cell-lines. Besides, the endosome escape capability of peptide/DNA complexes was investigated by confocal laser scanning microscopy (CLSM). To evaluate the co-delivery efficiency and the synergistic anti-tumor effect of gene and drug, p53 plasmid and DOX were simultaneously loaded in the peptide micelles to form micelleplexes during the self-assembly of the peptide. Cellular uptake and intracellular delivery of gene and drug were studied by CLSM and flow cytometry respectively. And p53 protein expression was determined via Western blot analysis. The in vitro cytotoxicity and in vivo tumor inhibition effect were also studied. Results suggest that the co-delivery of gene and drug from peptide micelles resulted in effective cell growth inhibition in vitro and significant tumor growth restraining in vivo. The chimeric peptide-based gene and drug co-delivery system will find great potential for tumor therapy. Copyright © 2013 Elsevier Ltd. All rights reserved.
MASM: a market architecture for sensor management in distributed sensor networks
NASA Astrophysics Data System (ADS)
Viswanath, Avasarala; Mullen, Tracy; Hall, David; Garga, Amulya
2005-03-01
Rapid developments in sensor technology and its applications have energized research efforts towards devising a firm theoretical foundation for sensor management. Ubiquitous sensing, wide bandwidth communications and distributed processing provide both opportunities and challenges for sensor and process control and optimization. Traditional optimization techniques do not have the ability to simultaneously consider the wildly non-commensurate measures involved in sensor management in a single optimization routine. Market-oriented programming provides a valuable and principled paradigm to designing systems to solve this dynamic and distributed resource allocation problem. We have modeled the sensor management scenario as a competitive market, wherein the sensor manager holds a combinatorial auction to sell the various items produced by the sensors and the communication channels. However, standard auction mechanisms have been found not to be directly applicable to the sensor management domain. For this purpose, we have developed a specialized market architecture MASM (Market architecture for Sensor Management). In MASM, the mission manager is responsible for deciding task allocations to the consumers and their corresponding budgets and the sensor manager is responsible for resource allocation to the various consumers. In addition to having a modified combinatorial winner determination algorithm, MASM has specialized sensor network modules that address commensurability issues between consumers and producers in the sensor network domain. A preliminary multi-sensor, multi-target simulation environment has been implemented to test the performance of the proposed system. MASM outperformed the information theoretic sensor manager in meeting the mission objectives in the simulation experiments.
Song, Myeong-Sub; Sekhon, Simranjeet Singh; Shin, Woo-Ri; Rhee, Sung-Keun; Ko, Jung Ho; Kim, Sang Yong; Min, Jiho; Ahn, Ji-Young; Kim, Yang-Hoon
2018-05-01
Shigella sonnei isolate invasion plasmid antigen protein, IpaH, was successfully expressed in recombinant overexpression bacterial system. The soluble expression IpaH was enhanced with molecular chaperon co-expressed environment. Specific aptamer IpaH17 was isolated through the SELEX process and showed fM binding affinity. IpaH17-SPR biosensor platform was involved to verify the binding sensitivity and specificity. The IpaH concentration dependent IpaH17-SPR sensor response was highly linear with a linear regression constant of 99.4% in the range between 0 and 100 ng/mL. In addition, S. sonnei revealed the specific RU value and detected in a real-time manner within 1 hour. Our study indicated that IpaH17-SPR sensor can allow for rapid, sensitive and specific determination of Shigella sonnei virulent factor.
A Sensor Dynamic Measurement Error Prediction Model Based on NAPSO-SVM
Jiang, Minlan; Jiang, Lan; Jiang, Dingde; Li, Fei
2018-01-01
Dynamic measurement error correction is an effective way to improve sensor precision. Dynamic measurement error prediction is an important part of error correction, and support vector machine (SVM) is often used for predicting the dynamic measurement errors of sensors. Traditionally, the SVM parameters were always set manually, which cannot ensure the model’s performance. In this paper, a SVM method based on an improved particle swarm optimization (NAPSO) is proposed to predict the dynamic measurement errors of sensors. Natural selection and simulated annealing are added in the PSO to raise the ability to avoid local optima. To verify the performance of NAPSO-SVM, three types of algorithms are selected to optimize the SVM’s parameters: the particle swarm optimization algorithm (PSO), the improved PSO optimization algorithm (NAPSO), and the glowworm swarm optimization (GSO). The dynamic measurement error data of two sensors are applied as the test data. The root mean squared error and mean absolute percentage error are employed to evaluate the prediction models’ performances. The experimental results show that among the three tested algorithms the NAPSO-SVM method has a better prediction precision and a less prediction errors, and it is an effective method for predicting the dynamic measurement errors of sensors. PMID:29342942
A heuristic for deriving the optimal number and placement of reconnaissance sensors
NASA Astrophysics Data System (ADS)
Nanda, S.; Weeks, J.; Archer, M.
2008-04-01
A key to mastering asymmetric warfare is the acquisition of accurate intelligence on adversaries and their assets in urban and open battlefields. To achieve this, one needs adequate numbers of tactical sensors placed in locations to optimize coverage, where optimality is realized by covering a given area of interest with the least number of sensors, or covering the largest possible subsection of an area of interest with a fixed set of sensors. Unfortunately, neither problem admits a polynomial time algorithm as a solution, and therefore, the placement of such sensors must utilize intelligent heuristics instead. In this paper, we present a scheme implemented on parallel SIMD processing architectures to yield significantly faster results, and that is highly scalable with respect to dynamic changes in the area of interest. Furthermore, the solution to the first problem immediately translates to serve as a solution to the latter if and when any sensors are rendered inoperable.
An Enhanced PSO-Based Clustering Energy Optimization Algorithm for Wireless Sensor Network.
Vimalarani, C; Subramanian, R; Sivanandam, S N
2016-01-01
Wireless Sensor Network (WSN) is a network which formed with a maximum number of sensor nodes which are positioned in an application environment to monitor the physical entities in a target area, for example, temperature monitoring environment, water level, monitoring pressure, and health care, and various military applications. Mostly sensor nodes are equipped with self-supported battery power through which they can perform adequate operations and communication among neighboring nodes. Maximizing the lifetime of the Wireless Sensor networks, energy conservation measures are essential for improving the performance of WSNs. This paper proposes an Enhanced PSO-Based Clustering Energy Optimization (EPSO-CEO) algorithm for Wireless Sensor Network in which clustering and clustering head selection are done by using Particle Swarm Optimization (PSO) algorithm with respect to minimizing the power consumption in WSN. The performance metrics are evaluated and results are compared with competitive clustering algorithm to validate the reduction in energy consumption.
Femtosecond laser pulse optimization for multiphoton cytometry and control of fluorescence
NASA Astrophysics Data System (ADS)
Tkaczyk, Eric Robert
This body of work encompasses optimization of near infrared femtosecond laser pulses both for enhancement of flow cytometry as well as adaptive pulse shaping to control fluorescence. A two-photon system for in vivo flow cytometry is demonstrated, which allows noninvasive quantification of circulating cell populations in a single live mouse. We monitor fluorescently-labeled red blood cells for more than two weeks, and are also able to noninvasively measure circulation times of two distinct populations of breast cancer cells simultaneously in a single mouse. We build a custom laser excitation source in the form of an extended cavity mode-locked oscillator, which enables superior detection in whole blood or saline of cell lines expressing fluorescent proteins including the green fluorescent protein (GFP), tdTomato and mPlum. A mathematical model explains unique features of the signals. The ability to distinguish different fluorescent species is central to simultaneous measurement of multiple molecular targets in high throughput applications including the multiphoton flow cytometer. We demonstrate that two dyes which are not distinguishable to one-photon measurements can be differentiated and in fact quantified in mixture via phase-shaped two-photon excitation pulses found by a genetic algorithm. We also selectively enhance or suppress two-photon fluorescence of numerous common dyes with tailored pulse shapes. Using a multiplicative (rather than ratiometric) fitness parameter, we are able to control the fluorescence while maintaining a strong signal. With this method, we control the two-photon fluorescence of the blue fluorescent protein (BFP), which is of particular interest in investigations of protein-protein interactions, and has frustrated previous attempts of control. Implementing an acousto-optic interferometer, we use the same experimental setup to measure two-photon excitation cross-sections of dyes and prove that photon-photon interferences are the predominant mechanism of control. This research establishes the basis for molecularly tailored pulse shaping in multiphoton flow cytometry, which will advance our ability to probe the biology of circulating cells during disease progression and response to therapy.
Scheduling policies of intelligent sensors and sensor/actuators in flexible structures
NASA Astrophysics Data System (ADS)
Demetriou, Michael A.; Potami, Raffaele
2006-03-01
In this note, we revisit the problem of actuator/sensor placement in large civil infrastructures and flexible space structures within the context of spatial robustness. The positioning of these devices becomes more important in systems employing wireless sensor and actuator networks (WSAN) for improved control performance and for rapid failure detection. The ability of the sensing and actuating devices to possess the property of spatial robustness results in reduced control energy and therefore the spatial distribution of disturbances is integrated into the location optimization measures. In our studies, the structure under consideration is a flexible plate clamped at all sides. First, we consider the case of sensor placement and the optimization scheme attempts to produce those locations that minimize the effects of the spatial distribution of disturbances on the state estimation error; thus the sensor locations produce state estimators with minimized disturbance-to-error transfer function norms. A two-stage optimization procedure is employed whereby one first considers the open loop system and the spatial distribution of disturbances is found that produces the maximal effects on the entire open loop state. Once this "worst" spatial distribution of disturbances is found, the optimization scheme subsequently finds the locations that produce state estimators with minimum transfer function norms. In the second part, we consider the collocated actuator/sensor pairs and the optimization scheme produces those locations that result in compensators with the smallest norms of the disturbance-to-state transfer functions. Going a step further, an intelligent control scheme is presented which, at each time interval, activates a subset of the actuator/sensor pairs in order provide robustness against spatiotemporally moving disturbances and minimize power consumption by keeping some sensor/actuators in sleep mode.
Optimal multi-type sensor placement for response and excitation reconstruction
NASA Astrophysics Data System (ADS)
Zhang, C. D.; Xu, Y. L.
2016-01-01
The need to perform dynamic response reconstruction always arises as the measurement of structural response is often limited to a few locations, especially for a large civil structure. Besides, it is usually very difficult, if not impossible, to measure external excitations under the operation condition of a structure. This study presents an algorithm for optimal placement of multi-type sensors, including strain gauges, displacement transducers and accelerometers, for the best reconstruction of responses of key structural components where there are no sensors installed and the best estimation of external excitations acting on the structure at the same time. The algorithm is developed in the framework of Kalman filter with unknown excitation, in which minimum-variance unbiased estimates of the generalized state of the structure and the external excitations are obtained by virtue of limited sensor measurements. The structural responses of key locations without sensors can then be reconstructed with the estimated generalized state and excitation. The asymptotic stability feature of the filter is utilized for optimal sensor placement. The number and spatial location of the multi-type sensors are determined by adding the optimal sensor which gains the maximal reduction of the estimation error of reconstructed responses. For the given mode number in response reconstruction and the given locations of external excitations, the optimal multi-sensor placement achieved by the proposed method is independent of the type and time evolution of external excitation. A simply-supported overhanging steel beam under multiple types of excitation is numerically studied to demonstrate the feasibility and superiority of the proposed method, and the experimental work is then carried out to testify the effectiveness of the proposed method.
An Umeclidinium membrane sensor; Two-step optimization strategy for improved responses.
Yehia, Ali M; Monir, Hany H
2017-09-01
In the scientific context of membrane sensors and improved experimentation, we devised an experimentally designed protocol for sensor optimization. Two-step strategy was implemented for Umeclidinium bromide (UMEC) analysis which is a novel quinuclidine-based muscarinic antagonist used for maintenance treatment of symptoms accompanied with chronic obstructive pulmonary disease. In the first place, membrane components were screened for ideal ion exchanger, ionophore and plasticizer using three categorical factors at three levels in Taguchi design. Secondly, experimentally designed optimization was followed in order to tune the sensor up for finest responses. Twelve experiments were randomly carried out in a continuous factor design. Nernstian response, detection limit and selectivity were assigned as responses in these designs. The optimized membrane sensor contained tetrakis-[3,5-bis(trifluoro- methyl)phenyl] borate (0.44wt%) and calix[6]arene (0.43wt%) in 50.00% PVC plasticized with 49.13wt% 2-ni-tro-phenyl octylether. This sensor, along with an optimum concentration of inner filling solution (2×10 -4 molL -1 UMEC) and 2h of soaking time, attained the design objectives. Nernstian response approached 59.7mV/decade and detection limit decreased by about two order of magnitude (8×10 -8 mol L -1 ) through this optimization protocol. The proposed sensor was validated for UMEC determination in its linear range (3.16×10 -7 -1×10 -3 mol L -1 ) and challenged for selective discrimination of other congeners and inorganic cations. Results of INCRUSE ELLIPTA ® inhalation powder analyses obtained from the proposed sensor and manufacturer's UPLC were statistically compared. Moreover the proposed sensor was successfully used for the determination of UMEC in plasma samples. Copyright © 2017 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Stojicic, Nevena; Walrafen, David; Baumstark-Khan, Christa; Rabbow, Elke; Rettberg, Petra; Weisshaar, Maria-Paz; Horneck, Gerda
Harmful environmental factors - namely ionizing radiation - will continue to influence future manned space missions. The Radiation Biology Unit at the German Aerospace Center (DLR) develops cellular monitoring systems, which include bacterial and mammalian cell systems capable of recognizing DNA damage as a consequence of the presence of genotoxic conditions. Such a bioassay is the SOS-LUX test, which represents the radiobiological part of the German space experiment "Gene, immune and cellular responses to single and combined space flight conditions (TRIPLE-LUX)" which has been selected by the IDI/USRA Peer Review Panel for NASA/ESA to be performed on the International Space Station (ISS). It will supply basic information on the genotoxic response to radiation applied in microgravity. The biological end-point under investigation will depend on the bacterial SOS response brought about by genetically modified bacteria that are transformed with the pSWITCH plasmid (constructed from the plasmids pPLS-1 and pGFPuv). The luminescent/fluorescent bioassay SWITCH (SWITCH: Salmonella Weighting of Induced Toxicity Cyto/GenoTox for Human Health) as successor of the SOS-LUX test for rapid toxicity (genotoxicity and cytotoxicity) testing, makes use of two sensing and reporting systems for the two biological endpoints under investigation: the SOS-LUX test and the LAC- Fluoro test. The SWITCH plasmid carries the promoterless lux operon of Photobacterium leiognathi as reporter element under the control of the DNA-damage-dependent SOS promoter of ColD as sensor element (for genotoxicity testing) and the sequences for a hybrid protein consisting of β-galactosidase and GFPuv of Aequorea victoria as reporter element under the control of the (in Salmonella constitutively active) LAC promoter of Escherichia coli as sensor element (for cytotoxicity testing). The system has worked properly for terrestrial applications during the first experiments. Experiments using X-rays and UV radiation of various qualities (from UVC to UVA) have given insights into cellular mechanisms relevant for estimation of health risks, resulting from exposure of astronauts to the extraordinary radiation environment of space.
Aoshima, Yumiko; Hokama, Ryosuke; Sou, Keitaro; Sarker, Satya Ranjan; Iida, Kabuto; Nakamura, Hideki; Inoue, Takafumi; Takeoka, Shinji
2013-12-18
The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl-) and trifluoroacetic acid (TFA-), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA- induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA- showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA- is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity.
2013-01-01
The delivery of specific genes into neurons offers a potent approach for treatment of diseases as well as for the study of neuronal cell biology. Here we investigated the capabilities of cationic amino acid based lipid assemblies to act as nonviral gene delivery vectors in primary cultured neurons. An arginine-based lipid, Arg-C3-Glu2C14, and a lysine-based lipid, Lys-C3-Glu2C14, with two different types of counterion, chloride ion (Cl–) and trifluoroacetic acid (TFA–), were shown to successfully mediate transfection of primary cultured neurons with plasmid DNA encoding green fluorescent protein. Among four types of lipids, we optimized their conditions such as the lipid-to-DNA ratio and the amount of pDNA and conducted a cytotoxicity assay at the same time. Overall, Arg-C3-Glu2C14 with TFA– induced a rate of transfection in primary cultured neurons higher than that of Lys-C3-Glu2C14 using an optimal weight ratio of lipid-to-plasmid DNA of 1. Moreover, it was suggested that Arg-C3-Glu2C14 with TFA– showed the optimized value higher than that of Lipofectamine2000 in experimental conditions. Thus, Arg-C3-Glu2C14 with TFA– is a promising candidate as a reliable transfection reagent for primary cultured neurons with a relatively low cytotoxicity. PMID:24087930
Galli, A; Della Latta, V; Bologna, C; Pucciarelli, D; Cipriani, F; Backovic, A; Cervelli, T
2017-08-01
Adeno-associated virus type 2 (AAV) is a nonpathogenic parvovirus that is a promising tool for gene therapy. We aimed to construct plasmids for optimal expression and assembly of capsid proteins and evaluate adenovirus (Ad) protein effect on AAV single-stranded DNA (ssDNA) formation in Saccharomyces cerevisiae. Yeast expression plasmids have been developed in which the transcription of AAV capsid proteins (VP1,2,3) is driven by the constitutive ADH1 promoter or galactose-inducible promoters. Optimal VP1,2,3 expression was obtained from GAL1/10 bidirectional promoter. Moreover, we demonstrated that AAP is expressed in yeast and virus-like particles (VLPs) assembled inside the cell. Finally, the expression of two Ad proteins, E4orf6 and E1b55k, had no effect on AAV ssDNA formation. This study confirms that yeast is able to form AAV VLPs; however, capsid assembly and ssDNA formation are less efficient in yeast than in human cells. Moreover, the expression of Ad proteins did not affect AAV ssDNA formation. New manufacturing strategies for AAV-based gene therapy vectors (rAAV) are needed to reduce costs and time of production. Our study explores the feasibility of yeast as alternative system for rAAV production. © 2017 The Society for Applied Microbiology.
Non-Viral Transfection Methods Optimized for Gene Delivery to a Lung Cancer Cell Line
Salimzadeh, Loghman; Jaberipour, Mansooreh; Hosseini, Ahmad; Ghaderi, Abbas
2013-01-01
Background Mehr-80 is a newly established adherent human large cell lung cancer cell line that has not been transfected until now. This study aims to define the optimal transfection conditions and effects of some critical elements for enhancing gene delivery to this cell line by utilizing different non-viral transfection Procedures. Methods In the current study, calcium phosphate (CaP), DEAE-dextran, superfect, electroporation and lipofection transfection methods were used to optimize delivery of a plasmid construct that expressed Green Fluorescent Protein (GFP). Transgene expression was detected by fluorescent microscopy and flowcytometry. Toxicities of the methods were estimated by trypan blue staining. In order to evaluate the density of the transfected gene, we used a plasmid construct that expressed the Stromal cell-Derived Factor-1 (SDF-1) gene and measured its expression by real-time PCR. Results Mean levels of GFP-expressing cells 48 hr after transfection were 8.4% (CaP), 8.2% (DEAE-dextran), 4.9% (superfect), 34.1% (electroporation), and 40.1% (lipofection). Lipofection had the highest intense SDF-1 expression of the analyzed methods. Conclusion This study has shown that the lipofection and electroporation methods were more efficient at gene delivery to Mehr-80 cells. The quantity of DNA per transfection, reagent concentration, and incubation time were identified as essential factors for successful transfection in all of the studied methods. PMID:23799175
The study of hydrogen peroxide level under cisplatin action using genetically encoded sensor hyper
NASA Astrophysics Data System (ADS)
Belova, A. S.; Orlova, A. G.; Maslennikova, A. V.; Brilkina, A. A.; Balalaeva, I. V.; Antonova, N. O.; Mishina, N. M.; Shakhova, N. M.; Belousov, V. V.
2014-03-01
The aim of the work was to study the participation of hydrogen peroxide in reaction of cervical cancer cell line HeLa Kyoto on cisplatin action. Determination of hydrogen peroxide level was performed using genetically encoded fluorescent sensor HyPer2. The dependence of cell viability on cisplatin concentration was determined using MTT assay. Mechanisms of cell death as well as HyPer2 reaction was revealed by flow cytometry after 6-hours of incubation with cisplatin in different concentrations. Cisplatin used in low concentrations had no effect on hydrogen peroxide level in HeLa Kyoto cells. Increase of HyPer2 fluorescence was detected only after exposure with cisplatin in high concentration. The reaction was not the consequence of cell death.
The Homogeneity of Optimal Sensor Placement Across Multiple Winged Insect Species
NASA Astrophysics Data System (ADS)
Jenkins, Abigail L.
Taking inspiration from biology, control algorithms can be implemented to imitate the naturally occurring control systems present in nature. This research is primarily concerned with insect flight and optimal wing sensor placement. Many winged insects with halteres are equipped with mechanoreceptors termed campaniform sensilla. Although the exact information these receptors provide to the insect's nervous system is unknown, it is thought to have the capability of measuring inertial rotation forces. During flight, when the wing bends, the information measured by the campaniform sensilla is received by the central nervous system, and provides the insect necessary data to control flight. This research compares three insect species - the hawkmoth Manduca sexta, the honeybee Apis mellifera, and the fruit fly Drosophila melanogaster. Using an observability-based sensor placement algorithm, the optimal sensor placement for these three species is determined. Simulations resolve if this optimal sensor placement corresponds to the insect's campaniform sensilla, as well as if placement is homogeneous across species.
Using RGB-D sensors and evolutionary algorithms for the optimization of workstation layouts.
Diego-Mas, Jose Antonio; Poveda-Bautista, Rocio; Garzon-Leal, Diana
2017-11-01
RGB-D sensors can collect postural data in an automatized way. However, the application of these devices in real work environments requires overcoming problems such as lack of accuracy or body parts' occlusion. This work presents the use of RGB-D sensors and genetic algorithms for the optimization of workstation layouts. RGB-D sensors are used to capture workers' movements when they reach objects on workbenches. Collected data are then used to optimize workstation layout by means of genetic algorithms considering multiple ergonomic criteria. Results show that typical drawbacks of using RGB-D sensors for body tracking are not a problem for this application, and that the combination with intelligent algorithms can automatize the layout design process. The procedure described can be used to automatically suggest new layouts when workers or processes of production change, to adapt layouts to specific workers based on their ways to do the tasks, or to obtain layouts simultaneously optimized for several production processes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Guimarães, Dayan Adionel; Sakai, Lucas Jun; Alberti, Antonio Marcos; de Souza, Rausley Adriano Amaral
2016-01-01
In this paper, a simple and flexible method for increasing the lifetime of fixed or mobile wireless sensor networks is proposed. Based on past residual energy information reported by the sensor nodes, the sink node or another central node dynamically optimizes the communication activity levels of the sensor nodes to save energy without sacrificing the data throughput. The activity levels are defined to represent portions of time or time-frequency slots in a frame, during which the sensor nodes are scheduled to communicate with the sink node to report sensory measurements. Besides node mobility, it is considered that sensors’ batteries may be recharged via a wireless power transmission or equivalent energy harvesting scheme, bringing to the optimization problem an even more dynamic character. We report large increased lifetimes over the non-optimized network and comparable or even larger lifetime improvements with respect to an idealized greedy algorithm that uses both the real-time channel state and the residual energy information. PMID:27657075
A Scheme to Smooth Aggregated Traffic from Sensors with Periodic Reports
Oh, Sungmin; Jang, Ju Wook
2017-01-01
The possibility of smoothing aggregated traffic from sensors with varying reporting periods and frame sizes to be carried on an access link is investigated. A straightforward optimization would take O(pn) time, whereas our heuristic scheme takes O(np) time where n, p denote the number of sensors and size of periods, respectively. Our heuristic scheme performs local optimization sensor by sensor, starting with the smallest to largest periods. This is based on an observation that sensors with large offsets have more choices in offsets to avoid traffic peaks than the sensors with smaller periods. A MATLAB simulation shows that our scheme excels the known scheme by M. Grenier et al. in a similar situation (aggregating periodic traffic in a controller area network) for almost all possible permutations. The performance of our scheme is very close to the straightforward optimization, which compares all possible permutations. We expect that our scheme would greatly contribute in smoothing the traffic from an ever-increasing number of IoT sensors to the gateway, reducing the burden on the access link to the Internet. PMID:28273831
A Scheme to Smooth Aggregated Traffic from Sensors with Periodic Reports.
Oh, Sungmin; Jang, Ju Wook
2017-03-03
The possibility of smoothing aggregated traffic from sensors with varying reporting periods and frame sizes to be carried on an access link is investigated. A straightforward optimization would take O(pn) time, whereas our heuristic scheme takes O(np) time where n, p denote the number of sensors and size of periods, respectively. Our heuristic scheme performs local optimization sensor by sensor, starting with the smallest to largest periods. This is based on an observation that sensors with large offsets have more choices in offsets to avoid traffic peaks than the sensors with smaller periods. A MATLAB simulation shows that our scheme excels the known scheme by M. Grenier et al. in a similar situation (aggregating periodic traffic in a controller area network) for almost all possible permutations. The performance of our scheme is very close to the straightforward optimization, which compares all possible permutations. We expect that our scheme would greatly contribute in smoothing the traffic from an ever-increasing number of IoT sensors to the gateway, reducing the burden on the access link to the Internet.
Spatiotemporal and geometric optimization of sensor arrays for detecting analytes fluids
Lewis, Nathan S.; Freund, Michael S.; Briglin, Shawn M.; Tokumaru, Phil; Martin, Charles R.; Mitchell, David T.
2006-10-17
Sensor arrays and sensor array systems for detecting analytes in fluids. Sensors configured to generate a response upon introduction of a fluid containing one or more analytes can be located on one or more surfaces relative to one or more fluid channels in an array. Fluid channels can take the form of pores or holes in a substrate material. Fluid channels can be formed between one or more substrate plates. Sensor can be fabricated with substantially optimized sensor volumes to generate a response having a substantially maximized signal to noise ratio upon introduction of a fluid containing one or more target analytes. Methods of fabricating and using such sensor arrays and systems are also disclosed.
Spatiotemporal and geometric optimization of sensor arrays for detecting analytes in fluids
Lewis, Nathan S [La Canada, CA; Freund, Michael S [Winnipeg, CA; Briglin, Shawn S [Chittenango, NY; Tokumaru, Phillip [Moorpark, CA; Martin, Charles R [Gainesville, FL; Mitchell, David [Newtown, PA
2009-09-29
Sensor arrays and sensor array systems for detecting analytes in fluids. Sensors configured to generate a response upon introduction of a fluid containing one or more analytes can be located on one or more surfaces relative to one or more fluid channels in an array. Fluid channels can take the form of pores or holes in a substrate material. Fluid channels can be formed between one or more substrate plates. Sensor can be fabricated with substantially optimized sensor volumes to generate a response having a substantially maximized signal to noise ratio upon introduction of a fluid containing one or more target analytes. Methods of fabricating and using such sensor arrays and systems are also disclosed.
A Droplet Microfluidic Platform for Automating Genetic Engineering.
Gach, Philip C; Shih, Steve C C; Sustarich, Jess; Keasling, Jay D; Hillson, Nathan J; Adams, Paul D; Singh, Anup K
2016-05-20
We present a water-in-oil droplet microfluidic platform for transformation, culture and expression of recombinant proteins in multiple host organisms including bacteria, yeast and fungi. The platform consists of a hybrid digital microfluidic/channel-based droplet chip with integrated temperature control to allow complete automation and integration of plasmid addition, heat-shock transformation, addition of selection medium, culture, and protein expression. The microfluidic format permitted significant reduction in consumption (100-fold) of expensive reagents such as DNA and enzymes compared to the benchtop method. The chip contains a channel to continuously replenish oil to the culture chamber to provide a fresh supply of oxygen to the cells for long-term (∼5 days) cell culture. The flow channel also replenished oil lost to evaporation and increased the number of droplets that could be processed and cultured. The platform was validated by transforming several plasmids into Escherichia coli including plasmids containing genes for fluorescent proteins GFP, BFP and RFP; plasmids with selectable markers for ampicillin or kanamycin resistance; and a Golden Gate DNA assembly reaction. We also demonstrate the applicability of this platform for transformation in widely used eukaryotic organisms such as Saccharomyces cerevisiae and Aspergillus niger. Duration and temperatures of the microfluidic heat-shock procedures were optimized to yield transformation efficiencies comparable to those obtained by benchtop methods with a throughput up to 6 droplets/min. The proposed platform offers potential for automation of molecular biology experiments significantly reducing cost, time and variability while improving throughput.
Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma.
Rao, Donald D; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John
2016-08-01
The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85-92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing.
Preclinical Justification of pbi-shRNA EWS/FLI1 Lipoplex (LPX) Treatment for Ewing's Sarcoma
Rao, Donald D.; Jay, Christopher; Wang, Zhaohui; Luo, Xiuquan; Kumar, Padmasini; Eysenbach, Hilary; Ghisoli, Maurizio; Senzer, Neil; Nemunaitis, John
2016-01-01
The EWS/FLI1 fusion gene is well characterized as a driver of Ewing's sarcoma. Bi-shRNA EWS/FLI1 is a functional plasmid DNA construct that transcribes both siRNA and miRNA-like effectors each of which targets the identical type 1 translocation junction region of the EWS/FLI1 transcribed mRNA sequence. Previous preclinical and clinical studies confirm the safety of this RNA interference platform technology and consistently demonstrate designated mRNA and protein target knockdown at greater than 90% efficiency. We initiated development of pbi-shRNA EWS/FLI1 lipoplex (LPX) for the treatment of type 1 Ewing's sarcoma. Clinical-grade plasmid was manufactured and both sequence and activity verified. Target protein and RNA knockdown of 85–92% was demonstrated in vitro in type 1 human Ewing's sarcoma tumor cell lines with the optimal bi-shRNA EWS/FLI1 plasmid. This functional plasmid was placed in a clinically tested, liposomal (LP) delivery vehicle followed by in vivo verification of activity. Type 1 Ewing's sarcoma xenograft modeling confirmed dose related safety and tumor response to pbi-shRNA EWS/FLI1 LPX. Toxicology studies in mini-pigs with doses comparable to the demonstrated in vivo efficacy dose resulted in transient fever, occasional limited hypertension at low- and high-dose assessment and transient liver enzyme elevation at high dose. These results provide the justification to initiate clinical testing. PMID:27166877
Scorza, T.; Grubb, K.; Smooker, P.; Rainczuk, A.; Proll, D.; Spithill, T. W.
2005-01-01
A major goal of current malaria vaccine programs is to develop multivalent vaccines that will protect humans against the many heterologous malaria strains that circulate in endemic areas. We describe a multiepitope DNA vaccine, derived from a genomic Plasmodium chabaudi adami DS DNA expression library of 30,000 plasmids, which induces strain-transcending immunity in mice against challenge with P. c. adami DK. Segregation of this library and DNA sequence analysis identified vaccine subpools encoding open reading frames (ORFs)/peptides of >9 amino acids [aa] (the V9+ pool, 303 plasmids) and >50 aa (V50+ pool, 56 plasmids), respectively. The V9+ and V50+ plasmid vaccine subpools significantly cross-protected mice against heterologous P. c. adami DK challenge, and protection correlated with the induction of both specific gamma interferon production by splenic cells and opsonizing antibodies. Bioinformatic analysis showed that 22 of the V50+ ORFs were polypeptides conserved among three or more Plasmodium spp., 13 of which are predicted hypothetical proteins. Twenty-nine of these ORFs are orthologues of predicted Plasmodium falciparum sequences known to be expressed in the blood stage, suggesting that this vaccine pool encodes multiple blood-stage antigens. The results have implications for malaria vaccine design by providing proof-of-principle that significant strain-transcending immunity can be induced using multiepitope blood-stage DNA vaccines and suggest that both cellular responses and opsonizing antibodies are necessary for optimal protection against P. c. adami. PMID:15845504
Fumoto, Shintaro; Nishimura, Koyo; Nishida, Koyo; Kawakami, Shigeru
2016-01-01
Evaluation methods for determining the distribution of transgene expression in the body and the in vivo fate of viral and non-viral vectors are necessary for successful development of in vivo gene delivery systems. Here, we evaluated the spatial distribution of transgene expression using tissue clearing methods. After hydrodynamic injection of plasmid DNA into mice, whole tissues were subjected to tissue clearing. Tissue clearing followed by confocal laser scanning microscopy enabled evaluation of the three-dimensional distribution of transgene expression without preparation of tissue sections. Among the tested clearing methods (ClearT2, SeeDB, and CUBIC), CUBIC was the most suitable method for determining the spatial distribution of transgene expression in not only the liver but also other tissues such as the kidney and lung. In terms of the type of fluorescent protein, the observable depth for green fluorescent protein ZsGreen1 was slightly greater than that for red fluorescent protein tdTomato. We observed a depth of ~1.5 mm for the liver and 500 μm for other tissues without preparation of tissue sections. Furthermore, we succeeded in multicolor deep imaging of the intracellular fate of plasmid DNA in the murine liver. Thus, tissue clearing would be a powerful approach for determining the spatial distribution of plasmid DNA and transgene expression in various murine tissues.
Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu
2016-06-01
Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.
Optimal geometry for a quartz multipurpose SPM sensor.
Stirling, Julian
2013-01-01
We propose a geometry for a piezoelectric SPM sensor that can be used for combined AFM/LFM/STM. The sensor utilises symmetry to provide a lateral mode without the need to excite torsional modes. The symmetry allows normal and lateral motion to be completely isolated, even when introducing large tips to tune the dynamic properties to optimal values.
Wireless Cooperative Networks: Self-Configuration and Optimization
2011-09-09
TERMS wireless sensor networks , wireless cooperative networks, resource optimization, ultra-wideband, localization, ranging 16. SECURITY...Communications We consider two prevalent relay protocols for wireless sensor networks : decode-and-forward (DF) and amplify-and-forward (AF). To... sensor networks where each node may have its own sensing data to transmit, since they can maximally conserve energy while helping others as relays
Large-Scale Transient Transfection of Suspension Mammalian Cells for VLP Production.
