NCI Researchers Discover Exceptionally Potent Antibodies with Potential for Prophylaxis and Therapy of MERS-Coronavirus Infections | Poster

Cancer.gov

By Andrea Frydl, Contributing Writer In a recent article published in the Journal of Virology, Tianlei Ying, Ph.D., Dimiter Dimitrov, Ph.D., and their colleagues in the Laboratory of Experimental Immunology (LEI), Cancer and Inflammation Program, NCI Center for Cancer Research, reported the identification of three human monoclonal antibodies (m336, m337, and m338) that target the part of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) that is responsible for binding to its receptor. These antibodies are exceptionally potent inhibitors of MERS-CoV infection and also provide a basis for creating a future MERS-CoV vaccine.

Treatment outcomes for patients with Middle Eastern Respiratory Syndrome Coronavirus (MERS CoV) infection at a coronavirus referral center in the Kingdom of Saudi Arabia.

PubMed

Al Ghamdi, Mohammed; Alghamdi, Khalid M; Ghandoora, Yasmeen; Alzahrani, Ameera; Salah, Fatmah; Alsulami, Abdulmoatani; Bawayan, Mayada F; Vaidya, Dhananjay; Perl, Trish M; Sood, Geeta

2016-04-21

Middle Eastern Respiratory Syndrome coronavirus (MERS-CoV) is a poorly understood disease with no known treatments. We describe the clinical features and treatment outcomes of patients with laboratory confirmed MERS-CoV at a regional referral center in the Kingdom of Saudi Arabia. In 2014, a retrospective chart review was performed on patients with a laboratory confirmed diagnosis of MERS-CoV to determine clinical and treatment characteristics associated with death. Confounding was evaluated and a multivariate logistic regression was performed to assess the independent effect of treatments administered. Fifty-one patients had an overall mortality of 37 %. Most patients were male (78 %) with a mean age of 54 years. Almost a quarter of the patients were healthcare workers (23.5 %) and 41 % had a known exposure to another person with MERS-CoV. Survival was associated with male gender, working as a healthcare worker, history of hypertension, vomiting on admission, elevated respiratory rate, abnormal lung exam, elevated alanine transaminase (ALT), clearance of MERS-CoV on repeat PCR polymerase chain reaction (PCR) testing, and mycophenolate mofetil treatment. Survival was reduced in the presence of coronary artery disease, hypotension, hypoxemia, CXR (chest X-ray) abnormalities, leukocytosis, creatinine >1 · 5 mg/dL, thrombocytopenia, anemia, and renal failure. In a multivariate analysis of treatments administered, severity of illness was the greatest predictor of reduced survival. Care for patients with MERS-CoV remains a challenge. In this retrospective cohort, interferon beta and mycophenolate mofetil treatment were predictors of increased survival in the univariate analysis. Severity of illness was the greatest predictor of reduced survival in the multivariate analysis. Larger randomized trials are needed to better evaluate the efficacy of these treatment regimens for MERS-CoV.

Etude de la performance des radars hautes-frequences CODAR et WERA pour la mesure des courants marins en presence partielle de glace de mer

NASA Astrophysics Data System (ADS)

Kamli, Emna

Les radars hautes-frequences (RHF) mesurent les courants marins de surface avec une portee pouvant atteindre 200 kilometres et une resolution de l'ordre du kilometre. Cette etude a pour but de caracteriser la performance des RHF, en terme de couverture spatiale, pour la mesure des courants de surface en presence partielle de glace de mer. Pour ce faire, les mesures des courants de deux radars de type CODAR sur la rive sud de l'estuaire maritime du Saint-Laurent, et d'un radar de type WERA sur la rive nord, prises pendant l'hiver 2013, ont ete utilisees. Dans un premier temps, l'aire moyenne journaliere de la zone ou les courants sont mesures par chaque radar a ete comparee a l'energie des vagues de Bragg calculee a partir des donnees brutes d'acceleration fournies par une bouee mouillee dans la zone couverte par les radars. La couverture des CODARs est dependante de la densite d'energie de Bragg, alors que la couverture du WERA y est pratiquement insensible. Un modele de fetch appele GENER a ete force par la vitesse du vent predite par le modele GEM d'Environnement Canada pour estimer la hauteur significative ainsi que la periode modale des vagues. A partir de ces parametres, la densite d'energie des vagues de Bragg a ete evaluee pendant l'hiver a l'aide du spectre theorique de Bretschneider. Ces resultats permettent d'etablir la couverture normale de chaque radar en absence de glace de mer. La concentration de glace de mer, predite par le systeme canadien operationnel de prevision glace-ocean, a ete moyennee sur les differents fetchs du vent selon la direction moyenne journaliere des vagues predites par GENER. Dans un deuxieme temps, la relation entre le ratio des couvertures journalieres obtenues pendant l'hiver 2013 et des couvertures normales de chaque radar d'une part, et la concentration moyenne journaliere de glace de mer d'autre part, a ete etablie. Le ratio des couvertures decroit avec l'augmentation de la concentration de glace de mer pour les deux types de radars, mais pour une concentration de glace de 20% la couverture du WERA est reduite de 34% alors que pour les CODARs elle est reduite de 67%. Les relations empiriques etablies entre la couverture des RHF et les parametres environnementaux (vent et glace de mer) permettront de predire la couverture que pourraient fournir des RHF installes dans d'autres regions soumises a la presence saisonniere de glace de mer.

Effects of Human Recombinant PEDF Protein and PEDF-Derived Peptide 34-mer on Choroidal Neovascularization

PubMed Central

Amaral, Juan

2010-01-01

Purpose. Pigment epithelium-derived factor (PEDF) is a serpin with antiangiogenic properties. Previously, the authors showed that PEDF injected into the subconjunctiva reaches the choroid. Here, they examined the effects of PEDF polypeptide fragments on vessel sprouting and on choroidal neovascularization (CNV) after subconjunctival administration. Methods. Recombinant human PEDF (rhuPEDF) was cleaved at its serpin-exposed loop by limited chymotrypsin proteolysis. Synthetic PEDF peptides 34-mer (Asp44-Asn77) and 44-mer (Val78-Thr121) were used. Ex vivo chick aortic vessel sprouting assays were performed. CNV was induced in rats by laser injury of Bruch's membrane. Daily subconjunctival injections (0.01–10 pmol/d protein) were performed for 5 days starting at day of injury or at the seventh day after injury. New vessel volumes were quantified using optical sections of choroid/RPE flat-mounts labeled with isolectin-Ib4. PEDF distribution was evaluated by immunofluorescence of choroid/RPE/retina cross-sections. Results. Full-length rhuPEDF, cleaved rhuPEDF, or peptide 34-mer exhibited ex vivo antiangiogenic activity, but peptide 44-mer was inefficient. PEDF immunostaining around CNV lesions diminished after laser injury. Subconjunctival administration of rhuPEDF or 34-mer at 0.1 pmol/d decreased CNV lesion volumes by 52% and 47%, respectively, whereas those of 44-mer were similar to vehicle injections. Doses of 0.1 and 1 pmol/d rhuPEDF decreased fully developed CNV complex volumes by 45% and 50%, respectively, compared with vehicle injections. Conclusions. A functional region for the inhibition of vessel sprouting and CNV resides within the 34-mer region of PEDF. Furthermore, subconjunctival administration of optimal range dosages of rhuPEDF or 34-mer can suppress and regress rat CNV lesions, demonstrating that these agents reach the choroid/RPE complex as functionally active molecules. PMID:19850839

Effective therapy with infliximab for clinically mild encephalitis/encephalopathy with a reversible splenial lesion in an infant with Kawasaki disease.

PubMed

Kurokawa, Yoshie; Masuda, Hiroshi; Kobayashi, Tohru; Ono, Hiroshi; Kato, Hitoshi; Imadome, Ken-Ichi; Abe, Jun; Abe, Yuichi; Ito, Shuichi; Ishiguro, Akira

2017-01-01

Kawasaki disease (KD) is a systemic vasculitis in infants. In KD, encephalopathy is rarely (0.1%) associated, however, clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) has previously been reported in some pediatric patients. Here, we report on a 2-year-old girl who had KD complicated with MERS. The patient experienced generalized clonic convulsion and prolonged consciousness disturbance with fever for 2 days. Her head MRI showed a high signal intensity lesion in the splenium of the corpus callosum in diffusion-weighted images, and low apparent diffusion coefficient (ADC) values on day 3. An electroencephalogram showed high voltage slow waves on the occipital and parietal head. On the same day, it was confirmed that the patient showed all the main symptoms of KD. Based on these findings, we diagnosed her with MERS-complicated KD. Even though she was treated with immunoglobulin (total 4 g/kg) and pulsed-dose methylprednisolone, her fever and consciousness disturbance continued, and blood tests showed that inflammation markers remained high. We then treated the patient with infliximab on day 9, and within a few hours of the treatment her fever dropped and all symptoms of KD and consciousness disturbance disappeared. No recurrence of KD or other complications of KD occurred, and she was discharged on day 23. We propose that infliximab is an effective optional treatment for immunoglobulin/glucocorticoid-resistant KD with MERS. To clarify this possibility, further case accumulation is warranted.

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - At right is the Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, that will launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - The Delta II rocket on Launch Complex 17-A, Cape Canaveral Air Force Station, is having solid rocket boosters (SRBs) installed that will help launch Mars Exploration Rover 2 (MER-2) on June 5. In the center are three more solid rocket boosters that will be added to the Delta, which will carry nine in all. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

NASA Image and Video Library

2003-05-31

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2) is installed around the Mars Exploration Rover 2 (MER-2). MER-2 is one of NASA's twin Mars Exploration Rovers designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch no earlier than June 8 as MER-A, with two launch opportunities each day during the launch period that closes on June 19.

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers on the launch tower of Complex 17-A, Cape Canaveral Air Force Station, stand by while a solid rocket booster (SRB) is lifted to vertical. It is one of nine that will help launch Mars Exploration Rover 2 (MER-2). NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Robust k-mer frequency estimation using gapped k-mers

PubMed Central

Ghandi, Mahmoud; Mohammad-Noori, Morteza

2013-01-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome. PMID:23861010

Robust k-mer frequency estimation using gapped k-mers.

PubMed

Ghandi, Mahmoud; Mohammad-Noori, Morteza; Beer, Michael A

2014-08-01

Oligomers of fixed length, k, commonly known as k-mers, are often used as fundamental elements in the description of DNA sequence features of diverse biological function, or as intermediate elements in the constuction of more complex descriptors of sequence features such as position weight matrices. k-mers are very useful as general sequence features because they constitute a complete and unbiased feature set, and do not require parameterization based on incomplete knowledge of biological mechanisms. However, a fundamental limitation in the use of k-mers as sequence features is that as k is increased, larger spatial correlations in DNA sequence elements can be described, but the frequency of observing any specific k-mer becomes very small, and rapidly approaches a sparse matrix of binary counts. Thus any statistical learning approach using k-mers will be susceptible to noisy estimation of k-mer frequencies once k becomes large. Because all molecular DNA interactions have limited spatial extent, gapped k-mers often carry the relevant biological signal. Here we use gapped k-mer counts to more robustly estimate the ungapped k-mer frequencies, by deriving an equation for the minimum norm estimate of k-mer frequencies given an observed set of gapped k-mer frequencies. We demonstrate that this approach provides a more accurate estimate of the k-mer frequencies in real biological sequences using a sample of CTCF binding sites in the human genome.

Clinically mild encephalitis/encephalopathy with a reversible splenial lesion associated with febrile urinary tract infection.

PubMed

Okamoto, Takayuki; Sato, Yasuyuki; Yamazaki, Takeshi; Hayashi, Asako

2014-04-01

Common pathogens of clinically mild encephalitis/encephalopathy with a reversible splenial lesion (MERS) are viruses, such as influenza virus. However, bacteria are rare pathogens for MERS. We report the first patient with MERS associated with febrile urinary tract infection. A 16-year-old lupus patient was admitted to our hospital. She had fever, headache, vomiting, and right back pain. Urinary analysis showed leukocyturia, and urinary culture identified Klebsiella pneumoniae. Cerebrospinal fluid examination and brain single-photon emission computed tomography showed no abnormalities. Therefore, she was diagnosed with febrile urinary tract infection. For further examinations, 99mTc-dimercaptosuccinic acid renal scintigraphy showed right cortical defects, and a voiding cystourethrogram demonstrated right vesicoureteral reflux (grade II). Therefore, she was diagnosed with right pyelonephritis. Although treatment with antibiotics administered intravenously improved the fever, laboratory findings, and right back pain, she had prolonged headaches, nausea, and vomiting. T2-weighted, diffusion-weighted, and fluid attenuated inversion recovery images in brain magnetic resonance imaging showed high intensity lesions in the splenium of the corpus callosum, which completely disappeared 1 week later. These results were compatible with MERS. To the best of our knowledge, our patient is the first patient who showed clinical features of MERS associated with febrile urinary tract infection. In patients with pyelonephritis and an atypical clinical course, such as prolonged headache, nausea, vomiting, and neurological disorders, the possibility of MERS should be considered.

Catalysis in prebiotic chemistry RNA synthesis

NASA Astrophysics Data System (ADS)

Ferris, J.; Joshi, P.; Wang, K.; Huang, W.; Miyakawa, S.

It is proposed that catalysis by minerals and metal ions had a central role in the steps that led to the origins of life. In particular, the formation of biopolymers in the presence of water requires catalysis to compete with hydrolytic processes. Catalysis is required to limit the number of isomers generated so that the longer polymers necessary for the origins of life formed. Montmorillonite clay catalyzes the formation of 6 14 mers of RNA from activated monomers of A, G, U and C in- aqueous solution. Daily addition of activated monomers to a 10 mer primer results in the formation of 40-50 mers of adenylic acid and 30 mers of uridylic acid. The sequence selectivity and regioselectivity in phosphodiester bond formation results from the montmorillonite catalysis. Reaction of D, L-activated monomers of A and U leads to the preferential formation of homochiral dimers (eg. D, D and L, L-- pApA). These data and any more recent developments will be discussed.

MERS-CoV Accessory ORFs Play Key Role for Infection and Pathogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Menachery, Vineet D.; Mitchell, Hugh D.; Cockrell, Adam S.

ABSTRACT While dispensable for viral replication, coronavirus (CoV) accessory open reading frame (ORF) proteins often play critical roles during infection and pathogenesis. Utilizing a previously generated mutant, we demonstrate that the absence of all four Middle East respiratory syndrome CoV (MERS-CoV) accessory ORFs (deletion of ORF3, -4a, -4b, and -5 [dORF3-5]) has major implications for viral replication and pathogenesis. Importantly, attenuation of the dORF3-5 mutant is primarily driven by dysregulated host responses, including disrupted cell processes, augmented interferon (IFN) pathway activation, and robust inflammation.In vitroreplication attenuation also extends toin vivomodels, allowing use of dORF3-5 as a live attenuated vaccine platform.more » Finally, examination of ORF5 implicates a partial role in modulation of NF-κB-mediated inflammation. Together, the results demonstrate the importance of MERS-CoV accessory ORFs for pathogenesis and highlight them as potential targets for surveillance and therapeutic treatments moving forward. IMPORTANCEThe initial emergence and periodic outbreaks of MERS-CoV highlight a continuing threat posed by zoonotic pathogens to global public health. In these studies, mutant virus generation demonstrates the necessity of accessory ORFs in regard to MERS-CoV infection and pathogenesis. With this in mind, accessory ORF functions can be targeted for both therapeutic and vaccine treatments in response to MERS-CoV and related group 2C coronaviruses. In addition, disruption of accessory ORFs in parallel may offer a rapid response platform to attenuation of future emergent strains based on both SARS- and MERS-CoV accessory ORF mutants.« less

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Concerted action of the MutLβ heterodimer and Mer3 helicase regulates the global extent of meiotic gene conversion

PubMed Central

Duroc, Yann; Kumar, Rajeev; Ranjha, Lepakshi; Adam, Céline; Guérois, Raphaël; Md Muntaz, Khan; Marsolier-Kergoat, Marie-Claude; Dingli, Florent; Laureau, Raphaëlle; Loew, Damarys; Llorente, Bertrand; Charbonnier, Jean-Baptiste; Cejka, Petr; Borde, Valérie

2017-01-01

Gene conversions resulting from meiotic recombination are critical in shaping genome diversification and evolution. How the extent of gene conversions is regulated is unknown. Here we show that the budding yeast mismatch repair related MutLβ complex, Mlh1-Mlh2, specifically interacts with the conserved meiotic Mer3 helicase, which recruits it to recombination hotspots, independently of mismatch recognition. This recruitment is essential to limit gene conversion tract lengths genome-wide, without affecting crossover formation. Contrary to expectations, Mer3 helicase activity, proposed to extend the displacement loop (D-loop) recombination intermediate, does not influence the length of gene conversion events, revealing non-catalytical roles of Mer3. In addition, both purified Mer3 and MutLβ preferentially recognize D-loops, providing a mechanism for limiting gene conversion in vivo. These findings show that MutLβ is an integral part of a new regulatory step of meiotic recombination, which has implications to prevent rapid allele fixation and hotspot erosion in populations. DOI: http://dx.doi.org/10.7554/eLife.21900.001 PMID:28051769

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

MER SPICE Interface

NASA Technical Reports Server (NTRS)

Sayfi, Elias

2004-01-01

MER SPICE Interface is a software module for use in conjunction with the Mars Exploration Rover (MER) mission and the SPICE software system of the Navigation and Ancillary Information Facility (NAIF) at NASA's Jet Propulsion Laboratory. (SPICE is used to acquire, record, and disseminate engineering, navigational, and other ancillary data describing circumstances under which data were acquired by spaceborne scientific instruments.) Given a Spacecraft Clock value, MER SPICE Interface extracts MER-specific data from SPICE kernels (essentially, raw data files) and calculates values for Planet Day Number, Local Solar Longitude, Local Solar Elevation, Local Solar Azimuth, and Local Solar Time (UTC). MER SPICE Interface was adapted from a subroutine, denoted m98SpiceIF written by Payam Zamani, that was intended to calculate SPICE values for the Mars Polar Lander. The main difference between MER SPICE Interface and m98SpiceIf is that MER SPICE Interface does not explicitly call CHRONOS, a time-conversion program that is part of a library of utility subprograms within SPICE. Instead, MER SPICE Interface mimics some portions of the CHRONOS code, the advantage being that it executes much faster and can efficiently be called from a pipeline of events in a parallel processing environment.

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012.

PubMed

Johnson, Reed F; Bagci, Ulas; Keith, Lauren; Tang, Xianchun; Mollura, Daniel J; Zeitlin, Larry; Qin, Jing; Huzella, Louis; Bartos, Christopher J; Bohorova, Natasha; Bohorov, Ognian; Goodman, Charles; Kim, Do H; Paulty, Michael H; Velasco, Jesus; Whaley, Kevin J; Johnson, Joshua C; Pettitt, James; Ork, Britini L; Solomon, Jeffrey; Oberlander, Nicholas; Zhu, Quan; Sun, Jiusong; Holbrook, Michael R; Olinger, Gene G; Baric, Ralph S; Hensley, Lisa E; Jahrling, Peter B; Marasco, Wayne A

2016-03-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10(6) PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a human anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. Published by Elsevier Inc.

Efficacy of a Mer and Flt3 tyrosine kinase small molecule inhibitor, UNC1666, in acute myeloid leukemia

PubMed Central

Lee-Sherick, Alisa B.; Zhang, Weihe; Menachof, Kelly K.; Hill, Amanda A.; Rinella, Sean; Kirkpatrick, Gregory; Page, Lauren S.; Stashko, Michael A.; Jordan, Craig T.; Wei, Qi; Liu, Jing; Zhang, Dehui; DeRyckere, Deborah; Wang, Xiaodong; Frye, Stephen; Earp, H. Shelton; Graham, Douglas K.

2015-01-01

Mer and Flt3 receptor tyrosine kinases have been implicated as therapeutic targets in acute myeloid leukemia (AML). In this manuscript we describe UNC1666, a novel ATP-competitive small molecule tyrosine kinase inhibitor, which potently diminishes Mer and Flt3 phosphorylation in AML. Treatment with UNC1666 mediated biochemical and functional effects in AML cell lines expressing Mer or Flt3 internal tandem duplication (ITD), including decreased phosphorylation of Mer, Flt3 and downstream effectors Stat, Akt and Erk, induction of apoptosis in up to 98% of cells, and reduction of colony formation by greater than 90%, compared to treatment with vehicle. These effects were dose-dependent, with inhibition of downstream signaling and functional effects correlating with the degree of Mer or Flt3 kinase inhibition. Treatment of primary AML patient samples expressing Mer and/or Flt3-ITD with UNC1666 also inhibited Mer and Flt3 intracellular signaling, induced apoptosis, and inhibited colony formation. In summary, UNC1666 is a novel potent small molecule tyrosine kinase inhibitor that decreases oncogenic signaling and myeloblast survival, thereby validating dual Mer/Flt3 inhibition as an attractive treatment strategy for AML. PMID:25762638

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - A third solid rocket booster (SRB) is lifted up the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station. They are three of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, workers complete raising a solid rocket booster to a vertical position. It will be lifted up the launch tower and mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is raised off the transporter. When vertical, it will be lifted up the launch tower and mated to the Delta rocket (in the background) to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-14

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, a solid rocket booster is moved into position to raise to vertical and lift up the launch tower. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Development of Animal Models Against Emerging Coronaviruses: From SARS to MERS coronavirus

PubMed Central

Sutton, Troy C; Subbarao, Kanta

2016-01-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. PMID:25791336

Development of animal models against emerging coronaviruses: From SARS to MERS coronavirus.

PubMed

Sutton, Troy C; Subbarao, Kanta

2015-05-01

Two novel coronaviruses have emerged to cause severe disease in humans. While bats may be the primary reservoir for both viruses, SARS coronavirus (SARS-CoV) likely crossed into humans from civets in China, and MERS coronavirus (MERS-CoV) has been transmitted from camels in the Middle East. Unlike SARS-CoV that resolved within a year, continued introductions of MERS-CoV present an on-going public health threat. Animal models are needed to evaluate countermeasures against emerging viruses. With SARS-CoV, several animal species were permissive to infection. In contrast, most laboratory animals are refractory or only semi-permissive to infection with MERS-CoV. This host-range restriction is largely determined by sequence heterogeneity in the MERS-CoV receptor. We describe animal models developed to study coronaviruses, with a focus on host-range restriction at the level of the viral receptor and discuss approaches to consider in developing a model to evaluate countermeasures against MERS-CoV. Copyright © 2015. Published by Elsevier Inc.

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed Central

Berressem, R; Engels, J W

1995-01-01

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457

6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.

PubMed

Berressem, R; Engels, J W

1995-09-11

2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.

Transmission of Middle East Respiratory Syndrome Coronavirus Infections in Healthcare Settings, Abu Dhabi

PubMed Central

Nguyen, Duc; Aden, Bashir; Al Bandar, Zyad; Al Dhaheri, Wafa; Abu Elkheir, Kheir; Khudair, Ahmed; Al Mulla, Mariam; El Saleh, Feda; Imambaccus, Hala; Al Kaabi, Nawal; Sheikh, Farrukh Amin; Sasse, Jurgen; Turner, Andrew; Abdel Wareth, Laila; Weber, Stefan; Al Ameri, Asma; Abu Amer, Wesal; Alami, Negar N.; Bunga, Sudhir; Haynes, Lia M.; Hall, Aron J.; Kallen, Alexander J.; Kuhar, David; Pham, Huong; Pringle, Kimberly; Tong, Suxiang; Whitaker, Brett L.; Gerber, Susan I.; Al Hosani, Farida Ismail

2016-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) infections sharply increased in the Arabian Peninsula during spring 2014. In Abu Dhabi, United Arab Emirates, these infections occurred primarily among healthcare workers and patients. To identify and describe epidemiologic and clinical characteristics of persons with healthcare-associated infection, we reviewed laboratory-confirmed MERS-CoV cases reported to the Health Authority of Abu Dhabi during January 1, 2013–May 9, 2014. Of 65 case-patients identified with MERS-CoV infection, 27 (42%) had healthcare-associated cases. Epidemiologic and genetic sequencing findings suggest that 3 healthcare clusters of MERS-CoV infection occurred, including 1 that resulted in 20 infected persons in 1 hospital. MERS-CoV in healthcare settings spread predominantly before MERS-CoV infection was diagnosed, underscoring the importance of increasing awareness and infection control measures at first points of entry to healthcare facilities. PMID:26981708

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers prepare to mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

NASA Image and Video Library

2003-05-23

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers mate the Mars Exploration Rover-2 (MER-2) to the third stage of a Delta II rocket for launch on June 5. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. MER-1 (MER-B) will launch June 25.

Polyphyletic origin of MERS coronaviruses and isolation of a novel clade A strain from dromedary camels in the United Arab Emirates

PubMed Central

Lau, Susanna K P; Wernery, Renate; Wong, Emily Y M; Joseph, Sunitha; Tsang, Alan K L; Patteril, Nissy Annie Georgy; Elizabeth, Shyna K; Chan, Kwok-Hung; Muhammed, Rubeena; Kinne, Jöerg; Yuen, Kwok-Yung; Wernery, Ulrich; Woo, Patrick C Y

2016-01-01

Little is known regarding the molecular epidemiology of Middle East respiratory syndrome coronavirus (MERS-CoV) circulating in dromedaries outside Saudi Arabia. To address this knowledge gap, we sequenced 10 complete genomes of MERS-CoVs isolated from 2 live and 8 dead dromedaries from different regions in the United Arab Emirates (UAE). Phylogenetic analysis revealed one novel clade A strain, the first detected in the UAE, and nine clade B strains. Strain D998/15 had a distinct phylogenetic position within clade A, being more closely related to the dromedary isolate NRCE-HKU205 from Egypt than to the human isolates EMC/2012 and Jordan-N3/2012. A comparison of predicted protein sequences also demonstrated the existence of two clade A lineages with unique amino acid substitutions, A1 (EMC/2012 and Jordan-N3/2012) and A2 (D998/15 and NRCE-HKU205), circulating in humans and camels, respectively. The nine clade B isolates belong to three distinct lineages: B1, B3 and B5. Two B3 strains, D1271/15 and D1189.1/15, showed evidence of recombination between lineages B4 and B5 in ORF1ab. Molecular clock analysis dated the time of the most recent common ancestor (tMRCA) of clade A to March 2011 and that of clade B to November 2011. Our data support a polyphyletic origin of MERS-CoV in dromedaries and the co-circulation of diverse MERS-CoVs including recombinant strains in the UAE. PMID:27999424

Three-dimensional hologram display system

NASA Technical Reports Server (NTRS)

Mintz, Frederick (Inventor); Chao, Tien-Hsin (Inventor); Bryant, Nevin (Inventor); Tsou, Peter (Inventor)

2009-01-01

The present invention relates to a three-dimensional (3D) hologram display system. The 3D hologram display system includes a projector device for projecting an image upon a display medium to form a 3D hologram. The 3D hologram is formed such that a viewer can view the holographic image from multiple angles up to 360 degrees. Multiple display media are described, namely a spinning diffusive screen, a circular diffuser screen, and an aerogel. The spinning diffusive screen utilizes spatial light modulators to control the image such that the 3D image is displayed on the rotating screen in a time-multiplexing manner. The circular diffuser screen includes multiple, simultaneously-operated projectors to project the image onto the circular diffuser screen from a plurality of locations, thereby forming the 3D image. The aerogel can use the projection device described as applicable to either the spinning diffusive screen or the circular diffuser screen.

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) in adults-a case report and literature review.

PubMed

Yuan, Junliang; Yang, Shuna; Wang, Shuangkun; Qin, Wei; Yang, Lei; Hu, Wenli

2017-05-25

Mild encephalitis/encephalopathy with reversible splenial lesion (MERS) is a rare clinico-radiological entity characterized by the magnetic resonance imaging (MRI) finding of a reversible lesion in the corpus callosum, sometimes involved the symmetrical white matters. Many cases of child-onset MERS with various causes have been reported. However, adult-onset MERS is relatively rare. The clinical characteristics and pathophysiologiccal mechanisms of adult-onset MERS are not well understood. We reviewed the literature on adult-onset MERS in order to describe the characteristics of MERS in adults and to provide experiences for clinician. We reported a case of adult-onset MERS with acute urinary retension and performed literature search from PubMed and web of science databases to identify other adult-onset MERS reports from Januarary 2004 to March 2016. Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guideline was followed on selection process. And then we summarized the clinico-radiological features of adult-onset MERS. Twenty-nine adult-onset MERS cases were reviewed from available literature including the case we have. 86.2% of the cases (25/29) were reported in Asia, especially in Japan. Ages varied between 18 and 59 years old with a 12:17 female-to-male ratio. The major cause was infection by virus or bacteria. Fever and headache were the most common clinical manifestation, and acute urinary retention was observed in 6 patients. All patients recovered completely within a month. Adult-onset MERS is an entity with a broad clinico-radiological spectrum because of the various diseases and conditions. There are similar characteristics between MERS in adults and children, also some differences.

Primer design for a prokaryotic differential display RT-PCR.

PubMed Central

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-01-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168

Primer design for a prokaryotic differential display RT-PCR.

PubMed

Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H

1997-05-01

We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.

The Ames MER microscopic imager toolkit

USGS Publications Warehouse

Sargent, R.; Deans, Matthew; Kunz, C.; Sims, M.; Herkenhoff, K.

2005-01-01

12The Mars Exploration Rovers, Spirit and Opportunity, have spent several successful months on Mars, returning gigabytes of images and spectral data to scientists on Earth. One of the instruments on the MER rovers, the Athena Microscopic Imager (MI), is a fixed focus, megapixel camera providing a ??3mm depth of field and a 31??31mm field of view at a working distance of 63 mm from the lens to the object being imaged. In order to maximize the science return from this instrument, we developed the Ames MI Toolkit and supported its use during the primary mission. The MI Toolkit is a set of programs that operate on collections of MI images, with the goal of making the data more understandable to the scientists on the ground. Because of the limited depth of field of the camera, and the often highly variable topography of the terrain being imaged, MI images of a given rock are often taken as a stack, with the Instrument Deployment Device (IDD) moving along a computed normal vector, pausing every few millimeters for the MI to acquire an image. The MI Toolkit provides image registration and focal section merging, which combine these images to form a single, maximally in-focus image, while compensating for changes in lighting as well as parallax due to the motion of the camera. The MI Toolkit also provides a 3-D reconstruction of the surface being imaged using stereo and can embed 2-D MI images as texture maps into 3-D meshes produced by other imagers on board the rover to provide context. The 2-D images and 3-D meshes output from the Toolkit are easily viewed by scientists using other mission tools, such as Viz or the MI Browser.This paper describes the MI Toolkit in detail, as well as our experience using it with scientists at JPL during the primary MER mission. ?? 2005 IEEE.

The Ames MER Microscopic Imager Toolkit

NASA Technical Reports Server (NTRS)

Sargent, Randy; Deans, Matthew; Kunz, Clayton; Sims, Michael; Herkenhoff, Ken

2005-01-01

The Mars Exploration Rovers, Spirit and Opportunity, have spent several successful months on Mars, returning gigabytes of images and spectral data to scientists on Earth. One of the instruments on the MER rovers, the Athena Microscopic Imager (MI), is a fixed focus, megapixel camera providing a plus or minus mm depth of field and a 3lx31mm field of view at a working distance of 63 mm from the lens to the object being imaged. In order to maximize the science return from this instrument, we developed the Ames MI Toolkit and supported its use during the primary mission. The MI Toolkit is a set of programs that operate on collections of MI images, with the goal of making the data more understandable to the scientists on the ground. Because of the limited depth of field of the camera, and the often highly variable topography of the terrain being imaged, MI images of a given rock are often taken as a stack, with the Instrument Deployment Device (IDD) moving along a computed normal vector, pausing every few millimeters for the MI to acquire an image. The MI Toolkit provides image registration and focal section merging, which combine these images to form a single, maximally in-focus image, while compensating for changes in lighting as well as parallax due to the motion of the camera. The MI Toolkit also provides a 3-D reconstruction of the surface being imaged using stereo and can embed 2-D MI images as texture maps into 3-D meshes produced by other imagers on board the rover to provide context. The 2-D images and 3-D meshes output from the Toolkit are easily viewed by scientists using other mission tools, such as Viz or the MI Browser. This paper describes the MI Toolkit in detail, as well as our experience using it with scientists at JPL during the primary MER mission.

Diffusion MRI and its role in neuropsychology

PubMed Central

Mueller, Bryon A; Lim, Kelvin O; Hemmy, Laura; Camchong, Jazmin

2015-01-01

Diffusion Magnetic Resonance Imaging (dMRI) is a popular method used by neuroscientists to uncover unique information about the structural connections within the brain. dMRI is a non-invasive imaging methodology in which image contrast is based on the diffusion of water molecules in tissue. While applicable to many tissues in the body, this review focuses exclusively on the use of dMRI to examine white matter in the brain. In this review, we begin with a definition of diffusion and how diffusion is measured with MRI. Next we introduce the diffusion tensor model, the predominant model used in dMRI. We then describe acquisition issues related to acquisition parameters and scanner hardware and software. Sources of artifacts are then discussed, followed by a brief review of analysis approaches. We provide an overview of the limitations of the traditional diffusion tensor model, and highlight several more sophisticated non-tensor models that better describe the complex architecture of the brain’s white matter. We then touch on reliability and validity issues of diffusion measurements. Finally, we describe examples of ways in which dMRI has been applied to studies of brain disorders and how identified alterations relate to symptomatology and cognition. PMID:26255305

Genesis Sample Return Capsule Overview

NASA Technical Reports Server (NTRS)

Willcockson, Bill

2005-01-01

I. Simple Entry Capsule Concept: a) Spin-Stabilized/No Active Control Systems; b) Ballistic Entry for 11.04 km/sec Velocity; c) No Heatshield Separation During Entry; d) Parachute Deploy via g-Switch + Timer. II. Stardust Design Inheritance a) Forebody Shape; b) Seal Concepts; c) Parachute Deploy Control; d) Utah Landing Site (UTTR). III. TPS Systems a) Heatshield - Carbon-Carbon - First Planetary Entry; b) Backshell - SLA-561V - Flight Heritage from Pathfinder, MER; d) Forebody Structural Penetrations Aerothermal and TPS Design Process has the Same Methodology as Used for Pathfinder, MER Flight Vehicles.

Modeling diffusion and reaction in soils: 9. The Buckingham-Burdine-Campbell equation for gas diffusivity in undisturbed soil

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moldrup, P.; Olesen, T.; Yamaguchi, T.

1999-08-01

Accurate description of gas diffusivity (ratio of gas diffusion coefficients in soil and free air, D{sub s}/D{sub 0}) in undisturbed soils is a prerequisite for predicting in situ transport and fate of volatile organic chemicals and greenhouse gases. Reference point gas diffusivities (R{sub p}) in completely dry soil were estimated for 20 undisturbed soils by assuming a power function relation between gas diffusivity and air-filled porosity ({epsilon}). Among the classical gas diffusivity models, the Buckingham (1904) expression, equal to the soil total porosity squared, best described R{sub p}. Inasmuch, as their previous works implied a soil-type dependency of D{sub s}/D{submore » 0}({epsilon}) in undisturbed soils, the Buckingham R{sub p} expression was inserted in two soil-type-dependent D{sub s}/D{sub 0}({epsilon}) models. One D{sub s}/D{sub 0}({epsilon}) model is a function of pore-size distribution (the Campbell water retention parameter used in a modified Burdine capillary tube model), and the other is a calibrated, empirical function of soil texture (silt + sand fraction). Both the Buckingham-Burdine-Campbell (BBC) and the Buckingham/soil texture-based D{sub s}/D{sub 0}({epsilon}) models described well the observed soil type effects on gas diffusivity and gave improved predictions compared with soil type independent models when tested against an independent data set for six undisturbed surface soils. This study emphasizes that simple but soil-type-dependent power function D{sub s}/D{sub 0}({epsilon}) models can adequately describe and predict gas diffusivity in undisturbed soil. The authors recommend the new BBC model as basis for modeling gas transport and reactions in undisturbed soil systems.« less

Middle East respiratory syndrome coronavirus (MERS-CoV): animal to human interaction

PubMed Central

Omrani, Ali S.; Al-Tawfiq, Jaffar A.

2015-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel enzootic betacoronavirus that was first described in September 2012. The clinical spectrum of MERS-CoV infection in humans ranges from an asymptomatic or mild respiratory illness to severe pneumonia and multi-organ failure; overall mortality is around 35.7%. Bats harbour several betacoronaviruses that are closely related to MERS-CoV but more research is needed to establish the relationship between bats and MERS-CoV. The seroprevalence of MERS-CoV antibodies is very high in dromedary camels in Eastern Africa and the Arabian Peninsula. MERS-CoV RNA and viable virus have been isolated from dromedary camels, including some with respiratory symptoms. Furthermore, near-identical strains of MERS-CoV have been isolated from epidemiologically linked humans and camels, confirming inter-transmission, most probably from camels to humans. Though inter-human spread within health care settings is responsible for the majority of reported MERS-CoV cases, the virus is incapable at present of causing sustained human-to-human transmission. Clusters can be readily controlled with implementation of appropriate infection control procedures. Phylogenetic and sequencing data strongly suggest that MERS-CoV originated from bat ancestors after undergoing a recombination event in the spike protein, possibly in dromedary camels in Africa, before its exportation to the Arabian Peninsula along the camel trading routes. MERS-CoV serosurveys are needed to investigate possible unrecognized human infections in Africa. Amongst the important measures to control MERS-CoV spread are strict regulation of camel movement, regular herd screening and isolation of infected camels, use of personal protective equipment by camel handlers and enforcing rules banning all consumption of unpasteurized camel milk and urine. PMID:26924345

A Chimeric Kinesin-1 Head/Kinesin-5 Tail Motor Switches between Diffusive and Processive Motility

PubMed Central

Thiede, Christina; Lakämper, Stefan; Wessel, Alok D.; Kramer, Stefanie; Schmidt, Christoph F.

2013-01-01

Homotetrameric kinesin-5 motors are essential for chromosome separation and assembly of the mitotic spindle. These kinesins bind between two microtubules (MTs) and slide them apart, toward the spindle poles. This process must be tightly regulated in mitosis. In in vitro assays, Eg5 moves diffusively on single MTs and switches to a directed mode between MTs. How allosteric communication between opposing motor domains works remains unclear, but kinesin-5 tail domains may be involved. Here we present a single-molecule fluorescence study of a tetrameric kinesin-1 head/kinesin-5 tail chimera, DK4mer. This motor exhibited fast processive motility on single MTs interrupted by pauses. Like Eg5, DK4mer diffused along MTs with ADP, and slid antiparallel MTs apart with ATP. In contrast to Eg5, diffusive and processive periods were clearly distinguishable. This allowed us to measure transition rates among states and for unbinding as a function of buffer ionic strength. These data, together with results from controls using tail-less dimers, indicate that there are two modes of interaction with MTs, separated by an energy barrier. This result suggests a scheme of motor regulation that involves switching between two bound states, possibly allosterically controlled by the opposing tetramer end. Such a scheme is likely to be relevant for the regulation of native kinesin-5 motors. PMID:23442865

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

The backshell for the Mars Exploration Rover 1 (MER-1) is moved toward the rover (foreground, left). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

3B11-N, a monoclonal antibody against MERS-CoV, reduces lung pathology in rhesus monkeys following intratracheal inoculation of MERS-CoV Jordan-n3/2012

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Bagci, Ulas; Center for Research in Computer Vision

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was identified in 2012 as the causative agent of a severe, lethal respiratory disease occurring across several countries in the Middle East. To date there have been over 1600 laboratory confirmed cases of MERS-CoV in 26 countries with a case fatality rate of 36%. Given the endemic region, it is possible that MERS-CoV could spread during the annual Hajj pilgrimage, necessitating countermeasure development. In this report, we describe the clinical and radiographic changes of rhesus monkeys following infection with 5×10{sup 6} PFU MERS-CoV Jordan-n3/2012. Two groups of NHPs were treated with either a humanmore » anti-MERS monoclonal antibody 3B11-N or E410-N, an anti-HIV antibody. MERS-CoV Jordan-n3/2012 infection resulted in quantifiable changes by computed tomography, but limited other clinical signs of disease. 3B11-N treated subjects developed significantly reduced lung pathology when compared to infected, untreated subjects, indicating that this antibody may be a suitable MERS-CoV treatment. - Highlights: • MERS-CoV Jordan-n3/2012 challenge of rhesus monkeys results in a mild disease. • CT can be used to monitor disease progression to aid models of human disease. • Treatment with the human monoclonal antibody 3B11-N resulted in decreased disease.« less

Length of encapsidated cargo impacts stability and structure of in vitro assembled alphavirus core-like particles

NASA Astrophysics Data System (ADS)

Rayaprolu, Vamseedhar; Moore, Alan; Che-Yen Wang, Joseph; Goh, Boon Chong; Perilla, Juan R.; Zlotnick, Adam; Mukhopadhyay, Suchetana

2017-12-01

In vitro assembly of alphavirus nucleocapsid cores, called core-like particles (CLPs), requires a polyanionic cargo. There are no sequence or structure requirements to encapsidate single-stranded nucleic acid cargo. In this work, we wanted to determine how the length of the cargo impacts the stability and structure of the assembled CLPs. We hypothesized that cargo neutralizes the basic region of the alphavirus capsid protein and if the cargo is long enough, it will also act to scaffold the CP monomers together. Experimentally we found that CLPs encapsidating short 27mer oligonucleotides were less stable than CLPs encapsidating 48mer or 90mer oligonucleotides under different chemical and thermal conditions. Furthermore, cryo-EM studies showed there were structural differences between CLPs assembled with 27mer and 48mer cargo. To mimic the role of the cargo in CLP assembly we made a mutant (4D) where we substituted a cluster of four Lys residues in the CP with four Asp residues. We found that these few amino acid substitutions were enough to initiate CLP assembly in the absence of cargo. The cargo-free 4D CLPs show higher resistance to ionic strength and increased temperature compared to wild-type cargo containing CLPs suggesting their CLP assembly mechanism might also be different.

Reverse Transcription Recombinase Polymerase Amplification Assay for the Detection of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Abd El Wahed, Ahmed; Patel, Pranav; Heidenreich, Doris; Hufert, Frank T.; Weidmann, Manfred

2013-01-01

The emergence of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in the eastern Mediterranean and imported cases to Europe has alerted public health authorities. Currently, detection of MERS-CoV in patient samples is done by real-time RT-PCR. Samples collected from suspected cases are sent to highly-equipped centralized laboratories for screening. A rapid point-of-care test is needed to allow more widespread mobile detection of the virus directly from patient material. In this study, we describe the development of a reverse transcription isothermal Recombinase Polymerase Amplification (RT-RPA) assay for the identification of MERS-CoV. A partial nucleocapsid gene RNA molecular standard of MERS-coronavirus was used to determine the assay sensitivity. The isothermal (42°C) MERS-CoV RT-RPA was as sensitive as real-time RT-PCR (10 RNA molecules), rapid (3-7 minutes) and mobile (using tubescanner weighing 1kg). The MERS-CoV RT-RPA showed cross-detection neither of any of the RNAs of several coronaviruses and respiratory viruses affecting humans nor of the human genome. The developed isothermal real-time RT-RPA is ideal for rapid mobile molecular MERS-CoV monitoring in acute patients and may also facilitate the search for the animal reservoir of MERS-CoV. PMID:24459611

Korean Society for Laboratory Medicine Practice Guidelines for the Molecular Diagnosis of Middle East Respiratory Syndrome During an Outbreak in Korea in 2015.

PubMed

Ki, Chang Seok; Lee, Hyukmin; Sung, Heungsup; Kim, Sinyoung; Seong, Moon Woo; Yong, Dongeun; Kim, Jae Seok; Lee, Mi Kyung; Kim, Mi Na; Choi, Jong Rak; Kim, Jeong Ho

2016-05-01

For two months between May and July 2015, a nationwide outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) occurred in Korea. On June 3, 2015, the Korean Society for Laboratory Medicine (KSLM) launched a MERS-CoV Laboratory Response Task Force (LR-TF) to facilitate clinical laboratories to set up the diagnosis of MERS-CoV infection. Based on the WHO interim recommendations, the Centers for Disease Control and Prevention of United States guidelines for MERS-CoV laboratory testing, and other available resources, the KSLM MERS-CoV LR-TF provided the first version of the laboratory practice guidelines for the molecular diagnosis of MERS-CoV to the clinical laboratories on June 12, 2015. The guidelines described here are an updated version that includes case definition, indications for testing, specimen type and protocols for specimen collection, specimen packing and transport, specimen handling and nucleic acid extraction, molecular detection of MERS-CoV, interpretation of results and reporting, and laboratory safety. The KSLM guidelines mainly focus on the molecular diagnosis of MERS-CoV, reflecting the unique situation in Korea and the state of knowledge at the time of publication.

Peptide synthesis on glass substrate using acoustic droplet ejector.

PubMed

Youngki Choe; Shih-Jui Chen; Eun Sok Kim

2014-03-01

This paper describes the synthesis of a 9-mers-long peptide ladder structure of glycine on a modified glass surface using a nanoliter droplet ejector. To synthesize peptide on a glass substrate, SPOT peptide synthesis protocol was followed with a nozzleless acoustic droplet ejector being used to eject about 300 droplets of preactivated amino acid solution to dispense 60 nL of the solution per mer. The coupling efficiency of each mer was measured with FITC fluorescent tag to be 96%, resulting in net 70% efficiency for the whole 9-mer-long peptide of glycine. Usage of a nanoliter droplet ejector for SPOT peptide synthesis increases the density of protein array on a chip.

Comparative Epidemiology of Human Infections with Middle East Respiratory Syndrome and Severe Acute Respiratory Syndrome Coronaviruses among Healthcare Personnel

PubMed Central

Chu, Yu-Tseng; Wu, Joseph Tsung-Shu; Geng, Xingyi; Zhao, Na; Cheng, Wei; Chen, Enfu; King, Chwan-Chuen

2016-01-01

The largest nosocomial outbreak of Middle East respiratory syndrome (MERS) occurred in South Korea in 2015. Health Care Personnel (HCP) are at high risk of acquiring MERS-Coronavirus (MERS-CoV) infections, similar to the severe acute respiratory syndrome (SARS)-Coronavirus (SARS-CoV) infections first identified in 2003. This study described the similarities and differences in epidemiological and clinical characteristics of 183 confirmed global MERS cases and 98 SARS cases in Taiwan associated with HCP. The epidemiological findings showed that the mean age of MERS-HCP and total MERS cases were 40 (24~74) and 49 (2~90) years, respectively, much older than those in SARS [SARS-HCP: 35 (21~68) years, p = 0.006; total SARS: 42 (0~94) years, p = 0.0002]. The case fatality rates (CFR) was much lower in MERS-HCP [7.03% (9/128)] or SARS-HCP [12.24% (12/98)] than the MERS-non-HCP [36.96% (34/92), p<0.001] or SARS-non-HCP [24.50% (61/249), p<0.001], however, no difference was found between MERS-HCP and SARS-HCP [p = 0.181]. In terms of clinical period, the days from onset to death [13 (4~17) vs 14.5 (0~52), p = 0.045] and to discharge [11 (5~24) vs 24 (0~74), p = 0.010] and be hospitalized days [9.5 (3~22) vs 22 (0~69), p = 0.040] were much shorter in MERS-HCP than SARS-HCP. Similarly, days from onset to confirmation were shorter in MERS-HCP than MERS-non-HCP [6 (1~14) vs 10 (1~21), p = 0.044]. In conclusion, the severity of MERS-HCP and SARS-HCP was lower than that of MERS-non-HCP and SARS-non-HCP due to younger age and early confirmation in HCP groups. However, no statistical difference was found in MERS-HCP and SARS-HCP. Thus, prevention of nosocomial infections involving both novel Coronavirus is crucially important to protect HCP. PMID:26930074

Challenges presented by MERS corona virus, and SARS corona virus to global health.

PubMed

Al-Hazmi, Ali

2016-07-01

Numerous viral infections have arisen and affected global healthcare facilities. Millions of people are at severe risk of acquiring several evolving viral infections through several factors. In the present article we have described about risk factors, chance of infection, and prevention methods of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and severe acute respiratory syndrome (SARS-CoV), human coronaviruses (CoVs) frequently cause a normal cold which is mild and self-restricting. Zoonotic transmission of CoVs such as the newly discovered MERS-CoV and SARS-CoV, may be associated with severe lower respiratory tract infection. The present review provides the recent clinical and pathological information on MERS and SARS. The task is to transform these discoveries about MERS and SARS pathogenesis and to develop intervention methods that will eventually allow the effective control of these recently arising severe viral infections. Global health sector has learnt many lessons through the recent outbreak of MERS and SARS, but the need for identifying new antiviral treatment was not learned. In the present article we have reviewed the literature on the several facets like transmission, precautions and effectiveness of treatments used in patients with MERS-CoV and SARS infections.

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers watch as an overhead crane begins to lift the backshell with the Mars Exploration Rover 1 (MER-1) inside. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-06

KENNEDY SPACE CENTER, FLA. - A closeup of the cruise stage to be mated to the Mars Exploration Rover 2 (MER-2) entry vehicle. The cruise stage includes fuel tanks, thruster clusters and avionics for steering and propulsion. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-2 is scheduled to launch June 5 as MER-A aboard a Delta rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Assembly of the backshell and heat shield surrounding the Mars Exploration Rover 1 (MER-1) is complete. The resulting aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Assessing the Accuracy of Density Functional and Semiempirical Wave Function Methods for Water Nanoparticles: Comparing Binding and Relative Energies of (H2O)16 and (H2O)17 to CCSD(T) Results.

PubMed

Leverentz, Hannah R; Qi, Helena W; Truhlar, Donald G

2013-02-12

The binding energies and relative conformational energies of five configurations of the water 16-mer are computed using 61 levels of density functional (DF) theory, 12 methods combining DF theory with molecular mechanics damped dispersion (DF-MM), seven semiempirical-wave function (SWF) methods, and five methods combining SWF theory with molecular mechanics damped dispersion (SWF-MM). The accuracies of the computed energies are assessed by comparing them to recent high-level ab initio results; this assessment is more relevant to bulk water than previous tests on small clusters because a 16-mer is large enough to have water molecules that participate in more than three hydrogen bonds. We find that for water 16-mer binding energies the best DF, DF-MM, SWF, and SWF-MM methods (and their mean unsigned errors in kcal/mol) are respectively M06-2X (1.6), ωB97X-D (2.3), SCC-DFTB-γ(h) (35.2), and PM3-D (3.2). We also mention the good performance of CAM-B3LYP (1.8), M05-2X (1.9), and TPSSLYP (3.0). In contrast, for relative energies of various water nanoparticle 16-mer structures, the best methods (and mean unsigned errors in kcal/mol), in the same order of classes of methods, are SOGGA11-X (0.3), ωB97X-D (0.2), PM6 (0.4), and PMOv1 (0.6). We also mention the good performance of LC-ωPBE-D3 (0.3) and ωB97X (0.4). When both relative and binding energies are taken into consideration, the best methods overall (out of the 85 tested) are M05-2X without molecular mechanics and ωB97X-D when molecular mechanics corrections are included; with considerably higher average errors and considerably lower cost, the best SWF or SWF-MM method is PMOv1. We use six of the best methods for binding energies of the water 16-mers to calculate the binding energies of water hexamers and water 17-mers to test whether these methods are also reliable for binding energy calculations on other types of water clusters.

MERS-CoV Accessory ORFs Play Key Role for Infection and Pathogenesis

PubMed Central

Menachery, Vineet D.; Mitchell, Hugh D.; Cockrell, Adam S.; Gralinski, Lisa E.; Yount, Boyd L.; Graham, Rachel L.; McAnarney, Eileen T.; Douglas, Madeline G.; Scobey, Trevor; Beall, Anne; Dinnon, Kenneth; Kocher, Jacob F.; Hale, Andrew E.; Stratton, Kelly G.; Waters, Katrina M.

2017-01-01

ABSTRACT While dispensable for viral replication, coronavirus (CoV) accessory open reading frame (ORF) proteins often play critical roles during infection and pathogenesis. Utilizing a previously generated mutant, we demonstrate that the absence of all four Middle East respiratory syndrome CoV (MERS-CoV) accessory ORFs (deletion of ORF3, -4a, -4b, and -5 [dORF3-5]) has major implications for viral replication and pathogenesis. Importantly, attenuation of the dORF3-5 mutant is primarily driven by dysregulated host responses, including disrupted cell processes, augmented interferon (IFN) pathway activation, and robust inflammation. In vitro replication attenuation also extends to in vivo models, allowing use of dORF3-5 as a live attenuated vaccine platform. Finally, examination of ORF5 implicates a partial role in modulation of NF-κB-mediated inflammation. Together, the results demonstrate the importance of MERS-CoV accessory ORFs for pathogenesis and highlight them as potential targets for surveillance and therapeutic treatments moving forward. PMID:28830941

Identifying Monoclonal Antibodies that Potently Inhibit MERS-CoV | Center for Cancer Research

Cancer.gov

The Middle East respiratory syndrome coronavirus (MERS-CoV), first isolated in September 2012, infects cells lining the human airway, causing severe flu-like symptoms that, in some cases, lead to death. As of July 2, 2014, 824 confirmed cases of MERS-CoV infection, including at least 286 related deaths, have been reported to the World Health Organization. While there are currently no effective therapies against the virus, monoclonal antibodies (MAbs) may be a promising candidate. Having previously developed MAbs against other viruses, including the related severe acute respiratory syndrome coronavirus or SARS-CoV, Dimiter Dimitrov, Ph.D., of CCR’s Laboratory of Experimental Immunology (LEI), and his colleagues decided to pan a library of antigen binding fragments (Fab) for activity against MERS-CoV.

KSC-03PD-1587

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. A solid rocket booster arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It is one of nine that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

The Synechocystis PCC6803 MerA-like enzyme operates in the reduction of both mercury and uranium under the control of the glutaredoxin 1 enzyme.

PubMed

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D; Cassier-Chauvat, Corinne; Chauvat, Franck

2013-09-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX(2)C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes.

The Synechocystis PCC6803 MerA-Like Enzyme Operates in the Reduction of Both Mercury and Uranium under the Control of the Glutaredoxin 1 Enzyme

PubMed Central

Marteyn, Benoit; Sakr, Samer; Farci, Sandrine; Bedhomme, Mariette; Chardonnet, Solenne; Decottignies, Paulette; Lemaire, Stéphane D.; Cassier-Chauvat, Corinne

2013-01-01

In a continuing effort to analyze the selectivity/redundancy of the three glutaredoxin (Grx) enzymes of the model cyanobacterium Synechocystis PCC6803, we have characterized an enzyme system that plays a crucial role in protection against two toxic metal pollutants, mercury and uranium. The present data show that Grx1 (Slr1562 in CyanoBase) selectively interacts with the presumptive mercuric reductase protein (Slr1849). This MerA enzyme plays a crucial role in cell defense against both mercuric and uranyl ions, in catalyzing their NADPH-driven reduction. Like MerA, Grx1 operates in cell protection against both mercury and uranium. The Grx1-MerA interaction requires cysteine 86 (C86) of Grx1 and C78 of MerA, which is critical for its reductase activity. MerA can be inhibited by glutathionylation and subsequently reactivated by Grx1, likely through deglutathionylation. The two Grx1 residues C31, which belongs to the redox active site (CX2C), and C86, which operates in MerA interactions, are both required for reactivation of MerA. These novel findings emphasize the role of glutaredoxins in tolerance to metal stress as well as the evolutionary conservation of the glutathionylation process, so far described mostly for eukaryotes. PMID:23852862

Diatomaceous Fungal and Bacterial Building Blocks for Material Synthesis

DTIC Science & Technology

2008-04-08

Thalassiosira-templated metallic microshells. Thalassiosira, only 1mM rhodamine 6G (d) lmM, (e) I piM ,(f 100 nM R6G. 4 concentrations gave detectable...hybridized with a 27-mer 7 oligonucleotide containing a 7-mer TAG GAA TAG TTA TA AT OTT ATT AGO complementary region 2, which produces TAIOATCCTTA TACAATAATCC

Effects of Polymer Conjugation on Hybridization Thermodynamics of Oligonucleic Acids.

PubMed

Ghobadi, Ahmadreza F; Jayaraman, Arthi

2016-09-15

In this work, we perform coarse-grained (CG) and atomistic simulations to study the effects of polymer conjugation on hybridization/melting thermodynamics of oligonucleic acids (ONAs). We present coarse-grained Langevin molecular dynamics simulations (CG-NVT) to assess the effects of the polymer flexibility, length, and architecture on hybridization/melting of ONAs with different ONA duplex sequences, backbone chemistry, and duplex concentration. In these CG-NVT simulations, we use our recently developed CG model of ONAs in implicit solvent, and treat the conjugated polymer as a CG chain with purely repulsive Weeks-Chandler-Andersen interactions with all other species in the system. We find that 8-100-mer linear polymer conjugation destabilizes 8-mer ONA duplexes with weaker Watson-Crick hydrogen bonding (WC H-bonding) interactions at low duplex concentrations, while the same polymer conjugation has an insignificant impact on 8-mer ONA duplexes with stronger WC H-bonding. To ensure the configurational space is sampled properly in the CG-NVT simulations, we also perform CG well-tempered metadynamics simulations (CG-NVT-MetaD) and analyze the free energy landscape of ONA hybridization for a select few systems. We demonstrate that CG-NVT-MetaD simulation results are consistent with the CG-NVT simulations for the studied systems. To examine the limitations of coarse-graining in capturing ONA-polymer interactions, we perform atomistic parallel tempering metadynamics simulations at well-tempered ensemble (AA-MetaD) for a 4-mer DNA in explicit water with and without conjugation to 8-mer poly(ethylene glycol) (PEG). AA-MetaD simulations also show that, for a short DNA duplex at T = 300 K, a condition where the DNA duplex is unstable, conjugation with PEG further destabilizes DNA duplex. We conclude with a comparison of results from these three different types of simulations and discuss their limitations and strengths.

“Don’t forget the migrants”: exploring preparedness and response strategies to combat the potential spread of MERS-CoV virus through migrant workers in Sri Lanka

PubMed Central

Agampodi, Suneth B

2013-01-01

From September 2012 to July 2013, 81 laboratory-confirmed cases of infection with Middle East respiratory syndrome coronavirus (MERS-CoV), including 45 deaths (a case fatality ratio of 55%) have been reported from eight countries. Human-to-human transmission is now confirmed showing potential for another pandemic of zoonotic disease, with an extremely high mortality rate. Effective surveillance strategies are required in countries with a high influx of migrants from the Middle East to mitigate the probable importation of MERS-CoV. We discuss here the risk of MERS-CoV in major labor sending countries and list the probable strategies for control and prevention of MERS-CoV using Sri Lanka as an example. It is conservatively estimated that 10% of Sri Lanka’s population work as international labor migrants (1.8 to 2 million workers), with 93% residing in the Middle East. An average of 720 workers depart each day, with the majority of these workers (71%) departing to the Kingdom of Saudi Arabia (the country with 81.5% of total MERS-CoV cases). We also describe other inbound migration categories such as tourists and resident visa holders relevant to the context of preparedness and planning. The importance of partnerships between public health authorities at national and regional levels with labor migration networks to establish institutional and/or policy mechanisms are highlighted for ensuring effective preparedness and response planning. Strategies that can be taken by public health authorities working in both labor sending and labor receiving counties are also described.  The strategies described here may be useful for other labor sending country contexts in Asia with a high frequency and volume of migrant workers to and from the Gulf region. PMID:24555078

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the attachment between the backshell (above) and heat shield (below) surrounding the Mars Exploration Rover 1 (MER-1). The aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-15

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the attachment between the backshell (above) and heat shield (below) surrounding the Mars Exploration Rover 1 (MER-1). The aeroshell will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NCI Scientists Solve Structure of Protein that Enables MERS Virus to Spread | Poster

Cancer.gov

Scientists at the Frederick National Lab have produced three crystal structures that reveal a specific part of a protein that can be targeted to fight the Middle East respiratory syndrome coronavirus (MERS-CoV), which causes an emerging viral respiratory illness. Senior Investigator David Waugh, Ph.D., Macromolecular Crystallography Laboratory, has solved the structure of an

Mission Evaluation Room Intelligent Diagnostic and Analysis System (MIDAS)

NASA Technical Reports Server (NTRS)

Pack, Ginger L.; Falgout, Jane; Barcio, Joseph; Shnurer, Steve; Wadsworth, David; Flores, Louis

1994-01-01

The role of Mission Evaluation Room (MER) engineers is to provide engineering support during Space Shuttle missions, for Space Shuttle systems. These engineers are concerned with ensuring that the systems for which they are responsible function reliably, and as intended. The MER is a central facility from which engineers may work, in fulfilling this obligation. Engineers participate in real-time monitoring of shuttle telemetry data and provide a variety of analyses associated with the operation of the shuttle. The Johnson Space Center's Automation and Robotics Division is working to transfer advances in intelligent systems technology to NASA's operational environment. Specifically, the MER Intelligent Diagnostic and Analysis System (MIDAS) project provides MER engineers with software to assist them with monitoring, filtering and analyzing Shuttle telemetry data, during and after Shuttle missions. MIDAS off-loads to computers and software, the tasks of data gathering, filtering, and analysis, and provides the engineers with information which is in a more concise and usable form needed to support decision making and engineering evaluation. Engineers are then able to concentrate on more difficult problems as they arise. This paper describes some, but not all of the applications that have been developed for MER engineers, under the MIDAS Project. The sampling described herewith was selected to show the range of tasks that engineers must perform for mission support, and to show the various levels of automation that have been applied to assist their efforts.