Cervera, Laura; Kamen, Amine A
2018-01-01
Large-scale transient transfection of mammalian cell suspension cultures enables the production of biological products in sufficient quantity and under stringent quality attributes to perform accelerated in vitro evaluations and has the potential to support preclinical or even clinical studies. Here we describe the methodology to produce VLPs in a 3L bioreactor, using suspension HEK 293 cells and PEIPro as a transfection reagent. Cells are grown in the bioreactor to 1 × 10 6 cells/mL and transfected with a plasmid DNA-PEI complex at a ratio of 1:2. Dissolved oxygen and pH are controlled and are online monitored during the production phase and cell growth and viability can be measured off line taking samples from the bioreactor. If the product is labeled with a fluorescent marker, transfection efficiency can be also assessed using flow cytometry analysis. Typically, the production phase lasts between 48 and 96 h until the product is harvested.
Kemppainen, Minna J.; Pardo, Alejandro G.
2010-01-01
Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319
Optimal Power Control in Wireless Powered Sensor Networks: A Dynamic Game-Based Approach
Xu, Haitao; Guo, Chao; Zhang, Long
2017-01-01
In wireless powered sensor networks (WPSN), it is essential to research uplink transmit power control in order to achieve throughput performance balancing and energy scheduling. Each sensor should have an optimal transmit power level for revenue maximization. In this paper, we discuss a dynamic game-based algorithm for optimal power control in WPSN. The main idea is to use the non-cooperative differential game to control the uplink transmit power of wireless sensors in WPSN, to extend their working hours and to meet QoS (Quality of Services) requirements. Subsequently, the Nash equilibrium solutions are obtained through Bellman dynamic programming. At the same time, an uplink power control algorithm is proposed in a distributed manner. Through numerical simulations, we demonstrate that our algorithm can obtain optimal power control and reach convergence for an infinite horizon. PMID:28282945
2010-11-01
pected target motion. Along this line, Wettergren [5] analyzed the performance of the track - before - detect schemes for the sensor networks. Furthermore...dressed by Baumgartner and Ferrari [11] for the reorganization of the sensor field to achieve the maximum coverage. The track - before - detect -based optimal...confirming a target. In accordance with the track - before - detect paradigm [4], a moving target is detected if the kd (typically kd = 3 or 4) sensors detect
Field-Based Optimal Placement of Antennas for Body-Worn Wireless Sensors
Januszkiewicz, Łukasz; Di Barba, Paolo; Hausman, Sławomir
2016-01-01
We investigate a case of automated energy-budget-aware optimization of the physical position of nodes (sensors) in a Wireless Body Area Network (WBAN). This problem has not been presented in the literature yet, as opposed to antenna and routing optimization, which are relatively well-addressed. In our research, which was inspired by a safety-critical application for firefighters, the sensor network consists of three nodes located on the human body. The nodes communicate over a radio link operating in the 2.4 GHz or 5.8 GHz ISM frequency band. Two sensors have a fixed location: one on the head (earlobe pulse oximetry) and one on the arm (with accelerometers, temperature and humidity sensors, and a GPS receiver), while the position of the third sensor can be adjusted within a predefined region on the wearer’s chest. The path loss between each node pair strongly depends on the location of the nodes and is difficult to predict without performing a full-wave electromagnetic simulation. Our optimization scheme employs evolutionary computing. The novelty of our approach lies not only in the formulation of the problem but also in linking a fully automated optimization procedure with an electromagnetic simulator and a simplified human body model. This combination turns out to be a computationally effective solution, which, depending on the initial placement, has a potential to improve performance of our example sensor network setup by up to about 20 dB with respect to the path loss between selected nodes. PMID:27196911
Sequential Injection Analysis for Optimization of Molecular Biology Reactions
Allen, Peter B.; Ellington, Andrew D.
2011-01-01
In order to automate the optimization of complex biochemical and molecular biology reactions, we developed a Sequential Injection Analysis (SIA) device and combined this with a Design of Experiment (DOE) algorithm. This combination of hardware and software automatically explores the parameter space of the reaction and provides continuous feedback for optimizing reaction conditions. As an example, we optimized the endonuclease digest of a fluorogenic substrate, and showed that the optimized reaction conditions also applied to the digest of the substrate outside of the device, and to the digest of a plasmid. The sequential technique quickly arrived at optimized reaction conditions with less reagent use than a batch process (such as a fluid handling robot exploring multiple reaction conditions in parallel) would have. The device and method should now be amenable to much more complex molecular biology reactions whose variable spaces are correspondingly larger. PMID:21338059
Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...
2015-09-08
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.
Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less
A robust TALENs system for highly efficient mammalian genome editing.
Feng, Yuanxi; Zhang, Siliang; Huang, Xin
2014-01-10
Recently, transcription activator-like effector nucleases (TALENs) have emerged as a highly effective tool for genomic editing. A pair of TALENs binds to two DNA recognition sites separated by a spacer sequence, and the dimerized FokI nucleases at the C terminal then cleave DNA in the spacer. Because of its modular design and capacity to precisely target almost any desired genomic locus, TALEN is a technology that can revolutionize the entire biomedical research field. Currently, for genomic editing in cultured cells, two plasmids encoding a pair of TALENs are co-transfected, followed by limited dilution to isolate cell colonies with the intended genomic manipulation. However, uncertain transfection efficiency becomes a bottleneck, especially in hard-to-transfect cells, reducing the overall efficiency of genome editing. We have developed a robust TALENs system in which each TALEN plasmid also encodes a fluorescence protein. Thus, cells transfected with both TALEN plasmids, a prerequisite for genomic editing, can be isolated by fluorescence-activated cell sorting. Our improved TALENs system can be applied to all cultured cells to achieve highly efficient genomic editing. Furthermore, an optimized procedure for genomic editing using TALENs is also presented. We expect our system to be widely adopted by the scientific community.
Enhancement and optimization of plasmid expression in femtosecond optical transfection.
Praveen, Bavishna B; Stevenson, David J; Antkowiak, Maciej; Dholakia, Kishan; Gunn-Moore, Frank J
2011-04-01
Cell transfection using femtosecond lasers is gaining importance for its proven ability to achieve selective transfection in a sterile and relatively non-invasive manner. However, the net efficiency of this technique is limited due to a number of factors that ultimately makes it difficult to be used as a viable and widely used technique. We report here a method to achieve significant enhancement in the efficiency of femtosecond optical transfection. The transfection procedure is modified by incorporating a suitable synthetic peptide containing nuclear localization and DNA binding sequences, assisting DNA import into the nucleus. We achieved a 3-fold enhancement in the transfection efficiency for adherent Chinese Hamster Ovary (CHO-K1) cells with this modified protocol. Further, in the presence of this biochemical reagent, we were able to reduce the required plasmid concentration by ~70% without compromising the transfection efficiency. Also, we report for the first time the successful photo-transfection of recently trypsinised cells with significantly high transfection efficiency when transfected with modified plasmid. This paves the way for the development of high throughput microfluidic optical transfection devices. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A Multi-Objective Partition Method for Marine Sensor Networks Based on Degree of Event Correlation.
Huang, Dongmei; Xu, Chenyixuan; Zhao, Danfeng; Song, Wei; He, Qi
2017-09-21
Existing marine sensor networks acquire data from sea areas that are geographically divided, and store the data independently in their affiliated sea area data centers. In the case of marine events across multiple sea areas, the current network structure needs to retrieve data from multiple data centers, and thus severely affects real-time decision making. In this study, in order to provide a fast data retrieval service for a marine sensor network, we use all the marine sensors as the vertices, establish the edge based on marine events, and abstract the marine sensor network as a graph. Then, we construct a multi-objective balanced partition method to partition the abstract graph into multiple regions and store them in the cloud computing platform. This method effectively increases the correlation of the sensors and decreases the retrieval cost. On this basis, an incremental optimization strategy is designed to dynamically optimize existing partitions when new sensors are added into the network. Experimental results show that the proposed method can achieve the optimal layout for distributed storage in the process of disaster data retrieval in the China Sea area, and effectively optimize the result of partitions when new buoys are deployed, which eventually will provide efficient data access service for marine events.
Alonso-Gutierrez, Jorge; Koma, Daisuke; Hu, Qijun; Yang, Yuchen; Chan, Leanne J G; Petzold, Christopher J; Adams, Paul D; Vickers, Claudia E; Nielsen, Lars K; Keasling, Jay D; Lee, Taek S
2018-04-01
Escherichia coli has been the organism of choice for the production of different chemicals by engineering native and heterologous pathways. In the present study, we simultaneously address some of the main issues associated with E. coli as an industrial platform for isoprenoids, including an inability to grow on sucrose, a lack of endogenous control over toxic mevalonate (MVA) pathway intermediates, and the limited pathway engineering into the chromosome. As a proof of concept, we generated an E. coli DH1 strain able to produce the isoprenoid bisabolene from sucrose by integrating the cscAKB operon into the chromosome and by expressing a heterologous MVA pathway under stress-responsive control. Production levels dropped dramatically relative to plasmid-mediated expression when the entire pathway was integrated into the chromosome. In order to optimize the chromosomally integrated MVA pathway, we established a CRISPR-Cas9 system to rapidly and systematically replace promoter sequences. This strategy led to higher pathway expression and a fivefold improvement in bisabolene production. More interestingly, we analyzed proteomics data sets to understand and address some of the challenges associated with metabolic engineering of the chromosomally integrated pathway. This report shows that integrating plasmid-optimized operons into the genome and making them work optimally is not a straightforward task and any poor engineering choices on the chromosome may lead to cell death rather than just resulting in low titers. Based on these results, we also propose directions for chromosomal metabolic engineering. © 2017 Wiley Periodicals, Inc.
Mohanasundaram, Ranganathan; Periasamy, Pappampalayam Sanmugam
2015-01-01
The current high profile debate with regard to data storage and its growth have become strategic task in the world of networking. It mainly depends on the sensor nodes called producers, base stations, and also the consumers (users and sensor nodes) to retrieve and use the data. The main concern dealt here is to find an optimal data storage position in wireless sensor networks. The works that have been carried out earlier did not utilize swarm intelligence based optimization approaches to find the optimal data storage positions. To achieve this goal, an efficient swam intelligence approach is used to choose suitable positions for a storage node. Thus, hybrid particle swarm optimization algorithm has been used to find the suitable positions for storage nodes while the total energy cost of data transmission is minimized. Clustering-based distributed data storage is utilized to solve clustering problem using fuzzy-C-means algorithm. This research work also considers the data rates and locations of multiple producers and consumers to find optimal data storage positions. The algorithm is implemented in a network simulator and the experimental results show that the proposed clustering and swarm intelligence based ODS strategy is more effective than the earlier approaches.
Detection of Ti02 nanoparticles using flow cytometry and optimized darkfield microscopy
Evaluation of the potential hazard of man made nanomaterials has been hampered by a limited ability to observe and measure nanoparticles in cells. In the present study, TiOz nanoparticles (rutile, 30-40 nm) were suspended in DMEM/F12 with 10% fetal bovine serum, sonicated, and ch...
Energy-Efficient Cognitive Radio Sensor Networks: Parametric and Convex Transformations
Naeem, Muhammad; Illanko, Kandasamy; Karmokar, Ashok; Anpalagan, Alagan; Jaseemuddin, Muhammad
2013-01-01
Designing energy-efficient cognitive radio sensor networks is important to intelligently use battery energy and to maximize the sensor network life. In this paper, the problem of determining the power allocation that maximizes the energy-efficiency of cognitive radio-based wireless sensor networks is formed as a constrained optimization problem, where the objective function is the ratio of network throughput and the network power. The proposed constrained optimization problem belongs to a class of nonlinear fractional programming problems. Charnes-Cooper Transformation is used to transform the nonlinear fractional problem into an equivalent concave optimization problem. The structure of the power allocation policy for the transformed concave problem is found to be of a water-filling type. The problem is also transformed into a parametric form for which a ε-optimal iterative solution exists. The convergence of the iterative algorithms is proven, and numerical solutions are presented. The iterative solutions are compared with the optimal solution obtained from the transformed concave problem, and the effects of different system parameters (interference threshold level, the number of primary users and secondary sensor nodes) on the performance of the proposed algorithms are investigated. PMID:23966194
Marechal, Luc; Shaohui Foong; Zhenglong Sun; Wood, Kristin L
2015-08-01
Motivated by the need for developing a neuronavigation system to improve efficacy of intracranial surgical procedures, a localization system using passive magnetic fields for real-time monitoring of the insertion process of an external ventricular drain (EVD) catheter is conceived and developed. This system operates on the principle of measuring the static magnetic field of a magnetic marker using an array of magnetic sensors. An artificial neural network (ANN) is directly used for solving the inverse problem of magnetic dipole localization for improved efficiency and precision. As the accuracy of localization system is highly dependent on the sensor spatial location, an optimization framework, based on understanding and classification of experimental sensor characteristics as well as prior knowledge of the general trajectory of the localization pathway, for design of such sensing assemblies is described and investigated in this paper. Both optimized and non-optimized sensor configurations were experimentally evaluated and results show superior performance from the optimized configuration. While the approach presented here utilizes ventriculostomy as an illustrative platform, it can be extended to other medical applications that require localization inside the body.
Model Based Optimal Sensor Network Design for Condition Monitoring in an IGCC Plant
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kumar, Rajeeva; Kumar, Aditya; Dai, Dan
2012-12-31
This report summarizes the achievements and final results of this program. The objective of this program is to develop a general model-based sensor network design methodology and tools to address key issues in the design of an optimal sensor network configuration: the type, location and number of sensors used in a network, for online condition monitoring. In particular, the focus in this work is to develop software tools for optimal sensor placement (OSP) and use these tools to design optimal sensor network configuration for online condition monitoring of gasifier refractory wear and radiant syngas cooler (RSC) fouling. The methodology developedmore » will be applicable to sensing system design for online condition monitoring for broad range of applications. The overall approach consists of (i) defining condition monitoring requirement in terms of OSP and mapping these requirements in mathematical terms for OSP algorithm, (ii) analyzing trade-off of alternate OSP algorithms, down selecting the most relevant ones and developing them for IGCC applications (iii) enhancing the gasifier and RSC models as required by OSP algorithms, (iv) applying the developed OSP algorithm to design the optimal sensor network required for the condition monitoring of an IGCC gasifier refractory and RSC fouling. Two key requirements for OSP for condition monitoring are desired precision for the monitoring variables (e.g. refractory wear) and reliability of the proposed sensor network in the presence of expected sensor failures. The OSP problem is naturally posed within a Kalman filtering approach as an integer programming problem where the key requirements of precision and reliability are imposed as constraints. The optimization is performed over the overall network cost. Based on extensive literature survey two formulations were identified as being relevant to OSP for condition monitoring; one based on LMI formulation and the other being standard INLP formulation. Various algorithms to solve these two formulations were developed and validated. For a given OSP problem the computation efficiency largely depends on the “size” of the problem. Initially a simplified 1-D gasifier model assuming axial and azimuthal symmetry was used to test out various OSP algorithms. Finally these algorithms were used to design the optimal sensor network for condition monitoring of IGCC gasifier refractory wear and RSC fouling. The sensors type and locations obtained as solution to the OSP problem were validated using model based sensing approach. The OSP algorithm has been developed in a modular form and has been packaged as a software tool for OSP design where a designer can explore various OSP design algorithm is a user friendly way. The OSP software tool is implemented in Matlab/Simulink© in-house. The tool also uses few optimization routines that are freely available on World Wide Web. In addition a modular Extended Kalman Filter (EKF) block has also been developed in Matlab/Simulink© which can be utilized for model based sensing of important process variables that are not directly measured through combining the online sensors with model based estimation once the hardware sensor and their locations has been finalized. The OSP algorithm details and the results of applying these algorithms to obtain optimal sensor location for condition monitoring of gasifier refractory wear and RSC fouling profile are summarized in this final report.« less
Optimal Cloning of PCR Fragments by Homologous Recombination in Escherichia coli
Jacobus, Ana Paula; Gross, Jeferson
2015-01-01
PCR fragments and linear vectors containing overlapping ends are easily assembled into a propagative plasmid by homologous recombination in Escherichia coli. Although this gap-repair cloning approach is straightforward, its existence is virtually unknown to most molecular biologists. To popularize this method, we tested critical parameters influencing the efficiency of PCR fragments cloning into PCR-amplified vectors by homologous recombination in the widely used E. coli strain DH5α. We found that the number of positive colonies after transformation increases with the length of overlap between the PCR fragment and linear vector. For most practical purposes, a 20 bp identity already ensures high-cloning yields. With an insert to vector ratio of 2:1, higher colony forming numbers are obtained when the amount of vector is in the range of 100 to 250 ng. An undesirable cloning background of empty vectors can be minimized during vector PCR amplification by applying a reduced amount of plasmid template or by using primers in which the 5′ termini are separated by a large gap. DpnI digestion of the plasmid template after PCR is also effective to decrease the background of negative colonies. We tested these optimized cloning parameters during the assembly of five independent DNA constructs and obtained 94% positive clones out of 100 colonies probed. We further demonstrated the efficient and simultaneous cloning of two PCR fragments into a vector. These results support the idea that homologous recombination in E. coli might be one of the most effective methods for cloning one or two PCR fragments. For its simplicity and high efficiency, we believe that recombinational cloning in E. coli has a great potential to become a routine procedure in most molecular biology-oriented laboratories. PMID:25774528
Cai, Yingying; Xia, Miaomiao; Dong, Huina; Qian, Yuan; Zhang, Tongcun; Zhu, Beiwei; Wu, Jinchuan; Zhang, Dawei
2018-05-11
As a very important coenzyme in the cell metabolism, Vitamin B 12 (cobalamin, VB 12 ) has been widely used in food and medicine fields. The complete biosynthesis of VB 12 requires approximately 30 genes, but overexpression of these genes did not result in expected increase of VB 12 production. High-yield VB 12 -producing strains are usually obtained by mutagenesis treatments, thus developing an efficient screening approach is urgently needed. By the help of engineered strains with varied capacities of VB 12 production, a riboswitch library was constructed and screened, and the btuB element from Salmonella typhimurium was identified as the best regulatory device. A flow cytometry high-throughput screening system was developed based on the btuB riboswitch with high efficiency to identify positive mutants. Mutation of Sinorhizobium meliloti (S. meliloti) was optimized using the novel mutation technique of atmospheric and room temperature plasma (ARTP). Finally, the mutant S. meliloti MC5-2 was obtained and considered as a candidate for industrial applications. After 7 d's cultivation on a rotary shaker at 30 °C, the VB 12 titer of S. meliloti MC5-2 reached 156 ± 4.2 mg/L, which was 21.9% higher than that of the wild type strain S. meliloti 320 (128 ± 3.2 mg/L). The genome of S. meliloti MC5-2 was sequenced, and gene mutations were identified and analyzed. To our knowledge, it is the first time that a riboswitch element was used in S. meliloti. The flow cytometry high-throughput screening system was successfully developed and a high-yield VB 12 producing strain was obtained. The identified and analyzed gene mutations gave useful information for developing high-yield strains by metabolic engineering. Overall, this work provides a useful high-throughput screening method for developing high VB 12 -yield strains.
Li, Ruiying; Liu, Xiaoxi; Xie, Wei; Huang, Ning
2014-12-10
Sensor-deployment-based lifetime optimization is one of the most effective methods used to prolong the lifetime of Wireless Sensor Network (WSN) by reducing the distance-sensitive energy consumption. In this paper, data retransmission, a major consumption factor that is usually neglected in the previous work, is considered. For a homogeneous WSN, monitoring a circular target area with a centered base station, a sensor deployment model based on regular hexagonal grids is analyzed. To maximize the WSN lifetime, optimization models for both uniform and non-uniform deployment schemes are proposed by constraining on coverage, connectivity and success transmission rate. Based on the data transmission analysis in a data gathering cycle, the WSN lifetime in the model can be obtained through quantifying the energy consumption at each sensor location. The results of case studies show that it is meaningful to consider data retransmission in the lifetime optimization. In particular, our investigations indicate that, with the same lifetime requirement, the number of sensors needed in a non-uniform topology is much less than that in a uniform one. Finally, compared with a random scheme, simulation results further verify the advantage of our deployment model.
Nguyen, Thi-Tham; Van Le, Duc; Yoon, Seokhoon
2014-01-01
This paper proposes a practical low-complexity MAC (medium access control) scheme for quality of service (QoS)-aware and cluster-based underwater acoustic sensor networks (UASN), in which the provision of differentiated QoS is required. In such a network, underwater sensors (U-sensor) in a cluster are divided into several classes, each of which has a different QoS requirement. The major problem considered in this paper is the maximization of the number of nodes that a cluster can accommodate while still providing the required QoS for each class in terms of the PDR (packet delivery ratio). In order to address the problem, we first estimate the packet delivery probability (PDP) and use it to formulate an optimization problem to determine the optimal value of the maximum packet retransmissions for each QoS class. The custom greedy and interior-point algorithms are used to find the optimal solutions, which are verified by extensive simulations. The simulation results show that, by solving the proposed optimization problem, the supportable number of underwater sensor nodes can be maximized while satisfying the QoS requirements for each class. PMID:24608009
Nguyen, Thi-Tham; Le, Duc Van; Yoon, Seokhoon
2014-03-07
This paper proposes a practical low-complexity MAC (medium access control) scheme for quality of service (QoS)-aware and cluster-based underwater acoustic sensor networks (UASN), in which the provision of differentiated QoS is required. In such a network, underwater sensors (U-sensor) in a cluster are divided into several classes, each of which has a different QoS requirement. The major problem considered in this paper is the maximization of the number of nodes that a cluster can accommodate while still providing the required QoS for each class in terms of the PDR (packet delivery ratio). In order to address the problem, we first estimate the packet delivery probability (PDP) and use it to formulate an optimization problem to determine the optimal value of the maximum packet retransmissions for each QoS class. The custom greedy and interior-point algorithms are used to find the optimal solutions, which are verified by extensive simulations. The simulation results show that, by solving the proposed optimization problem, the supportable number of underwater sensor nodes can be maximized while satisfying the QoS requirements for each class.
NASA Astrophysics Data System (ADS)
Basak, Nupur
A potentially implantable single crystal 3C-SiC pressure sensor for blood pressure measurement was designed, simulated, fabricated, characterized and optimized. This research uses a single crystal 3C-SiC, for the first time, to demonstrate its application as a blood pressure measurement sensor. The sensor, which uses the epitaxial grown 3C-SiC membrane to measure changes in pressure, is designed to be wireless, biocompatible and linear. The SiC material was chosen for its superior physical, chemical and mechanical properties; the capacitive sensor uses a 3C-SiC membrane as one of the electrodes; and, the sensor system is wireless for comfort and to allow for convenient reading of real-time pressure data (wireless communication is enabled by connecting the sensor parallel to a planar inductor). Together, the variable capacitive sensor and planar inductor create a pressure sensitive resonant circuit. The sensor system described above allows for implantation into a human patient's body, after which the planar inductor can be coupled with an external inductor to receive data for real-time blood pressure measurement. Electroplating, thick photo-resist characterization, RIE etching, oxidation, CVD, chemical mechanical polishing and wafer bonding were optimized during the process of fabricating the sensor system and, in addition to detailing the sensor system simulation and characterization; the optimized processes are detailed in the dissertation. This absolute pressure sensor is designed to function optimally within the human blood pressure range of 50-350mmHg. The layout and modeling of the sensor uses finite element analysis (FEA) software. The simulations for membrane deflection, stress analysis and electro-mechanical analysis are performed for 100 μm2 and 400μm2sensors. The membrane deflection-pressure, capacitance-pressure and resonant frequency-pressure graphs were obtained, and detailed in the dissertation, along with the planar inductor simulation for differently sized inductors. Ultimately, an optimized sensor with a size of 400μm2 was chosen because of its high sensitivity. The sensor, and the planar inductor, which is 3mm 2, is comparable to the presently researched implantable chip size. The measured inductance of the gold electroplated inductor is 0.371μH. The capacitance changes from 0.934 pF to 0.997pF with frequency shift of 248MHz to 256 MHz. The sensitivity of the sensor is found to be 0.21 fF/mmHg or 27.462 kHz/mmHg with an average non-linearity of 0.23216%.
Geometrical optimization of sensors for eddy currents nondestructive testing and evaluation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Thollon, F.; Burais, N.
1995-05-01
Design of Non Destructive Testing (NDT) and Non Destructive Evaluation (NDE) sensors is possible by solving Maxwell`s relations with FEM or BIM. But the large number of geometrical and electrical parameters of sensor and tested material implies many results that don`t give necessarily a well adapted sensor. The authors have used a genetic algorithm for automatic optimization. After having tested this algorithm with analytical solution of Maxwell`s relations for cladding thickness measurement, the method has been implemented in finite element package.
Tang, Vera A; Renner, Tyler M; Fritzsche, Anna K; Burger, Dylan; Langlois, Marc-André
2017-12-19
Retroviruses and small EVs overlap in size, buoyant densities, refractive indices and share many cell-derived surface markers making them virtually indistinguishable by standard biochemical methods. This poses a significant challenge when purifying retroviruses for downstream analyses or for phenotypic characterization studies of markers on individual virions given that EVs are a major contaminant of retroviral preparations. Nanoscale flow cytometry (NFC), also called flow virometry, is an adaptation of flow cytometry technology for the analysis of individual nanoparticles such as extracellular vesicles (EVs) and retroviruses. In this study we systematically optimized NFC parameters for the detection of retroviral particles in the range of 115-130 nm, including viral production, sample labeling, laser power and voltage settings. By using the retroviral envelope glycoprotein as a selection marker, and evaluating a number of fluorescent dyes and labeling methods, we demonstrate that it is possible to confidently distinguish retroviruses from small EVs by NFC. Our findings make it now possible to individually phenotype genetically modified retroviral particles that express a fluorescent envelope glycoprotein without removing EV contaminants from the sample.
Tips and tricks for flow cytometry-based analysis and counting of microparticles.
Poncelet, Philippe; Robert, Stéphane; Bailly, Nicolas; Garnache-Ottou, Francine; Bouriche, Tarik; Devalet, Bérangère; Segatchian, Jerard H; Saas, Philippe; Mullier, François
2015-10-01
Submicron-sized extra-cellular vesicles generated by budding from the external cell membranes, microparticles (MPs) are important actors in transfusion as well as in other medical specialties. After briefly positioning their role in the characterization of labile blood products, this technically oriented chapter aims to review practical points that need to be considered when trying to use flow cytometry for the analysis, characterization and absolute counting of MP subsets. Subjects of active discussions relative to instrumentation will include the choice of the trigger parameter, possible standardization approaches requiring instrument quality-control, origin and control of non-specific background and of coincidence artifacts, choice of the type of electronic signals, optimal sheath fluid and sample speed. Questions related to reagents will cover target antigens and receptors, multi-color reagents, negative controls, enumeration of MPs and limiting artifacts due to unexpected (micro-) coagulation of plasma samples. Newly detected problems are generating innovative solutions and flow cytometry will continue to remain the technology of choice for the analysis of MPs, in the domain of transfusion as well as in many diverse specialties. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ferrarezi, Marina C; Curci, Vera C L M; Cardoso, Tereza C
2013-12-01
Epsilon toxin (ETX) produced by Clostridium perfringens types B and D is a potent toxin that is responsible for fatal enterotoxaemia. In vitro, ETX, which is considered as a pore-forming toxin, forms a heptamer in Madin-Darby canine kidney (MDCK) cell membranes, which is considered to be a pre-pore stage. After binding of the ETX, vacuoles inside cell cytoplasm are produced. ETX causes decreased levels of essential coenzymes required for host cell energy. Here, we optimized and applied acoustic flow cytometry analysis in order to gain further insight into ETX-pathogenesis. Using acoustic flow cytometer analysis, which considered highly sensitive, ETX-exposed MDCK cells revealed mitochondrial membrane decreases followed by 25.48% and 45.45% of the exposed cells expressing the Bax and BCL-2 proteins at a pre-pore stage, respectively. These results together with high cytotoxicity and visualization of cell vacuoles, demonstrates that acoustic flow cytometry analysis potentially represents an effective tool to study ETX pathogenesis. Copyright © 2013. Published by Elsevier Ltd.
Strategy Developed for Selecting Optimal Sensors for Monitoring Engine Health
NASA Technical Reports Server (NTRS)
2004-01-01
Sensor indications during rocket engine operation are the primary means of assessing engine performance and health. Effective selection and location of sensors in the operating engine environment enables accurate real-time condition monitoring and rapid engine controller response to mitigate critical fault conditions. These capabilities are crucial to ensure crew safety and mission success. Effective sensor selection also facilitates postflight condition assessment, which contributes to efficient engine maintenance and reduced operating costs. Under the Next Generation Launch Technology program, the NASA Glenn Research Center, in partnership with Rocketdyne Propulsion and Power, has developed a model-based procedure for systematically selecting an optimal sensor suite for assessing rocket engine system health. This optimization process is termed the systematic sensor selection strategy. Engine health management (EHM) systems generally employ multiple diagnostic procedures including data validation, anomaly detection, fault-isolation, and information fusion. The effectiveness of each diagnostic component is affected by the quality, availability, and compatibility of sensor data. Therefore systematic sensor selection is an enabling technology for EHM. Information in three categories is required by the systematic sensor selection strategy. The first category consists of targeted engine fault information; including the description and estimated risk-reduction factor for each identified fault. Risk-reduction factors are used to define and rank the potential merit of timely fault diagnoses. The second category is composed of candidate sensor information; including type, location, and estimated variance in normal operation. The final category includes the definition of fault scenarios characteristic of each targeted engine fault. These scenarios are defined in terms of engine model hardware parameters. Values of these parameters define engine simulations that generate expected sensor values for targeted fault scenarios. Taken together, this information provides an efficient condensation of the engineering experience and engine flow physics needed for sensor selection. The systematic sensor selection strategy is composed of three primary algorithms. The core of the selection process is a genetic algorithm that iteratively improves a defined quality measure of selected sensor suites. A merit algorithm is employed to compute the quality measure for each test sensor suite presented by the selection process. The quality measure is based on the fidelity of fault detection and the level of fault source discrimination provided by the test sensor suite. An inverse engine model, whose function is to derive hardware performance parameters from sensor data, is an integral part of the merit algorithm. The final component is a statistical evaluation algorithm that characterizes the impact of interference effects, such as control-induced sensor variation and sensor noise, on the probability of fault detection and isolation for optimal and near-optimal sensor suites.
Arvand, Majid; Ghodsi, Navid; Zanjanchi, Mohammad Ali
2016-03-15
The current techniques for determining adenine have several shortcomings such as high cost, high time consumption, tedious pretreatment steps and the requirements for highly skilled personnel often restrict their use in routine analytical practice. This paper describes the development and utilization of a new nanocomposite consisting of titanium dioxide nanofibers (TNFs) and graphene oxide nanosheets (GONs) for screen printed carbon electrode (SPCE) modification. The synthesized GONs and TNFs were characterized by transmission electron microscopy (TEM), scanning electron microscopy (SEM), X-ray diffraction (XRD) and Fourier transform infrared spectroscopy (FT-IR). The modified electrode (TNFs/GONs/SPCE) was used for electrochemical characterization of adenine. The TNFs/GONs/SPCE exhibited an increase in peak current and the electron transfer kinetics and decrease in the overpotential for the oxidation reaction of adenine. Using differential pulse voltammetry (DPV), the prepared sensor showed good sensitivity for determining adenine in two ranges from 0.1-1 and 1-10 μM, with a detection limit (DL) of 1.71 nM. Electrochemical studies suggested that the TNFs/GONs/SPCE provided a synergistic augmentation on the voltammetric behavior of electrochemical oxidation of adenine, which was indicated by the improvement of anodic peak current and a decrease in anodic peak potential. The amount of adenine in pBudCE4.1 plasmid was determined via the proposed sensor and the result was in good compatibility with the sequence data of pBudCE4.1 plasmid. Copyright © 2015 Elsevier B.V. All rights reserved.
Xu, Jingjing; Yang, Wei; Zhang, Linyuan; Han, Ruisong; Shao, Xiaotao
2015-01-01
In this paper, a wireless sensor network (WSN) technology adapted to underground channel conditions is developed, which has important theoretical and practical value for safety monitoring in underground coal mines. According to the characteristics that the space, time and frequency resources of underground tunnel are open, it is proposed to constitute wireless sensor nodes based on multicarrier code division multiple access (MC-CDMA) to make full use of these resources. To improve the wireless transmission performance of source sensor nodes, it is also proposed to utilize cooperative sensors with good channel conditions from the sink node to assist source sensors with poor channel conditions. Moreover, the total power of the source sensor and its cooperative sensors is allocated on the basis of their channel conditions to increase the energy efficiency of the WSN. To solve the problem that multiple access interference (MAI) arises when multiple source sensors transmit monitoring information simultaneously, a kind of multi-sensor detection (MSD) algorithm with particle swarm optimization (PSO), namely D-PSO, is proposed for the time-frequency coded cooperative MC-CDMA WSN. Simulation results show that the average bit error rate (BER) performance of the proposed WSN in an underground coal mine is improved significantly by using wireless sensor nodes based on MC-CDMA, adopting time-frequency coded cooperative transmission and D-PSO algorithm with particle swarm optimization. PMID:26343660
Xu, Jingjing; Yang, Wei; Zhang, Linyuan; Han, Ruisong; Shao, Xiaotao
2015-08-27
In this paper, a wireless sensor network (WSN) technology adapted to underground channel conditions is developed, which has important theoretical and practical value for safety monitoring in underground coal mines. According to the characteristics that the space, time and frequency resources of underground tunnel are open, it is proposed to constitute wireless sensor nodes based on multicarrier code division multiple access (MC-CDMA) to make full use of these resources. To improve the wireless transmission performance of source sensor nodes, it is also proposed to utilize cooperative sensors with good channel conditions from the sink node to assist source sensors with poor channel conditions. Moreover, the total power of the source sensor and its cooperative sensors is allocated on the basis of their channel conditions to increase the energy efficiency of the WSN. To solve the problem that multiple access interference (MAI) arises when multiple source sensors transmit monitoring information simultaneously, a kind of multi-sensor detection (MSD) algorithm with particle swarm optimization (PSO), namely D-PSO, is proposed for the time-frequency coded cooperative MC-CDMA WSN. Simulation results show that the average bit error rate (BER) performance of the proposed WSN in an underground coal mine is improved significantly by using wireless sensor nodes based on MC-CDMA, adopting time-frequency coded cooperative transmission and D-PSO algorithm with particle swarm optimization.
Simultaneous Intrinsic and Extrinsic Parameter Identification of a Hand-Mounted Laser-Vision Sensor
Lee, Jong Kwang; Kim, Kiho; Lee, Yongseok; Jeong, Taikyeong
2011-01-01
In this paper, we propose a simultaneous intrinsic and extrinsic parameter identification of a hand-mounted laser-vision sensor (HMLVS). A laser-vision sensor (LVS), consisting of a camera and a laser stripe projector, is used as a sensor component of the robotic measurement system, and it measures the range data with respect to the robot base frame using the robot forward kinematics and the optical triangulation principle. For the optimal estimation of the model parameters, we applied two optimization techniques: a nonlinear least square optimizer and a particle swarm optimizer. Best-fit parameters, including both the intrinsic and extrinsic parameters of the HMLVS, are simultaneously obtained based on the least-squares criterion. From the simulation and experimental results, it is shown that the parameter identification problem considered was characterized by a highly multimodal landscape; thus, the global optimization technique such as a particle swarm optimization can be a promising tool to identify the model parameters for a HMLVS, while the nonlinear least square optimizer often failed to find an optimal solution even when the initial candidate solutions were selected close to the true optimum. The proposed optimization method does not require good initial guesses of the system parameters to converge at a very stable solution and it could be applied to a kinematically dissimilar robot system without loss of generality. PMID:22164104
Optimal Sensor Selection for Health Monitoring Systems
NASA Technical Reports Server (NTRS)
Santi, L. Michael; Sowers, T. Shane; Aguilar, Robert B.
2005-01-01
Sensor data are the basis for performance and health assessment of most complex systems. Careful selection and implementation of sensors is critical to enable high fidelity system health assessment. A model-based procedure that systematically selects an optimal sensor suite for overall health assessment of a designated host system is described. This procedure, termed the Systematic Sensor Selection Strategy (S4), was developed at NASA John H. Glenn Research Center in order to enhance design phase planning and preparations for in-space propulsion health management systems (HMS). Information and capabilities required to utilize the S4 approach in support of design phase development of robust health diagnostics are outlined. A merit metric that quantifies diagnostic performance and overall risk reduction potential of individual sensor suites is introduced. The conceptual foundation for this merit metric is presented and the algorithmic organization of the S4 optimization process is described. Representative results from S4 analyses of a boost stage rocket engine previously under development as part of NASA's Next Generation Launch Technology (NGLT) program are presented.
A Systematic Approach to Sensor Selection for Aircraft Engine Health Estimation
NASA Technical Reports Server (NTRS)
Simon, Donald L.; Garg, Sanjay
2009-01-01
A systematic approach for selecting an optimal suite of sensors for on-board aircraft gas turbine engine health estimation is presented. The methodology optimally chooses the engine sensor suite and the model tuning parameter vector to minimize the Kalman filter mean squared estimation error in the engine s health parameters or other unmeasured engine outputs. This technique specifically addresses the underdetermined estimation problem where there are more unknown system health parameters representing degradation than available sensor measurements. This paper presents the theoretical estimation error equations, and describes the optimization approach that is applied to select the sensors and model tuning parameters to minimize these errors. Two different model tuning parameter vector selection approaches are evaluated: the conventional approach of selecting a subset of health parameters to serve as the tuning parameters, and an alternative approach that selects tuning parameters as a linear combination of all health parameters. Results from the application of the technique to an aircraft engine simulation are presented, and compared to those from an alternative sensor selection strategy.
Joint Resource Optimization for Cognitive Sensor Networks with SWIPT-Enabled Relay.
Lu, Weidang; Lin, Yuanrong; Peng, Hong; Nan, Tian; Liu, Xin
2017-09-13
Energy-constrained wireless networks, such as wireless sensor networks (WSNs), are usually powered by fixed energy supplies (e.g., batteries), which limits the operation time of networks. Simultaneous wireless information and power transfer (SWIPT) is a promising technique to prolong the lifetime of energy-constrained wireless networks. This paper investigates the performance of an underlay cognitive sensor network (CSN) with SWIPT-enabled relay node. In the CSN, the amplify-and-forward (AF) relay sensor node harvests energy from the ambient radio-frequency (RF) signals using power splitting-based relaying (PSR) protocol. Then, it helps forward the signal of source sensor node (SSN) to the destination sensor node (DSN) by using the harvested energy. We study the joint resource optimization including the transmit power and power splitting ratio to maximize CSN's achievable rate with the constraint that the interference caused by the CSN to the primary users (PUs) is within the permissible threshold. Simulation results show that the performance of our proposed joint resource optimization can be significantly improved.
Perspectives on MEMS in bioengineering: a novel capacitive position microsensor.
Pedrocchi, A; Hoen, S; Ferrigno, G; Pedotti, A
2000-01-01
We describe a novel capacitive position sensor using micromachining to achieve high sensitivity and large range of motion. These sensors require a new theoretical framework to describe and optimize their performance. Employing a complete description of the electrical fields, the sensor should deviate from the standard geometries used for capacitive sensors. By this optimization, the sensor gains a twofold increase in sensitivity. Results on a PC board 10x model imply that the micromachined sensor should achieve a sensitivity of less than 10 nm over 500-micron range of travel. Some bioengineering applications are addressed, including positioning of micromirrors for laser surgery and dose control for implantable drug delivery systems.
Al-Fatlawi, Ali H; Fatlawi, Hayder K; Sai Ho Ling
2017-07-01
Daily physical activities monitoring is benefiting the health care field in several ways, in particular with the development of the wearable sensors. This paper adopts effective ways to calculate the optimal number of the necessary sensors and to build a reliable and a high accuracy monitoring system. Three data mining algorithms, namely Decision Tree, Random Forest and PART Algorithm, have been applied for the sensors selection process. Furthermore, the deep belief network (DBN) has been investigated to recognise 33 physical activities effectively. The results indicated that the proposed method is reliable with an overall accuracy of 96.52% and the number of sensors is minimised from nine to six sensors.
NASA Astrophysics Data System (ADS)
Mousavi, Monireh Sadat; Ashrafi, Khosro; Motlagh, Majid Shafie Pour; Niksokhan, Mohhamad Hosein; Vosoughifar, HamidReza
2018-02-01
In this study, coupled method for simulation of flow pattern based on computational methods for fluid dynamics with optimization technique using genetic algorithms is presented to determine the optimal location and number of sensors in an enclosed residential complex parking in Tehran. The main objective of this research is costs reduction and maximum coverage with regard to distribution of existing concentrations in different scenarios. In this study, considering all the different scenarios for simulation of pollution distribution using CFD simulations has been challenging due to extent of parking and number of cars available. To solve this problem, some scenarios have been selected based on random method. Then, maximum concentrations of scenarios are chosen for performing optimization. CFD simulation outputs are inserted as input in the optimization model using genetic algorithm. The obtained results stated optimal number and location of sensors.
Saw, Jimmy H. W.; Yuryev, Anton; Kanbe, Masaomi; Hou, Shaobin; Young, Aaron G.; Aizawa, Shin-Ichi
2012-01-01
Saprospira grandis is a coastal marine bacterium that can capture and prey upon other marine bacteria using a mechanism known as ‘ixotrophy’. Here, we present the complete genome sequence of Saprospira grandis str. Lewin isolated from La Jolla beach in San Diego, California. The complete genome sequence comprises a chromosome of 4.35 Mbp and a plasmid of 54.9 Kbp. Genome analysis revealed incomplete pathways for the biosynthesis of nine essential amino acids but presence of a large number of peptidases. The genome encodes multiple copies of sensor globin-coupled rsbR genes thought to be essential for stress response and the presence of such sensor globins in Bacteroidetes is unprecedented. A total of 429 spacer sequences within the three CRISPR repeat regions were identified in the genome and this number is the largest among all the Bacteroidetes sequenced to date. PMID:22675601
Zaĭtseva, Iu V; Granik, V G; Belik, A S; Koksharova, O A; Khmel', I A
2010-01-01
Nitrofurans (nitrofurazone, nitrofurantoin, furazidin, nifuroxazide), and nitric oxide generators (sodium nitroprusside and isosorbide mononitrate) in subinhibitory concentrations were shown to significantly increase the bioluminescence of the sensor Escherichia coli strains used for detecting N-acyl-homoserine lactones, signaling molecules of Quorum Sensing (QS) regulatory systems. The highest activation of bioluminescence (up to 250-400 fold) was observed in the presence of nitrofurazone on E. coli DH5alpha biosensors containing lux-reporter plasmids pSB401 or pSB536. However, this activation was not specifically associated with the functioning of QS systems. We suggest that the effect observed results from a direct action of nitrofurans and NO donors on the process of bioluminescence. The data indicate the necessity of using the biosensors that make it possible to detect specific effects of substances tested on QS regulation.
A Parameter Communication Optimization Strategy for Distributed Machine Learning in Sensors.
Zhang, Jilin; Tu, Hangdi; Ren, Yongjian; Wan, Jian; Zhou, Li; Li, Mingwei; Wang, Jue; Yu, Lifeng; Zhao, Chang; Zhang, Lei
2017-09-21
In order to utilize the distributed characteristic of sensors, distributed machine learning has become the mainstream approach, but the different computing capability of sensors and network delays greatly influence the accuracy and the convergence rate of the machine learning model. Our paper describes a reasonable parameter communication optimization strategy to balance the training overhead and the communication overhead. We extend the fault tolerance of iterative-convergent machine learning algorithms and propose the Dynamic Finite Fault Tolerance (DFFT). Based on the DFFT, we implement a parameter communication optimization strategy for distributed machine learning, named Dynamic Synchronous Parallel Strategy (DSP), which uses the performance monitoring model to dynamically adjust the parameter synchronization strategy between worker nodes and the Parameter Server (PS). This strategy makes full use of the computing power of each sensor, ensures the accuracy of the machine learning model, and avoids the situation that the model training is disturbed by any tasks unrelated to the sensors.
Halim, Dunant; Cheng, Li; Su, Zhongqing
2011-04-01
The work proposed an optimization approach for structural sensor placement to improve the performance of vibro-acoustic virtual sensor for active noise control applications. The vibro-acoustic virtual sensor was designed to estimate the interior sound pressure of an acoustic-structural coupled enclosure using structural sensors. A spectral-spatial performance metric was proposed, which was used to quantify the averaged structural sensor output energy of a vibro-acoustic system excited by a spatially varying point source. It was shown that (i) the overall virtual sensing error energy was contributed additively by the modal virtual sensing error and the measurement noise energy; (ii) each of the modal virtual sensing error system was contributed by both the modal observability levels for the structural sensing and the target acoustic virtual sensing; and further (iii) the strength of each modal observability level was influenced by the modal coupling and resonance frequencies of the associated uncoupled structural/cavity modes. An optimal design of structural sensor placement was proposed to achieve sufficiently high modal observability levels for certain important panel- and cavity-controlled modes. Numerical analysis on a panel-cavity system demonstrated the importance of structural sensor placement on virtual sensing and active noise control performance, particularly for cavity-controlled modes.
Williams, Laura E; Wireman, Joy; Hilliard, Valda C; Summers, Anne O
2013-01-01
Plasmids are important in evolution and adaptation of host bacteria, yet we lack a comprehensive picture of their own natural variation. We used replicon typing and RFLP analysis to assess diversity and distribution of plasmids in the ECOR, SARA, SARB and SARC reference collections of Escherichia coli and Salmonella. Plasmids, especially large (≥30 kb) plasmids, are abundant in these collections. Host species and genotype clearly impact plasmid prevalence; plasmids are more abundant in ECOR than SAR, but, within ECOR, subgroup B2 strains have the fewest large plasmids. The majority of large plasmids have unique RFLP patterns, suggesting high variation, even within dominant replicon families IncF and IncI1. We found only four conserved plasmid types within ECOR, none of which are widely distributed. Within SAR, conserved plasmid types are primarily serovar-specific, including a pSLT-like plasmid in 13 Typhimurium strains. Conservation of pSLT contrasts with variability of other plasmids, suggesting evolution of serovar-specific virulence plasmids is distinct from that of most enterobacterial plasmids. We sequenced a conserved serovar Heidelberg plasmid but did not detect virulence or antibiotic resistance genes. Our data illustrate the high degree of natural variation in large plasmids of E. coli and Salmonella, even among plasmids sharing backbone genes. Copyright © 2012 Elsevier Inc. All rights reserved.
Exponential Modelling for Mutual-Cohering of Subband Radar Data
NASA Astrophysics Data System (ADS)
Siart, U.; Tejero, S.; Detlefsen, J.
2005-05-01
Increasing resolution and accuracy is an important issue in almost any type of radar sensor application. However, both resolution and accuracy are strongly related to the available signal bandwidth and energy that can be used. Nowadays, often several sensors operating in different frequency bands become available on a sensor platform. It is an attractive goal to use the potential of advanced signal modelling and optimization procedures by making proper use of information stemming from different frequency bands at the RF signal level. An important prerequisite for optimal use of signal energy is coherence between all contributing sensors. Coherent multi-sensor platforms are greatly expensive and are thus not available in general. This paper presents an approach for accurately estimating object radar responses using subband measurements at different RF frequencies. An exponential model approach allows to compensate for the lack of mutual coherence between independently operating sensors. Mutual coherence is recovered from the a-priori information that both sensors have common scattering centers in view. Minimizing the total squared deviation between measured data and a full-range exponential signal model leads to more accurate pole angles and pole magnitudes compared to single-band optimization. The model parameters (range and magnitude of point scatterers) after this full-range optimization process are also more accurate than the parameters obtained from a commonly used super-resolution procedure (root-MUSIC) applied to the non-coherent subband data.
Xiu, Yu; Jang, Sungho; Jones, J Andrew; Zill, Nicholas A; Linhardt, Robert J; Yuan, Qipeng; Jung, Gyoo Yeol; Koffas, Mattheos A G
2017-10-01
The ability to design and construct combinatorial synthetic metabolic pathways has far exceeded our capacity for efficient screening and selection of the resulting microbial strains. The need for high-throughput rapid screening techniques is of upmost importance for the future of synthetic biology and metabolic engineering. Here we describe the development of an RNA riboswitch-based biosensor module with dual fluorescent reporters, and demonstrate a high-throughput flow cytometry-based screening method for identification of naringenin over producing Escherichia coli strains in co-culture. Our efforts helped identify a number of key operating parameters that affect biosensor performance, including the selection of promoter and linker elements within the sensor-actuator domain, and the effect of host strain, fermentation time, and growth medium on sensor dynamic range. The resulting biosensor demonstrates a high correlation between specific fluorescence of the biosensor strain and naringenin titer produced by the second member of the synthetic co-culture system. This technique represents a novel application for synthetic microbial co-cultures and can be expanded from naringenin to any metabolite if a suitable riboswitch is identified. The co-culture technique presented here can be applied to a variety of target metabolites in combination with the SELEX approach for aptamer design. Due to the compartmentalization of the two genetic constructs responsible for production and detection into separate cells and application as independent modules of a synthetic microbial co-culture we have subsequently reduced the need for re-optimization of the producer module when the biosensor is replaced or removed. Biotechnol. Bioeng. 2017;114: 2235-2244. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Arakawa, Reiko; Arakawa, Masayuki; Kaneko, Kaori; Otsuki, Noriko; Aoki, Ryoko; Saito, Kayoko
2016-08-01
Spinal muscular atrophy is a neurodegenerative disorder caused by the deficient expression of survival motor neuron protein in motor neurons. A major goal of disease-modifying therapy is to increase survival motor neuron expression. Changes in survival motor neuron protein expression can be monitored via peripheral blood cells in patients; therefore we tested the sensitivity and utility of imaging flow cytometry for this purpose. After the immortalization of peripheral blood lymphocytes from a human healthy control subject and two patients with spinal muscular atrophy type 1 with two and three copies of SMN2 gene, respectively, we used imaging flow cytometry analysis to identify significant differences in survival motor neuron expression. A bright detail intensity analysis was used to investigate differences in the cellular localization of survival motor neuron protein. Survival motor neuron expression was significantly decreased in cells derived from patients with spinal muscular atrophy relative to those derived from a healthy control subject. Moreover, survival motor neuron expression correlated with the clinical severity of spinal muscular atrophy according to SMN2 copy number. The cellular accumulation of survival motor neuron protein was also significantly decreased in cells derived from patients with spinal muscular atrophy relative to those derived from a healthy control subject. The benefits of imaging flow cytometry for peripheral blood analysis include its capacities for analyzing heterogeneous cell populations; visualizing cell morphology; and evaluating the accumulation, localization, and expression of a target protein. Imaging flow cytometry analysis should be implemented in future studies to optimize its application as a tool for spinal muscular atrophy clinical trials. Copyright © 2016 Elsevier Inc. All rights reserved.
Single cell analysis using surface enhanced Raman scattering (SERS) tags
Nolan, John P.; Duggan, Erika; Liu, Er; Condello, Danilo; Dave, Isha; Stoner, Samuel A.
2013-01-01
Fluorescence is a mainstay of bioanalytical methods, offering sensitive and quantitative reporting, often in multiplexed or multiparameter assays. Perhaps the best example of the latter is flow cytometry, where instruments equipped with multiple lasers and detectors allow measurement of 15 or more different fluorophores simultaneously, but increases beyond this number are limited by the relatively broad emission spectra. Surface enhanced Raman scattering (SERS) from metal nanoparticles can produce signal intensities that rival fluorescence, but with narrower spectral features that allow a greater degree of multiplexing. We are developing nanoparticle SERS tags as well as Raman flow cytometers for multiparameter single cell analysis of suspension or adherent cells. SERS tags are based on plasmonically active nanoparticles (gold nanorods) whose plasmon resonance can be tuned to give optimal SERS signals at a desired excitation wavelength. Raman resonant compounds are adsorbed on the nanoparticles to confer a unique spectral fingerprint on each SERS tag, which are then encapsulated in a polymer coating for conjugation to antibodies or other targeting molecules. Raman flow cytometry employs a high resolution spectral flow cytometer capable of measuring the complete SERS spectra, as well as conventional flow cytometry measurements, from thousands of individual cells per minute. Automated spectral unmixing algorithms extract the contributions of each SERS tag from each cell to generate high content, multiparameter single cell population data. SERS-based cytometry is a powerful complement to conventional fluorescence-based cytometry. The narrow spectral features of the SERS signal enables more distinct probes to be measured in a smaller region of the optical spectrum with a single laser and detector, allowing for higher levels of multiplexing and multiparameter analysis. PMID:22498143
NASA Astrophysics Data System (ADS)
Wang, H.; Jing, X. J.
2017-02-01
This paper proposes a novel method for the fault diagnosis of complex structures based on an optimized virtual beam-like structure approach. A complex structure can be regarded as a combination of numerous virtual beam-like structures considering the vibration transmission path from vibration sources to each sensor. The structural 'virtual beam' consists of a sensor chain automatically obtained by an Improved Bacterial Optimization Algorithm (IBOA). The biologically inspired optimization method (i.e. IBOA) is proposed for solving the discrete optimization problem associated with the selection of the optimal virtual beam for fault diagnosis. This novel virtual beam-like-structure approach needs less or little prior knowledge. Neither does it require stationary response data, nor is it confined to a specific structure design. It is easy to implement within a sensor network attached to the monitored structure. The proposed fault diagnosis method has been tested on the detection of loosening screws located at varying positions in a real satellite-like model. Compared with empirical methods, the proposed virtual beam-like structure method has proved to be very effective and more reliable for fault localization.
Mohanasundaram, Ranganathan; Periasamy, Pappampalayam Sanmugam
2015-01-01
The current high profile debate with regard to data storage and its growth have become strategic task in the world of networking. It mainly depends on the sensor nodes called producers, base stations, and also the consumers (users and sensor nodes) to retrieve and use the data. The main concern dealt here is to find an optimal data storage position in wireless sensor networks. The works that have been carried out earlier did not utilize swarm intelligence based optimization approaches to find the optimal data storage positions. To achieve this goal, an efficient swam intelligence approach is used to choose suitable positions for a storage node. Thus, hybrid particle swarm optimization algorithm has been used to find the suitable positions for storage nodes while the total energy cost of data transmission is minimized. Clustering-based distributed data storage is utilized to solve clustering problem using fuzzy-C-means algorithm. This research work also considers the data rates and locations of multiple producers and consumers to find optimal data storage positions. The algorithm is implemented in a network simulator and the experimental results show that the proposed clustering and swarm intelligence based ODS strategy is more effective than the earlier approaches. PMID:25734182
NASA Astrophysics Data System (ADS)
Fu, Liyue; Song, Aiguo
2018-02-01
In order to improve the measurement precision of 6-axis force/torque sensor for robot, BP decoupling algorithm optimized by GA (GA-BP algorithm) is proposed in this paper. The weights and thresholds of a BP neural network with 6-10-6 topology are optimized by GA to develop decouple a six-axis force/torque sensor. By comparison with other traditional decoupling algorithm, calculating the pseudo-inverse matrix of calibration and classical BP algorithm, the decoupling results validate the good decoupling performance of GA-BP algorithm and the coupling errors are reduced.
Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard
1983-01-01
We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426
Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O
2011-07-01
Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M; Branger, Christine G; Tinge, Steven A; Curtiss, Roy
2010-06-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal DeltaasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain chi9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/P(cro)) (P(R)), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC P(BAD) c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of beta-lactamase, and cloned into pYA4534 under the control of the P(trc) promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain chi9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route.
Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Gunn, Bronwyn M.; Branger, Christine G.; Tinge, Steven A.; Curtiss, Roy
2010-01-01
A balanced-lethal plasmid expression system that switches from low-copy-number to runaway-like high-copy-number replication (pYA4534) was constructed for the regulated delayed in vivo synthesis of heterologous antigens by vaccine strains. This is an antibiotic resistance-free maintenance system containing the asdA gene (essential for peptidoglycan synthesis) as a selectable marker to complement the lethal chromosomal ΔasdA allele in live recombinant attenuated Salmonella vaccines (RASVs) such as Salmonella enterica serovar Typhimurium strain χ9447. pYA4534 harbors two origins of replication, pSC101 and pUC (low and high copy numbers, respectively). The pUC replication origin is controlled by a genetic switch formed by the operator/promoter of the P22 cro gene (O/Pcro) (PR), which is negatively regulated by an arabinose-inducible P22 c2 gene located on both the plasmid and the chromosome (araC PBAD c2). The absence of arabinose, which is unavailable in vivo, triggers replication to a high-copy-number plasmid state. To validate these vector attributes, the Yersinia pestis virulence antigen LcrV was used to develop a vaccine against plague. An lcrV sequence encoding amino acids 131 to 326 (LcrV196) was optimized for expression in Salmonella, flanked with nucleotide sequences encoding the signal peptide (SS) and the carboxy-terminal domain (CT) of β-lactamase, and cloned into pYA4534 under the control of the Ptrc promoter to generate plasmid pYA4535. Our results indicate that the live Salmonella vaccine strain χ9447 harboring pYA4535 efficiently stimulated a mixed Th1/Th2 immune response that protected mice against lethal challenge with Y. pestis strain CO92 introduced through either the intranasal or subcutaneous route. PMID:20308296
NASA Astrophysics Data System (ADS)
Han, Maeum; Keon Kim, Jae; Kong, Seong Ho; Kang, Shin-Won; Jung, Daewoong
2018-06-01
This paper reports a micro-electro-mechanical-system (MEMS)-based tilt sensor using air medium. Since the working mechanism of the sensor is the thermal convection in a sealed chamber, structural parameters that can affect thermal convection must be considered to optimize the performance of the sensor. This paper presents the experimental results that were conducted by optimizing several parameters such as the heater geometry, input power and cavity volume. We observed that an increase in the heating power and cavity volume can improve the sensitivity, and heater geometry plays important role in performance of the sensor.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yin Jiangmei; Dai Anlan; Laddy, Dominick J.
2009-10-10
Interleukin (IL)-15, is a cytokine that is important for the maintenance of long-lasting, high-avidity T cell response to invading pathogens and has, therefore, been used in vaccine and therapeutic platforms as an adjuvant. In addition to pure protein delivery, plasmids encoding the IL-15 gene have been utilized. However, it is critical to determine the appropriate dose to maximize the adjuvanting effects. We immunized rhesus macaques with different doses of IL-15 expressing plasmid in an influenza non-human primate immunogenicity model. We found that co-immunization of rhesus macaques with a Flu DNA-based vaccine and low doses of plasmid encoding macaque IL-15 enhancedmore » the production of IFN-gamma (0.5 mg) and the proliferation of CD4{sup +} and CD8{sup +} T cells, as well as T{sub CM} levels in proliferating CD8{sup +} T cells (0.25 mg). Whereas, high doses of IL-15 (4 mg) decrease the production of IFN-gamma and the proliferation of CD4{sup +} and CD8{sup +} T cells and T{sub CM} levels in the proliferating CD4{sup +} and CD8{sup +} T cells. In addition, the data of hemagglutination inhibition (HI) antibody titer suggest that although not significantly different, there appears to be a slight increase in antibodies at lower doses of IL-15. Importantly, however, the higher doses of IL-15 decrease the antibody levels significantly. This study demonstrates the importance of optimizing DNA-based cytokine adjuvants.« less
Hormonal induction of transfected genes depends on DNA topology.
Piña, B; Haché, R J; Arnemann, J; Chalepakis, G; Slater, E P; Beato, M
1990-01-01
Plasmids containing the hormone regulatory element of mouse mammary tumor virus linked to the thymidine kinase promoter of herpes simplex virus and the reporter gene chloramphenicol acetyltransferase of Escherichia coli respond to glucocorticoids and progestins when transfected into appropriate cells. In the human mammary tumor cell line T47D, the response to progestins, but not to glucocorticoids, is highly dependent on the topology of the transfected DNA. Although negatively supercoiled plasmids respond optimally to the synthetic progestin R5020, their linearized counterparts exhibit markedly reduced progestin inducibility. This is not due to changes in the efficiency of DNA transfection, since the amount of DNA incorporated into the cell nucleus is not significantly dependent on the initial topology of the plasmids. In contrast, cotransfection experiments with glucocorticoid receptor cDNA in the same cell line show no significant influence of DNA topology on induction by dexamethasone. A similar result was obtained with fibroblasts that contain endogenous glucocorticoid receptors. When the distance between receptor-binding sites or between the binding sites and the promoter was increased, the dependence of progestin induction on DNA topology was more pronounced. In contrast to the original plasmid, these constructs also revealed a similar topological dependence for induction by glucocorticoids. The differential influence of DNA topology is not due to differences in the affinity of the two hormone receptors for DNA of various topologies, but probably reflects an influence of DNA topology on the interaction between different DNA-bound receptor molecules and between receptors and other transcription factors. Images PMID:2153920
Optimal sensor placement for leak location in water distribution networks using genetic algorithms.
Casillas, Myrna V; Puig, Vicenç; Garza-Castañón, Luis E; Rosich, Albert
2013-11-04
This paper proposes a new sensor placement approach for leak location in water distribution networks (WDNs). The sensor placement problem is formulated as an integer optimization problem. The optimization criterion consists in minimizing the number of non-isolable leaks according to the isolability criteria introduced. Because of the large size and non-linear integer nature of the resulting optimization problem, genetic algorithms (GAs) are used as the solution approach. The obtained results are compared with a semi-exhaustive search method with higher computational effort, proving that GA allows one to find near-optimal solutions with less computational load. Moreover, three ways of increasing the robustness of the GA-based sensor placement method have been proposed using a time horizon analysis, a distance-based scoring and considering different leaks sizes. A great advantage of the proposed methodology is that it does not depend on the isolation method chosen by the user, as long as it is based on leak sensitivity analysis. Experiments in two networks allow us to evaluate the performance of the proposed approach.
Optimal Sensor Placement for Leak Location in Water Distribution Networks Using Genetic Algorithms
Casillas, Myrna V.; Puig, Vicenç; Garza-Castañón, Luis E.; Rosich, Albert
2013-01-01
This paper proposes a new sensor placement approach for leak location in water distribution networks (WDNs). The sensor placement problem is formulated as an integer optimization problem. The optimization criterion consists in minimizing the number of non-isolable leaks according to the isolability criteria introduced. Because of the large size and non-linear integer nature of the resulting optimization problem, genetic algorithms (GAs) are used as the solution approach. The obtained results are compared with a semi-exhaustive search method with higher computational effort, proving that GA allows one to find near-optimal solutions with less computational load. Moreover, three ways of increasing the robustness of the GA-based sensor placement method have been proposed using a time horizon analysis, a distance-based scoring and considering different leaks sizes. A great advantage of the proposed methodology is that it does not depend on the isolation method chosen by the user, as long as it is based on leak sensitivity analysis. Experiments in two networks allow us to evaluate the performance of the proposed approach. PMID:24193099
Multi-Sensor Optimal Data Fusion Based on the Adaptive Fading Unscented Kalman Filter
Gao, Bingbing; Hu, Gaoge; Gao, Shesheng; Gu, Chengfan
2018-01-01
This paper presents a new optimal data fusion methodology based on the adaptive fading unscented Kalman filter for multi-sensor nonlinear stochastic systems. This methodology has a two-level fusion structure: at the bottom level, an adaptive fading unscented Kalman filter based on the Mahalanobis distance is developed and serves as local filters to improve the adaptability and robustness of local state estimations against process-modeling error; at the top level, an unscented transformation-based multi-sensor optimal data fusion for the case of N local filters is established according to the principle of linear minimum variance to calculate globally optimal state estimation by fusion of local estimations. The proposed methodology effectively refrains from the influence of process-modeling error on the fusion solution, leading to improved adaptability and robustness of data fusion for multi-sensor nonlinear stochastic systems. It also achieves globally optimal fusion results based on the principle of linear minimum variance. Simulation and experimental results demonstrate the efficacy of the proposed methodology for INS/GNSS/CNS (inertial navigation system/global navigation satellite system/celestial navigation system) integrated navigation. PMID:29415509
Multi-Sensor Optimal Data Fusion Based on the Adaptive Fading Unscented Kalman Filter.
Gao, Bingbing; Hu, Gaoge; Gao, Shesheng; Zhong, Yongmin; Gu, Chengfan
2018-02-06
This paper presents a new optimal data fusion methodology based on the adaptive fading unscented Kalman filter for multi-sensor nonlinear stochastic systems. This methodology has a two-level fusion structure: at the bottom level, an adaptive fading unscented Kalman filter based on the Mahalanobis distance is developed and serves as local filters to improve the adaptability and robustness of local state estimations against process-modeling error; at the top level, an unscented transformation-based multi-sensor optimal data fusion for the case of N local filters is established according to the principle of linear minimum variance to calculate globally optimal state estimation by fusion of local estimations. The proposed methodology effectively refrains from the influence of process-modeling error on the fusion solution, leading to improved adaptability and robustness of data fusion for multi-sensor nonlinear stochastic systems. It also achieves globally optimal fusion results based on the principle of linear minimum variance. Simulation and experimental results demonstrate the efficacy of the proposed methodology for INS/GNSS/CNS (inertial navigation system/global navigation satellite system/celestial navigation system) integrated navigation.
Wang, Yunpeng; Xu, Wentao; Kou, Xiaohong; Luo, Yunbo; Zhang, Yanan; Ma, Biao; Wang, Mengsha; Huang, Kunlun
2012-08-01
Wheat germ cell-free protein synthesis systems have the potential to synthesize functional proteins safely and with high accuracy, but the poor energy supply and the instability of mRNA templates reduce the productivity of this system, which restricts its applications. In this report, phosphocreatine and pyruvate were added to the system to supply ATP as a secondary energy source. After comparing the protein yield, we found that phosphocreatine is more suitable for use in the wheat germ cell-free protein synthesis system. To stabilize the mRNA template, the plasmid vector, SP6 RNA polymerase, and Cu(2+) were optimized, and a wheat germ cell-free protein synthesis system with high yield and speed was established. When plasmid vector (30 ng/μl), SP6 RNA polymerase (15 U), phosphocreatine (25 mM), and Cu(2+) (5 mM) were added to the system and incubated at 26°C for 16 h, the yield of venom kallikrein increased from 0.13 to 0.74 mg/ml. The specific activity of the recombinant protein was 1.3 U/mg, which is only slightly lower than the crude venom kallikrein (1.74 U/mg) due to the lack of the sugar chain. In this study, the yield of venom kallikrein was improved by optimizing the system, and a good foundation has been laid for industrial applications and for further studies. Copyright © 2012 Elsevier Inc. All rights reserved.
Optimization of hCFTR Lung Expression in Mice Using DNA Nanoparticles
Padegimas, Linas; Kowalczyk, Tomasz H; Adams, Sam; Gedeon, Chris R; Oette, Sharon M; Dines, Karla; Hyatt, Susannah L; Sesenoglu-Laird, Ozge; Tyr, Olena; Moen, Robert C; Cooper, Mark J
2012-01-01
Efficient and prolonged human cystic fibrosis transmembrane conductance regulator (hCFTR) expression is a major goal for cystic fibrosis (CF) lung therapy. A hCFTR expression plasmid was optimized as a payload for compacted DNA nanoparticles formulated with polyethylene glycol (PEG)-substituted 30-mer lysine peptides. A codon-optimized and CpG-reduced hCFTR synthetic gene (CO-CFTR) was placed in a polyubiquitin C expression plasmid. Compared to hCFTR complementary DNA (cDNA), CO-CFTR produced a ninefold increased level of hCFTR protein in transfected HEK293 cells and, when compacted as DNA nanoparticles, produced a similar improvement in lung mRNA expression in Balb/c and fatty acid binding protein promoter (FABP) CF mice, although expression duration was transient. Various vector modifications were tested to extend duration of CO-CFTR expression. A novel prolonged expression (PE) element derived from the bovine growth hormone (BGH) gene 3′ flanking sequence produced prolonged expression of CO-CFTR mRNA at biologically relevant levels. A time course study in the mouse lung revealed that CO-CFTR mRNA did not change significantly, with CO-CFTR/mCFTR geometric mean ratios of 94% on day 2, 71% on day 14, 53% on day 30, and 14% on day 59. Prolonged CO-CFTR expression is dependent on the orientation of the PE element and its transcription, is not specific to the UbC promoter, and is less dependent on other vector backbone elements. PMID:21952168
Influence of model errors in optimal sensor placement
NASA Astrophysics Data System (ADS)
Vincenzi, Loris; Simonini, Laura
2017-02-01
The paper investigates the role of model errors and parametric uncertainties in optimal or near optimal sensor placements for structural health monitoring (SHM) and modal testing. The near optimal set of measurement locations is obtained by the Information Entropy theory; the results of placement process considerably depend on the so-called covariance matrix of prediction error as well as on the definition of the correlation function. A constant and an exponential correlation function depending on the distance between sensors are firstly assumed; then a proposal depending on both distance and modal vectors is presented. With reference to a simple case-study, the effect of model uncertainties on results is described and the reliability and the robustness of the proposed correlation function in the case of model errors are tested with reference to 2D and 3D benchmark case studies. A measure of the quality of the obtained sensor configuration is considered through the use of independent assessment criteria. In conclusion, the results obtained by applying the proposed procedure on a real 5-spans steel footbridge are described. The proposed method also allows to better estimate higher modes when the number of sensors is greater than the number of modes of interest. In addition, the results show a smaller variation in the sensor position when uncertainties occur.