Overview of Athena Microscopic Imager Results

NASA Technical Reports Server (NTRS)

Herkenhoff, K.; Squyres, S.; Arvidson, R.; Bass, D.; Bell, J., III; Bertelsen, P.; Cabrol, N.; Ehlmann, B.; Farrand, W.; Gaddis, L.

2005-01-01

The Athena science payload on the Mars Exploration Rovers (MER) includes the Microscopic Imager (MI). The MI is a fixed-focus camera mounted on an extendable arm, the Instrument Deployment Device (IDD). The MI acquires images at a spatial resolution of 31 microns/pixel over a broad spectral range (400 - 700 nm). The MI uses the same electronics design as the other MER cameras but its optics yield a field of view of 32 32 mm across a 1024 1024 pixel CCD image. The MI acquires images using only solar or skylight illumination of the target surface. The MI science objectives, instrument design and calibration, operation, and data processing were described by Herkenhoff et al. Initial results of the MI experiment on both MER rovers (Spirit and Opportunity) have been published previously. Highlights of these and more recent results are described.

Application of State Analysis and Goal-based Operations to a MER Mission Scenario

NASA Technical Reports Server (NTRS)

Morris, John Richard; Ingham, Michel D.; Mishkin, Andrew H.; Rasmussen, Robert D.; Starbird, Thomas W.

2006-01-01

State Analysis is a model-based systems engineering methodology employing a rigorous discovery process which articulates operations concepts and operability needs as an integrated part of system design. The process produces requirements on system and software design in the form of explicit models which describe the system behavior in terms of state variables and the relationships among them. By applying State Analysis to an actual MER flight mission scenario, this study addresses the specific real world challenges of complex space operations and explores technologies that can be brought to bear on future missions. The paper first describes the tools currently used on a daily basis for MER operations planning and provides an in-depth description of the planning process, in the context of a Martian day's worth of rover engineering activities, resource modeling, flight rules, science observations, and more. It then describes how State Analysis allows for the specification of a corresponding goal-based sequence that accomplishes the same objectives, with several important additional benefits.

Application of State Analysis and Goal-Based Operations to a MER Mission Scenario

NASA Technical Reports Server (NTRS)

Morris, J. Richard; Ingham, Michel D.; Mishkin, Andrew H.; Rasmussen, Robert D.; Starbird, Thomas W.

2006-01-01

State Analysis is a model-based systems engineering methodology employing a rigorous discovery process which articulates operations concepts and operability needs as an integrated part of system design. The process produces requirements on system and software design in the form of explicit models which describe the behavior of states and the relationships among them. By applying State Analysis to an actual MER flight mission scenario, this study addresses the specific real world challenges of complex space operations and explores technologies that can be brought to bear on future missions. The paper describes the tools currently used on a daily basis for MER operations planning and provides an in-depth description of the planning process, in the context of a Martian day's worth of rover engineering activities, resource modeling, flight rules, science observations, and more. It then describes how State Analysis allows for the specification of a corresponding goal-based sequence that accomplishes the same objectives, with several important additional benefits.

Transmission characteristics of MERS and SARS in the healthcare setting: a comparative study.

PubMed

Chowell, Gerardo; Abdirizak, Fatima; Lee, Sunmi; Lee, Jonggul; Jung, Eunok; Nishiura, Hiroshi; Viboud, Cécile

2015-09-03

The Middle East respiratory syndrome (MERS) coronavirus has caused recurrent outbreaks in the Arabian Peninsula since 2012. Although MERS has low overall human-to-human transmission potential, there is occasional amplification in the healthcare setting, a pattern reminiscent of the dynamics of the severe acute respiratory syndrome (SARS) outbreaks in 2003. Here we provide a head-to-head comparison of exposure patterns and transmission dynamics of large hospital clusters of MERS and SARS, including the most recent South Korean outbreak of MERS in 2015. To assess the unexpected nature of the recent South Korean nosocomial outbreak of MERS and estimate the probability of future large hospital clusters, we compared exposure and transmission patterns for previously reported hospital clusters of MERS and SARS, based on individual-level data and transmission tree information. We carried out simulations of nosocomial outbreaks of MERS and SARS using branching process models rooted in transmission tree data, and inferred the probability and characteristics of large outbreaks. A significant fraction of MERS cases were linked to the healthcare setting, ranging from 43.5 % for the nosocomial outbreak in Jeddah, Saudi Arabia, in 2014 to 100 % for both the outbreak in Al-Hasa, Saudi Arabia, in 2013 and the outbreak in South Korea in 2015. Both MERS and SARS nosocomial outbreaks are characterized by early nosocomial super-spreading events, with the reproduction number dropping below 1 within three to five disease generations. There was a systematic difference in the exposure patterns of MERS and SARS: a majority of MERS cases occurred among patients who sought care in the same facilities as the index case, whereas there was a greater concentration of SARS cases among healthcare workers throughout the outbreak. Exposure patterns differed slightly by disease generation, however, especially for SARS. Moreover, the distributions of secondary cases per single primary case varied highly across individual hospital outbreaks (Kruskal-Wallis test; P < 0.0001), with significantly higher transmission heterogeneity in the distribution of secondary cases for MERS than SARS. Simulations indicate a 2-fold higher probability of occurrence of large outbreaks (>100 cases) for SARS than MERS (2 % versus 1 %); however, owing to higher transmission heterogeneity, the largest outbreaks of MERS are characterized by sharper incidence peaks. The probability of occurrence of MERS outbreaks larger than the South Korean cluster (n = 186) is of the order of 1 %. Our study suggests that the South Korean outbreak followed a similar progression to previously described hospital clusters involving coronaviruses, with early super-spreading events generating a disproportionately large number of secondary infections, and the transmission potential diminishing greatly in subsequent generations. Differences in relative exposure patterns and transmission heterogeneity of MERS and SARS could point to changes in hospital practices since 2003 or differences in transmission mechanisms of these coronaviruses.

KSC-03pd1832

NASA Image and Video Library

2003-06-06

KENNEDY SPACE CENTER, FLA. - A science briefing on the Mars Exploration Rover (MER) missions is held for the media at Kennedy Space Center. From left, the participants are Donald Savage, NASA Public Information Officer; Dr. Ed Weiler, Associate Administrator for Space Science, NASA Headquarters; Dr. Jim Garvin, Mars lead scientist, NASA Headquarters; Dr. Cathy Weitz, MER program scientist, NASA Headquarters; Dr. Joy Crisp, MER project scientist, Jet Propulsion Laboratory; and Dr. Steve Squyres, Mer principal investigator, Cornell Univeristy, Ithaca, N.Y. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans are not yet able to go. MER-A is scheduled to launch on June 8 at 2:06 p.m. EDT, with two launch opportunities each day during a launch period that closes on June 24.

KSC-03PD-1593

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. While one solid rocket booster (SRB) is suspended in the launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, another is raised from its transporter for a similar lift. They are two of nine SRBs that will be mated to the Delta rocket to launch Mars Exploration Rover 2. NASAs twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans cant yet go. MER-2 is scheduled to launch June 5 as MER-A. MER-1 (MER-B) will launch June 25.

Roles of Diffusion Dynamics in Stem Cell Signaling and Three-Dimensional Tissue Development.

PubMed

McMurtrey, Richard J

2017-09-15

Recent advancements in the ability to construct three-dimensional (3D) tissues and organoids from stem cells and biomaterials have not only opened abundant new research avenues in disease modeling and regenerative medicine but also have ignited investigation into important aspects of molecular diffusion in 3D cellular architectures. This article describes fundamental mechanics of diffusion with equations for modeling these dynamic processes under a variety of scenarios in 3D cellular tissue constructs. The effects of these diffusion processes and resultant concentration gradients are described in the context of the major molecular signaling pathways in stem cells that both mediate and are influenced by gas and nutrient concentrations, including how diffusion phenomena can affect stem cell state, cell differentiation, and metabolic states of the cell. The application of these diffusion models and pathways is of vital importance for future studies of developmental processes, disease modeling, and tissue regeneration.

Transferability of different classical force fields for right and left handed α-helices constructed from enantiomeric amino acids.

PubMed

Biswas, Santu; Sarkar, Sujit; Pandey, Prithvi Raj; Roy, Sudip

2016-02-21

Amino acids can form d and l enantiomers, of which the l enantiomer is abundant in nature. The naturally occurring l enantiomer has a greater preference for a right handed helical conformation, and the d enantiomer for a left handed helical conformation. The other conformations, that is, left handed helical conformations of the l enantiomers and right handed helical conformations of the d enantiomers, are not common. The energetic differences between left and right handed alpha helical peptide chains constructed from enantiomeric amino acids are investigated using quantum chemical calculations (using the M06/6-311g(d,p) level of theory). Further, the performances of commonly used biomolecular force fields (OPLS/AA, CHARMM27/CMAP and AMBER) to represent the different helical conformations (left and right handed) constructed from enantiomeric (D and L) amino acids are evaluated. 5- and 10-mer chains from d and l enantiomers of alanine, leucine, lysine, and glutamic acid, in right and left handed helical conformations, are considered in the study. Thus, in total, 32 α-helical polypeptides (4 amino acids × 4 conformations of 5-mer and 10-mer) are studied. Conclusions, with regards to the performance of the force fields, are derived keeping the quantum optimized geometry as the benchmark, and on the basis of phi and psi angle calculations, hydrogen bond analysis, and different long range helical order parameters.

Development of Fluorescent Reverse Transcription Loop-mediated Isothermal Amplification (RT-LAMP) using Quenching Probes for the Detection of the Middle East Respiratory Syndrome Coronavirus.

PubMed

Shirato, Kazuya; Semba, Shohei; El-Kafrawy, Sherif A; Hassan, Ahmed M; Tolah, Ahmed M; Takayama, Ikuyo; Kageyama, Tsutomu; Notomi, Tsugunori; Kamitani, Wataru; Matsuyama, Shutoku; Azhar, Esam Ibraheem

2018-05-12

Clinical detection of Middle East respiratory syndrome (MERS) coronavirus (MERS-CoV) in patients is achieved using genetic diagnostic methods, such as real-time RT-PCR assay. Previously, we developed a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay for the detection of MERS-CoV [Virol J. 2014. 11:139]. Generally, amplification of RT-LAMP is monitored by the turbidity induced by precipitation of magnesium pyrophosphate with newly synthesized DNA. However, this mechanism cannot completely exclude the possibility of unexpected reactions. Therefore, in this study, fluorescent RT-LAMP assays using quenching probes (QProbes) were developed specifically to monitor only primer-derived signals. Two primer sets (targeting nucleocapsid and ORF1a sequences) were constructed to confirm MERS cases by RT-LAMP assay only. Our data indicate that both primer sets were capable of detecting MERS-CoV RNA to the same level as existing genetic diagnostic methods, and that both were highly specific with no cross-reactivity observed with other respiratory viruses. These primer sets were highly efficient in amplifying target sequences derived from different MERS-CoV strains, including camel MERS-CoV. In addition, the detection efficacy of QProbe RT-LAMP was comparable to that of real-time RT-PCR assay using clinical specimens from patients in Saudi Arabia. Altogether, these results indicate that QProbe RT-LAMP assays described here can be used as powerful diagnostic tools for rapid detection and surveillance of MERS-CoV infections. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Computational modeling of the bat HKU4 coronavirus 3CLpro inhibitors as a tool for the development of antivirals against the emerging Middle East respiratory syndrome (MERS) coronavirus.

PubMed

Abuhammad, Areej; Al-Aqtash, Rua'a A; Anson, Brandon J; Mesecar, Andrew D; Taha, Mutasem O

2017-11-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging virus that poses a major challenge to clinical management. The 3C-like protease (3CL pro ) is essential for viral replication and thus represents a potential target for antiviral drug development. Presently, very few data are available on MERS-CoV 3CL pro inhibition by small molecules. We conducted extensive exploration of the pharmacophoric space of a recently identified set of peptidomimetic inhibitors of the bat HKU4-CoV 3CL pro . HKU4-CoV 3CL pro shares high sequence identity (81%) with the MERS-CoV enzyme and thus represents a potential surrogate model for anti-MERS drug discovery. We used 2 well-established methods: Quantitative structure-activity relationship (QSAR)-guided modeling and docking-based comparative intermolecular contacts analysis. The established pharmacophore models highlight structural features needed for ligand recognition and revealed important binding-pocket regions involved in 3CL pro -ligand interactions. The best models were used as 3D queries to screen the National Cancer Institute database for novel nonpeptidomimetic 3CL pro inhibitors. The identified hits were tested for HKU4-CoV and MERS-CoV 3CL pro inhibition. Two hits, which share the phenylsulfonamide fragment, showed moderate inhibitory activity against the MERS-CoV 3CL pro and represent a potential starting point for the development of novel anti-MERS agents. To the best of our knowledge, this is the first pharmacophore modeling study supported by in vitro validation on the MERS-CoV 3CL pro . MERS-CoV is an emerging virus that is closely related to the bat HKU4-CoV. 3CL pro is a potential drug target for coronavirus infection. HKU4-CoV 3CL pro is a useful surrogate model for the identification of MERS-CoV 3CL pro enzyme inhibitors. dbCICA is a very robust modeling method for hit identification. The phenylsulfonamide scaffold represents a potential starting point for MERS coronavirus 3CL pro inhibitors development. Copyright © 2017 John Wiley & Sons, Ltd.

Terrain Modelling for Immersive Visualization for the Mars Exploration Rovers

NASA Technical Reports Server (NTRS)

Wright, J.; Hartman, F.; Cooper, B.; Maxwell, S.; Yen, J.; Morrison, J.

2004-01-01

Immersive environments are being used to support mission operations at the Jet Propulsion Laboratory. This technology contributed to the Mars Pathfinder Mission in planning sorties for the Sojourner rover and is being used for the Mars Exploration Rover (MER) missions. The stereo imagery captured by the rovers is used to create 3D terrain models, which can be viewed from any angle, to provide a powerful and information rich immersive visualization experience. These technologies contributed heavily to both the mission success and the phenomenal level of public outreach achieved by Mars Pathfinder and MER. This paper will review the utilization of terrain modelling for immersive environments in support of MER.

Cardiac-Specific Deletion of Pyruvate Dehydrogenase Impairs Glucose Oxidation Rates and Induces Diastolic Dysfunction.

PubMed

Gopal, Keshav; Almutairi, Malak; Al Batran, Rami; Eaton, Farah; Gandhi, Manoj; Ussher, John Reyes

2018-01-01

Obesity and type 2 diabetes (T2D) increase the risk for cardiomyopathy, which is the presence of ventricular dysfunction in the absence of underlying coronary artery disease and/or hypertension. As myocardial energy metabolism is altered during obesity/T2D (increased fatty acid oxidation and decreased glucose oxidation), we hypothesized that restricting myocardial glucose oxidation in lean mice devoid of the perturbed metabolic milieu observed in obesity/T2D would produce a cardiomyopathy phenotype, characterized via diastolic dysfunction. We tested our hypothesis via producing mice with a cardiac-specific gene knockout for pyruvate dehydrogenase (PDH, gene name Pdha1 ), the rate-limiting enzyme for glucose oxidation. Cardiac-specific Pdha1 deficient ( Pdha1 Cardiac-/- ) mice were generated via crossing a tamoxifen-inducible Cre expressing mouse under the control of the alpha-myosin heavy chain (αMHC-MerCreMer) promoter with a floxed Pdha1 mouse. Energy metabolism and cardiac function were assessed via isolated working heart perfusions and ultrasound echocardiography, respectively. Tamoxifen administration produced an ~85% reduction in PDH protein expression in Pdha1 Cardiac-/- mice versus their control littermates, which resulted in a marked reduction in myocardial glucose oxidation and a corresponding increase in palmitate oxidation. This myocardial metabolism profile did not impair systolic function in Pdha1 Cardiac-/- mice, which had comparable left ventricular ejection fractions and fractional shortenings as their αMHC-MerCreMer control littermates, but did produce diastolic dysfunction as seen via the reduced mitral E/A ratio. Therefore, it does appear that forced restriction of glucose oxidation in the hearts of Pdha1 Cardiac-/- mice is sufficient to produce a cardiomyopathy-like phenotype, independent of the perturbed metabolic milieu observed in obesity and/or T2D.

Multimode marine engine room simulation system based on field bus technology

NASA Astrophysics Data System (ADS)

Zheng, Huayao; Deng, Linlin; Guo, Yi

2003-09-01

Developing multi mode MER (Marine Engine Room) Labs is the main work in Marine Simulation Center, which is the key lab of Communication Ministry of China. It includes FPP (Fixed Pitch Propeller) and CPP (Controllable Pitch Propeller) mode MER simulation systems, integrated electrical propulsion mode MER simulation system, physical mode MER lab, etc. FPP mode simulation system, which was oriented to large container ship, had been completed since 1999, and got second level of Shanghai Municipal Science and Technical Progress award. This paper mainly introduces the recent development and achievements of Marine Simulation Center. Based on the Lon Works field bus, the structure characteristics and control strategies of completely distributed intelligent control network are discussed. The experiment mode of multi-nodes field bus detection and control system is described. Besides, intelligent fault diagnosis technology about some mechatronics integration control systems explored is also involved.

CAFE: aCcelerated Alignment-FrEe sequence analysis.

PubMed

Lu, Yang Young; Tang, Kujin; Ren, Jie; Fuhrman, Jed A; Waterman, Michael S; Sun, Fengzhu

2017-07-03

Alignment-free genome and metagenome comparisons are increasingly important with the development of next generation sequencing (NGS) technologies. Recently developed state-of-the-art k-mer based alignment-free dissimilarity measures including CVTree, $d_2^*$ and $d_2^S$ are more computationally expensive than measures based solely on the k-mer frequencies. Here, we report a standalone software, aCcelerated Alignment-FrEe sequence analysis (CAFE), for efficient calculation of 28 alignment-free dissimilarity measures. CAFE allows for both assembled genome sequences and unassembled NGS shotgun reads as input, and wraps the output in a standard PHYLIP format. In downstream analyses, CAFE can also be used to visualize the pairwise dissimilarity measures, including dendrograms, heatmap, principal coordinate analysis and network display. CAFE serves as a general k-mer based alignment-free analysis platform for studying the relationships among genomes and metagenomes, and is freely available at https://github.com/younglululu/CAFE. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Thermally induced defluorination during a mer to fac transformation of a blue-green phosphorescent cyclometalated iridium(III) complex.

PubMed

Zheng, Yonghao; Batsanov, Andrei S; Edkins, Robert M; Beeby, Andrew; Bryce, Martin R

2012-01-02

The new homoleptic tris-cyclometalated [Ir(C^N)(3)] complexes mer-8, fac-8, and fac-9 incorporating γ-carboline ligands are reported. Reaction of 3-(2,4-difluorophenyl)-5-(2-ethylhexyl)-pyrido[4,3-b]indole 6 with iridium(III) chloride under standard cyclometalating conditions gave the homoleptic complex mer-8 in 63% yield. The X-ray crystal structure of mer-8 is described. The Ir-C and Ir-N bonds show the expected bond length alternations for the differing trans influence of phenyl and pyridyl ligands. mer-8 quantitatively isomerized to fac-8 upon irradiation with UV light. However, heating mer-8 at 290 °C in glycerol led to an unusual regioselective loss of one fluorine atom from each of the ligands, yielding fac-9 in 58% yield. fac-8 is thermally very stable: no decomposition was observed when fac-8 was heated in glycerol at 290 °C for 48 h. The γ-carboline system of fac-8 enhances thermal stability compared to the pyridyl analogue fac-Ir(46dfppy)(3)10, which decomposes extensively upon being heated in glycerol at 290 °C for 2 h. Complexes mer-8, fac-8, and fac-9 are emitters of blue-green light (λ(max)(em) = 477, 476, and 494 nm, respectively). The triplet lifetimes for fac-8 and fac-9 are ~4.5 μs at room temperature; solution Φ(PL) values are 0.31 and 0.22, respectively.

KENNEDY SPACE CENTER, FLA. - On Mars Exploration Rover 1 (MER-1) , air bags are installed on the lander. The airbags will inflate to cushion the landing of the spacecraft on the surface of Mars. When it stops bouncing and rolling, the airbags will deflate and retract, the petals will open to bring the lander to an upright position, and the rover will be exposed. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

KENNEDY SPACE CENTER, FLA. - On Mars Exploration Rover 1 (MER-1) , air bags are installed on the lander. The airbags will inflate to cushion the landing of the spacecraft on the surface of Mars. When it stops bouncing and rolling, the airbags will deflate and retract, the petals will open to bring the lander to an upright position, and the rover will be exposed. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-1) is seen after installation of the air bags on the outside of the lander. The airbags will inflate to cushion the landing of the spacecraft on the surface of Mars. When it stops bouncing and rolling, the airbags will deflate and retract, the petals will open to bring the lander to an upright position, and the rover will be exposed. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-10

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-1) is seen after installation of the air bags on the outside of the lander. The airbags will inflate to cushion the landing of the spacecraft on the surface of Mars. When it stops bouncing and rolling, the airbags will deflate and retract, the petals will open to bring the lander to an upright position, and the rover will be exposed. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Rapid detection of MERS coronavirus-like viruses in bats: pote1ntial for tracking MERS coronavirus transmission and animal origin.

PubMed

Woo, Patrick C Y; Lau, Susanna K P; Chen, Yixin; Wong, Emily Y M; Chan, Kwok-Hung; Chen, Honglin; Zhang, Libiao; Xia, Ningshao; Yuen, Kwok-Yung

2018-03-07

Recently, we developed a monoclonal antibody-based rapid nucleocapsid protein detection assay for diagnosis of MERS coronavirus (MERS-CoV) in humans and dromedary camels. In this study, we examined the usefulness of this assay to detect other lineage C betacoronaviruses closely related to MERS-CoV in bats. The rapid MERS-CoV nucleocapsid protein detection assay was tested positive in 24 (88.9%) of 27 Tylonycteris bat CoV HKU4 (Ty-BatCoV-HKU4) RNA-positive alimentary samples of Tylonycteris pachypus and 4 (19.0%) of 21 Pipistrellus bat CoV HKU5 (Pi-BatCoV-HKU5) RNA-positive alimentary samples of Pipistrellus abramus. There was significantly more Ty-BatCoV-HKU4 RNA-positive alimentary samples than Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive by the rapid MERS-CoV nucleocapsid protein detection assay (P < 0.001 by Chi-square test). The rapid assay was tested negative in all 51 alimentary samples RNA-positive for alphacoronaviruses (Rhinolophus bat CoV HKU2, Myotis bat CoV HKU6, Miniopterus bat CoV HKU8 and Hipposideros batCoV HKU10) and 32 alimentary samples positive for lineage B (SARS-related Rhinolophus bat CoV HKU3) and lineage D (Rousettus bat CoV HKU9) betacoronaviruses. No significant difference was observed between the viral loads of Ty-BatCoV-HKU4/Pi-BatCoV-HKU5 RNA-positive alimentary samples that were tested positive and negative by the rapid test (Mann-Witney U test). The rapid MERS-CoV nucleocapsid protein detection assay is able to rapidly detect lineage C betacoronaviruses in bats. It detected significantly more Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5 because MERS-CoV is more closely related to Ty-BatCoV-HKU4 than Pi-BatCoV-HKU5. This assay will facilitate rapid on-site mass screening of animal samples for ancestors of MERS-CoV and tracking transmission in the related bat species.

In vitro and in vivo characterization of a reversible synthetic heparin analog.

PubMed

Whelihan, Matthew F; Cooley, Brian; Xu, Yongmei; Pawlinski, Rafal; Liu, Jian; Key, Nigel S

2016-02-01

The global supply of unfractionated heparin (UFH) and all commercially available low molecular weight heparins (LMWH) remain dependent on animal sources, such as porcine intestine or bovine lung. Recent experience has shown that contamination of the supply chain (with over-sulfated chondroitin sulfates) can result in lethal toxicity. Fondaparinux is currently the only commercially available synthetic analog of heparin. We recently described a new class of chemoenzymatically synthesized heparin analogs. One of these compounds (S12-mer) is a dodecasaccharide consisting of an antithrombin-binding moiety with repeating units of IdoA2S-GlcNS6S and two 3-O-sulfate groups that confer the ability to bind protamine. We sought to further characterize this new compound in vitro using biochemical and global coagulation assays and in vivo using thrombosis and hemostasis assays. The anticoagulant activities of the Super 12-mer (S12-mer) and Enoxaparin in anti-factor Xa and plasma-based thrombin generation assays were roughly equivalent with a 50% reduction in peak thrombin generation occurring at approximately 325nM. When protamine was titrated against a fixed concentration of S12-mer in plasma or blood, the S12-mer displayed a significant restitution of thrombin generation and clot formation. In vivo, S12-mer inhibited venous thrombosis to a similar extent as Enoxaparin, with similar bleeding profiles. These data show that the S12-mer has almost identical efficacy to Enoxaparin in terms of FXa inhibition, while displaying significant reversibility with protamine. Taken together with the ability to ensure purity and homogeneity from batch to batch, the S12-mer is a promising new synthetic heparin analog with a potentially enhanced safety profile. Copyright © 2015 Elsevier Ltd. All rights reserved.

Supporting medical education research quality: the Association of American Medical Colleges' Medical Education Research Certificate program.

PubMed

Gruppen, Larry D; Yoder, Ernie; Frye, Ann; Perkowski, Linda C; Mavis, Brian

2011-01-01

The quality of the medical education research (MER) reported in the literature has been frequently criticized. Numerous reasons have been provided for these shortcomings, including the level of research training and experience of many medical school faculty. The faculty development required to improve MER can take various forms. This article describes the Medical Education Research Certificate (MERC) program, a national faculty development program that focuses exclusively on MER. Sponsored by the Association of American Medical Colleges and led by a committee of established medical education researchers from across the United States, the MERC program is built on a set of 11 interactive workshops offered at various times and places across the United States. MERC participants can customize the program by selecting six workshops from this set to fulfill requirements for certification. This article describes the history, operations, current organization, and evaluation of the program. Key elements of the program's success include alignment of program content and focus with needs identified by prospective users, flexibility in program organization and logistics to fit participant schedules, an emphasis on practical application of MER principles in the context of the participants' activities and interests, consistency in program content and format to ensure standards of quality, and a sustainable financial model. The relationship between the national MERC program and local faculty development initiatives is also described. The success of the MERC program suggests that it may be a possible model for nationally disseminated faculty development programs in other domains.

Improved modified energy ratio method using a multi-window approach for accurate arrival picking

NASA Astrophysics Data System (ADS)

Lee, Minho; Byun, Joongmoo; Kim, Dowan; Choi, Jihun; Kim, Myungsun

2017-04-01

To identify accurately the location of microseismic events generated during hydraulic fracture stimulation, it is necessary to detect the first break of the P- and S-wave arrival times recorded at multiple receivers. These microseismic data often contain high-amplitude noise, which makes it difficult to identify the P- and S-wave arrival times. The short-term-average to long-term-average (STA/LTA) and modified energy ratio (MER) methods are based on the differences in the energy densities of the noise and signal, and are widely used to identify the P-wave arrival times. The MER method yields more consistent results than the STA/LTA method for data with a low signal-to-noise (S/N) ratio. However, although the MER method shows good results regardless of the delay of the signal wavelet for signals with a high S/N ratio, it may yield poor results if the signal is contaminated by high-amplitude noise and does not have the minimum delay. Here we describe an improved MER (IMER) method, whereby we apply a multiple-windowing approach to overcome the limitations of the MER method. The IMER method contains calculations of an additional MER value using a third window (in addition to the original MER window), as well as the application of a moving average filter to each MER data point to eliminate high-frequency fluctuations in the original MER distributions. The resulting distribution makes it easier to apply thresholding. The proposed IMER method was applied to synthetic and real datasets with various S/N ratios and mixed-delay wavelets. The results show that the IMER method yields a high accuracy rate of around 80% within five sample errors for the synthetic datasets. Likewise, in the case of real datasets, 94.56% of the P-wave picking results obtained by the IMER method had a deviation of less than 0.5 ms (corresponding to 2 samples) from the manual picks.

K-mer Content, Correlation, and Position Analysis of Genome DNA Sequences for the Identification of Function and Evolutionary Features

PubMed Central

Sievers, Aaron; Bosiek, Katharina; Bisch, Marc; Dreessen, Chris; Riedel, Jascha; Froß, Patrick; Hausmann, Michael; Hildenbrand, Georg

2017-01-01

In genome analysis, k-mer-based comparison methods have become standard tools. However, even though they are able to deliver reliable results, other algorithms seem to work better in some cases. To improve k-mer-based DNA sequence analysis and comparison, we successfully checked whether adding positional resolution is beneficial for finding and/or comparing interesting organizational structures. A simple but efficient algorithm for extracting and saving local k-mer spectra (frequency distribution of k-mers) was developed and used. The results were analyzed by including positional information based on visualizations as genomic maps and by applying basic vector correlation methods. This analysis was concentrated on small word lengths (1 ≤ k ≤ 4) on relatively small viral genomes of Papillomaviridae and Herpesviridae, while also checking its usability for larger sequences, namely human chromosome 2 and the homologous chromosomes (2A, 2B) of a chimpanzee. Using this alignment-free analysis, several regions with specific characteristics in Papillomaviridae and Herpesviridae formerly identified by independent, mostly alignment-based methods, were confirmed. Correlations between the k-mer content and several genes in these genomes have been found, showing similarities between classified and unclassified viruses, which may be potentially useful for further taxonomic research. Furthermore, unknown k-mer correlations in the genomes of Human Herpesviruses (HHVs), which are probably of major biological function, are found and described. Using the chromosomes of a chimpanzee and human that are currently known, identities between the species on every analyzed chromosome were reproduced. This demonstrates the feasibility of our approach for large data sets of complex genomes. Based on these results, we suggest k-mer analysis with positional resolution as a method for closing a gap between the effectiveness of alignment-based methods (like NCBI BLAST) and the high pace of standard k-mer analysis. PMID:28422050

Slowdown of surface diffusion during early stages of bacterial colonization

NASA Astrophysics Data System (ADS)

Vourc'h, T.; Peerhossaini, H.; Léopoldès, J.; Méjean, A.; Chauvat, F.; Cassier-Chauvat, C.

2018-03-01

We study the surface diffusion of the model cyanobacterium Synechocystis sp. PCC6803 during the incipient stages of cell contact with a glass surface in the dilute regime. We observe a twitching motility with alternating immobile tumble and mobile run periods, resulting in a normal diffusion described by a continuous-time random walk with a coefficient of diffusion D . Surprisingly, D is found to decrease with time down to a plateau. This is observed only when the cyanobacterial cells are able to produce released extracellular polysaccharides, as shown by a comparative study between the wild-type strain and various polysaccharides-depleted mutants. The analysis of the trajectories taken by the bacterial cells shows that the temporal characteristics of their intermittent motion depend on the instantaneous fraction of visited sites during diffusion. This describes quantitatively the time dependence of D , related to the progressive surface coverage by the polysaccharides. The observed slowdown of the surface diffusion may constitute a basic precursor mechanism for microcolony formation and provides clues for controlling biofilm formation.

A novel approach to interpretation of the time-dependent self-diffusion coefficient as a probe of porous media geometry.

PubMed

Loskutov, V V; Sevriugin, V A

2013-05-01

This article presents a new approximation describing fluid diffusion in porous media. Time dependence of the self-diffusion coefficient D(t) in the permeable porous medium is studied based on the assumption that diffusant molecules move randomly. An analytical expression for time dependence of the self-diffusion coefficient was obtained in the following form: D(t)=(D0-D∞)exp(-D0t/λ)+D∞, where D0 is the self-diffusion coefficient of bulk fluid, D∞ is the asymptotic value of the self-diffusion coefficient in the limit of long time values (t→∞), λ is the characteristic parameter of this porous medium with dimensionality of length. Applicability of the solution obtained to the analysis of experimental data is shown. The possibility of passing to short-time and long-time regimes is discussed. Copyright © 2013 Elsevier Inc. All rights reserved.

KSC-03PD-1586

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. The backshell is in place over the Mars Exploration Rover 1 (MER-1). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KSC-03PD-1578

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. Workers in the Payload Hazardous Servicing Facility prepare to lift and move the backshell that will cover the Mars Exploration Rover 1 (MER-1) and its lander. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KSC-03PD-1584

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. Workers in the Payload Hazardous Servicing Facility lower the backshell over the Mars Exploration Rover 1 (MER-1). The backshell is a protective cover for the rover. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Correlation-Induced Changes of Spectra

DTIC Science & Technology

1989-12-01

tances has been one of the central have been observed etperimental- other end of the frequency spec- issues of debate among astrono - ly could be...limited consideration by astrono - I mers. in the updated theory, described in the Nov. 13 PHYSICAL REVIEw LETTERS, Wolf outlines a more general - and...billions of light-years apart. Many astrono - mers-ncluding Christopher L. Carilli of Harvard University, who with two colleagues found the most recent

Outbreak of Middle East respiratory syndrome coronavirus in Saudi Arabia: a retrospective study.

PubMed

Aleanizy, Fadilah Sfouq; Mohmed, Nahla; Alqahtani, Fulwah Y; El Hadi Mohamed, Rania Ali

2017-01-05

The Middle East respiratory syndrome (MERS) is proposed to be a zoonotic disease. Dromedary camels have been implicated due to reports that some confirmed cases were exposed to camels. Risk factors for MERS coronavirus (MERS-CoV) infections in humans are incompletely understood. This study aimed to describe the demographic characteristics, mortality rate, clinical manifestations and comorbidities with confirmed cases of MERS-CoV. Retrospective chart review were performed to identify all laboratory-confirmed cases of MERS-CoV in Saudi Arabia who reported to the Ministry of Health (MOH) of Saudi Arabia and WHO between April 23, 2014 and August 31, 2015. Patients' charts were also reviewed for demographic information, mortality, comorbidities, clinical presentations, health care facility and presented with descriptive and comparative statistics using non parametric binomial test and Chi-square test. Confirmed cases of male patients (61.1%) exceeded those of female patients (38.9%). Infections among Saudi patients (62.6%) exceeded those among non-Saudi patients (37.4%; P = 0.001). The majority of the patients were aged 21-40 years (37.4%) or 41-60 years (35.8%); 43 (22.6%) were aged >61 years, and (8) 4.2% were aged 0-20 years. There was a difference in mortality between confirmed MERS-CoV cases (63.7% alive versus 36.3% dead cases, respectively). Furthermore, fever with cough and shortness of breath (SOB) (n = 39; 20.5%), fever with cough (n = 29; 15.3%), fever (n = 18; 9.5%), and fever with SOB (n = 13; 6.8%), were the most common clinical manifestations associated with confirmed MERS-CoV cases. MERS-CoV is considered an epidemic in Saudi Arabia. The results of the present study showed that the frequency of cases is higher among men than women, in Saudi patients than non-Saudi, and those between 21 to 60 years are most affected. Further studies are required to improve the surveillance associated with MERS-CoV to get definite and clear answers and better understanding of the MERS-CoV outbreak as well the source, and route of infection transmission in Saudi Arabia.

Photochemistry in a 3D metal-organic framework (MOF): monitoring intermediates and reactivity of the fac-to-mer photoisomerization of Re(diimine)(CO)3Cl incorporated in a MOF.

PubMed

Easun, Timothy L; Jia, Junhua; Calladine, James A; Blackmore, Danielle L; Stapleton, Christopher S; Vuong, Khuong Q; Champness, Neil R; George, Michael W

2014-03-03

The mechanism and intermediates in the UV-light-initiated ligand rearrangement of fac-Re(diimine)(CO)3Cl to form the mer isomer, when incorporated into a 3D metal-organic framework (MOF), have been investigated. The structure hosting the rhenium diimine complex is a 3D network with the formula {Mn(DMF)2[LRe(CO)3Cl]}∞ (ReMn; DMF = N,N-dimethylformamide), where the diimine ligand L, 2,2'-bipyridine-5,5'-dicarboxylate, acts as a strut of the MOF. The incorporation of ReMn into a KBr disk allows spatial distribution of the mer-isomer photoproduct in the disk to be mapped and spectroscopically characterized by both Fourier transform infrared and Raman microscopy. Photoisomerization has been monitored by IR spectroscopy and proceeds via dissociation of a CO to form more than one dicarbonyl intermediate. The dicarbonyl species are stable in the solid state at 200 K. The photodissociated CO ligand appears to be trapped within the crystal lattice and, upon warming above 200 K, readily recombines with the dicarbonyl intermediates to form both the fac-Re(diimine)(CO)3Cl starting material and the mer-Re(diimine)(CO)3Cl photoproduct. Experiments over a range of temperatures (265-285 K) allow estimates of the activation enthalpy of recombination for each process of ca. 16 (±6) kJ mol(-1) (mer formation) and 23 (±4) kJ mol(-1) (fac formation) within the MOF. We have compared the photochemistry of the ReMn MOF with a related alkane-soluble Re(dnb)(CO)3Cl complex (dnb = 4,4'-dinonyl-2,2'-bipyridine). Time-resolved IR measurements clearly show that, in an alkane solution, the photoinduced dicarbonyl species again recombines with CO to both re-form the fac-isomer starting material and form the mer-isomer photoproduct. Density functional theory calculations of the possible dicarbonyl species aids the assignment of the experimental data in that the ν(CO) IR bands of the CO loss intermediate are, as expected, shifted to lower energy when the metal is bound to DMF rather than to an alkane and both solution data and calculations suggest that the ν(CO) band positions in the photoproduced dicarbonyl intermediates of ReMn are consistent with DMF binding.

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Flexible Microsphere-Embedded Film for Microsphere-Enhanced Raman Spectroscopy.

PubMed

Xing, Cheng; Yan, Yinzhou; Feng, Chao; Xu, Jiayu; Dong, Peng; Guan, Wei; Zeng, Yong; Zhao, Yan; Jiang, Yijian

2017-09-27

Dielectric microspheres with extraordinary microscale optical properties, such as photonic nanojets, optical whispering-gallery modes (WGMs), and directional antennas, have drawn interest in many research fields. Microsphere-enhanced Raman spectroscopy (MERS) is an alternative approach for enhanced Raman detection by dielectric microstructures. Unfortunately, fabrication of microsphere monolayer arrays is the major challenge of MERS for practical applications on various specimen surfaces. Here we report a microsphere-embedded film (MF) by immersing a highly refractive microsphere monolayer array in the poly(dimethylsiloxane) (PDMS) film as a flexible MERS sensing platform for one- to three-dimensional (1D to 3D) specimen surfaces. The directional antennas and wave-guided whispering-gallery modes (WG-WGMs) contribute to the majority of Raman enhancement by the MFs. Moreover, the MF can be coupled with surface-enhanced Raman spectroscopy (SERS) to provide an extra >10-fold enhancement. The limit of detection is therefore improved for sensing of crystal violet (CV) and Sudan I molecules in aqueous solutions at concentrations down to 10 -7 M. A hybrid dual-layer microsphere enhancer, constructed by depositing a MF onto a microsphere monolayer array, is also demonstrated, wherein the WG-WGMs become dominant and boost the enhancement ratio >50-fold. The present work opens up new opportunities for design of cost-effective and flexible MERS sensing platforms as individual or associated techniques toward practical applications in ultrasensitive Raman detection.

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 2 (MER-2) undergoes a weight and center of gravity determination in the Payload Hazardous Servicing Facility. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-09

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 2 (MER-2) undergoes a weight and center of gravity determination in the Payload Hazardous Servicing Facility. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare the Mars Exploration Rover 2 (MER-2) for a weight and center of gravity determination. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-09

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare the Mars Exploration Rover 2 (MER-2) for a weight and center of gravity determination. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility are preparing to determine weight and center of gravity for the Mars Exploration Rover 2 (MER-2). NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-09

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility are preparing to determine weight and center of gravity for the Mars Exploration Rover 2 (MER-2). NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. Launch of MER-2 is scheduled for June 5 from Cape Canaveral Air Force Station.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, the Mars Exploration Rover 2 (MER-2) is moved to a spin table. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. The MER-2 is scheduled to launch June 5 from Launch Pad 17-A, Cape Canaveral Air Force Station.

NASA Image and Video Library

2003-05-19

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, the Mars Exploration Rover 2 (MER-2) is moved to a spin table. NASA’s twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can’t yet go. The MER-2 is scheduled to launch June 5 from Launch Pad 17-A, Cape Canaveral Air Force Station.

Overview of preparedness and response for Middle East respiratory syndrome coronavirus (MERS-CoV) in Oman.

PubMed

Al-Abaidani, I S; Al-Maani, A S; Al-Kindi, H S; Al-Jardani, A K; Abdel-Hady, D M; Zayed, B E; Al-Harthy, K S; Al-Shaqsi, K H; Al-Abri, S S

2014-12-01

Several countries in the Middle East and around 22 countries worldwide have reported cases of human infection with the Middle East respiratory syndrome coronavirus (MERS-CoV). The exceptionally high fatality rate resulting from MERS-CoV infection in conjunction with the paucity of knowledge about this emerging virus has led to major public and international concern. Within the framework of the national acute respiratory illness surveillance, the Ministry of Health in the Sultanate of Oman has announced two confirmed cases of MERS-CoV to date. The aim of this report is to describe the epidemiological aspects of these two cases and to highlight the importance of public health preparedness and response. The absence of secondary cases among contacts of the reported cases can be seen as evidence of the effectiveness of infection prevention and control precautions as an important pillar of the national preparedness and response plan applied in the health care institutions in Oman. Copyright © 2014. Published by Elsevier Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yazhen; Musser, Sarah K.; Saleh, Sam

1,N{sup 2}-Propanodeoxyguanosine (PdG) is a stable structural analogue for the 3-(2'-deoxy-{beta}-d-erythro-pentofuranosyl)pyrimido[1,2-?]purin-10(3H)-one (M{sub 1}dG) adduct derived from exposure of DNA to base propenals and to malondialdehyde. The structures of ternary polymerase-DNA-dNTP complexes for three template-primer DNA sequences were determined, with the Y-family Sulfolobus solfataricus DNA polymerase IV (Dpo4), at resolutions between 2.4 and 2.7 {angstrom}. Three template 18-mer-primer 13-mer sequences, 5'-d(TCACXAAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTT)-3' (template I), 5'-d(TCACXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template II), and 5'-d(TCATXGAATCCTTCCCCC)-3'{center_dot}5'-d(GGGGGAAGGATTC)-3' (template III), where X is PdG, were analyzed. With templates I and II, diffracting ternary complexes including dGTP were obtained. The dGTP did not pair with PdG, but instead with the 5'-neighboring templatemore » dC, utilizing Watson-Crick geometry. Replication bypass experiments with the template-primer 5?-TCACXAAATCCTTACGAGCATCGCCCCC-3'{center_dot}5'-GGGGGCGATGCTCGTAAGGATTT-3', where X is PdG, which includes PdG in the 5'-CXA-3' template sequence as in template I, showed that the Dpo4 polymerase inserted dGTP and dATP when challenged by the PdG adduct. For template III, in which the template sequence was 5'-TXG-3', a diffracting ternary complex including dATP was obtained. The dATP did not pair with PdG, but instead with the 5'-neighboring T, utilizing Watson-Crick geometry. Thus, all three ternary complexes were of the 'type II' structure described for ternary complexes with native DNA [Ling, H., Boudsocq, F., Woodgate, R., and Yang, W. (2001) Cell 107, 91--102]. The PdG adduct remained in the anti conformation about the glycosyl bond in each of these threee ternary complexes. These results provide insight into how -1 frameshift mutations might be generated for the PdG adduct, a structural model for the exocylic M{sub 1}dG adduct formed by malondialdehyde.« less

Modified telomeric repeat amplification protocol: a quantitative radioactive assay for telomerase without using electrophoresis.

PubMed

Szatmari, I; Tókés, S; Dunn, C B; Bardos, T J; Aradi, J

2000-06-15

A polymerase chain reaction (PCR)-based radioactive telomerase assay was developed in our laboratory which is quantitative and does not require electrophoretic evaluation (designated as TP-TRAP; it utilizes two reverse primers). The main steps of the assay include (1) extension of a 20-mer oligonucleotide substrate (MTS) by telomerase, (2) amplification of the telomerase products in the presence of [(3)H]dTTP using the substrate oligonucleotide and two reverse primers (RPC3, 38 mer; RP, 20 mer), (3) isolation of the amplified radioactive dsDNA by precipitation and filtration, (4) determination of the radioactivity of the acid-insoluble DNA. The length of the telomerase products does not increase on amplification. This valuable feature of the assay is achieved by utilization of the two reverse primers and a highly specific PCR protocol. The assay is linear, accurate, and suitable for cell-biological studies where slight quantitative differences in telomerase activity must be detected. The assay is also suitable for screening and characterization of telomerase inhibitors, as shown with a chemically modified oligonucleotide reverse transcriptase inhibitor [(s(4)dU)(35)]. Copyright 2000 Academic Press.

KSC-03PD-1601

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. Workers attach an overhead crane to the Mars Exploration Rover 1 (MER-1) inside the upper backshell. The backshell will be moved and attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KSC-03PD-1603

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. Workers walk with the suspended backshell/ Mars Exploration Rover 1 (MER-1) as it travels across the floor of the Payload Hazardous Servicing Facility. The backshell will be attached to the lower heat shield. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KSC-03PD-1605

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. In the Payload Hazardous Servicing Facility, workers move the heat shield (foreground) toward the upper backshell/ Mars Exploration Rover 1 (MER-1), in the background. The backshell and heat shield will be mated. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Spatially Variable CO2 Degassing in the Main Ethiopian Rift: Implications for Magma Storage, Volatile Transport, and Rift-Related Emissions

NASA Astrophysics Data System (ADS)

Hunt, Jonathan A.; Zafu, Amdemichael; Mather, Tamsin A.; Pyle, David M.; Barry, Peter H.

2017-10-01

Deep carbon emissions from historically inactive volcanoes, hydrothermal, and tectonic structures are among the greatest unknowns in the long-term (˜Myr) carbon cycle. Recent estimates of diffuse CO2 flux from the Eastern Rift of the East African Rift System (EARS) suggest this could equal emissions from the entire mid-ocean ridge system. We report new CO2 surveys from the Main Ethiopian Rift (MER, northernmost EARS), and reassess the rift-related CO2 flux. Since degassing in the MER is concentrated in discrete areas of volcanic and off-edifice activity, characterization of such areas is important for extrapolation to a rift-scale budget. Locations of hot springs and fumaroles along the rift show numerous geothermal areas away from volcanic edifices. With these new data, we estimate total CO2 emissions from the central and northern MER as 0.52-4.36 Mt yr-1. Our extrapolated flux from the Eastern Rift is 3.9-32.7 Mt yr-1 CO2, overlapping with lower end of the range presented in recent estimates. By scaling, we suggest that 6-18 Mt yr-1 CO2 flux can be accounted for by magmatic extension, which implies an important role for volatile-enriched lithosphere, crustal assimilation, and/or additional magmatic intrusion to account for the upper range of flux estimates. Our results also have implications for the nature of volcanism in the MER. Many geothermal areas are found >10 km from the nearest volcanic center, suggesting ongoing hazards associated with regional volcanism.

Molecular dynamics studies of polyethylene oxide and polyethylene glycol: hydrodynamic radius and shape anisotropy.

PubMed

Lee, Hwankyu; Venable, Richard M; Mackerell, Alexander D; Pastor, Richard W

2008-08-01

A revision (C35r) to the CHARMM ether force field is shown to reproduce experimentally observed conformational populations of dimethoxyethane. Molecular dynamics simulations of 9, 18, 27, and 36-mers of polyethylene oxide (PEO) and 27-mers of polyethylene glycol (PEG) in water based on C35r yield a persistence length lambda = 3.7 A, in quantitative agreement with experimentally obtained values of 3.7 A for PEO and 3.8 A for PEG; agreement with experimental values for hydrodynamic radii of comparably sized PEG is also excellent. The exponent upsilon relating the radius of gyration and molecular weight (R(g) proportional, variantM(w)(upsilon)) of PEO from the simulations equals 0.515 +/- 0.023, consistent with experimental observations that low molecular weight PEG behaves as an ideal chain. The shape anisotropy of hydrated PEO is 2.59:1.44:1.00. The dimension of the middle length for each of the polymers nearly equals the hydrodynamic radius R(h)obtained from diffusion measurements in solution. This explains the correspondence of R(h) and R(p), the pore radius of membrane channels: a polymer such as PEG diffuses with its long axis parallel to the membrane channel, and passes through the channel without substantial distortion.

NCI Scientists Solve Structure of Protein that Enables MERS Virus to Spread | Poster

Cancer.gov

Scientists at the Frederick National Lab have produced three crystal structures that reveal a specific part of a protein that can be targeted to fight the Middle East respiratory syndrome coronavirus (MERS-CoV), which causes an emerging viral respiratory illness. Senior Investigator David Waugh, Ph.D., Macromolecular Crystallography Laboratory, has solved the structure of an enzyme known as the 3C-like protease (3CLpro), which, if blocked, can prevent the virus from replicating...

Thermophilic Ferritin 24mer Assembly and Nanoparticle Encapsulation Modulated by Interdimer Electrostatic Repulsion.

PubMed

Pulsipher, Katherine W; Villegas, Jose A; Roose, Benjamin W; Hicks, Tacey L; Yoon, Jennifer; Saven, Jeffery G; Dmochowski, Ivan J

2017-07-18

Protein cage self-assembly enables encapsulation and sequestration of small molecules, macromolecules, and nanomaterials for many applications in bionanotechnology. Notably, wild-type thermophilic ferritin from Archaeoglobus fulgidus (AfFtn) exists as a stable dimer of four-helix bundle proteins at a low ionic strength, and the protein forms a hollow assembly of 24 protomers at a high ionic strength (∼800 mM NaCl). This assembly process can also be initiated by highly charged gold nanoparticles (AuNPs) in solution, leading to encapsulation. These data suggest that salt solutions or charged AuNPs can shield unfavorable electrostatic interactions at AfFtn dimer-dimer interfaces, but specific "hot-spot" residues controlling assembly have not been identified. To investigate this further, we computationally designed three AfFtn mutants (E65R, D138K, and A127R) that introduce a single positive charge at sites along the dimer-dimer interface. These proteins exhibited different assembly kinetics and thermodynamics, which were ranked in order of increasing 24mer propensity: A127R < wild type < D138K ≪ E65R. E65R assembled into the 24mer across a wide range of ionic strengths (0-800 mM NaCl), and the dissociation temperature for the 24mer was 98 °C. X-ray crystal structure analysis of the E65R mutant identified a more compact, closed-pore cage geometry. A127R and D138K mutants exhibited wild-type ability to encapsulate and stabilize 5 nm AuNPs, whereas E65R did not encapsulate AuNPs at the same high yields. This work illustrates designed protein cages with distinct assembly and encapsulation properties.

Role of MR-DWI and MR-PWI in the radiotherapy of implanted pulmonary VX-2 carcinoma in rabbits.

PubMed

Zhang, Qiang; Zhang, Mingmin; Liu, Zhaoxin; Shi, Baoqi; Qi, Fuliang; Wang, Haijiang; Lv, Yuan; Jin, Haijiao; Zhang, Weijing

2014-10-01

To detect the activity of tumor cells and tumor blood flow before and after the radiotherapy of implanted pulmonary VX-2 carcinoma in rabbit models by using magnetic resonance diffusion-weighted imaging (MR-DWI) and magnetic resonance perfusion weighted imaging (MR-PWI), and to evaluate the effectiveness and safety of the radiotherapy based on the changes in the MR-DWI and MR-PWI parameters at different treatment stages. A total of 56 rabbit models with implanted pulmonary VX-2 carcinoma were established, and then equally divided into treatment group and control group. MR-DWI and MR-PWI were separately performed using a Philips Acheiva 1.5T MRI machine (Philips, Netherland). MRI image processing was performed using special perfusion software and the WORKSPACE advanced workstation for MRI. MR-DWI was applied for the observation of tumor signals and the measurement of apparent diffusion coefficient (ADC) values; whereas MR-PWI was used for the measurement of wash in rate (WIR), wash out rate (WOR), and maximum enhancement rate (MER). The radiation treatment was performed using Siemens PRIMUS linear accelerator. In the treatment group, the radiotherapy was performed 21 days later on a once weekly dosage of 1,000 cGy to yield a total dosage of 5,000 cGy. THE ADC PARAMETERS IN THE REGION OF INTEREST ON DWI WERE AS FOLLOWS: on the treatment day for the implanted pulmonary VX-2 carcinoma, the t values at the center and the edge of the lesions were 1.352 and 1.461 in the treatment group and control group (P>0.05). During weeks 0-1 after treatment, the t values at the center and the edge of the lesions were 1.336 and 1.137 (P>0.05). During weeks 1-2, the t values were 1.731 and 1.736 (P<0.05). During weeks 2-3, the t values were 1.742 and 1.749 (P<0.05). During weeks 3-4, the t values were 2.050 and 2.127 (P<0.05). During weeks 4-5, the t values were 2.764 and 2.985 (P<0.05). The ADC values in the treatment group were significantly higher than in the control group. After the radiotherapy (5,000 cGy), the tumors remarkably shrank, along with low signal on DWI, decreased signal on ADC map, and remarkably increased ADC values. As shown on PWI, on the treatment day for the implanted pulmonary VX-2 carcinoma, the t values of the WIR, WOR, and MER at the center of the lesions were 1.05, 1.31, and 1.33 in the treatment group and control group (P>0.05); in addition, the t values of the WIR, WOR, and MER at the edge of the lesions were 1.35, 1.07, and 1.51 (P>0.05). During weeks 0-1 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 1.821, 1.856, and 1.931 (P<0.05); in addition, the t values of the WIR, WOR, and MER at the edge of the lesions were 1.799, 2.016, and 2.137 (P<0.05). During weeks 1-1 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.574, 2.156, and 2.059 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 1.869, 2.058, and 2.057 (P<0.05). During weeks 2-3 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.461, 2.098, and 2.739 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 2.951, 2.625, and 2.154 (P<0.05). During weeks 3-4 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.584, 2.107, and 2.869 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 2.057, 2.637, and 2.951 (P<0.05). During weeks 4-5 after treatment, the t values of the WIR, WOR, and MER at the center of the lesions were 2.894, 2.827, and 3.285 (P<0.05) and the t values of the WIR, WOR, and MER at the edge of the lesions were 3.45, 3.246, and 3.614 (P<0.05). After the radiotherapy (500 cGy), the tumors shrank on the T1WI, WIR, WOR, and MER; meanwhile, the PWI parameter gradually decreased and reached its minimum value. MR-DWI and MR-PWI can accurately and directly reflect the inactivation of tumor cells and the tumor hemodynamics in rabbit models with implanted pulmonary VX-2 carcinoma, and thus provide theoretical evidences for judging the clinical effectiveness of radiotherapy for the squamous cell carcinoma of the lung.

Community Case Clusters of Middle East Respiratory Syndrome Coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: A Descriptive Genomic study

PubMed Central

Memish, Ziad A.; Cotten, Matthew; Watson, Simon J.; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F.; Assiri, Abdullah; Rabeeah, Abdullah A. Al; Al-Tawfiq, Jaffar A.

2014-01-01

Summary The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. PMID:24699184

Serologic follow-up of Middle East Respiratory Syndrome Coronavirus Cases and Contacts - Abu Dhabi, United Arab Emirates.

PubMed

Al Hosani, Farida Ismail; Kim, Lindsay; Khudhair, Ahmed; Pham, Huong; Al Mulla, Mariam; Al Bandar, Zyad; Pradeep, Krishna; Elkheir, Kheir Abou; Weber, Stefan; Khoury, Mary; Donnelly, George; Younis, Naima; El Saleh, Feda; Abdalla, Muna; Imambaccus, Hala; Haynes, Lia M; Thornburg, Natalie J; Harcourt, Jennifer L; Miao, Congrong; Tamin, Azaibi; Hall, Aron J; Russell, Elizabeth S; Harris, Aaron M; Kiebler, Craig; Mir, Roger A; Pringle, Kimberly; Alami, Negar N; Abedi, Glen R; Gerber, Susan I

2018-06-13

Although there is evidence of person-to-person transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) in household and healthcare settings, more data are needed to describe and better understand the risk factors and transmission routes in both settings, as well as the extent that disease severity affects transmission. A sero-epidemiological investigation was conducted among Middle East Respiratory Syndrome Coronavirus (MERS-CoV) case-patients and their household contacts to investigate transmission risk in Abu Dhabi, United Arab Emirates. Cases diagnosed between January 1, 2013-May 9, 2014 and their household contacts were approached for enrollment. Demographic, clinical, and exposure history data were collected. Sera were screened by MERS-CoV nucleocapsid protein (N) ELISA and indirect immunofluorescence, with results confirmed by microneutralization assay. Ninety-one percent (n=31/34) of case-patients were asymptomatic or mildly symptomatic and did not require oxygen during hospitalization. MERS-CoV antibodies were detected in 13 of 24 (54%) cases with available sera, including 3 asymptomatic, 9 mildly symptomatic, and 1 severely symptomatic case-patient. No serologic evidence of MERS-CoV transmission was found among 105 household contacts with available sera. Transmission of MERS-CoV was not documented in this investigation of mostly asymptomatic and mildly symptomatic cases and their household contacts. These results have implications for clinical management of cases and formulation of isolation policies to reduce the risk of transmission.

Prevalence of Diabetes in the 2009 Influenza A (H1N1) and the Middle East Respiratory Syndrome Coronavirus: A Systematic Review and Meta-Analysis.

PubMed

Badawi, Alaa; Ryoo, Seung Gwan

2016-12-09

Over the past two decades a number of severe acute respiratory infection outbreaks such as the 2009 influenza A (H1N1) and the Middle East respiratory syndrome coronavirus (MERS-CoV) have emerged and presented a considerable global public health threat. Epidemiologic evidence suggests that diabetic subjects are more susceptible to these conditions. However, the prevalence of diabetes in H1N1 and MERS-CoV has not been systematically described. The aim of this study is to conduct a systematic review and meta-analysis of published reports documenting the prevalence of diabetes in H1N1 and MERS-CoV and compare its frequency in the two viral conditions. Meta-analysis for the proportions of subjects with diabetes was carried out in 29 studies for H1N1 ( n =92,948) and 9 for MERS-CoV ( n =308). Average age of H1N1 patients (36.2±6.0 years) was significantly younger than that of subjects with MERS-CoV (54.3±7.4 years, P<0.05). Compared to MERS-CoV patients, subjects with H1N1 exhibited 3-fold lower frequency of cardiovascular diseases and 2- and 4-fold higher prevalence of obesity and immunosuppression, respectively. The overall prevalence of diabetes in H1N1 was 14.6% (95% CI: 12.3-17.0%; P<0.001), a 3.6-fold lower than in MERS-CoV (54.4%; 95% CI: 29.4-79.5; P<0.001). The prevalence of diabetes among H1N1 cases from Asia and North America was ~two-fold higher than those from South America and Europe. The prevalence of diabetes in MERS-CoV cases is higher than in H1N1. Regional comparisons suggest that an etiologic role of diabetes in MERS-CoV may exist distinctive from that in H1N1.