Antibiotic resistance of vibrio cholerae: special considerations of R-plasmids.
Kuwahara, S
1978-09-01
Studies on the transmission of R plasmid by conjugation between enterobacteria and vibrio or related bacteria were reviewed. The majority of the reports confirmed successful transmission from enterobacteria to Vibrio cholerae and related species, although the transmission frequencies were extremely low and the transmitted R plasmid was very unstable except for thermosensitive kanamycin plasmid and usual R plasmid coexisting with P plasmid. Strains of V. cholerae and Aeromonas liquefaciens as well as A. salmonicida bearing R plasmid were detected in nature. R plasmid was relatively unstable in V. cholerae strains with which transmission of R plasmid to enterobacteria was confirmed. At present, only 3 R plasmids have been obtained from naturally occurring strains of V. cholerae. Although the 2 European plasmids belong to the C incompatibility group with 98 megadalton closed covalent circular DNA molecule, one plasmid belongs to the J group with more than 25 megadalton molecular weight, and no CCC of satelite DNA was detected in bacteria harboring this plasmid.
Effect of SOCS1 overexpression on RPE cell activation by proinflammatory cytokines.
Bazewicz, Magdalena; Draganova, Dafina; Makhoul, Maya; Chtarto, Abdel; Elmaleh, Valerie; Tenenbaum, Liliane; Caspers, Laure; Bruyns, Catherine; Willermain, François
2016-09-06
The purpose of this study was to investigate the in vitro effect of Suppressor Of Cytokine Signaling 1 (SOCS1) overexpression in retinal pigment epithelium (RPE) cells on their activation by pro-inflammatory cytokines IFNγ, TNFα and IL-17. Retinal pigment epithelium cells (ARPE-19) were stably transfected with the control plasmid pIRES2-AcGFP1 or the plasmid pSOCS1-IRES2-AcGFP1. They were stimulated by IFNγ (150ng/ml), TNFα (30ng/ml) or IL-17 (100ng/ml). The levels of SOCS1 mRNA were measured by real-time PCR. Signal Transducer and Activator of Transcription 1 (STAT1) phosphorylation and IκBα expression were analysed by western Blot (WB). IL-8 secretion was analysed by ELISA and expression of MHCII molecules and ICAM-1/CD54 by flow cytometry. Our data show that SOCS1 mRNA overexpression in RPE cells prevents IFNγ-induced SOCS1 mRNA increase and IFNγ-mediated STAT1 phosphorylation. Moreover, SOCS1 overexpression in RPE cells inhibits IFNγ-induced decrease of IL-8 secretion and prevents IFNγ-induced MHC II and ICAM1/CD54 upregulation. However, SOCS1 overexpression does not affect TNFα-induced IκBα degradation nor block TNFα-induced or IL-17-induced IL-8 secretion. On the contrary, IL-17-induced secretion is increased by SOCS1 overexpression. In conclusion, SOCS1 overexpression in RPE cells inhibits some IFNγ-mediated responses that lead to uveitis development. This notion raises the possibility that SOCS1 overexpression could be a novel target for treating non-infectious uveitis. However, some proinflammatory effects of TNFα and IL-17 stimulation on RPE are not blocked by SOCS1 overexpression. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.
Radiosensitivity in HeLa cervical cancer cells overexpressing glutathione S-transferase π 1
YANG, LIANG; LIU, REN; MA, HONG-BIN; YING, MING-ZHEN; WANG, YA-JIE
2015-01-01
The aims of the present study were to investigate the effect of overexpressed exogenous glutathione S-transferase π 1 (GSTP1) gene on the radiosensitivity of the HeLa human cervical cancer cell line and conduct a preliminarily investigation into the underlying mechanisms of the effect. The full-length sequence of human GSTP1 was obtained by performing a polymerase chain reaction (PCR) using primers based on the GenBank sequence of GSTP1. Subsequently, the gene was cloned into a recombinant eukaryotic expression plasmid, and the resulting construct was confirmed by restriction analysis and DNA sequencing. A HeLa cell line that was stably expressing high levels of GSTP1 was obtained through stable transfection of the constructed plasmids using lipofectamine and screening for G418 resistance, as demonstrated by reverse transcription-PCR. Using the transfected HeLa cells, a colony formation assay was conducted to detect the influence of GSTP1 overexpression on the cell radiosensitivity. Furthermore, flow cytometry was used to investigate the effect of GSTP1 overexpression on cell cycle progression, with the protein expression levels of the cell cycle regulating factor cyclin B1 detected using western blot analysis. Colony formation and G2/M phase arrest in the GSTP1-expressing cells were significantly increased compared with the control group (P<0.01). In addition, the expression of cyclin B1 was significantly reduced in the GSTP1-expressing cells. These results demonstrated that increased expression of GSTP1 inhibits radiosensitivity in HeLa cells. The mechanism underlying this effect may be associated with the ability of the GSTP1 protein to reduce cyclin B1 expression, resulting in significant G2/M phase arrest. PMID:26622693
Radiosensitivity in HeLa cervical cancer cells overexpressing glutathione S-transferase π 1.
Yang, Liang; Liu, Ren; Ma, Hong-Bin; Ying, Ming-Zhen; Wang, Ya-Jie
2015-09-01
The aims of the present study were to investigate the effect of overexpressed exogenous glutathione S-transferase π 1 ( GSTP1 ) gene on the radiosensitivity of the HeLa human cervical cancer cell line and conduct a preliminarily investigation into the underlying mechanisms of the effect. The full-length sequence of human GSTP1 was obtained by performing a polymerase chain reaction (PCR) using primers based on the GenBank sequence of GSTP1. Subsequently, the gene was cloned into a recombinant eukaryotic expression plasmid, and the resulting construct was confirmed by restriction analysis and DNA sequencing. A HeLa cell line that was stably expressing high levels of GSTP1 was obtained through stable transfection of the constructed plasmids using lipofectamine and screening for G418 resistance, as demonstrated by reverse transcription-PCR. Using the transfected HeLa cells, a colony formation assay was conducted to detect the influence of GSTP1 overexpression on the cell radiosensitivity. Furthermore, flow cytometry was used to investigate the effect of GSTP1 overexpression on cell cycle progression, with the protein expression levels of the cell cycle regulating factor cyclin B1 detected using western blot analysis. Colony formation and G 2 /M phase arrest in the GSTP1 -expressing cells were significantly increased compared with the control group (P<0.01). In addition, the expression of cyclin B1 was significantly reduced in the GSTP1 -expressing cells. These results demonstrated that increased expression of GSTP1 inhibits radiosensitivity in HeLa cells. The mechanism underlying this effect may be associated with the ability of the GSTP1 protein to reduce cyclin B1 expression, resulting in significant G 2 /M phase arrest.
Schuh, Roselena Silvestri; de Carvalho, Talita Giacomet; Giugliani, Roberto; Matte, Ursula; Baldo, Guilherme; Teixeira, Helder Ferreira
2018-01-01
Mucopolysaccharidosis type I (MPS I) is an inherited disease caused by the deficiency of alpha-L-iduronidase (IDUA). This study shows the use of nanoemulsions co-complexed with the plasmid of CRISPR/Cas9 system and a donor oligonucleotide aiming at MPS I gene editing in vitro. Nanoemulsions composed of MCT, DOPE, DOTAP, DSPE-PEG, and water were prepared by high-pressure homogenization. The DNA was complexed by adsorption (NA) or encapsulation (NE) of preformed DNA/DOTAP complexes with nanoemulsions at +4/-1 charge ratio. The incubation in pure DMEM or supplemented with serum showed that the complexation with DNA was stable after 1 h of incubation, but the complexes tended to release the adsorbed DNA after 24 h of incubation, while the encapsulated DNA remained complexed in the oil core of the nanoemulsions even 48 h after incubation with DMEM. The treatment of MPS I patient's fibroblasts homozygous for the p.Trp402 ∗ mutation led to a significant increase in IDUA activity at 2, 15, and 30 days when compared to MPS I untreated fibroblasts. Flow cytometry and confocal microscopy demonstrated that there was a reduction in the area of lysosomes to values similar to normal, an indicator of correction of the cellular phenotype. These results show that the nanoemulsions co-complexed with the CRISPR/Cas9 system and a donor oligonucleotide could effectively transfect MPS I p.Trp402 ∗ patient's fibroblasts, as well as enable the production of IDUA, and represent a potential new treatment option for MPS I. Copyright © 2017 Elsevier B.V. All rights reserved.
Su, Jing; You, Jiang-feng; Wang, Jie-liang; Cui, Xiang-lin; Fang, Wei-gang; Zheng, Jie
2007-10-01
To investigate the effects of tumor metastasis suppressor gene 1 (TMSG-1) overexpression on the proliferation, invasion and apoptosis of breast cancer cells and to determine possible correlations of TMSG-1 and metastasis of breast cancer. Full-length human TMSG-1 coding sequences were cloned into plasmid pcDNA3.0-FLAG. The recombinant plasmids constructs were transfeced into MDA-MB-231, a highly malignant breast cancer cell line. Parental, vector-only stable transfectant and TMSG-1 stable transfectant clones were tested by MTT, soft agar colony formation and Boyden chamber assays. At twenty-four hours and forty-eight hours post transient transfection, double staining with Annexin-V-FITC and PI were employed to distinguish apoptotic cells from living cells by flow cytometry analysis. Three TMSG-1 overexpression clones were selected. Compared with the control cells, TMSG-1 overexpression MDA-MB-231 cells showed strong inhibition of proliferation and decreased clonogenicity in soft agar (P<0.05). Transfection of TMSG-1 into MDA-MB-231 cells significantly suppressed the cell invasion ability in vitro (decreased numbers of cells trespassing the matrigel in three experiments: 72.3+/-8.1, 85.0+/-4.2, and 73.5+/-7.8) in comparison with nave cells without transfection (187.5+/-2.1) and cells transfected with the control vector (162.3+/-6.8) (P<0.01). Transient transfection of TMSG-1 into MDA-MB-231 cells could promote cell apoptosis at 24 and 48 hours after transfection (P<0.05). TMSG-1 protein may have multiple functions in the regulation of proliferation, invasion and apoptosis of metastatic breast cancer cells, likely as a metastasis suppressor gene.
Horn, Nikki; Wegmann, Udo; Dertli, Enes; Mulholland, Francis; Collins, Samuel R A; Waldron, Keith W; Bongaerts, Roy J; Mayer, Melinda J; Narbad, Arjan
2013-01-01
As a competitive exclusion agent, Lactobacillus johnsonii FI9785 has been shown to prevent the colonization of selected pathogenic bacteria from the chicken gastrointestinal tract. During growth of the bacterium a rare but consistent emergence of an altered phenotype was noted, generating smooth colonies in contrast to the wild type rough form. A smooth colony variant was isolated and two-dimensional gel analysis of both strains revealed a protein spot with different migration properties in the two phenotypes. The spot in both gels was identified as a putative tyrosine kinase (EpsC), associated with a predicted exopolysaccharide gene cluster. Sequencing of the epsC gene from the smooth mutant revealed a single substitution (G to A) in the coding strand, resulting in the amino acid change D88N in the corresponding gene product. A native plasmid of L. johnsonii was engineered to produce a novel vector for constitutive expression and this was used to demonstrate that expression of the wild type epsC gene in the smooth mutant produced a reversion to the rough colony phenotype. Both the mutant and epsC complemented strains had increased levels of exopolysaccharides compared to the wild type strain, indicating that the rough phenotype is not solely associated with the quantity of exopolysaccharide. Another gene in the cluster, epsE, that encoded a putative undecaprenyl-phosphate galactosephosphotransferase, was deleted in order to investigate its role in exopolysaccharide biosynthesis. The ΔepsE strain exhibited a large increase in cell aggregation and a reduction in exopolysaccharide content, while plasmid complementation of epsE restored the wild type phenotype. Flow cytometry showed that the wild type and derivative strains exhibited clear differences in their adhesive ability to HT29 monolayers in tissue culture, demonstrating an impact of EPS on surface properties and bacteria-host interactions.
Paz, Ana H; Salton, Gabrielle Dias; Ayala-Lugo, Ana; Gomes, Cristiano; Terraciano, Paula; Scalco, Rosana; Laurino, Claudia Cilene Fernandes Correia; Passos, Eduardo Pandolfi; Schneider, Marlon R; Meurer, Luise; Cirne-Lima, Elizabeth
2011-02-01
Betacellulin (BTC), a ligand of the epidermal growth factor receptor, has been shown to promote growth and differentiation of pancreatic β-cells and to improve glucose metabolism in experimental diabetic rodent models. Mesenchymal stem cells (MSCs) have been already proved to be multipotent. Recent work has attributed to rat and human MSCs the potential to differentiate into insulin-secreting cells. Our goal was to transfect rat MSCs with a plasmid containing BTC cDNA to guide MSC differentiation into insulin-producing cells. Prior to induction of cell MSC transfection, MSCs were characterized by flow cytometry and the ability to in vitro differentiate into mesoderm cell types was evaluated. After rat MSC characterization, these cells were electroporated with a plasmid containing BTC cDNA. Transfected cells were cultivated in Dulbecco's modified Eagle medium high glucose (H-DMEM) with 10 mM nicotinamide. Then, the capability of MSC-BTC to produce insulin in vitro and in vivo was evaluated. It was possible to demonstrate by radioimmunoassay analysis that 10(4) MSC-BTC cells produced up to 0.4 ng/mL of insulin, whereas MSCs transfected with the empty vector (negative control) produced no detectable insulin levels. Moreover, MSC-BTC were positive for insulin in immunohistochemistry assay. In parallel, the expression of pancreatic marker genes was demonstrated by molecular analysis of MSC-BTC. Further, when MSC-BTC were transplanted to streptozotocin diabetic rats, BTC-transfected cells ameliorated hyperglycemia from over 500 to about 200 mg/dL at 35 days post-cell transplantation. In this way, our results clearly demonstrate that BTC overabundance enhances glucose-induced insulin secretion in MSCs in vitro as well as in vivo.
Distribution of small native plasmids in Streptococcus pyogenes in India.
Bergmann, René; Nerlich, Andreas; Chhatwal, Gursharan S; Nitsche-Schmitz, D Patric
2014-05-01
Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (<5kb) in a collection of 279 S. pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emm-type 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India. Copyright © 2013 Elsevier GmbH. All rights reserved.
Optimization of Self-Directed Target Coverage in Wireless Multimedia Sensor Network
Yang, Yang; Wang, Yufei; Pi, Dechang; Wang, Ruchuan
2014-01-01
Video and image sensors in wireless multimedia sensor networks (WMSNs) have directed view and limited sensing angle. So the methods to solve target coverage problem for traditional sensor networks, which use circle sensing model, are not suitable for WMSNs. Based on the FoV (field of view) sensing model and FoV disk model proposed, how expected multimedia sensor covers the target is defined by the deflection angle between target and the sensor's current orientation and the distance between target and the sensor. Then target coverage optimization algorithms based on expected coverage value are presented for single-sensor single-target, multisensor single-target, and single-sensor multitargets problems distinguishingly. Selecting the orientation that sensor rotated to cover every target falling in the FoV disk of that sensor for candidate orientations and using genetic algorithm to multisensor multitargets problem, which has NP-complete complexity, then result in the approximated minimum subset of sensors which covers all the targets in networks. Simulation results show the algorithm's performance and the effect of number of targets on the resulting subset. PMID:25136667
Hinson, Brian T; Morgansen, Kristi A
2015-10-06
The wings of the hawkmoth Manduca sexta are lined with mechanoreceptors called campaniform sensilla that encode wing deformations. During flight, the wings deform in response to a variety of stimuli, including inertial-elastic loads due to the wing flapping motion, aerodynamic loads, and exogenous inertial loads transmitted by disturbances. Because the wings are actuated, flexible structures, the strain-sensitive campaniform sensilla are capable of detecting inertial rotations and accelerations, allowing the wings to serve not only as a primary actuator, but also as a gyroscopic sensor for flight control. We study the gyroscopic sensing of the hawkmoth wings from a control theoretic perspective. Through the development of a low-order model of flexible wing flapping dynamics, and the use of nonlinear observability analysis, we show that the rotational acceleration inherent in wing flapping enables the wings to serve as gyroscopic sensors. We compute a measure of sensor fitness as a function of sensor location and directional sensitivity by using the simulation-based empirical observability Gramian. Our results indicate that gyroscopic information is encoded primarily through shear strain due to wing twisting, where inertial rotations cause detectable changes in pronation and supination timing and magnitude. We solve an observability-based optimal sensor placement problem to find the optimal configuration of strain sensor locations and directional sensitivities for detecting inertial rotations. The optimal sensor configuration shows parallels to the campaniform sensilla found on hawkmoth wings, with clusters of sensors near the wing root and wing tip. The optimal spatial distribution of strain directional sensitivity provides a hypothesis for how heterogeneity of campaniform sensilla may be distributed.
Optimizing Retransmission Threshold in Wireless Sensor Networks
Bi, Ran; Li, Yingshu; Tan, Guozhen; Sun, Liang
2016-01-01
The retransmission threshold in wireless sensor networks is critical to the latency of data delivery in the networks. However, existing works on data transmission in sensor networks did not consider the optimization of the retransmission threshold, and they simply set the same retransmission threshold for all sensor nodes in advance. The method did not take link quality and delay requirement into account, which decreases the probability of a packet passing its delivery path within a given deadline. This paper investigates the problem of finding optimal retransmission thresholds for relay nodes along a delivery path in a sensor network. The object of optimizing retransmission thresholds is to maximize the summation of the probability of the packet being successfully delivered to the next relay node or destination node in time. A dynamic programming-based distributed algorithm for finding optimal retransmission thresholds for relay nodes along a delivery path in the sensor network is proposed. The time complexity is OnΔ·max1≤i≤n{ui}, where ui is the given upper bound of the retransmission threshold of sensor node i in a given delivery path, n is the length of the delivery path and Δ is the given upper bound of the transmission delay of the delivery path. If Δ is greater than the polynomial, to reduce the time complexity, a linear programming-based (1+pmin)-approximation algorithm is proposed. Furthermore, when the ranges of the upper and lower bounds of retransmission thresholds are big enough, a Lagrange multiplier-based distributed O(1)-approximation algorithm with time complexity O(1) is proposed. Experimental results show that the proposed algorithms have better performance. PMID:27171092
NASA Astrophysics Data System (ADS)
Tran, T.
With the onset of the SmallSat era, the RSO catalog is expected to see continuing growth in the near future. This presents a significant challenge to the current sensor tasking of the SSN. The Air Force is in need of a sensor tasking system that is robust, efficient, scalable, and able to respond in real-time to interruptive events that can change the tracking requirements of the RSOs. Furthermore, the system must be capable of using processed data from heterogeneous sensors to improve tasking efficiency. The SSN sensor tasking can be regarded as an economic problem of supply and demand: the amount of tracking data needed by each RSO represents the demand side while the SSN sensor tasking represents the supply side. As the number of RSOs to be tracked grows, demand exceeds supply. The decision-maker is faced with the problem of how to allocate resources in the most efficient manner. Braxton recently developed a framework called Multi-Objective Resource Optimization using Genetic Algorithm (MOROUGA) as one of its modern COTS software products. This optimization framework took advantage of the maturing technology of evolutionary computation in the last 15 years. This framework was applied successfully to address the resource allocation of an AFSCN-like problem. In any resource allocation problem, there are five key elements: (1) the resource pool, (2) the tasks using the resources, (3) a set of constraints on the tasks and the resources, (4) the objective functions to be optimized, and (5) the demand levied on the resources. In this paper we explain in detail how the design features of this optimization framework are directly applicable to address the SSN sensor tasking domain. We also discuss our validation effort as well as present the result of the AFSCN resource allocation domain using a prototype based on this optimization framework.
Characterization of Vibrio fluvialis-Like Strains Implicated in Limp Lobster Disease
Tall, B. D.; Fall, S.; Pereira, M. R.; Ramos-Valle, M.; Curtis, S. K.; Kothary, M. H.; Chu, D. M. T.; Monday, S. R.; Kornegay, L.; Donkar, T.; Prince, D.; Thunberg, R. L.; Shangraw, K. A.; Hanes, D. E.; Khambaty, F. M.; Lampel, K. A.; Bier, J. W.; Bayer, R. C.
2003-01-01
Studies were undertaken to characterize and determine the pathogenic mechanisms involved in a newly described systemic disease in Homarus americanus (American lobster) caused by a Vibrio fluvialis-like microorganism. Nineteen isolates were obtained from eight of nine lobsters sampled. Biochemically, the isolates resembled V. fluvialis, and the isolates grew optimally at 20°C; none could grow at temperatures above 23°C. The type strain (1AMA) displayed a thermal reduction time (D value) of 5.77 min at 37°C. All of the isolates required at least 1% NaCl for growth. Collectively, the data suggest that these isolates may embody a new biotype. Pulsed-field gel electrophoresis (PFGE) analysis of the isolates revealed five closely related subgroups. Some isolates produced a sheep hemagglutinin that was neither an outer membrane protein nor a metalloprotease. Several isolates possessed capsules. The isolates were highly susceptible to a variety of antibiotics tested. However, six isolates were resistant to erythromycin. Seventeen isolates harbored plasmids. Lobster challenge studies revealed that the 50% lethal dose of a plasmid-positive strain was 100-fold lower than that of a plasmid-negative strain, suggesting that the plasmid may enhance the pathogenicity of these microorganisms in lobsters. Microorganisms that were recovered from experimentally infected lobsters exhibited biochemical and PFGE profiles that were indistinguishable from those of the challenge strain. Tissue affinity studies demonstrated that the challenge microorganisms accumulated in heart and midgut tissues as well as in the hemolymph. Culture supernatants and polymyxin B lysates of the strains caused elongation of CHO cells in tissue culture, suggesting the presence of a hitherto unknown enterotoxin. Both plasmid-positive and plasmid-negative strains caused significant dose-related intestinal fluid accumulations in suckling mice. Absence of viable organisms in the intestinal contents of mice suggests that these microorganisms cause diarrhea in mice by intoxication rather than by an infectious process. Further, these results support the thermal reduction data at 37°C and suggest that the mechanism(s) that led to fluid accumulation in mice differs from the disease process observed in lobsters by requiring neither the persistence of viable microorganisms nor the presence of plasmids. In summary, results of lobster studies satisfy Koch's postulates at the organismal and molecular levels; the findings support the hypothesis that these V. fluvialis-like organisms were responsible for the originally described systemic disease, which is now called limp lobster disease. PMID:14660396
Agrobacterium-mediated transient MaFT expression in mulberry (Morus alba L.) leaves.
Wu, Su-Li; Yang, Xiao-Bing; Liu, Li-Qun; Jiang, Tao; Wu, Hai; Su, Chao; Qian, Yong-Hua; Jiao, Feng
2015-01-01
To optimize Agrobacterium-mediated transient transformation assay in mulberry (Morus alba L.), various infiltration methods, Agrobacterium tumefaciens (A. tumefaciens) strains, and bacterial concentrations were tested in mulberry seedlings. Compared with LBA4404, GV3101 harboring pBE2133 plasmids presented stronger GUS signals at 3 days post infiltration using syringe. Recombinant plasmids pBE2133:GFP and pBE2133:GFP:MaFT were successfully constructed. Transient expression of MaFT:GFP protein was found in leaves, petiole (cross section), and shoot apical meristem (SAM) of mulberry according to the GFP signal. Moreover, MaFT:GFP mRNA was also detected in leaves and SAM via RT-PCR and qRT-PCR. An efficient transient transformation system could be achieved in mulberry seedlings by syringe using A. tumefaciens GV3101 at the OD600 of 0.5. The movement of MaFT expression from leaves to SAM might trigger the precocious flowering of mulberry.
[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].
Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing
2012-08-01
Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.
NASA Astrophysics Data System (ADS)
Li, Chuang; Cordovilla, Francisco; Ocaña, José L.
2018-01-01
This paper presents a novel structural piezoresistive pressure sensor with a four-beams-bossed-membrane (FBBM) structure that consisted of four short beams and a central mass to measure micro-pressure. The proposed structure can alleviate the contradiction between sensitivity and linearity to realize the micro measurement with high accuracy. In this study, the design, fabrication and test of the sensor are involved. By utilizing the finite element analysis (FEA) to analyze the stress distribution of sensitive elements and subsequently deducing the relationships between structural dimensions and mechanical performance, the optimization process makes the sensor achieve a higher sensitivity and a lower pressure nonlinearity. Based on the deduced equations, a series of optimized FBBM structure dimensions are ultimately determined. The designed sensor is fabricated on a silicon wafer by using traditional MEMS bulk-micromachining and anodic bonding technology. Experimental results show that the sensor achieves the sensitivity of 4.65 mV/V/kPa and pressure nonlinearity of 0.25% FSS in the operating range of 0-5 kPa at room temperature, indicating that this novel structure sensor can be applied in measuring the absolute micro pressure lower than 5 kPa.
Plasmid diversity and phylogenetic consistency in the Lyme disease agent Borrelia burgdorferi.
Casjens, Sherwood R; Gilcrease, Eddie B; Vujadinovic, Marija; Mongodin, Emmanuel F; Luft, Benjamin J; Schutzer, Steven E; Fraser, Claire M; Qiu, Wei-Gang
2017-02-15
Bacteria from the genus Borrelia are known to harbor numerous linear and circular plasmids. We report here a comparative analysis of the nucleotide sequences of 236 plasmids present in fourteen independent isolates of the Lyme disease agent B. burgdorferi. We have sequenced the genomes of 14 B. burgdorferi sensu stricto isolates that carry a total of 236 plasmids. These individual isolates carry between seven and 23 plasmids. Their chromosomes, the cp26 and cp32 circular plasmids, as well as the lp54 linear plasmid, are quite evolutionarily stable; however, the remaining plasmids have undergone numerous non-homologous and often duplicative recombination events. We identify 32 different putative plasmid compatibility types among the 236 plasmids, of which 15 are (usually) circular and 17 are linear. Because of past rearrangements, any given gene, even though it might be universally present in these isolates, is often found on different linear plasmid compatibility types in different isolates. For example, the arp gene and the vls cassette region are present on plasmids of four and five different compatibility types, respectively, in different isolates. A majority of the plasmid types have more than one organizationally different subtype, and the number of such variants ranges from one to eight among the 18 linear plasmid types. In spite of this substantial organizational diversity, the plasmids are not so variable that every isolate has a novel version of every plasmid (i.e., there appears to be a limited number of extant plasmid subtypes). Although there have been many past recombination events, both homologous and nonhomologous, among the plasmids, particular organizational variants of these plasmids correlate with particular chromosomal genotypes, suggesting that there has not been rapid horizontal transfer of whole linear plasmids among B. burgdorferi lineages. We argue that plasmid rearrangements are essentially non-revertable and are present at a frequency of only about 0.65% that of single nucleotide changes, making rearrangement-derived novel junctions (mosaic boundaries) ideal phylogenetic markers in the study of B. burgdorferi population structure and plasmid evolution and exchange.
NASA Astrophysics Data System (ADS)
Yang, Chen; Zhang, Xuepan; Huang, Xiaoqi; Cheng, ZhengAi; Zhang, Xinghua; Hou, Xinbin
2017-11-01
The concept of space solar power satellite (SSPS) is an advanced system for collecting solar energy in space and transmitting it wirelessly to earth. However, due to the long service life, in-orbit damage may occur in the structural system of SSPS. Therefore, sensor placement layouts for structural health monitoring should be firstly considered in this concept. In this paper, based on genetic algorithm, an optimal sensor placement method for deployable antenna module health monitoring in SSPS is proposed. According to the characteristics of the deployable antenna module, the designs of sensor placement are listed. Furthermore, based on effective independence method and effective interval index, a combined fitness function is defined to maximize linear independence in targeted modes while simultaneously avoiding redundant information at nearby positions. In addition, by considering the reliability of sensors located at deployable mechanisms, another fitness function is constituted. Moreover, the solution process of optimal sensor placement by using genetic algorithm is clearly demonstrated. At last, a numerical example about the sensor placement layout in a deployable antenna module of SSPS is presented, which by synthetically considering all the above mentioned performances. All results can illustrate the effectiveness and feasibility of the proposed sensor placement method in SSPS.
Steam distribution and energy delivery optimization using wireless sensors
NASA Astrophysics Data System (ADS)
Olama, Mohammed M.; Allgood, Glenn O.; Kuruganti, Teja P.; Sukumar, Sreenivas R.; Djouadi, Seddik M.; Lake, Joe E.
2011-05-01
The Extreme Measurement Communications Center at Oak Ridge National Laboratory (ORNL) explores the deployment of a wireless sensor system with a real-time measurement-based energy efficiency optimization framework in the ORNL campus. With particular focus on the 12-mile long steam distribution network in our campus, we propose an integrated system-level approach to optimize the energy delivery within the steam distribution system. We address the goal of achieving significant energy-saving in steam lines by monitoring and acting on leaking steam valves/traps. Our approach leverages an integrated wireless sensor and real-time monitoring capabilities. We make assessments on the real-time status of the distribution system by mounting acoustic sensors on the steam pipes/traps/valves and observe the state measurements of these sensors. Our assessments are based on analysis of the wireless sensor measurements. We describe Fourier-spectrum based algorithms that interpret acoustic vibration sensor data to characterize flows and classify the steam system status. We are able to present the sensor readings, steam flow, steam trap status and the assessed alerts as an interactive overlay within a web-based Google Earth geographic platform that enables decision makers to take remedial action. We believe our demonstration serves as an instantiation of a platform that extends implementation to include newer modalities to manage water flow, sewage and energy consumption.
Arai, T; Ando, T; Kusakabe, A; Ullah, M A
1983-01-01
We surveyed plasmids in naturally occurring Vibrio parahemolyticus strains isolated in Japan and Bangladesh. Among the strains isolated in Japan, about half of the strains isolated from stools of patients of domestic diarrhea outbreaks as well as of travelers returning from East Asia were found to have plasmids, but no strains from foods had plasmids. In contrast, among the strains isolated in Bangladesh, none of the four strains isolated from patients had plasmids, but two out of eight strains isolated from water had plasmids, suggesting that plasmids are common in strains from the water in Bangladesh. All plasmids so far reported in V. parahemolyticus were detected in strains isolated from stools of patients. Incidences of plasmids in this organism were not so high in either area. In Japan, all plasmids were detected in strains from human intestines at 37 C, but in Bangladesh, where the temperature is around 30-40 C, the plasmids were detected in strains from the natural environment. These results suggested the possibility that these plasmids can come from different bacteria under rather high temperatures and that incidences of plasmids are influenced by the incidences of plasmids in bacteria present in the vicinity of V. parahemolyticus strains. None of these plasmids were found to have any relation to the biological characters tested.
Yan, Yongsheng; Wang, Haiyan; Shen, Xiaohong; Leng, Bing; Li, Shuangquan
2018-05-21
The energy reading has been an efficient and attractive measure for collaborative acoustic source localization in practical application due to its cost saving in both energy and computation capability. The maximum likelihood problems by fusing received acoustic energy readings transmitted from local sensors are derived. Aiming to efficiently solve the nonconvex objective of the optimization problem, we present an approximate estimator of the original problem. Then, a direct norm relaxation and semidefinite relaxation, respectively, are utilized to derive the second-order cone programming, semidefinite programming or mixture of them for both cases of sensor self-location and source localization. Furthermore, by taking the colored energy reading noise into account, several minimax optimization problems are formulated, which are also relaxed via the direct norm relaxation and semidefinite relaxation respectively into convex optimization problems. Performance comparison with the existing acoustic energy-based source localization methods is given, where the results show the validity of our proposed methods.