Junctional and allele-specific residues are critical for MERS-CoV neutralization by an exceptionally potent germline-like antibody

DOE PAGES

Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying; ...

2015-09-15

The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of bindingmore » at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.« less

Multi-Agent Modeling and Simulation Approach for Design and Analysis of MER Mission Operations

NASA Technical Reports Server (NTRS)

Seah, Chin; Sierhuis, Maarten; Clancey, William J.

2005-01-01

A space mission operations system is a complex network of human organizations, information and deep-space network systems and spacecraft hardware. As in other organizations, one of the problems in mission operations is managing the relationship of the mission information systems related to how people actually work (practices). Brahms, a multi-agent modeling and simulation tool, was used to model and simulate NASA's Mars Exploration Rover (MER) mission work practice. The objective was to investigate the value of work practice modeling for mission operations design. From spring 2002 until winter 2003, a Brahms modeler participated in mission systems design sessions and operations testing for the MER mission held at Jet Propulsion Laboratory (JPL). He observed how designers interacted with the Brahms tool. This paper discussed mission system designers' reactions to the simulation output during model validation and the presentation of generated work procedures. This project spurred JPL's interest in the Brahms model, but it was never included as part of the formal mission design process. We discuss why this occurred. Subsequently, we used the MER model to develop a future mission operations concept. Team members were reluctant to use the MER model, even though it appeared to be highly relevant to their effort. We describe some of the tool issues we encountered.

Monocyte and plasma expression of TAM ligand and receptor in renal failure: Links to unregulated immunity and chronic inflammation.

PubMed

Lee, Iris J; Hilliard, Brendan A; Ulas, Mehriban; Yu, Daohai; Vangala, Chandan; Rao, Swati; Lee, Jean; Gadegbeku, Crystal A; Cohen, Philip L

2015-06-01

Chronic inflammation is increased in patients with chronic kidney disease (CKD) and contributes to cardiovascular morbidity and mortality. Specific immune mechanisms and pathways that drive and maintain chronic inflammation in CKD are not well described. The TAM ligands (Gas6 and protein S) and receptors (Axl and Mer) have been recently recognized as playing a prominent role in immune regulation. The receptors exist in both soluble and cell-bound forms; the soluble receptors (sAxl and sMer) are believed to compete with the bound receptors and thus inhibit their function. In this study, we determined the expression of cell-bound and soluble TAM proteins in patients with CKD. CKD patients had significantly lower expression of Mer in monocytes, yet increased expression of soluble TAM receptors sAxl and sMer in plasma compared to controls. The metalloproteinase ADAM 17, responsible for cleavage of Mer to its soluble form, was increased in patient monocytes. Elevated levels of soluble TAM receptors were more evident in patients with progressive renal failure. These observations suggest that functional deficiency of TAM receptor-mediated regulation of inflammation may contribute to chronic inflammation in patients with CKD. Copyright © 2015 Elsevier Inc. All rights reserved.

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) arrives at the tower landing where it will be mated with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) arrives at the tower landing where it will be mated with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - Workers on Launch Pad 17-B, Cape Canaveral Air Force Station, complete mating of the Mars Exploration Rover 1 (MER-B), above, to the Delta rocket below. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - Workers on Launch Pad 17-B, Cape Canaveral Air Force Station, complete mating of the Mars Exploration Rover 1 (MER-B), above, to the Delta rocket below. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) is lifted up the tower for mating with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) is lifted up the tower for mating with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - In the gantry on Launch Complex 17-B, Cape Canaveral Air Force Station, workers start removing the canister from around the Mars Exploration Rover 1 (MER-B). The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - In the gantry on Launch Complex 17-B, Cape Canaveral Air Force Station, workers start removing the canister from around the Mars Exploration Rover 1 (MER-B). The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-B) arrives at Launch Pad 17-B, Cape Canaveral Air Force Station, where it will be mated with the Delta rocket for launch. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-B) arrives at Launch Pad 17-B, Cape Canaveral Air Force Station, where it will be mated with the Delta rocket for launch. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-B) is moved out of the Payload Hazardous Servicing Facility for transfer to Launch Pad 17-B, Cape Canaveral Air Force Station. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - The Mars Exploration Rover 1 (MER-B) is moved out of the Payload Hazardous Servicing Facility for transfer to Launch Pad 17-B, Cape Canaveral Air Force Station. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

Rapid generation of a mouse model for Middle East respiratory syndrome

PubMed Central

Zhao, Jincun; Li, Kun; Wohlford-Lenane, Christine; Agnihothram, Sudhakar S.; Fett, Craig; Zhao, Jingxian; Gale, Michael J.; Baric, Ralph S.; Enjuanes, Luis; Gallagher, Tom; McCray, Paul B.; Perlman, Stanley

2014-01-01

In this era of continued emergence of zoonotic virus infections, the rapid development of rodent models represents a critical barrier to public health preparedness, including the testing of antivirus therapy and vaccines. The Middle East respiratory syndrome coronavirus (MERS-CoV) was recently identified as the causative agent of a severe pneumonia. Given the ability of coronavirus to rapidly adapt to new hosts, a major public health concern is that MERS-CoV will further adapt to replication in humans, triggering a pandemic. No small-animal model for this infection is currently available, but studies suggest that virus entry factors can confer virus susceptibility. Here, we show that mice were sensitized to MERS-CoV infection by prior transduction with adenoviral vectors expressing the human host-cell receptor dipeptidyl peptidase 4. Mice developed a pneumonia characterized by extensive inflammatory-cell infiltration with virus clearance occurring 6–8 d after infection. Clinical disease and histopathological changes were more severe in the absence of type-I IFN signaling whereas the T-cell response was required for virus clearance. Using these mice, we demonstrated the efficacy of a therapeutic intervention (poly I:C) and a potential vaccine [Venezuelan equine encephalitis replicon particles expressing MERS-CoV spike protein]. We also found little protective cross-reactivity between MERS-CoV and the severe acute respiratory syndrome-CoV. Our results demonstrate that this system will be useful for MERS-CoV studies and for the rapid development of relevant animal models for emerging respiratory viral infections. PMID:24599590

Use of Base Modifications in Primers and Amplicons to Improve Nucleic Acids Detection in the Real-Time Snake Polymerase Chain Reaction

PubMed Central

2011-01-01

Abstract The addition of relatively short flap sequence at the 5′-end of one of the polymerase chain reaction (PCR) primers considerably improves performance of real-time assays based on 5′-nuclease activity. This new technology, called Snake, was shown to supersede the conventional methods like TaqMan, Molecular Beacons, and Scorpions in the signal productivity and discrimination of target polymorphic variations as small as single nucleotides. The present article describes a number of reaction conditions and methods that allow further improvement of the assay performance. One of the identified approaches is the use of duplex-destabilizing modifications such as deoxyinosine and deoxyuridine in the design of the Snake primers. This approach was shown to solve the most serious problem associated with the antisense amplicon folding and cleavage. As a result, the method permits the use of relatively long—in this study—14-mer flap sequences. Investigation also revealed that only the 5′-segment of the flap requires the deoxyinosine/deoxyuridine destabilization, whereas the 3′-segment is preferably left unmodified or even stabilized using 2-amino deoxyadenosine d(2-amA) and 5-propynyl deoxyuridine d(5-PrU) modifications. The base-modification technique is especially effective when applied in combination with asymmetric three-step PCR. The most valuable discovery of the present study is the effective application of modified deoxynucleoside 5′-triphosphates d(2-amA)TP and d(5-PrU)TP in Snake PCR. This method made possible the use of very short 6-8-mer 5′-flap sequences in Snake primers. PMID:21050073

KSC-03PD-1606

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

KSC-03PD-1607

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. In the Payload Hazardous Servicing Facility, workers lower the backshell with the Mars Exploration Rover 1 (MER-1) onto the heat shield. The two components form the aeroshell that will protect the rover on its journey to Mars. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Acute respiratory infections among returning Hajj pilgrims-Jordan, 2014.

PubMed

Al-Abdallat, Mohammad Mousa; Rha, Brian; Alqasrawi, Sultan; Payne, Daniel C; Iblan, Ibrahim; Binder, Alison M; Haddadin, Aktham; Nsour, Mohannad Al; Alsanouri, Tarek; Mofleh, Jawad; Whitaker, Brett; Lindstrom, Stephen L; Tong, Suxiang; Ali, Sami Sheikh; Dahl, Rebecca Moritz; Berman, LaShondra; Zhang, Jing; Erdman, Dean D; Gerber, Susan I

2017-04-01

The emergence of Middle East Respiratory Syndrome coronavirus (MERS-CoV) has prompted enhanced surveillance for respiratory infections among pilgrims returning from the Hajj, one of the largest annual mass gatherings in the world. To describe the epidemiology and etiologies of respiratory illnesses among pilgrims returning to Jordan after the 2014 Hajj. Surveillance for respiratory illness among pilgrims returning to Jordan after the 2014 Hajj was conducted at sentinel health care facilities using epidemiologic surveys and molecular diagnostic testing of upper respiratory specimens for multiple respiratory pathogens, including MERS-CoV. Among the 125 subjects, 58% tested positive for at least one virus; 47% tested positive for rhino/enterovirus. No cases of MERS-CoV were detected. The majority of pilgrims returning to Jordan from the 2014 Hajj with respiratory illness were determined to have a viral etiology, but none were due to MERS-CoV. A greater understanding of the epidemiology of acute respiratory infections among returning travelers to other countries after Hajj should help optimize surveillance systems and inform public health response practices. Published by Elsevier B.V.

A discrete model to study reaction-diffusion-mechanics systems.

PubMed

Weise, Louis D; Nash, Martyn P; Panfilov, Alexander V

2011-01-01

This article introduces a discrete reaction-diffusion-mechanics (dRDM) model to study the effects of deformation on reaction-diffusion (RD) processes. The dRDM framework employs a FitzHugh-Nagumo type RD model coupled to a mass-lattice model, that undergoes finite deformations. The dRDM model describes a material whose elastic properties are described by a generalized Hooke's law for finite deformations (Seth material). Numerically, the dRDM approach combines a finite difference approach for the RD equations with a Verlet integration scheme for the equations of the mass-lattice system. Using this framework results were reproduced on self-organized pacemaking activity that have been previously found with a continuous RD mechanics model. Mechanisms that determine the period of pacemakers and its dependency on the medium size are identified. Finally it is shown how the drift direction of pacemakers in RDM systems is related to the spatial distribution of deformation and curvature effects.

A Discrete Model to Study Reaction-Diffusion-Mechanics Systems

PubMed Central

Weise, Louis D.; Nash, Martyn P.; Panfilov, Alexander V.

2011-01-01

This article introduces a discrete reaction-diffusion-mechanics (dRDM) model to study the effects of deformation on reaction-diffusion (RD) processes. The dRDM framework employs a FitzHugh-Nagumo type RD model coupled to a mass-lattice model, that undergoes finite deformations. The dRDM model describes a material whose elastic properties are described by a generalized Hooke's law for finite deformations (Seth material). Numerically, the dRDM approach combines a finite difference approach for the RD equations with a Verlet integration scheme for the equations of the mass-lattice system. Using this framework results were reproduced on self-organized pacemaking activity that have been previously found with a continuous RD mechanics model. Mechanisms that determine the period of pacemakers and its dependency on the medium size are identified. Finally it is shown how the drift direction of pacemakers in RDM systems is related to the spatial distribution of deformation and curvature effects. PMID:21804911

The Paul-Emile Victor group. to the rescue of the sea (in French)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The Paul-Emile Victor Group, which includes P. E. Victor, J. Auriol, A. Bombard, J. Y. Consteau, J. Debat, L. Leprince-Ringuet, and H. Tazieff, was formed to protect man and his environment, and for about a year has been prepared to deal with problems caused by marine pollution. Eight industrial firms, including the Compagnie Francaise des Petroles, supply chemical, financial, and scientific assistance. The Service d'Action and d'Assistance Marine d'Urgence and de Recherche (SAMUR), has three functions: corrective action, research and prevention, and education; it is divided into two sections: one comprising several rapid-action units (UNIR), and the other constituting amore » center for marine bioecological study and research (''cerber-mer''). The UNIR includes professional divers, pollution-control technicians, and biologists and goes into action immediately. The ''cerber-mer'' section will constitute a 24 hr information-exchange center for all of Europe.« less

Connecting the molecular scale to the continuum scale for diffusion processes in smectite-rich porous media.

PubMed

Bourg, Ian C; Sposito, Garrison

2010-03-15

In this paper, we address the manner in which the continuum-scale diffusive properties of smectite-rich porous media arise from their molecular- and pore-scale features. Our starting point is a successful model of the continuum-scale apparent diffusion coefficient for water tracers and cations, which decomposes it as a sum of pore-scale terms describing diffusion in macropore and interlayer "compartments." We then apply molecular dynamics (MD) simulations to determine molecular-scale diffusion coefficients D(interlayer) of water tracers and representative cations (Na(+), Cs(+), Sr(2+)) in Na-smectite interlayers. We find that a remarkably simple expression relates D(interlayer) to the pore-scale parameter δ(nanopore) ≤ 1, a constrictivity factor that accounts for the lower mobility in interlayers as compared to macropores: δ(nanopore) = D(interlayer)/D(0), where D(0) is the diffusion coefficient in bulk liquid water. Using this scaling expression, we can accurately predict the apparent diffusion coefficients of tracers H(2)0, Na(+), Sr(2+), and Cs(+) in compacted Na-smectite-rich materials.

Phenomenological Partial Specific Volumes for G-Quadruplex DNAs

PubMed Central

Hellman, Lance M.; Rodgers, David W.; Fried, Michael G.

2009-01-01

Accurate partial specific volume (ν̄) values are required for sedimentation velocity and sedimentation equilibrium analyses. For nucleic acids, the estimation of these values is complicated by the fact that ν̄ depends on base composition, secondary structure, solvation and the concentrations and identities of ions in the surrounding buffer. Here we describe sedimentation equilibrium measurements of the apparent isopotential partial specific volume φ′ for two G-quadruplex DNAs and a single-stranded DNA of similar molecular weight and base composition. The G-quadruplex DNAs are a 22 nucleotide fragment of the human telomere consensus sequence and a 27 nucleotide fragment from the human c-myc promoter. The single-stranded DNA is 26 nucleotides long and is designed to have low propensity to form secondary structures. Parallel measurements were made in buffers containing NaCl and in buffers containing KCl, spanning the range 0.09M ≤ [salt] ≤ 2.3M. Limiting values of φ′, extrapolated to [salt] = 0M, were: 22-mer (NaCl-form), 0.525 ± 0.004 mL/g; 22-mer (KCl-form), 0.531 ± 0.006 mL/g; 27-mer (NaCl-form), 0.548 ± 0.005 mL/g; 27-mer (KCl-form), 0.557 ± 0.006 mL/g; 26-mer (NaCl-form), 0.555 ± 0.004 mL/g; 26-mer (KCl-form), 0.564 ± 0.006 mL/g. Small changes in φ′ with [salt] suggest that large changes in counterion association or hydration are unlikely to take place over these concentration ranges. PMID:19238377

Membrane estrogen receptors - is it an alternative way of estrogen action?

PubMed

Soltysik, K; Czekaj, P

2013-04-01

The functions of estrogens are relatively well known, however the molecular mechanism of their action is not clear. The classical pathway of estrogen action is dependent on ERα and ERβ which act as transcription factors. The effects of this pathway occur within hours or days. In addition, so-called, non-classical mechanism of steroid action dependent on membrane estrogen receptors (mER) was described. In this mechanism the effects of estrogen action are observed in a much shorter time. Here we review the structure and cellular localization of mER, molecular basis of non-classical mER action, physiological role of mER as well as implications of mER action for cancer biology. Finally, some concerns about the new estrogen receptor - GPER and candidates for estrogen receptors - ER-X and ERx, are briefly discussed. It seems that mER is a complex containing signal proteins (signalosome), as IGF receptor, EGF receptor, Ras protein, adaptor protein Shc, non-receptor kinase c-Src and PI-3K, what rationalizes production of second messengers. Some features of membrane receptors are almost identical if compared to nuclear receptors. Probably, membrane and nuclear estrogen receptors are not separate units, but rather the components of a complex mechanism in which they both cooperate with each other. We conclude that the image of the estrogen receptor as a simple transcription factor is a far-reaching simplification. A better understanding of the mechanisms of estrogen action will help us to design more effective drugs affecting signal pathways depending on both membrane and nuclear receptors.

Community case clusters of Middle East respiratory syndrome coronavirus in Hafr Al-Batin, Kingdom of Saudi Arabia: a descriptive genomic study.

PubMed

Memish, Ziad A; Cotten, Matthew; Watson, Simon J; Kellam, Paul; Zumla, Alimuddin; Alhakeem, Rafat F; Assiri, Abdullah; Rabeeah, Abdullah A Al; Al-Tawfiq, Jaffar A

2014-06-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first described in September 2012 and to date 86 deaths from a total of 206 cases of MERS-CoV infection have been reported to the WHO. Camels have been implicated as the reservoir of MERS-CoV, but the exact source and mode of transmission for most patients remain unknown. During a 3 month period, June to August 2013, there were 12 positive MERS-CoV cases reported from the Hafr Al-Batin region district in the north east region of the Kingdom of Saudi Arabia. In addition to the different regional camel festivals in neighboring countries, Hafr Al-Batin has the biggest camel market in the entire Kingdom and hosts an annual camel festival. Thus, we conducted a detailed epidemiological, clinical and genomic study to ascertain common exposure and transmission patterns of all cases of MERS-CoV reported from Hafr Al-Batin. Analysis of previously reported genetic data indicated that at least two of the infected contacts could not have been directly infected from the index patient and alternate source should be considered. While camels appear as the likely source, other sources have not been ruled out. More detailed case control studies with detailed case histories, epidemiological information and genomic analysis are being conducted to delineate the missing pieces in the transmission dynamics of MERS-CoV outbreak. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

CAFE: aCcelerated Alignment-FrEe sequence analysis

PubMed Central

Lu, Yang Young; Tang, Kujin; Ren, Jie; Fuhrman, Jed A.; Waterman, Michael S.

2017-01-01

Abstract Alignment-free genome and metagenome comparisons are increasingly important with the development of next generation sequencing (NGS) technologies. Recently developed state-of-the-art k-mer based alignment-free dissimilarity measures including CVTree, \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$d_2^*$\\end{document} and \\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}$d_2^S$\\end{document} are more computationally expensive than measures based solely on the k-mer frequencies. Here, we report a standalone software, aCcelerated Alignment-FrEe sequence analysis (CAFE), for efficient calculation of 28 alignment-free dissimilarity measures. CAFE allows for both assembled genome sequences and unassembled NGS shotgun reads as input, and wraps the output in a standard PHYLIP format. In downstream analyses, CAFE can also be used to visualize the pairwise dissimilarity measures, including dendrograms, heatmap, principal coordinate analysis and network display. CAFE serves as a general k-mer based alignment-free analysis platform for studying the relationships among genomes and metagenomes, and is freely available at https://github.com/younglululu/CAFE. PMID:28472388

Ash-plume dynamics and eruption source parameters by infrasound and thermal imagery: The 2010 Eyjafjallajökull eruption

NASA Astrophysics Data System (ADS)

Ripepe, M.; Bonadonna, C.; Folch, A.; Delle Donne, D.; Lacanna, G.; Marchetti, E.; Höskuldsson, A.

2013-03-01

During operational ash-cloud forecasting, prediction of ash concentration and total erupted mass directly depends on the determination of mass eruption rate (MER), which is typically inferred from plume height. Uncertainties for plume heights are large, especially for bent-over plumes in which the ascent dynamics are strongly affected by the surrounding wind field. Here we show how uncertainties can be reduced if MER is derived directly from geophysical observations of source dynamics. The combination of infrasound measurements and thermal camera imagery allows for the infrasonic type of source to be constrained (a dipole in this case) and for the plume exit velocity to be calculated (54-142 m/s) based on the acoustic signal recorded during the 2010 Eyjafjallajökull eruption from 4 to 21 May. Exit velocities are converted into MER using additional information on vent diameter (50±10 m) and mixture density (5.4±1.1 kg/m3), resulting in an average ∼9×105 kg/s MER during the considered period of the eruption. We validate our acoustic-derived MER by using independent measurements of plume heights (Icelandic Meteorological Office radar observations). Acoustically derived MER are converted into plume heights using field-based relationships and a 1D radially averaged buoyant plume theory model using a reconstructed total grain size distribution. We conclude that the use of infrasonic monitoring may lead to important understanding of the plume dynamics and allows for real-time determination of eruption source parameters. This could improve substantially the forecasting of volcano-related hazards, with important implications for civil aviation safety.

Single molecule counting and assessment of random molecular tagging errors with transposable giga-scale error-correcting barcodes.

PubMed

Lau, Billy T; Ji, Hanlee P

2017-09-21

RNA-Seq measures gene expression by counting sequence reads belonging to unique cDNA fragments. Molecular barcodes commonly in the form of random nucleotides were recently introduced to improve gene expression measures by detecting amplification duplicates, but are susceptible to errors generated during PCR and sequencing. This results in false positive counts, leading to inaccurate transcriptome quantification especially at low input and single-cell RNA amounts where the total number of molecules present is minuscule. To address this issue, we demonstrated the systematic identification of molecular species using transposable error-correcting barcodes that are exponentially expanded to tens of billions of unique labels. We experimentally showed random-mer molecular barcodes suffer from substantial and persistent errors that are difficult to resolve. To assess our method's performance, we applied it to the analysis of known reference RNA standards. By including an inline random-mer molecular barcode, we systematically characterized the presence of sequence errors in random-mer molecular barcodes. We observed that such errors are extensive and become more dominant at low input amounts. We described the first study to use transposable molecular barcodes and its use for studying random-mer molecular barcode errors. Extensive errors found in random-mer molecular barcodes may warrant the use of error correcting barcodes for transcriptome analysis as input amounts decrease.

Clinical validation of 3 commercial real-time reverse transcriptase polymerase chain reaction assays for the detection of Middle East respiratory syndrome coronavirus from upper respiratory tract specimens.

PubMed

Mohamed, Deqa H; AlHetheel, AbdulKarim F; Mohamud, Hanat S; Aldosari, Kamel; Alzamil, Fahad A; Somily, Ali M

2017-04-01

Since discovery of Middle East respiratory syndrome coronavirus (MERS-CoV), a novel betacoronavirus first isolated and characterized in 2012, MERS-CoV real-time reverse transcriptase polymerase chain reaction (rRT-PCR) assays represent one of the most rapidly expanding commercial tests. However, in the absence of extensive evaluations of these assays on positive clinical material of different sources, evaluating their diagnostic effectiveness remains challenging. We describe the diagnostic performance evaluation of 3 common commercial MERS-CoV rRT-PCR assays on a large panel (n = 234) of upper respiratory tract specimens collected during an outbreak episode in Saudi Arabia. Assays were compared to the RealStar® MERS-CoV RT-PCR (Alton Diagnostics, Hamburg, Germany) assay as the gold standard. Results showed i) the TIB MolBiol® LightMix UpE and Orf1a assays (TIB MolBiol, Berlin, Germany) to be the most sensitive, followed by ii) the Anyplex™ Seegene MERS-CoV assay (Seegene, Seoul, Korea), and finally iii) the PrimerDesign™ Genesig® HCoV_2012 assay (PrimerDesign, England, United Kingdom). We also evaluate a modified protocol for the PrimerDesign™ Genesig® HCoV_2012 assay. Copyright © 2017 Elsevier Inc. All rights reserved.

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) is moved toward the opening above the Delta rocket. The rover will then be mated with the rocket for launch. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-17

KENNEDY SPACE CENTER, FLA. - On Launch Pad 17-B, Cape Canaveral Air Force Station, the Mars Exploration Rover 1 (MER-B) is moved toward the opening above the Delta rocket. The rover will then be mated with the rocket for launch. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

Structure-Function Analysis of Peptide Signaling in the Clostridium perfringens Agr-Like Quorum Sensing System

PubMed Central

Ma, Menglin; Li, Jihong

2015-01-01

ABSTRACT The accessory growth regulator (Agr)-like quorum sensing (QS) system of Clostridium perfringens controls the production of many toxins, including beta toxin (CPB). We previously showed (J. E. Vidal, M. Ma, J. Saputo, J. Garcia, F. A. Uzal, and B. A. McClane, Mol Microbiol 83:179–194, 2012, http://dx.doi.org/10.1111/j.1365-2958.2011.07925.x) that an 8-amino-acid, AgrD-derived peptide named 8-R upregulates CPB production by this QS system. The current study synthesized a series of small signaling peptides corresponding to sequences within the C. perfringens AgrD polypeptide to investigate the C. perfringens autoinducing peptide (AIP) structure-function relationship. When both linear and cyclic ring forms of these peptides were added to agrB null mutants of type B strain CN1795 or type C strain CN3685, the 5-amino-acid peptides, whether in a linear or ring (thiolactone or lactone) form, induced better signaling (more CPB production) than peptide 8-R for both C. perfringens strains. The 5-mer thiolactone ring peptide induced faster signaling than the 5-mer linear peptide. Strain-related variations in sensing these peptides were detected, with CN3685 sensing the synthetic peptides more strongly than CN1795. Consistent with those synthetic peptide results, Transwell coculture experiments showed that CN3685 exquisitely senses native AIP signals from other isolates (types A, B, C, and D), while CN1795 barely senses even its own AIP. Finally, a C. perfringens AgrD sequence-based peptide with a 6-amino-acid thiolactone ring interfered with CPB production by several C. perfringens strains, suggesting potential therapeutic applications. These results indicate that AIP signaling sensitivity and responsiveness vary among C. perfringens strains and suggest C. perfringens prefers a 5-mer AIP to initiate Agr signaling. IMPORTANCE Clostridium perfringens possesses an Agr-like quorum sensing (QS) system that regulates virulence, sporulation, and toxin production. The current study used synthetic peptides to identify the structure-function relationship for the signaling peptide that activates this QS system. We found that a 5-mer peptide induces optimal signaling. Unlike other Agr systems, a linear version of this peptide (in addition to thiolactone and lactone versions) could induce signaling. Two C. perfringens strains were found to vary in sensitivity to these peptides. We also found that a 6-mer peptide can inhibit toxin production by some strains, suggesting therapeutic applications. PMID:25777675

Effects of operational decisions on the diffusion of epidemic disease: A system dynamics modeling of the MERS-CoV outbreak in South Korea.

PubMed

Shin, Nina; Kwag, Taewoo; Park, Sangwook; Kim, Yon Hui

2017-05-21

We evaluated the nosocomial outbreak of Middle East Respiratory Syndrome (MERS) Coronavirus (CoV) in the Republic of Korea, 2015, from a healthcare operations management perspective. Establishment of healthcare policy in South Korea provides patients' freedom to select and visit multiple hospitals. Current policy enforces hospitals preference for multi-patient rooms to single-patient rooms, to lower financial burden. Existing healthcare systems tragically contributed to 186 MERS outbreak cases, starting from single "index patient" into three generations of secondary infections. By developing a macro-level health system dynamics model, we provide empirical knowledge to examining the case from both operational and financial perspectives. In our simulation, under base infectivity scenario, high emergency room occupancy circumstance contributed to an estimated average of 101 (917%) more infected patients, compared to when in low occupancy circumstance. Economic patient room design showed an estimated 702% increase in the number of infected patients, despite the overall 98% savings in total expected costs compared to optimal room design. This study provides first time, system dynamics model, performance measurements from an operational perspective. Importantly, the intent of this study was to provide evidence to motivate public, private, and government healthcare administrators' recognition of current shortcomings, to optimize performance as a whole system, rather than mere individual aspects. Copyright © 2017 Elsevier Ltd. All rights reserved.

A Mouse Model for Betacoronavirus Subgroup 2c Using a Bat Coronavirus Strain HKU5 Variant

PubMed Central

Agnihothram, Sudhakar; Yount, Boyd L.; Donaldson, Eric F.; Huynh, Jeremy; Menachery, Vineet D.; Gralinski, Lisa E.; Graham, Rachel L.; Becker, Michelle M.; Tomar, Sakshi; Scobey, Trevor D.; Osswald, Heather L.; Whitmore, Alan; Gopal, Robin; Ghosh, Arun K.; Mesecar, Andrew; Zambon, Maria; Heise, Mark; Denison, Mark R.; Baric, Ralph S.

2014-01-01

ABSTRACT Cross-species transmission of zoonotic coronaviruses (CoVs) can result in pandemic disease outbreaks. Middle East respiratory syndrome CoV (MERS-CoV), identified in 2012, has caused 182 cases to date, with ~43% mortality, and no small animal model has been reported. MERS-CoV and Pipistrellus bat coronavirus (BtCoV) strain HKU5 of Betacoronavirus (β-CoV) subgroup 2c share >65% identity at the amino acid level in several regions, including nonstructural protein 5 (nsp5) and the nucleocapsid (N) protein, which are significant drug and vaccine targets. BtCoV HKU5 has been described in silico but has not been shown to replicate in culture, thus hampering drug and vaccine studies against subgroup 2c β-CoVs. We report the synthetic reconstruction and testing of BtCoV HKU5 containing the severe acute respiratory syndrome (SARS)-CoV spike (S) glycoprotein ectodomain (BtCoV HKU5-SE). This virus replicates efficiently in cell culture and in young and aged mice, where the virus targets airway and alveolar epithelial cells. Unlike some subgroup 2b SARS-CoV vaccines that elicit a strong eosinophilia following challenge, we demonstrate that BtCoV HKU5 and MERS-CoV N-expressing Venezuelan equine encephalitis virus replicon particle (VRP) vaccines do not cause extensive eosinophilia following BtCoV HKU5-SE challenge. Passage of BtCoV HKU5-SE in young mice resulted in enhanced virulence, causing 20% weight loss, diffuse alveolar damage, and hyaline membrane formation in aged mice. Passaged virus was characterized by mutations in the nsp13, nsp14, open reading frame 5 (ORF5) and M genes. Finally, we identified an inhibitor active against the nsp5 proteases of subgroup 2c β-CoVs. Synthetic-genome platforms capable of reconstituting emerging zoonotic viral pathogens or their phylogenetic relatives provide new strategies for identifying broad-based therapeutics, evaluating vaccine outcomes, and studying viral pathogenesis. PMID:24667706

High field induced magnetic transitions in the Y0.7E r0.3F e2D4.2 deuteride

NASA Astrophysics Data System (ADS)

Paul-Boncour, V.; Guillot, M.; Isnard, O.; Hoser, A.

2017-09-01

The influence of the partial Er for Y substitution on the crystal structure and magnetic properties of YF e2D4.2 has been investigated by high field magnetization and neutron diffraction experiments. Y0.7E r0.3F e2D4.2 compound crystallizes in the same monoclinic structure as YF e2D4.2 described in P c (P1c1) space group with D atoms located in 18 different tetrahedral interstitial sites. A cell volume contraction of 0.6% is observed upon Er substitution, inducing large modification of the magnetic properties. Electronic effect of D insertion as well as lowering of crystal symmetry are important factors determining the magnetic properties of Fe sublattice, which evolves towards more delocalized behavior and modifying the Er-Fe exchange interactions. In the ground state, the Er and Fe moments are arranged ferrimagnetically within the plane perpendicular to the monoclinic b axis and with average moments mEr=6.4 (3 ) μBEr-1 and mFe=2.0 (1 ) μBFe-1 at 10 K. Upon heating, mEr decreases progressively until TEr=55 K . Between 55 K and 75 K, the Fe sublattice undergoes a first-order ferromagnetic-antiferromagnetic (FM-AFM) transition with a cell volume contraction due to the itinerant metamagnetic behavior of one Fe site. In the AFM structure, mFe decreases until the Néel temperature TN=125 K . At high field, two different types of field induced transitions are observed. The Er moments become parallel to the Fe one and saturates to the E r3 + free ion value, leading to an unusual field induced FM arrangement at a transition field BTrans of only 78 kG below 30 K. Then above TM0=66 K , an AFM-FM transition of the Fe sublattice, accompanied by a cell volume increase is observed. BTrans increases linearly versus temperature and with a larger d BTrans/d T slope than for YF e2D4.2 . This has been explained by the additional contribution of Er induced moments above BTrans.

Phase ordering dynamics of reconstituting particles

NASA Astrophysics Data System (ADS)

Albarracín, F. A. Gómez; Rosales, H. D.; Grynberg, M. D.

2017-06-01

We consider the large-time dynamics of one-dimensional processes involving adsorption and desorption of extended hard-core particles (dimers, trimers, ..., k -mers), while interacting through their constituent monomers. Desorption can occur whether or not these latter adsorbed together, which leads to reconstitution of k -mers and the appearance of sectors of motion with nonlocal conservation laws for k ≥3 . Dynamic exponents of the sector including the empty chain are evaluated by finite-size scaling analyses of the relaxation times embodied in the spectral gaps of evolution operators. For attractive interactions it is found that in the low-temperature limit such time scales converge to those of the Glauber dynamics, thus suggesting a diffusive universality class for k ≥2 . This is also tested by simulated quenches down to T =0 , where a common scaling function emerges. By contrast, under repulsive interactions the low-temperature dynamics is characterized by metastable states which decay subdiffusively to a highly degenerate and partially jammed phase.

Insights into cadmium diffusion mechanisms in two-stage diffusion profiles in solar-grade Cu(In,Ga)Se{sub 2} thin films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Biderman, N. J.; Sundaramoorthy, R.; Haldar, Pradeep

Cadmium diffusion experiments were performed on polished copper indium gallium diselenide (Cu(In,Ga)Se{sub 2} or CIGS) samples with resulting cadmium diffusion profiles measured by time-of-flight secondary ion mass spectroscopy. Experiments done in the annealing temperature range between 275 °C and 425 °C reveal two-stage cadmium diffusion profiles which may be indicative of multiple diffusion mechanisms. Each stage can be described by the standard solutions of Fick's second law. The slower cadmium diffusion in the first stage can be described by the Arrhenius equation D{sub 1} = 3 × 10{sup −4} exp (− 1.53 eV/k{sub B}T) cm{sup 2} s{sup −1}, possibly representing vacancy-meditated diffusion. The faster second-stage diffusion coefficients determined in these experiments matchmore » the previously reported cadmium diffusion Arrhenius equation of D{sub 2} = 4.8 × 10{sup −4} exp (−1.04 eV/k{sub B}T) cm{sup 2} s{sup −1}, suggesting an interstitial-based mechanism.« less

Fluorescence-based characterization of genetically encoded peptides that fold in live cells: progress toward a generic hairpin scaffold

NASA Astrophysics Data System (ADS)

Cheng, Zihao; Campbell, Robert E.

2007-02-01

Binding proteins suitable for expression and high affinity molecular recognition in the cytoplasm or nucleus of live cells have numerous applications in the biological sciences. In an effort to add a new minimal motif to the growing repertoire of validated non-immunoglobulin binding proteins, we have undertaken the development of a generic protein scaffold based on a single β-hairpin that can fold efficiently in the cytoplasm. We have developed a method, based on the measurement of fluorescence resonance energy transfer (FRET) between a genetically fused cyan fluorescent protein (CFP) and yellow fluorescent protein (YFP), that allows the structural stability of recombinant β-hairpin peptides to be rapidly assessed both in vitro and in vivo. We have previously reported the validation of this method when applied to a 16mer tryptophan zipper β-hairpin. We now describe the use of this method to evaluate the potential of a designed 20mer β-hairpin peptide with a 3rd Trp/Trp cross-strand pair to function as a generic protein scaffold. Quantitative analysis of the FRET efficiency, resistance to proteolysis (assayed by loss of FRET), and circular dichroism spectra revealed that the 20mer peptide is significantly more tolerant of destabilizing mutations than the 16mer peptide. Furthermore, we experimentally demonstrate that the in vitro determined β-hairpin stabilities are well correlated with in vivo β-hairpin stabilities as determined by FRET measurements of colonies of live bacteria expressing the recombinant peptides flanked by CFP and YFP. Finally, we report on our progress to develop highly folded 24mer and 28mer β-hairpin peptides through the use of fluorescence-based library screening.

CDC's Early Response to a Novel Viral Disease, Middle East Respiratory Syndrome Coronavirus (MERS-CoV), September 2012-May 2014.

PubMed

Williams, Holly Ann; Dunville, Richard L; Gerber, Susan I; Erdman, Dean D; Pesik, Nicki; Kuhar, David; Mason, Karen A; Haynes, Lia; Rotz, Lisa; St Pierre, Jeanette; Poser, Sarah; Bunga, Sudhir; Pallansch, Mark A; Swerdlow, David L

2015-01-01

The first ever case of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was reported in September 2012. This report describes the approaches taken by CDC, in collaboration with the World Health Organization (WHO) and other partners, to respond to this novel virus, and outlines the agency responses prior to the first case appearing in the United States in May 2014. During this time, CDC's response integrated multiple disciplines and was divided into three distinct phases: before, during, and after the initial activation of its Emergency Operations Center. CDC's response to MERS-CoV required a large effort, deploying at least 353 staff members who worked in the areas of surveillance, laboratory capacity, infection control guidance, and travelers' health. This response built on CDC's experience with previous outbreaks of other pathogens and provided useful lessons for future emerging threats.

CDC's Early Response to a Novel Viral Disease, Middle East Respiratory Syndrome Coronavirus (MERS-CoV), September 2012–May 2014

PubMed Central

Dunville, Richard L.; Gerber, Susan I.; Erdman, Dean D.; Pesik, Nicki; Kuhar, David; Mason, Karen A.; Haynes, Lia; Rotz, Lisa; St. Pierre, Jeanette; Poser, Sarah; Bunga, Sudhir; Pallansch, Mark A.; Swerdlow, David L.

2015-01-01

The first ever case of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) was reported in September 2012. This report describes the approaches taken by CDC, in collaboration with the World Health Organization (WHO) and other partners, to respond to this novel virus, and outlines the agency responses prior to the first case appearing in the United States in May 2014. During this time, CDC's response integrated multiple disciplines and was divided into three distinct phases: before, during, and after the initial activation of its Emergency Operations Center. CDC's response to MERS-CoV required a large effort, deploying at least 353 staff members who worked in the areas of surveillance, laboratory capacity, infection control guidance, and travelers' health. This response built on CDC's experience with previous outbreaks of other pathogens and provided useful lessons for future emerging threats. PMID:26345122

Photo-realistic Terrain Modeling and Visualization for Mars Exploration Rover Science Operations

NASA Technical Reports Server (NTRS)

Edwards, Laurence; Sims, Michael; Kunz, Clayton; Lees, David; Bowman, Judd

2005-01-01

Modern NASA planetary exploration missions employ complex systems of hardware and software managed by large teams of. engineers and scientists in order to study remote environments. The most complex and successful of these recent projects is the Mars Exploration Rover mission. The Computational Sciences Division at NASA Ames Research Center delivered a 30 visualization program, Viz, to the MER mission that provides an immersive, interactive environment for science analysis of the remote planetary surface. In addition, Ames provided the Athena Science Team with high-quality terrain reconstructions generated with the Ames Stereo-pipeline. The on-site support team for these software systems responded to unanticipated opportunities to generate 30 terrain models during the primary MER mission. This paper describes Viz, the Stereo-pipeline, and the experiences of the on-site team supporting the scientists at JPL during the primary MER mission.

The Challenges of Designing the Rocker-Bogie Suspension for the Mars Exploration Rover

NASA Technical Reports Server (NTRS)

Harrington, Brian D.; Voorhees, Chris

2004-01-01

Over the past decade, the rocker-bogie suspension design has become a proven mobility application known for its superior vehicle stability and obstacle-climbing capability. Following several technology and research rover implementations, the system was successfully flown as part of Mars Pathfinder s Sojourner rover. When the Mars Exploration Rover (MER) Project was first proposed, the use of a rocker-bogie suspension was the obvious choice due to its extensive heritage. The challenge posed by MER was to design a lightweight rocker-bogie suspension that would permit the mobility to stow within the limited space available and deploy into a configuration that the rover could then safely use to egress from the lander and explore the Martian surface. This paper will describe how the MER rocker-bogie suspension subsystem was able to meet these conflicting design requirements while highlighting the variety of deployment and latch mechanisms employed in the design.

Total synthesis of mycobacterial arabinogalactan containing 92 monosaccharide units

NASA Astrophysics Data System (ADS)

Wu, Yong; Xiong, De-Cai; Chen, Si-Cong; Wang, Yong-Shi; Ye, Xin-Shan

2017-03-01

Carbohydrates are diverse bio-macromolecules with highly complex structures that are involved in numerous biological processes. Well-defined carbohydrates obtained by chemical synthesis are essential to the understanding of their functions. However, synthesis of carbohydrates is greatly hampered by its insufficient efficiency. So far, assembly of long carbohydrate chains remains one of the most challenging tasks for synthetic chemists. Here we describe a highly efficient assembly of a 92-mer polysaccharide by the preactivation-based one-pot glycosylation protocol. Several linear and branched oligosaccharide/polysaccharide fragments ranging from 5-mer to 31-mer in length have been rapidly constructed in one-pot manner, which enables the first total synthesis of a biologically important mycobacterial arabinogalactan through a highly convergent [31+31+30] coupling reaction. Our results show that the preactivation-based one-pot glycosylation protocol may provide access to the construction of long and complicated carbohydrate chains.

Developing a benchmark for emotional analysis of music

PubMed Central

Yang, Yi-Hsuan; Soleymani, Mohammad

2017-01-01

Music emotion recognition (MER) field rapidly expanded in the last decade. Many new methods and new audio features are developed to improve the performance of MER algorithms. However, it is very difficult to compare the performance of the new methods because of the data representation diversity and scarcity of publicly available data. In this paper, we address these problems by creating a data set and a benchmark for MER. The data set that we release, a MediaEval Database for Emotional Analysis in Music (DEAM), is the largest available data set of dynamic annotations (valence and arousal annotations for 1,802 songs and song excerpts licensed under Creative Commons with 2Hz time resolution). Using DEAM, we organized the ‘Emotion in Music’ task at MediaEval Multimedia Evaluation Campaign from 2013 to 2015. The benchmark attracted, in total, 21 active teams to participate in the challenge. We analyze the results of the benchmark: the winning algorithms and feature-sets. We also describe the design of the benchmark, the evaluation procedures and the data cleaning and transformations that we suggest. The results from the benchmark suggest that the recurrent neural network based approaches combined with large feature-sets work best for dynamic MER. PMID:28282400

Developing a benchmark for emotional analysis of music.

PubMed

Aljanaki, Anna; Yang, Yi-Hsuan; Soleymani, Mohammad

2017-01-01

Music emotion recognition (MER) field rapidly expanded in the last decade. Many new methods and new audio features are developed to improve the performance of MER algorithms. However, it is very difficult to compare the performance of the new methods because of the data representation diversity and scarcity of publicly available data. In this paper, we address these problems by creating a data set and a benchmark for MER. The data set that we release, a MediaEval Database for Emotional Analysis in Music (DEAM), is the largest available data set of dynamic annotations (valence and arousal annotations for 1,802 songs and song excerpts licensed under Creative Commons with 2Hz time resolution). Using DEAM, we organized the 'Emotion in Music' task at MediaEval Multimedia Evaluation Campaign from 2013 to 2015. The benchmark attracted, in total, 21 active teams to participate in the challenge. We analyze the results of the benchmark: the winning algorithms and feature-sets. We also describe the design of the benchmark, the evaluation procedures and the data cleaning and transformations that we suggest. The results from the benchmark suggest that the recurrent neural network based approaches combined with large feature-sets work best for dynamic MER.

A 4D Hyperspherical Interpretation of q-Space

PubMed Central

Hosseinbor, A. Pasha; Chung, Moo K.; Wu, Yu-Chien; Bendlin, Barbara B.; Alexander, Andrew L.

2015-01-01

3D q-space can be viewed as the surface of a 4D hypersphere. In this paper, we seek to develop a 4D hyperspherical interpretation of q-space by projecting it onto a hypersphere and subsequently modeling the q-space signal via 4D hyperspherical harmonics (HSH). Using this orthonormal basis, we derive several well-established q-space indices and numerically estimate the diffusion orientation distribution function (dODF). We also derive the integral transform describing the relationship between the diffusion signal and propagator on a hypersphere. Most importantly, we will demonstrate that for hybrid diffusion imaging (HYDI) acquisitions low order linear expansion of the HSH basis is sufficient to characterize diffusion in neural tissue. In fact, the HSH basis achieves comparable signal and better dODF reconstructions than other well-established methods, such as Bessel Fourier orientation reconstruction (BFOR), using fewer fitting parameters. All in all, this work provides a new way of looking at q-space. PMID:25624043

A 4D hyperspherical interpretation of q-space.

PubMed

Pasha Hosseinbor, A; Chung, Moo K; Wu, Yu-Chien; Bendlin, Barbara B; Alexander, Andrew L

2015-04-01

3D q-space can be viewed as the surface of a 4D hypersphere. In this paper, we seek to develop a 4D hyperspherical interpretation of q-space by projecting it onto a hypersphere and subsequently modeling the q-space signal via 4D hyperspherical harmonics (HSH). Using this orthonormal basis, we derive several well-established q-space indices and numerically estimate the diffusion orientation distribution function (dODF). We also derive the integral transform describing the relationship between the diffusion signal and propagator on a hypersphere. Most importantly, we will demonstrate that for hybrid diffusion imaging (HYDI) acquisitions low order linear expansion of the HSH basis is sufficient to characterize diffusion in neural tissue. In fact, the HSH basis achieves comparable signal and better dODF reconstructions than other well-established methods, such as Bessel Fourier orientation reconstruction (BFOR), using fewer fitting parameters. All in all, this work provides a new way of looking at q-space. Copyright © 2014 Elsevier B.V. All rights reserved.

Transepithelial ultrafiltration and fractal power diffusion of D-glucose in the perfused rat intestine.

PubMed

Kochak, Gregory M; Mangat, Surinder

2002-12-23

Despite an enormous body of research investigating the mass transfer of D-glucose through biological membranes, carrier-mediated and first-order models have remained the prevalent models describing glucose's quantitative behavior even though they have proven to be inadequate over extended concentration ranges. Recent evidence from GLUT2 knockout studies further questions our understanding of molecular models, especially those employing Michaelis-Menten (MM)-type kinetic models. In this report, evidence is provided that D-glucose is absorbed by rat intestinal epithelium by a combination of convective ultrafiltration and nonlinear diffusion. The diffusive component of mass transfer is described by a concentration-dependent permeability coefficient, modeled as a fractal power function. Glucose and sodium chloride-dependent-induced aqueous convection currents are the result of prevailing oncotic and osmotic pressure effects, and a direct effect of glucose and sodium chloride on intestinal epithelium resulting in enhanced glucose, sodium ion, and water mobility. The fractal power model of glucose diffusion was superior to the conventional MM description. A convection-diffusion model of mass transfer adequately characterized glucose mass transfer over a 105-fold glucose concentration range in the presence and absence of sodium ion.

Implementation of hierarchical clustering using k-mer sparse matrix to analyze MERS-CoV genetic relationship

NASA Astrophysics Data System (ADS)

Bustamam, A.; Ulul, E. D.; Hura, H. F. A.; Siswantining, T.

2017-07-01

Hierarchical clustering is one of effective methods in creating a phylogenetic tree based on the distance matrix between DNA (deoxyribonucleic acid) sequences. One of the well-known methods to calculate the distance matrix is k-mer method. Generally, k-mer is more efficient than some distance matrix calculation techniques. The steps of k-mer method are started from creating k-mer sparse matrix, and followed by creating k-mer singular value vectors. The last step is computing the distance amongst vectors. In this paper, we analyze the sequences of MERS-CoV (Middle East Respiratory Syndrome - Coronavirus) DNA by implementing hierarchical clustering using k-mer sparse matrix in order to perform the phylogenetic analysis. Our results show that the ancestor of our MERS-CoV is coming from Egypt. Moreover, we found that the MERS-CoV infection that occurs in one country may not necessarily come from the same country of origin. This suggests that the process of MERS-CoV mutation might not only be influenced by geographical factor.

Identification of a Novel Inhibitor against Middle East Respiratory Syndrome Coronavirus

PubMed Central

Sun, Yaping; Zhang, Huaidong; Shi, Jian; Zhang, Zhe; Gong, Rui

2017-01-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) was first isolated in 2012, and circulated worldwide with high mortality. The continual outbreaks of MERS-CoV highlight the importance of developing antiviral therapeutics. Here, we rationally designed a novel fusion inhibitor named MERS-five-helix bundle (MERS-5HB) derived from the six-helix bundle (MERS-6HB) which was formed by the process of membrane fusion. MERS-5HB consists of three copies of heptad repeat 1 (HR1) and two copies of heptad repeat 2 (HR2) while MERS-6HB includes three copies each of HR1 and HR2. As it lacks one HR2, MERS-5HB was expected to interact with viral HR2 to interrupt the fusion step. What we found was that MERS-5HB could bind to HR2P, a peptide derived from HR2, with a strong affinity value (KD) of up to 0.24 nM. Subsequent assays indicated that MERS-5HB could inhibit pseudotyped MERS-CoV entry effectively with 50% inhibitory concentration (IC50) of about 1 μM. In addition, MERS-5HB significantly inhibited spike (S) glycoprotein-mediated syncytial formation in a dose-dependent manner. Further biophysical characterization showed that MERS-5HB was a thermo-stable α-helical secondary structure. The inhibitory potency of MERS-5HB may provide an attractive basis for identification of a novel inhibitor against MERS-CoV, as a potential antiviral agent. PMID:28906430

TAM receptors Tyro3 and Mer as novel targets in colorectal cancer.

PubMed

Schmitz, Robin; Valls, Aida Freire; Yerbes, Rosario; von Richter, Sophie; Kahlert, Christoph; Loges, Sonja; Weitz, Jürgen; Schneider, Martin; Ruiz de Almodovar, Carmen; Ulrich, Alexis; Schmidt, Thomas

2016-08-30

CRC remains the third most common cancer worldwide with a high 5-year mortality rate in advanced cases. Combined with chemotherapy, targeted therapy is an additional treatment option. However as CRC still escapes targeted therapy the vigorous search for new targets is warranted to increase patients´ overall survival. In this study we describe a new role for Gas6/protein S-TAM receptor interaction in CRC. Gas6, expressed by tumor-infiltrating M2-like macrophages, enhances malignant properties of tumor cells including proliferation, invasion and colony formation. Upon chemotherapy macrophages increase Gas6 synthesis, which significantly attenuates the cytotoxic effect of 5-FU chemotherapy on tumor cells. The anti-coagulant protein S has similar effects as Gas6.In CRC patient samples Tyro3 was overexpressed within the tumor. In-vitro inhibition of Tyro3 and Mer reduces tumor cell proliferation and sensitizes tumor cells to chemotherapy. Moreover high expression of Tyro3 and Mer in tumor tissue significantly shortens CRC patients´ survival. Various in vitro models were used to investigate the role of Gas6 and its TAM receptors in human CRC cells, by stimulation (rhGas6) and knockdown (siRNA) of Axl, Tyro3 and Mer. In terms of a translational research, we additionally performed an expression analysis in human CRC tissue and analyzed the medical record of these patients. Tyro3 and Mer represent novel therapeutic targets in CRC and warrant further preclinical and clinical investigation in the future.

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen

PubMed Central

BANNAI, Hiroshi; NEMOTO, Manabu; TSUJIMURA, Koji; YAMANAKA, Takashi; MAEDA, Ken; KONDO, Takashi

2015-01-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA. PMID:26424485

Improvement of an enzyme-linked immunosorbent assay for equine herpesvirus type 4 by using a synthetic-peptide 24-mer repeat sequence of glycoprotein G as an antigen.

PubMed

Bannai, Hiroshi; Nemoto, Manabu; Tsujimura, Koji; Yamanaka, Takashi; Maeda, Ken; Kondo, Takashi

2016-02-01

To increase the sensitivity of an enzyme-linked immunosorbent assay (ELISA) for equine herpesvirus type 4 (EHV-4) that uses a 12-mer peptide of glycoprotein G (gG4-12-mer: MKNNPIYSEGSL) [4], we used a longer peptide consisting of a 24-mer repeat sequence (gG4-24-mer: MKNNPIYSEGSLMLNVQHDDSIHT) as an antigen. Sera of horses experimentally infected with EHV-4 reacted much more strongly to the gG4-24-mer peptide than to the gG4-12-mer peptide. We used peptide ELISAs to test paired sera from horses naturally infected with EHV-4 (n=40). gG4-24-mer ELISA detected 37 positive samples (92.5%), whereas gG4-12-mer ELISA detected only 28 (70.0%). gG4-24-mer ELISA was much more sensitive than gG4-12-mer ELISA.

Native and subunit molecular mass and quarternary structure of the hemoglobin from the primitive branchiopod crustacean Triops cancriformis.

PubMed

Rousselot, Morgane; Jaenicke, Elmar; Lamkemeyer, Tobias; Harris, J Robin; Pirow, Ralph

2006-09-01

Many branchiopod crustaceans are endowed with extracellular, high-molecular-weight hemoglobins whose exact structural characteristics have remained a matter of conjecture. By using a broad spectrum of techniques, we provide precise and coherent information on the hemoglobin of one of the phylogenetically 'oldest' extant branchiopods, the tadpole shrimp Triops cancriformis. The hemoglobin dissociated under reducing conditions into two subunits, designated TcHbA and TcHbB, with masses of 35,775+/-4 and 36,055+/-4 Da, respectively, determined by ESI-MS. Nonreducing conditions showed only two disulfide-bridged dimers, a homodimer of TcHbA, designated D1 (71,548+/-5 Da), and the heterodimer D2 (71,828+/-5 Da). Carbamidomethylation of free SH groups revealed the presence of three cysteines per subunit and indicated one intrasubunit and one intersubunit disulfide bridge. Ultracentrifugation and light-scattering experiments under nondenaturating conditions yielded mass estimates that suggested an uneven number of 17 subunits forming the native hemoglobin. This unrealistic number resulted from the presence of two size classes (16-mer and 18-mer), which were recognized by native PAGE and Ferguson plot analysis. ESI-MS revealed three hemoglobin isoforms with masses of 588.1 kDa, 662.0 kDa, and 665.0 kDa. The 16-mer and the smaller 18-mer species are supposed to be composed of TcHbA only, given the dominance of this subunit type in SDS/PAGE. Transmission electron microscopy of negatively stained specimens showed a population of compact molecules with geometrical extensions of 14, 16 and 9 nm. The proposed stoichiometric model of quarternary structure provides the missing link to achieve a mechanistic understanding of the structure-function relationships among the multimeric arthropodan hemoglobins.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, the cylindrical payload canister is lowered around Mars Exploration Rover 1 (MER-B). Once secure inside the canister, the rover will be transported to Launch Complex 17-B, Cape Canaveral Air Force Station, for mating with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Pad 17-B June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-13

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, the cylindrical payload canister is lowered around Mars Exploration Rover 1 (MER-B). Once secure inside the canister, the rover will be transported to Launch Complex 17-B, Cape Canaveral Air Force Station, for mating with the Delta rocket. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Pad 17-B June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare Mars Exploration Rover 1 (MER-B) to be mated with the third stage of the Delta rocket that will launch it to Mars. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-12

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility prepare Mars Exploration Rover 1 (MER-B) to be mated with the third stage of the Delta rocket that will launch it to Mars. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - In the background, right, workers in the Payload Hazardous Servicing Facility get ready to lift Mars Exploration Rover 1 (MER-B) to the third stage of the Delta rocket (foreground) for mating. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-12

KENNEDY SPACE CENTER, FLA. - In the background, right, workers in the Payload Hazardous Servicing Facility get ready to lift Mars Exploration Rover 1 (MER-B) to the third stage of the Delta rocket (foreground) for mating. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the connections after the Mars Exploration Rover 1 (MER-B) above was mated with the third stage of the Delta rocket below. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

NASA Image and Video Library

2003-06-12

KENNEDY SPACE CENTER, FLA. - In the Payload Hazardous Servicing Facility, workers check the connections after the Mars Exploration Rover 1 (MER-B) above was mated with the third stage of the Delta rocket below. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch from Launch Pad 17-B, Cape Canaveral Air Force Station, June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

Molecular dynamics of Middle East Respiratory Syndrome Coronavirus (MERS CoV) fusion heptad repeat trimers.

PubMed

Kandeel, Mahmoud; Al-Taher, Abdulla; Li, Huifang; Schwingenschlogl, Udo; Al-Nazawi, Mohamed

2018-08-01

Structural studies related to Middle East Respiratory Syndrome Coronavirus (MERS CoV) infection process are so limited. In this study, molecular dynamics (MD) simulations were carried out to unravel changes in the MERS CoV heptad repeat domains (HRs) and factors affecting fusion state HR stability. Results indicated that HR trimer is more rapidly stabilized, having stable system energy and lower root mean square deviations (RMSDs). While trimers were the predominant active form of CoVs HRs, monomers were also discovered in both of viral and cellular membranes. In order to find the differences between S2 monomer and trimer molecular dynamics, S2 monomer was modelled and subjected to MD simulation. In contrast to S2 trimer, S2 monomer was unstable, having high RMSDs with major drifts above 8 Å. Fluctuation of HR residue positions revealed major changes in the C-terminal of HR2 and the linker coil between HR1 and HR2 in both monomer and trimer. Hydrophobic residues at the a and d positions of HR helices stabilize the whole system, with minimal changes in RMSD. The global distance test and contact area difference scores support instability of MERS CoV S2 monomer. Analysis of HR1-HR2 inter-residue contacts and interaction energy revealed three energy scales along HR helices. Two strong interaction energies were identified at the start of the HR2 helix and at the C-terminal of HR2. The identified critical residues by MD simulation and residues at the a and d positions of HR helix were strong stabilizers of HR recognition. Copyright © 2018 Elsevier Ltd. All rights reserved.

Development of a transgenic tobacco plant for phytoremediation of methylmercury pollution.

PubMed

Nagata, Takeshi; Morita, Hirofumi; Akizawa, Toshifumi; Pan-Hou, Hidemitsu

2010-06-01

To develop the potential of plant for phytoremediation of methylmercury pollution, a genetically engineered tobacco plant that coexpresses organomercurial lyase (MerB) with the ppk-specified polyphosphate (polyP) and merT-encoding mercury transporter was constructed by integrating a bacterial merB gene into ppk/merT-transgenic tobacco. A large number of independent transgenic tobaccos was obtained, in some of which the merB gene was stably integrated in the plant genome and substantially translated to the expected MerB enzyme in the transgenic tobacco. The ppk/merT/merB-transgenic tobacco callus showed more resistance to methylmercury (CH3Hg+) and accumulated more mercury from CH3Hg+-containing medium than the ppk/merT-transgenic and wild-type progenitors. These results suggest that the MerB enzyme encoded by merB degraded the incorporated CH3Hg+ to Hg2+, which then accumulated as a less toxic Hg-polyP complex in the tobacco cells. Phytoremediation of CH3Hg+ and Hg2+ in the environment with this engineered ppk/merT/merB-transgenic plant, which prevents the release mercury vapor (Hg0) into the atmosphere in addition to generating potentially recyclable mercury-rich plant residues, is believed to be more acceptable to the public than other competing technologies, including phytovolatilization.

Understanding M-ligand bonding and mer-/fac-isomerism in tris(8-hydroxyquinolinate) metallic complexes.

PubMed

Lima, Carlos F R A C; Taveira, Ricardo J S; Costa, José C S; Fernandes, Ana M; Melo, André; Silva, Artur M S; Santos, Luís M N B F

2016-06-28

Tris(8-hydroxyquinolinate) metallic complexes, Mq3, are one of the most important classes of organic semiconductor materials. Herein, the nature of the chemical bond in Mq3 complexes and its implications on their molecular properties were investigated by a combined experimental and computational approach. Various Mq3 complexes, resulting from the alteration of the metal and substitution of the 8-hydroxyquinoline ligand in different positions, were prepared. The mer-/fac-isomerism in Mq3 was explored by FTIR and NMR spectroscopy, evidencing that, irrespective of the substituent, mer- and fac-are the most stable molecular configurations of Al(iii) and In(iii) complexes, respectively. The relative M-ligand bond dissociation energies were evaluated experimentally by electrospray ionization tandem mass spectrometry (ESI-MS-MS), showing a non-monotonous variation along the group (Al > In > Ga). The results reveal a strong covalent character in M-ligand bonding, which allows for through-ligand electron delocalization, and explain the preferred molecular structures of Mq3 complexes as resulting from the interplay between bonding and steric factors. The mer-isomer reduces intraligand repulsions, being preferred for smaller metals, while the fac-isomer is favoured for larger metals where stronger covalent M-ligand bonds can be formed due to more extensive through-ligand conjugation mediated by metal "d" orbitals.