Wang, Jie-sheng; Han, Shuang; Shen, Na-na
2014-01-01
For predicting the key technology indicators (concentrate grade and tailings recovery rate) of flotation process, an echo state network (ESN) based fusion soft-sensor model optimized by the improved glowworm swarm optimization (GSO) algorithm is proposed. Firstly, the color feature (saturation and brightness) and texture features (angular second moment, sum entropy, inertia moment, etc.) based on grey-level co-occurrence matrix (GLCM) are adopted to describe the visual characteristics of the flotation froth image. Then the kernel principal component analysis (KPCA) method is used to reduce the dimensionality of the high-dimensional input vector composed by the flotation froth image characteristics and process datum and extracts the nonlinear principal components in order to reduce the ESN dimension and network complex. The ESN soft-sensor model of flotation process is optimized by the GSO algorithm with congestion factor. Simulation results show that the model has better generalization and prediction accuracy to meet the online soft-sensor requirements of the real-time control in the flotation process. PMID:24982935
Yan, Yongsheng; Wang, Haiyan; Shen, Xiaohong; Leng, Bing; Li, Shuangquan
2018-01-01
The energy reading has been an efficient and attractive measure for collaborative acoustic source localization in practical application due to its cost saving in both energy and computation capability. The maximum likelihood problems by fusing received acoustic energy readings transmitted from local sensors are derived. Aiming to efficiently solve the nonconvex objective of the optimization problem, we present an approximate estimator of the original problem. Then, a direct norm relaxation and semidefinite relaxation, respectively, are utilized to derive the second-order cone programming, semidefinite programming or mixture of them for both cases of sensor self-location and source localization. Furthermore, by taking the colored energy reading noise into account, several minimax optimization problems are formulated, which are also relaxed via the direct norm relaxation and semidefinite relaxation respectively into convex optimization problems. Performance comparison with the existing acoustic energy-based source localization methods is given, where the results show the validity of our proposed methods. PMID:29883410
Optimal Sensor-Based Motion Planning for Autonomous Vehicle Teams
2017-03-01
calculated for non -dimensional ranges with Equation (3.26) and DU = 100 meters (shown at right) are equivalent to propagation loss calculated for 72 0 100...sensor and uniform target PDF, both choices are equivalent and the probability of non -detection equals the fraction of un- searched area. Time...feasible. Another goal is maximizing sensor performance in the presence of uncertainty. Optimal control provides a useful frame- work for solving these
Halim, Dunant; Cheng, Li; Su, Zhongqing
2011-03-01
The work was aimed to develop a robust virtual sensing design methodology for sensing and active control applications of vibro-acoustic systems. The proposed virtual sensor was designed to estimate a broadband acoustic interior sound pressure using structural sensors, with robustness against certain dynamic uncertainties occurring in an acoustic-structural coupled enclosure. A convex combination of Kalman sub-filters was used during the design, accommodating different sets of perturbed dynamic model of the vibro-acoustic enclosure. A minimax optimization problem was set up to determine an optimal convex combination of Kalman sub-filters, ensuring an optimal worst-case virtual sensing performance. The virtual sensing and active noise control performance was numerically investigated on a rectangular panel-cavity system. It was demonstrated that the proposed virtual sensor could accurately estimate the interior sound pressure, particularly the one dominated by cavity-controlled modes, by using a structural sensor. With such a virtual sensing technique, effective active noise control performance was also obtained even for the worst-case dynamics. © 2011 Acoustical Society of America
Geometry optimization for micro-pressure sensor considering dynamic interference
NASA Astrophysics Data System (ADS)
Yu, Zhongliang; Zhao, Yulong; Li, Lili; Tian, Bian; Li, Cun
2014-09-01
Presented is the geometry optimization for piezoresistive absolute micro-pressure sensor. A figure of merit called the performance factor (PF) is defined as a quantitative index to describe the comprehensive performances of a sensor including sensitivity, resonant frequency, and acceleration interference. Three geometries are proposed through introducing islands and sensitive beams into typical flat diaphragm. The stress distributions of sensitive elements are analyzed by finite element method. Multivariate fittings based on ANSYS simulation results are performed to establish the equations about surface stress, deflection, and resonant frequency. Optimization by MATLAB is carried out to determine the dimensions of the geometries. Convex corner undercutting is evaluated. Each PF of the three geometries with the determined dimensions is calculated and compared. Silicon bulk micromachining is utilized to fabricate the prototypes of the sensors. The outputs of the sensors under both static and dynamic conditions are tested. Experimental results demonstrate the rationality of the defined performance factor and reveal that the geometry with quad islands presents the highest PF of 210.947 Hz1/4. The favorable overall performances enable the sensor more suitable for altimetry.
Optimized autonomous space in-situ sensor web for volcano monitoring
Song, W.-Z.; Shirazi, B.; Huang, R.; Xu, M.; Peterson, N.; LaHusen, R.; Pallister, J.; Dzurisin, D.; Moran, S.; Lisowski, M.; Kedar, S.; Chien, S.; Webb, F.; Kiely, A.; Doubleday, J.; Davies, A.; Pieri, D.
2010-01-01
In response to NASA's announced requirement for Earth hazard monitoring sensor-web technology, a multidisciplinary team involving sensor-network experts (Washington State University), space scientists (JPL), and Earth scientists (USGS Cascade Volcano Observatory (CVO)), have developed a prototype of dynamic and scalable hazard monitoring sensor-web and applied it to volcano monitoring. The combined Optimized Autonomous Space In-situ Sensor-web (OASIS) has two-way communication capability between ground and space assets, uses both space and ground data for optimal allocation of limited bandwidth resources on the ground, and uses smart management of competing demands for limited space assets. It also enables scalability and seamless infusion of future space and in-situ assets into the sensor-web. The space and in-situ control components of the system are integrated such that each element is capable of autonomously tasking the other. The ground in-situ was deployed into the craters and around the flanks of Mount St. Helens in July 2009, and linked to the command and control of the Earth Observing One (EO-1) satellite. ?? 2010 IEEE.
Li, Bo; Chai, Zhixin; Yan, Xiaohui; Liu, Chunchen; Situ, Bo; Zhang, Ye; Pan, Weilun; Luo, Shihua; Liu, Jianhua; Zheng, Lei
2018-05-22
Antibiotic resistance associated with the mcr-1 gene of Gram-negative bacteria, which confers resistance to drugs of last resort and has the potential to spread via plasmids, is one of the most pressing issues facing global health today. Point-of-care testing for the mcr-1 gene is needed to aid in the identification of colistin resistance in the field and to control its horizontal transmission. Here, we report the successful development of an enzyme-free homogenous electrochemical strategy for sensitive detection of the antibiotic resistance gene mcr-1 using the hybridization chain reaction and mcr-1-specific toehold probe. The long double-stranded DNA polymer produced using this strategy could be detected by assessing the diffusion of methylene blue towards the surface of a screen-printed gold electrode. Under optimized conditions, a linear relationship was observed between the variation of peak current and the natural logarithm of the mcr-1 gene concentration in the range of 1 nM to 1 μM with a detection limit of 0.78 nM (S/N = 3). This enzyme-free, isothermal platform is a rapid, portable, disposable, and sensitive method for detection of plasmid-mediated colistin resistance.
Klebsiella pneumoniae in Singapore: Hypervirulent Infections and the Carbapenemase Threat
Chew, Ka Lip; Lin, Raymond T. P.; Teo, Jeanette W. P.
2017-01-01
Klebsiella pneumoniae remains a major pathogen responsible for localized infections such as cystitis and pneumonia, and disseminated infections that may result in severe sepsis and death. Invasive disease such as liver abscesses and endogenous endophthalmitis are associated with capsular serotypes K1 and K2. These infections require a prolonged course of antimicrobial treatment which has evolved over the years from inpatient treatment to outpatient parenteral antibiotic therapy. The emergence of plasmid-mediated resistance began with extended-spectrum β-lactamases (ESBLs) and AmpC β-lactamases. This was followed by carbapenemase genes and now plasmid transmissible colistin resistance (mcr), thus limiting viable treatment options. Plasmid-mediated carbapenemase production in Singapore was first reported in 1996. Carbapenemase production has since become the predominant mechanism of carbapenem resistance and incidence rates continue to increase over time. Although carbapenemases can occur in all Enterobacteriaceae, K. pneumoniae are the most common carrier of carbapenemase genes. Alternative treatment options are urgently required before the simplest infections, let alone invasive infections are left potentially untreatable. Clinical management requires guidance from robust laboratory testing methods to optimize patient outcomes. We explore past and present trends in treatment of K. pneumoniae infections, and discuss future treatment options and gaps in knowledge for further study. PMID:29312894
Directed Diffusion Modelling for Tesso Nilo National Parks Case Study
NASA Astrophysics Data System (ADS)
Yasri, Indra; Safrianti, Ery
2018-01-01
— Directed Diffusion (DD has ability to achieve energy efficiency in Wireless Sensor Network (WSN). This paper proposes Directed Diffusion (DD) modelling for Tesso Nilo National Parks (TNNP) case study. There are 4 stages of scenarios involved in this modelling. It’s started by appointing of sampling area through GPS coordinate. The sampling area is determined by optimization processes from 500m x 500m up to 1000m x 1000m with 100m increment in between. The next stage is sensor node placement. Sensor node is distributed in sampling area with three different quantities i.e. 20 nodes, 30 nodes and 40 nodes. One of those quantities is choose as an optimized sensor node placement. The third stage is to implement all scenarios in stages 1 and stages 2 on DD modelling. In the last stage, the evaluation process to achieve most energy efficient in the combination of optimized sampling area and optimized sensor node placement on Direct Diffusion (DD) routing protocol. The result shows combination between sampling area 500m x 500m and 20 nodes able to achieve energy efficient to support a forest preventive fire system at Tesso Nilo National Parks.
A Survey on Multimedia-Based Cross-Layer Optimization in Visual Sensor Networks
Costa, Daniel G.; Guedes, Luiz Affonso
2011-01-01
Visual sensor networks (VSNs) comprised of battery-operated electronic devices endowed with low-resolution cameras have expanded the applicability of a series of monitoring applications. Those types of sensors are interconnected by ad hoc error-prone wireless links, imposing stringent restrictions on available bandwidth, end-to-end delay and packet error rates. In such context, multimedia coding is required for data compression and error-resilience, also ensuring energy preservation over the path(s) toward the sink and improving the end-to-end perceptual quality of the received media. Cross-layer optimization may enhance the expected efficiency of VSNs applications, disrupting the conventional information flow of the protocol layers. When the inner characteristics of the multimedia coding techniques are exploited by cross-layer protocols and architectures, higher efficiency may be obtained in visual sensor networks. This paper surveys recent research on multimedia-based cross-layer optimization, presenting the proposed strategies and mechanisms for transmission rate adjustment, congestion control, multipath selection, energy preservation and error recovery. We note that many multimedia-based cross-layer optimization solutions have been proposed in recent years, each one bringing a wealth of contributions to visual sensor networks. PMID:22163908
Identification of the optimal spectral region for plasmonic and nanoplasmonic sensing.
Otte, Marinus A; Sepúlveda, Borja; Ni, Weihai; Juste, Jorge Pérez; Liz-Marzán, Luis M; Lechuga, Laura M
2010-01-26
We present a theoretical and experimental study involving the sensing characteristics of wavelength-interrogated plasmonic sensors based on surface plasmon polaritons (SPP) in planar gold films and on localized surface plasmon resonances (LSPR) of single gold nanorods. The tunability of both sensing platforms allowed us to analyze their bulk and surface sensing characteristics as a function of the plasmon resonance position. We demonstrate that a general figure of merit (FOM), which is equivalent in wavelength and energy scales, can be employed to mutually compare both sensing schemes. Most interestingly, this FOM has revealed a spectral region for which the surface sensitivity performance of both sensor types is optimized, which we attribute to the intrinsic dielectric properties of plasmonic materials. Additionally, in good agreement with theoretical predictions, we experimentally demonstrate that, although the SPP sensor offers a much better bulk sensitivity, the LSPR sensor shows an approximately 15% better performance for surface sensitivity measurements when its FOM is optimized. However, optimization of the substrate refractive index and the accessibility of the relevant molecules to the nanoparticles can lead to a total 3-fold improvement of the FOM in LSPR sensors.
Exploiting a new electrochemical sensor for biofilm monitoring and water treatment optimization.
Pavanello, Giovanni; Faimali, Marco; Pittore, Massimiliano; Mollica, Angelo; Mollica, Alessandro; Mollica, Alfonso
2011-02-01
Bacterial biofilm development is a serious problem in many fields, and the existing biofilm monitoring sensors often turn out to be inadequate. In this perspective, a new sensor (ALVIM) has been developed, exploiting the natural marine and freshwater biofilms electrochemical activity, proportional to surface covering. The results presented in this work, obtained testing the ALVIM system both in laboratory and in an industrial environment, show that the sensor gives a fast and accurate response to biofilm growth, and that this response can be used to optimize cleaning treatments inside pipelines. Compared to the existing biofilm sensors, the proposed system show significant technological innovations, higher sensitivity and precision. © 2010 Elsevier Ltd. All rights reserved.
Communal Sensor Network for Adaptive Noise Reduction in Aircraft Engine Nacelles
NASA Technical Reports Server (NTRS)
Jones, Kennie H.; Nark, Douglas M.; Jones, Michael G.
2011-01-01
Emergent behavior, a subject of much research in biology, sociology, and economics, is a foundational element of Complex Systems Science and is apropos in the design of sensor network systems. To demonstrate engineering for emergent behavior, a novel approach in the design of a sensor/actuator network is presented maintaining optimal noise attenuation as an adaptation to changing acoustic conditions. Rather than use the conventional approach where sensors are managed by a central controller, this new paradigm uses a biomimetic model where sensor/actuators cooperate as a community of autonomous organisms, sharing with neighbors to control impedance based on local information. From the combination of all individual actions, an optimal attenuation emerges for the global system.
NASA Astrophysics Data System (ADS)
Sutton, Virginia Kay
This paper examines statistical issues associated with estimating paths of juvenile salmon through the intakes of Kaplan turbines. Passive sensors, hydrophones, detecting signals from ultrasonic transmitters implanted in individual fish released into the preturbine region were used to obtain the information to estimate fish paths through the intake. Aim and location of the sensors affects the spatial region in which the transmitters can be detected, and formulas relating this region to sensor aiming directions are derived. Cramer-Rao lower bounds for the variance of estimators of fish location are used to optimize placement of each sensor. Finally, a statistical methodology is developed for analyzing angular data collected from optimally placed sensors.
Yao, Ke-Han; Jiang, Jehn-Ruey; Tsai, Chung-Hsien; Wu, Zong-Syun
2017-08-20
This paper investigates how to efficiently charge sensor nodes in a wireless rechargeable sensor network (WRSN) with radio frequency (RF) chargers to make the network sustainable. An RF charger is assumed to be equipped with a uniform circular array (UCA) of 12 antennas with the radius λ , where λ is the RF wavelength. The UCA can steer most RF energy in a target direction to charge a specific WRSN node by the beamforming technology. Two evolutionary algorithms (EAs) using the evolution strategy (ES), namely the Evolutionary Beamforming Optimization (EBO) algorithm and the Evolutionary Beamforming Optimization Reseeding (EBO-R) algorithm, are proposed to nearly optimize the power ratio of the UCA beamforming peak side lobe (PSL) and the main lobe (ML) aimed at the given target direction. The proposed algorithms are simulated for performance evaluation and are compared with a related algorithm, called Particle Swarm Optimization Gravitational Search Algorithm-Explore (PSOGSA-Explore), to show their superiority.
Conjugal properties of the Sinorhizobium meliloti plasmid mobilome.
Pistorio, Mariano; Giusti, María A; Del Papa, María F; Draghi, Walter O; Lozano, Mauricio J; Tejerizo, Gonzalo Torres; Lagares, Antonio
2008-09-01
The biology and biochemistry of plasmid transfer in soil bacteria is currently under active investigation because of its central role in prokaryote adaptation and evolution. In this work, we examined the conjugal properties of the cryptic plasmids present in a collection of the N(2)-fixing legume-symbiont Sinorhizobium meliloti. The study was performed on 65 S. meliloti isolates recovered from 25 humic soils of Argentina, which were grouped into 22 plasmid-profile types [i.e. plasmid operational taxonomic units (OTUs)]. The cumulative Shannon index calculated for the observed plasmid profiles showed a clear saturation plateau, thus indicating an adequate representation of the S. meliloti plasmid-profile types in the isolates studied. The results show that isolates of nearly 14% of the plasmid OTUs hosted transmissible plasmids and that isolates of 29% of the plasmid OTUs were able to retransfer the previously characterized mobilizable-cryptic plasmid pSmeLPU88b to a third recipient strain. It is noteworthy that isolates belonging to 14% of the plasmid OTUs proved to be refractory to the entrance of the model plasmid pSmeLPU88b, suggesting either the presence of surface exclusion phenomena or the occurrence of restriction incompatibility with the incoming replicon. Incompatibility for replication between resident plasmids and plasmid pSmeLPU88b was observed in c. 20% of the OTUs. The results reported here reveal a widespread compatibility among the conjugal functions of the cryptic plasmids in S. meliloti, and this fact, together with the observed high proportion of existing donor genotypes, points to the extrachromosomal compartment of the species as being an extremely active plasmid mobilome.
NASA Astrophysics Data System (ADS)
Potyrailo, Radislav A.; Hassib, Lamyaa
2005-06-01
Multicomponent polymer-based formulations of optical sensor materials are difficult and time consuming to optimize using conventional approaches. To address these challenges, our long-term goal is to determine relationships between sensor formulation and sensor response parameters using new scientific methodologies. As the first step, we have designed and implemented an automated analytical instrumentation infrastructure for combinatorial and high-throughput development of polymeric sensor materials for optical sensors. Our approach is based on the fabrication and performance screening of discrete and gradient sensor arrays. Simultaneous formation of multiple sensor coatings into discrete 4×6, 6×8, and 8×12 element arrays (3-15μL volume per element) and their screening provides not only a well-recognized acceleration in the screening rate, but also considerably reduces or even eliminates sources of variability, which are randomly affecting sensors response during a conventional one-at-a-time sensor coating evaluation. The application of gradient sensor arrays provides additional capabilities for rapid finding of the optimal formulation parameters.
Moscoso, I; Centeno, A; López, E; Rodriguez-Barbosa, J I; Santamarina, I; Filgueira, P; Sánchez, M J; Domínguez-Perles, R; Peñuelas-Rivas, G; Domenech, N
2005-01-01
Cell transplantation to regenerate injured tissues is a promising new treatment for patients suffering several diseases. Bone marrow contains a population of progenitor cells known as mesenchymal stem cells (MSCs), which have the capability to colonize different tissues, replicate, and differentiate into multilineage cells. Our goal was the isolation, characterization, and immortalization of porcine MSCs (pMSCs) to study their potential differentiation "in vitro" into cardiomyocytes. pMSCs were obtained from the aspirated bone marrow of Large-White pigs. After 4 weeks in culture, adherent cells were phenotypically characterized by flow cytometry and immunochemistry by using monoclonal antibodies. Primary pMSCs were transfected with the plasmid pRNS-1 to obtain continuous growing cloned cell lines. Fresh pMSCs and immortalized cells were treated with 5-azacytidine to differentiate them into cardiomyocytes. Flow cytometry analysis of isolated pMSCs demonstrated the following phenotype, CD90(pos), CD29(pos), CD44(pos), SLA-I(pos), CD106(pos), CD46(pos) and CD45(neg), CD14(neg), CD31(neg), and CD11b(neg), similar to that described for human MSC. We derived several stable immortalized MSC cell lines. One of these, called pBMC-2, was chosen for further characterization. After "in vitro" stimulation of both primary or immortalized cells with 5-azacytidine, we obtained different percentages (30%-50%) of cells with cardiomyocyte characteristics, namely, positive for alpha-Actin and T-Troponin. Thus, primary or immortalized pMSCs derived from bone marrow and cultured were able to differentiate "ex vivo" into cardiac-like muscle cells. These elements may be potentials tools to improve cardiac function in a swine myocardial infarct model.
Absolute counting of neutrophils in whole blood using flow cytometry.
Brunck, Marion E G; Andersen, Stacey B; Timmins, Nicholas E; Osborne, Geoffrey W; Nielsen, Lars K
2014-12-01
Absolute neutrophil count (ANC) is used clinically to monitor physiological dysfunctions such as myelosuppression or infection. In the research laboratory, ANC is a valuable measure to monitor the evolution of a wide range of disease states in disease models. Flow cytometry (FCM) is a fast, widely used approach to confidently identify thousands of cells within minutes. FCM can be optimised for absolute counting using spiked-in beads or by measuring the sample volume analysed. Here we combine the 1A8 antibody, specific for the mouse granulocyte protein Ly6G, with flow cytometric counting in straightforward FCM assays for mouse ANC, easily implementable in the research laboratory. Volumetric and Trucount™ bead assays were optimized for mouse neutrophils, and ANC values obtained with these protocols were compared to ANC measured by a dual-platform assay using the Orphee Mythic 18 veterinary haematology analyser. The single platform assays were more precise with decreased intra-assay variability compared with ANC obtained using the dual protocol. Defining ANC based on Ly6G expression produces a 15% higher estimate than the dual protocol. Allowing for this difference in ANC definition, the flow cytometry counting assays using Ly6G can be used reliably in the research laboratory to quantify mouse ANC from a small volume of blood. We demonstrate the utility of the volumetric protocol in a time-course study of chemotherapy induced neutropenia using four drug regimens. © 2014 International Society for Advancement of Cytometry.
Sensors for rate responsive pacing
Dell'Orto, Simonetta; Valli, Paolo; Greco, Enrico Maria
2004-01-01
Advances in pacemaker technology in the 1980s have generated a wide variety of complex multiprogrammable pacemakers and pacing modes. The aim of the present review is to address the different rate responsive pacing modalities presently available in respect to physiological situations and pathological conditions. Rate adaptive pacing has been shown to improve exercise capacity in patients with chronotropic incompetence. A number of activity and metabolic sensors have been proposed and used for rate control. However, all sensors used to optimize pacing rate metabolic demands show typical limitations. To overcome these weaknesses the use of two sensors has been proposed. Indeed an unspecific but fast reacting sensor is combined with a more specific but slower metabolic one. Clinical studies have demonstrated that this methodology is suitable to reproduce normal sinus behavior during different types and loads of exercise. Sensor combinations require adequate sensor blending and cross checking possibly controlled by automatic algorithms for sensors optimization and simplicity of programming. Assessment and possibly deactivation of some automatic functions should be also possible to maximize benefits from the dual sensor system in particular conditions. This is of special relevance in patient whose myocardial contractility is limited such as in subjects with implantable defibrillators and biventricular pacemakers. The concept of closed loop pacing, implementing a negative feedback relating pacing rate and the control signal, will provide new opportunities to optimize dual-sensors system and deserves further investigation. The integration of rate adaptive pacing into defibrillators is the natural consequence of technical evolution. PMID:16943981
Wide-field microscopy using microcamera arrays
NASA Astrophysics Data System (ADS)
Marks, Daniel L.; Youn, Seo Ho; Son, Hui S.; Kim, Jungsang; Brady, David J.
2013-02-01
A microcamera is a relay lens paired with image sensors. Microcameras are grouped into arrays to relay overlapping views of a single large surface to the sensors to form a continuous synthetic image. The imaged surface may be curved or irregular as each camera may independently be dynamically focused to a different depth. Microcamera arrays are akin to microprocessors in supercomputers in that both join individual processors by an optoelectronic routing fabric to increase capacity and performance. A microcamera may image ten or more megapixels and grouped into an array of several hundred, as has already been demonstrated by the DARPA AWARE Wide-Field program with multiscale gigapixel photography. We adapt gigapixel microcamera array architectures to wide-field microscopy of irregularly shaped surfaces to greatly increase area imaging over 1000 square millimeters at resolutions of 3 microns or better in a single snapshot. The system includes a novel relay design, a sensor electronics package, and a FPGA-based networking fabric. Biomedical applications of this include screening for skin lesions, wide-field and resolution-agile microsurgical imaging, and microscopic cytometry of millions of cells performed in situ.
EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.
Moore, Simon J; Lai, Hung-En; Kelwick, Richard J R; Chee, Soo Mei; Bell, David J; Polizzi, Karen Marie; Freemont, Paul S
2016-10-21
Golden Gate cloning is a prominent DNA assembly tool in synthetic biology for the assembly of plasmid constructs often used in combinatorial pathway optimization, with a number of assembly kits developed specifically for yeast and plant-based expression. However, its use for synthetic biology in commonly used bacterial systems such as Escherichia coli has surprisingly been overlooked. Here, we introduce EcoFlex a simplified modular package of DNA parts for a variety of applications in E. coli, cell-free protein synthesis, protein purification and hierarchical assembly of transcription units based on the MoClo assembly standard. The kit features a library of constitutive promoters, T7 expression, RBS strength variants, synthetic terminators, protein purification tags and fluorescence proteins. We validate EcoFlex by assembling a 68-part containing (20 genes) plasmid (31 kb), characterize in vivo and in vitro library parts, and perform combinatorial pathway assembly, using pooled libraries of either fluorescent proteins or the biosynthetic genes for the antimicrobial pigment violacein as a proof-of-concept. To minimize pathway screening, we also introduce a secondary module design site to simplify MoClo pathway optimization. In summary, EcoFlex provides a standardized and multifunctional kit for a variety of applications in E. coli synthetic biology.
Extracting archaeal populations from iron oxidizing systems
NASA Astrophysics Data System (ADS)
Whitmore, L. M.; Hutchison, J.; Chrisler, W.; Jay, Z.; Moran, J.; Inskeep, W.; Kreuzer, H.
2013-12-01
Unique environments in Yellowstone National Park offer exceptional conditions for studying microorganisms in extreme and constrained systems. However, samples from some extreme systems often contain inorganic components that pose complications during microbial and molecular analysis. Several archaeal species are found in acidic, geothermal ferric-oxyhydroxide mats; these species have been shown to adhere to mineral surfaces in flocculated colonies. For optimal microbial analysis, (microscopy, flow cytometry, genomic extractions, proteomic analysis, stable isotope analysis, and others), improved techniques are needed to better facilitate cell detachment and separation from mineral surfaces. As a requirement, these techniques must preserve cell structure while simultaneously minimizing organic carryover to downstream analysis. Several methods have been developed for removing sediments from mixed prokaryotic populations, including ultra-centrifugation, nycodenz gradient, sucrose cushions, and cell straining. In this study we conduct a comparative analysis of mechanisms used to detach archaeal cell populations from the mineral interface. Specifically, we evaluated mechanical and chemical approaches for cell separation and homogenization. Methods were compared using confocal microscopy, flow cytometry analyses, and real-time PCR detection. The methodology and approaches identified will be used to optimize biomass collection from environmental specimens or isolates grown with solid phases.
Yong, Delicia; Tee, Kok Keng; Yin, Wai-Fong; Chan, Kok-Gan
2016-01-01
To date, information on plasmid analysis in Pandoraea spp. is scarce. To address the gap of knowledge on this, the complete sequences of eight plasmids from Pandoraea spp. namely Pandoraea faecigallinarum DSM 23572T (pPF72-1, pPF72-2), Pandoraea oxalativorans DSM 23570T (pPO70-1, pPO70-2, pPO70-3, pPO70-4), Pandoraea vervacti NS15 (pPV15) and Pandoraea apista DSM 16535T (pPA35) were studied for the first time in this study. The information on plasmid sequences in Pandoraea spp. is useful as the sequences did not match any known plasmid sequence deposited in public databases. Replication genes were not identified in some plasmids, a situation that has led to the possibility of host interaction involvement. Some plasmids were also void of par genes and intriguingly, repA gene was also not discovered in these plasmids. This further leads to the hypothesis of host-plasmid interaction. Plasmid stabilization/stability protein-encoding genes were observed in some plasmids but were not established for participating in plasmid segregation. Toxin-antitoxin systems MazEF, VapBC, RelBE, YgiT-MqsR, HigBA, and ParDE were identified across the plasmids and their presence would improve plasmid maintenance. Conjugation genes were identified portraying the conjugation ability amongst Pandoraea plasmids. Additionally, we found a shared region amongst some of the plasmids that consists of conjugation genes. The identification of genes involved in replication, segregation, toxin-antitoxin systems and conjugation, would aid the design of drugs to prevent the survival or transmission of plasmids carrying pathogenic properties. Additionally, genes conferring virulence and antibiotic resistance were identified amongst the plasmids. The observed features in the plasmids shed light on the Pandoraea spp. as opportunistic pathogens. PMID:27790203
Villarubia, Gabriel; De Paz, Juan F.; Bajo, Javier
2017-01-01
The use of electric bikes (e-bikes) has grown in popularity, especially in large cities where overcrowding and traffic congestion are common. This paper proposes an intelligent engine management system for e-bikes which uses the information collected from sensors to optimize battery energy and time. The intelligent engine management system consists of a built-in network of sensors in the e-bike, which is used for multi-sensor data fusion; the collected data is analysed and fused and on the basis of this information the system can provide the user with optimal and personalized assistance. The user is given recommendations related to battery consumption, sensors, and other parameters associated with the route travelled, such as duration, speed, or variation in altitude. To provide a user with these recommendations, artificial neural networks are used to estimate speed and consumption for each of the segments of a route. These estimates are incorporated into evolutionary algorithms in order to make the optimizations. A comparative analysis of the results obtained has been conducted for when routes were travelled with and without the optimization system. From the experiments, it is evident that the use of an engine management system results in significant energy and time savings. Moreover, user satisfaction increases as the level of assistance adapts to user behavior and the characteristics of the route. PMID:29088087
De La Iglesia, Daniel H; Villarrubia, Gabriel; De Paz, Juan F; Bajo, Javier
2017-10-31
The use of electric bikes (e-bikes) has grown in popularity, especially in large cities where overcrowding and traffic congestion are common. This paper proposes an intelligent engine management system for e-bikes which uses the information collected from sensors to optimize battery energy and time. The intelligent engine management system consists of a built-in network of sensors in the e-bike, which is used for multi-sensor data fusion; the collected data is analysed and fused and on the basis of this information the system can provide the user with optimal and personalized assistance. The user is given recommendations related to battery consumption, sensors, and other parameters associated with the route travelled, such as duration, speed, or variation in altitude. To provide a user with these recommendations, artificial neural networks are used to estimate speed and consumption for each of the segments of a route. These estimates are incorporated into evolutionary algorithms in order to make the optimizations. A comparative analysis of the results obtained has been conducted for when routes were travelled with and without the optimization system. From the experiments, it is evident that the use of an engine management system results in significant energy and time savings. Moreover, user satisfaction increases as the level of assistance adapts to user behavior and the characteristics of the route.
Li, Chuan; Peng, Juan; Liang, Ming
2014-01-01
Oil debris sensors are effective tools to monitor wear particles in lubricants. For in situ applications, surrounding noise and vibration interferences often distort the oil debris signature of the sensor. Hence extracting oil debris signatures from sensor signals is a challenging task for wear particle monitoring. In this paper we employ the maximal overlap discrete wavelet transform (MODWT) with optimal decomposition depth to enhance the wear particle monitoring capability. The sensor signal is decomposed by the MODWT into different depths for detecting the wear particle existence. To extract the authentic particle signature with minimal distortion, the root mean square deviation of kurtosis value of the segmented signal residue is adopted as a criterion to obtain the optimal decomposition depth for the MODWT. The proposed approach is evaluated using both simulated and experimental wear particles. The results show that the present method can improve the oil debris monitoring capability without structural upgrade requirements. PMID:24686730
Li, Chuan; Peng, Juan; Liang, Ming
2014-03-28
Oil debris sensors are effective tools to monitor wear particles in lubricants. For in situ applications, surrounding noise and vibration interferences often distort the oil debris signature of the sensor. Hence extracting oil debris signatures from sensor signals is a challenging task for wear particle monitoring. In this paper we employ the maximal overlap discrete wavelet transform (MODWT) with optimal decomposition depth to enhance the wear particle monitoring capability. The sensor signal is decomposed by the MODWT into different depths for detecting the wear particle existence. To extract the authentic particle signature with minimal distortion, the root mean square deviation of kurtosis value of the segmented signal residue is adopted as a criterion to obtain the optimal decomposition depth for the MODWT. The proposed approach is evaluated using both simulated and experimental wear particles. The results show that the present method can improve the oil debris monitoring capability without structural upgrade requirements.
A Parameter Communication Optimization Strategy for Distributed Machine Learning in Sensors
Zhang, Jilin; Tu, Hangdi; Ren, Yongjian; Wan, Jian; Zhou, Li; Li, Mingwei; Wang, Jue; Yu, Lifeng; Zhao, Chang; Zhang, Lei
2017-01-01
In order to utilize the distributed characteristic of sensors, distributed machine learning has become the mainstream approach, but the different computing capability of sensors and network delays greatly influence the accuracy and the convergence rate of the machine learning model. Our paper describes a reasonable parameter communication optimization strategy to balance the training overhead and the communication overhead. We extend the fault tolerance of iterative-convergent machine learning algorithms and propose the Dynamic Finite Fault Tolerance (DFFT). Based on the DFFT, we implement a parameter communication optimization strategy for distributed machine learning, named Dynamic Synchronous Parallel Strategy (DSP), which uses the performance monitoring model to dynamically adjust the parameter synchronization strategy between worker nodes and the Parameter Server (PS). This strategy makes full use of the computing power of each sensor, ensures the accuracy of the machine learning model, and avoids the situation that the model training is disturbed by any tasks unrelated to the sensors. PMID:28934163
NASA Astrophysics Data System (ADS)
Leal-Junior, Arnaldo G.; Frizera, Anselmo; José Pontes, Maria
2018-03-01
Polymer optical fibers (POFs) are suitable for applications such as curvature sensors, strain, temperature, liquid level, among others. However, for enhancing sensitivity, many polymer optical fiber curvature sensors based on intensity variation require a lateral section. Lateral section length, depth, and surface roughness have great influence on the sensor sensitivity, hysteresis, and linearity. Moreover, the sensor curvature radius increase the stress on the fiber, which leads on variation of the sensor behavior. This paper presents the analysis relating the curvature radius and lateral section length, depth and surface roughness with the sensor sensitivity, hysteresis and linearity for a POF curvature sensor. Results show a strong correlation between the decision parameters behavior and the performance for sensor applications based on intensity variation. Furthermore, there is a trade-off among the sensitive zone length, depth, surface roughness, and curvature radius with the sensor desired performance parameters, which are minimum hysteresis, maximum sensitivity, and maximum linearity. The optimization of these parameters is applied to obtain a sensor with sensitivity of 20.9 mV/°, linearity of 0.9992 and hysteresis below 1%, which represent a better performance of the sensor when compared with the sensor without the optimization.
Optimized passive sonar placement to allow improved interdiction
NASA Astrophysics Data System (ADS)
Johnson, Bruce A.; Matthews, Cameron
2016-05-01
The Art Gallery Problem (AGP) is the name given to a constrained optimization problem meant to determine the maximum amount of sensor coverage while utilizing the minimum number of resources. The AGP is significant because a common issue among surveillance and interdiction systems is obtaining an understanding of the optimal position of sensors and weapons in advance of enemy combatant maneuvers. The implication that an optimal position for a sensor to observe an event or for a weapon to engage a target autonomously is usually very clear after the target has passed, but for autonomous systems the solution must at least be conjectured in advance for deployment purposes. This abstract applies the AGP as a means to solve where best to place underwater sensor nodes such that the amount of information acquired about a covered area is maximized while the number of resources used to gain that information is minimized. By phrasing the ISR/interdiction problem this way, the issue is addressed as an instance of the AGP. The AGP is a member of a set of computational problems designated as nondeterministic polynomial-time (NP)-hard. As a member of this set, the AGP shares its members' defining feature, namely that no one has proven that there exists a deterministic algorithm providing a computationally-tractable solution to the AGP within a finite amount of time. At best an algorithm meant to solve the AGP can asymptotically approach perfect coverage with minimal resource usage but providing perfect coverage would either break the minimal resource usage constraint or require an exponentially-growing amount of time. No perfectly-optimal solution yet exists to the AGP, however, approximately optimal solutions to the AGP can approach complete area or barrier coverage while simultaneously minimizing the number of sensors and weapons utilized. A minimal number of underwater sensor nodes deployed can greatly increase the Mean Time Between Operational Failure (MTBOF) and logistical footprint. The resulting coverage optimizes the likelihood of encounter given an arbitrary sensor profile and threat from a free field statistical model approach. The free field statistical model is particularly applicable to worst case scenario modeling in open ocean operational profiles where targets to do not follow a particular pattern in any of the modeled dimensions. We present an algorithmic testbed which shows how to achieve approximately optimal solutions to the AGP for a network of underwater sensor nodes with or without effector systems for engagement while operating under changing environmental circumstances. The means by which we accomplish this goal are three-fold: 1) Develop a 3D model for the sonar signal propagating through the underwater environment 2) Add rigorous physics-based modeling of environmental events which can affect sensor information acquisition 3) Provide innovative solutions to the AGP which account for the environmental circumstances affecting sensor performance.