Diffuse pulmonary gallium accumulation with a normal chest radiogram in a homosexual man with pneumocystis carinii pneumonia. A case report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, S.C.; Baker, S.R.; Seldin, M.F.

1983-12-01

A homosexual man with A.I.D.S. (acquired immunologic deficiency syndrome) and pneumocystis infestation was found to have diffuse Ga-67 uptake in the lungs with a coincident negative chest x-ray. While Ga-67 accumulates diffusely in the lungs in a variety of conditions, the present case is the first described in a patient with A.I.D.S. in which Ga-67 was positive before roentgenographic abnormalities were demonstrated. Thus, the use of Ga-67 scan, when A.I.D.S. is suspected, could help establish a diagnosis more promptly.

High Gain Antenna Gimbal for the 2003-2004 Mars Exploration Rover Program

NASA Technical Reports Server (NTRS)

Sokol, Jeff; Krishnan, Satish; Ayari, Laoucet

2004-01-01

The High Gain Antenna Assemblies built for the 2003-2004 Mars Exploration Rover (MER) missions provide the primary communication link for the Rovers once they arrive on Mars. The High Gain Antenna Gimbal (HGAG) portion of the assembly is a two-axis gimbal that provides the structural support, pointing, and tracking for the High Gain Antenna (HGA). The MER mission requirements provided some unique design challenges for the HGAG. This paper describes all the major subsystems of the HGAG that were developed to meet these challenges, and the requirements that drove their design.

Potential population-level nutritional impact of replacing whole and reduced-fat milk with low-fat and skim milk among US children aged 2-19 years.

PubMed

Rehm, Colin D; Drewnowski, Adam; Monsivais, Pablo

2015-01-01

Dietary guidance emphasizes plain low-fat and skim milk over whole, reduced-fat, and flavored milk (milk eligible for replacement [MER]). The objective of this study was to evaluate the population-level impact of such a change on energy, macronutrient and nutrient intakes, and diet cost. Cross-sectional modeling study. Data from the 2001-2002 and 2003-2004 National Health and Nutrition Examination Survey. A total of 8,112 children aged 2-19 years. Energy, macronutrient, and micronutrient intake before and after replacement of MER with low-fat or skim milk. Survey-weighted linear regression models. Milk eligible for replacement accounted for 46% of dairy servings. Among MER consumers, replacement with skim or low-fat milk would lead to a projected reduction in energy of 113 (95% confidence interval [CI], 107-119) and 77 (95% CI, 73-82) kcal/d and percent energy from saturated fat by an absolute value of 2.5% of total energy (95% CI, 2.4-2.6) and 1.4% (95% CI, 1.3-1.5), respectively. Replacement of MER does not change diet costs or calcium and potassium intake. Substitution of MER has the potential to reduce energy and total and saturated fat intake with no impact on diet costs or micronutrient density. The feasibility of such replacement has not been examined and there may be negative consequences if replacement is done with non-nutrient-rich beverages. Copyright © 2015. Published by Elsevier Inc.

Professional tennis players' serve: correlation between segmental angular momentums and ball velocity.

PubMed

Martin, Caroline; Kulpa, Richard; Delamarche, Paul; Bideau, Benoit

2013-03-01

The purpose of the study was to identify the relationships between segmental angular momentum and ball velocity between the following events: ball toss, maximal elbow flexion (MEF), racket lowest point (RLP), maximal shoulder external rotation (MER), and ball impact (BI). Ten tennis players performed serves recorded with a real-time motion capture. Mean angular momentums of the trunk, upper arm, forearm, and the hand-racket were calculated. The anteroposterior axis angular momentum of the trunk was significantly related with ball velocity during the MEF-RLP, RLP-MER, and MER-BI phases. The strongest relationships between the transverse-axis angular momentums and ball velocity followed a proximal-to-distal timing sequence that allows the transfer of angular momentum from the trunk (MEF-RLP and RLP-MER phases) to the upper arm (RLP-MER phase), forearm (RLP-MER and MER-BI phases), and the hand-racket (MER-BI phase). Since sequence is crucial for ball velocity, players should increase angular momentums of the trunk during MEF-MER, upper arm during RLP-MER, forearm during RLP-BI, and the hand-racket during MER-BI.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ying, Tianlei; Prabakaran, Ponraj; Du, Lanying

The MERS-CoV is an emerging virus, which already infected more than 1,300 humans with high (~36%) mortality. Here, we show that m336, an exceptionally potent human anti-MERS-CoV antibody, is almost germline with only one somatic mutation in the heavy chain. The structure of Fab m336 in complex with the MERS-CoV receptor-binding domain reveals that its IGHV1-69-derived heavy chain provides more than 85% binding surface and that its epitope almost completely overlaps with the receptor-binding site. Analysis of antibodies from 69 healthy humans suggests an important role of the V(D)J recombination-generated junctional and allele-specific residues for achieving high affinity of bindingmore » at such low levels of somatic hypermutation. Our results also have important implications for development of vaccine immunogens based on the newly identified m336 epitope as well as for elucidation of mechanisms of neutralization by m336-like antibodies and their elicitation in vivo.« less

Air Bag Installation

NASA Technical Reports Server (NTRS)

2003-01-01

May 10, 2003Prelaunch at Kennedy Space Center

On Mars Exploration Rover 1 (MER-1) , air bags are installed on the lander. The airbags will inflate to cushion the landing of the spacecraft on the surface of Mars. When it stops bouncing and rolling, the airbags will deflate and retract, the petals will open to bring the lander to an upright position, and the rover will be exposed. NASA's twin Mars Exploration Rovers are designed to study the history of water on Mars. These robotic geologists are equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow them to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-1 is scheduled to launch June 25 as MER-B aboard a Delta II rocket from Cape Canaveral Air Force Station.

Preventing cleavage of Mer promotes efferocytosis and suppresses acute lung injury in bleomycin treated mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ye-Ji; Tissue Injury Defense Research Center, School of Medicine, Ewha Womans University, Seoul; Lee, Seung-Hae

2012-08-15

Mer receptor tyrosine kinase (Mer) regulates macrophage activation and promotes apoptotic cell clearance. Mer activation is regulated through proteolytic cleavage of the extracellular domain. To determine if membrane-bound Mer is cleaved during bleomycin-induced lung injury, and, if so, how preventing the cleavage of Mer enhances apoptotic cell uptake and down-regulates pulmonary immune responses. During bleomycin-induced acute lung injury in mice, membrane-bound Mer expression decreased, but production of soluble Mer and activity as well as expression of disintegrin and metalloproteinase 17 (ADAM17) were enhanced . Treatment with the ADAM inhibitor TAPI-0 restored Mer expression and diminished soluble Mer production. Furthermore, TAPI-0more » increased Mer activation in alveolar macrophages and lung tissue resulting in enhanced apoptotic cell clearance in vivo and ex vivo by alveolar macrophages. Suppression of bleomycin-induced pro-inflammatory mediators, but enhancement of hepatocyte growth factor induction were seen after TAPI-0 treatment. Additional bleomycin-induced inflammatory responses reduced by TAPI-0 treatment included inflammatory cell recruitment into the lungs, levels of total protein and lactate dehydrogenase activity in bronchoalveolar lavage fluid, as well as caspase-3 and caspase-9 activity and alveolar epithelial cell apoptosis in lung tissue. Importantly, the effects of TAPI-0 on bleomycin-induced inflammation and apoptosis were reversed by coadministration of specific Mer-neutralizing antibodies. These findings suggest that restored membrane-bound Mer expression by TAPI-0 treatment may help resolve lung inflammation and apoptosis after bleomycin treatment. -- Highlights: ►Mer expression is restored by TAPI-0 treatment in bleomycin-stimulated lung. ►Mer signaling is enhanced by TAPI-0 treatment in bleomycin-stimulated lung. ►TAPI-0 enhances efferocytosis and promotes resolution of lung injury.« less

Integration of sparse electrophysiological measurements with preoperative MRI using 3D surface estimation in deep brain stimulation surgery

NASA Astrophysics Data System (ADS)

Husch, Andreas; Gemmar, Peter; Thunberg, Johan; Hertel, Frank

2017-03-01

Intraoperative microelectrode recordings (MER) have been used for several decades to guide neurosurgeons during the implantation of Deep Brain Stimulation (DBS) electrodes, especially when targeting the subthalamic nucleus (STN) to suppress the symptoms of Parkinson's Disease. The standard approach is to use an array of up to five MER electrodes in a fixed configuration. Interpretation of the recorded signals yields a spatially very sparse set of information about the morphology of the respective brain structures in the targeted area. However, no aid is currently available for surgeons to intraoperatively integrate this information with other data available on the patient's individual morphology (e.g. MR imaging data used for surgical planning). This integration might allow surgeons to better determine the most probable position of the electrodes within the target structure during surgery. This paper suggests a method for reconstructing a surface patch from the sparse MER dataset utilizing additional a priori knowledge about the geometrical configuration of the measurement electrodes. The conventional representation of MER measurements as intervals of target region/non-target region is therefore transformed into an equivalent boundary set representation, allowing ecient point-based calculations. Subsequently, the problem is to integrate the resulting patch with a preoperative model of the target structure, which can be formulated as registration problem minimizing a distance measure between the two surfaces. When restricting this registration procedure to translations, which is reasonable given certain geometric considerations, the problem can be solved globally by employing an exhaustive search with arbitrary precision in polynomial time. The proposed method is demonstrated using bilateral STN/Substantia Nigra segmentation data from preoperative MRIs of 17 Patients with simulated MER electrode placement. When using simulated data of heavily perturbed electrodes and subsequent MER measurements, our optimization resulted in an improvement of the electrode position within 1 mm of the ground truth in 80.29% of the cases.

A Novel Role of MerC in Methylmercury Transport and Phytoremediation of Methylmercury Contamination.

PubMed

Sone, Yuka; Uraguchi, Shimpei; Takanezawa, Yasukazu; Nakamura, Ryosuke; Pan-Hou, Hidemitsu; Kiyono, Masako

2017-01-01

MerC, encoded by merC in the transposon Tn21 mer operon, is a heavy metal transporter with potential applications for phytoremediation of heavy metals such as mercuric ion and cadmium. In this study, we demonstrate that MerC also acts as a transporter for methylmercury. When MerC was expressed in Escherichia coli XL1-Blue, cells became hypersensitive to CH 3 Hg(I) and the uptake of CH 3 Hg(I) by these cells was higher than that by cells of the isogenic strain. Moreover, transgenic Arabidopsis plants expressing bacterial MerC or MerC fused to plant soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) accumulated CH 3 Hg(I) effectively and their growth was comparable to the wild-type plants. These results demonstrate that when the bacterium-derived merC gene is ectopically introduced in genetically modified plants, MerC expression in the transgenic plants promotes the transport and sequestration of methylmercury. Thus, our results show that the expression of merC in Arabidopsis results in transgenic plants that could be used for the phytoremediation and elimination of toxic methylmercury from the environment.

The Mercury Resistance Operon: From an Origin in a Geothermal Environment to an Efficient Detoxification Machine

PubMed Central

Boyd, Eric S.; Barkay, Tamar

2012-01-01

Mercuric mercury (Hg[II]) is a highly toxic and mobile element that is likely to have had a pronounced and adverse effect on biology since Earth’s oxygenation ∼2.4 billion years ago due to its high affinity for protein sulfhydryl groups, which upon binding destabilize protein structure and decrease enzyme activity, resulting in a decreased organismal fitness. The central enzyme in the microbial mercury detoxification system is the mercuric reductase (MerA) protein, which catalyzes the reduction of Hg(II) to volatile Hg(0). In addition to MerA, mer operons encode for proteins involved in regulation, Hg binding, and organomercury degradation. Mer-mediated approaches have had broad applications in the bioremediation of mercury-contaminated environments and industrial waste streams. Here, we examine the composition of 272 individual mer operons and quantitatively map the distribution of mer-encoded functions on both taxonomic SSU rRNA gene and MerA phylogenies. The results indicate an origin and early evolution of MerA among thermophilic bacteria and an overall increase in the complexity of mer operons through evolutionary time, suggesting continual gene recruitment and evolution leading to an improved efficiency and functional potential of the Mer detoxification system. Consistent with a positive relationship between the evolutionary history and topology of MerA and SSU rRNA gene phylogenies (Mantel R = 0.81, p < 0.01), the distribution of the majority of mer functions, when mapped on these phylograms, indicates an overall tendency to inherit mer-encoded functions through vertical descent. However, individual mer functions display evidence of a variable degree of vertical inheritance, with several genes exhibiting strong evidence for acquisition via lateral gene transfer and/or gene loss. Collectively, these data suggest that (i) mer has evolved from a simple system in geothermal environments to a widely distributed and more complex and efficient detoxification system, and (ii) merA is a suitable biomarker for examining the functional diversity of Hg detoxification and for predicting the composition of mer operons in natural environments. PMID:23087676

DIFF--A 7090 Fortran Program to Determine Neutron Diffusion Constants Relating to a Six-Group Calculation; DIFF--UN PROGRAMME FOR TRAN 7090 POUR DETERMINER LES CONSTANTES DE DIFFUSION NEUTRONIQUE RELATIVES A UN CALCUL A SIX GROUPES

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plelnevaux, C.

The computer program DIFF, in Fortran for the IBM 7090, for calculating the neutron diffusion coefficients and attenuation areas (L/sup 2/) necessary for multigroup diffusion calculations for reactor shielding is described. Diffusion coefficients and values of the inverse attenuation length are given for a six group calculation for several interesting shielding materials. (D.C.W.)

Organization of model helical peptides in lipid bilayers: insight into the behavior of single-span protein transmembrane domains.

PubMed Central

Sharpe, Simon; Barber, Kathryn R; Grant, Chris W M; Goodyear, David; Morrow, Michael R

2002-01-01

Selectively deuterated transmembrane peptides comprising alternating leucine-alanine subunits were examined in fluid bilayer membranes by solid-state nuclear magnetic resonance (NMR) spectroscopy in an effort to gain insight into the behavior of membrane proteins. Two groups of peptides were studied: 21-mers having a 17-amino-acid hydrophobic domain calculated to be close in length to the hydrophobic thickness of 1-palmitoyl-2-oleoyl phosphatidylcholine and 26-mers having a 22-amino-acid hydrophobic domain calculated to exceed the membrane hydrophobic thickness. (2)H NMR spectral features similar to ones observed for transmembrane peptides from single-span receptors of higher animal cells were identified which apparently correspond to effectively monomeric peptide. Spectral observations suggested significant distortion of the transmembrane alpha-helix, and/or potential for restriction of rotation about the tilted helix long axis for even simple peptides. Quadrupole splittings arising from the 26-mer were consistent with greater peptide "tilt" than were those of the analogous 21-mer. Quadrupole splittings associated with monomeric peptide were relatively insensitive to concentration and temperature over the range studied, indicating stable average conformations, and a well-ordered rotation axis. At high peptide concentration (6 mol% relative to phospholipid) it appeared that the peptide predicted to be longer than the membrane thickness had a particular tendency toward reversible peptide-peptide interactions occurring on a timescale comparable with or faster than approximately 10(-5) s. This interaction may be direct or lipid-mediated and was manifest as line broadening. Peptide rotational diffusion rates within the membrane, calculated from quadrupolar relaxation times, T(2e), were consistent with such interactions. In the case of the peptide predicted to be equal to the membrane thickness, at low peptide concentration spectral lineshape indicated the additional presence of a population of peptide having rotational motion that was restricted on a timescale of 10(-5) s. PMID:12080125

Novel dermaseptin, adenoregulin and caerin homologs from the Central American red-eyed leaf frog, Agalychnis callidryas, revealed by functional peptidomics of defensive skin secretion.

PubMed

Wang, Lei; Zhou, Mei; McClelland, Ann; Reilly, Aislinn; Chen, Tianbao; Gagliardo, Ron; Walker, Brian; Shaw, Chris

2008-10-01

By integrating systematic peptidome and transcriptome studies of the defensive skin secretion of the Central American red-eyed leaf frog, Agalychnis callidryas, we have identified novel members of three previously described antimicrobial peptide families, a 27-mer dermaseptin-related peptide (designated DRP-AC4), a 33-mer adenoregulin-related peptide (designated ARP-AC1) and most unusually, a 27-mer caerin-related peptide (designated CRP-AC1). While dermaseptin and adenoregulin were originally isolated from phyllomedusine leaf frogs, the caerins, until now, had only been described in Australian frogs of the genus, Litoria. Both the dermaseptin and adenoregulin were C-terminally amidated and lacked the C-terminal tripeptide of the biosynthetic precursor sequence. In contrast, the caerin-related peptide, unlike the majority of Litoria analogs, was not C-terminally amidated. The present data emphasize the need for structural characterization of mature peptides to ensure that unexpected precursor cleavages and/or post-translational modifications do not produce mature peptides that differ in structure to those predicted from cloned biosynthetic precursor cDNA. Additionally, systematic study of the secretory peptidome can produce unexpected results such as the CRP described here that may have phylogenetic implications. It is thus of the utmost importance in the functional evaluation of novel peptides that the primary structure of the mature peptide is unequivocally established -- something that is often facilitated by cloning biosynthetic precursor cDNAs but obviously not reliable using such data alone.

Effective inhibition of MERS-CoV infection by resveratrol.

PubMed

Lin, Shih-Chao; Ho, Chi-Tang; Chuo, Wen-Ho; Li, Shiming; Wang, Tony T; Lin, Chi-Chen

2017-02-13

Middle East Respiratory Syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that causes severe morbidity and mortality. Up to date, there is no approved or licensed vaccine or antiviral medicines can be used to treat MERS-CoV-infected patients. Here, we analyzed the antiviral activities of resveratrol, a natural compound found in grape seeds and skin and in red wine, against MERS-CoV infection. We performed MTT and neutral red uptake assays to assess the survival rates of MERS-infected Vero E6 cells. In addition, quantitative PCR, western blotting, and immunofluorescent assays determined the intracellular viral RNA and protein expression. For viral productivity, we utilized plaque assays to confirm the antiviral properties of resveratrol against MERS-CoV. Resveratrol significantly inhibited MERS-CoV infection and prolonged cellular survival after virus infection. We also found that the expression of nucleocapsid (N) protein essential for MERS-CoV replication was decreased after resveratrol treatment. Furthermore, resveratrol down-regulated the apoptosis induced by MERS-CoV in vitro. By consecutive administration of resveratrol, we were able to reduce the concentration of resveratrol while achieving inhibitory effectiveness against MERS-CoV. In this study, we first demonstrated that resveratrol is a potent anti-MERS agent in vitro. We perceive that resveratrol can be a potential antiviral agent against MERS-CoV infection in the near future.

Critical decay exponent of the pair contact process with diffusion

NASA Astrophysics Data System (ADS)

Park, Su-Chan

2014-11-01

We investigate the one-dimensional pair contact process with diffusion (PCPD) by extensive Monte Carlo simulations, mainly focusing on the critical density decay exponent δ . To obtain an accurate estimate of δ , we first find the strength of corrections to scaling using the recently introduced method [S.-C. Park. J. Korean Phys. Soc. 62, 469 (2013), 10.3938/jkps.62.469]. For small diffusion rate (d ≤0.5 ), the leading corrections-to-scaling term is found to be ˜t-0.15, whereas for large diffusion rate (d =0.95 ) it is found to be ˜t-0.5. After finding the strength of corrections to scaling, effective exponents are systematically analyzed to conclude that the value of critical decay exponent δ is 0.173 (3 ) irrespective of d . This value should be compared with the critical decay exponent of the directed percolation, 0.1595. In addition, we study two types of crossover. At d =0 , the phase boundary is discontinuous and the crossover from the pair contact process to the PCPD is found to be described by the crossover exponent ϕ =2.6 (1 ) . We claim that the discontinuity of the phase boundary cannot be consistent with the theoretical argument supporting the hypothesis that the PCPD should belong to the DP. At d =1 , the crossover from the mean field PCPD to the PCPD is described by ϕ =2 which is argued to be exact.

Communication: On the diffusion tensor in macroscopic theory of cavitation

NASA Astrophysics Data System (ADS)

Shneidman, Vitaly A.

2017-08-01

The classical description of nucleation of cavities in a stretched fluid relies on a one-dimensional Fokker-Planck equation (FPE) in the space of their sizes r, with the diffusion coefficient D(r) constructed for all r from macroscopic hydrodynamics and thermodynamics, as shown by Zeldovich. When additional variables (e.g., vapor pressure) are required to describe the state of a bubble, a similar approach to construct a diffusion tensor D ^ generally works only in the direct vicinity of the thermodynamic saddle point corresponding to the critical nucleus. It is shown, nevertheless, that "proper" kinetic variables to describe a cavity can be selected, allowing to introduce D ^ in the entire domain of parameters. In this way, for the first time, complete FPE's are constructed for viscous volatile and inertial fluids. In the former case, the FPE with symmetric D ^ is solved numerically. Alternatively, in the case of an inertial fluid, an equivalent Langevin equation is considered; results are compared with analytics. The suggested approach is quite general and can be applied beyond the cavitation problem.

Simple Preparation and NMR Analysis of mer and fac Isomers of Tris(1,1,1-trifluoro-2,4-pentanedionato)cobalt(III). An Experiment for the Inorganic Chemistry Laboratory

NASA Astrophysics Data System (ADS)

Jensen, Ashley W.; O'Brien, Brian A.

2001-07-01

A one-step procedure for the preparation of tris(1,1,1-trifluoro-2,4-pentanedionato)cobalt(III) from hydrated cobalt(II) carbonate and 10% hydrogen peroxide, in which tert-butyl alcohol is used as a component of the solvent, is described. The procedure is short, simple, and less hazardous than procedures reported in the literature, and the starting materials are readily available and inexpensive. The product is a mixture of mer and fac isomers that can be separated by silica gel chromatography with toluene as the eluent. Thin-layer chromatography is used to obtain a collective class sample of each isomer for 1H, 13C, and 19F NMR analysis. The NMR analyses clearly illustrate the threefold rotational symmetry of the fac isomer and the lack of symmetry of the mer isomer. Detailed NMR data are provided for each isomer.

High-Resolution Topomapping of Mars: Life After MER Site Selection

NASA Technical Reports Server (NTRS)

Kirk, R. L.; Howington-Kraus, E.; Hare, T. M.; Soricone, R.; Ross, K.; Weller, L.; Rosiek, M.; Redding, B.; Galuszka, D.; Haldemann, A. F. C.

2004-01-01

In this abstract we describe our ongoing use of high-resolution images from the Mars Global Surveyor Mars Orbiter Camera Narrow-Angle subsystem (MGS MOC-NA) to derive quantitative topographic and slope data for the martian surface at 3 - 10-m resolution. Our efforts over the past several years focused on assessment of candidate landing sites for the Mars Exploration Rovers (MER) and culminated in the selection of sites in Gusev crater and Meridiani Planum as safe as well as scientifically compelling. As of this writing, MER-A (Spirit) has landed safely in Gusev and we are performing a limited amount of additional mapping near the landing point to support localization of the lander and rover operations planning. The primary focus of our work, however, has been extending our techniques to sample a variety of geologic terrains planetwide to support both a variety of geoscientific studies and planning and data analysis for missions such as Mars Express, Mars Reconnaissance Orbiter, and Phoenix.

Anomalous dimensionality dependence of diffusion in a rugged energy landscape: How pathological is one dimension?

NASA Astrophysics Data System (ADS)

Seki, Kazuhiko; Bagchi, Kaushik; Bagchi, Biman

2016-05-01

Diffusion in one dimensional rugged energy landscape (REL) is predicted to be pathologically different (from any higher dimension) with a much larger chance of encountering broken ergodicity [D. L. Stein and C. M. Newman, AIP Conf. Proc. 1479, 620 (2012)]. However, no quantitative study of this difference has been reported, despite the prevalence of multidimensional physical models in the literature (like a high dimensional funnel guiding protein folding/unfolding). Paradoxically, some theoretical studies of these phenomena still employ a one dimensional diffusion description for analytical tractability. We explore the dimensionality dependent diffusion on REL by carrying out an effective medium approximation based analytical calculations and compare them with the available computer simulation results. We find that at an intermediate level of ruggedness (assumed to have a Gaussian distribution), where diffusion is well-defined, the value of the effective diffusion coefficient depends on dimensionality and changes (increases) by several factors (˜5-10) in going from 1d to 2d. In contrast, the changes in subsequent transitions (like 2d to 3d and 3d to 4d and so on) are far more modest, of the order of 10-20% only. When ruggedness is given by random traps with an exponential distribution of barrier heights, the mean square displacement (MSD) is sub-diffusive (a well-known result), but the growth of MSD is described by different exponents in one and higher dimensions. The reason for such strong ruggedness induced retardation in the case of one dimensional REL is discussed. We also discuss the special limiting case of infinite dimension (d = ∞) where the effective medium approximation becomes exact and where theoretical results become simple. We discuss, for the first time, the role of spatial correlation in the landscape on diffusion of a random walker.

Anomalous dimensionality dependence of diffusion in a rugged energy landscape: How pathological is one dimension?

PubMed

Seki, Kazuhiko; Bagchi, Kaushik; Bagchi, Biman

2016-05-21

Diffusion in one dimensional rugged energy landscape (REL) is predicted to be pathologically different (from any higher dimension) with a much larger chance of encountering broken ergodicity [D. L. Stein and C. M. Newman, AIP Conf. Proc. 1479, 620 (2012)]. However, no quantitative study of this difference has been reported, despite the prevalence of multidimensional physical models in the literature (like a high dimensional funnel guiding protein folding/unfolding). Paradoxically, some theoretical studies of these phenomena still employ a one dimensional diffusion description for analytical tractability. We explore the dimensionality dependent diffusion on REL by carrying out an effective medium approximation based analytical calculations and compare them with the available computer simulation results. We find that at an intermediate level of ruggedness (assumed to have a Gaussian distribution), where diffusion is well-defined, the value of the effective diffusion coefficient depends on dimensionality and changes (increases) by several factors (∼5-10) in going from 1d to 2d. In contrast, the changes in subsequent transitions (like 2d to 3d and 3d to 4d and so on) are far more modest, of the order of 10-20% only. When ruggedness is given by random traps with an exponential distribution of barrier heights, the mean square displacement (MSD) is sub-diffusive (a well-known result), but the growth of MSD is described by different exponents in one and higher dimensions. The reason for such strong ruggedness induced retardation in the case of one dimensional REL is discussed. We also discuss the special limiting case of infinite dimension (d = ∞) where the effective medium approximation becomes exact and where theoretical results become simple. We discuss, for the first time, the role of spatial correlation in the landscape on diffusion of a random walker.

One-Health: a Safe, Efficient, Dual-Use Vaccine for Humans and Animals against Middle East Respiratory Syndrome Coronavirus and Rabies Virus.

PubMed

Wirblich, Christoph; Coleman, Christopher M; Kurup, Drishya; Abraham, Tara S; Bernbaum, John G; Jahrling, Peter B; Hensley, Lisa E; Johnson, Reed F; Frieman, Matthew B; Schnell, Matthias J

2017-01-15

Middle East respiratory syndrome coronavirus (MERS-CoV) emerged in 2012 and is a highly pathogenic respiratory virus. There are no treatment options against MERS-CoV for humans or animals, and there are no large-scale clinical trials for therapies against MERS-CoV. To address this need, we developed an inactivated rabies virus (RABV) that contains the MERS-CoV spike (S) protein expressed on its surface. Our initial recombinant vaccine, BNSP333-S, expresses a full-length wild-type MERS-CoV S protein; however, it showed significantly reduced viral titers compared to those of the parental RABV strain and only low-level incorporation of full-length MERS-CoV S into RABV particles. Therefore, we developed a RABV-MERS vector that contained the MERS-CoV S1 domain of the MERS-CoV S protein fused to the RABV G protein C terminus (BNSP333-S1). BNSP333-S1 grew to titers similar to those of the parental vaccine vector BNSP333, and the RABV G-MERS-CoV S1 fusion protein was efficiently expressed and incorporated into RABV particles. When we vaccinated mice, chemically inactivated BNSP333-S1 induced high-titer neutralizing antibodies. Next, we challenged both vaccinated mice and control mice with MERS-CoV after adenovirus transduction of the human dipeptidyl peptidase 4 (hDPP4) receptor and then analyzed the ability of mice to control MERS-CoV infection. Our results demonstrated that vaccinated mice were fully protected from the MERS-CoV challenge, as indicated by the significantly lower MERS-CoV titers and MERS-CoV and mRNA levels in challenged mice than those in unvaccinated controls. These data establish that an inactivated RABV-MERS S-based vaccine may be effective for use in animals and humans in areas where MERS-CoV is endemic. Rabies virus-based vectors have been proven to be efficient dual vaccines against rabies and emergent infectious diseases such as Ebola virus. Here we show that inactivated rabies virus particles containing the MERS-CoV S1 protein induce potent immune responses against MERS-CoV and RABV. This novel vaccine is easy to produce and may be useful to protect target animals, such as camels, as well as humans from deadly MERS-CoV and RABV infections. Our results indicate that this vaccine approach can prevent disease, and the RABV-based vaccine platform may be a valuable tool for timely vaccine development against emerging infectious diseases. Copyright © 2017 American Society for Microbiology.

Medical emergency response in a sub-acute hospital: improving the model of care for deteriorating patients.

PubMed

Visser, Philip; Dwyer, Alison; Moran, Juli; Britton, Mary; Heland, Melodie; Ciavarella, Filomena; Schutte, Sandy; Jones, Daryl

2014-05-01

To assess the frequency, characteristics and outcomes of medical emergency response (MER) calls in a sub-acute hospital setting. The present study was a retrospective observational study in a sub-acute hospital providing aged care, palliative care, rehabilitation, veteran's mental health and elective surgical services. We assessed annual MER call numbers between 2005 and 2011 in the context of contemporaneous changes to hospital services. We also assessed MER calls over a 12-month period in detail using standardised case report forms and the scanned medical record. There were 2285 multiday admissions in the study period where 141 MER calls were triggered in 132 patients (61.7 calls per 1000 admissions). The median patient age was 83.0 years, and 55.3% of patients were men. Most calls occurred on weekdays and during the daytime, and were triggered by altered conscious state, low oxygen saturations and hypotension. Documentation of escalation of care before the MER call was not present in 99 of 141 (70.2%) calls. Following the call, in 70 of 141 (49.6%) cases, the patient was transferred to the acute campus, where 52 (74.2%) and 14 (20%) patients required ward and intensive care level treatment, respectively. Thirty-seven of 132 (28%) patients died. A palliative care physician adjudicated that most of these patients who died (24/37; 64.9%) were appropriate for a call, but that 19 (51.4%) should have received palliation at the time of the call. Compared with survivors, patients who died after the MER call were more likely originally admitted from supported accommodation. MER calls in our sub-acute hospital occurred in elderly patients and are associated with an in-hospital mortality of 28%. A small proportion of patients required intensive care level treatment. There is a need to improve processes involving escalation of care before MER call activation and to revise advance care directives. What is known about this topic? Rapid response team (RRT) activation has been well described in the acute hospital setting. Although the impact on survival benefit to patients remains controversial, it has been widely adopted as a model of care to respond to deteriorating ward patients. This is particularly relevant in Australia at present with the implementation of the new National Safety and Quality Health Service Standards. What does this paper add? There have not been any previous papers published on rapid response systems in a sub-acute hospital. This paper describes some of the changes and challenges associated with increasing RRT activations in a sub-acute health care facility. What are the implications for practitioners? For clinicians in a sub-acute setting, the study reinforces the importance of pre-emptively documenting and communicating advance care directives. In addition, it is important to identify patients with reversible pathology likely to benefit from transfer and acute care, and to avoid the transfer of those who will not and, instead, provide appropriate palliation. For practitioners involved in models of care for deteriorating patients, the study provides information on where problems occurred in our system and the strategies used to address these issues.

Metal tolerance in emerging clinically relevant multidrug-resistant Salmonella enterica serotype 4,[5],12:i:- clones circulating in Europe.

PubMed

Mourão, Joana; Novais, Carla; Machado, Jorge; Peixe, Luísa; Antunes, Patrícia

2015-06-01

The occurrence of acquired metal tolerance genes in emerging MDR Salmonella enterica serotype 4,[5],12:i:- clones was assessed and their associated platforms and tolerance phenotype were characterised. Salmonella 4,[5],12:i:- from different sources belonging to European, Spanish and Southern European clones were studied. Screening for copper (pcoA-pcoD/tcrB), silver/copper (silA-silE), mercury (merA), arsenic (arsB) and tellurite (terF) tolerance genes was performed by PCR/sequencing. CuSO(4)/AgNO(3) MICs were determined in aerobic/anaerobic atmospheres by agar dilution. Conjugation assays, genomic location and plasmid analysis were performed by standard procedures. Most isolates from European (98%) and Spanish (74%) clones carried silA-silE, contrasting with the Southern European clone (26%). merA/62% (European and Spanish clones) and pcoA-pcoD/50% (European clone) were also detected. merA±pco+sil were chromosomally located in the European clone, whereas in Spanish and Southern European clones sil±merA were within plasmids, both with antibiotic resistance genes. The pcoA-pcoD/silA-silE(+) isolates showed higher MICCuSO(4) in anaerobiosis than those without these genes (MIC(50)=24-28 vs. 2 mM). Different MICAgNO(3) of silA-silE(+) (MIC(50)=0.25 mM) and silA-silE(-)(MIC(50)=0.16 mM) isolates were observed in both atmospheres, with an MIC increment after prior exposure to silver (>3 vs. 0.08-0.125 mM) in aerobiosis. A high frequency of copper and silver tolerance, particularly among the two major Salmonella 4,[5],12:i:- MDR clones (European/Spanish) circulating in Europe and causing human infections, might facilitate adaptation/expansion of these strains in metal-contaminated environments, particularly copper in anaerobiosis. Furthermore, metal toxic concentrations in food-animal environments can contribute to persistence of genetic platforms carrying metal/antibiotic resistance genes in this foodborne zoonotic pathogen. Copyright © 2015 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

Clinical heterogeneity of diffuse large B cell lymphoma following failure of front-line immunochemotherapy.

PubMed

Farooq, Umar; Maurer, Matthew J; Thompson, Carrie A; Thanarajasingam, Gita; Inwards, David J; Micallef, Ivana; Macon, William; Syrbu, Sergei; Lin, Tasha; Lin, Yi; Ansell, Stephen M; Nowakowski, Grzegorz S; Habermann, Thomas M; Cerhan, James R; Link, Brian K

2017-10-01

This study aimed to describe the patterns of care and outcomes of diffuse large B cell lymphoma (DLBCL) after failure of front line anthracycline-based immunochemotherapy (IC). Patients with newly diagnosed lymphoma were prospectively enrolled in Molecular Epidemiology Resource (MER) of the University of Iowa/Mayo Clinic Lymphoma Specialized Program of Research Excellzence. All DLBCL and primary mediastinal B-cell lymphoma (PMBL) patients treated with front-line anthracycline-based IC were followed for relapse. Patients with relapse on follow-up and subsequently retreated were included in this analysis. 1039 patients received anthracycline-based IC between 2002 and 2012, of which 244 relapsed and were subsequently retreated. Across all therapies, overall survival at 4 years (OS4) from relapse was 28% and 103 patients ultimately underwent autologous haematopoietic cell transplant (autoHCT) with OS4 from autoHCT of 51%. Patients relapsing after 12 months from initial diagnosis had OS4 of 47% but those with a transient or no response to initial therapy had OS4 of only 13%. Outcomes of relapsed or refractory DLBCL differ substantially when categorized by response to initial therapy, timing of relapse and opportunity to undergo autoHCT. The design and interpretation of uncontrolled trials should account for this heterogeneity in patients with relapsed DLBCL. © 2017 John Wiley & Sons Ltd.

Instructional Developer as Content Specialist: Three Case Studies Utilizing the Instructional Development-Operations Research Model.

ERIC Educational Resources Information Center

Faust, Stephen M.

1980-01-01

Presents a 3-phase model (content research, specification, delivery) for instructional development-operations research and describes its application in developing courses in zoology, geology, and paleontology. (MER)

Is there evidence for more than two diffusion components in abdominal organs? - A magnetic resonance imaging study in healthy volunteers.

PubMed

Wurnig, Moritz C; Germann, Manon; Boss, Andreas

2018-01-01

The most commonly applied model for the description of diffusion-weighted imaging (DWI) data in perfused organs is bicompartmental intravoxel incoherent motion (IVIM) analysis. In this study, we assessed the ground truth of underlying diffusion components in healthy abdominal organs using an extensive DWI protocol and subsequent computation of apparent diffusion coefficient 'spectra', similar to the computation of previously described T 2 relaxation spectra. Diffusion datasets of eight healthy subjects were acquired in a 3-T magnetic resonance scanner using 68 different b values during free breathing (equidistantly placed in the range 0-1005 s/mm 2 ). Signal intensity curves as a function of the b value were analyzed in liver, spleen and kidneys using non-negative least-squares fitting to a distribution of decaying exponential functions with minimum amplitude energy regularization. In all assessed organs, the typical slow- and fast-diffusing components of the IVIM model were detected [liver: true diffusion D = (1.26 ± 0.01) × 10 -3 mm 2 /s, pseudodiffusion D* = (270 ± 44) × 10 -3 mm 2 /s; kidney cortex: D = (2.26 ± 0.07) × 10 -3 mm 2 /s, D* = (264 ± 78) × 10 -3 mm 2 /s; kidney medulla: D = (1.57 ± 0.28) × 10 -3 mm 2 /s, D* = (168 ± 18) × 10 -3 mm 2 /s; spleen: D = (0.91 ± 0.01) × 10 -3 mm 2 /s, D* = (69.8 ± 0.50) × 10 -3 mm 2 /s]. However, in the liver and kidney, a third component between D and D* was found [liver: D' = (43.8 ± 5.9) × 10 -3 mm 2 /s; kidney cortex: D' = (23.8 ± 11.5) × 10 -3 mm 2 /s; kidney medulla: D' = (5.23 ± 0.93) × 10 -3 mm 2 /s], whereas no third component was detected in the spleen. Fitting with a diffusion kurtosis model did not lead to a better fit of the resulting curves to the acquired data compared with apparent diffusion coefficient spectrum analysis. For a most accurate description of diffusion properties in the liver and the kidneys, a more sophisticated model seems to be required including three diffusion components. Copyright © 2017 John Wiley & Sons, Ltd.

Analysis of mercuric reductase (merA) gene diversity in an anaerobic mercury-contaminated sediment enrichment.

PubMed

Ní Chadhain, Sinéad M; Schaefer, Jeffra K; Crane, Sharron; Zylstra, Gerben J; Barkay, Tamar

2006-10-01

The reduction of ionic mercury to elemental mercury by the mercuric reductase (MerA) enzyme plays an important role in the biogeochemical cycling of mercury in contaminated environments by partitioning mercury to the atmosphere. This activity, common in aerobic environments, has rarely been examined in anoxic sediments where production of highly toxic methylmercury occurs. Novel degenerate PCR primers were developed which span the known diversity of merA genes in Gram-negative bacteria and amplify a 285 bp fragment at the 3' end of merA. These primers were used to create a clone library and to analyse merA diversity in an anaerobic sediment enrichment collected from a mercury-contaminated site in the Meadowlands, New Jersey. A total of 174 sequences were analysed, representing 71 merA phylotypes and four novel MerA clades. This first examination of merA diversity in anoxic environments suggests an untapped resource for novel merA sequences.

Ceramidastin, a novel bacterial ceramidase inhibitor, produced by Penicillium sp. Mer-f17067.

PubMed

Inoue, Hiroyuki; Someno, Tetsuya; Kato, Taira; Kumagai, Hiroyuki; Kawada, Manabu; Ikeda, Daishiro

2009-02-01

Decrease of ceramide in the skin is one of the aggravating factors of atopic dermatitis. The skin is often infected by ceramidase-producing bacteria, such as Pseudomonas aeruginosa. The bacterial ceramidase then degrades ceramide in the skin. To develop anti-atopic dermatitis drugs, we searched for ceramidase inhibitors, which led to the discovery of ceramidastin, a novel inhibitor of bacterial ceramidase, from the culture broth of Penicillium sp. Mer-f17067. Ceramidastin inhibited the bacterial ceramidase with an IC(50) value of 6.25 microg ml(-1). Here we describe the isolation, physicochemical properties, structure determination and biological activity of ceramidastin.

High reproduction number of Middle East respiratory syndrome coronavirus in nosocomial outbreaks: mathematical modelling in Saudi Arabia and South Korea.

PubMed

Choi, S; Jung, E; Choi, B Y; Hur, Y J; Ki, M

2018-06-01

Effective countermeasures against emerging infectious diseases require an understanding of transmission rate and basic reproduction number (R 0 ). R 0 for severe acute respiratory syndrome is generally considered to be >1, whereas that for Middle East respiratory syndrome (MERS) is considered to be <1. However, this does not explain the large-scale outbreaks of MERS that occurred in Kingdom of Saudi Arabia (KSA) and South Korean hospitals. To estimate R 0 in nosocomial outbreaks of MERS. R 0 was estimated using the incidence decay with an exponential adjustment model. The KSA and Korean outbreaks were compared using a line listing of MERS cases compiled using publicly available sources. Serial intervals to estimate R 0 were assumed to be six to eight days. Study parameters [R 0 and countermeasures (d)] were estimated by fitting a model to the cumulative incidence epidemic curves using Matlab. The estimated R 0 in Korea was 3.9 in the best-fit model, with a serial interval of six days. The first outbreak cluster in a hospital in Pyeongtaek had an R 0 of 4.04, and the largest outbreak cluster in a hospital in Samsung had an R 0 of 5.0. Assuming a six-day serial interval, the KSA outbreaks in Jeddah and Riyadh had R 0 values of 3.9 and 1.9, respectively. R 0 for the nosocomial MERS outbreaks in KSA and South Korea was estimated to be in the range of 2-5, which is significantly higher than the previous estimate of <1. Therefore, more comprehensive countermeasures are needed to address these infections. Copyright © 2017 The Healthcare Infection Society. Published by Elsevier Ltd. All rights reserved.

Potential Population-Level Nutritional Impact of Replacing Whole and Reduced-Fat Milk With Low-Fat and Skim Milk Among US Children Aged 2–19 Years

PubMed Central

Rehm, Colin D.; Drewnowski, Adam; Monsivais, Pablo

2015-01-01

Objective Dietary guidance emphasizes plain low-fat and skim milk over whole, reduced-fat, and flavored milk (milk eligible for replacement [MER]). The objective of this study was to evaluate the population-level impact of such a change on energy, macronutrient and nutrient intakes, and diet cost. Design Cross-sectional modeling study. Setting Data from the 2001–2002 and 2003–2004 National Health and Nutrition Examination Survey. Participants A total of 8,112 children aged 2–19 years. Main Outcome Measures Energy, macronutrient, and micronutrient intake before and after replacement of MER with low-fat or skim milk. Analysis Survey-weighted linear regression models. Results Milk eligible for replacement accounted for 46% of dairy servings. Among MER consumers, replacement with skim or low-fat milk would lead to a projected reduction in energy of 113 (95% confidence interval [CI], 107–119) and 77 (95% CI, 73–82) kcal/d and percent energy from saturated fat by an absolute value of 2.5% of total energy (95% CI, 2.4–2.6) and 1.4% (95% CI, 1.3–1.5), respectively. Replacement of MER does not change diet costs or calcium and potassium intake. Conclusions Substitution of MER has the potential to reduce energy and total and saturated fat intake with no impact on diet costs or micronutrient density. The feasibility of such replacement has not been examined and there may be negative consequences if replacement is done with non-nutrient–rich beverages. PMID:25528079

Discovery of Novel Bat Coronaviruses in South China That Use the Same Receptor as Middle East Respiratory Syndrome Coronavirus.

PubMed

Luo, Chu-Ming; Wang, Ning; Yang, Xing-Lou; Liu, Hai-Zhou; Zhang, Wei; Li, Bei; Hu, Ben; Peng, Cheng; Geng, Qi-Bin; Zhu, Guang-Jian; Li, Fang; Shi, Zheng-Li

2018-07-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has represented a human health threat since 2012. Although several MERS-related CoVs that belong to the same species as MERS-CoV have been identified from bats, they do not use the MERS-CoV receptor, dipeptidyl peptidase 4 (DPP4). Here, we screened 1,059 bat samples from at least 30 bat species collected in different regions in south China and identified 89 strains of lineage C betacoronaviruses, including Tylonycteris pachypus coronavirus HKU4 , Pipistrellus pipistrellus coronavirus HKU5 , and MERS-related CoVs. We sequenced the full-length genomes of two positive samples collected from the great evening bat, Ia io , from Guangdong Province. The two genomes were highly similar and exhibited genomic structures identical to those of other lineage C betacoronaviruses. While they exhibited genome-wide nucleotide identities of only 75.3 to 81.2% with other MERS-related CoVs, their gene-coding regions were highly similar to their counterparts, except in the case of the spike proteins. Further protein-protein interaction assays demonstrated that the spike proteins of these MERS-related CoVs bind to the receptor DPP4. Recombination analysis suggested that the newly discovered MERS-related CoVs have acquired their spike genes from a DPP4-recognizing bat coronavirus HKU4. Our study provides further evidence that bats represent the evolutionary origins of MERS-CoV. IMPORTANCE Previous studies suggested that MERS-CoV originated in bats. However, its evolutionary path from bats to humans remains unclear. In this study, we discovered 89 novel lineage C betacoronaviruses in eight bat species. We provide evidence of a MERS-related CoV derived from the great evening bat that uses the same host receptor as human MERS-CoV. This virus also provides evidence for a natural recombination event between the bat MERS-related CoV and another bat coronavirus, HKU4. Our study expands the host ranges of MERS-related CoV and represents an important step toward establishing bats as the natural reservoir of MERS-CoV. These findings may lead to improved epidemiological surveillance of MERS-CoV and the prevention and control of the spread of MERS-CoV to humans. Copyright © 2018 American Society for Microbiology.

Comparative Genomic Analysis MERS CoV Isolated from Humans and Camels with Special Reference to Virus Encoded Helicase.

PubMed

Alnazawi, Mohamed; Altaher, Abdallah; Kandeel, Mahmoud

2017-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) is a new emerging viral disease characterized by high fatality rate. Understanding MERS CoV genetic aspects and codon usage pattern is important to understand MERS CoV survival, adaptation, evolution, resistance to innate immunity, and help in finding the unique aspects of the virus for future drug discovery experiments. In this work, we provide comprehensive analysis of 238 MERS CoV full genomes comprised of human (hMERS) and camel (cMERS) isolates of the virus. MERS CoV genome shaping seems to be under compositional and mutational bias, as revealed by preference of A/T over G/C nucleotides, preferred codons, nucleotides at the third position of codons (NT3s), relative synonymous codon usage, hydropathicity (Gravy), and aromaticity (Aromo) indices. Effective number of codons (ENc) analysis reveals a general slight codon usage bias. Codon adaptation index reveals incomplete adaptation to host environment. MERS CoV showed high ability to resist the innate immune response by showing lower CpG frequencies. Neutrality evolution analysis revealed a more significant role of mutation pressure in cMERS over hMERS. Correspondence analysis revealed that MERS CoV genomes have three genetic clusters, which were distinct in their codon usage, host, and geographic distribution. Additionally, virtual screening and binding experiments were able to identify three new virus-encoded helicase binding compounds. These compounds can be used for further optimization of inhibitors.

Unstructured Polyhedral Mesh Thermal Radiation Diffusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palmer, T.S.; Zika, M.R.; Madsen, N.K.

2000-07-27

Unstructured mesh particle transport and diffusion methods are gaining wider acceptance as mesh generation, scientific visualization and linear solvers improve. This paper describes an algorithm that is currently being used in the KULL code at Lawrence Livermore National Laboratory to solve the radiative transfer equations. The algorithm employs a point-centered diffusion discretization on arbitrary polyhedral meshes in 3D. We present the results of a few test problems to illustrate the capabilities of the radiation diffusion module.

High correlation of Middle East respiratory syndrome spread with Google search and Twitter trends in Korea.

PubMed

Shin, Soo-Yong; Seo, Dong-Woo; An, Jisun; Kwak, Haewoon; Kim, Sung-Han; Gwack, Jin; Jo, Min-Woo

2016-09-06

The Middle East respiratory syndrome coronavirus (MERS-CoV) was exported to Korea in 2015, resulting in a threat to neighboring nations. We evaluated the possibility of using a digital surveillance system based on web searches and social media data to monitor this MERS outbreak. We collected the number of daily laboratory-confirmed MERS cases and quarantined cases from May 11, 2015 to June 26, 2015 using the Korean government MERS portal. The daily trends observed via Google search and Twitter during the same time period were also ascertained using Google Trends and Topsy. Correlations among the data were then examined using Spearman correlation analysis. We found high correlations (>0.7) between Google search and Twitter results and the number of confirmed MERS cases for the previous three days using only four simple keywords: "MERS", " ("MERS (in Korean)"), " ("MERS symptoms (in Korean)"), and " ("MERS hospital (in Korean)"). Additionally, we found high correlations between the Google search and Twitter results and the number of quarantined cases using the above keywords. This study demonstrates the possibility of using a digital surveillance system to monitor the outbreak of MERS.

Increase methylmercury accumulation in Arabidopsis thaliana expressing bacterial broad-spectrum mercury transporter MerE

PubMed Central

2013-01-01

The bacterial merE gene derived from the Tn21 mer operon encodes a broad-spectrum mercury transporter that governs the transport of methylmercury and mercuric ions across bacterial cytoplasmic membranes, and this gene is a potential molecular tool for improving the efficiency of methylmercury phytoremediation. A transgenic Arabidopsis engineered to express MerE was constructed and the impact of expression of MerE on methylmercury accumulation was evaluated. The subcellular localization of transiently expressed GFP-tagged MerE was examined in Arabidopsis suspension-cultured cells. The GFP-MerE was found to localize to the plasma membrane and cytosol. The transgenic Arabidopsis expressing MerE accumulated significantly more methymercury and mercuric ions into plants than the wild-type Arabidopsis did. The transgenic plants expressing MerE was significantly more resistant to mercuric ions, but only showed more resistant to methylmercury compared with the wild type Arabidopsis. These results demonstrated that expression of the bacterial mercury transporter MerE promoted the transport and accumulation of methylmercury in transgenic Arabidopsis, which may be a useful method for improving plants to facilitate the phytoremediation of methylmercury pollution. PMID:24004544

Extensive Viable Middle East Respiratory Syndrome (MERS) Coronavirus Contamination in Air and Surrounding Environment in MERS Isolation Wards.

PubMed

Kim, Sung-Han; Chang, So Young; Sung, Minki; Park, Ji Hoon; Bin Kim, Hong; Lee, Heeyoung; Choi, Jae-Phil; Choi, Won Suk; Min, Ji-Young

2016-08-01

The largest outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) outside the Middle East occurred in South Korea in 2015 and resulted in 186 laboratory-confirmed infections, including 36 (19%) deaths. Some hospitals were considered epicenters of infection and voluntarily shut down most of their operations after nearly half of all transmissions occurred in hospital settings. However, the ways that MERS-CoV is transmitted in healthcare settings are not well defined. We explored the possible contribution of contaminated hospital air and surfaces to MERS transmission by collecting air and swabbing environmental surfaces in 2 hospitals treating MERS-CoV patients. The samples were tested by viral culture with reverse transcription polymerase chain reaction (RT-PCR) and immunofluorescence assay (IFA) using MERS-CoV Spike antibody, and electron microscopy (EM). The presence of MERS-CoV was confirmed by RT-PCR of viral cultures of 4 of 7 air samples from 2 patients' rooms, 1 patient's restroom, and 1 common corridor. In addition, MERS-CoV was detected in 15 of 68 surface swabs by viral cultures. IFA on the cultures of the air and swab samples revealed the presence of MERS-CoV. EM images also revealed intact particles of MERS-CoV in viral cultures of the air and swab samples. These data provide experimental evidence for extensive viable MERS-CoV contamination of the air and surrounding materials in MERS outbreak units. Thus, our findings call for epidemiologic investigation of the possible scenarios for contact and airborne transmission, and raise concern regarding the adequacy of current infection control procedures. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Rare k-mer DNA: Identification of sequence motifs and prediction of CpG island and promoter.

PubMed

Mohamed Hashim, Ezzeddin Kamil; Abdullah, Rosni

2015-12-21

Empirical analysis on k-mer DNA has been proven as an effective tool in finding unique patterns in DNA sequences which can lead to the discovery of potential sequence motifs. In an extensive study of empirical k-mer DNA on hundreds of organisms, the researchers found unique multi-modal k-mer spectra occur in the genomes of organisms from the tetrapod clade only which includes all mammals. The multi-modality is caused by the formation of the two lowest modes where k-mers under them are referred as the rare k-mers. The suppression of the two lowest modes (or the rare k-mers) can be attributed to the CG dinucleotide inclusions in them. Apart from that, the rare k-mers are selectively distributed in certain genomic features of CpG Island (CGI), promoter, 5' UTR, and exon. We correlated the rare k-mers with hundreds of annotated features using several bioinformatic tools, performed further intrinsic rare k-mer analyses within the correlated features, and modeled the elucidated rare k-mer clustering feature into a classifier to predict the correlated CGI and promoter features. Our correlation results show that rare k-mers are highly associated with several annotated features of CGI, promoter, 5' UTR, and open chromatin regions. Our intrinsic results show that rare k-mers have several unique topological, compositional, and clustering properties in CGI and promoter features. Finally, the performances of our RWC (rare-word clustering) method in predicting the CGI and promoter features are ranked among the top three, in eight of the CGI and promoter evaluations, among eight of the benchmarked datasets. Crown Copyright © 2015. Published by Elsevier Ltd. All rights reserved.

Long term evolution and internal architecture of high-energy banner ridges of Mer d'Iroise (Western Brittany, France) : interplay of sea-level, basement morphology, biogenic productivity and hydrodynamics

NASA Astrophysics Data System (ADS)

Le Roy, P., Sr.; Le Dantec, N.; Franzetti, M.; Delacourt, C.; Ehrhold, A.

2016-12-01

The recent completion of a coupled seismic and swath bathymetric survey, conducted across the Mer d'Iroise (Atlantic continental shelf, France), provided new data for the study of the long term evolution of deep tidal sand ridges. Three major banner sand ridges composed of biogenic sands were investigated: the Banc du Four, the Haut Fond d'Ouessant and the Banc d'Ar Men. Seismic interpretation reveals a compound internal architecture of these sand ridges with a sedimentary core forming the lower units interpreted to be shoreface deposits and overlain by sandwaves. Sandwave climbing, which combines progradation and accretion, is the major process controlling the growth of the ridges. The elevation of the preserved dune foresets reaches values of about 20 to 30 m and indicate a combination of giant dunes characterized by numerous steep (up to 20°) clinoforms corresponding to a high-energy depositional environment. All of the radiocarbon ages of the biogenic surficial deposits of the Banc du Four range from 10,036 to 2,748 cal years B.P. and suggest it has grown during the last sea-level rise. The apparent absence of recent surface deposits could be caused by a change in benthic biogenic productivity or the non-conservation of recent deposits. The multiphase accretion of the ridge is closely linked to the progressive flooding of the coastal promontories and straits that structured the igneous basement. A comparable evolutionary scheme is observed for the Haut-Fond d'Ouessant where a counter-clock wise migration of dunes characterizes the surface of the ridge. In contrast, the Banc d'Ar Men located above a regular basement displays a simpler structure with a consistent Northwestward migration of steep clinoforms. Therefore, the sand ridges of the Mer d'Iroise should be thought of as a representative example of large-scale high-energy banner banks controlled by interaction of sea-level, basement morphology, biogenic productivity, tidal and wave hydrodynamics.

Self and transport diffusivity of CO2 in the metal-organic framework MIL-47(V) explored by quasi-elastic neutron scattering experiments and molecular dynamics simulations.

PubMed

Salles, Fabrice; Jobic, Hervé; Devic, Thomas; Llewellyn, Philip L; Serre, Christian; Férey, Gérard; Maurin, Guillaume

2010-01-26

Quasi-elastic neutron scattering measurements are combined with molecular dynamics simulations to determine the self-diffusivity, corrected diffusivity, and transport diffusivity of CO(2) in the metal-organic framework MIL-47(V) (MIL = Materials Institut Lavoisier) over a wide range of loading. The force field used for describing the host/guest interactions is first validated on the thermodynamics of the MIL-47(V)/CO(2) system, prior to being transferred to the investigations of the dynamics. A decreasing profile is then deduced for D(s) and D(o) whereas D(t) presents a non monotonous evolution with a slight decrease at low loading followed by a sharp increase at higher loading. Such decrease of D(t) which has never been evidenced in any microporous systems comes from the atypical evolution of the thermodynamic correction factor that reaches values below 1 at low loading. This implies that, due to intermolecular interactions, the CO(2) molecules in MIL-47(V) do not behave like an ideal gas. Further, molecular simulations enabled us to elucidate unambiguously a 3D diffusion mechanism within the pores of MIL-47(V).

Replication and shedding of MERS-CoV in Jamaican fruit bats (Artibeus jamaicensis)

PubMed Central

Munster, Vincent J.; Adney, Danielle R.; van Doremalen, Neeltje; Brown, Vienna R.; Miazgowicz, Kerri L.; Milne-Price, Shauna; Bushmaker, Trenton; Rosenke, Rebecca; Scott, Dana; Hawkinson, Ann; de Wit, Emmie; Schountz, Tony; Bowen, Richard A.

2016-01-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) highlights the zoonotic potential of Betacoronaviruses. Investigations into the origin of MERS-CoV have focused on two potential reservoirs: bats and camels. Here, we investigated the role of bats as a potential reservoir for MERS-CoV. In vitro, the MERS-CoV spike glycoprotein interacted with Jamaican fruit bat (Artibeus jamaicensis) dipeptidyl peptidase 4 (DPP4) receptor and MERS-CoV replicated efficiently in Jamaican fruit bat cells, suggesting there is no restriction at the receptor or cellular level for MERS-CoV. To shed light on the intrinsic host-virus relationship, we inoculated 10 Jamaican fruit bats with MERS-CoV. Although all bats showed evidence of infection, none of the bats showed clinical signs of disease. Virus shedding was detected in the respiratory and intestinal tract for up to 9 days. MERS-CoV replicated transiently in the respiratory and, to a lesser extent, the intestinal tracts and internal organs; with limited histopathological changes observed only in the lungs. Analysis of the innate gene expression in the lungs showed a moderate, transient induction of expression. Our results indicate that MERS-CoV maintains the ability to replicate in bats without clinical signs of disease, supporting the general hypothesis of bats as ancestral reservoirs for MERS-CoV. PMID:26899616

Detection and full genome characterization of two beta CoV viruses related to Middle East respiratory syndrome from bats in Italy.