Optimal power allocation and joint source-channel coding for wireless DS-CDMA visual sensor networks
NASA Astrophysics Data System (ADS)
Pandremmenou, Katerina; Kondi, Lisimachos P.; Parsopoulos, Konstantinos E.
2011-01-01
In this paper, we propose a scheme for the optimal allocation of power, source coding rate, and channel coding rate for each of the nodes of a wireless Direct Sequence Code Division Multiple Access (DS-CDMA) visual sensor network. The optimization is quality-driven, i.e. the received quality of the video that is transmitted by the nodes is optimized. The scheme takes into account the fact that the sensor nodes may be imaging scenes with varying levels of motion. Nodes that image low-motion scenes will require a lower source coding rate, so they will be able to allocate a greater portion of the total available bit rate to channel coding. Stronger channel coding will mean that such nodes will be able to transmit at lower power. This will both increase battery life and reduce interference to other nodes. Two optimization criteria are considered. One that minimizes the average video distortion of the nodes and one that minimizes the maximum distortion among the nodes. The transmission powers are allowed to take continuous values, whereas the source and channel coding rates can assume only discrete values. Thus, the resulting optimization problem lies in the field of mixed-integer optimization tasks and is solved using Particle Swarm Optimization. Our experimental results show the importance of considering the characteristics of the video sequences when determining the transmission power, source coding rate and channel coding rate for the nodes of the visual sensor network.
Joslin, John; Gilligan, James; Anderson, Paul; Garcia, Catherine; Sharif, Orzala; Hampton, Janice; Cohen, Steven; King, Miranda; Zhou, Bin; Jiang, Shumei; Trussell, Christopher; Dunn, Robert; Fathman, John W; Snead, Jennifer L; Boitano, Anthony E; Nguyen, Tommy; Conner, Michael; Cooke, Mike; Harris, Jennifer; Ainscow, Ed; Zhou, Yingyao; Shaw, Chris; Sipes, Dan; Mainquist, James; Lesley, Scott
2018-05-01
The goal of high-throughput screening is to enable screening of compound libraries in an automated manner to identify quality starting points for optimization. This often involves screening a large diversity of compounds in an assay that preserves a connection to the disease pathology. Phenotypic screening is a powerful tool for drug identification, in that assays can be run without prior understanding of the target and with primary cells that closely mimic the therapeutic setting. Advanced automation and high-content imaging have enabled many complex assays, but these are still relatively slow and low throughput. To address this limitation, we have developed an automated workflow that is dedicated to processing complex phenotypic assays for flow cytometry. The system can achieve a throughput of 50,000 wells per day, resulting in a fully automated platform that enables robust phenotypic drug discovery. Over the past 5 years, this screening system has been used for a variety of drug discovery programs, across many disease areas, with many molecules advancing quickly into preclinical development and into the clinic. This report will highlight a diversity of approaches that automated flow cytometry has enabled for phenotypic drug discovery.
Study of low speed flow cytometry for diffraction imaging with different chamber and nozzle designs.
Sa, Yu; Feng, Yuanming; Jacobs, Kenneth M; Yang, Jun; Pan, Ran; Gkigkitzis, Ioannis; Lu, Jun Q; Hu, Xin-Hua
2013-11-01
Achieving effective hydrodynamic focusing and flow stability at low speed presents a challenging design task in flow cytometry for studying phenomena such as cell adhesion and diffraction imaging of cells with low-cost cameras. We have developed different designs of flow chamber and sheath nozzle to accomplish the above goal. A 3D computational model of the chambers has been established to simulate the fluid dynamics in different chamber designs and measurements have been performed to determine the velocity and size distributions of the core fluid from the nozzle. Comparison of the simulation data with experimental results shows good agreement. With the computational model significant insights were gained for optimization of the chamber design and improvement of the cell positioning accuracy for study of slow moving cells. The benefit of low flow speed has been demonstrated also by reduced blurring in the diffraction images of single cells. Based on these results, we concluded that the new designs of chamber and sheath nozzle produce stable hydrodynamic focusing of the core fluid at low speed and allow detailed study of cellular morphology under various rheological conditions using the diffraction imaging method. © 2013 International Society for Advancement of Cytometry.
Radar coordination and resource management in a distributed sensor network using emergent control
NASA Astrophysics Data System (ADS)
Weir, B. S.; Sokol, T. M.
2009-05-01
As the list of anti-air warfare and ballistic missile defense missions grows, there is an increasing need to coordinate and optimize usage of radar resources across the netted force. Early attempts at this optimization involved top-down control mechanisms whereby sensors accept resource tasking orders from networked tracking elements. These approaches rely heavily on uncertain knowledge of sensor constraints and capabilities. Furthermore, advanced sensor systems may support self-defense missions of the host platform and are therefore unable to relinquish control to an external function. To surmount these issues, the use of bottom-up emergent control techniques is proposed. The information necessary to make quality, network-wide resource allocations is readily available to sensor nodes with access to a netted track picture. By assessing resource priorities relative to the network (versus local) track picture, sensors can understand the contribution of their resources to the netted force. This allows the sensors to apply resources where most needed and remove waste. Furthermore, simple local rules for resource usage, when properly constructed, allow sensors to obtain a globally optimal resource allocation without direct coordination (emergence). These results are robust to partial implementation (i.e., not all nodes upgraded at once) and failures on individual nodes (whether from casualty or reallocation to other sensor missions), and they leave resource control decisions in the hands of the sensor systems instead of an external function. This paper presents independent research and development work on emergent control of sensor resources and the impact to resource allocation and tracking performance.
Rational design of gene-based vaccines.
Barouch, Dan H
2006-01-01
Vaccine development has traditionally been an empirical discipline. Classical vaccine strategies include the development of attenuated organisms, whole killed organisms, and protein subunits, followed by empirical optimization and iterative improvements. While these strategies have been remarkably successful for a wide variety of viruses and bacteria, these approaches have proven more limited for pathogens that require cellular immune responses for their control. In this review, current strategies to develop and optimize gene-based vaccines are described, with an emphasis on novel approaches to improve plasmid DNA vaccines and recombinant adenovirus vector-based vaccines. Copyright 2006 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Mobile Wireless Sensor Networks for Advanced Soil Sensing and Ecosystem Monitoring
NASA Astrophysics Data System (ADS)
Mollenhauer, Hannes; Schima, Robert; Remmler, Paul; Mollenhauer, Olaf; Hutschenreuther, Tino; Toepfer, Hannes; Dietrich, Peter; Bumberger, Jan
2015-04-01
For an adequate characterization of ecosystems it is necessary to detect individual processes with suitable monitoring strategies and methods. Due to the natural complexity of all environmental compartments, single point or temporally and spatially fixed measurements are mostly insufficient for an adequate representation. The application of mobile wireless sensor networks for soil and atmosphere sensing offers significant benefits, due to the simple adjustment of the sensor distribution, the sensor types and the sample rate (e.g. by using optimization approaches or event triggering modes) to the local test conditions. This can be essential for the monitoring of heterogeneous and dynamic environmental systems and processes. One significant advantage in the application of mobile ad-hoc wireless sensor networks is their self-organizing behavior. Thus, the network autonomously initializes and optimizes itself. Due to the localization via satellite a major reduction in installation and operation costs and time is generated. In addition, single point measurements with a sensor are significantly improved by measuring at several optimized points continuously. Since performing analog and digital signal processing and computation in the sensor nodes close to the sensors a significant reduction of the data to be transmitted can be achieved which leads to a better energy management of nodes. Furthermore, the miniaturization of the nodes and energy harvesting are current topics under investigation. First results of field measurements are given to present the potentials and limitations of this application in environmental science. In particular, collected in-situ data with numerous specific soil and atmosphere parameters per sensor node (more than 25) recorded over several days illustrates the high performance of this system for advanced soil sensing and soil-atmosphere interaction monitoring. Moreover, investigations of biotic and abiotic process interactions and optimization of sensor positioning for measuring soil moisture are scopes of this work and initial results of these issues will be presented.
Gascoyne, D M; Heritage, J; Hawkey, P M; Turner, A; van Klingeren, B
1991-08-01
High level tetracycline resistant strains of Neisseria gonorrhoeae (TRNG) have been shown to carry a 40.6 kb (25.2 MDa) conjugative plasmid with a Class M tetracycline resistance determinant. Restriction endonuclease analysis mapping showed that there were at least two different TRNG plasmid types which were found in geographically distinct locations. The physical maps of these two plasmids were compared to a gonococcal conjugative plasmid which did not encode tetracycline resistance. The plasmid type which is endemic in the Netherlands was found to be closely related to the gonococcal conjugative plasmid, which supports the established hypothesis that the 40.6 kb plasmid has evolved by transposition of the TetM determinant into the conjugative plasmid. The plasmid found in the United States has either evolved by substantial divergent evolution or it results from a different transposition event. In the UK there have been isolations of TRNGs carrying either of the two plasmid types reflecting a flow of people both across the Atlantic and in Europe. It is possible that further TetM-containing plasmids will be found in N. gonorrhoeae paralleling the family of TEM beta-lactamase encoding plasmids already described.
A three-axis force sensor for dual finger haptic interfaces.
Fontana, Marco; Marcheschi, Simone; Salsedo, Fabio; Bergamasco, Massimo
2012-10-10
In this work we present the design process, the characterization and testing of a novel three-axis mechanical force sensor. This sensor is optimized for use in closed-loop force control of haptic devices with three degrees of freedom. In particular the sensor has been conceived for integration with a dual finger haptic interface that aims at simulating forces that occur during grasping and surface exploration. The sensing spring structure has been purposely designed in order to match force and layout specifications for the application. In this paper the design of the sensor is presented, starting from an analytic model that describes the characteristic matrix of the sensor. A procedure for designing an optimal overload protection mechanism is proposed. In the last part of the paper the authors describe the experimental characterization and the integrated test on a haptic hand exoskeleton showing the improvements in the controller performances provided by the inclusion of the force sensor.
Plasmid-linked ampicillin resistance in haempohilus influenza type b.
Elwell, L P; De Graaff, J; Seibert, D; Falkow, S
1975-08-01
Four ampicillin-resistant, beta-lactamase-producing strains of Haempohilus influenzae type b were examined for the presence of plasmid deoxyribonucleic acid (DNA). Three resistant strains contained a 30 x 10-6-dalton (30Mdal) plasmid and one resitant strain contained a 3-Mdal plasmid. The ampicillin-sensitive Haemophilus strains examined did not contain plasmid DNA. Transformation of a sensitive H. influenzae strain to ampicillin resistance with isolated plasmid DNA preparations revealed that the structural gene for beta-lactamase resided on both plasmid species. DNA-DNA hybridization studies showed that the 30-Mdal Haemophilus plasmid contained the ampicillin translocation DNA segment (TnA) found on some R-factors of enteric origin of the H. influenzae plasmids.
Ro, Dae-Kyun; Ouellet, Mario; Paradise, Eric M; Burd, Helcio; Eng, Diana; Paddon, Chris J; Newman, Jack D; Keasling, Jay D
2008-11-04
Due to the global occurrence of multi-drug-resistant malarial parasites (Plasmodium falciparum), the anti-malarial drug most effective against malaria is artemisinin, a natural product (sesquiterpene lactone endoperoxide) extracted from sweet wormwood (Artemisia annua). However, artemisinin is in short supply and unaffordable to most malaria patients. Artemisinin can be semi-synthesized from its precursor artemisinic acid, which can be synthesized from simple sugars using microorganisms genetically engineered with genes from A. annua. In order to develop an industrially competent yeast strain, detailed analyses of microbial physiology and development of gene expression strategies are required. Three plant genes coding for amorphadiene synthase, amorphadiene oxidase (AMO or CYP71AV1), and cytochrome P450 reductase, which in concert divert carbon flux from farnesyl diphosphate to artemisinic acid, were expressed from a single plasmid. The artemisinic acid production in the engineered yeast reached 250 microg mL(-1) in shake-flask cultures and 1 g L(-1) in bio-reactors with the use of Leu2d selection marker and appropriate medium formulation. When plasmid stability was measured, the yeast strain synthesizing amorphadiene alone maintained the plasmid in 84% of the cells, whereas the yeast strain synthesizing artemisinic acid showed poor plasmid stability. Inactivation of AMO by a point-mutation restored the high plasmid stability, indicating that the low plasmid stability is not caused by production of the AMO protein but by artemisinic acid synthesis or accumulation. Semi-quantitative reverse-transcriptase (RT)-PCR and quantitative real time-PCR consistently showed that pleiotropic drug resistance (PDR) genes, belonging to the family of ATP-Binding Cassette (ABC) transporter, were massively induced in the yeast strain producing artemisinic acid, relative to the yeast strain producing the hydrocarbon amorphadiene alone. Global transcriptional analysis by yeast microarray further demonstrated that the induction of drug-resistant genes such as ABC transporters and major facilitator superfamily (MSF) genes is the primary cellular stress-response; in addition, oxidative and osmotic stress responses were observed in the engineered yeast. The data presented here suggest that the engineered yeast producing artemisinic acid suffers oxidative and drug-associated stresses. The use of plant-derived transporters and optimizing AMO activity may improve the yield of artemisinic acid production in the engineered yeast.
Smith, Hilde; Bossers, Alex; Harders, Frank; Wu, Guanghui; Woodford, Neil; Schwarz, Stefan; Guerra, Beatriz; Rodríguez, Irene; van Essen-Zandbergen, Alieda; Brouwer, Michael; Mevius, Dik
2015-09-01
The aim of the study was to identify the plasmid-encoded factors contributing to the emergence and spread of epidemic IncI1-Iγ plasmids obtained from Escherichia coli and Salmonella enterica isolates from animal and human reservoirs. For this, 251 IncI1-Iγ plasmids carrying various extended-spectrum β-lactamase (ESBL) or AmpC β-lactamase genes were compared using plasmid multilocus sequence typing (pMLST). Thirty-two of these plasmids belonging to different pMLST types were sequenced using Roche 454 and Illumina platforms. Epidemic IncI1-Iγ plasmids could be assigned to various dominant clades, whereas rarely detected plasmids clustered together as a distinct clade. Similar phylogenetic trees were obtained using only the plasmid backbone sequences, showing that the differences observed between the plasmids belonging to distinct clades resulted mainly from differences between their backbone sequences. Plasmids belonging to the various clades differed particularly in the presence/absence of genes encoding partitioning and addiction systems, which contribute to stable inheritance during cell division and plasmid maintenance. Despite this, plasmids belonging to the various phylogenetic clades also showed marked resistance gene associations, indicating the circulation of successful plasmid-gene combinations. The variation in traY and excA genes found in IncI1-Iγ plasmids is conserved within pMLST sequence types and plays a role in incompatibility, although functional study is needed to elucidate the role of these genes in plasmid epidemiology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
On the Design of Smart Parking Networks in the Smart Cities: An Optimal Sensor Placement Model
Bagula, Antoine; Castelli, Lorenzo; Zennaro, Marco
2015-01-01
Smart parking is a typical IoT application that can benefit from advances in sensor, actuator and RFID technologies to provide many services to its users and parking owners of a smart city. This paper considers a smart parking infrastructure where sensors are laid down on the parking spots to detect car presence and RFID readers are embedded into parking gates to identify cars and help in the billing of the smart parking. Both types of devices are endowed with wired and wireless communication capabilities for reporting to a gateway where the situation recognition is performed. The sensor devices are tasked to play one of the three roles: (1) slave sensor nodes located on the parking spot to detect car presence/absence; (2) master nodes located at one of the edges of a parking lot to detect presence and collect the sensor readings from the slave nodes; and (3) repeater sensor nodes, also called “anchor” nodes, located strategically at specific locations in the parking lot to increase the coverage and connectivity of the wireless sensor network. While slave and master nodes are placed based on geographic constraints, the optimal placement of the relay/anchor sensor nodes in smart parking is an important parameter upon which the cost and efficiency of the parking system depends. We formulate the optimal placement of sensors in smart parking as an integer linear programming multi-objective problem optimizing the sensor network engineering efficiency in terms of coverage and lifetime maximization, as well as its economic gain in terms of the number of sensors deployed for a specific coverage and lifetime. We propose an exact solution to the node placement problem using single-step and two-step solutions implemented in the Mosel language based on the Xpress-MPsuite of libraries. Experimental results reveal the relative efficiency of the single-step compared to the two-step model on different performance parameters. These results are consolidated by simulation results, which reveal that our solution outperforms a random placement in terms of both energy consumption, delay and throughput achieved by a smart parking network. PMID:26134104
On the Design of Smart Parking Networks in the Smart Cities: An Optimal Sensor Placement Model.
Bagula, Antoine; Castelli, Lorenzo; Zennaro, Marco
2015-06-30
Smart parking is a typical IoT application that can benefit from advances in sensor, actuator and RFID technologies to provide many services to its users and parking owners of a smart city. This paper considers a smart parking infrastructure where sensors are laid down on the parking spots to detect car presence and RFID readers are embedded into parking gates to identify cars and help in the billing of the smart parking. Both types of devices are endowed with wired and wireless communication capabilities for reporting to a gateway where the situation recognition is performed. The sensor devices are tasked to play one of the three roles: (1) slave sensor nodes located on the parking spot to detect car presence/absence; (2) master nodes located at one of the edges of a parking lot to detect presence and collect the sensor readings from the slave nodes; and (3) repeater sensor nodes, also called "anchor" nodes, located strategically at specific locations in the parking lot to increase the coverage and connectivity of the wireless sensor network. While slave and master nodes are placed based on geographic constraints, the optimal placement of the relay/anchor sensor nodes in smart parking is an important parameter upon which the cost and efficiency of the parking system depends. We formulate the optimal placement of sensors in smart parking as an integer linear programming multi-objective problem optimizing the sensor network engineering efficiency in terms of coverage and lifetime maximization, as well as its economic gain in terms of the number of sensors deployed for a specific coverage and lifetime. We propose an exact solution to the node placement problem using single-step and two-step solutions implemented in the Mosel language based on the Xpress-MPsuite of libraries. Experimental results reveal the relative efficiency of the single-step compared to the two-step model on different performance parameters. These results are consolidated by simulation results, which reveal that our solution outperforms a random placement in terms of both energy consumption, delay and throughput achieved by a smart parking network.
Optimization of the coplanar interdigital capacitive sensor
NASA Astrophysics Data System (ADS)
Huang, Yunzhi; Zhan, Zheng; Bowler, Nicola
2017-02-01
Interdigital capacitive sensors are applied in nondestructive testing and material property characterization of low-conductivity materials. The sensor performance is typically described based on the penetration depth of the electric field into the sample material, the sensor signal strength and its sensitivity. These factors all depend on the geometry and material properties of the sensor and sample. In this paper, a detailed analysis is provided, through finite element simulations, of the ways in which the sensor's geometrical parameters affect its performance. The geometrical parameters include the number of digits forming the interdigital electrodes and the ratio of digit width to their separation. In addition, the influence of the presence or absence of a metal backplane on the sample is analyzed. Further, the effects of sensor substrate thickness and material on signal strength are studied. The results of the analysis show that it is necessary to take into account a trade-off between the desired sensitivity and penetration depth when designing the sensor. Parametric equations are presented to assist the sensor designer or nondestructive evaluation specialist in optimizing the design of a capacitive sensor.
van Mastrigt, Oscar; Lommers, Marcel M A N; de Vries, Yorick C; Abee, Tjakko; Smid, Eddy J
2018-03-23
Lactic acid bacteria can carry multiple plasmids affecting their performance in dairy fermentations. The expression of plasmid-encoded genes and the activity of the corresponding proteins is severely affected by changes in the number of plasmid copies. We studied the impact of growth rate on dynamics of plasmid copy numbers at high growth rates in chemostat cultures and down to near-zero growth rates in retentostat cultures. Five plasmids of the dairy strain Lactococcus lactis FM03-V1 were selected which varied in size (3 to 39 kb), in replication mechanism (theta or rolling-circle) and in putative (dairy-associated) functions. Copy numbers ranged from 1.5 to 40.5 and the copy number of theta-type replicating plasmids were negatively correlated to the plasmid size. Despite the extremely wide range of growth rates (0.0003 h -1 to 0.6 h -1 ), copy numbers of the five plasmids were stable and only slightly increased at near-zero growth rates showing that the plasmid replication rate was strictly controlled. One low-copy number plasmid, carrying a large exopolysaccharide gene cluster, was segregationally unstable during retentostat cultivations reflected in complete loss of the plasmid in one of the retentostat cultures. The copy number of the five plasmids was also hardly affected by varying the pH value, nutrient limitation or presence of citrate (maximum 2.2-fold) signifying the stability in copy number of the plasmids. Importance Lactococcus lactis is extensively used in starter cultures for dairy fermentations. Important traits for growth and survival of L. lactis in dairy fermentations are encoded by genes located on plasmids, such as genes involved in lactose and citrate metabolism, protein degradation and oligopeptide uptake and bacteriophage resistance. Because the number of plasmid copies could affect the expression of plasmid-encoded genes, it is important to know the factors that influence the plasmid copy numbers. We monitored plasmid copy numbers of L. lactis at near-zero growth rates, characteristic for cheese ripening. Moreover, we analysed the effect of pH, nutrient limitation and presence of citrate. This showed that plasmid copy numbers were stable giving insight into plasmid copy number dynamics in dairy fermentations. Copyright © 2018 American Society for Microbiology.
Clostridium perfringens type A–E toxin plasmids
Freedman, John C.; Theoret, James R.; Wisniewski, Jessica A.; Uzal, Francisco A.; Rood, Julian I.; McClane, Bruce A.
2014-01-01
Clostridium perfringens relies upon plasmid-encoded toxin genes to cause intestinal infections. These toxin genes are associated with insertion sequences that may facilitate their mobilization and transfer, giving rise to new toxin plasmids with common backbones. Most toxin plasmids carry a transfer of clostridial plasmids locus mediating conjugation, which likely explains the presence of similar toxin plasmids in otherwise unrelated C. perfringens strains. The association of many toxin genes with insertion sequences and conjugative plasmids provides virulence flexibility when causing intestinal infections. However, incompatibility issues apparently limit the number of toxin plasmids maintained by a single cell. PMID:25283728
Maruyama, Fumito; Kenzaka, Takehiko; Yamaguchi, Nobuyasu; Tani, Katsuji; Nasu, Masao
2005-01-01
Rolling circle amplification (RCA) generates large single-stranded and tandem repeats of target DNA as amplicons. This technique was applied to in situ nucleic acid amplification (in situ RCA) to visualize and count single Escherichia coli cells carrying a specific gene sequence. The method features (i) one short target sequence (35 to 39 bp) that allows specific detection; (ii) maintaining constant fluorescent intensity of positive cells permeabilized extensively after amplicon detection by fluorescence in situ hybridization, which facilitates the detection of target bacteria in various physiological states; and (iii) reliable enumeration of target bacteria by concentration on a gelatin-coated membrane filter. To test our approach, the presence of the following genes were visualized by in situ RCA: green fluorescent protein gene, the ampicillin resistance gene and the replication origin region on multicopy pUC19 plasmid, as well as the single-copy Shiga-like toxin gene on chromosomes inside E. coli cells. Fluorescent antibody staining after in situ RCA also simultaneously identified cells harboring target genes and determined the specificity of in situ RCA. E. coli cells in a nonculturable state from a prolonged incubation were periodically sampled and used for plasmid uptake study. The numbers of cells taking up plasmids determined by in situ RCA was up to 106-fold higher than that measured by selective plating. In addition, in situ RCA allowed the detection of cells taking up plasmids even when colony-forming cells were not detected during the incubation period. By optimizing the cell permeabilization condition for in situ RCA, this method can become a valuable tool for studying free DNA uptake, especially in nonculturable bacteria. PMID:16332770
Affinity analysis and application of dipeptides derived from l-tyrosine in plasmid purification.
Ferreira, Soraia; Carvalho, Josué; Valente, Joana F A; Corvo, Marta C; Cabrita, Eurico J; Sousa, Fani; Queiroz, João A; Cruz, Carla
2015-12-01
The developments in the use of plasmid DNA (pDNA) in gene therapy and vaccines have motivated the search and improvement of optimized purification processes. In this context, dipeptides l-tyrosine-l-tyrosine and l-tyrosine-l-arginine are synthetized to explore their application as affinity ligands for supercoiled (sc) plasmid DNA (pDNA) purification. The synthesis is based on the protection of N-Boc-l-tyrosine, followed by condensation with l-tyrosine or l-arginine methyl esters in the presence of dicyclohexylcarbodiimide (DCC), which after hydrolysis and acidification give the afforded dipeptides. The supports are then obtained by coupling l-tyrosine, l-tyrosine-l-tyrosine and l-tyrosine-l-arginine to epoxy-activated Sepharose and are characterized by high resolution magic angle spinning (HR-MAS) NMR and Fourier transform infrared spectroscopy (FTIR). Surface plasmon resonance (SPR) biosensor is used to establish the promising ligand to be used in the chromatographic experiments and ascertain experimental conditions. Sc isoform showed the highest affinity to the dipeptides, followed by linear (ln) pDNA, being the open circular (oc) the one that promoted the lowest affinity to l-tyrosine-l-arginine. Saturation transfer difference (STD)-NMR experiments show that the interaction is mainly hydrophobic with the majority of the 5'-mononucleotides, except for 5'-GMP with l-tyrosine-l-arginine Sepharose that is mainly electrostatic. The support l-tyrosine Sepharose used in chromatographic experiments promotes the separation of native pVAX1-LacZ and pcDNA3-FLAG-p53 samples (oc+sc) by decreasing the salt concentration. The results suggest that it is possible to purify different plasmids with the l-tyrosine Sepharose, with slight adjustments in the gradient conditions. Copyright © 2015 Elsevier B.V. All rights reserved.
Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop
2016-01-01
The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.
Bruffaerts, Nicolas; Pedersen, Lasse E.; Vandermeulen, Gaëlle; Préat, Véronique; Stockhofe-Zurwieden, Norbert; Huygen, Kris; Romano, Marta
2015-01-01
The only tuberculosis vaccine currently available, bacille Calmette-Guérin (BCG) is a poor inducer of CD8+ T cells, which are particularly important for the control of latent tuberculosis and protection against reactivation. As the induction of strong CD8+ T cell responses is a hallmark of DNA vaccines, a combination of BCG with plasmid DNA encoding a prototype TB antigen (Ag85A) was tested. As an alternative animal model, pigs were primed with BCG mixed with empty vector or codon-optimized pAg85A by the intradermal route and boosted with plasmid delivered by intramuscular electroporation. Control pigs received unformulated BCG. The BCG-pAg85A combination stimulated robust and sustained Ag85A specific antibody, lymphoproliferative, IL-6, IL-10 and IFN-γ responses. IgG1/IgG2 antibody isotype ratio reflected the Th1 helper type biased response. T lymphocyte responses against purified protein derivative of tuberculin (PPD) were induced in all (BCG) vaccinated animals, but responses were much stronger in BCG-pAg85A vaccinated pigs. Finally, Ag85A-specific IFN-γ producing CD8+ T cells were detected by intracellular cytokine staining and a synthetic peptide, spanning Ag85A131-150 and encompassing two regions with strong predicted SLA-1*0401/SLA-1*0801 binding affinity, was promiscuously recognized by 6/6 animals vaccinated with the BCG-pAg85A combination. Our study provides a proof of concept in a large mammalian species, for a new Th1 and CD8+ targeting tuberculosis vaccine, based on BCG-plasmid DNA co-administration. PMID:26172261
Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.
2013-01-01
Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422
Novel RepA-MCM proteins encoded in plasmids pTAU4, pORA1 and pTIK4 from Sulfolobus neozealandicus
Greve, Bo; Jensen, Susanne; Phan, Hoa; Brügger, Kim; Zillig, Wolfram; She, Qunxin; Garrett, Roger A.
2005-01-01
Three plasmids isolated from the crenarchaeal thermoacidophile Sulfolobus neozealandicus were characterized. Plasmids pTAU4 (7,192 bp), pORA1 (9,689 bp) and pTIK4 (13,638 bp) show unusual properties that distinguish them from previously characterized cryptic plasmids of the genus Sulfolobus. Plasmids pORA1 and pTIK4 encode RepA proteins, only the former of which carries the novel polymerase–primase domain of other known Sulfolobus plasmids. Plasmid pTAU4 encodes a mini-chromosome maintenance protein homolog and no RepA protein; the implications for DNA replication are considered. Plasmid pORA1 is the first Sulfolobus plasmid to be characterized that does not encode the otherwise highly conserved DNA-binding PlrA protein. Another encoded protein appears to be specific for the New Zealand plasmids. The three plasmids should provide useful model systems for functional studies of these important crenarchaeal proteins. PMID:15876565
Pu, Xiao-Ying; Gu, Yaming; Li, Jun; Song, Shu-Juan; Lu, Zhe
2018-05-18
The aim of this study was to explore the fluoroquinolone resistance mechanism of aac (6')-Ib-cr and qnrS gene by comparing complete sequences and stability of the aac(6')-Ib-cr- and qnrS-positive plasmids from Shigella isolates in the Hangzhou area of China. The complete sequences of four newly acquired plasmids carrying aac(6')-Ib-cr or qnrS were compared with those of two plasmids obtained previously and two similar reference Escherichia coli plasmids. The results showed that the length, antibiotic resistance genes and genetic environment were different among the plasmids. Moreover, the plasmid stability of three wild-type isolates and five plasmid transformants carrying aac(6')-Ib-cr and/or qnrS was measured in vitro, and all eight isolates were found to have lost their aac(6')-Ib-cr- or qnrS-positive plasmids to a different extent at different stages. When the plasmids were electroporated into Shigella flexneri or they lost positive plasmids, the MICs of ciprofloxacin increased or decreased two- to eightfold for aac(6')-Ib-cr-positive plasmids and 16- to 32-fold for qnrS-positive plasmids. To our knowledge, this is the first report comparing the complete sequences and describing stability for the aac(6')-Ib-cr- and qnrS-positive plasmids from Shigella isolates.
Host range diversification within the IncP-1 plasmid group
Yano, Hirokazu; Rogers, Linda M.; Knox, Molly G.; Heuer, Holger; Smalla, Kornelia; Brown, Celeste J.
2013-01-01
Broad-host-range plasmids play a critical role in the spread of antibiotic resistance and other traits. In spite of increasing information about the genomic diversity of closely related plasmids, the relationship between sequence divergence and host range remains unclear. IncP-1 plasmids are currently classified into six subgroups based on the genetic distance of backbone genes. We investigated whether plasmids from two subgroups exhibit a different host range, using two IncP-1γ plasmids, an IncP-1β plasmid and their minireplicons. Efficiencies of plasmid establishment and maintenance were compared using five species that belong to the Alphaproteobacteria, Betaproteobacteria and Gammaproteobacteria. The IncP-1β plasmid replicated and persisted in all five hosts in the absence of selection. Of the two IncP-1γ plasmids, both were unable to replicate in alphaproteobacterial host Sphingobium japonicum, and one established itself in Agrobacterium tumefaciens but was very unstable. In contrast, both IncP-1γ minireplicons, which produced higher levels of replication initiation protein than the wild-type plasmids, replicated in all strains, suggesting that poor establishment of the native plasmids is in part due to suboptimal replication initiation gene regulation. The findings suggest that host ranges of distinct IncP-1 plasmids only partially overlap, which may limit plasmid recombination and thus result in further genome divergence. PMID:24002747
Wireless sensor placement for structural monitoring using information-fusing firefly algorithm
NASA Astrophysics Data System (ADS)
Zhou, Guang-Dong; Yi, Ting-Hua; Xie, Mei-Xi; Li, Hong-Nan
2017-10-01
Wireless sensor networks (WSNs) are promising technology in structural health monitoring (SHM) applications for their low cost and high efficiency. The limited wireless sensors and restricted power resources in WSNs highlight the significance of optimal wireless sensor placement (OWSP) during designing SHM systems to enable the most useful information to be captured and to achieve the longest network lifetime. This paper presents a holistic approach, including an optimization criterion and a solution algorithm, for optimally deploying self-organizing multi-hop WSNs on large-scale structures. The combination of information effectiveness represented by the modal independence and the network performance specified by the network connectivity and network lifetime is first formulated to evaluate the performance of wireless sensor configurations. Then, an information-fusing firefly algorithm (IFFA) is developed to solve the OWSP problem. The step sizes drawn from a Lévy distribution are adopted to drive fireflies toward brighter individuals. Following the movement with Lévy flights, information about the contributions of wireless sensors to the objective function as carried by the fireflies is fused and applied to move inferior wireless sensors to better locations. The reliability of the proposed approach is verified via a numerical example on a long-span suspension bridge. The results demonstrate that the evaluation criterion provides a good performance metric of wireless sensor configurations, and the IFFA outperforms the simple discrete firefly algorithm.
NASA Astrophysics Data System (ADS)
Ehfaed, Nuri. A. K. H.; Bathmanathan, Shillan A. L.; Dhahi, Th S.; Adam, Tijjani; Hashim, Uda; Noriman, N. Z.
2017-09-01
The study proposed characterization and optimization of silicon nanosensor for specific detection of heavy metal. The sensor was fabricated in-house and conventional photolithography coupled with size reduction via dry etching process in an oxidation furnace. Prior to heavy metal heavy metal detection, the capability to aqueous sample was determined utilizing serial DI water at various. The sensor surface was surface modified with Organofunctional alkoxysilanes (3-aminopropyl) triethoxysilane (APTES) to create molecular binding chemistry. This has allowed interaction between heavy metals being measured and the sensor component resulting in increasing the current being measured. Due to its, excellent detection capabilities, this sensor was able to identify different group heavy metal species. The device was further integrated with sub-50 µm for chemical delivery.