PubMed

Moreno, Ana; Lelli, Davide; de Sabato, Luca; Zaccaria, Guendalina; Boni, Arianna; Sozzi, Enrica; Prosperi, Alice; Lavazza, Antonio; Cella, Eleonora; Castrucci, Maria Rita; Ciccozzi, Massimo; Vaccari, Gabriele

2017-12-19

Middle East respiratory syndrome coronavirus (MERS-CoV), which belongs to beta group of coronavirus, can infect multiple host species and causes severe diseases in humans. Multiple surveillance and phylogenetic studies suggest a bat origin. In this study, we describe the detection and full genome characterization of two CoVs closely related to MERS-CoV from two Italian bats, Pipistrellus kuhlii and Hypsugo savii. Pool of viscera were tested by a pan-coronavirus RT-PCR. Virus isolation was attempted by inoculation in different cell lines. Full genome sequencing was performed using the Ion Torrent platform and phylogenetic trees were performed using IQtree software. Similarity plots of CoV clade c genomes were generated by using SSE v1.2. The three dimensional macromolecular structure (3DMMS) of the receptor binding domain (RBD) in the S protein was predicted by sequence-homology method using the protein data bank (PDB). Both samples resulted positive to the pan-coronavirus RT-PCR (IT-batCoVs) and their genome organization showed identical pattern of MERS CoV. Phylogenetic analysis showed a monophyletic group placed in the Beta2c clade formed by MERS-CoV sequences originating from humans and camels and bat-related sequences from Africa, Italy and China. The comparison of the secondary and 3DMMS of the RBD of IT-batCoVs with MERS, HKU4 and HKU5 bat sequences showed two aa deletions located in a region corresponding to the external subdomain of MERS-RBD in IT-batCoV and HKU5 RBDs. This study reported two beta CoVs closely related to MERS that were obtained from two bats belonging to two commonly recorded species in Italy (P. kuhlii and H. savii). The analysis of the RBD showed similar structure in IT-batCoVs and HKU5 respect to HKU4 sequences. Since the RBD domain of HKU4 but not HKU5 can bind to the human DPP4 receptor for MERS-CoV, it is possible to suggest also for IT-batCoVs the absence of DPP4-binding potential. More surveillance studies are needed to better investigate the potential intermediate hosts that may play a role in the interspecies transmission of known and currently unknown coronaviruses with particular attention to the S protein and the receptor specificity and binding affinity.

k-merSNP discovery: Software for alignment-and reference-free scalable SNP discovery, phylogenetics, and annotation for hundreds of microbial genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs or raw, unassembled reads. The method is fast to compute, finding SNPs and building a SNP phylogeny in minutes to hours, depending on the size and diversity of the input sequences. The SNP-based trees that result are consistent with known taxonomy and treesmore » determined in other studies. The approach we describe can handle many gigabases of sequence in a single run. The algorithm is based on k-mer analysis.« less

The MER/CIP Portal for Ground Operations

NASA Technical Reports Server (NTRS)

Chan, Louise; Desai, Sanjay; DOrtenzio, Matthew; Filman, Robtert E.; Heher, Dennis M.; Hubbard, Kim; Johan, Sandra; Keely, Leslie; Magapu, Vish; Mak, Ronald

2003-01-01

We developed the Mars Exploration Rover/Collaborative Information Portal (MER/CIP) to facilitate MER operations. MER/CIP provides a centralized, one-stop delivery platform integrating science and engineering data from several distributed heterogeneous data sources. Key issues for MER/CIP include: 1) Scheduling and schedule reminders; 2) Tracking the status of daily predicted outputs; 3) Finding and analyzing data products; 4) Collaboration; 5) Announcements; 6) Personalization.

The 3-D numerical study of airflow in the compressor/combustor prediffuser and dump diffuser of an industrial gas turbine

NASA Technical Reports Server (NTRS)

Agrawal, Ajay K.; Yang, Tah-Teh

1993-01-01

This paper describes the 3D computations of a flow field in the compressor/combustor diffusers of an industrial gas turbine. The geometry considered includes components such as the combustor support strut, the transition piece and the impingement sleeve with discrete cooling air holes on its surface. Because the geometry was complex and 3D, the airflow path was divided into two computational domains sharing an interface region. The body-fitted grid was generated independently in each of the two domains. The governing equations for incompressible Navier-Stokes equations were solved using the finite volume approach. The results show that the flow in the prediffuser is strongly coupled with the flow in the dump diffuser and vice versa. The computations also revealed that the flow in the dump diffuser is highly nonuniform.

Combining phase-field crystal methods with a Cahn-Hilliard model for binary alloys

NASA Astrophysics Data System (ADS)

Balakrishna, Ananya Renuka; Carter, W. Craig

2018-04-01

Diffusion-induced phase transitions typically change the lattice symmetry of the host material. In battery electrodes, for example, Li ions (diffusing species) are inserted between layers in a crystalline electrode material (host). This diffusion induces lattice distortions and defect formations in the electrode. The structural changes to the lattice symmetry affect the host material's properties. Here, we propose a 2D theoretical framework that couples a Cahn-Hilliard (CH) model, which describes the composition field of a diffusing species, with a phase-field crystal (PFC) model, which describes the host-material lattice symmetry. We couple the two continuum models via coordinate transformation coefficients. We introduce the transformation coefficients in the PFC method to describe affine lattice deformations. These transformation coefficients are modeled as functions of the composition field. Using this coupled approach, we explore the effects of coarse-grained lattice symmetry and distortions on a diffusion-induced phase transition process. In this paper, we demonstrate the working of the CH-PFC model through three representative examples: First, we describe base cases with hexagonal and square symmetries for two composition fields. Next, we illustrate how the CH-PFC method interpolates lattice symmetry across a diffuse phase boundary. Finally, we compute a Cahn-Hilliard type of diffusion and model the accompanying changes to lattice symmetry during a phase transition process.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction

PubMed Central

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-01-01

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination–initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria. However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome–axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. PMID:29021238

First Results of the Athena Microscopic Imager Investigation

NASA Technical Reports Server (NTRS)

Herkenhoff, K.; Squyres, S.; Archinal, B.; Arvidson, R.; Bass, D.; Barrett, J.; Becker, K.; Becker, T.; Bell, J., III; Burr, D.

2004-01-01

The Athena science payload on the Mars Exploration Rovers (MER) includes the Microscopic Imager (MI). The MI is a fixed-focus camera mounted on an extendable arm, the Instrument Deployment Device (IDD). The MI acquires images at a spatial resolution of 30 microns/pixel over a broad spectral range (400 - 700 nm). The MI uses the same electronics design as the other MER cameras but its optics yield a field of view of 31 x 31 mm across a 1024 x 1024 pixel CCD image. The MI acquires images using only solar or skylight illumination of the target surface. A contact sensor is used to place the MI slightly closer to the target surface than its best focus distance (about 69 mm), allowing concave surfaces to be imaged in good focus. Coarse focusing (approx. 2 mm precision) is achieved by moving the IDD away from a rock target after contact is sensed. The MI optics are protected from the Martian environment by a retractable dust cover. This cover includes a Kapton window that is tinted orange to restrict the spectral bandpass to 500 - 700 nm, allowing crude color information to be obtained by acquiring images with the cover open and closed. The MI science objectives, instrument design and calibration, operation, and data processing were described by Herkenhoff et al. Initial results of the MI experiment on both MER rovers ('Spirit' and 'Opportunity') are described below.

Engineered Single-Chain, Antiparallel, Coiled Coil Mimics the MerR Metal Binding Site

PubMed Central

Song, Lingyun; Caguiat, Jonathan; Li, Zhongrui; Shokes, Jacob; Scott, Robert A.; Olliff, Lynda; Summers, Anne O.

2004-01-01

The repressor-activator MerR that controls transcription of the mercury resistance (mer) operon is unusual for its high sensitivity and specificity for Hg(II) in in vivo and in vitro transcriptional assays. The metal-recognition domain of MerR resides at the homodimer interface in a novel antiparallel arrangement of α-helix 5 that forms a coiled-coil motif. To facilitate the study of this novel metal binding motif, we assembled this antiparallel coiled coil into a single chain by directly fusing two copies of the 48-residue α-helix 5 of MerR. The resulting 107-residue polypeptide, called the metal binding domain (MBD), and wild-type MerR were overproduced and purified, and their metal-binding properties were determined in vivo and in vitro. In vitro MBD bound ca. 1.0 equivalent of Hg(II) per pair of binding sites, just as MerR does, and it showed only a slightly lower affinity for Hg(II) than did MerR. Extended X-ray absorption fine structure data showed that MBD has essentially the same Hg(II) coordination environment as MerR. In vivo, cells overexpressing MBD accumulated 70 to 100% more 203Hg(II) than cells bearing the vector alone, without deleterious effects on cell growth. Both MerR and MBD variously bound other thiophilic metal ions, including Cd(II), Zn(II), Pb(II), and As(III), in vitro and in vivo. We conclude that (i) it is possible to simulate in a single polypeptide chain the in vitro and in vivo metal-binding ability of dimeric, full-length MerR and (ii) MerR's specificity in transcriptional activation does not reside solely in the metal-binding step. PMID:14996817

Engineering tobacco to remove mercury from polluted soil.

PubMed

Chang, S; Wei, F; Yang, Y; Wang, A; Jin, Z; Li, J; He, Y; Shu, H

2015-04-01

Tobacco is an ideal plant for modification to remove mercury from soil. Although several transgenic tobacco strains have been developed, they either release elemental mercury directly into the air or are only capable of accumulating small quantities of mercury. In this study, we constructed two transgenic tobacco lines: Ntk-7 (a tobacco plant transformed with merT-merP-merB1-merB2-ppk) and Ntp-36 (tobacco transformed with merT-merP-merB1-merB2-pcs1). The genes merT, merP, merB1, and merB2 were obtained from the well-known mercury-resistant bacterium Pseudomonas K-62. Ppk is a gene that encodes polyphosphate kinase, a key enzyme for synthesizing polyphosphate in Enterobacter aerogenes. Pcs1 is a tobacco gene that encodes phytochelatin synthase, which is the key enzyme for phytochelatin synthesis. The genes were linked with LP4/2A, a sequence that encodes a well-known linker peptide. The results demonstrate that all foreign genes can be abundantly expressed. The mercury resistance of Ntk-7 and Ntp-36 was much higher than that of the wild type whether tested with organic mercury or with mercuric ions. The transformed plants can accumulate significantly more mercury than the wild type, and Ntp-36 can accumulate more mercury from soil than Ntk-7. In mercury-polluted soil, the mercury content in Ntp-36's root can reach up to 251 μg/g. This is the first report to indicate that engineered tobacco can not only accumulate mercury from soil but also retain this mercury within the plant. Ntp-36 has good prospects for application in bioremediation for mercury pollution.

Reverse genetics with a full-length infectious cDNA of the Middle East respiratory syndrome coronavirus.

PubMed

Scobey, Trevor; Yount, Boyd L; Sims, Amy C; Donaldson, Eric F; Agnihothram, Sudhakar S; Menachery, Vineet D; Graham, Rachel L; Swanstrom, Jesica; Bove, Peter F; Kim, Jeeho D; Grego, Sonia; Randell, Scott H; Baric, Ralph S

2013-10-01

Severe acute respiratory syndrome with high mortality rates (~50%) is associated with a novel group 2c betacoronavirus designated Middle East respiratory syndrome coronavirus (MERS-CoV). We synthesized a panel of contiguous cDNAs that spanned the entire genome. Following contig assembly into genome-length cDNA, transfected full-length transcripts recovered several recombinant viruses (rMERS-CoV) that contained the expected marker mutations inserted into the component clones. Because the wild-type MERS-CoV contains a tissue culture-adapted T1015N mutation in the S glycoprotein, rMERS-CoV replicated ~0.5 log less efficiently than wild-type virus. In addition, we ablated expression of the accessory protein ORF5 (rMERS•ORF5) and replaced it with tomato red fluorescent protein (rMERS-RFP) or deleted the entire ORF3, 4, and 5 accessory cluster (rMERS-ΔORF3-5). Recombinant rMERS-CoV, rMERS-CoV•ORF5, and MERS-CoV-RFP replicated to high titers, whereas MERS-ΔORF3-5 showed 1-1.5 logs reduced titer compared with rMERS-CoV. Northern blot analyses confirmed the associated molecular changes in the recombinant viruses, and sequence analysis demonstrated that RFP was expressed from the appropriate consensus sequence AACGAA. We further show dipeptidyl peptidase 4 expression, MERS-CoV replication, and RNA and protein synthesis in human airway epithelial cell cultures, primary lung fibroblasts, primary lung microvascular endothelial cells, and primary alveolar type II pneumocytes, demonstrating a much broader tissue tropism than severe acute respiratory syndrome coronavirus. The availability of a MERS-CoV molecular clone, as well as recombinant viruses expressing indicator proteins, will allow for high-throughput testing of therapeutic compounds and provide a genetic platform for studying gene function and the rational design of live virus vaccines.

Molecular interaction study of commercial cyclic peptides and MERS-COV papain-like protease as novel drug candidate for MERS-COV

NASA Astrophysics Data System (ADS)

Nasution, M. A. F.; Azzuhdi, M. G.; Tambunan, U. S. F.

2017-07-01

Middle-east respiratory syndrome coronavirus (MERS-CoV) has become the current outbreak, MERS-CoV infection results in illness at the respiratory system, digestive, and even lead to death with an average mortality caused by MERS-CoV infection reaches 50 %. Until now, there is not any effective vaccine or drug to ward off MERS-CoV infection. Papain-like protease (PLpro) is responsible for cleavage of a nonstructural protein that is essential for viral maturation. Inhibition of PLpro with a ligand will block the cleavage process of nonstructural protein, thus reduce the infection of MERS-CoV. Through of bioinformatics study with molecular docking and binding interaction analysis of commercial cyclic peptides, aldosterone secretion inhibiting factor (1-35) (bovine) was obtained as an inhibitor for PLpro. Thus, aldosterone secretion inhibiting factor (1-35) (bovine) has a potential as a novel candidate drug for treating MERS-CoV.

Middle East respiratory syndrome in children. Dental considerations.

PubMed

Al-Sehaibany, Fares S

2017-04-01

As of January 2016, 1,633 laboratory-confirmed cases of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infection and 587 MERS-related deaths have been reported by the World Health Organization globally. Middle East Respiratory Syndrome Coronavirus  may occur sporadically in communities or may be transmitted within families or hospitals. The number of confirmed MERS-CoV cases among healthcare workers has been increasing. Middle East Respiratory Syndrome Coronavirus may also spread through aerosols generated during various dental treatments, resulting in transmission between patients and dentists. As MERS-CoV cases have also been reported among children, pediatric dentists are at risk of MERS-CoV infection. This review discusses MERS-CoV infection in children and healthcare workers, especially pediatric dentists, and considerations pertaining to pediatric dentistry. Although no cases of MERS-CoV transmission between a patient and a dentist have yet been reported, the risk of MERS-CoV transmission from an infected patient may be high due to the unique work environment of dentists (aerosol generation).

Fusion and Visualization of HiRISE Super-Resolution, Shape-from-Shading DTM with MER Stereo 3D Reconstructions

NASA Astrophysics Data System (ADS)

Gupta, S.; Paar, G.; Muller, J. P.; Tao, Y.; Tyler, L.; Traxler, C.; Hesina, G.; Huber, B.; Nauschnegg, B.

2014-12-01

The FP7-SPACE project PRoViDE has assembled a major portion of the imaging data gathered so far from rover vehicles, landers and probes on extra-terrestrial planetary surfaces into a unique database, bringing them into a common planetary geospatial context and providing access to a complete set of 3D vision products. One major aim of PRoViDE is the fusion between orbiter and rover image products. To close the gap between HiRISE imaging resolution (down to 25cm for the OrthoRectified image (ORI), down to 1m for the DTM) and surface vision products, images from multiple HiRISE acquisitions are combined into a super resolution data set (Tao & Muller, 2014), increasing to 5cm resolution the Ortho images. Furthermore, shape-from-shading is applied to one of the ORIs at its original resolution for refinement of the HiRISE DTM, leading to DTM ground resolutions of up to 25 cm. After texture-based co-registration with these refined orbiter 3D products, MER PanCam and NavCam 3D image products can be smoothly pasted into a multi-resolution 3D data representation. Typical results from the MER mission are presented by a dedicated real-time rendering tool which is fed by a hierarchical 3D data structure that is able to cope with all involved scales from global planetary scale down to close-up reconstructions in the mm range. This allows us to explore and analyze the geological characteristics of rock outcrops, for example the detailed geometry and internal features of sedimentary rock layers, to aid paleoenvironmental interpretation. This integrated approach enables more efficient development of geological models of martian rock outcrops. The rendering tool also provides measurement tools to obtain geospatial data of surface points and distances between them. We report on novel scientific use cases and the added value potential of the resultant high-quality data set and presentation means to support further geologic investigations. The research leading to these results has received funding from the EC's 7th Framework Programme (FP7/2007-2013) under grant agreement n° 312377.

KAnalyze: a fast versatile pipelined K-mer toolkit

PubMed Central

Audano, Peter; Vannberg, Fredrik

2014-01-01

Motivation: Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. Results: As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. Availability and implementation: KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/ Contact: fredrik.vannberg@biology.gatech.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:24642064

KAnalyze: a fast versatile pipelined k-mer toolkit.

PubMed

Audano, Peter; Vannberg, Fredrik

2014-07-15

Converting nucleotide sequences into short overlapping fragments of uniform length, k-mers, is a common step in many bioinformatics applications. While existing software packages count k-mers, few are optimized for speed, offer an application programming interface (API), a graphical interface or contain features that make it extensible and maintainable. We designed KAnalyze to compete with the fastest k-mer counters, to produce reliable output and to support future development efforts through well-architected, documented and testable code. Currently, KAnalyze can output k-mer counts in a sorted tab-delimited file or stream k-mers as they are read. KAnalyze can process large datasets with 2 GB of memory. This project is implemented in Java 7, and the command line interface (CLI) is designed to integrate into pipelines written in any language. As a k-mer counter, KAnalyze outperforms Jellyfish, DSK and a pipeline built on Perl and Linux utilities. Through extensive unit and system testing, we have verified that KAnalyze produces the correct k-mer counts over multiple datasets and k-mer sizes. KAnalyze is available on SourceForge: https://sourceforge.net/projects/kanalyze/. © The Author 2014. Published by Oxford University Press.

Coupling two mercury resistance genes in Eastern cottonwood enhances the processing of organomercury.

PubMed

Lyyra, Satu; Meagher, Richard B; Kim, Tehryung; Heaton, Andrew; Montello, Paul; Balish, Rebecca S; Merkle, Scott A

2007-03-01

Eastern cottonwood (Populus deltoides Bartr. ex Marsh.) trees were engineered to express merA (mercuric ion reductase) and merB (organomercury lyase) transgenes in order to be used for the phytoremediation of mercury-contaminated soils. Earlier studies with Arabidopsis thaliana and Nicotiana tabacum showed that this gene combination resulted in more efficient detoxification of organomercurial compounds than did merB alone, but neither species is optimal for long-term field applications. Leaf discs from in vitro-grown merA, nptII (neomycin phosphotransferase) transgenic cottonwood plantlets were inoculated with Agrobacterium tumefaciens strain C58 carrying the merB and hygromycin resistance (hptII) genes. Polymerase chain reaction of shoots regenerated from the leaf discs under selection indicated an overall transformation frequency of 20%. Western blotting of leaves showed that MerA and MerB proteins were produced. In vitro-grown merA/merB plants were highly resistant to phenylmercuric acetate, and detoxified organic mercury compounds two to three times more rapidly than did controls, as shown by mercury volatilization assay. This indicates that these cottonwood trees are reasonable candidates for the remediation of organomercury-contaminated sites.

Increase in Middle East Respiratory Syndrome-Coronavirus Cases in Saudi Arabia Linked to Hospital Outbreak With Continued Circulation of Recombinant Virus, July 1–August 31, 2015

PubMed Central

Assiri, Abdullah M.; Biggs, Holly M.; Abedi, Glen R.; Lu, Xiaoyan; Bin Saeed, Abdulaziz; Abdalla, Osman; Mohammed, Mutaz; Al-Abdely, Hail M.; Algarni, Homoud S.; Alhakeem, Raafat F.; Almasri, Malak M.; Alsharef, Ali A.; Nooh, Randa; Erdman, Dean D.; Gerber, Susan I.; Watson, John T.

2016-01-01

During July–August 2015, the number of cases of Middle East respiratory syndrome (MERS) reported from Saudi Arabia increased dramatically. We reviewed the 143 confirmed cases from this period and classified each based upon likely transmission source. We found that the surge in cases resulted predominantly (90%) from secondary transmission largely attributable to an outbreak at a single healthcare facility in Riyadh. Genome sequencing of MERS coronavirus from 6 cases demonstrated continued circulation of the recently described recombinant virus. A single unique frameshift deletion in open reading frame 5 was detected in the viral sequence from 1 case. PMID:27704019

Overtone Vibrations of OH Groups in Fused Silica Optical Fibers.

DTIC Science & Technology

1981-09-01

MER IPEFRIGORGANIZATION- NAME AND ADDRESS - 10. PROGRAM ELEMENT, PROJECT, TS Chemitry eparmentAREA & WORK UNIT NUMBERS Howard-University Washington D...edameutal and overtone contours were decomposed into Gaussian components using a D. Post 310 analog computer . ?~ .5- 3. F..*’m,,ntal Re,.ults A. Infrared...spectrum. AoD - k AoH (here k-3.981) computed S from a linear combination of deuterated, AOD, and undeuterated, AoH, absorbance spectra, was required, Fig

Human Centered Design and Development for NASA's MerBoard

NASA Technical Reports Server (NTRS)

Trimble, Jay

2003-01-01

This viewgraph presentation provides an overview of the design and development process for NASA's MerBoard. These devices are large interactive display screens which can be shown on the user's computer, which will allow scientists in many locations to interpret and evaluate mission data in real-time. These tools are scheduled to be used during the 2003 Mars Exploration Rover (MER) expeditions. Topics covered include: mission overview, Mer Human Centered Computers, FIDO 2001 observations and MerBoard prototypes.

A mouse model for MERS coronavirus-induced acute respiratory distress syndrome.

PubMed

Cockrell, Adam S; Yount, Boyd L; Scobey, Trevor; Jensen, Kara; Douglas, Madeline; Beall, Anne; Tang, Xian-Chun; Marasco, Wayne A; Heise, Mark T; Baric, Ralph S

2016-11-28

Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel virus that emerged in 2012, causing acute respiratory distress syndrome (ARDS), severe pneumonia-like symptoms and multi-organ failure, with a case fatality rate of ∼36%. Limited clinical studies indicate that humans infected with MERS-CoV exhibit pathology consistent with the late stages of ARDS, which is reminiscent of the disease observed in patients infected with severe acute respiratory syndrome coronavirus. Models of MERS-CoV-induced severe respiratory disease have been difficult to achieve, and small-animal models traditionally used to investigate viral pathogenesis (mouse, hamster, guinea-pig and ferret) are naturally resistant to MERS-CoV. Therefore, we used CRISPR-Cas9 gene editing to modify the mouse genome to encode two amino acids (positions 288 and 330) that match the human sequence in the dipeptidyl peptidase 4 receptor, making mice susceptible to MERS-CoV infection and replication. Serial MERS-CoV passage in these engineered mice was then used to generate a mouse-adapted virus that replicated efficiently within the lungs and evoked symptoms indicative of severe ARDS, including decreased survival, extreme weight loss, decreased pulmonary function, pulmonary haemorrhage and pathological signs indicative of end-stage lung disease. Importantly, therapeutic countermeasures comprising MERS-CoV neutralizing antibody treatment or a MERS-CoV spike protein vaccine protected the engineered mice against MERS-CoV-induced ARDS.

Intratracheal exposure of common marmosets to MERS-CoV Jordan-n3/2012 or MERS-CoV EMC/2012 isolates does not result in lethal disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Johnson, Reed F., E-mail: johnsonreed@mail.nih.gov; Via, Laura E.; Kumar, Mia R.

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) continues to be a threat to human health in the Middle East. Development of countermeasures is ongoing; however, an animal model that faithfully recapitulates human disease has yet to be defined. A recent study indicated that inoculation of common marmosets resulted in inconsistent lethality. Based on these data we sought to compare two isolates of MERS-CoV. We followed disease progression in common marmosets after intratracheal exposure with: MERS-CoV-EMC/2012, MERS-CoV-Jordan-n3/2012, media, or inactivated virus. Our data suggest that common marmosets developed a mild to moderate non-lethal respiratory disease, which was quantifiable by computed tomography (CT),more » with limited other clinical signs. Based on CT data, clinical data, and virological data, MERS-CoV inoculation of common marmosets results in mild to moderate clinical signs of disease that are likely due to manipulations of the marmoset rather than as a result of robust viral replication. - Highlights: • Common marmosets infected with MERS-EMC and MERS-JOR did not develop lethal disease. • Infected subjects developed transient signs of clinical disease. • CT indicated few differences between the infected and control groups. • Marmosets do not faithfully replicate human MERS pathogenesis.« less

Enhanced Regulatory Sequence Prediction Using Gapped k-mer Features

PubMed Central

Mohammad-Noori, Morteza; Beer, Michael A.

2014-01-01

Abstract Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem. PMID:25033408

Enhanced regulatory sequence prediction using gapped k-mer features.

PubMed

Ghandi, Mahmoud; Lee, Dongwon; Mohammad-Noori, Morteza; Beer, Michael A

2014-07-01

Oligomers of length k, or k-mers, are convenient and widely used features for modeling the properties and functions of DNA and protein sequences. However, k-mers suffer from the inherent limitation that if the parameter k is increased to resolve longer features, the probability of observing any specific k-mer becomes very small, and k-mer counts approach a binary variable, with most k-mers absent and a few present once. Thus, any statistical learning approach using k-mers as features becomes susceptible to noisy training set k-mer frequencies once k becomes large. To address this problem, we introduce alternative feature sets using gapped k-mers, a new classifier, gkm-SVM, and a general method for robust estimation of k-mer frequencies. To make the method applicable to large-scale genome wide applications, we develop an efficient tree data structure for computing the kernel matrix. We show that compared to our original kmer-SVM and alternative approaches, our gkm-SVM predicts functional genomic regulatory elements and tissue specific enhancers with significantly improved accuracy, increasing the precision by up to a factor of two. We then show that gkm-SVM consistently outperforms kmer-SVM on human ENCODE ChIP-seq datasets, and further demonstrate the general utility of our method using a Naïve-Bayes classifier. Although developed for regulatory sequence analysis, these methods can be applied to any sequence classification problem.

Asy2/Mer2: an evolutionarily conserved mediator of meiotic recombination, pairing, and global chromosome compaction.

PubMed

Tessé, Sophie; Bourbon, Henri-Marc; Debuchy, Robert; Budin, Karine; Dubois, Emeline; Liangran, Zhang; Antoine, Romain; Piolot, Tristan; Kleckner, Nancy; Zickler, Denise; Espagne, Eric

2017-09-15

Meiosis is the cellular program by which a diploid cell gives rise to haploid gametes for sexual reproduction. Meiotic progression depends on tight physical and functional coupling of recombination steps at the DNA level with specific organizational features of meiotic-prophase chromosomes. The present study reveals that every step of this coupling is mediated by a single molecule: Asy2/Mer2. We show that Mer2, identified so far only in budding and fission yeasts, is in fact evolutionarily conserved from fungi (Mer2/Rec15/Asy2/Bad42) to plants (PRD3/PAIR1) and mammals (IHO1). In yeasts, Mer2 mediates assembly of recombination-initiation complexes and double-strand breaks (DSBs). This role is conserved in the fungus Sordaria However, functional analysis of 13 mer2 mutants and successive localization of Mer2 to axis, synaptonemal complex (SC), and chromatin revealed, in addition, three further important functions. First, after DSB formation, Mer2 is required for pairing by mediating homolog spatial juxtaposition, with implications for crossover (CO) patterning/interference. Second, Mer2 participates in the transfer/maintenance and release of recombination complexes to/from the SC central region. Third, after completion of recombination, potentially dependent on SUMOylation, Mer2 mediates global chromosome compaction and post-recombination chiasma development. Thus, beyond its role as a recombinosome-axis/SC linker molecule, Mer2 has important functions in relation to basic chromosome structure. © 2017 Tessé et al.; Published by Cold Spring Harbor Laboratory Press.

Phytoremediation of Ionic and Methyl Mercury P

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meagher, Richard B.

1999-06-01

Our long-term goal is to enable highly productive plant species to extract, resist, detoxify, and/or sequester toxic heavy metal pollutants as an environmentally friendly alternative to physical remediation methods. We have focused this phytoremediation research on soil and water-borne ionic and methylmercury. Mercury pollution is a serious world-wide problem affecting the health of human and wild-life populations. Methylmercury, produced by native bacteria at mercury-contaminated wetland sites, is a particularly serious problem due to its extreme toxicity and efficient biomagnification in the food chain. We engineered several plant species (e.g., Arabidopsis, tobacco, canola, yellow poplar, rice) to express the bacterial genes,more » merB and/or merA, under the control of plant regulatory sequences. These transgenic plants acquired remarkable properties for mercury remediation. (1) Transgenic plants expressing merB (organomercury lyase) extract methylmercury from their growth substrate and degrade it to less toxic ionic mercury. They grow on concentrations of methylmercury that kill normal plants and accumulate low levels of ionic mercury. (2) Transgenic plants expressing merA (mercuric ion reductase) extract and electrochemically reduce toxic, reactive ionic mercury to much less toxic and volatile metallic mercury. This metal transformation is driven by the powerful photosynthetic reducing capacity of higher plants that generates excess NADPH using solar energy. MerA plants grow vigorously on levels of ionic mercury that kill control plants. Plants expressing both merB and merA degrade high levels of methylmercury and volatilize metallic mercury. These properties were shown to be genetically stable for several generations in the two plant species examined. Our work demonstrates that native trees, shrubs, and grasses can be engineered to remediate the most abundant toxic mercury pollutants. Building on these data our working hypothesis for the next grant period is that transgenic plants expressing the bacterial merB and merA genes will (a) remove mercury from polluted soil and water and (b) prevent methylmercury from entering the food chain. Our specific aims center on understanding the mechanisms by which plants process the various forms of mercury and volatilize or transpire mercury vapor. This information will allow us to improve the design of our current phytoremediation strategies. As an alternative to volatilizing mercury, we are using several new genes to construct plants that will hyperaccumulate mercury in above-ground tissues for later harvest. The Department of Energy's Oak Ridge National Laboratory and Brookhaven National Laboratory have sites with significant levels of mercury contamination that could be cleaned by applying the scientific discoveries and new phytoremediation technologies described in this proposal. The knowledge and expertise gained by engineering plants to hyperaccumulate mercury can be applied to the remediation of other heavy metals pollutants (e.g., arsenic, cesium, cadmium, chromium, lead, strontium, technetium, uranium) found at several DOE facilities.« less

KSC-03PD-1956

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. The Mars Exploration Rover 1 (MER-B) is moved out of the Payload Hazardous Servicing Facility for transfer to Launch Pad 17-B, Cape Canaveral Air Force Station. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans can't yet go. MER-B is scheduled to launch June 26 at one of two available times, 12:27:31 a.m. EDT or 1:08:45 a.m. EDT.

MER : from landing to six wheels on Mars ... twice

NASA Technical Reports Server (NTRS)

Krajewski, Joel; Burke, Kevin; Lewicki, Chris; Limonadi, Daniel; Trebi-Ollennu, Ashitey; Voorhees, Chris

2005-01-01

Application of the Pathfinder landing system design to enclose the much larger Mars Exploration Rover required a variety of Rover deployments to achieve the surface driving configuration. The project schedule demanded that software design, engineering model test, and flight hardware build to be accomplished in parallel. This challenge was met through (a) bounding unknown environments against which to design and test, (b) early mechanical prototype testing, (c) constraining the scope of on-board autonomy to survival-critical deployments, (d) executing a balance of nominal and off-nominal test cases, (e) developing off-nominal event mitigation techniques before landing, (f) flexible replanning in response to surprises during operations. Here is discussed several specific events encountered during initial MER surface operations.

Ion radial diffusion in an electrostatic impulse model for stormtime ring current formation

NASA Technical Reports Server (NTRS)

Chen, Margaret W.; Schulz, Michael; Lyons, Larry R.; Gorney, David J.

1992-01-01

Guiding-center simulations of stormtime transport of ring-current and radiation-belt ions having first adiabatic invariants mu is approximately greater than 15 MeV/G (E is approximately greater than 165 keV at L is approximately 3) are surprisingly well described (typically within a factor of approximately less than 4) by the quasilinear theory of radial diffusion. This holds even for the case of an individual model storm characterized by substorm-associated impulses in the convection electric field, provided that the actual spectrum of the electric field is incorporated in the quasilinear theory. Correction of the quasilinear diffusion coefficient D(sub LL)(sup ql) for drift-resonance broadening (so as to define D(sub LL)(sup ql)) reduced the typical discrepancy with the diffusion coefficients D(sub LL)(sup sim) deduced from guiding-center simulations of representative-particle trajectories to a factor of approximately 3. The typical discrepancy was reduced to a factor of approximately 1.4 by averaging D(sub LL)(sup sim), D(sub LL)(sup ql), and D(sub LL)(sup rb) over an ensemble of model storms characterized by different (but statistically equivalent) sets of substorm-onset times.

Anomalous Diffusion Measured by a Twice-Refocused Spin Echo Pulse Sequence: Analysis Using Fractional Order Calculus

PubMed Central

2011-01-01

Purpose To theoretically develop and experimentally validate a formulism based on a fractional order calculus (FC) diffusion model to characterize anomalous diffusion in brain tissues measured with a twice-refocused spin-echo (TRSE) pulse sequence. Materials and Methods The FC diffusion model is the fractional order generalization of the Bloch-Torrey equation. Using this model, an analytical expression was derived to describe the diffusion-induced signal attenuation in a TRSE pulse sequence. To experimentally validate this expression, a set of diffusion-weighted (DW) images was acquired at 3 Tesla from healthy human brains using a TRSE sequence with twelve b-values ranging from 0 to 2,600 s/mm2. For comparison, DW images were also acquired using a Stejskal-Tanner diffusion gradient in a single-shot spin-echo echo planar sequence. For both datasets, a Levenberg-Marquardt fitting algorithm was used to extract three parameters: diffusion coefficient D, fractional order derivative in space β, and a spatial parameter μ (in units of μm). Using adjusted R-squared values and standard deviations, D, β and μ values and the goodness-of-fit in three specific regions of interest (ROI) in white matter, gray matter, and cerebrospinal fluid were evaluated for each of the two datasets. In addition, spatially resolved parametric maps were assessed qualitatively. Results The analytical expression for the TRSE sequence, derived from the FC diffusion model, accurately characterized the diffusion-induced signal loss in brain tissues at high b-values. In the selected ROIs, the goodness-of-fit and standard deviations for the TRSE dataset were comparable with the results obtained from the Stejskal-Tanner dataset, demonstrating the robustness of the FC model across multiple data acquisition strategies. Qualitatively, the D, β, and μ maps from the TRSE dataset exhibited fewer artifacts, reflecting the improved immunity to eddy currents. Conclusion The diffusion-induced signal attenuation in a TRSE pulse sequence can be described by an FC diffusion model at high b-values. This model performs equally well for data acquired from the human brain tissues with a TRSE pulse sequence or a conventional Stejskal-Tanner sequence. PMID:21509877

Anomalous diffusion measured by a twice-refocused spin echo pulse sequence: analysis using fractional order calculus.

PubMed

Gao, Qing; Srinivasan, Girish; Magin, Richard L; Zhou, Xiaohong Joe

2011-05-01

To theoretically develop and experimentally validate a formulism based on a fractional order calculus (FC) diffusion model to characterize anomalous diffusion in brain tissues measured with a twice-refocused spin-echo (TRSE) pulse sequence. The FC diffusion model is the fractional order generalization of the Bloch-Torrey equation. Using this model, an analytical expression was derived to describe the diffusion-induced signal attenuation in a TRSE pulse sequence. To experimentally validate this expression, a set of diffusion-weighted (DW) images was acquired at 3 Tesla from healthy human brains using a TRSE sequence with twelve b-values ranging from 0 to 2600 s/mm(2). For comparison, DW images were also acquired using a Stejskal-Tanner diffusion gradient in a single-shot spin-echo echo planar sequence. For both datasets, a Levenberg-Marquardt fitting algorithm was used to extract three parameters: diffusion coefficient D, fractional order derivative in space β, and a spatial parameter μ (in units of μm). Using adjusted R-squared values and standard deviations, D, β, and μ values and the goodness-of-fit in three specific regions of interest (ROIs) in white matter, gray matter, and cerebrospinal fluid, respectively, were evaluated for each of the two datasets. In addition, spatially resolved parametric maps were assessed qualitatively. The analytical expression for the TRSE sequence, derived from the FC diffusion model, accurately characterized the diffusion-induced signal loss in brain tissues at high b-values. In the selected ROIs, the goodness-of-fit and standard deviations for the TRSE dataset were comparable with the results obtained from the Stejskal-Tanner dataset, demonstrating the robustness of the FC model across multiple data acquisition strategies. Qualitatively, the D, β, and μ maps from the TRSE dataset exhibited fewer artifacts, reflecting the improved immunity to eddy currents. The diffusion-induced signal attenuation in a TRSE pulse sequence can be described by an FC diffusion model at high b-values. This model performs equally well for data acquired from the human brain tissues with a TRSE pulse sequence or a conventional Stejskal-Tanner sequence. Copyright © 2011 Wiley-Liss, Inc.

An elemental mercury diffusion coefficient for natural waters determined by molecular dynamics simulation.

PubMed

Kuss, Joachim; Holzmann, Jörg; Ludwig, Ralf

2009-05-01

Mercury is a priority pollutant as its mobility between the hydrosphere and the atmosphere threatens the biosphere globally. The air-water gas transfer of elemental mercury (Hg0) is controlled by its diffusion through the water-side boundary layer and thus by its diffusion coefficient, D(Hg), the value of which, however, has not been established. Here, the diffusion of Hg0 in water was modeled by molecular dynamics (MD) simulation and the diffusion coefficient subsequently determined. Therefore the movement of either Hg(0) or xenon and 1000 model water molecules (TIP4P-Ew) were traced for time spans of 50 ns. The modeled D(Xe) of the monatomic noble gas agreed well with measured data; thus, MD simulation was assumed to be a reliable approach to determine D(Hg) for monatomic Hg(0) as well. Accordingly, Hg(0) diffusion was then simulated for freshwater and seawater, and the data were well-described by the equation of Eyring. The activation energies for the diffusion of Hg0 in freshwater was 17.0 kJ mol(-1) and in seawater 17.8 kJ mol(-1). The newly determined D(Hg) is clearly lower than the one previously used for an oceanic mercury budget. Thus, its incorporation into the model should lead to lower estimates of global ocean mercury emissions.

Variational description of the positive column with two-stem ionization

NASA Technical Reports Server (NTRS)

Crawford, F. W.

1979-01-01

The ionization balance in diffusion dominated discharges which depends on both one and two step ionization processes is considered. The Spenke diffusion equation (D sq delta n + neutrino n + sq kn =0) describing such conditions is solved by the Rayleigh-Ritz variational method. Simple analytic approximations to the density profile, and the similarity relation between neutrino,k,D and the discharge dimensions, are derived for planar and cylindrical geometry, and compared with exact computations for certain limiting cases.

Communication: Diverse nanoscale cluster dynamics: Diffusion of 2D epitaxial clusters

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lai, King C.; Evans, James W.; Liu, Da -Jiang

The dynamics of nanoscale clusters can be distinct from macroscale behavior described by continuum formalisms. For diffusion of 2D clusters of N atoms in homoepitaxial systems mediated by edge atom hopping, macroscale theory predicts simple monotonic size scaling of the diffusion coefficient, D N ~ N –β, with β = 3/2. However, modeling for nanoclusters on metal(100) surfaces reveals that slow nucleation-mediated diffusion displaying weak size scaling β < 1 occurs for “perfect” sizes N p = L 2 and L(L+1) for integer L = 3,4,… (with unique square or near-square ground state shapes), and also for N p+3, Nmore » p+4,…. In contrast, fast facile nucleation-free diffusion displaying strong size scaling β ≈ 2.5 occurs for sizes N p+1 and N p+2. D N versus N oscillates strongly between the slowest branch (for N p+3) and the fastest branch (for N p+1). All branches merge for N = O(10 2), but macroscale behavior is only achieved for much larger N = O(10 3). Here, this analysis reveals the unprecedented diversity of behavior on the nanoscale.« less

Communication: Diverse nanoscale cluster dynamics: Diffusion of 2D epitaxial clusters

DOE PAGES

Lai, King C.; Evans, James W.; Liu, Da -Jiang

2017-11-27

The dynamics of nanoscale clusters can be distinct from macroscale behavior described by continuum formalisms. For diffusion of 2D clusters of N atoms in homoepitaxial systems mediated by edge atom hopping, macroscale theory predicts simple monotonic size scaling of the diffusion coefficient, D N ~ N –β, with β = 3/2. However, modeling for nanoclusters on metal(100) surfaces reveals that slow nucleation-mediated diffusion displaying weak size scaling β < 1 occurs for “perfect” sizes N p = L 2 and L(L+1) for integer L = 3,4,… (with unique square or near-square ground state shapes), and also for N p+3, Nmore » p+4,…. In contrast, fast facile nucleation-free diffusion displaying strong size scaling β ≈ 2.5 occurs for sizes N p+1 and N p+2. D N versus N oscillates strongly between the slowest branch (for N p+3) and the fastest branch (for N p+1). All branches merge for N = O(10 2), but macroscale behavior is only achieved for much larger N = O(10 3). Here, this analysis reveals the unprecedented diversity of behavior on the nanoscale.« less

Using max entropy ratio of recurrence plot to measure electrocorticogram changes in epilepsy patients

NASA Astrophysics Data System (ADS)

Yan, Jiaqing; Wang, Yinghua; Ouyang, Gaoxiang; Yu, Tao; Li, Xiaoli

2016-02-01

A maximum entropy ratio (MER) method is firstly adapted to investigate the high-dimensional Electrocorticogram (ECoG) data from epilepsy patients. MER is a symbolic analysis approach for the detection of recurrence domains of complex dynamical systems from time series. Data were chosen from eight patients undergoing pre-surgical evaluation for drug-resistant temporal lobe epilepsy. MERs for interictal and ictal data were calculated and compared. A statistical test was performed to evaluate the ability of MER to separate the interictal state from the ictal state. MER showed significant changes from the interictal state into the ictal state, where MER was low at the ictal state and is significantly different with that at the interictal state. These suggest that MER is able to separate the ictal state from the interictal state based on ECoG data. It has the potential of detecting the transition between normal brain activity and the ictal state.

Instrumental, theoretical, and experimental aspects of determining thermodynamic and kinetic parameters from steady-state and non-steady-state cyclic voltammetry at microelectrodes in high-resistance solvents: Application to the fac/mer-[Cr(CO){sub 3}({eta}{sup 3}-Ph{sub 2}PCH{sub 2}CH{sub 2}P(Ph)CH{sub 2}CH{sub 2}PPh{sub 2})]{sup +/0} square reaction sheme in dichloromethane

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bond, A.M.; Feldberg, S.W.; Greenhill, H.B.

1992-05-01

Instrumental, experimental and theoretical approaches required to quantify the thermodynamic and kinetic aspects of the square reaction scheme relating the fac{sup +/0} and mer{sup +/0} redox couples in the high-resistance solvent dichloromethane, at microelectrodes, under both steady-state and fast scan rate (transient) conditions, are presented. fac{sup +}, mer{sup +}, fac{sup 0}, and mer{sup 0} represent the facial and meridional isomers of Cr-(CO){sub 3}({eta}{sup 3}-Ph{sub 2}PCH{sub 2}CH{sub 2}P(Ph)CH{sub 2}CH{sub 2}PPh{sub 2}) in the oxidized 17 electron (fac{sup +}, mer{sup +}) and reduced 18 electron (fac{sup 0}, mer{sup 0}) configurations, respectively. A computationally efficient simulation method based on the DuFort-Frankel algorithm ismore » readily applied to microelectrodes and enables simulations to be undertaken for both steady-state and transient voltammetry at electrodes of microdisk geometry. The minimal ohmic drop present under steady-state conditions enables a limited set of parameters to be calculated for the square scheme. However, data relevant to species generated as a product of electron transfer have to be determined from the transient voltammetry at fast scans rates. For the latter experiments, a newly designed electrochemical cell was developed along with relevant electronic circuitry to minimize the background current and uncompensated resistance. The cell contains two matched working microelectrodes (one in the test solution and one in the separated electrolyte solution) and a common quasi-reference electrode which passes through both compartments of the cell. It is concluded that a judicious choice of steady-state and transient techniques, such as those described in this work, are necessary to characterize complex reaction schemes in high-resistance solvents. 46 refs., 7 figs., 3 tabs.« less

2009 Biometrics Conference

DTIC Science & Technology

2009-01-28

STATEMENT USNORTHCOM ti i t d d t H l d D f d an c pa es an con uc s ome an e ense an Civil Support operations within the assigned area of responsibility... operational goals and objectives of HSPD-24 and make our world a safer place to live and work. Promotional Partners: Increase your company or organization...INFORMATION Ir i tech, Inc. S A I C B o o z A l l e n H a m i l t o n Aware, Inc. H i t ach i A mer i c a , LT D Companies that will be displaying

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The overhead crane settles the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

4D Biofabrication of Branching Multicellular Structures: A Morphogenesis Simulation Based on Turing’s Reaction-Diffusion Dynamics

NASA Astrophysics Data System (ADS)

Zhu, Xiaolu; Yang, Hao

2017-12-01

The recently emerged four-dimensional (4D) biofabrication technique aims to create dynamic three-dimensional (3D) biological structures that can transform their shapes or functionalities with time when an external stimulus is imposed or when cell postprinting self-assembly occurs. The evolution of 3D pattern of branching geometry via self-assembly of cells is critical for 4D biofabrication of artificial organs or tissues with branched geometry. However, it is still unclear that how the formation and evolution of these branching pattern are biologically encoded. We study the 4D fabrication of lung branching structures utilizing a simulation model on the reaction-diffusion mechanism, which is established using partial differential equations of four variables, describing the reaction and diffusion process of morphogens with time during the development process of lung branching. The simulation results present the forming process of 3D branching pattern, and also interpret the behaviors of side branching and tip splitting as the stalk growing, through 3D visualization of numerical simulation.

First-Passage Times in d -Dimensional Heterogeneous Media

NASA Astrophysics Data System (ADS)

Vaccario, G.; Antoine, C.; Talbot, J.

2015-12-01

Although there are many theoretical studies of the mean first-passage time (MFPT), most neglect the diffusive heterogeneity of real systems. We present exact analytical expressions for the MFPT and residence times of a pointlike particle diffusing in a spherically symmetric d -dimensional heterogeneous system composed of two concentric media with different diffusion coefficients with an absorbing inner boundary (target) and a reflecting outer boundary. By varying the convention, e.g., Itō, Stratonovich, or isothermal, chosen to interpret the overdamped Langevin equation with multiplicative noise describing the diffusion process, we find different predictions and counterintuitive results for the residence time in the outer region and hence for the MFPT, while the residence time in the inner region is independent of the convention. This convention dependence of residence times and the MFPT could provide insights about the heterogeneous diffusion in a cell or in a tumor, or for animal and insect searches inside their home range.

Analysis of Particle Transport in DIII-D H-mode Plasma with a Generalized Pinch-Diffusion Model

NASA Astrophysics Data System (ADS)

Owen, L. W.; Stacey, W. M.; Groebner, R. J.; Callen, J. D.; Bonnin, X.

2009-11-01

Interpretative analyses of particle transport in the pedestal region of H-mode plasmas typically yield diffusion coefficients that are very small (<0.1 m^2/s) in the steep gradient region when a purely diffusive particle flux is fitted to the experimental density gradients. Previous evaluation of the particle and momentum balance equations using the experimental data indicated that the pedestal profiles are consistent with transport described by a pinch-diffusion particle flux relation [1]. This type of model is used to calculate the diffusion coefficient and pinch velocity in the core for an inter-ELM H-mode plasma in the DIII-D discharge 98889. Full-plasma SOPLS simulations using neutral beam particle and energy sources from ONETWO calculations and the model transport coefficients show good agreement with the measured density pedestal profile. 6pt [1] W.M. Stacey and R.J. Groebner, Phys. Plasmas 12, 042504 (2005).

Allostery and the dynamic oligomerization of porphobilinogen synthase

PubMed Central

Jaffe, Eileen K.; Lawrence, Sarah H.

2011-01-01

The structural basis for allosteric regulation of porphobilinogen synthase (PBGS) is modulation of a quaternary structure equilibrium between octamer and hexamer (via dimers), which is represented schematically as 8mer ⇔ 2mer ⇔ 2mer* ⇔ 6mer*. The “*” represents a reorientation between two domains of each subunit that occurs in the dissociated state because it is sterically forbidden in the larger multimers. Allosteric effectors of PBGS are both intrinsic and extrinsic and are phylogenetically variable. In some species this equilibrium is modulated intrinsically by magnesium which binds at a site specific to the 8mer. In other species this equilibrium is modulated intrinsically by pH; the guanidinium group of an arginine being spatially equivalent to the allosteric magnesium ion. In humans, disease associated variants all shift the equilibrium toward the 6mer* relative to wild type. The 6mer* has a surface cavity that is not present in the 8mer and is proposed as a small molecule allosteric binding site. In silico and in vitro approaches have revealed species-specific allosteric PBGS inhibitors that stabilize the 6mer*. Some of these inhibitors are drugs in clinical use leading to the hypothesis that extrinsic allosteric inhibition of human PBGS could be a mechanism for drug side effects. PMID:22037356

Deterministic and stochastic models for middle east respiratory syndrome (MERS)

NASA Astrophysics Data System (ADS)

Suryani, Dessy Rizki; Zevika, Mona; Nuraini, Nuning

2018-03-01

World Health Organization (WHO) data stated that since September 2012, there were 1,733 cases of Middle East Respiratory Syndrome (MERS) with 628 death cases that occurred in 27 countries. MERS was first identified in Saudi Arabia in 2012 and the largest cases of MERS outside Saudi Arabia occurred in South Korea in 2015. MERS is a disease that attacks the respiratory system caused by infection of MERS-CoV. MERS-CoV transmission occurs directly through direct contact between infected individual with non-infected individual or indirectly through contaminated object by the free virus. Suspected, MERS can spread quickly because of the free virus in environment. Mathematical modeling is used to illustrate the transmission of MERS disease using deterministic model and stochastic model. Deterministic model is used to investigate the temporal dynamic from the system to analyze the steady state condition. Stochastic model approach using Continuous Time Markov Chain (CTMC) is used to predict the future states by using random variables. From the models that were built, the threshold value for deterministic models and stochastic models obtained in the same form and the probability of disease extinction can be computed by stochastic model. Simulations for both models using several of different parameters are shown, and the probability of disease extinction will be compared with several initial conditions.

Integration of a splicing regulatory network within the meiotic gene expression program of Saccharomyces cerevisiae

PubMed Central

Munding, Elizabeth M.; Igel, A. Haller; Shiue, Lily; Dorighi, Kristel M.; Treviño, Lisa R.; Ares, Manuel

2010-01-01

Splicing regulatory networks are essential components of eukaryotic gene expression programs, yet little is known about how they are integrated with transcriptional regulatory networks into coherent gene expression programs. Here we define the MER1 splicing regulatory network and examine its role in the gene expression program during meiosis in budding yeast. Mer1p splicing factor promotes splicing of just four pre-mRNAs. All four Mer1p-responsive genes also require Nam8p for splicing activation by Mer1p; however, other genes require Nam8p but not Mer1p, exposing an overlapping meiotic splicing network controlled by Nam8p. MER1 mRNA and three of the four Mer1p substrate pre-mRNAs are induced by the transcriptional regulator Ume6p. This unusual arrangement delays expression of Mer1p-responsive genes relative to other genes under Ume6p control. Products of Mer1p-responsive genes are required for initiating and completing recombination and for activation of Ndt80p, the activator of the transcriptional network required for subsequent steps in the program. Thus, the MER1 splicing regulatory network mediates the dependent relationship between the UME6 and NDT80 transcriptional regulatory networks in the meiotic gene expression program. This study reveals how splicing regulatory networks can be interlaced with transcriptional regulatory networks in eukaryotic gene expression programs. PMID:21123654

Synthesis, structure, luminescence, and magnetic properties of a single-ion magnet "mer"-[tris(N-[(imidazol-4-yl)-methylidene]-DL-phenylalaninato)terbium(III) and related "fac"-DL-alaninato derivative.

PubMed

Yamauchi, Suguru; Fujinami, Takeshi; Matsumoto, Naohide; Mochida, Naotaka; Ishida, Takayuki; Sunatsuki, Yukinari; Watanabe, Masayuki; Tsuchimoto, Masanobu; Coletti, Cecilia; Re, Nazzareno

2014-06-16

Two Tb(III) complexes with the same N6O3 donor atoms but different coordination geometries, "fac"-[Tb(III)(HL(DL-ala))3]·7H2O (1) and "mer"-[Tb(III)(HL(DL-phe))3]·7H2O (2), were synthesized, where H2L(DL-ala) and H2L(DL-phe) are N-[(imidazol-4-yl)methylidene]-DL-alanine and -DL-phenylalanine, respectively. Each Tb(III) ion is coordinated by three electronically mononegative NNO tridentate ligands to form a coordination geometry of a tricapped trigonal prism. Compound 1 consists of enantiomers "fac"-[Tb(III)(HL(D-ala))3] and "fac"-[Tb(III)(HL(L-ala))3], while 2 consists of "mer"-[Tb(III)(HL(D-phe))2(HL(L-phe))] and "mer"-[Tb(III)(HL(D-phe))(HL(L-phe))2]. Magnetic data were analyzed by a spin Hamiltonian including the crystal field effect on the Tb(III) ion (4f(8), J = 6, S = 3, L = 3, gJ = 3/2, (7)F6). The Stark splitting of the ground state (7)F6 was evaluated from magnetic analysis, and the energy diagram pattern indicated easy-plane and easy-axis (Ising type) magnetic anisotropies for 1 and 2, respectively. Highly efficient luminescences with Φ = 0.50 and 0.61 for 1 and 2, respectively, were observed, and the luminescence fine structure due to the (5)D4 → (7)F6 transition is in good accordance with the energy diagram determined from magnetic analysis. The energy diagram of 1 shows an approximate single-well potential curve, whereas that of 2 shows a double- or quadruple-well potential within the (7)F6 multiplets. Complex 2 displayed an onset of the out-of-phase signal in alternating current (ac) susceptibility at a direct current bias field of 1000 Oe on cooling down to 1.9 K. A slight frequency dependence was recorded around 2 K. On the other hand, 1 did not show any meaningful out-of-phase ac susceptibility. Pulsed-field magnetizations of 1 and 2 were measured below 1.6 K, and only 2 exhibited magnetic hysteresis. This finding agrees well with the energy diagram pattern from crystal field calculation on 1 and 2. DFT calculation allowed us to estimate the negative charge distribution around the Tb(III) ion, giving a rationale to the different magnetic anisotropies of 1 and 2.

Numerical and experimental modelling of the centrifugal compressor stage - setting the model of impellers with 2D blades

NASA Astrophysics Data System (ADS)

Matas, Richard; Syka, Tomáš; Luňáček, Ondřej

The article deals with a description of results from research and development of a radial compressor stage. The experimental compressor and used numerical models are briefly described. In the first part, the comparisons of characteristics obtained experimentally and by numerical simulations for stage with vaneless diffuser are described. In the second part, the results for stage with vanned diffuser are presented. The results are relevant for next studies in research and development process.

The receptor tyrosine kinase MerTK activates phospholipase C γ2 during recognition of apoptotic thymocytes by murine macrophages

PubMed Central

Todt, Jill C.; Hu, Bin; Curtis, Jeffrey L.

2008-01-01

Apoptotic leukocytes must be cleared efficiently by macrophages (Mø). Apoptotic cell phagocytosis by Mø requires the receptor tyrosine kinase (RTK) MerTK (also known as c-Mer and Tyro12), the phosphatidylserine receptor (PS-R), and the classical protein kinase C (PKC) isoform βII, which translocates to Mø membrane and cytoskeletal fractions in a PS-R-dependent fashion. How these molecules cooperate to induce phagocytosis is unknown. Because the phosphatidylinositol-specific phospholipase (PI-PLC) PLC γ2 is downstream of RTKs in some cell types and can activate classical PKCs, we hypothesized that MerTK signals via PLC γ2. To test this hypothesis, we examined the interaction of MerTK and PLC γ2 in resident murine PMø and in the murine Mø cell line J774A.1 (J774) following exposure to apoptotic thymocytes. We found that, as with PMø, J774 phagocytosis of apoptotic thymocytes was inhibited by antibody against MerTK. Western blotting and immunoprecipitation showed that exposure to apoptotic cells produced three time-dependent changes in PMø and J774: (1) tyrosine phosphorylation of MerTK; (2) association of PLC γ2 with MerTK; and (3) tyrosine phosphorylation of PLC γ2. Phosphorylation of PLC γ2 and its association with MerTK was also induced by cross-linking MerTK using antibody. A PI-PLC appears to be required for phagocytosis of apoptotic cells because the PI-PLC inhibitor Et-18-OCH3 and the PLC inhibitor U73122, but not the inactive control U73343, blocked phagocytosis without impairing adhesion. On apoptotic cell adhesion to Mø, MerTK signals at least in part via PLC γ2. PMID:14704368

Environmental Conditions Constrain the Distribution and Diversity of Archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

USGS Publications Warehouse

Wang, Y.; Boyd, E.; Crane, S.; Lu-Irving, P.; Krabbenhoft, D.; King, S.; Dighton, J.; Geesey, G.; Barkay, T.

2011-01-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient. ?? 2011 Springer Science+Business Media, LLC.

Environmental conditions constrain the distribution and diversity of archaeal merA in Yellowstone National Park, Wyoming, U.S.A.

PubMed

Wang, Yanping; Boyd, Eric; Crane, Sharron; Lu-Irving, Patricia; Krabbenhoft, David; King, Susan; Dighton, John; Geesey, Gill; Barkay, Tamar

2011-11-01

The distribution and phylogeny of extant protein-encoding genes recovered from geochemically diverse environments can provide insight into the physical and chemical parameters that led to the origin and which constrained the evolution of a functional process. Mercuric reductase (MerA) plays an integral role in mercury (Hg) biogeochemistry by catalyzing the transformation of Hg(II) to Hg(0). Putative merA sequences were amplified from DNA extracts of microbial communities associated with mats and sulfur precipitates from physicochemically diverse Hg-containing springs in Yellowstone National Park, Wyoming, using four PCR primer sets that were designed to capture the known diversity of merA. The recovery of novel and deeply rooted MerA lineages from these habitats supports previous evidence that indicates merA originated in a thermophilic environment. Generalized linear models indicate that the distribution of putative archaeal merA lineages was constrained by a combination of pH, dissolved organic carbon, dissolved total mercury and sulfide. The models failed to identify statistically well supported trends for the distribution of putative bacterial merA lineages as a function of these or other measured environmental variables, suggesting that these lineages were either influenced by environmental parameters not considered in the present study, or the bacterial primer sets were designed to target too broad of a class of genes which may have responded differently to environmental stimuli. The widespread occurrence of merA in the geothermal environments implies a prominent role for Hg detoxification in these environments. Moreover, the differences in the distribution of the merA genes amplified with the four merA primer sets suggests that the organisms putatively engaged in this activity have evolved to occupy different ecological niches within the geothermal gradient.

3-O sulfation of heparin leads to hepatotropism and longer circulatory half-life.

PubMed

Miller, Colton M; Xu, Yongmei; Kudrna, Katrina M; Hass, Blake E; Kellar, Brianna M; Egger, Andrew W; Liu, Jian; Harris, Edward N

2018-05-17

Heparins are common blood anticoagulants that are critical for many surgical and biomedical procedures used in modern medicine. In contrast to natural heparin derived from porcine gut mucosa, synthetic heparins are homogenous by mass, polymer length, and chemistry. Stable cell lines expressing the human and mouse Stabilin receptors were used to evaluate endocytosis of natural and synthetic heparin. We chemoenzymatically produced synthetic heparin consisting of 12 sugars (dodecamers) containing 14 sulfate groups resulting in a non-3-O sulfated structure (n12mer). Half of the n12mer was modified with a 3-O sulfate on a single GlcNS sugar producing the 3-O sulfated heparin (12mer). Wildtype (WT), Stabilin-1 knock-out (KO), and Stabilin-2 KO C57BL/6 mice were developed and used for metabolic studies and provided as a source for primary liver sinusoidal endothelial cells. Human and mouse Stabilin-2 receptors had very similar endocytosis rates of both the 12mer and n12mer, suggesting that they are functionally similar in primary cells. Subcutaneous injections of the n12mer and 12mer revealed that the 12mer had a much longer half-life in circulation and a higher accumulation in liver. The n12mer never accumulated in circulation and was readily excreted by the kidneys before liver accumulation could occur. Liver sinusoidal endothelial cells from the Stabilin-2 KO mice had lower uptake rates for both dodecamers, whereas, the Stabilin-1 KO mice had lower endocytosis rates for the 12mer than the n12mer. 3-O sulfation of heparin is correlated to both a longer circulatory half-life and hepatotropism which is largely performed by the Stabilin receptors. Copyright © 2018 Elsevier Ltd. All rights reserved.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches.

PubMed

Almutairy, Meznah; Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method.

Comparing fixed sampling with minimizer sampling when using k-mer indexes to find maximal exact matches

PubMed Central

Torng, Eric

2018-01-01

Bioinformatics applications and pipelines increasingly use k-mer indexes to search for similar sequences. The major problem with k-mer indexes is that they require lots of memory. Sampling is often used to reduce index size and query time. Most applications use one of two major types of sampling: fixed sampling and minimizer sampling. It is well known that fixed sampling will produce a smaller index, typically by roughly a factor of two, whereas it is generally assumed that minimizer sampling will produce faster query times since query k-mers can also be sampled. However, no direct comparison of fixed and minimizer sampling has been performed to verify these assumptions. We systematically compare fixed and minimizer sampling using the human genome as our database. We use the resulting k-mer indexes for fixed sampling and minimizer sampling to find all maximal exact matches between our database, the human genome, and three separate query sets, the mouse genome, the chimp genome, and an NGS data set. We reach the following conclusions. First, using larger k-mers reduces query time for both fixed sampling and minimizer sampling at a cost of requiring more space. If we use the same k-mer size for both methods, fixed sampling requires typically half as much space whereas minimizer sampling processes queries only slightly faster. If we are allowed to use any k-mer size for each method, then we can choose a k-mer size such that fixed sampling both uses less space and processes queries faster than minimizer sampling. The reason is that although minimizer sampling is able to sample query k-mers, the number of shared k-mer occurrences that must be processed is much larger for minimizer sampling than fixed sampling. In conclusion, we argue that for any application where each shared k-mer occurrence must be processed, fixed sampling is the right sampling method. PMID:29389989

Sulforaphane rescues amyloid-β peptide-mediated decrease in MerTK expression through its anti-inflammatory effect in human THP-1 macrophages.

PubMed

Jhang, Kyoung A; Park, Jin-Sun; Kim, Hee-Sun; Chong, Young Hae

2018-03-12

Mer tyrosine kinase (MerTK) activity necessary for amyloid-stimulated phagocytosis strongly implicates that MerTK dysregulation might contribute to chronic inflammation implicated in Alzheimer's disease (AD) pathology. However, the precise mechanism involved in the regulation of MerTK expression by amyloid-β (Aβ) in proinflammatory environment has not yet been ascertained. The objective of this study was to determine the underlying mechanism involved in Aβ-mediated decrease in MerTK expression through Aβ-mediated regulation of MerTK expression and its modulation by sulforaphane in human THP-1 macrophages challenged with Aβ1-42. We used protein preparation, Ca 2+ influx fluorescence imaging, nuclear fractionation, Western blotting techniques, and small interfering RNA (siRNA) knockdown to perform our study. Aβ1-42 elicited a marked decrease in MerTK expression along with increased intracellular Ca 2+ level and induction of proinflammatory cytokines such as IL-1β and TNF-α. Ionomycin A and thapsigargin also increased intracellular Ca 2+ levels and production of IL-1β and TNF-α, mimicking the effect of Aβ1-42. In contrast, the Aβ1-42-evoked responses were attenuated by depletion of Ca 2+ with ethylene glycol tetraacetic acid. Furthermore, recombinant IL-1β or TNF-α elicited a decrease in MerTK expression. However, immunodepletion of IL-1β or TNF-α with neutralizing antibodies significantly inhibited Aβ1-42-mediated downregulation of MerTK expression. Notably, sulforaphane treatment potently inhibited Aβ1-42-induced intracellular Ca 2+ level and rescued the decrease in MerTK expression by blocking nuclear factor-κB (NF-κB) nuclear translocation, thereby decreasing IL-1β and TNF-α production upon Aβ1-42 stimulation. Such adverse effects of sulforaphane were replicated by BAY 11-7082, a NF-κB inhibitor. Moreover, sulforaphane's anti-inflammatory effects on Aβ1-42-induced production of IL-1β and TNF-α were significantly diminished by siRNA-mediated knockdown of MerTK, confirming a critical role of MerTK in suppressing Aβ1-42-induced innate immune response. These findings implicate that targeting of MerTK with phytochemical sulforaphane as a mechanism for preventing Aβ1-42-induced neuroinflammation has potential to be applied in AD therapeutics.

Characterization and Demonstration of the Value of a Lethal Mouse Model of Middle East Respiratory Syndrome Coronavirus Infection and Disease.

PubMed

Tao, Xinrong; Garron, Tania; Agrawal, Anurodh Shankar; Algaissi, Abdullah; Peng, Bi-Hung; Wakamiya, Maki; Chan, Teh-Sheng; Lu, Lu; Du, Lanying; Jiang, Shibo; Couch, Robert B; Tseng, Chien-Te K

2016-01-01

Characterized animal models are needed for studying the pathogenesis of and evaluating medical countermeasures for persisting Middle East respiratory syndrome-coronavirus (MERS-CoV) infections. Here, we further characterized a lethal transgenic mouse model of MERS-CoV infection and disease that globally expresses human CD26 (hCD26)/DPP4. The 50% infectious dose (ID50) and lethal dose (LD50) of virus were estimated to be <1 and 10 TCID50 of MERS-CoV, respectively. Neutralizing antibody developed in the surviving mice from the ID50/LD50 determinations, and all were fully immune to challenge with 100 LD50 of MERS-CoV. The tissue distribution and histopathology in mice challenged with a potential working dose of 10 LD50 of MERS-CoV were subsequently evaluated. In contrast to the overwhelming infection seen in the mice challenged with 10(5) LD50 of MERS-CoV, we were able to recover infectious virus from these mice only infrequently, although quantitative reverse transcription-PCR (qRT-PCR) tests indicated early and persistent lung infection and delayed occurrence of brain infection. Persistent inflammatory infiltrates were seen in the lungs and brain stems at day 2 and day 6 after infection, respectively. While focal infiltrates were also noted in the liver, definite pathology was not seen in other tissues. Finally, using a receptor binding domain protein vaccine and a MERS-CoV fusion inhibitor, we demonstrated the value of this model for evaluating vaccines and antivirals against MERS. As outcomes of MERS-CoV infection in patients differ greatly, ranging from asymptomatic to overwhelming disease and death, having available both an infection model and a lethal model makes this transgenic mouse model relevant for advancing MERS research. Fully characterized animal models are essential for studying pathogenesis and for preclinical screening of vaccines and drugs against MERS-CoV infection and disease. When given a high dose of MERS-CoV, our transgenic mice expressing hCD26/DPP4 viral receptor uniformly succumbed to death within 6 days, making it difficult to evaluate host responses to infection and disease. We further characterized this model by determining both the ID50 and the LD50 of MERS-CoV in order to establish both an infection model and a lethal model for MERS and followed this by investigating the antibody responses and immunity of the mice that survived MERS-CoV infection. Using the estimated LD50 and ID50 data, we dissected the kinetics of viral tissue distribution and pathology in mice challenged with 10 LD50 of virus and utilized the model for preclinical evaluation of a vaccine and drug for treatment of MERS-CoV infection. This further-characterized transgenic mouse model will be useful for advancing MERS research. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

A data-drive analysis for heavy quark diffusion coefficient

NASA Astrophysics Data System (ADS)

Xu, Yingru; Nahrgang, Marlene; Cao, Shanshan; Bernhard, Jonah E.; Bass, Steffen A.

2018-02-01

We apply a Bayesian model-to-data analysis on an improved Langevin framework to estimate the temperature and momentum dependence of the heavy quark diffusion coefficient in the quark-gluon plasma (QGP). The spatial diffusion coefficient is found to have a minimum around 1-3 near Tc in the zero momentum limit, and has a non-trivial momentum dependence. With the estimated diffusion coefficient, our improved Langevin model is able to simultaneously describe the D-meson RAA and v2 in three different systems at RHIC and the LHC.

NCI Researchers Discover Exceptionally Potent Antibodies with Potential for Prophylaxis and Therapy of MERS-Coronavirus Infections | Poster

Cancer.gov

By Andrea Frydl, Contributing Writer In a recent article published in the Journal of Virology, Tianlei Ying, Ph.D., Dimiter Dimitrov, Ph.D., and their colleagues in the Laboratory of Experimental Immunology (LEI), Cancer and Inflammation Program, NCI Center for Cancer Research, reported the identification of three human monoclonal antibodies (m336, m337, and m338) that target

Instructional and Performance Technology in Brazil.

ERIC Educational Resources Information Center

Stone, John H.; Romiszowski, Alexander J.

1982-01-01

Describes the status and trends, achievements, and problems in the development of educational technology (ET) in Brazil. Areas examined include tax incentives for training programs, graduate programs in ET, teleducation and correspondence teaching, and government support of ET programs. Five references are listed. (MER)

Restricted exchange microenvironments for cell culture.

PubMed

Hoh, Jan H; Werbin, Jeffrey L; Heinz, William F

2018-03-01

Metabolite diffusion in tissues produces gradients and heterogeneous microenvironments that are not captured in standard 2D cell culture models. Here we describe restricted exchange environment chambers (REECs) in which diffusive gradients are formed and manipulated on length scales approximating those found in vivo. In REECs, cells are grown in 2D in an asymmetric chamber (<50 μL) formed between a coverglass and a glass bottom cell culture dish separated by a thin (~100 μm) gasket. Diffusive metabolite exchange between the chamber and bulk media occurs through one or more openings micromachined into the coverglass. Cell-generated concentration gradients form radially in REECs with a single round opening (~200 μm diameter). At steady state only cells within several hundred micrometers of the opening experience metabolite concentrations that permit survival which is analogous to diffusive exchange near a capillary in tissue. The chamber dimensions, the openings' shape, size, and number, and the cellular density and metabolic activity define the gradient structure. For example, two parallel slots above confluent cells produce the 1D equivalent of a spheroid. Using REECs, we found that fibroblasts align along the axis of diffusion while MDCK cells do not. MDCK cells do, however, exhibit significant morphological variations along the diffusive gradient.

MerCat: a versatile k-mer counter and diversity estimator for database-independent property analysis obtained from metagenomic and/or metatranscriptomic sequencing data

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, Richard A.; Panyala, Ajay R.; Glass, Kevin A.

MerCat is a parallel, highly scalable and modular property software package for robust analysis of features in next-generation sequencing data. MerCat inputs include assembled contigs and raw sequence reads from any platform resulting in feature abundance counts tables. MerCat allows for direct analysis of data properties without reference sequence database dependency commonly used by search tools such as BLAST and/or DIAMOND for compositional analysis of whole community shotgun sequencing (e.g. metagenomes and metatranscriptomes).

Sparse evidence of MERS-CoV infection among animal workers living in Southern Saudi Arabia during 2012

PubMed Central

Memish, Ziad A; Alsahly, Ahmad; Masri, Malak al; Heil, Gary L; Anderson, Benjamin D; Peiris, Malik; Khan, Salah Uddin; Gray, Gregory C

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an emerging viral pathogen that primarily causes respiratory illness. We conducted a seroprevalence study of banked human serum samples collected in 2012 from Southern Saudi Arabia. Sera from 300 animal workers (17% with daily camel exposure) and 50 non-animal-exposed controls were examined for serological evidence of MERS-CoV infection by a pseudoparticle MERS-CoV spike protein neutralization assay. None of the sera reproducibly neutralized the MERS-CoV-pseudotyped lentiviral vector. These data suggest that serological evidence of zoonotic transmission of MERS-CoV was not common among animal workers in Southern Saudi Arabia during July 2012. PMID:25470665

Molecular recognition of DNA by ligands: Roughness and complexity of the free energy profile

NASA Astrophysics Data System (ADS)

Zheng, Wenwei; Vargiu, Attilio Vittorio; Rohrdanz, Mary A.; Carloni, Paolo; Clementi, Cecilia

2013-10-01

Understanding the molecular mechanism by which probes and chemotherapeutic agents bind to nucleic acids is a fundamental issue in modern drug design. From a computational perspective, valuable insights are gained by the estimation of free energy landscapes as a function of some collective variables (CVs), which are associated with the molecular recognition event. Unfortunately the choice of CVs is highly non-trivial because of DNA's high flexibility and the presence of multiple association-dissociation events at different locations and/or sliding within the grooves. Here we have applied a modified version of Locally-Scaled Diffusion Map (LSDMap), a nonlinear dimensionality reduction technique for decoupling multiple-timescale dynamics in macromolecular systems, to a metadynamics-based free energy landscape calculated using a set of intuitive CVs. We investigated the binding of the organic drug anthramycin to a DNA 14-mer duplex. By performing an extensive set of metadynamics simulations, we observed sliding of anthramycin along the full-length DNA minor groove, as well as several detachments from multiple sites, including the one identified by X-ray crystallography. As in the case of equilibrium processes, the LSDMap analysis is able to extract the most relevant collective motions, which are associated with the slow processes within the system, i.e., ligand diffusion along the minor groove and dissociation from it. Thus, LSDMap in combination with metadynamics (and possibly every equivalent method) emerges as a powerful method to describe the energetics of ligand binding to DNA without resorting to intuitive ad hoc reaction coordinates.

Potential for Mercury Reduction by Microbes in the High Arctic▿

PubMed Central

Poulain, Alexandre J.; Ní Chadhain, Sinéad M.; Ariya, Parisa A.; Amyot, Marc; Garcia, Edenise; Campbell, Peter G. C.; Zylstra, Gerben J.; Barkay, Tamar

2007-01-01

The contamination of polar regions due to the global distribution of anthropogenic pollutants is of great concern because it leads to the bioaccumulation of toxic substances, methylmercury among them, in Arctic food chains. Here we present the first evidence that microbes in the high Arctic possess and express diverse merA genes, which specify the reduction of ionic mercury [Hg(II)] to the volatile elemental form [Hg(0)]. The sampled microbial biomass, collected from microbial mats in a coastal lagoon and from the surface of marine macroalgae, was comprised of bacteria that were most closely related to psychrophiles that had previously been described in polar environments. We used a kinetic redox model, taking into consideration photoredox reactions as well as mer-mediated reduction, to assess if the potential for Hg(II) reduction by Arctic microbes can affect the toxicity and environmental mobility of mercury in the high Arctic. Results suggested that mer-mediated Hg(II) reduction could account for most of the Hg(0) that is produced in high Arctic waters. At the surface, with only 5% metabolically active cells, up to 68% of the mercury pool was resolved by the model as biogenic Hg(0). At a greater depth, because of incident light attenuation, the significance of photoredox transformations declined and merA-mediated activity could account for up to 90% of Hg(0) production. These findings highlight the importance of microbial redox transformations in the biogeochemical cycling, and thus the toxicity and mobility, of mercury in polar regions. PMID:17293515

In vivo lung morphometry with hyperpolarized 3He diffusion MRI: Theoretical background

NASA Astrophysics Data System (ADS)

Sukstanskii, A. L.; Yablonskiy, D. A.

2008-02-01

MRI-based study of 3He gas diffusion in lungs may provide important information on lung microstructure. Lung acinar airways can be described in terms of cylinders covered with alveolar sleeve [Haefeli-Bleuer, Weibel, Anat. Rec. 220 (1988) 401]. For relatively short diffusion times (on the order of a few ms) this geometry allows description of the 3He diffusion attenuated MR signal in lungs in terms of two diffusion coefficients—longitudinal (D) and transverse (D) with respect to the individual acinar airway axis [Yablonskiy et al., PNAS 99 (2002) 3111]. In this paper, empirical relationships between D and D and the geometrical parameters of airways and alveoli are found by means of computer Monte Carlo simulations. The effects of non-Gaussian signal behavior (dependence of D and D on b-value) are also taken into account. The results obtained are quantitatively valid in the physiologically important range of airway parameters characteristic of healthy lungs and lungs with mild emphysema. In lungs with advanced emphysema, the results provide only "apparent" characteristics but still could potentially be used to evaluate emphysema progression. This creates a basis for in vivo lung morphometry—evaluation of the geometrical parameters of acinar airways from hyperpolarized 3He diffusion MRI, despite the airways being too small to be resolved by direct imaging. These results also predict a rather substantial dependence of 3He ADC on the experimentally-controllable diffusion time, Δ. If Δ is decreased from 3 ms to 1 ms, the ADC in normal human lungs may increase by almost 50%. This effect should be taken into account when comparing experimental data obtained with different pulse sequences.

Diversification of the celiac disease α-gliadin complex in wheat: a 33-mer peptide with six overlapping epitopes, evolved following polyploidization.

PubMed

Ozuna, Carmen V; Iehisa, Julio C M; Giménez, María J; Alvarez, Juan B; Sousa, Carolina; Barro, Francisco

2015-06-01

The gluten proteins from wheat, barley and rye are responsible both for celiac disease (CD) and for non-celiac gluten sensitivity, two pathologies affecting up to 6-8% of the human population worldwide. The wheat α-gliadin proteins contain three major CD immunogenic peptides: p31-43, which induces the innate immune response; the 33-mer, formed by six overlapping copies of three highly stimulatory epitopes; and an additional DQ2.5-glia-α3 epitope which partially overlaps with the 33-mer. Next-generation sequencing (NGS) and Sanger sequencing of α-gliadin genes from diploid and polyploid wheat provided six types of α-gliadins (named 1-6) with strong differences in their frequencies in diploid and polyploid wheat, and in the presence and abundance of these CD immunogenic peptides. Immunogenic variants of the p31-43 peptide were found in most of the α-gliadins. Variants of the DQ2.5-glia-α3 epitope were associated with specific types of α-gliadins. Remarkably, only type 1 α-gliadins contained 33-mer epitopes. Moreover, the full immunodominant 33-mer fragment was only present in hexaploid wheat at low abundance, probably as the result of allohexaploidization events from subtype 1.2 α-gliadins found only in Aegilops tauschii, the D-genome donor of hexaploid wheat. Type 3 α-gliadins seem to be the ancestral type as they are found in most of the α-gliadin-expressing Triticeae species. These findings are important for reducing the incidence of CD by the breeding/selection of wheat varieties with low stimulatory capacity of T cells. Moreover, advanced genome-editing techniques (TALENs, CRISPR) will be easier to implement on the small group of α-gliadins containing only immunogenic peptides. © 2015 Society for Experimental Biology and John Wiley & Sons Ltd.

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea

PubMed Central

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran

2016-01-01

Objective To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. Methods The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. Results The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. Discussion The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus. PMID:27508087

Assessment of the risk posed to Singapore by the 2015 Middle East respiratory syndrome outbreak in the Republic of Korea.

PubMed

Zhang, Emma Xuxiao; Oh, Olivia Seen Huey; See, Wanhan; Raj, Pream; James, Lyn; Khan, Kamran; Tey, Jeannie Su Hui

2016-01-01

To assess the public health risk to Singapore posed by the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea in 2015. The likelihood of importation of MERS cases and the magnitude of the public health impact in Singapore were assessed to determine overall risk. Literature on the epidemiology and contextual factors associated with MERS coronavirus infection was collected and reviewed. Connectivity between the Republic of Korea and Singapore was analysed. Public health measures implemented by the two countries were reviewed. The epidemiology of the 2015 MERS outbreak in the Republic of Korea remained similar to the MERS outbreaks in Saudi Arabia. In addition, strong infection control and response measures were effective in controlling the outbreak. In view of the air traffic between Singapore and MERS-affected areas, importation of MERS cases into Singapore is possible. Nonetheless, the risk of a serious public health impact to Singapore in the event of an imported case of MERS would be mitigated by its strong health-care system and established infection control practices. The MERS outbreak was sparked by an exported case from the Middle East, which remains a concern as the reservoir of infection (thought to be camels) continues to exist in the Middle East, and sporadic cases in the community and outbreaks in health-care settings continue to occur there. This risk assessment highlights the need for Singapore to stay vigilant and to continue enhancing core public health capacities to detect and respond to MERS coronavirus.

Characterization of novel monoclonal antibodies against the MERS-coronavirus spike protein and their application in species-independent antibody detection by competitive ELISA.

PubMed

Fukushi, Shuetsu; Fukuma, Aiko; Kurosu, Takeshi; Watanabe, Shumpei; Shimojima, Masayuki; Shirato, Kazuya; Iwata-Yoshikawa, Naoko; Nagata, Noriyo; Ohnishi, Kazuo; Ato, Manabu; Melaku, Simenew Keskes; Sentsui, Hiroshi; Saijo, Masayuki

2018-01-01

Since discovering the Middle East respiratory syndrome coronavirus (MERS-CoV) as a causative agent of severe respiratory illness in the Middle East in 2012, serological testing has been conducted to assess antibody responses in patients and to investigate the zoonotic reservoir of the virus. Although the virus neutralization test is the gold standard assay for MERS diagnosis and for investigating the zoonotic reservoir, it uses live virus and so must be performed in high containment laboratories. Competitive ELISA (cELISA), in which a labeled monoclonal antibody (MAb) competes with test serum antibodies for target epitopes, may be a suitable alternative because it detects antibodies in a species-independent manner. In this study, novel MAbs against the spike protein of MERS-CoV were produced and characterized. One of these MAbs was used to develop a cELISA. The cELISA detected MERS-CoV-specific antibodies in sera from MERS-CoV-infected rats and rabbits immunized with the spike protein of MERS-CoV. The MAb-based cELISA was validated using sera from Ethiopian dromedary camels. Relative to the neutralization test, the cELISA detected MERS-CoV-specific antibodies in 66 Ethiopian dromedary camels with a sensitivity and specificity of 98% and 100%, respectively. The cELISA and neutralization test results correlated well (Pearson's correlation coefficients=0.71-0.76, depending on the cELISA serum dilution). This cELISA may be useful for MERS epidemiological investigations on MERS-CoV infection. Copyright © 2017 Elsevier B.V. All rights reserved.

Restructuring the vocal fold lamina propria with endoscopic microdissection.

PubMed

Bartlett, Rebecca S; Hoffman, Henry T; Dailey, Seth H; Bock, Jonathan M; Klemuk, Sarah A; Askeland, Ryan W; Ahlrichs-Hanson, Jan S; Heaford, Andrew C; Thibeault, Susan L

2013-11-01

The purposes of this preclinical study were to investigate histologic and rheologic outcomes of Microendoscopy of Reinke's space (MERS)-guided minithyrotomy and to assess its instrumentation. Human cadaveric and in vivo animal study. Three human cadaveric larynges were treated with MERS-guided placement of Radiesse VoiceGel and immediately evaluated histologically for biomaterial location. In the second part of this investigation, two scarred porcine larynges were treated with MERS-guided placement of HyStem-VF and rheologically evaluated 6 weeks later. Student t tests determined differences in viscoelastic properties of treated/untreated vocal folds. Sialendoscopes and microendoscopes were subjectively compared for their visualization capacity. MERS imaged the subepithelial area and vocal ligament, guiding both tissue dissection and biomaterial positioning. Sialendoscopes provided adequate visualization and feature incorporated working channels. Enhanced image clarity was created in a gas-filled rather than saline-filled environment, per rater judgment. Histological analysis revealed desirable biomaterial positioning with MERS. Per rheological analysis, viscoelastic properties of the MERS-treated porcine vocal folds compared to uninjured vocal folds 6 weeks following treatment did not statistically differ. MERS-guided laryngoplasty using sialendoscopes yielded satisfactory biomaterial positioning in the short-term and normalized rheologic tissue properties in the long-term, contributing to proof of concept for MERS in the treatment of scarring. Strengths of MERS include direct, real-time visualization of Reinke's space and an ability to manipulate surgical instruments parallel to the vocal fold edge while maintaining an intact epithelium. Future work will explore the clinical utility of MERS for addressing scarring, sulcus vocalis, and other intracordal processes. Copyright © 2013 The American Laryngological, Rhinological and Otological Society, Inc.

PRo3D®: A Tool for High Resolution Rendering and Geological Analysis of Martian Rover-Derived Digital Outcrop Models.

NASA Astrophysics Data System (ADS)

Gupta, S.; Barnes, R.; Ortner, T.; Huber, B.; Paar, G.; Muller, J. P.; Giordano, M.; Willner, K.; Traxler, C.; Juhart, K.; Fritz, L.; Hesina, G.; Tasdelen, E.

2015-12-01

NASA's Mars Exploration Rovers (MER) and Mars Science Laboratory Curiosity Rover (MSL) are proxies for field geologists on Mars, taking high resolution imagery of rock formations and landscapes which is analysed in detail on Earth. Panoramic digital cameras (PanCam on MER and MastCam on MSL) are used for characterising the geology of rock outcrops along rover traverses. A key focus is on sedimentary rocks that have the potential to contain evidence for ancient life on Mars. Clues to determine ancient sedimentary environments are preserved in layer geometries, sedimentary structures and grain size distribution. The panoramic camera systems take stereo images which are co-registered to create 3D point clouds of rock outcrops to be quantitatively analysed much like geologists would do on Earth. The EU FP7 PRoViDE project is compiling all Mars rover vision data into a database accessible through a web-GIS (PRoGIS) and 3D viewer (PRo3D). Stereo-imagery selected in PRoGIS can be rendered in PRo3D, enabling the user to zoom, rotate and translate the 3D outcrop model. Interpretations can be digitised directly onto the 3D surface, and simple measurements can be taken of the dimensions of the outcrop and sedimentary features. Dip and strike is calculated within PRo3D from mapped bedding contacts and fracture traces. Results from multiple outcrops can be integrated in PRoGIS to gain a detailed understanding of the geological features within an area. These tools have been tested on three case studies; Victoria Crater, Yellowknife Bay and Shaler. Victoria Crater, in the Meridiani Planum region of Mars, was visited by the MER-B Opportunity Rover. Erosional widening of the crater produced <15 m high outcrops which expose ancient Martian eolian bedforms. Yellowknife Bay and Shaler were visited in the early stages of the MSL mission, and provide excellent opportunities to characterise Martian fluvio-lacustrine sedimentary features. Development of these tools is crucial to exploitation of vision data from future missions, such as the 2018 ExoMars Rover and the NASA 2020 mission. The research leading to these results has received funding from the European Community's Seventh Framework Programme (FP7/2007-2013) under grant agreement n° 312377 PRoViDE.

Cu diffusivity in granitic melts with application to the formation of porphyry Cu deposits

NASA Astrophysics Data System (ADS)

Ni, Huaiwei; Shi, Huifeng; Zhang, Li; Li, Wan-Cai; Guo, Xuan; Liang, Ting

2018-06-01

We report new experimental data of Cu diffusivity in granite porphyry melts with 0.01 and 3.9 wt% H2O at 0.15-1.0 GPa and 973-1523 K. A diffusion couple method was used for the nominally anhydrous granitic melt, whereas a Cu diffusion-in method using Pt95Cu5 as the source of Cu was applied to the hydrous granitic melt. The diffusion couple experiments also generate Cu diffusion-out profiles due to Cu loss to Pt capsule walls. Cu diffusivities were extracted from error function fits of the Cu concentration profiles measured by LA-ICP-MS. At 1 GPa, we obtain {D_{{Cu, dry, 1 GPa}}}=\\exp [ {( - {13.89} ± {0.42}) - {{12878} ± {540}}/T} ], and {D_{{Cu, 3}{.9 wt% }{{H}2}{O},{ 1 GPa}}}=\\exp [ {( - 16.31 ± 1.30) - {{8148} ± {1670}}/T} ], where D is Cu diffusivity in m2/s and T is temperature in K. The above expressions are in good agreement with a recent study on Cu diffusion in rhyolitic melt using the approach of Cu2S dissolution. The observed pressure effect over 0.15-1.0 GPa can be described by an activation volume of 5.9 cm3/mol for Cu diffusion. Comparison of Cu diffusivity to alkali diffusivity and its variation with melt composition implies fourfold-coordinated Cu+ in silicate melts. Our experimental results indicate that in the formation of porphyry Cu deposits, the diffusive transport of magmatic Cu to sulfide liquids or fluid bubbles is highly efficient. The obtained Cu diffusivity data can also be used to assess whether equilibrium Cu partitioning can be reached within certain experimental durations.

Taking aim at Mer and Axl receptor tyrosine kinases as novel therapeutic targets in solid tumors

PubMed Central

Linger, Rachel M.A.; Keating, Amy K.; Earp, H. Shelton

2010-01-01

Importance of the field Axl and/or Mer expression correlates with poor prognosis in several cancers. Until recently, the specific role of these receptor tyrosine kinases (RTKs) in the development and progression of cancer remained unexplained. Studies demonstrating that Axl and Mer contribute to mechanisms of cell survival, migration, invasion, metastasis, and chemosensitivity justify further investigation of Axl and Mer as novel therapeutic targets in cancer. Areas covered in this review Axl and Mer signaling pathways in cancer cells are summarized and evidence validating these RTKs as therapeutic targets in glioblastoma multiforme, non-small cell lung cancer, and breast cancer is examined. A comprehensive discussion of Axl and/or Mer inhibitors in development is also provided. What the reader will gain Potential toxicities associated with Axl or Mer inhibition are addressed. We hypothesize that the probable action of Mer and Axl inhibitors on cells within the tumor microenvironment will provide a unique therapeutic opportunity to target both tumor cells and the stromal components which facilitate disease progression. Take home message Axl and Mer mediate multiple oncogenic phenotypes and activation of these RTKs constitutes a mechanism of chemoresistance in a variety of solid tumors. Targeted inhibition of these RTKs may be effective as anti-tumor and/or anti-metastatic therapy, particularly if combined with standard cytotoxic therapies. PMID:20809868

Pedagogical Affordances of Multiple External Representations in Scientific Processes

NASA Astrophysics Data System (ADS)

Wu, Hsin-Kai; Puntambekar, Sadhana

2012-12-01

Multiple external representations (MERs) have been widely used in science teaching and learning. Theories such as dual coding theory and cognitive flexibility theory have been developed to explain why the use of MERs is beneficial to learning, but they do not provide much information on pedagogical issues such as how and in what conditions MERs could be introduced and used to support students' engagement in scientific processes and develop competent scientific practices (e.g., asking questions, planning investigations, and analyzing data). Additionally, little is understood about complex interactions among scientific processes and affordances of MERs. Therefore, this article focuses on pedagogical affordances of MERs in learning environments that engage students in various scientific processes. By reviewing literature in science education and cognitive psychology and integrating multiple perspectives, this article aims at exploring (1) how MERs can be integrated with science processes due to their different affordances, and (2) how student learning with MERs can be scaffolded, especially in a classroom situation. We argue that pairing representations and scientific processes in a principled way based on the affordances of the representations and the goals of the activities is a powerful way to use MERs in science education. Finally, we outline types of scaffolding that could help effective use of MERs including dynamic linking, model progression, support in instructional materials, teacher support, and active engagement.

Kmerind: A Flexible Parallel Library for K-mer Indexing of Biological Sequences on Distributed Memory Systems.

PubMed

Pan, Tony; Flick, Patrick; Jain, Chirag; Liu, Yongchao; Aluru, Srinivas

2017-10-09

Counting and indexing fixed length substrings, or k-mers, in biological sequences is a key step in many bioinformatics tasks including genome alignment and mapping, genome assembly, and error correction. While advances in next generation sequencing technologies have dramatically reduced the cost and improved latency and throughput, few bioinformatics tools can efficiently process the datasets at the current generation rate of 1.8 terabases every 3 days. We present Kmerind, a high performance parallel k-mer indexing library for distributed memory environments. The Kmerind library provides a set of simple and consistent APIs with sequential semantics and parallel implementations that are designed to be flexible and extensible. Kmerind's k-mer counter performs similarly or better than the best existing k-mer counting tools even on shared memory systems. In a distributed memory environment, Kmerind counts k-mers in a 120 GB sequence read dataset in less than 13 seconds on 1024 Xeon CPU cores, and fully indexes their positions in approximately 17 seconds. Querying for 1% of the k-mers in these indices can be completed in 0.23 seconds and 28 seconds, respectively. Kmerind is the first k-mer indexing library for distributed memory environments, and the first extensible library for general k-mer indexing and counting. Kmerind is available at https://github.com/ParBLiSS/kmerind.

Mercuric ion reduction and resistance in transgenic Arabidopsis thaliana plants expressing a modified bacterial merA gene.

PubMed Central

Rugh, C L; Wilde, H D; Stack, N M; Thompson, D M; Summers, A O; Meagher, R B

1996-01-01

With global heavy metal contamination increasing, plants that can process heavy metals might provide efficient and ecologically sound approaches to sequestration and removal. Mercuric ion reductase, MerA, converts toxic Hg2+ to the less toxic, relatively inert metallic mercury (Hg0) The bacterial merA sequence is rich in CpG dinucleotides and has a highly skewed codon usage, both of which are particularly unfavorable to efficient expression in plants. We constructed a mutagenized merA sequence, merApe9, modifying the flanking region and 9% of the coding region and placing this sequence under control of plant regulatory elements. Transgenic Arabidopsis thaliana seeds expressing merApe9 germinated, and these seedlings grew, flowered, and set seed on medium containing HgCl2 concentrations of 25-100 microM (5-20 ppm), levels toxic to several controls. Transgenic merApe9 seedlings evolved considerable amounts of Hg0 relative to control plants. The rate of mercury evolution and the level of resistance were proportional to the steady-state mRNA level, confirming that resistance was due to expression of the MerApe9 enzyme. Plants and bacteria expressing merApe9 were also resistant to toxic levels of Au3+. These and other data suggest that there are potentially viable molecular genetic approaches to the phytoremediation of metal ion pollution. Images Fig. 2 Fig. 3 Fig. 4 PMID:8622910

DNA motif elucidation using belief propagation.

PubMed

Wong, Ka-Chun; Chan, Tak-Ming; Peng, Chengbin; Li, Yue; Zhang, Zhaolei

2013-09-01

Protein-binding microarray (PBM) is a high-throughout platform that can measure the DNA-binding preference of a protein in a comprehensive and unbiased manner. A typical PBM experiment can measure binding signal intensities of a protein to all the possible DNA k-mers (k=8∼10); such comprehensive binding affinity data usually need to be reduced and represented as motif models before they can be further analyzed and applied. Since proteins can often bind to DNA in multiple modes, one of the major challenges is to decompose the comprehensive affinity data into multimodal motif representations. Here, we describe a new algorithm that uses Hidden Markov Models (HMMs) and can derive precise and multimodal motifs using belief propagations. We describe an HMM-based approach using belief propagations (kmerHMM), which accepts and preprocesses PBM probe raw data into median-binding intensities of individual k-mers. The k-mers are ranked and aligned for training an HMM as the underlying motif representation. Multiple motifs are then extracted from the HMM using belief propagations. Comparisons of kmerHMM with other leading methods on several data sets demonstrated its effectiveness and uniqueness. Especially, it achieved the best performance on more than half of the data sets. In addition, the multiple binding modes derived by kmerHMM are biologically meaningful and will be useful in interpreting other genome-wide data such as those generated from ChIP-seq. The executables and source codes are available at the authors' websites: e.g. http://www.cs.toronto.edu/∼wkc/kmerHMM.

Middle East Respiratory Syndrome (MERS)

MedlinePlus

Middle East Respiratory Syndrome Coronavirus; MERS-CoV; Novel coronavirus; nCoV ... for Disease Control and Prevention website. Middle East Respiratory Syndrome (MERS): Frequently asked questions and answers. www. ...

Deciphering MERS-CoV Evolution in Dromedary Camels.

PubMed

Du, Lin; Han, Guan-Zhu

2016-02-01

The emergence of the Middle East respiratory syndrome coronavirus (MERS-CoV) poses a potential threat to global public health. Many aspects of the evolution and transmission of MERS-CoV in its animal reservoir remain unclear. A recent study provides new insights into the evolution and transmission of MERS-CoV in dromedary camels. Copyright © 2015 Elsevier Ltd. All rights reserved.

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane lifts the Mars Exploration Rover 2 (MER-2) entry vehicle from its stand to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - With help from workers, the overhead crane lowers the Mars Exploration Rover 2 (MER-2) entry vehicle onto a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane moves the Mars Exploration Rover 2 (MER-2) entry vehicle across the Payload Hazardous Servicing Facility toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - Workers in the Payload Hazardous Servicing Facility help guide the Mars Exploration Rover 2 (MER-2) entry vehicle toward a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - An overhead crane is in place to lift the Mars Exploration Rover 2 (MER-2) entry vehicle to move it to a spin table for a dry-spin test. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch for MER-2 (MER-A) is scheduled for June 5.

Antibodies against MERS coronavirus in dromedary camels, United Arab Emirates, 2003 and 2013.

PubMed

Meyer, Benjamin; Müller, Marcel A; Corman, Victor M; Reusken, Chantal B E M; Ritz, Daniel; Godeke, Gert-Jan; Lattwein, Erik; Kallies, Stephan; Siemens, Artem; van Beek, Janko; Drexler, Jan F; Muth, Doreen; Bosch, Berend-Jan; Wernery, Ulrich; Koopmans, Marion P G; Wernery, Renate; Drosten, Christian

2014-04-01

Middle East respiratory syndrome coronavirus (MERS-CoV) has caused an ongoing outbreak of severe acute respiratory tract infection in humans in the Arabian Peninsula since 2012. Dromedary camels have been implicated as possible viral reservoirs. We used serologic assays to analyze 651 dromedary camel serum samples from the United Arab Emirates; 151 of 651 samples were obtained in 2003, well before onset of the current epidemic, and 500 serum samples were obtained in 2013. Recombinant spike protein-specific immunofluorescence and virus neutralization tests enabled clear discrimination between MERS-CoV and bovine CoV infections. Most (632/651, 97.1%) camels had antibodies against MERS-CoV. This result included all 151 serum samples obtained in 2003. Most (389/651, 59.8%) serum samples had MERS-CoV-neutralizing antibody titers >1,280. Dromedary camels from the United Arab Emirates were infected at high rates with MERS-CoV or a closely related, probably conspecific, virus long before the first human MERS cases.

Thermal Protection System Mass Estimating Relationships For Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

Mass estimating relationships (MERs) are developed to predict the amount of thermal protection system (TPS) necessary for safe Earth entry for blunt-body spacecraft using simple correlations that are non-ITAR and closely match estimates from NASA's highfidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA- 561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER can under predict FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) in dromedary camels in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Yusof, Mohammed F; Eltahir, Yassir M; Serhan, Wissam S; Hashem, Farouk M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem Si; Bensalah, Oum Keltoum A; Al Muhairi, Salama S

2015-06-01

High seroprevalence of Middle East respiratory syndrome corona virus (MERS-CoV) in dromedary camels has been previously reported in United Arab Emirates (UAE). However, the molecular detection of the virus has never been reported before in UAE. Of the 7,803 nasal swabs tested in the epidemiological survey, MERS-CoV nucleic acid was detected by real-time PCR in a total of 126 (1.6 %) camels. Positive camels were detected at the borders with Saudi Arabia and Oman and in camels' slaughter houses. MERS-CoV partial sequences obtained from UAE camels were clustering with human- and camel-derived MERS-CoV sequences in the same geographic area. Results provide further evidence of MERS-CoV zoonosis.

Middle East respiratory syndrome: obstacles and prospects for vaccine development

PubMed Central

Papaneri, Amy B.; Johnson, Reed F.; Wada, Jiro; Bollinger, Laura; Jahrling, Peter B.; Kuhn, Jens H.

2016-01-01

Summary The recent emergence of Middle East respiratory syndrome (MERS) highlights the need to engineer new methods for expediting vaccine development against emerging diseases. However, several obstacles prevent pursuit of a licensable MERS vaccine. First, the lack of a suitable animal model for MERS complicates in vivo testing of candidate vaccines. Second, due to the low number of MERS cases, pharmaceutical companies have little incentive to pursue MERS vaccine production as the costs of clinical trials are high. In addition, the timeline from bench research to approved vaccine use is 10 years or longer. Using novel methods and cost-saving strategies, genetically engineered vaccines can be produced quickly and cost-effectively. Along with progress in MERS animal model development, these obstacles can be circumvented or at least mitigated. PMID:25864502

Measurements of exciton diffusion by degenerate four-wave mixing in CdS1-xSex

NASA Astrophysics Data System (ADS)

Schwab, H.; Pantke, K.-H.; Hvam, J. M.; Klingshirn, C.

1992-09-01

We performed transient-grating experiments to study the diffusion of excitons in CdS1-xSex mixed crystals. The decay of the initially created exciton density grating is well described for t<=1 ns by a stretched-exponential function. For later times this decay changes over to a behavior that is well fitted by a simple exponential function. During resonant excitation of the localized states, we find the diffusion coefficient (D) to be considerably smaller than in the binary compounds CdSe and CdS. At 4.2 K, D is below our experimental resolution which is about 0.025 cm2/s. With increasing lattice temperature (Tlattice) the diffusion coefficient increases. It was therefore possible to prove, in a diffusion experiment, that at Tlattice<=5 K the excitons are localized, while the exciton-phonon interaction leads to a delocalization and thus to the onset of diffusion. It was possible to deduce the diffusion coefficient of the extended excitons as well as the energetic position of the mobility edge.

Response to a small external force and fluctuations of a passive particle in a one-dimensional diffusive environment

NASA Astrophysics Data System (ADS)

Huveneers, François

2018-04-01

We investigate the long-time behavior of a passive particle evolving in a one-dimensional diffusive random environment, with diffusion constant D . We consider two cases: (a) The particle is pulled forward by a small external constant force and (b) there is no systematic bias. Theoretical arguments and numerical simulations provide evidence that the particle is eventually trapped by the environment. This is diagnosed in two ways: The asymptotic speed of the particle scales quadratically with the external force as it goes to zero, and the fluctuations scale diffusively in the unbiased environment, up to possible logarithmic corrections in both cases. Moreover, in the large D limit (homogenized regime), we find an important transient region giving rise to other, finite-size scalings, and we describe the crossover to the true asymptotic behavior.

An assessment of the level of concern among hospital-based health-care workers regarding MERS outbreaks in Saudi Arabia.

PubMed

Abolfotouh, Mostafa A; AlQarni, Ali A; Al-Ghamdi, Suliman M; Salam, Mahmoud; Al-Assiri, Mohammed H; Balkhy, Hanan H

2017-01-03

Middle East Respiratory Syndrome (MERS) is caused by MERS coronavirus (MERS-CoV). More than 80% of reported cases have occurred in Saudi Arabia, with a mortality exceeding 50%. Health-care workers (HCWs) are at risk of acquiring and transmitting this virus, so the concerns of HCWs in Saudi Arabia regarding MERS were evaluated. An anonymous, self-administered, previously validated questionnaire was given to 1031 HCWs at three tertiary hospitals in Saudi Arabia from October to December, 2014. Concerns regarding the disease, its severity and governmental efforts to contain it, as well as disease outcomes were assessed using 31 concern statements in five distinct domains. A total concern score was calculated for each HCW. Multiple regression analyses were used to identify predictors of high concern scores. The average age of participants was 37.1 ± 9.0 years, 65.8% were married and 59.1% were nurses. The majority of respondents (70.4%) felt at risk of contracting a MERS-CoV infection at work, 69.1% felt threatened if a colleague contracted MERS-CoV, 60.9% felt obliged to care for patients infected with MERS-CoV and 87.8% did not feel safe at work using standard precautions. In addition, 87.7% believed that the government should isolate patients with MERS in specialized hospitals, 73.7% agreed with travel restriction to and from areas affected by MERS and 65.3% agreed with avoiding inviting expatriates from such areas. After adjustment for covariates, high concern scores were significantly associated with being a Saudi national (p < 0.001), a non-physician (p < 0.001) and working in the central region (p < 0.001). The majority of respondents reported concern regarding MERS-CoV infection from exposure at work. The overall level of concern may be influenced by previous experience of MERS outbreaks and related cultural issues. The concerns of HCWs may affect their overall effectiveness in an outbreak and should be addressed by incorporating management strategies in outbreak planning.

Phagocytosis of microparticles by alveolar macrophages during acute lung injury requires MerTK.

PubMed

Mohning, Michael P; Thomas, Stacey M; Barthel, Lea; Mould, Kara J; McCubbrey, Alexandria L; Frasch, S Courtney; Bratton, Donna L; Henson, Peter M; Janssen, William J

2018-01-01

Microparticles are a newly recognized class of mediators in the pathophysiology of lung inflammation and injury, but little is known about the factors that regulate their accumulation and clearance. The primary objective of our study was to determine whether alveolar macrophages engulf microparticles and to elucidate the mechanisms by which this occurs. Alveolar microparticles were quantified in bronchoalveolar fluid of mice with lung injury induced by LPS and hydrochloric acid. Microparticle numbers were greatest at the peak of inflammation and declined as inflammation resolved. Isolated, fluorescently labeled particles were placed in culture with macrophages to evaluate ingestion in the presence of endocytosis inhibitors. Ingestion was blocked with cytochalasin D and wortmannin, consistent with a phagocytic process. In separate experiments, mice were treated intratracheally with labeled microparticles, and their uptake was assessed though microscopy and flow cytometry. Resident alveolar macrophages, not recruited macrophages, were the primary cell-ingesting microparticles in the alveolus during lung injury. In vitro, microparticles promoted inflammatory signaling in LPS primed epithelial cells, signifying the importance of microparticle clearance in resolving lung injury. Microparticles were found to have phosphatidylserine exposed on their surfaces. Accordingly, we measured expression of phosphatidylserine receptors on macrophages and found high expression of MerTK and Axl in the resident macrophage population. Endocytosis of microparticles was markedly reduced in MerTK-deficient macrophages in vitro and in vivo. In conclusion, microparticles are released during acute lung injury and peak in number at the height of inflammation. Resident alveolar macrophages efficiently clear these microparticles through MerTK-mediated phagocytosis.

Pigment Epithelium Derived Factor Peptide Protects Murine Hepatocytes from Carbon Tetrachloride-Induced Injury

PubMed Central

Shih, Shou-Chuan; Ho, Tsung-Chuan; Chen, Show-Li; Tsao, Yeou-Ping

2016-01-01

Fibrogenesis is induced by repeated injury to the liver and reactive regeneration and leads eventually to liver cirrhosis. Pigment epithelium derived factor (PEDF) has been shown to prevent liver fibrosis induced by carbon tetrachloride (CCl4). A 44 amino acid domain of PEDF (44-mer) was found to have a protective effect against various insults to several cell types. In this study, we investigated the capability of synthetic 44-mer to protect against liver injury in mice and in primary cultured hepatocytes. Acute liver injury, induced by CCl4, was evident from histological changes, such as cell necrosis, inflammation and apoptosis, and a concomitant reduction of glutathione (GSH) and GSH redox enzyme activities in the liver. Intraperitoneal injection of the 44-mer into CCl4-treated mice abolished the induction of AST and ALT and markedly reduced histological signs of liver injury. The 44-mer treatment can reduce hepatic oxidative stress as evident from lower levels of lipid hydroperoxide, and higher levels of GSH. CCl4 caused a reduction of Bcl-xL, PEDF and PPARγ, which was markedly restored by the 44-mer treatment. Consequently, the 44-mer suppressed liver fibrosis induced by repeated CCl4 injury. Furthermore, our observations in primary culture of rat hepatocytes showed that PEDF and the 44-mer protected primary rat hepatocytes against apoptosis induced by serum deprivation and TGF-β1. PEDF/44-mer induced cell protective STAT3 phosphorylation. Pharmacological STAT3 inhibition prevented the antiapoptotic action of PEDF/44-mer. Among several PEDF receptor candidates that may be responsible for hepatocyte protection, we demonstrated that PNPLA2 was essential for PEDF/44-mer-mediated STAT3 phosphorylation and antiapoptotic activity by using siRNA to selectively knockdown PNPLA2. In conclusion, the PEDF 44-mer protects hepatocytes from single and repeated CCl4 injury. This protective effect may stem from strengthening the counter oxidative stress capacity and induction of hepatoprotective factors. PMID:27384427

Middle East Respiratory Syndrome (MERS)

MedlinePlus

... Controls Cancel Submit Search The CDC Middle East Respiratory Syndrome (MERS) Note: Javascript is disabled or is ... Recommend on Facebook Tweet Share Compartir Middle East Respiratory Syndrome (MERS) is viral respiratory illness that was ...

MERS transmission and risk factors: a systematic review.

PubMed

Park, Ji-Eun; Jung, Soyoung; Kim, Aeran; Park, Ji-Eun

2018-05-02

Since Middle East respiratory syndrome (MERS) infection was first reported in 2012, many studies have analysed its transmissibility and severity. However, the methodology and results of these studies have varied, and there has been no systematic review of MERS. This study reviews the characteristics and associated risk factors of MERS. We searched international (PubMed, ScienceDirect, Cochrane) and Korean databases (DBpia, KISS) for English- or Korean-language articles using the terms "MERS" and "Middle East respiratory syndrome". Only human studies with > 20 participants were analysed to exclude studies with low representation. Epidemiologic studies with information on transmissibility and severity of MERS as well as studies containing MERS risk factors were included. A total of 59 studies were included. Most studies from Saudi Arabia reported higher mortality (22-69.2%) than those from South Korea (20.4%). While the R 0 value in Saudi Arabia was < 1 in all but one study, in South Korea, the R 0 value was 2.5-8.09 in the early stage and decreased to < 1 in the later stage. The incubation period was 4.5-5.2 days in Saudi Arabia and 6-7.8 days in South Korea. Duration from onset was 4-10 days to confirmation, 2.9-5.3 days to hospitalization, 11-17 days to death, and 14-20 days to discharge. Older age and concomitant disease were the most common factors related to MERS infection, severity, and mortality. The transmissibility and severity of MERS differed by outbreak region and patient characteristics. Further studies assessing the risk of MERS should consider these factors.

Activated Microglia Desialylate and Phagocytose Cells via Neuraminidase, Galectin-3, and Mer Tyrosine Kinase

PubMed Central

Nomura, Koji; Vilalta, Anna; Allendorf, David H.; Hornik, Tamara C.

2017-01-01

Activated microglia can phagocytose dying, stressed, or excess neurons and synapses via the phagocytic receptor Mer tyrosine kinase (MerTK). Galectin-3 (Gal-3) can cross-link surface glycoproteins by binding galactose residues that are normally hidden below terminal sialic acid residues. Gal-3 was recently reported to opsonize cells via activating MerTK. We found that LPS-activated BV-2 microglia rapidly released Gal-3, which was blocked by calcineurin inhibitors. Gal-3 bound to MerTK on microglia and to stressed PC12 (neuron-like) cells, and it increased microglial phagocytosis of PC12 cells or primary neurons, which was blocked by inhibition of MerTK. LPS-activated microglia exhibited a sialidase activity that desialylated PC12 cells and could be inhibited by Tamiflu, a neuraminidase (sialidase) inhibitor. Sialidase treatment of PC12 cells enabled Gal-3 to bind and opsonize the live cells for phagocytosis by microglia. LPS-induced microglial phagocytosis of PC12 was prevented by small interfering RNA knockdown of Gal-3 in microglia, lactose inhibition of Gal-3 binding, inhibition of neuraminidase with Tamiflu, or inhibition of MerTK by UNC569. LPS-induced phagocytosis of primary neurons by primary microglia was also blocked by inhibition of MerTK. We conclude that activated microglia release Gal-3 and a neuraminidase that desialylates microglial and PC12 surfaces, enabling Gal-3 binding to PC12 cells and their phagocytosis via MerTK. Thus, Gal-3 acts as an opsonin of desialylated surfaces, and inflammatory loss of neurons or synapses may potentially be blocked by inhibiting neuraminidases, Gal-3, or MerTK. PMID:28500071

Increased Circulating and Urinary Levels of Soluble TAM Receptors in Diabetic Nephropathy.

PubMed

Ochodnicky, Peter; Lattenist, Lionel; Ahdi, Mohamed; Kers, Jesper; Uil, Melissa; Claessen, Nike; Leemans, Jaklien C; Florquin, Sandrine; Meijers, Joost C M; Gerdes, Victor E A; Roelofs, Joris J T H

2017-09-01

TAM receptors (Tyro3, Axl, and Mer) have been implicated in innate immunity. Circulating TAM receptor soluble forms (sTyro3, sAxl, sMer) are related to autoimmune disorders. We investigated TAM and their ligand protein S in patients with diabetes. Urinary and plasma levels of protein S, sTyro3, sAxl, and sMer were determined in 126 patients with diabetes assigned to a normoalbuminuric or macroalbuminuric (urinary albumin excretion <30 mg/24 hours and >300 mg/24 hours, respectively) study group and 18 healthy volunteers. TAM and protein S immunostaining was performed on kidney biopsy specimens from patients with diabetic nephropathy (n = 9) and controls (n = 6). TAM expression and shedding by tubular epithelial cells were investigated by PCR and enzyme-linked immunosorbent assay in an in vitro diabetes model. Patients with macroalbuminuria diabetes had higher circulating levels of sMer and more urinary sTyro3 and sMer than normoalbuminuric diabetics. Increased clearance of sTyro3 and sMer was associated with loss of tubular Tyro3 and Mer expression in diabetic nephropathy tissue and glomerular depositions of protein S. During in vitro diabetes, human kidney cells had down-regulation of Tyro3 and Mer mRNA and increased shedding of sTyro3 and sMer. Renal injury in diabetes is associated with elevated systemic and urine levels of sMer and sTyro3. This is the first study reporting excretion of sTAM receptors in urine, identifying the kidney as a source of sTAM. Copyright © 2017 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015.

PubMed

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-12

As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. A total of 1250 patients (aged 0-109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/.

Case characteristics among Middle East respiratory syndrome coronavirus outbreak and non-outbreak cases in Saudi Arabia from 2012 to 2015

PubMed Central

Alhamlan, F S; Majumder, M S; Brownstein, J S; Hawkins, J; Al-Abdely, H M; Alzahrani, A; Obaid, D A; Al-Ahdal, M N; BinSaeed, A

2017-01-01

Objectives As of 1 November 2015, the Saudi Ministry of Health had reported 1273 cases of Middle East respiratory syndrome (MERS); among these cases, which included 9 outbreaks at several hospitals, 717 (56%) patients recovered, 14 (1%) remain hospitalised and 543 (43%) died. This study aimed to determine the epidemiological, demographic and clinical characteristics that distinguished cases of MERS contracted during outbreaks from those contracted sporadically (ie, non-outbreak) between 2012 and 2015 in Saudi Arabia. Design Data from the Saudi Ministry of Health of confirmed outbreak and non-outbreak cases of MERS coronavirus (CoV) infections from September 2012 through October 2015 were abstracted and analysed. Univariate and descriptive statistical analyses were conducted, and the time between disease onset and confirmation, onset and notification and onset and death were examined. Results A total of 1250 patients (aged 0–109 years; mean, 50.825 years) were reported infected with MERS-CoV. Approximately two-thirds of all MERS cases were diagnosed in men for outbreak and non-outbreak cases. Healthcare workers comprised 22% of all MERS cases for outbreak and non-outbreak cases. Nosocomial infections comprised one-third of all Saudi MERS cases; however, nosocomial infections occurred more frequently in outbreak than non-outbreak cases (p<0.001). Patients contracting MERS during an outbreak were significantly more likely to die of MERS (p<0.001). Conclusions To date, nosocomial infections have fuelled MERS outbreaks. Given that the Kingdom of Saudi Arabia is a worldwide religious travel destination, localised outbreaks may have massive global implications and effective outbreak preventive measures are needed. PMID:28082362

Hospital Outbreak of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Assiri, Abdullah; McGeer, Allison; Perl, Trish M.; Price, Connie S.; Al Rabeeah, Abdullah A.; Cummings, Derek A.T.; Alabdullatif, Zaki N.; Assad, Maher; Almulhim, Abdulmohsen; Makhdoom, Hatem; Madani, Hossam; Alhakeem, Rafat; Al-Tawfiq, Jaffar A.; Cotten, Matthew; Watson, Simon J.; Kellam, Paul; Zumla, Alimuddin I.; Memish, Ziad A.

2013-01-01

BACKGROUND In September 2012, the World Health Organization reported the first cases of pneumonia caused by the novel Middle East respiratory syndrome coronavirus (MERS-CoV). We describe a cluster of health care–acquired MERS-CoV infections. METHODS Medical records were reviewed for clinical and demographic information and determination of potential contacts and exposures. Case patients and contacts were interviewed. The incubation period and serial interval (the time between the successive onset of symptoms in a chain of transmission) were estimated. Viral RNA was sequenced. RESULTS Between April 1 and May 23, 2013, a total of 23 cases of MERS-CoV infection were reported in the eastern province of Saudi Arabia. Symptoms included fever in 20 patients (87%), cough in 20 (87%), shortness of breath in 11 (48%), and gastrointestinal symptoms in 8 (35%); 20 patients (87%) presented with abnormal chest radiographs. As of June 12, a total of 15 patients (65%) had died, 6 (26%) had recovered, and 2 (9%) remained hospitalized. The median incubation period was 5.2 days (95% confidence interval [CI], 1.9 to 14.7), and the serial interval was 7.6 days (95% CI, 2.5 to 23.1). A total of 21 of the 23 cases were acquired by person-to-person transmission in hemodialysis units, intensive care units, or in-patient units in three different health care facilities. Sequencing data from four isolates revealed a single monophyletic clade. Among 217 household contacts and more than 200 health care worker contacts whom we identified, MERS-CoV infection developed in 5 family members (3 with laboratory-confirmed cases) and in 2 health care workers (both with laboratory-confirmed cases). CONCLUSIONS Person-to-person transmission of MERS-CoV can occur in health care settings and may be associated with considerable morbidity. Surveillance and infection-control measures are critical to a global public health response. PMID:23782161

Determination of the effective diffusivity of water in a poly (methyl methacrylate) membrane containing carbon nanotubes using kinetic Monte Carlo simulations.

PubMed

Mermigkis, Panagiotis G; Tsalikis, Dimitrios G; Mavrantzas, Vlasis G

2015-10-28

A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrix and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, D(eff), of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, D(eff) is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for D(eff) as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on D(eff) (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate times and correlated them with the time needed for penetrant water molecules to explore the available large, fast-diffusing CNT pores before Fickian diffusion is reached.

Marangoni-driven chemotaxis, chemotactic collapse, and the Keller-Segel equation

NASA Astrophysics Data System (ADS)

Shelley, Michael; Masoud, Hassan

2013-11-01

Almost by definition, chemotaxis involves the biased motion of motile particles along gradients of a chemical concentration field. Perhaps the most famous model for collective chemotaxis in mathematical biology is the Keller-Segel model, conceived to describe collective aggregation of slime mold colonies in response to an intrinsically produced, and diffusing, chemo-attractant. Heavily studied, particularly in 2D where the system is ``super-critical'', it has been proved that the KS model can develop finite-time singularities - so-called chemotactic collapse - of delta-function type. Here, we study the collective dynamics of immotile particles bound to a 2D interface above a 3D fluid. These particles are chemically active and produce a diffusing field that creates surface-tension gradients along the surface. The resultant Marangoni stresses create flows that carry the particles, possibly concentrating them. Remarkably, we show that this system involving 3D diffusion and fluid dynamics, exactly yields the 2D Keller-Segel model for the surface-flow of active particles. We discuss the consequences of collapse on the 3D fluid dynamics, and generalizations of the fluid-dynamical model.

Limit theorems for Lévy walks in d dimensions: rare and bulk fluctuations

NASA Astrophysics Data System (ADS)

Fouxon, Itzhak; Denisov, Sergey; Zaburdaev, Vasily; Barkai, Eli

2017-04-01

We consider super-diffusive Lévy walks in d≥slant 2 dimensions when the duration of a single step, i.e. a ballistic motion performed by a walker, is governed by a power-law tailed distribution of infinite variance and finite mean. We demonstrate that the probability density function (PDF) of the coordinate of the random walker has two different scaling limits at large times. One limit describes the bulk of the PDF. It is the d-dimensional generalization of the one-dimensional Lévy distribution and is the counterpart of the central limit theorem (CLT) for random walks with finite dispersion. In contrast with the one-dimensional Lévy distribution and the CLT this distribution does not have a universal shape. The PDF reflects anisotropy of the single-step statistics however large the time is. The other scaling limit, the so-called ‘infinite density’, describes the tail of the PDF which determines second (dispersion) and higher moments of the PDF. This limit repeats the angular structure of the PDF of velocity in one step. A typical realization of the walk consists of anomalous diffusive motion (described by anisotropic d-dimensional Lévy distribution) interspersed with long ballistic flights (described by infinite density). The long flights are rare but due to them the coordinate increases so much that their contribution determines the dispersion. We illustrate the concept by considering two types of Lévy walks, with isotropic and anisotropic distributions of velocities. Furthermore, we show that for isotropic but otherwise arbitrary velocity distributions the d-dimensional process can be reduced to a one-dimensional Lévy walk. We briefly discuss the consequences of non-universality for the d  >  1 dimensional fractional diffusion equation, in particular the non-uniqueness of the fractional Laplacian.