Zhang, Guozhu; Xie, Changsheng; Zhang, Shunping; Zhao, Jianwei; Lei, Tao; Zeng, Dawen
2014-09-08
A combinatorial high-throughput temperature-programmed method to obtain the optimal operating temperature (OOT) of gas sensor materials is demonstrated here for the first time. A material library consisting of SnO2, ZnO, WO3, and In2O3 sensor films was fabricated by screen printing. Temperature-dependent conductivity curves were obtained by scanning this gas sensor library from 300 to 700 K in different atmospheres (dry air, formaldehyde, carbon monoxide, nitrogen dioxide, toluene and ammonia), giving the OOT of each sensor formulation as a function of the carrier and analyte gases. A comparative study of the temperature-programmed method and a conventional method showed good agreement in measured OOT.
Desensitized Optimal Filtering and Sensor Fusion Toolkit
NASA Technical Reports Server (NTRS)
Karlgaard, Christopher D.
2015-01-01
Analytical Mechanics Associates, Inc., has developed a software toolkit that filters and processes navigational data from multiple sensor sources. A key component of the toolkit is a trajectory optimization technique that reduces the sensitivity of Kalman filters with respect to model parameter uncertainties. The sensor fusion toolkit also integrates recent advances in adaptive Kalman and sigma-point filters for non-Gaussian problems with error statistics. This Phase II effort provides new filtering and sensor fusion techniques in a convenient package that can be used as a stand-alone application for ground support and/or onboard use. Its modular architecture enables ready integration with existing tools. A suite of sensor models and noise distribution as well as Monte Carlo analysis capability are included to enable statistical performance evaluations.
Research Trends in Wireless Visual Sensor Networks When Exploiting Prioritization
Costa, Daniel G.; Guedes, Luiz Affonso; Vasques, Francisco; Portugal, Paulo
2015-01-01
The development of wireless sensor networks for control and monitoring functions has created a vibrant investigation scenario, where many critical topics, such as communication efficiency and energy consumption, have been investigated in the past few years. However, when sensors are endowed with low-power cameras for visual monitoring, a new scope of challenges is raised, demanding new research efforts. In this context, the resource-constrained nature of sensor nodes has demanded the use of prioritization approaches as a practical mechanism to lower the transmission burden of visual data over wireless sensor networks. Many works in recent years have considered local-level prioritization parameters to enhance the overall performance of those networks, but global-level policies can potentially achieve better results in terms of visual monitoring efficiency. In this paper, we make a broad review of some recent works on priority-based optimizations in wireless visual sensor networks. Moreover, we envisage some research trends when exploiting prioritization, potentially fostering the development of promising optimizations for wireless sensor networks composed of visual sensors. PMID:25599425
Engineering New Aptamer Geometries for Electrochemical Aptamer-Based Sensors
White, Ryan J.; Plaxco, Kevin W.
2010-01-01
Electrochemical aptamer-based sensors (E-AB sensors) represent a promising new approach to the detection of small molecules. E-AB sensors comprise an aptamer that is attached at one end to an electrode surface. The distal end of the aptamer probed is modified with an electroactive redox marker for signal transduction. Herein we report on the optimization of a cocaine-detecting E-AB sensor via optimization of the geometry of the aptamer. We explore two new aptamer architectures, one in which we concatenate three cocaine aptamers into a poly-aptamer and a second in which we divide the cocaine aptamer into pieces connected via an unstructured, 60-thymine linker. Both of these structures are designed such that the reporting redox tag will be located farther from the electrode in the unfolded, target-free conformation. Consistent with this, we find that signal gains of these two constructs are two to three times higher than that of the original E-AB architecture. Likewise all three architectures are selective enough to deploy directly in complex sample matrices, such as undiluted whole blood, with all three sensors successfully detecting the presence of cocaine. The findings in this ongoing study should be of value in future efforts to optimize the signaling of electrochemical aptamer-based sensors. PMID:20436792
Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin
2015-01-01
Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical importance. Such phenomenon is bothersome when the plasmids are transmissible, facilitating the spread of virulence and resistance plasmids among pathogenic bacteria. Notably, certain TA systems are more commonly found in particular ExPEC plasmid types, indicating the possible relationships between certain TA systems and ExPEC pathogenesis.
Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-06-01
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome sequences and provided possible spread mechanism of IncA/C plasmids in Salmonella Newport Lineage II.
NASA Astrophysics Data System (ADS)
Fink, Wolfgang; George, Thomas; Tarbell, Mark A.
2007-04-01
Robotic reconnaissance operations are called for in extreme environments, not only those such as space, including planetary atmospheres, surfaces, and subsurfaces, but also in potentially hazardous or inaccessible operational areas on Earth, such as mine fields, battlefield environments, enemy occupied territories, terrorist infiltrated environments, or areas that have been exposed to biochemical agents or radiation. Real time reconnaissance enables the identification and characterization of transient events. A fundamentally new mission concept for tier-scalable reconnaissance of operational areas, originated by Fink et al., is aimed at replacing the engineering and safety constrained mission designs of the past. The tier-scalable paradigm integrates multi-tier (orbit atmosphere surface/subsurface) and multi-agent (satellite UAV/blimp surface/subsurface sensing platforms) hierarchical mission architectures, introducing not only mission redundancy and safety, but also enabling and optimizing intelligent, less constrained, and distributed reconnaissance in real time. Given the mass, size, and power constraints faced by such a multi-platform approach, this is an ideal application scenario for a diverse set of MEMS sensors. To support such mission architectures, a high degree of operational autonomy is required. Essential elements of such operational autonomy are: (1) automatic mapping of an operational area from different vantage points (including vehicle health monitoring); (2) automatic feature extraction and target/region-of-interest identification within the mapped operational area; and (3) automatic target prioritization for close-up examination. These requirements imply the optimal deployment of MEMS sensors and sensor platforms, sensor fusion, and sensor interoperability.
Prevette, Lisa E.; Mullen, Douglas G.; Banaszak Holl, Mark M.
2010-01-01
Polycationic materials commonly used to delivery DNA to cells are known to induce cell membrane porosity in a charge-density dependent manner. It has been suggested that these pores may provide a mode of entry of the polymer-DNA complexes (polyplexes) into cells. To examine the correlation between membrane permeability and biological activity, we used two-color flow cytometry on two mammalian cell lines to simultaneously measure gene expression of a plasmid DNA delivered with four common nonviral vectors and cellular uptake of normally excluded fluorescent dye molecules of two different sizes, 668 Da and 2 MDa. We also followed gene expression in cells sorted based on the retention of endogenous fluorescein. We have found that cell membrane porosity caused by polycationic vectors does not enhance internalization or gene expression. Based on this single-cell study, membrane permeability is found to be an unwanted side effect that limits transfection efficiency, possibly through leakage of the delivered nucleic acid through the pores prior to transcription and translation and/or activation of cell defense mechanisms that restrict transgene expression. PMID:20349965
[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Fast and efficient three-step target-specific curing of a virulence plasmid in Salmonella enterica.
de Moraes, Marcos H; Teplitski, Max
2015-12-01
Virulence plasmids borne by serovars of Salmonella enterica carry genes involved in its pathogenicity, as well as other functions. Characterization of phenotypes associated with virulence plasmids requires a system for efficiently curing strains of their virulence plasmids. Here, we developed a 3-step protocol for targeted curing of virulence plasmids. The protocol involves insertion of an I-SecI restriction site linked to an antibiotic resistance gene into the target plasmid using λ-Red mutagenesis, followed by the transformation with a temperature-sensitive auxiliary plasmid which carries I-SecI nuclease expressed from a tetracycline-inducible promoter. Finally, the auxiliary plasmid is removed by incubation at 42 °C and the plasmid-less strains are verified on antibiotic-containing media. This method is fast and very efficient: over 90 % of recovered colonies lacked their virulence plasmid.
Heimdall System for MSSS Sensor Tasking
NASA Astrophysics Data System (ADS)
Herz, A.; Jones, B.; Herz, E.; George, D.; Axelrad, P.; Gehly, S.
In Norse Mythology, Heimdall uses his foreknowledge and keen eyesight to keep watch for disaster from his home near the Rainbow Bridge. Orbit Logic and the Colorado Center for Astrodynamics Research (CCAR) at the University of Colorado (CU) have developed the Heimdall System to schedule observations of known and uncharacterized objects and search for new objects from the Maui Space Surveillance Site. Heimdall addresses the current need for automated and optimized SSA sensor tasking driven by factors associated with improved space object catalog maintenance. Orbit Logic and CU developed an initial baseline prototype SSA sensor tasking capability for select sensors at the Maui Space Surveillance Site (MSSS) using STK and STK Scheduler, and then added a new Track Prioritization Component for FiSST-inspired computations for predicted Information Gain and Probability of Detection, and a new SSA-specific Figure-of-Merit (FOM) for optimized SSA sensor tasking. While the baseline prototype addresses automation and some of the multi-sensor tasking optimization, the SSA-improved prototype addresses all of the key elements required for improved tasking leading to enhanced object catalog maintenance. The Heimdall proof-of-concept was demonstrated for MSSS SSA sensor tasking for a 24 hour period to attempt observations of all operational satellites in the unclassified NORAD catalog, observe a small set of high priority GEO targets every 30 minutes, make a sky survey of the GEO belt region accessible to MSSS sensors, and observe particular GEO regions that have a high probability of finding new objects with any excess sensor time. This Heimdall prototype software paves the way for further R&D that will integrate this technology into the MSSS systems for operational scheduling, improve the software's scalability, and further tune and enhance schedule optimization. The Heimdall software for SSA sensor tasking provides greatly improved performance over manual tasking, improved coordinated sensor usage, and tasking schedules driven by catalog improvement goals (reduced overall covariance, etc.). The improved performance also enables more responsive sensor tasking to address external events, newly detected objects, newly detected object activity, and sensor anomalies. Instead of having to wait until the next day's scheduling phase, events can be addressed with new tasking schedules immediately (within seconds or minutes). Perhaps the most important benefit is improved SSA based on an overall improvement to the quality of the space catalog. By driving sensor tasking and scheduling based on predicted Information Gain and other relevant factors, better decisions are made in the application of available sensor resources, leading to an improved catalog and better information about the objects of most interest. The Heimdall software solution provides a configurable, automated system to improve sensor tasking efficiency and responsiveness for SSA applications. The FISST algorithms for Track Prioritization, SSA specific task and resource attributes, Scheduler algorithms, and configurable SSA-specific Figure-of-Merit together provide optimized and tunable scheduling for the Maui Space Surveillance Site and possibly other sites and organizations across the U.S. military and for allies around the world.
Barrán-Berdón, Ana L; Yélamos, Belén; Malfois, Marc; Aicart, Emilio; Junquera, Elena
2014-10-07
Several experimental methods, such as zeta potential, gel electrophoresis, small-angle X-ray scattering, gene transfection, fluorescence microscopy, flow cytometry, and cell viability/cytotoxicity assays, have been used to analyze the potential of anionic lipids (AL) as effective nontoxic and nonviral DNA vectors, assisted by divalent cations. The lipoplexes studied are those comprised of the green fluorescent protein-encoding plasmid DNA pEGFP-C3, an anionic lipid as 1,2-dioleoyl-sn-glycero-3-phospho-(1'-rac-glycerol) (DOPG) or 1,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS), and a zwitterionic lipid, the 1,2-dioleoyl-sn -glycero-3-phosphatidylethanolamine (DOPE, not charged at physiological pH). The studies have been carried on at different liposome and lipoplex compositions and in the presence of a variety of [Ca2+]. Electrochemical experiments reveal that DOPG/DOPE and DOPS/DOPE anionic liposomes may compact more effectively pDNA at low molar fractions (with an excess of DOPE) and at AL/pDNA ratios ≈20. Calcium concentrations around 15-20 mM are needed to yield lipoplexes neutral or slightly positive. From a structural standpoint, DOPG/DOPE-Ca2+-pDNA lipoplexes are self-assembled into a HIIc phase (inverted cylindrical micelles in hexagonal ordering with plasmid supercoils inside the cylinders), while DOPS/DOPE-Ca2+-pDNA lipoplexes show two phases in coexistence: one classical HIIc phase which contains pDNA supercoils and one Lα phase without pDNA among the lamellae, i.e., a lamellar stack of lipidic bilayers held together by Ca2+ bridges. Transfection and cell viability studies were done with HEK293T and HeLa cells in the presence of serum. Lipoplexes herein studied show moderate-to-low transfection levels combined with moderate-to-high cell viability, comparable to those yield by Lipofectamine2000*, which is a cationic lipid (CL) standard formulation, but none of them improve the output of typical CL gen vectors, mostly if they are gemini or dendritic. This fact would be indicating that, nowadays, lipofection via anionic lipids and divalent cations as mediators still needs to enhance transfection levels in order to be considered as a real and plausible alternative to lipofection through improved CLs-based lipoplexes.
Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.
Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel
2018-06-16
ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.
Parreira, Valeria R.; Costa, Marcio; Eikmeyer, Felix; Blom, Jochen; Prescott, John F.
2012-01-01
Twenty-six isolates of Clostridium perfringens of different MLST types from chickens with necrotic enteritis (NE) (15 netB-positive) or from healthy chickens (6 netB-positive, 5 netB-negative) were found to contain 1–4 large plasmids, with most netB-positive isolates containing 3 large and variably sized plasmids which were more numerous and larger than plasmids in netB-negative isolates. NetB and cpb2 were found on different plasmids consistent with previous studies. The pathogenicity locus NELoc1, which includes netB, was largely conserved in these plasmids whereas NeLoc3, present in the cpb2 containing plasmids, was less well conserved. A netB-positive and a cpb2-positive plasmid were likely to be conjugative, and the plasmids were completely sequenced. Both plasmids possessed the intact tcp conjugative region characteristic of C. perfringens conjugative plasmids. Comparative genomic analysis of nine CpCPs, including the two plasmids described here, showed extensive gene rearrangements including pathogenicity locus and accessory gene insertions around rather than within the backbone region. The pattern that emerges from this analysis is that the major toxin-containing regions of the variety of virulence-associated CpCPs are organized as complex pathogenicity loci. How these different but related CpCPs can co-exist in the same host has been an unanswered question. Analysis of the replication-partition region of these plasmids suggests that this region controls plasmid incompatibility, and that CpCPs can be grouped into at least four incompatibility groups. PMID:23189158
Parreira, Valeria R; Costa, Marcio; Eikmeyer, Felix; Blom, Jochen; Prescott, John F
2012-01-01
Twenty-six isolates of Clostridium perfringens of different MLST types from chickens with necrotic enteritis (NE) (15 netB-positive) or from healthy chickens (6 netB-positive, 5 netB-negative) were found to contain 1-4 large plasmids, with most netB-positive isolates containing 3 large and variably sized plasmids which were more numerous and larger than plasmids in netB-negative isolates. NetB and cpb2 were found on different plasmids consistent with previous studies. The pathogenicity locus NELoc1, which includes netB, was largely conserved in these plasmids whereas NeLoc3, present in the cpb2 containing plasmids, was less well conserved. A netB-positive and a cpb2-positive plasmid were likely to be conjugative, and the plasmids were completely sequenced. Both plasmids possessed the intact tcp conjugative region characteristic of C. perfringens conjugative plasmids. Comparative genomic analysis of nine CpCPs, including the two plasmids described here, showed extensive gene rearrangements including pathogenicity locus and accessory gene insertions around rather than within the backbone region. The pattern that emerges from this analysis is that the major toxin-containing regions of the variety of virulence-associated CpCPs are organized as complex pathogenicity loci. How these different but related CpCPs can co-exist in the same host has been an unanswered question. Analysis of the replication-partition region of these plasmids suggests that this region controls plasmid incompatibility, and that CpCPs can be grouped into at least four incompatibility groups.
Diverse Broad-Host-Range Plasmids from Freshwater Carry Few Accessory Genes
Sen, Diya; Yano, Hirokazu; Bauer, Matthew L.; Rogers, Linda M.; Van der Auwera, Geraldine A.
2013-01-01
Broad-host-range self-transferable plasmids are known to facilitate bacterial adaptation by spreading genes between phylogenetically distinct hosts. These plasmids typically have a conserved backbone region and a variable accessory region that encodes host-beneficial traits. We do not know, however, how well plasmids that do not encode accessory functions can survive in nature. The goal of this study was to characterize the backbone and accessory gene content of plasmids that were captured from freshwater sources without selecting for a particular phenotype or cultivating their host. To do this, triparental matings were used such that the only required phenotype was the plasmid's ability to mobilize a nonconjugative plasmid. Based on complete genome sequences of 10 plasmids, only 5 carried identifiable accessory gene regions, and none carried antibiotic resistance genes. The plasmids belong to four known incompatibility groups (IncN, IncP-1, IncU, and IncW) and two potentially new groups. Eight of the plasmids were shown to have a broad host range, being able to transfer into alpha-, beta-, and gammaproteobacteria. Because of the absence of antibiotic resistance genes, we resampled one of the sites and compared the proportion of captured plasmids that conferred antibiotic resistance to their hosts with the proportion of such plasmids captured from the effluent of a local wastewater treatment plant. Few of the captured plasmids from either site encoded antibiotic resistance. A high diversity of plasmids that encode no or unknown accessory functions is thus readily found in freshwater habitats. The question remains how the plasmids persist in these microbial communities. PMID:24096417
Davis, R; Vapnek, D
1976-01-01
The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321
Wang, Jie-sheng; Han, Shuang; Shen, Na-na; Li, Shu-xia
2014-01-01
For meeting the forecasting target of key technology indicators in the flotation process, a BP neural network soft-sensor model based on features extraction of flotation froth images and optimized by shuffled cuckoo search algorithm is proposed. Based on the digital image processing technique, the color features in HSI color space, the visual features based on the gray level cooccurrence matrix, and the shape characteristics based on the geometric theory of flotation froth images are extracted, respectively, as the input variables of the proposed soft-sensor model. Then the isometric mapping method is used to reduce the input dimension, the network size, and learning time of BP neural network. Finally, a shuffled cuckoo search algorithm is adopted to optimize the BP neural network soft-sensor model. Simulation results show that the model has better generalization results and prediction accuracy. PMID:25133210
Li, Chuang; Cordovilla, Francisco; Jagdheesh, R.
2018-01-01
This paper presents a novel structural piezoresistive pressure sensor with four-grooved membrane combined with rood beam to measure low pressure. In this investigation, the design, optimization, fabrication, and measurements of the sensor are involved. By analyzing the stress distribution and deflection of sensitive elements using finite element method, a novel structure featuring high concentrated stress profile (HCSP) and locally stiffened membrane (LSM) is built. Curve fittings of the mechanical stress and deflection based on FEM simulation results are performed to establish the relationship between mechanical performance and structure dimension. A combination of FEM and curve fitting method is carried out to determine the structural dimensions. The optimized sensor chip is fabricated on a SOI wafer by traditional MEMS bulk-micromachining and anodic bonding technology. When the applied pressure is 1 psi, the sensor achieves a sensitivity of 30.9 mV/V/psi, a pressure nonlinearity of 0.21% FSS and an accuracy of 0.30%, and thereby the contradiction between sensitivity and linearity is alleviated. In terms of size, accuracy and high temperature characteristic, the proposed sensor is a proper choice for measuring pressure of less than 1 psi. PMID:29393916
Moreno-Salinas, David; Pascoal, Antonio; Aranda, Joaquin
2013-08-12
In this paper, we address the problem of determining the optimal geometric configuration of an acoustic sensor network that will maximize the angle-related information available for underwater target positioning. In the set-up adopted, a set of autonomous vehicles carries a network of acoustic units that measure the elevation and azimuth angles between a target and each of the receivers on board the vehicles. It is assumed that the angle measurements are corrupted by white Gaussian noise, the variance of which is distance-dependent. Using tools from estimation theory, the problem is converted into that of minimizing, by proper choice of the sensor positions, the trace of the inverse of the Fisher Information Matrix (also called the Cramer-Rao Bound matrix) to determine the sensor configuration that yields the minimum possible covariance of any unbiased target estimator. It is shown that the optimal configuration of the sensors depends explicitly on the intensity of the measurement noise, the constraints imposed on the sensor configuration, the target depth and the probabilistic distribution that defines the prior uncertainty in the target position. Simulation examples illustrate the key results derived.
Shape Control of Plates with Piezo Actuators and Collocated Position/Rate Sensors
NASA Technical Reports Server (NTRS)
Balakrishnan, A. V.
1994-01-01
This paper treats the control problem of shaping the surface deformation of a circular plate using embedded piezo-electric actuators and collocated rate sensors. An explicit Linear Quadratic Gaussian (LQG) optimizer stability augmentation compensator is derived as well as the optimal feed-forward control. Corresponding performance evaluation formulas are also derived.
Shape Control of Plates with Piezo Actuators and Collocated Position/Rate Sensors
NASA Technical Reports Server (NTRS)
Balakrishnan, A. V.
1994-01-01
This paper treats the control problem of shaping the surface deformation of a circular plate using embedded piezo-electric actuator and collocated rate sensors. An explicit Linear Quadratic Gaussian (LQG) optimizer stability augmentation compensator is derived as well as the optimal feed-forward control. Corresponding performance evaluation formulas are also derived.
An Optimal Algorithm towards Successive Location Privacy in Sensor Networks with Dynamic Programming
NASA Astrophysics Data System (ADS)
Zhao, Baokang; Wang, Dan; Shao, Zili; Cao, Jiannong; Chan, Keith C. C.; Su, Jinshu
In wireless sensor networks, preserving location privacy under successive inference attacks is extremely critical. Although this problem is NP-complete in general cases, we propose a dynamic programming based algorithm and prove it is optimal in special cases where the correlation only exists between p immediate adjacent observations.
Determination of a temperature sensor location for monitoring weld pool size in GMAW
DOE Office of Scientific and Technical Information (OSTI.GOV)
Boo, K.S.; Cho, H.S.
1994-11-01
This paper describes a method of determining the optimal sensor location to measure weldment surface temperature, which has a close correlation with weld pool size in the gas metal arc (GMA) welding process. Due to the inherent complexity and nonlinearity in the GMA welding process, the relationship between the weldment surface temperature and the weld pool size varies with the point of measurement. This necessitates an optimal selection of the measurement point to minimize the process nonlinearity effect in estimating the weld pool size from the measured temperature. To determine the optimal sensor location on the top surface of themore » weldment, the correlation between the measured temperature and the weld pool size is analyzed. The analysis is done by calculating the correlation function, which is based upon an analytical temperature distribution model. To validate the optimal sensor location, a series of GMA bead-on-plate welds are performed on a medium-carbon steel under various welding conditions. A comparison study is given in detail based upon the simulation and experimental results.« less
NASA Astrophysics Data System (ADS)
Cioaca, Alexandru
A deep scientific understanding of complex physical systems, such as the atmosphere, can be achieved neither by direct measurements nor by numerical simulations alone. Data assimila- tion is a rigorous procedure to fuse information from a priori knowledge of the system state, the physical laws governing the evolution of the system, and real measurements, all with associated error statistics. Data assimilation produces best (a posteriori) estimates of model states and parameter values, and results in considerably improved computer simulations. The acquisition and use of observations in data assimilation raises several important scientific questions related to optimal sensor network design, quantification of data impact, pruning redundant data, and identifying the most beneficial additional observations. These questions originate in operational data assimilation practice, and have started to attract considerable interest in the recent past. This dissertation advances the state of knowledge in four dimensional variational (4D-Var) data assimilation by developing, implementing, and validating a novel computational framework for estimating observation impact and for optimizing sensor networks. The framework builds on the powerful methodologies of second-order adjoint modeling and the 4D-Var sensitivity equations. Efficient computational approaches for quantifying the observation impact include matrix free linear algebra algorithms and low-rank approximations of the sensitivities to observations. The sensor network configuration problem is formulated as a meta-optimization problem. Best values for parameters such as sensor location are obtained by optimizing a performance criterion, subject to the constraint posed by the 4D-Var optimization. Tractable computational solutions to this "optimization-constrained" optimization problem are provided. The results of this work can be directly applied to the deployment of intelligent sensors and adaptive observations, as well as to reducing the operating costs of measuring networks, while preserving their ability to capture the essential features of the system under consideration.
Kyselková, Martina; Chrudimský, Tomáš; Husník, Filip; Chroňáková, Alica; Heuer, Holger; Smalla, Kornelia; Elhottová, Dana
2016-06-01
Manure from dairy farms has been shown to contain diverse tetracycline resistance genes that are transferable to soil. Here, we focus on conjugative plasmids that may spread tetracycline resistance at a conventional dairy farm. We performed exogenous plasmid isolation from cattle feces using chlortetracycline for transconjugant selection. The transconjugants obtained harbored LowGC-type plasmids and tet(Y). A representative plasmid (pFK2-7) was fully sequenced and this was compared with previously described LowGC plasmids from piggery manure-treated soil and a GenBank record from Acinetobacter nosocomialis that we also identified as a LowGC plasmid. The pFK2-7 plasmid had the conservative backbone typical of LowGC plasmids, though this region was interrupted with an insert containing the tet(Y)-tet(R) tetracycline resistance genes and the strA-strB streptomycin resistance genes. Despite Acinetobacter populations being considered natural hosts of LowGC plasmids, these plasmids were not found in three Acinetobacter isolates from the study farm. The isolates harbored tet(Y)-tet(R) genes in identical genetic surroundings as pFK2-7, however, suggesting genetic exchange between Acinetobacter and LowGC plasmids. Abundance of LowGC plasmids and tet(Y) was correlated in manure and soil samples from the farm, indicating that LowGC plasmids may be involved in the spread of tet(Y) in the environment. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Optimizing Sensor and Actuator Arrays for ASAC Noise Control
NASA Technical Reports Server (NTRS)
Palumbo, Dan; Cabell, Ran
2000-01-01
This paper summarizes the development of an approach to optimizing the locations for arrays of sensors and actuators in active noise control systems. A type of directed combinatorial search, called Tabu Search, is used to select an optimal configuration from a much larger set of candidate locations. The benefit of using an optimized set is demonstrated. The importance of limiting actuator forces to realistic levels when evaluating the cost function is discussed. Results of flight testing an optimized system are presented. Although the technique has been applied primarily to Active Structural Acoustic Control systems, it can be adapted for use in other active noise control implementations.
Point Cloud Refinement with a Target-Free Intrinsic Calibration of a Mobile Multi-Beam LIDAR System
NASA Astrophysics Data System (ADS)
Nouiraa, H.; Deschaud, J. E.; Goulettea, F.
2016-06-01
LIDAR sensors are widely used in mobile mapping systems. The mobile mapping platforms allow to have fast acquisition in cities for example, which would take much longer with static mapping systems. The LIDAR sensors provide reliable and precise 3D information, which can be used in various applications: mapping of the environment; localization of objects; detection of changes. Also, with the recent developments, multi-beam LIDAR sensors have appeared, and are able to provide a high amount of data with a high level of detail. A mono-beam LIDAR sensor mounted on a mobile platform will have an extrinsic calibration to be done, so the data acquired and registered in the sensor reference frame can be represented in the body reference frame, modeling the mobile system. For a multibeam LIDAR sensor, we can separate its calibration into two distinct parts: on one hand, we have an extrinsic calibration, in common with mono-beam LIDAR sensors, which gives the transformation between the sensor cartesian reference frame and the body reference frame. On the other hand, there is an intrinsic calibration, which gives the relations between the beams of the multi-beam sensor. This calibration depends on a model given by the constructor, but the model can be non optimal, which would bring errors and noise into the acquired point clouds. In the litterature, some optimizations of the calibration parameters are proposed, but need a specific routine or environment, which can be constraining and time-consuming. In this article, we present an automatic method for improving the intrinsic calibration of a multi-beam LIDAR sensor, the Velodyne HDL-32E. The proposed approach does not need any calibration target, and only uses information from the acquired point clouds, which makes it simple and fast to use. Also, a corrected model for the Velodyne sensor is proposed. An energy function which penalizes points far from local planar surfaces is used to optimize the different proposed parameters for the corrected model, and we are able to give a confidence value for the calibration parameters found. Optimization results on both synthetic and real data are presented.
Design and performance of an integrated ground and space sensor web for monitoring active volcanoes.
NASA Astrophysics Data System (ADS)
Lahusen, Richard; Song, Wenzhan; Kedar, Sharon; Shirazi, Behrooz; Chien, Steve; Doubleday, Joshua; Davies, Ashley; Webb, Frank; Dzurisin, Dan; Pallister, John
2010-05-01
An interdisciplinary team of computer, earth and space scientists collaborated to develop a sensor web system for rapid deployment at active volcanoes. The primary goals of this Optimized Autonomous Space In situ Sensorweb (OASIS) are to: 1) integrate complementary space and in situ (ground-based) elements into an interactive, autonomous sensor web; 2) advance sensor web power and communication resource management technology; and 3) enable scalability for seamless addition sensors and other satellites into the sensor web. This three-year project began with a rigorous multidisciplinary interchange that resulted in definition of system requirements to guide the design of the OASIS network and to achieve the stated project goals. Based on those guidelines, we have developed fully self-contained in situ nodes that integrate GPS, seismic, infrasonic and lightning (ash) detection sensors. The nodes in the wireless sensor network are linked to the ground control center through a mesh network that is highly optimized for remote geophysical monitoring. OASIS also features an autonomous bidirectional interaction between ground nodes and instruments on the EO-1 space platform through continuous analysis and messaging capabilities at the command and control center. Data from both the in situ sensors and satellite-borne hyperspectral imaging sensors stream into a common database for real-time visualization and analysis by earth scientists. We have successfully completed a field deployment of 15 nodes within the crater and on the flanks of Mount St. Helens, Washington. The demonstration that sensor web technology facilitates rapid network deployments and that we can achieve real-time continuous data acquisition. We are now optimizing component performance and improving user interaction for additional deployments at erupting volcanoes in 2010.
An Energy-Efficient Approach to Enhance Virtual Sensors Provisioning in Sensor Clouds Environments
Filho, Raimir Holanda; Rabêlo, Ricardo de Andrade L.; de Carvalho, Carlos Giovanni N.; Mendes, Douglas Lopes de S.; Costa, Valney da Gama
2018-01-01
Virtual sensors provisioning is a central issue for sensors cloud middleware since it is responsible for selecting physical nodes, usually from Wireless Sensor Networks (WSN) of different owners, to handle user’s queries or applications. Recent works perform provisioning by clustering sensor nodes based on the correlation measurements and then selecting as few nodes as possible to preserve WSN energy. However, such works consider only homogeneous nodes (same set of sensors). Therefore, those works are not entirely appropriate for sensor clouds, which in most cases comprises heterogeneous sensor nodes. In this paper, we propose ACxSIMv2, an approach to enhance the provisioning task by considering heterogeneous environments. Two main algorithms form ACxSIMv2. The first one, ACASIMv1, creates multi-dimensional clusters of sensor nodes, taking into account the measurements correlations instead of the physical distance between nodes like most works on literature. Then, the second algorithm, ACOSIMv2, based on an Ant Colony Optimization system, selects an optimal set of sensors nodes from to respond user’s queries while attending all parameters and preserving the overall energy consumption. Results from initial experiments show that the approach reduces significantly the sensor cloud energy consumption compared to traditional works, providing a solution to be considered in sensor cloud scenarios. PMID:29495406
An Energy-Efficient Approach to Enhance Virtual Sensors Provisioning in Sensor Clouds Environments.
Lemos, Marcus Vinícius de S; Filho, Raimir Holanda; Rabêlo, Ricardo de Andrade L; de Carvalho, Carlos Giovanni N; Mendes, Douglas Lopes de S; Costa, Valney da Gama
2018-02-26
Virtual sensors provisioning is a central issue for sensors cloud middleware since it is responsible for selecting physical nodes, usually from Wireless Sensor Networks (WSN) of different owners, to handle user's queries or applications. Recent works perform provisioning by clustering sensor nodes based on the correlation measurements and then selecting as few nodes as possible to preserve WSN energy. However, such works consider only homogeneous nodes (same set of sensors). Therefore, those works are not entirely appropriate for sensor clouds, which in most cases comprises heterogeneous sensor nodes. In this paper, we propose ACxSIMv2, an approach to enhance the provisioning task by considering heterogeneous environments. Two main algorithms form ACxSIMv2. The first one, ACASIMv1, creates multi-dimensional clusters of sensor nodes, taking into account the measurements correlations instead of the physical distance between nodes like most works on literature. Then, the second algorithm, ACOSIMv2, based on an Ant Colony Optimization system, selects an optimal set of sensors nodes from to respond user's queries while attending all parameters and preserving the overall energy consumption. Results from initial experiments show that the approach reduces significantly the sensor cloud energy consumption compared to traditional works, providing a solution to be considered in sensor cloud scenarios.
Aneja, Manish Kumar; Geiger, Johannes; Imker, Rabea; Uzgun, Senta; Kormann, Michael; Hasenpusch, Guenther; Maucksch, Christof; Rudolph, Carsten
2009-12-31
phi C31 integrase has emerged as a potent tool for achieving long-term gene expression in different tissues. The present study aimed at optimizing elements of phi C31 integrase system for alveolar type II cells. Luciferase and beta-galactosidase activities were measured at different time points post transfection. 5-Aza-2'deoxycytidine (AZA) and trichostatin A (TSA) were used to inhibit DNA methyltransferase and histone deacetylase complex (HDAC) respectively. In A549 cells, expression of the integrase using a CMV promoter resulted in highest integrase activity, whereas in MLE12 cells, both CAG and CMV promoter were equally effective. Effect of polyA site was observed only in A549 cells, where replacement of SV40 polyA by bovine growth hormone (BGH) polyA site resulted in an enhancement of integrase activity. Addition of a C-terminal SV40 nuclear localization signal (NLS) did not result in any significant increase in integrase activity. Long-term expression studies with AZA and TSA, provided evidence for post-integrative gene silencing. In MLE12 cells, both DNA methylases and HDACs played a significant role in silencing, whereas in A549 cells, it could be attributed majorly to HDAC activity. Donor plasmids comprising cellular promoters ubiquitin B (UBB), ubiquitin C (UCC) and elongation factor 1 alpha (EF1 alpha) in an improved backbone prevented post-integrative gene silencing. In contrast to A549 and MLE12 cells, no silencing could be observed in human bronchial epithelial cells, BEAS-2B. Donor plasmid coding for murine erythropoietin under the EF1 alpha promoter when combined with phi C31 integrase resulted in higher long-term erythropoietin expression and subsequently higher hematocrit levels in mice after intravenous delivery to the lungs. These results provide evidence for cell specific post integrative gene silencing with C31 integrase and demonstrate the pivotal role of donor plasmid in long-term expression attained with this system.