Up-Regulation of Soluble Axl and Mer Receptor Tyrosine Kinases Negatively Correlates with Gas6 in Established Multiple Sclerosis Lesions

PubMed Central

Weinger, Jason G.; Omari, Kakuri M.; Marsden, Kurt; Raine, Cedric S.; Shafit-Zagardo, Bridget

2009-01-01

Multiple sclerosis is a disease that is characterized by inflammation, demyelination, and axonal damage; it ultimately forms gliotic scars and lesions that severely compromise the function of the central nervous system. Evidence has shown previously that altered growth factor receptor signaling contributes to lesion formation, impedes recovery, and plays a role in disease progression. Growth arrest-specific protein 6 (Gas6), the ligand for the TAM receptor tyrosine kinase family, consisting of Tyro3, Axl, and Mer, is important for cell growth, survival, and clearance of debris. In this study, we show that levels of membrane-bound Mer (205 kd), soluble Mer (∼150 kd), and soluble Axl (80 kd) were all significantly elevated in homogenates from established multiple sclerosis lesions comprised of both chronic active and chronic silent lesions. Whereas in normal tissue Gas6 positively correlated with soluble Axl and Mer, there was a negative correlation between Gas6 and soluble Axl and Mer in established multiple sclerosis lesions. In addition, increased levels of soluble Axl and Mer were associated with increased levels of mature ADAM17, mature ADAM10, and Furin, proteins that are associated with Axl and Mer solubilization. Soluble Axl and Mer are both known to act as decoy receptors and block Gas6 binding to membrane-bound receptors. These data suggest that in multiple sclerosis lesions, dysregulation of protective Gas6 receptor signaling may prolong lesion activity. PMID:19541935

Inactivation and safety testing of Middle East Respiratory Syndrome Coronavirus

PubMed Central

Kumar, Mia; Mazur, Steven; Ork, Britini L.; Postnikova, Elena; Hensley, Lisa E.; Jahrling, Peter B.; Johnson, Reed; Holbrook, Michael R.

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) is a recently emerged virus that has caused a number of human infections and deaths, primarily in the Middle East. The transmission of MERS-CoV to humans has been proposed to be as a result of contact with camels, but evidence of human-to-human transmission also exists. In order to work with MERS-CoV in a laboratory setting, the US Centers for Disease Control and Prevention (CDC) has determined that MERS-CoV should be handled at a biosafety level (BSL) 3 (BSL-3) biocontainment level. Many processes and procedures used to characterize MERS-CoV and to evaluate samples from MERS-CoV infected animals are more easily and efficiently completed at BSL-2 or lower containment. In order to complete experimental work at BSL-2, demonstration or proof of inactivation is required before removal of specimens from biocontainment laboratories. In the studies presented here, we evaluated typical means of inactivating viruses prior to handling specimens at a lower biocontainment level. We found that Trizol, AVL buffer and gamma irradiation were effective at inactivating MERS-CoV, that formaldehyde-based solutions required at least 30 minutes of contact time in a cell culture system while a mixture of methanol and acetone required 60 minutes to inactivate MERS-CoV. Together, these data provide a foundation for safely inactivating MERS-CoV, and potentially other coronaviruses, prior to removal from biocontainment facilities. PMID:26190637

28-mer Fragment Derived from Enterocin CRL35 Displays an Unexpected Bactericidal Effect on Listeria Cells.

PubMed

Masias, Emilse; Sanches, Paulo R S; Dupuy, Fernando G; Acuna, Leonardo; Bellomio, Augusto; Cilli, Eduardo; Saavedra, Lucila; Minahk, Carlos

2015-01-01

Two shorter peptides derived from enterocin CRL35, a 43-mer bacteriocin, were synthesized i.e. the N-terminal fragment spanning from residues 1 to 15, and a 28-mer fragment that represents the C-terminal of enterocin CRL35, the residues 16 to 43. The separate peptides showed no activity when combined. On one hand, the 28-mer peptide displayed an unpredicted antimicrobial activity. On the other, 15- mer peptide had no consistent anti-Listeria effect. The dissociation constants calculated from experimental data indicated that all peptides could bind at similar extent to the sensitive cells. However, transmembrane electrical potential was not dissipated to the same level by the different peptides; whereas the full-length and the C-terminal 28-mer fragment induced almost full dissipation, 15-mer fragment produced only a slow and incomplete effect. Furthermore, a different interaction of each peptide with membranes was demonstrated based on studies carried out with liposomes, which led us to conclude that activity was related to structure rather than to net positive charges. These results open up the possibility of designing new peptides based on the 28-mer fragment with enhanced activity, which would represent a promising approach for combating Listeria and other pathogens.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, a crane is in place to lift the fairing for the Mars Exploration Rover 2 (MER-2/MER-A). The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - The fairing for the Mars Exploration Rover 2 (MER-2/MER-A) arrives at Launch Complex 17-A, Cape Canaveral Air Force Station. It will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Thermal Protection System Mass Estimating Relationships for Blunt-Body, Earth Entry Spacecraft

NASA Technical Reports Server (NTRS)

Sepka, Steven A.; Samareh, Jamshid A.

2015-01-01

System analysis and design of any entry system must balance the level fidelity for each discipline against the project timeline. One way to inject high fidelity analysis earlier in the design effort is to develop surrogate models for the high-fidelity disciplines. Surrogate models for the Thermal Protection System (TPS) are formulated as Mass Estimating Relationships (MERs). The TPS MERs are presented that predict the amount of TPS necessary for safe Earth entry for blunt-body spacecraft using simple correlations that closely match estimates from NASA's high-fidelity ablation modeling tool, the Fully Implicit Ablation and Thermal Analysis Program (FIAT). These MERs provide a first order estimate for rapid feasibility studies. There are 840 different trajectories considered in this study, and each TPS MER has a peak heating limit. MERs for the vehicle forebody include the ablators Phenolic Impregnated Carbon Ablator (PICA) and Carbon Phenolic atop Advanced Carbon-Carbon. For the aftbody, the materials are Silicone Impregnated Reusable Ceramic Ablator (SIRCA), Acusil II, SLA-561V, and LI-900. The MERs are accurate to within 14% (at one standard deviation) of FIAT prediction, and the most any MER under predicts FIAT TPS thickness is 18.7%. This work focuses on the development of these MERs, the resulting equations, model limitations, and model accuracy.

Direct observation of transcription activator-like effector (TALE) protein dynamics

NASA Astrophysics Data System (ADS)

Cuculis, Luke; Abil, Zhanar; Zhao, Huimin; Schroeder, Charles M.

2014-03-01

In this work, we describe a single molecule assay to probe the site-search dynamics of transcription activator-like effector (TALE) proteins along DNA. In modern genetics, the ability to selectively edit the human genome is an unprecedented development, driven by recent advances in targeted nuclease proteins. Specific gene editing can be accomplished using TALE proteins, which are programmable DNA-binding proteins that can be fused to a nuclease domain. In this way, TALENs are a leading technology that has shown great success in the genomic editing of pluripotent stem cells. A major hurdle facing clinical implementation, however, is the potential for deleterious off-target binding events. For these reasons, a molecular-level understanding of TALE binding and target sequence search on DNA is essential. To this end, we developed a single-molecule fluorescence imaging assay that provides a first-of-its-kind view of the 1-D diffusion of TALE proteins along stretched DNA. Taken together with co-crystal structures of DNA-bound TALEs, our results suggest a rotationally-coupled, major groove tracking model for diffusion. We further report diffusion constants for TALE proteins as a function of salt concentration, consistent with previously described models of 1-D protein diffusion.

Debate on MERS-CoV respiratory precautions: surgical mask or N95 respirators?

PubMed Central

Chung, Jasmine Shimin; Ling, Moi Lin; Seto, Wing Hong; Ang, Brenda Sze Peng; Tambyah, Paul Anantharajah

2014-01-01

Since the emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in mid-2012, there has been controversy over the respiratory precaution recommendations in different guidelines from various international bodies. Our understanding of MERS-CoV is still evolving. Current recommendations on infection control practices are heavily influenced by the lessons learnt from severe acute respiratory syndrome. A debate on respiratory precautions for MERS-CoV was organised by Infection Control Association (Singapore) and the Society of Infectious Disease (Singapore). We herein discuss and present the evidence for surgical masks for the protection of healthcare workers from MERS-CoV. PMID:25017402

pH-independent triple-helix formation with 6-oxocytidine as cytidine analogue.

PubMed

Parsch, U; Engels, J W

2000-07-03

The syntheses of six different phosphoramidite building blocks of 6-oxocytosine and 5-allyl-6-oxocytosine as analogues of N(3)-protonated cytosine are described. These compounds have been incorporated into oligonucleotides by standard solid-phase synthesis. Hybridization of 15-mer Hoogsteen strands with target 21-mer duplexes was investigated. Comparison of the triplex-forming abilities of the different building blocks revealed that: i) 5-allyl substitution has a negative influence on triplex stability, ii) a uniform backbone of the Hoogsteen strand stabilizes triplexes relative to mixed backbones; iii) RNA strands with 6-oxocytidine or 5-allyl-6-oxocytidine do not form a triple helix with the DNA target duplex, probably due to backbone torsional constraints; and (iv) a 15-mer DNA sequence with three isolated 2'-deoxy-6-oxocytidines has the highest T(m) of all cytidine analogues investigated in this study. CD experiments provided further evidence for the presence or absence of triplex structures. In the course of these temperature-dependent CD measurements we were able to detect duplex and triplex melting independent from each other at selected wavelengths. This methodology is especially interesting in cases where UV melting curves show only one transition owing to spectral overlap.

NMR investigation of water diffusion in different biofilm structures.

PubMed

Herrling, Maria P; Weisbrodt, Jessica; Kirkland, Catherine M; Williamson, Nathan H; Lackner, Susanne; Codd, Sarah L; Seymour, Joseph D; Guthausen, Gisela; Horn, Harald

2017-12-01

Mass transfer in biofilms is determined by diffusion. Different mostly invasive approaches have been used to measure diffusion coefficients in biofilms, however, data on heterogeneous biomass under realistic conditions is still missing. To non-invasively elucidate fluid-structure interactions in complex multispecies biofilms pulsed field gradient-nuclear magnetic resonance (PFG-NMR) was applied to measure the water diffusion in five different types of biomass aggregates: one type of sludge flocs, two types of biofilm, and two types of granules. Data analysis is an important issue when measuring heterogeneous systems and is shown to significantly influence the interpretation and understanding of water diffusion. With respect to numerical reproducibility and physico-chemical interpretation, different data processing methods were explored: (bi)-exponential data analysis and the Γ distribution model. Furthermore, the diffusion coefficient distribution in relation to relaxation was studied by D-T 2 maps obtained by 2D inverse Laplace transform (2D ILT). The results show that the effective diffusion coefficients for all biofilm samples ranged from 0.36 to 0.96 relative to that of water. NMR diffusion was linked to biofilm structure (e.g., biomass density, organic and inorganic matter) as observed by magnetic resonance imaging and to traditional biofilm parameters: diffusion was most restricted in granules with compact structures, and fast diffusion was found in heterotrophic biofilms with fluffy structures. The effective diffusion coefficients in the biomass were found to be broadly distributed because of internal biomass heterogeneities, such as gas bubbles, precipitates, and locally changing biofilm densities. Thus, estimations based on biofilm bulk properties in multispecies systems can be overestimated and mean diffusion coefficients might not be sufficiently informative to describe mass transport in biofilms and the near bulk. © 2017 Wiley Periodicals, Inc.

Middle East respiratory syndrome coronavirus: current situation and travel-associated concerns.

PubMed

Al-Tawfiq, Jaffar A; Omrani, Ali S; Memish, Ziad A

2016-06-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 brought back memories of the occurrence of severe acute respiratory syndrome coronavirus (SARS-CoV) in 2002. More than 1500 MERS-CoV cases were recorded in 42 months with a case fatality rate (CFR) of 40%. Meanwhile, 8000 cases of SARS-CoV were confirmed in six months with a CFR of 10%. The clinical presentation of MERS-CoV ranges from mild and non-specific presentation to progressive and severe pneumonia. No predictive signs or symptoms exist to differentiate MERS-CoV from community-acquired pneumonia in hospitalized patients. An apparent heterogeneity was observed in transmission. Most MERS-CoV cases were secondary to large outbreaks in healthcare settings. These cases were secondary to community-acquired cases, which may also cause family outbreaks. Travel-associated MERS infection remains low. However, the virus exhibited a clear tendency to cause large outbreaks outside the Arabian Peninsula as exemplified by the outbreak in the Republic of Korea. In this review, we summarize the current knowledge about MERS-CoV and highlight travel-related issues.

Quality Control for Ordnance

DTIC Science & Technology

1957-01-01

Hafnium 181. . . . . . . . . . . . . . . . . . . . . . . . . Mercury 204.. Chromium 51...43 days I Mercury 197 . . . . . . . . . . . . . . . . . . . . . . . . . 64 hr R u t h i m 103...desfrzlclive T e s i i g , Vol. VI, No. 1, Sum" mer 1947, pp. 9-20. (72) K. Frerichs, "The Cadmium Sulphide X-ray Detector," J o w n d o/ Applied Pkys- its

A Highly Immunogenic and Protective Middle East Respiratory Syndrome Coronavirus Vaccine Based on a Recombinant Measles Virus Vaccine Platform

PubMed Central

Malczyk, Anna H.; Kupke, Alexandra; Prüfer, Steffen; Scheuplein, Vivian A.; Hutzler, Stefan; Kreuz, Dorothea; Beissert, Tim; Bauer, Stefanie; Hubich-Rau, Stefanie; Tondera, Christiane; Eldin, Hosam Shams; Schmidt, Jörg; Vergara-Alert, Júlia; Süzer, Yasemin; Seifried, Janna; Hanschmann, Kay-Martin; Kalinke, Ulrich; Herold, Susanne; Sahin, Ugur; Cichutek, Klaus; Waibler, Zoe; Eickmann, Markus; Becker, Stephan

2015-01-01

ABSTRACT In 2012, the first cases of infection with the Middle East respiratory syndrome coronavirus (MERS-CoV) were identified. Since then, more than 1,000 cases of MERS-CoV infection have been confirmed; infection is typically associated with considerable morbidity and, in approximately 30% of cases, mortality. Currently, there is no protective vaccine available. Replication-competent recombinant measles virus (MV) expressing foreign antigens constitutes a promising tool to induce protective immunity against corresponding pathogens. Therefore, we generated MVs expressing the spike glycoprotein of MERS-CoV in its full-length (MERS-S) or a truncated, soluble variant of MERS-S (MERS-solS). The genes encoding MERS-S and MERS-solS were cloned into the vaccine strain MVvac2 genome, and the respective viruses were rescued (MVvac2-CoV-S and MVvac2-CoV-solS). These recombinant MVs were amplified and characterized at passages 3 and 10. The replication of MVvac2-CoV-S in Vero cells turned out to be comparable to that of the control virus MVvac2-GFP (encoding green fluorescent protein), while titers of MVvac2-CoV-solS were impaired approximately 3-fold. The genomic stability and expression of the inserted antigens were confirmed via sequencing of viral cDNA and immunoblot analysis. In vivo, immunization of type I interferon receptor-deficient (IFNAR−/−)-CD46Ge mice with 2 × 105 50% tissue culture infective doses of MVvac2-CoV-S(H) or MVvac2-CoV-solS(H) in a prime-boost regimen induced robust levels of both MV- and MERS-CoV-neutralizing antibodies. Additionally, induction of specific T cells was demonstrated by T cell proliferation, antigen-specific T cell cytotoxicity, and gamma interferon secretion after stimulation of splenocytes with MERS-CoV-S presented by murine dendritic cells. MERS-CoV challenge experiments indicated the protective capacity of these immune responses in vaccinated mice. IMPORTANCE Although MERS-CoV has not yet acquired extensive distribution, being mainly confined to the Arabic and Korean peninsulas, it could adapt to spread more readily among humans and thereby become pandemic. Therefore, the development of a vaccine is mandatory. The integration of antigen-coding genes into recombinant MV resulting in coexpression of MV and foreign antigens can efficiently be achieved. Thus, in combination with the excellent safety profile of the MV vaccine, recombinant MV seems to constitute an ideal vaccine platform. The present study shows that a recombinant MV expressing MERS-S is genetically stable and induces strong humoral and cellular immunity against MERS-CoV in vaccinated mice. Subsequent challenge experiments indicated protection of vaccinated animals, illustrating the potential of MV as a vaccine platform with the potential to target emerging infections, such as MERS-CoV. PMID:26355094

Multiple Scattering in Clouds: Insights from Three-Dimensional Diffusion/P{sub 1} Theory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davis, Anthony B.; Marshak, Alexander

2001-03-15

In the atmosphere, multiple scattering matters nowhere more than in clouds, and being a product of its turbulence, clouds are highly variable environments. This challenges three-dimensional (3D) radiative transfer theory in a way that easily swamps any available computational resources. Fortunately, the far simpler diffusion (or P{sub 1}) theory becomes more accurate as the scattering intensifies, and allows for some analytical progress as well as computational efficiency. After surveying current approaches to 3D solar cloud-radiation problems from the diffusion standpoint, a general 3D result in steady-state diffusive transport is derived relating the variability-induced change in domain-average flux (i.e., diffuse transmittance)more » to the one-point covariance of internal fluctuations in particle density and in radiative flux. These flux variations follow specific spatial patterns in deliberately hydrodynamical language: radiative channeling. The P{sub 1} theory proves even more powerful when the photon diffusion process unfolds in time as well as space. For slab geometry, characteristic times and lengths that describe normal and transverse transport phenomena are derived. This phenomenology is used to (a) explain persistent features in satellite images of dense stratocumulus as radiative channeling, (b) set limits on current cloud remote-sensing techniques, and (c) propose new ones both active and passive.« less

From SARS to MERS: evidence and speculation.

PubMed

Gao, Hainv; Yao, Hangping; Yang, Shigui; Li, Lanjuan

2016-12-01

The Middle East respiratory syndrome coronavirus (MERS-CoV) is a novel zoonotic pathogen. In 2012, the infectious outbreak caused by MERS-CoV in Saudi Arabia has spread to more than 1600 patients in 26 countries, resulting in over 600 deaths.Without a travel history, few clinical and radiological features can reliably differentiate MERS from SARS. But in real world, comparing with SARS, MERS presents more vaguely defined epidemiology, more severe symptoms, and higher case fatality rate. In this review, we summarize the recent findings in the field of MERS-CoV, especially its molecular virology, interspecies mechanisms, clinical features, antiviral therapies, and the further investigation into this disease. As a newly emerging virus, many questions are not fully answered, including the exact mode of transmission chain, geographical distribution, and animal origins. Furthermore, a new protocol needs to be launched to rapidly evaluate the effects of unproven antiviral drugs and vaccine to fasten the clinical application of new drugs.

Percolation Diffusion into Self-Assembled Mesoporous Silica Microfibres

PubMed Central

Canning, John; Huyang, George; Ma, Miles; Beavis, Alison; Bishop, David; Cook, Kevin; McDonagh, Andrew; Shi, Dongqi; Peng, Gang-Ding; Crossley, Maxwell J.

2014-01-01

Percolation diffusion into long (11.5 cm) self-assembled, ordered mesoporous microfibres is studied using optical transmission and laser ablation inductive coupled mass spectrometry (LA-ICP-MS). Optical transmission based diffusion studies reveal rapid penetration (<5 s, D > 80 μm2∙s−1) of Rhodamine B with very little percolation of larger molecules such as zinc tetraphenylporphyrin (ZnTPP) observed under similar loading conditions. The failure of ZnTPP to enter the microfibre was confirmed, in higher resolution, using LA-ICP-MS. In the latter case, LA-ICP-MS was used to determine the diffusion of zinc acetate dihydrate, D~3 × 10−4 nm2∙s−1. The large differences between the molecules are accounted for by proposing ordered solvent and structure assisted accelerated diffusion of the Rhodamine B based on its hydrophilicity relative to the zinc compounds. The broader implications and applications for filtration, molecular sieves and a range of devices and uses are described. PMID:28348290

Oxygen diffusion in alpha-Al2O3. Ph.D. Thesis

NASA Technical Reports Server (NTRS)

Cawley, J. D.; Halloran, J. W.; Cooper, A. R.

1984-01-01

Oxygen self diffusion coefficients were determined in single crystal alpha-Al2O3 using the gas exchange technique. The samples were semi-infinite slabs cut from five different boules with varying background impurities. The diffusion direction was parallel to the c-axis. The tracer profiles were determined by two techniques, single spectrum proton activation and secondary ion mass spectrometry. The SIMS proved to be a more useful tool. The determined diffusion coefficients, which were insensitive to impurity levels and oxygen partial pressure, could be described by D = .00151 exp (-572kJ/RT) sq m/s. The insensitivities are discussed in terms of point defect clustering. Two independent models are consistent with the findings, the first considers the clusters as immobile point defect traps which buffer changes in the defect chemistry. The second considers clusters to be mobile and oxygen diffusion to be intrinsic behavior, the mechanism for oxygen transport involving neutral clusters of Schottky quintuplets.

Subtitling Television for Deaf Children. M.E.R.: No. 3.

ERIC Educational Resources Information Center

Baker, Robert

Experiments reported in this document were intended to shed light on the linguistic and presentational issues surrounding the provision of a subtitling service for deaf schoolchildren. A series of formal experiments was carried out to evaluate deaf children's appreciation of subtitled television programs. (These experiments are described in detail…

Intravoxel incoherent motion modeling in the kidneys: Comparison of mono-, bi-, and triexponential fit.

PubMed

van Baalen, Sophie; Leemans, Alexander; Dik, Pieter; Lilien, Marc R; Ten Haken, Bennie; Froeling, Martijn

2017-07-01

To evaluate if a three-component model correctly describes the diffusion signal in the kidney and whether it can provide complementary anatomical or physiological information about the underlying tissue. Ten healthy volunteers were examined at 3T, with T 2 -weighted imaging, diffusion tensor imaging (DTI), and intravoxel incoherent motion (IVIM). Diffusion tensor parameters (mean diffusivity [MD] and fractional anisotropy [FA]) were obtained by iterative weighted linear least squares fitting of the DTI data and mono-, bi-, and triexponential fit parameters (D 1 , D 2 , D 3 , f fast2 , f fast3 , and f interm ) using a nonlinear fit of the IVIM data. Average parameters were calculated for three regions of interest (ROIs) (cortex, medulla, and rest) and from fiber tractography. Goodness of fit was assessed with adjusted R 2 ( Radj2) and the Shapiro-Wilk test was used to test residuals for normality. Maps of diffusion parameters were also visually compared. Fitting the diffusion signal was feasible for all models. The three-component model was best able to describe fast signal decay at low b values (b < 50), which was most apparent in Radj2 of the ROI containing high diffusion signals (ROI rest ), which was 0.42 ± 0.14, 0.61 ± 0.11, 0.77 ± 0.09, and 0.81 ± 0.08 for DTI, one-, two-, and three-component models, respectively, and in visual comparison of the fitted and measured S 0 . None of the models showed significant differences (P > 0.05) between the diffusion constant of the medulla and cortex, whereas the f fast component of the two and three-component models were significantly different (P < 0.001). Triexponential fitting is feasible for the diffusion signal in the kidney, and provides additional information. 2 Technical Efficacy: Stage 1 J. MAGN. RESON. IMAGING 2017;46:228-239. © 2016 The Authors Journal of Magnetic Resonance Imaging published by Wiley Periodicals, Inc. on behalf of International Society for Magnetic Resonance in Medicine.

Application of ToFSIMS to Studying Surface Diffusion: Do cocaine and heroin form a two-dimensional gas on surfaces?

NASA Astrophysics Data System (ADS)

Avci, Recep; Maccagnano, Sara; Bohannan, Gary; Gresham, Gary; Groenewold, Gary

2001-03-01

Imaging time-of-flight secondary ion mass spectroscopy ( ToFSIMS) is a practical tool for studying the movement of molecules on material surfaces as a function of time. The high detection sensitivity, rapid data acquisition and reasonable spatial resolution present ideal conditions for such studies. An application of ToFSIMS is presented characterizing the diffusion of large molecules on gold-coated Si wafers. Polydimethylsiloxane (PDMS) was selected for study because it contaminates material surfaces and can be detected easily. Also, the temperature dependent diffusion properties of hydrochlorinated heroin and cocaine are presented as part of a forensic application. While the PDMS diffusion could be explained by a two-dimensional ( 2-D) Brownian motion with a Gaussian probability distribution function (pdf) with a diffusion coefficient of 1.6 μ m^2/sec, the cocaine and to a lesser extent heroin were observed to move nearly freely on the surfaces as though they were part of a 2-D gas evaporating in 2-D from a condensed phase. The results could be described reasonably well using an extreme Lévi pdf with an index of stability α<= 0.01.

Practical estimate of gradient nonlinearity for implementation of apparent diffusion coefficient bias correction.

PubMed

Malkyarenko, Dariya I; Chenevert, Thomas L

2014-12-01

To describe an efficient procedure to empirically characterize gradient nonlinearity and correct for the corresponding apparent diffusion coefficient (ADC) bias on a clinical magnetic resonance imaging (MRI) scanner. Spatial nonlinearity scalars for individual gradient coils along superior and right directions were estimated via diffusion measurements of an isotropicic e-water phantom. Digital nonlinearity model from an independent scanner, described in the literature, was rescaled by system-specific scalars to approximate 3D bias correction maps. Correction efficacy was assessed by comparison to unbiased ADC values measured at isocenter. Empirically estimated nonlinearity scalars were confirmed by geometric distortion measurements of a regular grid phantom. The applied nonlinearity correction for arbitrarily oriented diffusion gradients reduced ADC bias from 20% down to 2% at clinically relevant offsets both for isotropic and anisotropic media. Identical performance was achieved using either corrected diffusion-weighted imaging (DWI) intensities or corrected b-values for each direction in brain and ice-water. Direction-average trace image correction was adequate only for isotropic medium. Empiric scalar adjustment of an independent gradient nonlinearity model adequately described DWI bias for a clinical scanner. Observed efficiency of implemented ADC bias correction quantitatively agreed with previous theoretical predictions and numerical simulations. The described procedure provides an independent benchmark for nonlinearity bias correction of clinical MRI scanners.

Curiosity at Gale crater, Mars: characterization and analysis of the Rocknest sand shadow.

PubMed

Blake, D F; Morris, R V; Kocurek, G; Morrison, S M; Downs, R T; Bish, D; Ming, D W; Edgett, K S; Rubin, D; Goetz, W; Madsen, M B; Sullivan, R; Gellert, R; Campbell, I; Treiman, A H; McLennan, S M; Yen, A S; Grotzinger, J; Vaniman, D T; Chipera, S J; Achilles, C N; Rampe, E B; Sumner, D; Meslin, P-Y; Maurice, S; Forni, O; Gasnault, O; Fisk, M; Schmidt, M; Mahaffy, P; Leshin, L A; Glavin, D; Steele, A; Freissinet, C; Navarro-González, R; Yingst, R A; Kah, L C; Bridges, N; Lewis, K W; Bristow, T F; Farmer, J D; Crisp, J A; Stolper, E M; Des Marais, D J; Sarrazin, P

2013-09-27

The Rocknest aeolian deposit is similar to aeolian features analyzed by the Mars Exploration Rovers (MERs) Spirit and Opportunity. The fraction of sand <150 micrometers in size contains ~55% crystalline material consistent with a basaltic heritage and ~45% x-ray amorphous material. The amorphous component of Rocknest is iron-rich and silicon-poor and is the host of the volatiles (water, oxygen, sulfur dioxide, carbon dioxide, and chlorine) detected by the Sample Analysis at Mars instrument and of the fine-grained nanophase oxide component first described from basaltic soils analyzed by MERs. The similarity between soils and aeolian materials analyzed at Gusev Crater, Meridiani Planum, and Gale Crater implies locally sourced, globally similar basaltic materials or globally and regionally sourced basaltic components deposited locally at all three locations.

Processing of Mars Exploration Rover Imagery for Science and Operations Planning

NASA Technical Reports Server (NTRS)

Alexander, Douglass A.; Deen, Robert G.; Andres, Paul M.; Zamani, Payam; Mortensen, Helen B.; Chen, Amy C.; Cayanan, Michael K.; Hall, Jeffrey R.; Klochko, Vadim S.; Pariser, Oleg;

Multiplexing Short Primers for Viral Family PCR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gardner, S N; Hiddessen, A L; Hara, C A

We describe a Multiplex Primer Prediction (MPP) algorithm to build multiplex compatible primer sets for large, diverse, and unalignable sets of target sequences. The MPP algorithm is scalable to larger target sets than other available software, and it does not require a multiple sequence alignment. We applied it to questions in viral detection, and demonstrated that there are no universally conserved priming sequences among viruses and that it could require an unfeasibly large number of primers ({approx}3700 18-mers or {approx}2000 10-mers) to generate amplicons from all sequenced viruses. We then designed primer sets separately for each viral family, and formore » several diverse species such as foot-and-mouth disease virus, hemagglutinin and neuraminidase segments of influenza A virus, Norwalk virus, and HIV-1.« less

Epidemiology, Genetic Recombination, and Pathogenesis of Coronaviruses.

PubMed

Su, Shuo; Wong, Gary; Shi, Weifeng; Liu, Jun; Lai, Alexander C K; Zhou, Jiyong; Liu, Wenjun; Bi, Yuhai; Gao, George F

2016-06-01

Human coronaviruses (HCoVs) were first described in the 1960s for patients with the common cold. Since then, more HCoVs have been discovered, including those that cause severe acute respiratory syndrome (SARS) and Middle East respiratory syndrome (MERS), two pathogens that, upon infection, can cause fatal respiratory disease in humans. It was recently discovered that dromedary camels in Saudi Arabia harbor three different HCoV species, including a dominant MERS HCoV lineage that was responsible for the outbreaks in the Middle East and South Korea during 2015. In this review we aim to compare and contrast the different HCoVs with regard to epidemiology and pathogenesis, in addition to the virus evolution and recombination events which have, on occasion, resulted in outbreaks amongst humans. Copyright © 2016 Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

BEHAR, Christophe; GUIBERTEAU, Philippe; DUPERRET, Bernard

This paper describes the D&D program that is being implemented at France's High Enrichment Gaseous Diffusion Plant, which was designed to supply France's Military with Highly Enriched Uranium. This plant was definitively shut down in June 1996, following French President Jacques Chirac's decision to end production of Highly Enriched Uranium and dismantle the corresponding facilities.

Nucleocapsid protein-dependent assembly of the RNA packaging signal of Middle East respiratory syndrome coronavirus.

PubMed

Hsin, Wei-Chen; Chang, Chan-Hua; Chang, Chi-You; Peng, Wei-Hao; Chien, Chung-Liang; Chang, Ming-Fu; Chang, Shin C

2018-05-24

Middle East respiratory syndrome coronavirus (MERS-CoV) consists of a positive-sense, single-stranded RNA genome and four structural proteins: the spike, envelope, membrane, and nucleocapsid protein. The assembly of the viral genome into virus particles involves viral structural proteins and is believed to be mediated through recognition of specific sequences and RNA structures of the viral genome. A culture system for the production of MERS coronavirus-like particles (MERS VLPs) was determined and established by electron microscopy and the detection of coexpressed viral structural proteins. Using the VLP system, a 258-nucleotide RNA fragment, which spans nucleotides 19,712 to 19,969 of the MERS-CoV genome (designated PS258(19712-19969) ME ), was identified to function as a packaging signal. Assembly of the RNA packaging signal into MERS VLPs is dependent on the viral nucleocapsid protein. In addition, a 45-nucleotide stable stem-loop substructure of the PS258(19712-19969) ME interacted with both the N-terminal domain and the C-terminal domain of the viral nucleocapsid protein. Furthermore, a functional SARS-CoV RNA packaging signal failed to assemble into the MERS VLPs, which indicated virus-specific assembly of the RNA genome. A MERS-oV RNA packaging signal was identified by the detection of GFP expression following an incubation of MERS VLPs carrying the heterologous mRNA GFP-PS258(19712-19969) ME with virus permissive Huh7 cells. The MERS VLP system could help us in understanding virus infection and morphogenesis.

The proprotein convertase SKI-1/S1P. In vitro analysis of Lassa virus glycoprotein-derived substrates and ex vivo validation of irreversible peptide inhibitors.

PubMed

Pasquato, Antonella; Pullikotil, Philomena; Asselin, Marie-Claude; Vacatello, Manuela; Paolillo, Livio; Ghezzo, Francesca; Basso, Federica; Di Bello, Carlo; Dettin, Monica; Seidah, Nabil G

2006-08-18

Herein we designed, synthesized, tested, and validated fluorogenic methylcoumarinamide (MCA) and chloromethylketone-peptides spanning the Lassa virus GPC cleavage site as substrates and inhibitors for the proprotein convertase SKI-1/S1P. The 7-mer MCA (YISRRLL-MCA) and 8-mer MCA (IYISRRLL-MCA) are very efficiently cleaved with respect to both the 6-mer MCA (ISRRLL-MCA) and point mutated fluorogenic analogues, except for the 7-mer mutant Y253F. The importance of the P7 phenylic residue was confirmed by digestions of two 16-mer non-fluorogenic peptidyl substrates that differ by a single point mutation (Y253A). Because NMR analysis of these 16-mer peptides did not reveal significant structural differences at recognition motif RRLL, the P7 Tyr residue is likely important in establishing key interactions within the catalytic pocket of SKI-1. Based on these data, we established through analysis of pro-ATF6 and pro-SREBP-2 cellular processing that decanoylated chloromethylketone 7-mer, 6-mer, and 4-mer peptides containing the core RRLL sequence are irreversible and potent ex vivo SKI-1 inhibitors. Although caution must be exercised in using these inhibitors in in vitro reactions, as they can also inhibit the basic amino acid-specific convertase furin, within cells and when used at concentrations < or = 100 microM these inhibitors are relatively specific for inhibition of SKI-1 processing events, as opposed to those performed by furin-like convertases.

Public response to MERS-CoV in the Middle East: iPhone survey in six countries.

PubMed

Alqahtani, Amani S; Rashid, Harunor; Basyouni, Mada H; Alhawassi, Tariq M; BinDhim, Nasser F

Gulf Cooperation Council (GCC) countries bear the heaviest brunt of MERS-CoV. This study aims to compare public awareness and practice around MERS-CoV across GCC countries. A cross-sectional survey was conducted using the Gulf Indicators (GI) smartphone app among people in the six GCC countries, namely Saudi Arabia, Kuwait, the United Arab Emirates, Qatar, Bahrain, and Oman. A total of 1812 participants recruited. All were aware of MERS-CoV, yet the perception and practice around MERS-CoV varied widely between countries. Over two thirds were either "not concerned" or "slightly concerned" about contracting MERS-CoV; believing that they were under Allah's (God's) protection (40%) was the most cited reason. While 79% were aware that the disease can transmit through droplet from infected person, only 12% stated that MERS-CoV transmits via camels; people in Saudi Arabia were better aware of the transmission. Nevertheless, only 22% of respondents believed that camels are the zoonotic reservoir of MERS-CoV. Those who were concerned about contracting MERS-CoV (aOR: 1.6, 95% CI: 1.2-2.1, p<0.01) and those who thought MERS-CoV to be a severe disease only for those with high-risk conditions (aOR: 1.5, 95% CI: 1.1-2.1, p<0.01) were more likely to believe that camels are the zoonotic source. However, residents of KSA (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01), UAE (aOR: 0.01, 95% CI: 0.004-0.02, p<0.01) and Kuwait (aOR: 0.03, 95% CI: 0.01-0.07, p<0.01) were less likely to believe that camels are the main zoonotic source compared to respondents from the other countries. Hygienic measures were more commonly adopted than avoidance of camels or their raw products, yet there was a discrepancy between the countries. This study highlights that despite being aware of the ongoing MERS-CoV epidemic; many people lack accurate understanding about MERS-CoV transmission, prevention, and are not fully compliant with preventive measures. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Active screening and surveillance in the United Kingdom for Middle East respiratory syndrome coronavirus in returning travellers and pilgrims from the Middle East: a prospective descriptive study for the period 2013-2015.

PubMed

Atabani, Sowsan F; Wilson, Steven; Overton-Lewis, Clare; Workman, Judith; Kidd, I Michael; Petersen, Eskild; Zumla, Alimuddin; Smit, Erasmus; Osman, Husam

2016-06-01

Over 25000 pilgrims from the UK visit Saudi Arabia every year for the Umrah and Hajj pilgrimages. The recent outbreak of Middle East respiratory syndrome coronavirus (MERS-CoV) in South Korea and the continuing reports of MERS-CoV cases from Saudi Arabia highlight the need for active surveillance for MERS-CoV in returning pilgrims or travellers from the Middle East. Public Health England Birmingham Laboratory (PHEBL) is one of a few selected UK public health laboratories responsible for MERS-CoV screening in travellers returning to the UK from the Middle East who present to hospital with severe respiratory symptoms. The results of the PHEBL MERS-CoV screening and surveillance over the past 3 years is presented. UK travellers/pilgrims who returned from the Middle East and presented to a hospital with respiratory symptoms were studied over the period February 1, 2013 to December 31, 2015. Patients with respiratory symptoms, who satisfied the Public Health England MERS-CoV case algorithm, were tested for MERS-CoV and other respiratory tract viruses on admission to hospital. Two hundred and two patients suspected of having MERS-CoV were tested. None of them had a laboratory-confirmed MERS-CoV infection. A viral aetiology was detected in half (50.3%) of the cases, with rhinoviruses, influenza A (H1N1 and H3N2), and influenza B being most frequent. Peak testing occurred following the annual Hajj season and in other periods of raised national awareness. Respiratory tract infections in travellers/pilgrims returning to the UK from the Middle East are mainly due to rhinoviruses, influenza A, and influenza B. Whilst MERS-CoV was not detected in the 202 patients studied, heightened awareness of the possibility of MERS-CoV and continuous proactive surveillance are essential to rapidly identify cases of MERS-CoV and other seasonal respiratory tract viruses such as avian influenza, in patients presenting to hospital. Early identification and isolation may prevent outbreaks in nosocomial settings. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya

PubMed Central

Deem, Sharon L.; Fèvre, Eric M.; Kinnaird, Margaret; Browne, A. Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B.

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%– 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere. PMID:26473733

Serological Evidence of MERS-CoV Antibodies in Dromedary Camels (Camelus dromedaries) in Laikipia County, Kenya.

PubMed

Deem, Sharon L; Fèvre, Eric M; Kinnaird, Margaret; Browne, A Springer; Muloi, Dishon; Godeke, Gert-Jan; Koopmans, Marion; Reusken, Chantal B

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a recently identified virus causing severe viral respiratory illness in people. Little is known about the reservoir in the Horn of Africa. In Kenya, where no human MERS cases have been reported, our survey of 335 dromedary camels, representing nine herds in Laikipia County, showed a high seroprevalence (46.9%) to MERS-CoV antibodies. Between herd differences were present (14.3%- 82.9%), but was not related to management type or herd isolation. Further research should focus on identifying similarity between MERS-CoV viral isolates in Kenya and clinical isolates from the Middle East and elsewhere.

Methode des Rayons avec Calcul d’Intensite Appliquee a la Propagation Anormale (Method of Ray Intensity Calculation as Applied to Anomalous Propagation),

DTIC Science & Technology

1986-06-01

D’INTENSITE 0 APPLIQUEE A LA PROPAGATION "ANORNALE" par D. Dion DEFENCE RESEARCH ESTABLISHMENT CENTRE DE RECHERCHES POUR LA DEFENSE VALCARTI ER 6- Tel: (418...faqon ils sont reli~s aux conditions atmosph~riques. Les ph~no- manes les plus importants A signaler sont les conduits et les "trous radio". En effet...6tant tr~s fr~quents en mer, 11 est d’int&rt pour la marine de rechercher des m~thodes simples permettant de les caract~riser. Des 6quations d’int

Planar Gradient Diffusion System to Investigate Chemotaxis in a 3D Collagen Matrix.

PubMed

Stout, David A; Toyjanova, Jennet; Franck, Christian

2015-06-12

The importance of cell migration can be seen through the development of human life. When cells migrate, they generate forces and transfer these forces to their surrounding area, leading to cell movement and migration. In order to understand the mechanisms that can alter and/or affect cell migration, one can study these forces. In theory, understanding the fundamental mechanisms and forces underlying cell migration holds the promise of effective approaches for treating diseases and promoting cellular transplantation. Unfortunately, modern chemotaxis chambers that have been developed are usually restricted to two dimensions (2D) and have complex diffusion gradients that make the experiment difficult to interpret. To this end, we have developed, and describe in this paper, a direct-viewing chamber for chemotaxis studies, which allows one to overcome modern chemotaxis chamber obstacles able to measure cell forces and specific concentration within the chamber in a 3D environment to study cell 3D migration. More compelling, this approach allows one to successfully model diffusion through 3D collagen matrices and calculate the coefficient of diffusion of a chemoattractant through multiple different concentrations of collagen, while keeping the system simple and user friendly for traction force microscopy (TFM) and digital volume correlation (DVC) analysis.

Successful recovery of MERS CoV pneumonia in a patient with acquired immunodeficiency syndrome: a case report.

PubMed

Shalhoub, Sarah; AlZahrani, Abdulwahab; Simhairi, Raed; Mushtaq, Adnan

2015-01-01

Middle East Respiratory Syndrome Coronavirus (MERS CoV) may cause severe pneumonia with significant morbidity and mortality, particularly in patients with multiple comorbid condition. MERS CoV pneumonia has not been previously reported in patients with Human Immunodeficiency Virus (HIV). Herein, we report a case of MERS CoV pneumonia with a successful outcome in a patient recently diagnosed with HIV. Copyright © 2014 Elsevier B.V. All rights reserved.

A Unified Approach to Diffusion Direction Sensitive Slice Registration and 3-D DTI Reconstruction From Moving Fetal Brain Anatomy

PubMed Central

Fogtmann, Mads; Seshamani, Sharmishtaa; Kroenke, Christopher; Cheng, Xi; Chapman, Teresa; Wilm, Jakob; Rousseau, François

2014-01-01

This paper presents an approach to 3-D diffusion tensor image (DTI) reconstruction from multi-slice diffusion weighted (DW) magnetic resonance imaging acquisitions of the moving fetal brain. Motion scatters the slice measurements in the spatial and spherical diffusion domain with respect to the underlying anatomy. Previous image registration techniques have been described to estimate the between slice fetal head motion, allowing the reconstruction of 3-D a diffusion estimate on a regular grid using interpolation. We propose Approach to Unified Diffusion Sensitive Slice Alignment and Reconstruction (AUDiSSAR) that explicitly formulates a process for diffusion direction sensitive DW-slice-to-DTI-volume alignment. This also incorporates image resolution modeling to iteratively deconvolve the effects of the imaging point spread function using the multiple views provided by thick slices acquired in different anatomical planes. The algorithm is implemented using a multi-resolution iterative scheme and multiple real and synthetic data are used to evaluate the performance of the technique. An accuracy experiment using synthetically created motion data of an adult head and a experiment using synthetic motion added to sedated fetal monkey dataset show a significant improvement in motion-trajectory estimation compared to a state-of-the-art approaches. The performance of the method is then evaluated on challenging but clinically typical in utero fetal scans of four different human cases, showing improved rendition of cortical anatomy and extraction of white matter tracts. While the experimental work focuses on DTI reconstruction (second-order tensor model), the proposed reconstruction framework can employ any 5-D diffusion volume model that can be represented by the spatial parameterizations of an orientation distribution function. PMID:24108711

Monte Carlo simulation of evaporation-driven self-assembly in suspensions of colloidal rods

NASA Astrophysics Data System (ADS)

Lebovka, Nikolai I.; Vygornitskii, Nikolai V.; Gigiberiya, Volodymyr A.; Tarasevich, Yuri Yu.

2016-12-01

The vertical drying of a colloidal film containing rodlike particles was studied by means of kinetic Monte Carlo (MC) simulation. The problem was approached using a two-dimensional square lattice, and the rods were represented as linear k -mers (i.e., particles occupying k adjacent sites). The initial state before drying was produced using a model of random sequential adsorption (RSA) with isotropic orientations of the k -mers (orientation of the k -mers along horizontal x and vertical y directions are equiprobable). In the RSA model, overlapping of the k -mers is forbidden. During the evaporation, an upper interface falls with a linear velocity of u in the vertical direction and the k -mers undergo translation Brownian motion. The MC simulations were run at different initial concentrations, pi, (pi∈[0 ,pj] , where pj is the jamming concentration), lengths of k -mers (k ∈[1 ,12 ] ), and solvent evaporation rates, u . For completely dried films, the spatial distributions of k -mers and their electrical conductivities in both x and y directions were examined. Significant evaporation-driven self-assembly and orientation stratification of the k -mers oriented along the x and y directions were observed. The extent of stratification increased with increasing value of k . The anisotropy of the electrical conductivity of the film can be finely regulated by changes in the values of pi, k , and u .

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - After arriving at Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off its transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) reaches the top of the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted off the transporter. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is moved inside the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5..

Preparation and Single-Crystal X-Ray Structures of Four Related Mixed-Ligand 4-Methylpyridine Indium Halide Complexes

NASA Technical Reports Server (NTRS)

Hepp, Aloysius F.; Clark, Eric B.; Schupp, John D.; Williams, Jennifer N.; Duraj, Stan A.; Fanwick, Philip E.

2013-01-01

We describe the structures of four related indium complexes obtained during synthesis of solid-state materials precursors. Indium adducts of halides and 4-methylpyridine, InX3(pic)3 (X = Cl, Br; pic = 4-methylpyridine) consist of octahedral molecules with meridional (mer) geometry. Crystals of mer-InCl3(pic)3 (1) are triclinic, space group P1(bar) (No. 2), with a = 9.3240(3), b = 13.9580(6), c = 16.7268 (7) A, alpha = 84.323(2), beta = 80.938(2), gamma = 78.274(3)Z = 4, R = 0.035 for 8820 unique reflections. Crystals of mer-InBr3(pic)3 (2) are monoclinic, space group P21/n (No. 14), with a = 15.010(2), b = 19.938(2), c = 16.593(3), beta = 116.44(1)Z = 8, R = 0.053 for 4174 unique reflections. The synthesis and structures of related compounds with phenylsulfide (chloride) (3) and a dimeric complex with bridging hydroxide (bromide) (4) coordination is also described. Crystals of trans-In(SC6H5)Cl2(pic)3 (3) are monoclinic, space group P21/n (No. 14), with a = 9.5265(2), b = 17.8729(6), c = 13.8296(4), beta = 99.7640(15)Z = 4, R = 0.048 for 5511 unique reflections. Crystals of [In(mu-OH)Br2(pic)22 (4) are tetragonal, space group = I41cd (No. 110) with a = 19.8560(4), b = 19.8560(4), c = 25.9528(6), Z = 8, R = 0.039 for 5982 unique reflections.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mermigkis, Panagiotis G.; Tsalikis, Dimitrios G.; Institute of Chemical Engineering and High Temperature Chemical Processes, GR 26500 Patras

A kinetic Monte Carlo (kMC) simulation algorithm is developed for computing the effective diffusivity of water molecules in a poly(methyl methacrylate) (PMMA) matrix containing carbon nanotubes (CNTs) at several loadings. The simulations are conducted on a cubic lattice to the bonds of which rate constants are assigned governing the elementary jump events of water molecules from one lattice site to another. Lattice sites belonging to PMMA domains of the membrane are assigned different rates than lattice sites belonging to CNT domains. Values of these two rate constants are extracted from available numerical data for water diffusivity within a PMMA matrixmore » and a CNT pre-computed on the basis of independent atomistic molecular dynamics simulations, which show that water diffusivity in CNTs is 3 orders of magnitude faster than in PMMA. Our discrete-space, continuum-time kMC simulation results for several PMMA-CNT nanocomposite membranes (characterized by different values of CNT length L and diameter D and by different loadings of the matrix in CNTs) demonstrate that the overall or effective diffusivity, D{sub eff}, of water in the entire polymeric membrane is of the same order of magnitude as its diffusivity in PMMA domains and increases only linearly with the concentration C (vol. %) in nanotubes. For a constant value of the concentration C, D{sub eff} is found to vary practically linearly also with the CNT aspect ratio L/D. The kMC data allow us to propose a simple bilinear expression for D{sub eff} as a function of C and L/D that can describe the numerical data for water mobility in the membrane extremely accurately. Additional simulations with two different CNT configurations (completely random versus aligned) show that CNT orientation in the polymeric matrix has only a minor effect on D{sub eff} (as long as CNTs do not fully penetrate the membrane). We have also extensively analyzed and quantified sublinear (anomalous) diffusive phenomena over small to moderate times and correlated them with the time needed for penetrant water molecules to explore the available large, fast-diffusing CNT pores before Fickian diffusion is reached.« less

Influence of anisotropy on percolation and jamming of linear k-mers on square lattice with defects

NASA Astrophysics Data System (ADS)

Tarasevich, Yu Yu; Laptev, V. V.; Burmistrov, A. S.; Shinyaeva, T. S.

2015-09-01

By means of the Monte Carlo simulation, we study the layers produced by the random sequential adsorption of the linear rigid objects (k-mers also known as rigid or stiff rods, sticks, needles) onto the square lattice with defects in the presence of an external field. The value of k varies from 2 to 32. The point defects randomly and uniformly placed on the substrate hinder adsorption of the elongated objects. The external field affects isotropic deposition of the particles, consequently the deposited layers are anisotropic. We study the influence of the defect concentration, the length of the objects, and the external field on the percolation threshold and the jamming concentration. Our main findings are (i) the critical defect concentration at which the percolation never occurs even at jammed state decreases for short k-mers (k < 16) and increases for long k-mers (k > 16) as anisotropy increases, (ii) the corresponding critical k-mer concentration decreases with anisotropy growth, (iii) the jamming concentration decreases drastically with growth of k-mer length for any anisotropy, (iv) for short k-mers, the percolation threshold is almost insensitive to the defect concentration for any anisotropy.

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan.

PubMed

van Doremalen, Neeltje; Hijazeen, Zaidoun S K; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M; Munster, Vincent J; Richt, Juergen A

2017-02-01

Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks.

Field-scale effective matrix diffusion coefficient for fractured rock: results from literature survey.

PubMed

Zhou, Quanlin; Liu, Hui-Hai; Molz, Fred J; Zhang, Yingqi; Bodvarsson, Gudmundur S

2007-08-15

Matrix diffusion is an important mechanism for solute transport in fractured rock. We recently conducted a literature survey on the effective matrix diffusion coefficient, D(m)(e), a key parameter for describing matrix diffusion processes at the field scale. Forty field tracer tests at 15 fractured geologic sites were surveyed and selected for the study, based on data availability and quality. Field-scale D(m)(e) values were calculated, either directly using data reported in the literature, or by reanalyzing the corresponding field tracer tests. The reanalysis was conducted for the selected tracer tests using analytic or semi-analytic solutions for tracer transport in linear, radial, or interwell flow fields. Surveyed data show that the scale factor of the effective matrix diffusion coefficient (defined as the ratio of D(m)(e) to the lab-scale matrix diffusion coefficient, D(m), of the same tracer) is generally larger than one, indicating that the effective matrix diffusion coefficient in the field is comparatively larger than the matrix diffusion coefficient at the rock-core scale. This larger value can be attributed to the many mass-transfer processes at different scales in naturally heterogeneous, fractured rock systems. Furthermore, we observed a moderate, on average trend toward systematic increase in the scale factor with observation scale. This trend suggests that the effective matrix diffusion coefficient is likely to be statistically scale-dependent. The scale-factor value ranges from 0.5 to 884 for observation scales from 5 to 2000 m. At a given scale, the scale factor varies by two orders of magnitude, reflecting the influence of differing degrees of fractured rock heterogeneity at different geologic sites. In addition, the surveyed data indicate that field-scale longitudinal dispersivity generally increases with observation scale, which is consistent with previous studies. The scale-dependent field-scale matrix diffusion coefficient (and dispersivity) may have significant implications for assessing long-term, large-scale radionuclide and contaminant transport events in fractured rock, both for nuclear waste disposal and contaminant remediation.

Effects of pH2O, pH2 and fO2 on the Diffusion of H-Bearing Species in Lunar Basalt and an Iron-Free Basaltic Analog at 1 atm

NASA Astrophysics Data System (ADS)

Newcombe, M. E.; Beckett, J. R.; Baker, M. B.; Newman, S.; Guan, Y.; Eiler, J. M.; Stolper, E. M.

2016-12-01

We have conducted water diffusion experiments in synthetic Apollo 15 "yellow glass" (LG) and an iron-free basaltic analog melt (AD) at 1 atm and 1350 °C over a range of fO2 conditions from IW-2.2 to IW+6.7 and over a range of pH2/pH2O from nominally zero to 10. The water concentrations measured in our quenched experimental glasses by SIMS and FTIR vary from a few ppm to 430 ppm. Many studies of water diffusion at higher water concentrations indicate that the apparent diffusivity of total water (D*water; see [1]) in silicate melts is highly concentration dependent at water contents >0.1 wt% (e.g., [1]). However, water concentration gradients in each of our AD and LG experiments are well described by models in which D*water is assumed to be constant. Best-fit values of D*water obtained for our AD and LG experiments are consistent with a modified speciation model [2] in which both molecular water and hydroxyl are allowed to diffuse, and in which hydroxyl is the dominant diffusing species at the low total water concentrations of our experiments. Water concentration gradients generated during hydration and dehydration experiments conducted simultaneously propagate approximately equal distances into the melt and have the same concentration of water dissolved in the melt at the melt-vapor interface, suggesting that hydration and dehydration are symmetric under the conditions of our experiments. Best-fit values of D*water for our LG experiments vary within a factor of 2 over a range of pH2/pH2O from 0.007 to 9.7 (a range of ƒO2 from IW-2.2 to IW+4.9) and a water concentration range from 80 ppm to 280 ppm. The relative insensitivity of D*water to variations in pH2 suggests that loss of H during the degassing of the lunar melts described by [3] was not primarily by loss of dissolved H2. The value of D*water chosen by [3] for modeling diffusive degassing of lunar volcanic glasses is within a factor of three of our measured value in LG melt at 1350 °C. [1] Zhang et al. (1991) GCA 55, 441-456; [2] Ni et al. (2013) GCA 103, 36-48; [3] Saal et al. (2008) Nature 454, 192-195.

Oligomerization of uridine phosphorimidazolides on montmorillonite: a model for the prebiotic synthesis of RNA on minerals

NASA Technical Reports Server (NTRS)

Ding, P. Z.; Kawamura, K.; Ferris, J. P.

1996-01-01

The 5'-phosphorimidazolide of uridine reacts on Na(+)-montmorillonite 22A in aqueous solution to give oligomers as long as 7 mers. The maximum chain length increases to 9 mers and the overall oligomer yield increases when 9:1 ImpU, A5' ppA mixtures react under the same conditions. The oligomer yield and maximum chain length decreases with the structure of the added pyrophosphate in the order A5' ppA > A5' ppU > U5' ppU. Structure analysis of individual oligomer fractions was performed by selective enzymatic hydrolyses followed by HPLC analysis of the products. The regioselectivity for 3',5'-bond formation is 80-90% in the 9:1 ImpU, A5' ppA reaction, a percentage comparable to that observed in the 9:1 ImpA, A5' ppA reaction. Oligomerization of ImpU is inhibited by addition of dA5' ppdA, and MeppA. No oligomers containing A5' ppU were products of the 9:1 ImpU,A5' ppA reaction, a finding consistent with the simple addition of the ImpU to the A5' ppA and not the rearrangement of an ImpU-A5' ppA adduct. Concentrations of lysine or arginine which were close to that of the ImpU did not inhibit oligomer formation. Treatment of Na(+)-montmorillonite with 1 M arginine yielded arginine-montmorillonite, an amino acid-mineral adduct which did not catalyze ImpU oligomerization. Neither the 4-9 mers formed in the 9:1 ImpU, A5' ppA reaction nor the 4-9 mers formed by the base hydrolysis of poly(U) served as templates for the formation of oligo(A)s.

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age

PubMed Central

Wernery, Ulrich; Rasoul, IHassab El; Wong, Emily YM; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan KL; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna KP; Woo, Patrick CY

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted. PMID:26632876

Mitogenic signals and transforming potential of Nyk, a newly identified neural cell adhesion molecule-related receptor tyrosine kinase.

PubMed Central

Ling, L; Kung, H J

1995-01-01

Nyk/Mer is a recently identified receptor tyrosine kinase with neural cell adhesion molecule-like structure (two immunoglobulin G-like domains and two fibronectin III-like domains) in its extracellular region and belongs to the Ufo/Axl family of receptors. The ligand for Nyk/Mer is presently unknown, as are the signal transduction pathways mediated by this receptor. We constructed and expressed a chimeric receptor (Fms-Nyk) composed of the extracellular domain of the human colony-stimulating factor 1 receptor (Fms) and the transmembrane and cytoplasmic domains of human Nyk/Mer in NIH 3T3 fibroblasts in order to investigate the mitogenic signaling and biochemical properties of Nyk/Mer. Colony-stimulating factor 1 stimulation of the Fms-Nyk chimeric receptor in transfected NIH 3T3 fibroblasts leads to a transformed phenotype and generates a proliferative response in the absence of other growth factors. We show that phospholipase C gamma, phosphatidylinositol 3-kinase/p70 S6 kinase, Shc, Grb2, Raf-1, and mitogen-activated protein kinase are downstream components of the Nyk/Mer signal transduction pathways. In addition, Nyk/Mer weakly activates p90rsk, while stress-activated protein kinase, Ras GTPase-activating protein (GAP), and GAP-associated p62 and p190 proteins are not activated or tyrosine phosphorylated by Nyk/Mer. An analysis comparing the Nyk/Mer signal cascade with that of the epidermal growth factor receptor indicates substrate preferences by these two receptors. Our results provide a detailed description of the Nyk/Mer signaling pathways. Given the structural similarity between the Ufo/Axl family receptors, some of the information may also be applied to other members of this receptor tyrosine kinase family. PMID:8524223

Epidemiological investigation of Middle East respiratory syndrome coronavirus in dromedary camel farms linked with human infection in Abu Dhabi Emirate, United Arab Emirates.

PubMed

Muhairi, Salama Al; Hosani, Farida Al; Eltahir, Yassir M; Mulla, Mariam Al; Yusof, Mohammed F; Serhan, Wissam S; Hashem, Farouq M; Elsayed, Elsaeid A; Marzoug, Bahaaeldin A; Abdelazim, Assem S

2016-12-01

The objective of this research was to investigate the prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) infection primarily in dromedary camel farms and the relationship of those infections with infections in humans in the Emirate of Abu Dhabi. Nasal swabs from 1113 dromedary camels (39 farms) and 34 sheep (1 farm) and sputum samples from 2 MERS-CoV-infected camel farm owners and 1 MERS-CoV-infected sheep farm owner were collected. Samples from camels and humans underwent real-time reverse-transcription quantitative PCR screening to detect MERS-CoV. In addition, sequencing and phylogenetic analysis of partially characterized MERS-CoV genome fragments obtained from camels were performed. Among the 40 farms, 6 camel farms were positive for MERS-CoV; the virus was not detected in the single sheep farm. The maximum duration of viral shedding from infected camels was 2 weeks after the first positive test result as detected in nasal swabs and in rectal swabs obtained from infected calves. Three partial camel sequences characterized in this study (open reading frames 1a and 1ab, Spike1, Spike2, and ORF4b) together with the corresponding regions of previously reported MERS-CoV sequence obtained from one farm owner were clustering together within the larger MERS-CoV sequences cluster containing human and camel isolates reported for the Arabian Peninsula. Data provided further evidence of the zoonotic potential of MERS-CoV infection and strongly suggested that camels may have a role in the transmission of the virus to humans.