Joint Power Charging and Routing in Wireless Rechargeable Sensor Networks.
Jia, Jie; Chen, Jian; Deng, Yansha; Wang, Xingwei; Aghvami, Abdol-Hamid
2017-10-09
The development of wireless power transfer (WPT) technology has inspired the transition from traditional battery-based wireless sensor networks (WSNs) towards wireless rechargeable sensor networks (WRSNs). While extensive efforts have been made to improve charging efficiency, little has been done for routing optimization. In this work, we present a joint optimization model to maximize both charging efficiency and routing structure. By analyzing the structure of the optimization model, we first decompose the problem and propose a heuristic algorithm to find the optimal charging efficiency for the predefined routing tree. Furthermore, by coding the many-to-one communication topology as an individual, we further propose to apply a genetic algorithm (GA) for the joint optimization of both routing and charging. The genetic operations, including tree-based recombination and mutation, are proposed to obtain a fast convergence. Our simulation results show that the heuristic algorithm reduces the number of resident locations and the total moving distance. We also show that our proposed algorithm achieves a higher charging efficiency compared with existing algorithms.
Yao, Ke-Han; Jiang, Jehn-Ruey; Tsai, Chung-Hsien; Wu, Zong-Syun
2017-01-01
This paper investigates how to efficiently charge sensor nodes in a wireless rechargeable sensor network (WRSN) with radio frequency (RF) chargers to make the network sustainable. An RF charger is assumed to be equipped with a uniform circular array (UCA) of 12 antennas with the radius λ, where λ is the RF wavelength. The UCA can steer most RF energy in a target direction to charge a specific WRSN node by the beamforming technology. Two evolutionary algorithms (EAs) using the evolution strategy (ES), namely the Evolutionary Beamforming Optimization (EBO) algorithm and the Evolutionary Beamforming Optimization Reseeding (EBO-R) algorithm, are proposed to nearly optimize the power ratio of the UCA beamforming peak side lobe (PSL) and the main lobe (ML) aimed at the given target direction. The proposed algorithms are simulated for performance evaluation and are compared with a related algorithm, called Particle Swarm Optimization Gravitational Search Algorithm-Explore (PSOGSA-Explore), to show their superiority. PMID:28825648
Joint Power Charging and Routing in Wireless Rechargeable Sensor Networks
Jia, Jie; Chen, Jian; Deng, Yansha; Wang, Xingwei; Aghvami, Abdol-Hamid
2017-01-01
The development of wireless power transfer (WPT) technology has inspired the transition from traditional battery-based wireless sensor networks (WSNs) towards wireless rechargeable sensor networks (WRSNs). While extensive efforts have been made to improve charging efficiency, little has been done for routing optimization. In this work, we present a joint optimization model to maximize both charging efficiency and routing structure. By analyzing the structure of the optimization model, we first decompose the problem and propose a heuristic algorithm to find the optimal charging efficiency for the predefined routing tree. Furthermore, by coding the many-to-one communication topology as an individual, we further propose to apply a genetic algorithm (GA) for the joint optimization of both routing and charging. The genetic operations, including tree-based recombination and mutation, are proposed to obtain a fast convergence. Our simulation results show that the heuristic algorithm reduces the number of resident locations and the total moving distance. We also show that our proposed algorithm achieves a higher charging efficiency compared with existing algorithms. PMID:28991200
NASA Astrophysics Data System (ADS)
Petra, N.; Alexanderian, A.; Stadler, G.; Ghattas, O.
2015-12-01
We address the problem of optimal experimental design (OED) for Bayesian nonlinear inverse problems governed by partial differential equations (PDEs). The inverse problem seeks to infer a parameter field (e.g., the log permeability field in a porous medium flow model problem) from synthetic observations at a set of sensor locations and from the governing PDEs. The goal of the OED problem is to find an optimal placement of sensors so as to minimize the uncertainty in the inferred parameter field. We formulate the OED objective function by generalizing the classical A-optimal experimental design criterion using the expected value of the trace of the posterior covariance. This expected value is computed through sample averaging over the set of likely experimental data. Due to the infinite-dimensional character of the parameter field, we seek an optimization method that solves the OED problem at a cost (measured in the number of forward PDE solves) that is independent of both the parameter and the sensor dimension. To facilitate this goal, we construct a Gaussian approximation to the posterior at the maximum a posteriori probability (MAP) point, and use the resulting covariance operator to define the OED objective function. We use randomized trace estimation to compute the trace of this covariance operator. The resulting OED problem includes as constraints the system of PDEs characterizing the MAP point, and the PDEs describing the action of the covariance (of the Gaussian approximation to the posterior) to vectors. We control the sparsity of the sensor configurations using sparsifying penalty functions, and solve the resulting penalized bilevel optimization problem via an interior-point quasi-Newton method, where gradient information is computed via adjoints. We elaborate our OED method for the problem of determining the optimal sensor configuration to best infer the log permeability field in a porous medium flow problem. Numerical results show that the number of PDE solves required for the evaluation of the OED objective function and its gradient is essentially independent of both the parameter dimension and the sensor dimension (i.e., the number of candidate sensor locations). The number of quasi-Newton iterations for computing an OED also exhibits the same dimension invariance properties.
Orlek, Alex; Phan, Hang; Sheppard, Anna E; Doumith, Michel; Ellington, Matthew; Peto, Tim; Crook, Derrick; Walker, A Sarah; Woodford, Neil; Anjum, Muna F; Stoesser, Nicole
2017-05-01
Plasmid typing can provide insights into the epidemiology and transmission of plasmid-mediated antibiotic resistance. The principal plasmid typing schemes are replicon typing and MOB typing, which utilize variation in replication loci and relaxase proteins respectively. Previous studies investigating the proportion of plasmids assigned a type by these schemes ('typeability') have yielded conflicting results; moreover, thousands of plasmid sequences have been added to NCBI in recent years, without consistent annotation to indicate which sequences represent complete plasmids. Here, a curated dataset of complete Enterobacteriaceae plasmids from NCBI was compiled, and used to assess the typeability and concordance of in silico replicon and MOB typing schemes. Concordance was assessed at hierarchical replicon type resolutions, from replicon family-level to plasmid multilocus sequence type (pMLST)-level, where available. We found that 85% and 65% of the curated plasmids could be replicon and MOB typed, respectively. Overall, plasmid size and the number of resistance genes were significant independent predictors of replicon and MOB typing success. We found some degree of non-concordance between replicon families and MOB types, which was only partly resolved when partitioning plasmids into finer-resolution groups (replicon and pMLST types). In some cases, non-concordance was attributed to ambiguous boundaries between MOBP and MOBQ types; in other cases, backbone mosaicism was considered a more plausible explanation. β-lactamase resistance genes tended not to show fidelity to a particular plasmid type, though some previously reported associations were supported. Overall, replicon and MOB typing schemes are likely to continue playing an important role in plasmid analysis, but their performance is constrained by the diverse and dynamic nature of plasmid genomes. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Chen, Chin-Yi; Strobaugh, Terence P; Nguyen, Ly-Huong T; Abley, Melanie; Lindsey, Rebecca L; Jackson, Charlene R
2018-01-01
While antimicrobial resistance in Salmonella enterica is mainly attributed to large plasmids, small plasmids may also harbor antimicrobial resistance genes. Previously, three major groups of ColE1-like plasmids conferring kanamycin-resistance (KanR) in various S. enterica serotypes from diagnostic samples of human or animals were reported. In this study, over 200 KanR S. enterica isolates from slaughter samples, collected in 2010 and 2011 as a part of the animal arm of the National Antimicrobial Resistance Monitoring System, were screened for the presence of ColE1-like plasmids. Twenty-three KanR ColE1-like plasmids were successfully isolated. Restriction fragment mapping revealed five major plasmid groups with subgroups, including two new groups, X (n = 3) and Y/Y2/Y3 (n = 4), in addition to the previously identified groups A (n = 7), B (n = 6), and C/C3 (n = 3). Nearly 75% of the plasmid-carrying isolates were from turkey and included all the isolates carrying X and Y plasmids. All group X plasmids were from serotype Hadar. Serotype Senftenberg carried all the group Y plasmids and one group B plasmid. All Typhimurium isolates (n = 4) carried group A plasmids, while Newport isolates (n = 3) each carried a different plasmid group (A, B, or C). The presence of the selection bias in the NARMS strain collection prevents interpretation of findings at the population level. However, this study demonstrated that KanR ColE1-like plasmids are widely distributed among different S. enterica serotypes in the NARMS isolates and may play a role in dissemination of antimicrobial resistance genes.
Strobaugh, Terence P.; Nguyen, Ly-Huong T.; Abley, Melanie; Lindsey, Rebecca L.; Jackson, Charlene R.
2018-01-01
While antimicrobial resistance in Salmonella enterica is mainly attributed to large plasmids, small plasmids may also harbor antimicrobial resistance genes. Previously, three major groups of ColE1-like plasmids conferring kanamycin-resistance (KanR) in various S. enterica serotypes from diagnostic samples of human or animals were reported. In this study, over 200 KanR S. enterica isolates from slaughter samples, collected in 2010 and 2011 as a part of the animal arm of the National Antimicrobial Resistance Monitoring System, were screened for the presence of ColE1-like plasmids. Twenty-three KanR ColE1-like plasmids were successfully isolated. Restriction fragment mapping revealed five major plasmid groups with subgroups, including two new groups, X (n = 3) and Y/Y2/Y3 (n = 4), in addition to the previously identified groups A (n = 7), B (n = 6), and C/C3 (n = 3). Nearly 75% of the plasmid-carrying isolates were from turkey and included all the isolates carrying X and Y plasmids. All group X plasmids were from serotype Hadar. Serotype Senftenberg carried all the group Y plasmids and one group B plasmid. All Typhimurium isolates (n = 4) carried group A plasmids, while Newport isolates (n = 3) each carried a different plasmid group (A, B, or C). The presence of the selection bias in the NARMS strain collection prevents interpretation of findings at the population level. However, this study demonstrated that KanR ColE1-like plasmids are widely distributed among different S. enterica serotypes in the NARMS isolates and may play a role in dissemination of antimicrobial resistance genes. PMID:29513730
Zheng, Jinshui; Peng, Donghai; Ruan, Lifang; Sun, Ming
2013-12-02
Plasmids play a crucial role in the evolution of bacterial genomes by mediating horizontal gene transfer. However, the origin and evolution of most plasmids remains unclear, especially for megaplasmids. Strains of the Bacillus cereus group contain up to 13 plasmids with genome sizes ranging from 2 kb to 600 kb, and thus can be used to study plasmid dynamics and evolution. This work studied the origin and evolution of 31 B. cereus group megaplasmids (>100 kb) focusing on the most conserved regions on plasmids, minireplicons. Sixty-five putative minireplicons were identified and classified to six types on the basis of proteins that are essential for replication. Twenty-nine of the 31 megaplasmids contained two or more minireplicons. Phylogenetic analysis of the protein sequences showed that different minireplicons on the same megaplasmid have different evolutionary histories. Therefore, we speculated that these megaplasmids are the results of fusion of smaller plasmids. All plasmids of a bacterial strain must be compatible. In megaplasmids of the B. cereus group, individual minireplicons of different megaplasmids in the same strain belong to different types or subtypes. Thus, the subtypes of each minireplicon they contain may determine the incompatibilities of megaplasmids. A broader analysis of all 1285 bacterial plasmids with putative known minireplicons whose complete genome sequences were available from GenBank revealed that 34% (443 plasmids) of the plasmids have two or more minireplicons. This indicates that plasmid fusion events are general among bacterial plasmids. Megaplasmids of B. cereus group are fusion of smaller plasmids, and the fusion of plasmids likely occurs frequently in the B. cereus group and in other bacterial taxa. Plasmid fusion may be one of the major mechanisms for formation of novel megaplasmids in the evolution of bacteria.
Garcillán-Barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; de la Cruz, Fernando
2014-01-01
Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ–proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143
Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando
2014-12-01
Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.
Low-Cost Ultrasonic Distance Sensor Arrays with Networked Error Correction
Dai, Hongjun; Zhao, Shulin; Jia, Zhiping; Chen, Tianzhou
2013-01-01
Distance has been one of the basic factors in manufacturing and control fields, and ultrasonic distance sensors have been widely used as a low-cost measuring tool. However, the propagation of ultrasonic waves is greatly affected by environmental factors such as temperature, humidity and atmospheric pressure. In order to solve the problem of inaccurate measurement, which is significant within industry, this paper presents a novel ultrasonic distance sensor model using networked error correction (NEC) trained on experimental data. This is more accurate than other existing approaches because it uses information from indirect association with neighboring sensors, which has not been considered before. The NEC technique, focusing on optimization of the relationship of the topological structure of sensor arrays, is implemented for the compensation of erroneous measurements caused by the environment. We apply the maximum likelihood method to determine the optimal fusion data set and use a neighbor discovery algorithm to identify neighbor nodes at the top speed. Furthermore, we adopt the NEC optimization algorithm, which takes full advantage of the correlation coefficients for neighbor sensors. The experimental results demonstrate that the ranging errors of the NEC system are within 2.20%; furthermore, the mean absolute percentage error is reduced to 0.01% after three iterations of this method, which means that the proposed method performs extremely well. The optimized method of distance measurement we propose, with the capability of NEC, would bring a significant advantage for intelligent industrial automation. PMID:24013491
Optimal full motion video registration with rigorous error propagation
NASA Astrophysics Data System (ADS)
Dolloff, John; Hottel, Bryant; Doucette, Peter; Theiss, Henry; Jocher, Glenn
2014-06-01
Optimal full motion video (FMV) registration is a crucial need for the Geospatial community. It is required for subsequent and optimal geopositioning with simultaneous and reliable accuracy prediction. An overall approach being developed for such registration is presented that models relevant error sources in terms of the expected magnitude and correlation of sensor errors. The corresponding estimator is selected based on the level of accuracy of the a priori information of the sensor's trajectory and attitude (pointing) information, in order to best deal with non-linearity effects. Estimator choices include near real-time Kalman Filters and batch Weighted Least Squares. Registration solves for corrections to the sensor a priori information for each frame. It also computes and makes available a posteriori accuracy information, i.e., the expected magnitude and correlation of sensor registration errors. Both the registered sensor data and its a posteriori accuracy information are then made available to "down-stream" Multi-Image Geopositioning (MIG) processes. An object of interest is then measured on the registered frames and a multi-image optimal solution, including reliable predicted solution accuracy, is then performed for the object's 3D coordinates. This paper also describes a robust approach to registration when a priori information of sensor attitude is unavailable. It makes use of structure-from-motion principles, but does not use standard Computer Vision techniques, such as estimation of the Essential Matrix which can be very sensitive to noise. The approach used instead is a novel, robust, direct search-based technique.
Optical biosensor optimized for continuous in-line glucose monitoring in animal cell culture.
Tric, Mircea; Lederle, Mario; Neuner, Lisa; Dolgowjasow, Igor; Wiedemann, Philipp; Wölfl, Stefan; Werner, Tobias
2017-09-01
Biosensors for continuous glucose monitoring in bioreactors could provide a valuable tool for optimizing culture conditions in biotechnological applications. We have developed an optical biosensor for long-term continuous glucose monitoring and demonstrated a tight glucose level control during cell culture in disposable bioreactors. The in-line sensor is based on a commercially available oxygen sensor that is coated with cross-linked glucose oxidase (GOD). The dynamic range of the sensor was tuned by a hydrophilic perforated diffusion membrane with an optimized permeability for glucose and oxygen. The biosensor was thoroughly characterized by experimental data and numerical simulations, which enabled insights into the internal concentration profile of the deactivating by-product hydrogen peroxide. The simulations were carried out with a one-dimensional biosensor model and revealed that, in addition to the internal hydrogen peroxide concentration, the turnover rate of the enzyme GOD plays a crucial role for biosensor stability. In the light of this finding, the glucose sensor was optimized to reach a long functional stability (>52 days) under continuous glucose monitoring conditions with a dynamic range of 0-20 mM and a response time of t 90 ≤ 10 min. In addition, we demonstrated that the sensor was sterilizable with beta and UV irradiation and only subjected to minor cross sensitivity to oxygen, when an oxygen reference sensor was applied. Graphical abstract Measuring setup of a glucose biosensor in a shake flask for continuous glucose monitoring in mammalian cell culture.
Plasmid analyses in clinical isolates of Bacteroides fragilis and other Bacteroides species.
Wallace, B L; Bradley, J E; Rogolsky, M
1981-01-01
Plasmid analyses were performed on Bacteroides strains isolated from clinical specimens. Of 32 Bacteroides strains, 8 were found to contain plasmids. Seven of these eight strains were B. fragilis, and the other one was B. distasonis. Three of these eight strains harbored only a 3.0-megadalton plasmid. Two strains had only a 2.0-megadalton plasmid, and one had 2.0-, 3.0-megadalton plasmid. Of the remaining two strains, one had 2.0-, 3.0-, and 5.0-megadalton plasmids, and the other had 3.0- and 5.0-megadalton plasmids. Beta-Lactamase was produced by 93% of the clinical isolates. Seven of the eight plasmid-carrying strains were cadmium resistant, five were zinc resistant, four were mercury resistant, and two expressed a brick-red fluorescence under ultraviolet light. None of these traits could be associated with a plasmid after performing either curing experiments or genetic transfer experiments by cell-to-cell contact. Images PMID:6974737
Hofmeister series salts enhance purification of plasmid DNA by non-ionic detergents
Lezin, George; Kuehn, Michael R.; Brunelli, Luca
2011-01-01
Ion-exchange chromatography is the standard technique used for plasmid DNA purification, an essential molecular biology procedure. Non-ionic detergents (NIDs) have been used for plasmid DNA purification, but it is unclear whether Hofmeister series salts (HSS) change the solubility and phase separation properties of specific NIDs, enhancing plasmid DNA purification. After scaling-up NID-mediated plasmid DNA isolation, we established that NIDs in HSS solutions minimize plasmid DNA contamination with protein. In addition, large-scale NID/HSS solutions eliminated LPS contamination of plasmid DNA more effectively than Qiagen ion-exchange columns. Large-scale NID isolation/NID purification generated increased yields of high quality DNA compared to alkali isolation/column purification. This work characterizes how HSS enhance NID-mediated plasmid DNA purification, and demonstrates that NID phase transition is not necessary for LPS removal from plasmid DNA. Specific NIDs such as IGEPAL CA-520 can be utilized for rapid, inexpensive and efficient laboratory-based large-scale plasmid DNA purification, outperforming Qiagen-based column procedures. PMID:21351074
A quartz-based micro catalytic methane sensor by high resolution screen printing
NASA Astrophysics Data System (ADS)
Lu, Wenshuai; Jing, Gaoshan; Bian, Xiaomeng; Yu, Hongyan; Cui, Tianhong
2016-02-01
A micro catalytic methane sensor was proposed and fabricated on a bulk fused quartz substrate using a high resolution screen printing technique for the first time, with reduced power consumption and optimized sensitivity. The sensor was designed by the finite element method and quartz was chosen as the substrate material and alumina support with optimized dimensions. Fabrication of the sensor consisted of two MEMS processes, lift-off and high resolution screen printing, with the advantages of high yield and uniformity. When the sensor’s regional working temperature changes from 250 °C to 470 °C, its sensitivity increases, as well as the power consumption. The highest sensitivity can reach 1.52 mV/% CH4. A temperature of 300 °C was chosen as the optimized working temperature, and the sensor’s sensitivity, power consumption, nonlinearity and response time are 0.77 mV/% CH4, 415 mW, 2.6%, and 35 s, respectively. This simple, but highly uniform fabrication process and the reliable performance of this sensor may lead to wide applications for methane detection.
Niewiadomska-Szynkiewicz, Ewa; Sikora, Andrzej; Marks, Michał
2016-01-01
Using mobile robots or unmanned vehicles to assist optimal wireless sensors deployment in a working space can significantly enhance the capability to investigate unknown environments. This paper addresses the issues of the application of numerical optimization and computer simulation techniques to on-line calculation of a wireless sensor network topology for monitoring and tracking purposes. We focus on the design of a self-organizing and collaborative mobile network that enables a continuous data transmission to the data sink (base station) and automatically adapts its behavior to changes in the environment to achieve a common goal. The pre-defined and self-configuring approaches to the mobile-based deployment of sensors are compared and discussed. A family of novel algorithms for the optimal placement of mobile wireless devices for permanent monitoring of indoor and outdoor dynamic environments is described. They employ a network connectivity-maintaining mobility model utilizing the concept of the virtual potential function for calculating the motion trajectories of platforms carrying sensors. Their quality and utility have been justified through simulation experiments and are discussed in the final part of the paper. PMID:27649186
Niewiadomska-Szynkiewicz, Ewa; Sikora, Andrzej; Marks, Michał
2016-09-14
Using mobile robots or unmanned vehicles to assist optimal wireless sensors deployment in a working space can significantly enhance the capability to investigate unknown environments. This paper addresses the issues of the application of numerical optimization and computer simulation techniques to on-line calculation of a wireless sensor network topology for monitoring and tracking purposes. We focus on the design of a self-organizing and collaborative mobile network that enables a continuous data transmission to the data sink (base station) and automatically adapts its behavior to changes in the environment to achieve a common goal. The pre-defined and self-configuring approaches to the mobile-based deployment of sensors are compared and discussed. A family of novel algorithms for the optimal placement of mobile wireless devices for permanent monitoring of indoor and outdoor dynamic environments is described. They employ a network connectivity-maintaining mobility model utilizing the concept of the virtual potential function for calculating the motion trajectories of platforms carrying sensors. Their quality and utility have been justified through simulation experiments and are discussed in the final part of the paper.
Design, optimization and evaluation of a "smart" pixel sensor array for low-dose digital radiography
NASA Astrophysics Data System (ADS)
Wang, Kai; Liu, Xinghui; Ou, Hai; Chen, Jun
2016-04-01
Amorphous silicon (a-Si:H) thin-film transistors (TFTs) have been widely used to build flat-panel X-ray detectors for digital radiography (DR). As the demand for low-dose X-ray imaging grows, a detector with high signal-to-noise-ratio (SNR) pixel architecture emerges. "Smart" pixel is intended to use a dual-gate photosensitive TFT for sensing, storage, and switch. It differs from a conventional passive pixel sensor (PPS) and active pixel sensor (APS) in that all these three functions are combined into one device instead of three separate units in a pixel. Thus, it is expected to have high fill factor and high spatial resolution. In addition, it utilizes the amplification effect of the dual-gate photosensitive TFT to form a one-transistor APS that leads to a potentially high SNR. This paper addresses the design, optimization and evaluation of the smart pixel sensor and array for low-dose DR. We will design and optimize the smart pixel from the scintillator to TFT levels and validate it through optical and electrical simulation and experiments of a 4x4 sensor array.
Ecological and genetic determinants of plasmid distribution in Escherichia coli.
Medaney, Frances; Ellis, Richard J; Raymond, Ben
2016-11-01
Bacterial plasmids are important carriers of virulence and antibiotic resistance genes. Nevertheless, little is known of the determinants of plasmid distribution in bacterial populations. Here the factors affecting the diversity and distribution of the large plasmids of Escherichia coli were explored in cattle grazing on semi-natural grassland, a set of populations with low frequencies of antibiotic resistance genes. Critically, the population genetic structure of bacterial hosts was chararacterized. This revealed structured E. coli populations with high diversity between sites and individuals but low diversity within cattle hosts. Plasmid profiles, however, varied considerably within the same E. coli genotype. Both ecological and genetic factors affected plasmid distribution: plasmid profiles were affected by site, E. coli diversity, E. coli genotype and the presence of other large plasmids. Notably 3/26 E. coli serotypes accounted for half the observed plasmid-free isolates indicating that within species variation can substantially affect carriage of the major conjugative plasmids. The observed population structure suggest that most of the opportunities for within species plasmid transfer occur between different individuals of the same genotype and support recent experimental work indicating that plasmid-host coevolution, and epistatic interactions on fitness costs are likely to be important in determining occupancy. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Nikitin, Alexander P.; Bulsara, Adi R.; Stocks, Nigel G.
2017-03-01
Inspired by recent results on self-tunability in the outer hair cells of the mammalian cochlea, we describe an array of magnetic sensors where each individual sensor can self-tune to an optimal operating regime. The self-tuning gives the array its "biomimetic" features. We show that the overall performance of the array can, as expected, be improved by increasing the number of sensors but, however, coupling between sensors reduces the overall performance even though the individual sensors in the system could see an improvement. We quantify the similarity of this phenomenon to the Ringelmann effect that was formulated 103 years ago to account for productivity losses in human and animal groups. We propose a global feedback scheme that can be used to greatly mitigate the performance degradation that would, normally, stem from the Ringelmann effect.
Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen
2016-11-01
Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.
Sota, Masahiro; Yano, Hirokazu; Hughes, Julie; Daughdrill, Gary W.; Abdo, Zaid; Forney, Larry J.; Top, Eva M.
2011-01-01
The ability of bacterial plasmids to adapt to novel hosts and thereby shift their host range is key to their long-term persistence in bacterial communities. Promiscuous plasmids of the IncP-1 group can colonize a wide range of hosts, but it is not known if and how they can contract, shift or further expand their host range. To understand the evolutionary mechanisms of host range shifts of IncP-1 plasmids, an IncP-1β mini-replicon was experimentally evolved in four hosts wherein it was initially unstable. After 1000 generations in serial batch cultures under antibiotic selection for plasmid maintenance (kanamycin resistance), the stability of the mini-plasmid had dramatically improved in all coevolved hosts. However, only plasmids evolved in Shewanella oneidensis showed improved stability in the ancestor, indicating that adaptive mutations had occurred in the plasmid itself. Complete genome sequence analysis of nine independently evolved plasmids showed seven unique plasmid genotypes that had various kinds of single mutations at one locus, namely the N-terminal region of the replication initiation protein TrfA. Such parallel evolution indicates that this region was under strong selection. In five of the seven evolved plasmids these trfA mutations resulted in a significantly higher plasmid copy number. Evolved plasmids were found to be stable in four other naïve hosts, but could no longer replicate in Pseudomonas aeruginosa. This study demonstrates that plasmids can specialize to a novel host through trade-offs between improved stability in the new host and the ability to replicate in a previously permissive host. PMID:20520653
Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J.; Fox, Catherine A.
2016-01-01
The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid partitioning and suggest underlying biological roles shared by such elements. PMID:26865697
Wang, Yibing; Kahane, Simona; Cutcliffe, Lesley T; Skilton, Rachel J; Lambden, Paul R; Persson, Kenneth; Bjartling, Carina; Clarke, Ian N
2013-01-01
Our study had three objectives: to extend the plasmid-based transformation protocol to a clinical isolate of C. trachomatis belonging to the trachoma biovar, to provide "proof of principle" that it is possible to "knock out" selected plasmid genes (retaining a replication competent plasmid) and to investigate the plasticity of the plasmid. A recently developed, plasmid-based transformation protocol for LGV isolates of C. trachomatis was modified and a plasmid-free, genital tract C. trachomatis isolate from Sweden (SWFP-) was genetically transformed. Transformation of this non-LGV C. trachomatis host required a centrifugation step, but the absence of the natural plasmid removed the need for plaque purification of transformants. Transformants expressed GFP, were penicillin resistant and iodine stain positive for accumulated glycogen. The transforming plasmid did not recombine with the host chromosome. A derivative of pGFP::SW2 carrying a deletion of the plasmid CDS5 gene was engineered. CDS5 encodes pgp3, a protein secreted from the inclusion into the cell cytoplasm. This plasmid (pCDS5KO) was used to transform C. trachomatis SWFP-, and established that pgp3 is dispensable for plasmid function. The work shows it is possible to selectively delete segments of the chlamydial plasmid, and this is the first step towards a detailed molecular dissection of the role of the plasmid. The 3.6 kb β-galactosidase cassette was inserted into the deletion site of CDS5 to produce plasmid placZ-CDS5KO. Transformants were penicillin resistant, expressed GFP and stained for glycogen. In addition, they expressed β-galactosidase showing that the lacZ cassette was functional in C. trachomatis. An assay was developed that allowed the visualisation of individual inclusions by X-gal staining. The ability to express active β-galactosidase within chlamydial inclusions is an important advance as it allows simple, rapid assays to measure directly chlamydial infectivity without the need for plaquing, fluorescence or antibody staining.
Zeidler-Erdely, Patti C.; Antonini, James M.; Meighan, Terence G.; Young, Shih-Houng; Eye, Tracy J.; Hammer, Mary Ann; Erdely, Aaron
2016-01-01
Pulmonary toxicity studies often use bronchoalveolar lavage (BAL) to investigate potential adverse lung responses to a particulate exposure. The BAL cellular fraction is counted, using automated (i.e. Coulter Counter®), flow cytometry or manual (i.e. hemocytometer) methods, to determine inflammatory cell influx. The goal of the study was to compare the different counting methods to determine which is optimal for examining BAL cell influx after exposure by inhalation or intratracheal instillation (ITI) to different particles with varying inherent pulmonary toxicities in both rat and mouse models. General findings indicate that total BAL cell counts using the automated and manual methods tended to agree after inhalation or ITI exposure to particle samples that are relatively nontoxic or at later time points after exposure to a pneumotoxic particle when the response resolves. However, when the initial lung inflammation and cytotoxicity was high after exposure to a pneumotoxic particle, significant differences were observed when comparing cell counts from the automated, flow cytometry and manual methods. When using total BAL cell count for differential calculations from the automated method, depending on the cell diameter size range cutoff, the data suggest that the number of lung polymorphonuclear leukocytes (PMN) varies. Importantly, the automated counts, regardless of the size cutoff, still indicated a greater number of total lung PMN when compared with the manual method, which agreed more closely with flow cytometry. The results suggest that either the manual method or flow cytometry would be better suited for BAL studies where cytotoxicity is an unknown variable. PMID:27251196
Zeidler-Erdely, Patti C; Antonini, James M; Meighan, Terence G; Young, Shih-Houng; Eye, Tracy J; Hammer, Mary Ann; Erdely, Aaron
2016-08-01
Pulmonary toxicity studies often use bronchoalveolar lavage (BAL) to investigate potential adverse lung responses to a particulate exposure. The BAL cellular fraction is counted, using automated (i.e. Coulter Counter®), flow cytometry or manual (i.e. hemocytometer) methods, to determine inflammatory cell influx. The goal of the study was to compare the different counting methods to determine which is optimal for examining BAL cell influx after exposure by inhalation or intratracheal instillation (ITI) to different particles with varying inherent pulmonary toxicities in both rat and mouse models. General findings indicate that total BAL cell counts using the automated and manual methods tended to agree after inhalation or ITI exposure to particle samples that are relatively nontoxic or at later time points after exposure to a pneumotoxic particle when the response resolves. However, when the initial lung inflammation and cytotoxicity was high after exposure to a pneumotoxic particle, significant differences were observed when comparing cell counts from the automated, flow cytometry and manual methods. When using total BAL cell count for differential calculations from the automated method, depending on the cell diameter size range cutoff, the data suggest that the number of lung polymorphonuclear leukocytes (PMN) varies. Importantly, the automated counts, regardless of the size cutoff, still indicated a greater number of total lung PMN when compared with the manual method, which agreed more closely with flow cytometry. The results suggest that either the manual method or flow cytometry would be better suited for BAL studies where cytotoxicity is an unknown variable.
Biomass measurement by flow cytometry during solid-state fermentation of basidiomycetes.
Steudler, Susanne; Böhmer, Ulrike; Weber, Jost; Bley, Thomas
2015-02-01
Solid-state fermentation (SSF) is a robust process that is well suited to the on-site cultivation of basidiomycetes that produce enzymes for the treatment of lignocellulosics. Reliable methods for biomass quantification are essential for the analysis of fungal growth kinetics. However, direct biomass determination is not possible during SSF because the fungi grow into the substrate and use it as a nutrient source. This necessitates the use of indirect methods that are either very laborious and time consuming or can only provide biomass measurements during certain growth periods. Here, we describe the development and optimization of a new rapid method for fungal biomass determination during SSF that is based on counting fungal nuclei by flow cytometry. Fungal biomass was grown on an organic substrate and its concentration was measured by isolating the nuclei from the fungal hyphae after cell disruption, staining them with SYTOX(®) Green, and then counting them using a flow cytometer. A calibration curve relating the dry biomass of the samples to their concentrations of nuclei was established. Multiple buffers and disruption methods were tested. The results obtained were compared with values determined using the method of ergosterol determination, a classical technique for fungal biomass measurement during SSF. Our new approach can be used to measure fungal biomass on a range of different scales, from 15 mL cultures to a laboratory reactor with a working volume of 10 L (developed by the Research Center for Medical Technology and Biotechnology (fzmb GmbH)). © 2014 International Society for Advancement of Cytometry. © 2014 International Society for Advancement of Cytometry.
Parks, David R; Roederer, Mario; Moore, Wayne A
2006-06-01
In immunofluorescence measurements and most other flow cytometry applications, fluorescence signals of interest can range down to essentially zero. After fluorescence compensation, some cell populations will have low means and include events with negative data values. Logarithmic presentation has been very useful in providing informative displays of wide-ranging flow cytometry data, but it fails to adequately display cell populations with low means and high variances and, in particular, offers no way to include negative data values. This has led to a great deal of difficulty in interpreting and understanding flow cytometry data, has often resulted in incorrect delineation of cell populations, and has led many people to question the correctness of compensation computations that were, in fact, correct. We identified a set of criteria for creating data visualization methods that accommodate the scaling difficulties presented by flow cytometry data. On the basis of these, we developed a new data visualization method that provides important advantages over linear or logarithmic scaling for display of flow cytometry data, a scaling we refer to as "Logicle" scaling. Logicle functions represent a particular generalization of the hyperbolic sine function with one more adjustable parameter than linear or logarithmic functions. Finally, we developed methods for objectively and automatically selecting an appropriate value for this parameter. The Logicle display method provides more complete, appropriate, and readily interpretable representations of data that includes populations with low-to-zero means, including distributions resulting from fluorescence compensation procedures, than can be produced using either logarithmic or linear displays. The method includes a specific algorithm for evaluating actual data distributions and deriving parameters of the Logicle scaling function appropriate for optimal display of that data. It is critical to note that Logicle visualization does not change the data values or the descriptive statistics computed from them. Copyright 2006 International Society for Analytical Cytology.