Abelson Kinase Inhibitors Are Potent Inhibitors of Severe Acute Respiratory Syndrome Coronavirus and Middle East Respiratory Syndrome Coronavirus Fusion

PubMed Central

Coleman, Christopher M.; Sisk, Jeanne M.; Mingo, Rebecca M.; Nelson, Elizabeth A.; White, Judith M.

2016-01-01

ABSTRACT The highly pathogenic severe acute respiratory syndrome coronavirus (SARS-CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) cause significant morbidity and morality. There is currently no approved therapeutic for highly pathogenic coronaviruses, even as MERS-CoV is spreading throughout the Middle East. We previously screened a library of FDA-approved drugs for inhibitors of coronavirus replication in which we identified Abelson (Abl) kinase inhibitors, including the anticancer drug imatinib, as inhibitors of both SARS-CoV and MERS-CoV in vitro. Here we show that the anti-CoV activity of imatinib occurs at the early stages of infection, after internalization and endosomal trafficking, by inhibiting fusion of the virions at the endosomal membrane. We specifically identified the imatinib target, Abelson tyrosine-protein kinase 2 (Abl2), as required for efficient SARS-CoV and MERS-CoV replication in vitro. These data demonstrate that specific approved drugs can be characterized in vitro for their anticoronavirus activity and used to identify host proteins required for coronavirus replication. This type of study is an important step in the repurposing of approved drugs for treatment of emerging coronaviruses. IMPORTANCE Both SARS-CoV and MERS-CoV are zoonotic infections, with bats as the primary source. The 2003 SARS-CoV outbreak began in Guangdong Province in China and spread to humans via civet cats and raccoon dogs in the wet markets before spreading to 37 countries. The virus caused 8,096 confirmed cases of SARS and 774 deaths (a case fatality rate of ∼10%). The MERS-CoV outbreak began in Saudi Arabia and has spread to 27 countries. MERS-CoV is believed to have emerged from bats and passed into humans via camels. The ongoing outbreak of MERS-CoV has resulted in 1,791 cases of MERS and 640 deaths (a case fatality rate of 36%). The emergence of SARS-CoV and MERS-CoV provides evidence that coronaviruses are currently spreading from zoonotic sources and can be highly pathogenic, causing serious morbidity and mortality in humans. Treatment of SARS-CoV and MERS-CoV infection is limited to providing supportive therapy consistent with any serious lung disease, as no specific drugs have been approved as therapeutics. Highly pathogenic coronaviruses are rare and appear to emerge and disappear within just a few years. Currently, MERS-CoV is still spreading, as new infections continue to be reported. The outbreaks of SARS-CoV and MERS-CoV and the continuing diagnosis of new MERS cases highlight the need for finding therapeutics for these diseases and potential future coronavirus outbreaks. Screening FDA-approved drugs streamlines the pipeline for this process, as these drugs have already been tested for safety in humans. PMID:27466418

Assessment by regional modelling of the impact of monopile foundations on the hydrodynamics and sediment transport: case of Courseulles-sur-Mer (France) wind farm

NASA Astrophysics Data System (ADS)

Rivier, Aurélie; Bennis, Anne-Claire; Pinon, Grégory; Magar, Vanesa; Gross, Markus

2015-04-01

Offshore monopile foundations of wind turbines modify hydrodynamics and sediment transport at local scale and also at regional scale. The aim of this work is to assess these changes and to parametrize them in a regional model. These modifications were previously evaluated using the regional circulation model MARS3D (Lazure and Dumas, 2008) in tests-cases (Rivier et al., 2014) using two approaches: in the first approach, monopiles are explicitly modelled in the mesh as dry cells and in the second approach a sub-grid parametrization which considers the drag force exerted by a monopile on the flow is used. The sub-grid parametrization is improved close to the bed in this paper by adding a drag force term in the momentum equations, source terms in the turbulence model and by increasing the bed shear stress at monopile location. Changes in hydrodynamics regime, especially near-bed, affect sediment transport regime and modifications due to monopiles on sediment dynamics is also investigated using the MARS3D sediment transport module (Le Hir et al., 2011) which solves the advection-diffusion equations. Test-cases are run using hydrodynamical conditions and sediment grain sizes typical from the area located off Courseulles-sur-Mer (Normandy, France) where an offshore wind farm is planned to be built. Velocity, turbulent kinetic energy and bed thickness changes due to the monopile simulated by both approaches are compared to each other and to experimental measurements made in a flume at the University of Caen or to published data (e.g. Roulund et al., 2005; Dargahi,1989). Then the model is applied in a real configuration on an area including the future offshore wind farm of Courseulles-sur-Mer. Four monopiles are represented in the model using both approaches and modifications of the hydrodynamics and sediment transport are assessed along a tidal cycle. Currents increase at the side edge of the monopile and decrease in front of and downstream the monopile. Turbulent kinetic energy strongly increase as expected upstream the monopile. Resuspension and erosion occurs around the monopile in locations where current speeds increase due to the monopile presence and sediments deposit downstream where the bed shear stress is lower. The pattern of bed erosion is modified depending of current velocity. References Dargahi, B. 1989. The turbulent flow field around a circular cylinder. Experiments in Fluids, 8(1-2), 1-12. Lazure, P. and Dumas, F. (2008). external-internal mode coupling for a 3D hydrodynamical model for applications at regional scale (MARS). Advances in Water Resources 31(2), 233-250. Le Hir, P., Cayocca, F. and Waeles, B. (2011). Dynamics of sand and mud mixtures: a multiprocess-based modelling strategy. Continental Shelf Research 31(10), 135-149. Rivier, A., Bennis, A.-C., Pinon, G., Gross, M. and Magar, V. (2014). Regional numerical modelling of offshore monopile wind turbine impacts on hydrodynamics and sediment transport. Proceeding of the 1st International Conference on Renewable Energies Offshore, November 2014, Lisbonne, Portugal. Roulund, A., Sumer, B. M., Fredsøe, J., & Michelsen, J. 2005. Numerical and experimental investigation of flow and scour around a circular pile. Journal of Fluid Mechanics, 534, 351-401.

Occurrence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) across the Gulf Corporation Council countries: Four years update.

PubMed

Aly, Mahmoud; Elrobh, Mohamed; Alzayer, Maha; Aljuhani, Sameera; Balkhy, Hanan

2017-01-01

The emergence of the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) infections has become a global issue of dire concerns. MERS-CoV infections have been identified in many countries all over the world whereas high level occurrences have been documented in the Middle East and Korea. MERS-CoV is mainly spreading across the geographical region of the Middle East, especially in the Arabian Peninsula, while some imported sporadic cases were reported from the Europe, North America, Africa, and lately Asia. The prevalence of MERS-CoV infections across the Gulf Corporation Council (GCC) countries still remains unclear. Therefore, the objective of the current study was to report the prevalence of MERS-CoV in the GCC countries and to also elucidate on its demographics in the Arabian Peninsula. To date, the World Health Organization (WHO) has reported 1,797 laboratory-confirmed cases of MERS-CoV infection since June 2012, involving 687 deaths in 27 different countries worldwide. Within a time span of 4 years from June 2012 to July 2016, we collect samples form MERS-CoV infected individuals from National Guard Hospital, Riyadh, and Ministry of health Saudi Arabia and other GCC countries. Our data comprise a total of 1550 cases (67.1% male and 32.9% female). The age-specific prevalence and distribution of MERS-CoV was as follow: <20 yrs (36 cases: 3.28%), 20-39 yrs (331 cases: 30.15%), 40-59 yrs (314 cases: 28.60%), and the highest-risk elderly group aged ≥60 yrs (417 cases: 37.98%). The case distribution among GCC countries was as follows: Saudi Arabia (1441 cases: 93%), Kuwait (4 cases: 0.3%), Bahrain (1 case: 0.1%), Oman (8 cases: 0.5%), Qatar (16 cases: 1.0%), and United Arab Emirates (80 cases: 5.2%). Thus, MERS-CoV was found to be more prevalent in Saudi Arabia especially in Riyadh, where 756 cases (52.4%) were the worst hit area of the country identified, followed by the western region Makkah where 298 cases (20.6%) were recorded. This prevalence update indicates that the Arabian Peninsula, particularly Saudi Arabia, is the hardest hit region regarding the emerging MERS-CoV infections worldwide. GCC countries including Saudi Arabia now have the infrastructure in place that allows physicians and scientific community to identify and immediately respond to the potential risks posed by new outbreaks of MERS-CoV infections in the region. Given the continuum of emergence and the large magnitude of the disease in our region, more studies will be required to bolster capabilities for timely detection and effective control and prevention of MERS-CoV in our region.

Polymer diffusion in the interphase between surface and solution.

PubMed

Weger, Lukas; Weidmann, Monika; Ali, Wael; Hildebrandt, Marcus; Gutmann, Jochen Stefan; Hoffmann-Jacobsen, Kerstin

2018-05-22

Total internal reflection fluorescence correlation spectroscopy (TIR-FCS) is applied to study the self-diffusion of polyethylene glycol solutions in the presence of weakly attractive interfaces. Glass coverslips modified with aminopropyl- and propyl-terminated silanes are used to study the influence of solid surfaces on polymer diffusion. A model of three phases of polymer diffusion allows to describe the experimental fluorescence autocorrelation functions. Besides the two-dimensional diffusion of adsorbed polymer on the substrate and three-dimensional free diffusion in bulk solution, a third diffusion time scale is observed with intermediate diffusion times. This retarded three-dimensional diffusion in solution is assigned to long range effects of solid surfaces on diffusional dynamics of polymers. The respective diffusion constants show Rouse scaling (D~N -1 ) indicating a screening of hydrodynamic interactions by the presence of the surface. Hence, the presented TIR-FCS method proves to be a valuable tool to investigate the effect of surfaces on polymer diffusion beyond the first adsorbed polymer layer on the 100 nm length scale.

Optical absorption and scattering properties of bulk porcine muscle phantoms from interstitial radiance measurements in 650-900 nm range

NASA Astrophysics Data System (ADS)

Grabtchak, Serge; Montgomery, Logan G.; Whelan, William M.

2014-05-01

We demonstrated the application of relative radiance-based continuous wave (cw) measurements for recovering absorption and scattering properties (the effective attenuation coefficient, the diffusion coefficient, the absorption coefficient and the reduced scattering coefficient) of bulk porcine muscle phantoms in the 650-900 nm spectral range. Both the side-firing fiber (the detector) and the fiber with a spherical diffuser at the end (the source) were inserted interstitially at predetermined locations in the phantom. The porcine phantoms were prostate-shaped with ˜4 cm in diameter and ˜3 cm thickness and made from porcine loin or tenderloin muscles. The described method was previously validated using the diffusion approximation on simulated and experimental radiance data obtained for homogenous Intralipid-1% liquid phantom. The approach required performing measurements in two locations in the tissue with different distances to the source. Measurements were performed on 21 porcine phantoms. Spectral dependences of the effective attenuation and absorption coefficients for the loin phantom deviated from corresponding dependences for the tenderloin phantom for wavelengths <750 nm. The diffusion constant and the reduced scattering coefficient were very close for both phantom types. To quantify chromophore presence, the plot for the absorption coefficient was matched with a synthetic absorption spectrum constructed from deoxyhemoglobin, oxyhemoglobin and water. The closest match for the porcine loin spectrum was obtained with the following concentrations: 15.5 µM (±30% s.d.) Hb, 21 µM (±30% s.d.) HbO2 and 0.3 (±30% s.d.) fractional volume of water. The tenderloin absorption spectrum was best described by 30 µM Hb (±30% s.d), 19 µM (±30% s.d.) HbO2 and 0.3 (±30% s.d.) fractional volume of water. The higher concentration of Hb in tenderloin was consistent with a dark-red appearance of the tenderloin phantom. The method can be applied to a number of biological tissues and organs for interstitial optical interrogation.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and Mars Exploration Rover 2 (MER-A) are ready for the third launch attempt after weather concerns postponed earlier attempts. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the first half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is raised to a vertical position for its lift up the launch tower. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) nears the top of the launch tower. The fairing will be installed around the payload for protection during launch on a Delta II rocket. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

An investigation of the solar zenith angle variation of D-region ionization

NASA Technical Reports Server (NTRS)

Ratnasiri, P. A. J.; Sechrist, C. F., Jr.

1975-01-01

Model calculations are carried out with a view to interpreting the solar zenith angle variation of D-region ionization. A model is developed for the neutral chemistry including the transport terms relating to molecular and eddy diffusion. The diurnal behavior is described of the minor neutral constituents formed in an oxygen-hydrogen-nitrogen atmosphere, in the height interval between 30 and 120 km. Computations carried out for two cases of the eddy diffusion coefficients models indicate that the constituents which are important for the D-region positive-ion chemistry do not show a significant variation with zenith angle for values up to 75 deg over the D-region heights. In the ion chemistry model, ion-pair production rates are calculated for solar X-rays between 1 A and 100 A, EUV radiations from 100 A up to the Lyman-alpha line, precipitating electrons, and galactic cosmic rays. The solar zenith angle variation of the positive-ion composition, negative-ion composition, and the electron densities are described up to 75 deg zenith angle, in the height interval between 60 and 100 km.

An Extended Kalman filter (EKF) for Mars Exploration Rover (MER) entry, descent, and landing reconstruction

NASA Technical Reports Server (NTRS)

Lisano, M. E.

2003-01-01

This paper describes the design and initial test results of an extended Kalman filter that has been developed at Jet Propulsion Laboratory (JPL) for post-flight reconstruction of the trajectory and attitude history of a spacecraft entering a planetary atmosphere and descending upon a parachute.

MAPGEN Planner: Mixed-Initiative Activity Planning for the Mars Exploration Rover Mission

NASA Technical Reports Server (NTRS)

Ai-Chang, Mitch; Bresina, John; Charest, Leonard; Hsu, Jennifer; Jonsson, Ari K.; Kanefsky, Bob; Maldague, Pierre; Morris, Paul; Rajan, Kanna; Yglesias, Jeffrey

2003-01-01

This document describes the Mixed-initiative Activity Plan Generation system MAPGEN. The system is be- ing developed as one of the tools to be used during surface operations of NASA's Mars Exploration Rover mission (MER). However, the core technology is general and can be adapted to different missions and applications. The motivation for the system is to better support users that need to rapidly build activity plans that have to satisfy complex rules and fit within resource limits. The system therefore combines an existing tool for activity plan editing and resource modeling, with an advanced constraint-based reasoning and planning framework. The demonstration will show the key capabilities of the automated reasoning and planning component of the system, with emphasis on how these capabilities will be used during surface operations of the MER mission.

UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

PubMed

Robasky, Kimberly; Bulyk, Martha L

2011-01-01

The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

Curiosity at Gale Crater, Mars: Characterization and Analysis of the Rocknest Sand Shadow

NASA Technical Reports Server (NTRS)

Blake, David F.; Morris, Richard V.; Kocurek, G.; Morrison, S. M.; Downs, R. T.; Bish, D.; Ming, D. W.; Edgett, K. S.; Rubin, D.; Goetz, W.;

Representational Competence: Towards a Distributed and Embodied Cognition Account

ERIC Educational Resources Information Center

Pande, Prajakt; Chandrasekharan, Sanjay

2017-01-01

Multiple external representations (MERs) are central to the practice and learning of science, mathematics and engineering, as the phenomena and entities investigated and controlled in these domains are often not available for perception and action. MERs therefore play a twofold constitutive role in reasoning in these domains. Firstly, MERs stand…

High Prevalence of Middle East Respiratory Coronavirus in Young Dromedary Camels in Jordan

PubMed Central

van Doremalen, Neeltje; Hijazeen, Zaidoun S.K.; Holloway, Peter; Al Omari, Bilal; McDowell, Chester; Adney, Danielle; Talafha, Hani A.; Guitian, Javier; Steel, John; Amarin, Nadim; Tibbo, Markos; Abu-Basha, Ehab; Al-Majali, Ahmad M.

2017-01-01

Abstract Prevalence of Middle East respiratory syndrome coronavirus (MERS-CoV) was determined in 45 dromedary camels from two geographically separated herds in Jordan. Virus shedding was only detected in swabs obtained from the respiratory tract and primarily observed in camels younger than 3 years. MERS-CoV seroprevalence increased with age of camels. Bovine and sheep sera were seronegative. Phylogenetic analysis of partial S2 clustered the Jordanian MERS-CoV strains with contemporary MERS-CoV strains associated with nosocomial outbreaks. PMID:28009529

SARS and MERS: recent insights into emerging coronaviruses.

PubMed

de Wit, Emmie; van Doremalen, Neeltje; Falzarano, Darryl; Munster, Vincent J

2016-08-01

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) in 2012 marked the second introduction of a highly pathogenic coronavirus into the human population in the twenty-first century. The continuing introductions of MERS-CoV from dromedary camels, the subsequent travel-related viral spread, the unprecedented nosocomial outbreaks and the high case-fatality rates highlight the need for prophylactic and therapeutic measures. Scientific advancements since the 2002-2003 severe acute respiratory syndrome coronavirus (SARS-CoV) pandemic allowed for rapid progress in our understanding of the epidemiology and pathogenesis of MERS-CoV and the development of therapeutics. In this Review, we detail our present understanding of the transmission and pathogenesis of SARS-CoV and MERS-CoV, and discuss the current state of development of measures to combat emerging coronaviruses.

Prophylaxis With a Middle East Respiratory Syndrome Coronavirus (MERS-CoV)–Specific Human Monoclonal Antibody Protects Rabbits From MERS-CoV Infection

PubMed Central

Houser, Katherine V.; Gretebeck, Lisa; Ying, Tianlei; Wang, Yanping; Vogel, Leatrice; Lamirande, Elaine W.; Bock, Kevin W.; Moore, Ian N.; Dimitrov, Dimiter S.; Subbarao, Kanta

2016-01-01

With >1600 documented human infections with Middle East respiratory syndrome coronavirus (MERS-CoV) and a case fatality rate of approximately 36%, medical countermeasures are needed to prevent and limit the disease. We examined the in vivo efficacy of the human monoclonal antibody m336, which has high neutralizing activity against MERS-CoV in vitro. m336 was administered to rabbits intravenously or intranasally before infection with MERS-CoV. Prophylaxis with m336 resulted in a reduction of pulmonary viral RNA titers by 40–9000-fold, compared with an irrelevant control antibody with little to no inflammation or viral antigen detected. This protection in rabbits supports further clinical development of m336. PMID:26941283

The impact of multichannel microelectrode recording (MER) in deep brain stimulation of the basal ganglia.

PubMed

Kinfe, Thomas M; Vesper, Jan

2013-01-01

Deep brain stimulation (DBS) of the basal ganglia (Ncl. subthalamicus, Ncl. ventralis intermedius thalami, globus pallidus internus) has become an evidence-based and well-established treatment option in otherwise refractory movement disorders. The Ncl. subthalamicus (STN) is the target of choice in Parkinson's disease.However, a considerable discussion is currently ongoing with regard to the necessity for micro-electrode recording (MER) in DBS surgery.The present review provides an overview on deep brain stimulation and (MER) of the STN in patients with Parkinson's disease. Detailed description is given concerning the multichannel MER systems nowadays available for DBS of the basal ganglia, especially of the STN, as a useful tool for target refinement. Furthermore, an overview is given of the historical aspects, spatial mapping of the STN by MER, and its impact for accuracy and precision in current functional stereotactic neurosurgery.The pros concerning target refinement by MER means on the one hand, and cons including increased bleeding risk, increased operation time, local or general anesthesia, and single versus multichannel microelectrode recording are discussed in detail. Finally, the authors favor the use of MER with intraoperative testing combined with imaging to achieve a more precise electrode placement, aiming to ameliorate clinical outcome in therapy-resistant movement disorders.

Conserved antigenic sites between MERS-CoV and Bat-coronavirus are revealed through sequence analysis.

PubMed

Sharmin, Refat; Islam, Abul B M M K

2016-01-01

MERS-CoV is a newly emerged human coronavirus reported closely related with HKU4 and HKU5 Bat coronaviruses. Bat and MERS corona-viruses are structurally related. Therefore, it is of interest to estimate the degree of conserved antigenic sites among them. It is of importance to elucidate the shared antigenic-sites and extent of conservation between them to understand the evolutionary dynamics of MERS-CoV. Multiple sequence alignment of the spike (S), membrane (M), enveloped (E) and nucleocapsid (N) proteins was employed to identify the sequence conservation among MERS and Bat (HKU4, HKU5) coronaviruses. We used various in silico tools to predict the conserved antigenic sites. We found that MERS-CoV shared 30 % of its S protein antigenic sites with HKU4 and 70 % with HKU5 bat-CoV. Whereas 100 % of its E, M and N protein's antigenic sites are found to be conserved with those in HKU4 and HKU5. This sharing suggests that in case of pathogenicity MERS-CoV is more closely related to HKU5 bat-CoV than HKU4 bat-CoV. The conserved epitopes indicates their evolutionary relationship and ancestry of pathogenicity.

Promiscuity and selectivity of small-molecule inhibitors across TAM receptor tyrosine kinases in pediatric leukemia.

PubMed

Liu, Mao-Hua; Chen, Shi-Bing; Yu, Juan; Liu, Cheng-Jun; Zhang, Xiao-Jing

2017-08-01

The TAM receptor tyrosine kinase family member Mer has been recognized as an attractive therapeutic target for pediatric leukemia. Beside Mer the family contains other two kinases, namely, Tyro3 and Axl, which are highly homologues with Mer and thus most existing small-molecule inhibitors show moderate or high promiscuity across the three kinases. Here, the structural basis and energetic property of selective binding of small-molecule inhibitors to the three kinases were investigated at molecular level. It is found that the selectivity is primarily determined by the size, shape and configuration of kinase's ATP-binding site; the Mer and Axl possess a small, closed active pocket as compared to the bulky, open pocket of Tyro3. The location and conformation of active-site residues of Mer and Axl are highly consistent, suggesting that small-molecule inhibitors generally have a low Mer-over-Axl selectivity and a high Mer-over-Tyro3 selectivity. We demonstrated that the difference in ATP binding potency to the three kinases is also responsible for inhibitor selectivity. We also found that the long-range interactions and allosteric effect arising from rest of the kinase's active site can indirectly influence inhibitor binding and selectivity. Copyright © 2017 Elsevier Inc. All rights reserved.

Silk-based biomaterials functionalized with fibronectin type II promotes cell adhesion.

PubMed

Pereira, Ana Margarida; Machado, Raul; da Costa, André; Ribeiro, Artur; Collins, Tony; Gomes, Andreia C; Leonor, Isabel B; Kaplan, David L; Reis, Rui L; Casal, Margarida

2017-01-01

The objective of this work was to exploit the fibronectin type II (FNII) module from human matrix metalloproteinase-2 as a functional domain for the development of silk-based biopolymer blends that display enhanced cell adhesion properties. The DNA sequence of spider dragline silk protein (6mer) was genetically fused with the FNII coding sequence and expressed in Escherichia coli. The chimeric protein 6mer+FNII was purified by non-chromatographic methods. Films prepared from 6mer+FNII by solvent casting promoted only limited cell adhesion of human skin fibroblasts. However, the performance of the material in terms of cell adhesion was significantly improved when 6mer+FNII was combined with a silk-elastin-like protein in a concentration-dependent behavior. With this work we describe a novel class of biopolymer that promote cell adhesion and potentially useful as biomaterials for tissue engineering and regenerative medicine. This work reports the development of biocompatible silk-based composites with enhanced cell adhesion properties suitable for biomedical applications in regenerative medicine. The biocomposites were produced by combining a genetically engineered silk-elastin-like protein with a genetically engineered spider-silk-based polypeptide carrying the three domains of the fibronectin type II module from human metalloproteinase-2. These composites were processed into free-standing films by solvent casting and characterized for their biological behavior. To our knowledge this is the first report of the exploitation of all three FNII domains as a functional domain for the development of bioinspired materials with improved biological performance. The present study highlights the potential of using genetically engineered protein-based composites as a platform for the development of new bioinspired biomaterials. Copyright © 2016 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

Facilitating Analysis of Multiple Partial Data Streams

NASA Technical Reports Server (NTRS)

Maimone, Mark W.; Liebersbach, Robert R.

2008-01-01

Robotic Operations Automation: Mechanisms, Imaging, Navigation report Generation (ROAMING) is a set of computer programs that facilitates and accelerates both tactical and strategic analysis of time-sampled data especially the disparate and often incomplete streams of Mars Explorer Rover (MER) telemetry data described in the immediately preceding article. As used here, tactical refers to the activities over a relatively short time (one Martian day in the original MER application) and strategic refers to a longer time (the entire multi-year MER missions in the original application). Prior to installation, ROAMING must be configured with the types of data of interest, and parsers must be modified to understand the format of the input data (many example parsers are provided, including for general CSV files). Thereafter, new data from multiple disparate sources are automatically resampled into a single common annotated spreadsheet stored in a readable space-separated format, and these data can be processed or plotted at any time scale. Such processing or plotting makes it possible to study not only the details of a particular activity spanning only a few seconds, but also longer-term trends. ROAMING makes it possible to generate mission-wide plots of multiple engineering quantities [e.g., vehicle tilt as in Figure 1(a), motor current, numbers of images] that, heretofore could be found only in thousands of separate files. ROAMING also supports automatic annotation of both images and graphs. In the MER application, labels given to terrain features by rover scientists and engineers are automatically plotted in all received images based on their associated camera models (see Figure 2), times measured in seconds are mapped to Mars local time, and command names or arbitrary time-labeled events can be used to label engineering plots, as in Figure 1(b).

A novel measure and significance testing in data analysis of cell image segmentation.

PubMed

Wu, Jin Chu; Halter, Michael; Kacker, Raghu N; Elliott, John T; Plant, Anne L

2017-03-14

Cell image segmentation (CIS) is an essential part of quantitative imaging of biological cells. Designing a performance measure and conducting significance testing are critical for evaluating and comparing the CIS algorithms for image-based cell assays in cytometry. Many measures and methods have been proposed and implemented to evaluate segmentation methods. However, computing the standard errors (SE) of the measures and their correlation coefficient is not described, and thus the statistical significance of performance differences between CIS algorithms cannot be assessed. We propose the total error rate (TER), a novel performance measure for segmenting all cells in the supervised evaluation. The TER statistically aggregates all misclassification error rates (MER) by taking cell sizes as weights. The MERs are for segmenting each single cell in the population. The TER is fully supported by the pairwise comparisons of MERs using 106 manually segmented ground-truth cells with different sizes and seven CIS algorithms taken from ImageJ. Further, the SE and 95% confidence interval (CI) of TER are computed based on the SE of MER that is calculated using the bootstrap method. An algorithm for computing the correlation coefficient of TERs between two CIS algorithms is also provided. Hence, the 95% CI error bars can be used to classify CIS algorithms. The SEs of TERs and their correlation coefficient can be employed to conduct the hypothesis testing, while the CIs overlap, to determine the statistical significance of the performance differences between CIS algorithms. A novel measure TER of CIS is proposed. The TER's SEs and correlation coefficient are computed. Thereafter, CIS algorithms can be evaluated and compared statistically by conducting the significance testing.

Thermal diffusivity of electrical insulators at high temperatures: Evidence for diffusion of bulk phonon-polaritons at infrared frequencies augmenting phonon heat conduction

NASA Astrophysics Data System (ADS)

Hofmeister, Anne M.; Dong, Jianjun; Branlund, Joy M.

2014-04-01

We show that laser-flash analysis measurements of the temperature (T) dependence of thermal diffusivity (D) for diverse non-metallic (e.g., silicates) single-crystals is consistently represented by D(T) = FT-G + HT above 298 K, with G ranging from 0.3 to 2, depending on structure, and H being ˜10-4 K-1 for 51 single-crystals, 3 polycrystals, and two glasses unaffected by disorder or reconstructive phase transitions. Materials exhibiting this behavior include complex silicates with variable amounts of cation disorder, perovskite structured materials, and graphite. The high-temperature term HT becomes important by ˜1300 K, above which temperature its contribution to D(T) exceeds that of the FT-G term. The combination of the FT-G and HT terms produces the nearly temperature independent high-temperature region of D previously interpreted as the minimal phonon mean free path being limited by the finite interatomic spacing. Based on the simplicity of the fit and large number of materials it represents, this finding has repercussions for high-temperature models of heat transport. One explanation is that the two terms describing D(T) are associated with two distinct microscopic mechanisms; here, we explore the possibility that the thermal diffusivity of an electrical insulator could include both a contribution of lattice phonons (the FT-G term) and a contribution of diffusive bulk phonon-polaritons (BPP) at infrared (IR) frequencies (the HT term). The proposed BPP diffusion exists over length scales smaller than the laboratory sample sizes, and transfers mixed light and vibrational energy at a speed significantly smaller than the speed of light. Our diffusive IR-BPP hypothesis is consistent with other experimental observations such as polarization behavior, dependence of D on the number of IR peaks, and H = 0 for Ge and Si, which lack IR fundamentals. A simple quasi-particle thermal diffusion model is presented to begin understanding the contribution from bulk phonon-polaritons to overall heat conduction.

Inhibition of HIV Replication by Cyclic and Hairpin PNAs Targeting the HIV-1 TAR RNA Loop

PubMed Central

Upert, Gregory; Di Giorgio, Audrey; Upadhyay, Alok; Manvar, Dinesh; Pandey, Nootan; Pandey, Virendra N.; Patino, Nadia

2012-01-01

Human immunodeficiency virus-1 (HIV-1) replication and gene expression entails specific interaction of the viral protein Tat with its transactivation responsive element (TAR), to form a highly stable stem-bulge-loop structure. Previously, we described triphenylphosphonium (TPP) cation-based vectors that efficiently deliver nucleotide analogs (PNAs) into the cytoplasm of cells. In particular, we showed that the TPP conjugate of a linear 16-mer PNA targeting the apical stem-loop region of TAR impedes Tat-mediated transactivation of the HIV-1 LTR in vitro and also in cell culture systems. In this communication, we conjugated TPP to cyclic and hairpin PNAs targeting the loop region of HIV-1 TAR and evaluated their antiviral efficacy in a cell culture system. We found that TPP-cyclic PNAs containing only 8 residues, showed higher antiviral potency compared to hairpin PNAs of 12 or 16 residues. We further noted that the TPP-conjugates of the 8-mer cyclic PNA as well as the 16-mer linear PNA displayed similar antiviral efficacy. However, cyclic PNAs were shown to be highly specific to their target sequences. This communication emphasizes on the importance of small constrained cyclic PNAs over both linear and hairpin structures for targeting biologically relevant RNA hairpins. PMID:23029603

Theory of bi-molecular association dynamics in 2D for accurate model and experimental parameterization of binding rates

PubMed Central

Yogurtcu, Osman N.; Johnson, Margaret E.

2015-01-01

The dynamics of association between diffusing and reacting molecular species are routinely quantified using simple rate-equation kinetics that assume both well-mixed concentrations of species and a single rate constant for parameterizing the binding rate. In two-dimensions (2D), however, even when systems are well-mixed, the assumption of a single characteristic rate constant for describing association is not generally accurate, due to the properties of diffusional searching in dimensions d ≤ 2. Establishing rigorous bounds for discriminating between 2D reactive systems that will be accurately described by rate equations with a single rate constant, and those that will not, is critical for both modeling and experimentally parameterizing binding reactions restricted to surfaces such as cellular membranes. We show here that in regimes of intrinsic reaction rate (ka) and diffusion (D) parameters ka/D > 0.05, a single rate constant cannot be fit to the dynamics of concentrations of associating species independently of the initial conditions. Instead, a more sophisticated multi-parametric description than rate-equations is necessary to robustly characterize bimolecular reactions from experiment. Our quantitative bounds derive from our new analysis of 2D rate-behavior predicted from Smoluchowski theory. Using a recently developed single particle reaction-diffusion algorithm we extend here to 2D, we are able to test and validate the predictions of Smoluchowski theory and several other theories of reversible reaction dynamics in 2D for the first time. Finally, our results also mean that simulations of reactive systems in 2D using rate equations must be undertaken with caution when reactions have ka/D > 0.05, regardless of the simulation volume. We introduce here a simple formula for an adaptive concentration dependent rate constant for these chemical kinetics simulations which improves on existing formulas to better capture non-equilibrium reaction dynamics from dilute to dense systems. PMID:26328828

KSC-03PD-2060

NASA Technical Reports Server (NTRS)

2003-01-01

KENNEDY SPACE CENTER, FLA. The Mobile Service Tower is rolled back at Space Launch Complex 17B, Cape Canaveral Air Force Station, to reveal the Delta II Heavy launch vehicle ready for launch of the Mars Exploration Rover-B (MER-B) mission, with the rover 'Opportunity' aboard. The second of twin rovers being sent to Mars, it is equipped with a robotic arm, a drilling tool, three spectrometers, and four pairs of cameras that allow it to have a human-like, 3D view of the terrain. Each rover could travel as far as 100 meters in one day to act as Mars scientists' eyes and hands, exploring an environment where humans are not yet able to go. MER-B is scheduled to launch on June 28 at one of two available times, 11:56:16 p.m. EDT or 12:37:59 a.m. EDT on June 29.

Knowledge and Attitude of Dental Health Professionals about Middle East Respiratory Syndrome in Saudi Arabia

PubMed Central

Althomairy, Sameer Abdullah; Baseer, Mohammad Abdul; Assery, Mansour; Alsaffan, Abdulrahman Dahham

2018-01-01

Aim and Objective: This study aims to evaluate the knowledge and attitude of practicing dental health professionals (DHPs) (dentist and dental auxiliaries) toward Middle East Respiratory Syndrome coronavirus (MERS-CoV) in Saudi Arabia. Materials and Methods: A cross-sectional descriptive study was undertaken among practicing DHPs in Saudi Arabia. A total of 202 DHPs participated in this study. Knowledge and attitude were assessed using self-administered and pretested questionnaire. The questionnaire was administered online through Survey Monkey® program by sending link to the registered E-mail. Descriptive statistics were performed on demographic data. Mean knowledge and mean attitude scores of DHPs were calculated. Mann–Whitney U-test and Kruskal–Wallis tests were used to disclose the differences between study variables. Chi-square tests and Spearman's correlation tests were applied to find the associations between the variables. Results: The study participants showed mean knowledge score of 12.26 ± 2.27 (based on 17 knowledge questions) and attitude score of 8.63 ± 1.68 (based on 10 attitude questions). The spearman's test showed the positive correlation between knowledge and attitude of DHPs about MERS (r = 0.093, P = 0.188). Knowledge gaps were reflected in questions related to the duration of infectivity (47.5%), treatment of MERS (39.6%), reservoir of MERS-CoV (38.1%), availability of vaccination against MERS-CoV (25.2%), the likelihood of infection (24.3%), and the type of MERS-CoV (23.3%). DHPs showed a positive attitude toward adherence to universal precautions given by CDC and WHO (0.94 ± 0.25), active participation infection control program (0.94 ± 0.24), and use of gowns, gloves, mask, and goggles while dealing with MERS-CoV patients (0.97 ± 0.17). Male DHPs showed significantly higher knowledge and positive attitude toward MERS-CoV infection compared to females. Conclusion: DHPs participated in this study showed good knowledge and positive attitude toward MERS. However, still few lacunae in the knowledge and attitudes toward MERS-CoV were found requiring extensive educational programs. PMID:29780739

Electrical conductivity of a monolayer produced by random sequential adsorption of linear k -mers onto a square lattice

NASA Astrophysics Data System (ADS)

Tarasevich, Yuri Yu.; Goltseva, Valeria A.; Laptev, Valeri V.; Lebovka, Nikolai I.

2016-10-01

The electrical conductivity of a monolayer produced by the random sequential adsorption (RSA) of linear k -mers (particles occupying k adjacent adsorption sites) onto a square lattice was studied by means of computer simulation. Overlapping with predeposited k -mers and detachment from the surface were forbidden. The RSA process continued until the saturation jamming limit, pj. The isotropic (equiprobable orientations of k -mers along x and y axes) and anisotropic (all k -mers aligned along the y axis) depositions for two different models—of an insulating substrate and conducting k -mers (C model) and of a conducting substrate and insulating k -mers (I model)—were examined. The Frank-Lobb algorithm was applied to calculate the electrical conductivity in both the x and y directions for different lengths (k =1 - 128) and concentrations (p =0 - pj) of the k -mers. The "intrinsic electrical conductivity" and concentration dependence of the relative electrical conductivity Σ (p ) (Σ =σ /σm for the C model and Σ =σm/σ for the I model, where σm is the electrical conductivity of substrate) in different directions were analyzed. At large values of k the Σ (p ) curves became very similar and they almost coincided at k =128 . Moreover, for both models the greater the length of the k -mers the smoother the functions Σx y(p ) ,Σx(p ) and Σy(p ) . For the more practically important C model, the other interesting findings are (i) for large values of k (k =64 ,128 ), the values of Σx y and Σy increase rapidly with the initial increase of p from 0 to 0.1; (ii) for k ≥16 , all the Σx y(p ) and Σx(p ) curves intersect with each other at the same isoconductivity points; (iii) for anisotropic deposition, the percolation concentrations are the same in the x and y directions, whereas, at the percolation point the greater the length of the k -mers the larger the anisotropy of the electrical conductivity, i.e., the ratio σy/σx (>1 ).

Viral peptides-MHC interaction: Binding probability and distance from human peptides.

PubMed

Santoni, Daniele

2018-05-23

Identification of peptides binding to MHC class I complex can play a crucial role in retrieving potential targets able to trigger an immune response. Affinity binding of viral peptides can be estimated through effective computational methods that in the most of cases are based on machine learning approach. Achieving a better insight into peptide features that impact on the affinity binding rate is a challenging issue. In the present work we focused on 9-mer peptides of Human immunodeficiency virus type 1 and Human herpes simplex virus 1, studying their binding to MHC class I. Viral 9-mers were partitioned into different classes, where each class is characterized by how far (in terms of mutation steps) the peptides belonging to that class are from human 9-mers. Viral 9-mers were partitioned in different classes, based on the number of mutation steps they are far from human 9-mers. We showed that the overall binding probability significantly differs among classes, and it typically increases as the distance, computed in terms of number of mutation steps from the human set of 9-mers, increases. The binding probability is particularly high when considering viral 9-mers that are far from all human 9-mers more than three mutation steps. A further evidence, providing significance to those special viral peptides and suggesting a potential role they can play, comes from the analysis of their distribution along viral genomes, as it revealed they are not randomly located, but they preferentially occur in specific genes. Copyright © 2018 Elsevier B.V. All rights reserved.

Worry experienced during the 2015 Middle East Respiratory Syndrome (MERS) pandemic in Korea

PubMed Central

Ro, Jun-Soo; Lee, Jin-Seok; Kang, Sung-Chan; Jung, Hye-Min

2017-01-01

Background Korea failed in its risk communication during the early stage of the Middle East Respiratory Syndrome (MERS) outbreak; consequently, it faced difficulties in managing MERS, while disease-related worry increased. Disease-related worry can help disease prevention and management, but can also have a detrimental effect. This study measured the overall level of disease-related worry during the MERS outbreak period in Korea and the influencing factors and levels of disease-related worry during key outbreak periods. Methods The cross-sectional survey included 1,000 adults who resided in Korea. An ordinal logistic regression was performed for the overall level of MERS-related worry, and influencing factors of worry were analyzed. A reliability test was performed on the levels of MERS-related worry during key outbreak periods. Results The overall level of MERS-related worry was 2.44. Multivariate analysis revealed that women and respondents w very poor subjective health status had higher levels of worry. Respondents with very high stress in daily life had higher levels of worry than those who reported having little stress. The reliability test results on MERS-related worry scores during key outbreak periods showed consistent scores during each period. Conclusion Level of worry increased in cases having higher perceived susceptibility and greater trust in informal information, while initial stage of outbreak was closely associated with that at later stages. These findings suggest the importance of managing the level of worry by providing timely and accurate disease-related information during the initial stage of disease outbreak. PMID:28273131

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

NASA Image and Video Library

2003-04-30

KENNEDY SPACE CENTER, FLA. - At Launch Complex 17-A, Cape Canaveral Air Force Station, the second half of the fairing for the Mars Exploration Rover 2 (MER-2/MER-A) is lifted up the outside of the launch tower. Visible on another side is the Delta II rocket that will carry the payload into space. The fairing will be installed around the payload for protection during launch. The MER Mission consists of two identical rovers designed to cover roughly 110 yards each Martian day over various terrain. Each rover will carry five scientific instruments that will allow it to search for evidence of liquid water that may have been present in the planet's past. Identical to each other, the rovers will land at different regions of Mars. Launch date for MER-A is scheduled for June 5.

Effect of parallel radiofrequency transmission on arterial input function selection in dynamic contrast-enhanced 3 Tesla pelvic MRI.

PubMed

Chafi, Hatim; Elias, Saba N; Nguyen, Huyen T; Friel, Harry T; Knopp, Michael V; Guo, BeiBei; Heymsfield, Steven B; Jia, Guang

2016-01-01

To evaluate whether parallel radiofrequency transmission (mTX) can improve the symmetry of the left and right femoral arteries in dynamic contrast enhanced magnetic resonance imaging (DCE-MRI) of prostate and bladder cancer. Eighteen prostate and 24 bladder cancer patients underwent 3.0 Tesla DCE-MRI scan with a single transmission channel coil. Subsequently, 21 prostate and 21 bladder cancer patients were scanned using the dual channel mTX upgrade. The precontrast signal ( S0) and the maximum enhancement ratio (MER) were measured in both the left and the right femoral arteries. Within the patient cohort, the ratio of S0 and MER in the left artery to that in the right artery ( S0_LR, MER_LR) was calculated with and without the use of mTX. Left to right asymmetry indices for S0 ( S0_LRasym) and MER ( MER_LRasym) were defined as the absolute values of the difference between S0_LR and 1, and the difference between MER_LR and 1, respectively. S0_LRasym, and MER_LRasym were 0.21 and 0.19 for prostate cancer patients with mTX, and 0.43 and 0.45 for the ones imaged without it (P < 0.001). Also, for the bladder cancer patients, S0_LRasym, and MER_LRasym were 0.11 and 0.9 with mTX, while imaging without it yielded 0.52 and 0.39 (P < 0.001). mTX can significantly improve left-to-right symmetry of femoral artery precontrast signal and contrast enhancement. © 2015 Wiley Periodicals, Inc.

Communication: Diverse nanoscale cluster dynamics: Diffusion of 2D epitaxial clusters

NASA Astrophysics Data System (ADS)

Lai, King C.; Evans, James W.; Liu, Da-Jiang

2017-11-01

The dynamics of nanoscale clusters can be distinct from macroscale behavior described by continuum formalisms. For diffusion of 2D clusters of N atoms in homoepitaxial systems mediated by edge atom hopping, macroscale theory predicts simple monotonic size scaling of the diffusion coefficient, DN ˜ N-β, with β = 3/2. However, modeling for nanoclusters on metal(100) surfaces reveals that slow nucleation-mediated diffusion displaying weak size scaling β < 1 occurs for "perfect" sizes Np = L2 and L(L+1) for integer L = 3,4,… (with unique square or near-square ground state shapes), and also for Np+3, Np+4,…. In contrast, fast facile nucleation-free diffusion displaying strong size scaling β ≈ 2.5 occurs for sizes Np+1 and Np+2. DN versus N oscillates strongly between the slowest branch (for Np+3) and the fastest branch (for Np+1). All branches merge for N = O(102), but macroscale behavior is only achieved for much larger N = O(103). This analysis reveals the unprecedented diversity of behavior on the nanoscale.

Accuracy of entrainment coefficients in one-dimensional volcanic plume models

NASA Astrophysics Data System (ADS)

McNeal, J. S.; Freedland, G.; Cal, R. B.; Mastin, L. G.; Solovitz, S.

2017-12-01

During and after volcanic eruptions, ash clouds can present a danger to human activities, notably to air travel. Ash dispersal models can forecast the location and downwind path of the ash cloud, which are critical for mitigating potential threats. The accuracy of the ash dispersal model depends on the reliability of input parameters, one of which is the mass eruption rate (MER). Uncertainties in MER translate to uncertainties in forecasts of ash-cloud concentration. One-dimensional plume models can quickly estimate the MER from plume height, relying on empirical entrainment coefficients, α and β, which describe air inflow perpendicular and parallel to the centerline of the plume, respectively. While much work has been done to quantify α for strong plumes (0.06-0.09 in most cases), consensus has not been reached for α and β in moderate to weak plumes (i.e. plumes bent over by the wind). We conducted high precision jet entrainment measurements in a wind tunnel using particle image velocimetry (PIV). Observed centerline trajectories were compared to modeled ones using the one-dimensional plume model Plumeria. Test conditions produced Reynolds numbers (Re) on the order of 103 to 105 and jet-to-cross flow velocity ratios (Vr) from 6 to 34. Over this range, α and β were adjusted to match the modeled trajectories with measured ones. Additionally, we compared historical observations of plume height and MER during volcanic eruptions against Plumeria predictions. Uncertainties in MER were considered with additional model simulations to quantify their impact on the optimal entrainment coefficients. Our comparisons reveal a clear linear α-β relationship, where multiple α and β values could be found that produced accurate plume height predictions. For example, similar accuracy was found using both (α,β) = (0.07,0.35) and (α,β) = (0.04,0.95) for the test case based on the 2002 eruption of Reventador volcano in Ecuador. However, in some cases that we studied, the response was largely independent of the vertical entrainment coefficient α for weak plumes, such as for the 1996 eruption of Ruapehu volcano in New Zealand, where the optimal β was near 0.75 in all simulations.

Dynamic Light Scattering Study of Pig Vitreous Body

NASA Astrophysics Data System (ADS)

Matsuura, Toyoaki; Idota, Naokazu; Hara, Yoshiaki; Annaka, Masahiko

The phase behaviors and dynamical properties of pig vitreous body were studied by macroscopic observation of swelling behavior and dynamic light scattering under various conditions. From the observations of the dynamics of light scattered by the pig vitreous body under physiological condition, intensity autocorrelation functions that revealed two diffusion coefficients, D fast and D slow were obtained. We developed the theory for describing the density fluctuation of the entities in the vitreous gel system with sodium hyaluronate filled in the meshes of collagen fiber network. The dynamics of collagen and sodium hyaluronate explains two relaxation modes of the fluctuation. The diffusion coefficient of collagen obtained from D fast and D slow is very close to that in aqueous solution, which suggests the vitreous body is in the swollen state. Divergent behavior in the measured total scattered light intensities and diffusion coefficients upon varying the concentration of salt (NaCl and CaCl2) was observed. Namely, a slowing down of the dynamic modes accompanied by increased “static” scattered intensities was observed. This is indicative of the occurrence of a phase transition upon salt concentration.

Evaluation of candidate vaccine approaches for MERS-CoV

DOE PAGES

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon; ...

2015-07-28

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Large supramolecular structures of 33-mer gliadin peptide activate toll-like receptors in macrophages.

PubMed

Herrera, María Georgina; Pizzuto, Malvina; Lonez, Caroline; Rott, Karsten; Hütten, Andreas; Sewald, Norbert; Ruysschaert, Jean-Marie; Dodero, Veronica Isabel

2018-04-22

Gliadin, an immunogenic protein present in wheat, is not fully degraded by humans and after the normal gastric and pancreatic digestion, the immunodominant 33-mer gliadin peptide remains unprocessed. The 33-mer gliadin peptide is found in human faeces and urine, proving not only its proteolytic resistance in vivo but more importantly its transport through the entire human body. Here, we demonstrate that 33-mer supramolecular structures larger than 220 nm induce the overexpression of nuclear factor kappa B (NF-κB) via a specific Toll-like Receptor (TLR) 2 and (TLR) 4 dependent pathway and the secretion of pro-inflammatory cytokines such as IP-10/CXCL10 and TNF-α. Using helium ion microscopy, we elucidated the initial stages of oligomerisation of 33-mer gliadin peptide, showing that rod-like oligomers are nucleation sites for protofilament formation. The relevance of the 33-mer supramolecular structures in the early stages of the disease is paving new perspectives in the understanding of gluten-related disorders. Copyright © 2018. Published by Elsevier Inc.

Inactivation of Ebola virus and Middle East respiratory syndrome coronavirus in platelet concentrates and plasma by ultraviolet C light and methylene blue plus visible light, respectively.

PubMed

Eickmann, Markus; Gravemann, Ute; Handke, Wiebke; Tolksdorf, Frank; Reichenberg, Stefan; Müller, Thomas H; Seltsam, Axel

2018-05-06

Ebola virus (EBOV) and Middle East respiratory syndrome coronavirus (MERS-CoV) have been identified as potential threats to blood safety. This study investigated the efficacy of the THERAFLEX UV-Platelets and THERAFLEX MB-Plasma pathogen inactivation systems to inactivate EBOV and MERS-CoV in platelet concentrates (PCs) and plasma, respectively. PCs and plasma were spiked with high titers of cell culture-derived EBOV and MERS-CoV, treated with various light doses of ultraviolet C (UVC; THERAFLEX UV-Platelets) or methylene blue (MB) plus visible light (MB/light; THERAFLEX MB-Plasma), and assessed for residual viral infectivity. UVC reduced EBOV (≥4.5 log) and MERS-CoV (≥3.7 log) infectivity in PCs to the limit of detection, and MB/light decreased EBOV (≥4.6 log) and MERS-CoV (≥3.3 log) titers in plasma to nondetectable levels. Both THERAFLEX UV-Platelets (UVC) and THERAFLEX MB-Plasma (MB/light) effectively reduce EBOV and MERS-CoV infectivity in platelets and plasma, respectively. © 2018 AABB.

Biochemical and Structural Properties of a Thermostable Mercuric Ion Reductase from Metallosphaera sedula

PubMed Central

Artz, Jacob H.; White, Spencer N.; Zadvornyy, Oleg A.; Fugate, Corey J.; Hicks, Danny; Gauss, George H.; Posewitz, Matthew C.; Boyd, Eric S.; Peters, John W.

2015-01-01

Mercuric ion reductase (MerA), a mercury detoxification enzyme, has been tuned by evolution to have high specificity for mercuric ions (Hg2+) and to catalyze their reduction to a more volatile, less toxic elemental form. Here, we present a biochemical and structural characterization of MerA from the thermophilic crenarchaeon Metallosphaera sedula. MerA from M. sedula is a thermostable enzyme, and remains active after extended incubation at 97°C. At 37°C, the NADPH oxidation-linked Hg2+ reduction specific activity was found to be 1.9 μmol/min⋅mg, increasing to 3.1 μmol/min⋅mg at 70°C. M. sedula MerA crystals were obtained and the structure was solved to 1.6 Å, representing the first solved crystal structure of a thermophilic MerA. Comparison of both the crystal structure and amino acid sequence of MerA from M. sedula to mesophillic counterparts provides new insights into the structural determinants that underpin the thermal stability of the enzyme. PMID:26217660

Evaluation of candidate vaccine approaches for MERS-CoV

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Lingshu; Shi, Wei; Joyce, M. Gordon

The emergence of Middle East respiratory syndrome coronavirus (MERS-CoV) as a cause of severe respiratory disease highlights the need for effective approaches to CoV vaccine development. Efforts focused solely on the receptor-binding domain (RBD) of the viral Spike (S) glycoprotein may not optimize neutralizing antibody (NAb) responses. Here we show that immunogens based on full-length S DNA and S1 subunit protein elicit robust serum-neutralizing activity against several MERS-CoV strains in mice and non-human primates. Serological analysis and isolation of murine monoclonal antibodies revealed that immunization elicits NAbs to RBD and, non-RBD portions of S1 and S2 subunit. Multiple neutralization mechanismsmore » were demonstrated by solving the atomic structure of a NAb-RBD complex, through sequencing of neutralization escape viruses and by constructing MERS-CoV S variants for serological assays. Immunization of rhesus macaques confers protection against MERS-CoV-induced radiographic pneumonia, as assessed using computerized tomography, supporting this strategy as a promising approach for MERS-CoV vaccine development.« less

Impacts de l`élévation du niveau de la mer sur l'évolution future d'une côte basse à lagune de la péninsule du Cap Bon (Nord-Est de la Tunisie): approche cartographique

NASA Astrophysics Data System (ADS)

Brahmi, Noura; Dhieb, Mohsen; Chedly Rabia, Mohamed

2018-05-01

La submersion marine est l'une des principales menaces qui pèsent sur les zones humides littorales de la péninsule du Cap Bon. Or, cette menace est amenée à se renforcer en raison du réchauffement climatique qui entraînera une élévation du niveau marin et vraisemblablement un renforcement de l'intensité des tempêtes et des cyclones tropicaux d'ici à l'horizon 2100. L'objectif a donc été d'évaluer la vulnérabilité de la lagune face à la submersion. Dans cette optique, après avoir identifié les enjeux liés à l'élévation du niveau de la mer pour la lagune, nous avons dressé une cartographie prévisionnelle des risques de submersion par l'intermédiaire d'une application cartographique basée sur une modélisation numérique de terrain et analysé les impacts potentiels de ce phénomène. La cartographie est donc amenée à devenir centrale pour l'étude de l'impact du risque de la submersion marine sur les lagunes côtières et la gestion de ces espaces dans les décennies à venir. La cartographie de l'aléa submersion marine a montré que l'ouverture épisodique de brèches lors des tempêtes pourrait entraîner la submersion de l'ensemble du domaine lagunaire et aurait un impact morphogénique essentiel. En effet, le phénomène d'une accélération de l'élévation du niveau marin et d'un renforcement des tempêtes génère le morcellement du cordon littoral qui sépare la lagune de la mer. Par ailleurs, les pertes de matériel sédimentaire pour la plage augmenteront, dans la mesure où, lors d'une tempête, une grande partie des matériaux déplacés par les vagues dans les étangs par submersion ou par ouverture d'une brèche, ne peut être récupérée par la suite. Tout ceci constitue un facteur d'accélération du recul ou de disparition de la plage déjà très érodée. Les impacts de cette submersion pourraient être importants en absence de mesures préventives. Elle aurait ainsi des répercussions profondes sur les systèmes naturels et environnementaux et sur la qualité de vie de la population locale.

Diffusion control for a tempered anomalous diffusion system using fractional-order PI controllers.

PubMed

Juan Chen; Zhuang, Bo; Chen, YangQuan; Cui, Baotong

2017-05-09

This paper is concerned with diffusion control problem of a tempered anomalous diffusion system based on fractional-order PI controllers. The contribution of this paper is to introduce fractional-order PI controllers into the tempered anomalous diffusion system for mobile actuators motion and spraying control. For the proposed control force, convergence analysis of the system described by mobile actuator dynamical equations is presented based on Lyapunov stability arguments. Moreover, a new Centroidal Voronoi Tessellation (CVT) algorithm based on fractional-order PI controllers, henceforth called FOPI-based CVT algorithm, is provided together with a modified simulation platform called Fractional-Order Diffusion Mobile Actuator-Sensor 2-Dimension Fractional-Order Proportional Integral (FO-Diff-MAS2D-FOPI). Finally, extensive numerical simulations for the tempered anomalous diffusion process are presented to verify the effectiveness of our proposed fractional-order PI controllers. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Effect of chain length on the conformation and T cell recognition of synthetic hemagglutinin fragments

NASA Astrophysics Data System (ADS)

Tóth, Gábor K.; Holly, Sándor; Majer, Zsuzsa; Hollósi, Miklós; Rajnavölgyi, Éva; Laczkó, Ilona

2000-01-01

Circular dichroism and Fourier-transform infrared spectroscopies were used to compare the conformational mobility of 13-mer peptides covering the 317-329 region of the envelope protein hemagglutinin of human influenza A virus subtypes H1, H2 and H3 with that of their truncated deca- and nonapeptide analogs. These peptides were demonstrated to bind to the murine I-E d major histocompatibility complex encoded class II and human HLA-B*2705 class I molecules. Despite the amino acid substitutions in the three 13-mer subtype sequences, no significant differences in the conformational properties could be shown. Deletion of the N-terminal three residues resulted in a shift to an increased α-helical conformer population in the 317-329 H1 peptide and the breakage of the 3 10 or weakly H-bonded (nascent) α-helix in the H2 and H3 peptides. The conformational change observed upon deletion did not influence the efficiency of I-E d-peptide interaction, however, the C-terminal Arg had a beneficial effect both on MHC class II and class I binding without causing any remarkable change in solution conformation.

DNA with Parallel Strand Orientation: A Nanometer Distance Study with Spin Labels in the Watson-Crick and the Reverse Watson-Crick Double Helix.

PubMed

Wunnicke, Dorith; Ding, Ping; Yang, Haozhe; Seela, Frank; Steinhoff, Heinz-Jürgen

2015-10-29

Parallel-stranded (ps) DNA characterized by its sugar-phosphate backbones pointing in the same direction represents an alternative pairing system to antiparallel-stranded (aps) DNA with the potential to inhibit transcription and translation. 25-mer oligonucleotides were selected containing only dA·dT base pairs to compare spin-labeled nucleobase distances over a range of 10 or 15 base pairs in ps DNA with those in aps DNA. By means of the copper(I)-catalyzed Huisgen-Meldal-Sharpless alkyne-azide cycloaddition, the spin label 4-azido-2,2,6,6-tetramethylpiperidine-1-oxyl was clicked to 7-ethynyl-7-deaza-2'-deoxyadenosine or 5-ethynyl-2'-deoxyuridine to yield 25-mer oligonucleotides incorporating two spin labels. The interspin distances between spin labeled residues were determined by pulse EPR spectroscopy. The results reveal that in ps DNA these distances are between 5 and 10% longer than in aps DNA when the labeled DNA segment is located near the center of the double helix. The interspin distance in ps DNA becomes shorter compared with aps DNA when one of the spin labels occupies a position near the end of the double helix.

T7 lytic phage-displayed peptide libraries exhibit less sequence bias than M13 filamentous phage-displayed peptide libraries.

PubMed

Krumpe, Lauren R H; Atkinson, Andrew J; Smythers, Gary W; Kandel, Andrea; Schumacher, Kathryn M; McMahon, James B; Makowski, Lee; Mori, Toshiyuki

2006-08-01

We investigated whether the T7 system of phage display could produce peptide libraries of greater diversity than the M13 system of phage display due to the differing processes of lytic and filamentous phage morphogenesis. Using a bioinformatics-assisted computational approach, collections of random peptide sequences obtained from a T7 12-mer library (X(12)) and a T7 7-mer disulfide-constrained library (CX(7)C) were analyzed and compared with peptide populations obtained from New England BioLabs' M13 Ph.D.-12 and Ph.D.-C7C libraries. Based on this analysis, peptide libraries constructed with the T7 system have fewer amino acid biases, increased peptide diversity, and more normal distributions of peptide net charge and hydropathy than the M13 libraries. The greater diversity of T7-displayed libraries provides a potential resource of novel binding peptides for new as well as previously studied molecular targets. To demonstrate their utility, several of the T7-displayed peptide libraries were screened for streptavidin- and neutravidin-binding phage. Novel binding motifs were identified for each protein.

Determination of aquifer roof extending under the sea from variable-density flow modelling of groundwater response to tidal loading: case study of the Jahe River Basin, Shandong Province, China

NASA Astrophysics Data System (ADS)

Cheng, Jianmei; Chen, Chongxi; Ji, Menrui

The main task of studies on salt-water intrusion into coastal confined aquifers is to predict the position of the fresh- salt-water interface, which can be determined from the length of the aquifer roof extending under the sea. Records of groundwater level affected by tides can be used to infer hydrological conditions and determine hydraulic parameters of an aquifer extending under the sea. In this paper, a three-dimensional, variable-density groundwater flow model has been developed to determine the equivalent roof length of an aquifer extending under the sea from the tidal-effected data of groundwater level in the Jahe River Basin, Shandong Province, China. The seaward boundary is obtained by converging hydraulic head fluctuations observed in drill holes with calculated values, and the aquifer parameters in the extending zone are estimated. The impacts of aquifer roof length and aquifer parameters on the fluctuation of tidal groundwater are studied. It is concluded that the length of the aquifer roof extending under the sea should correspond with certain aquifer parameters in the extrapolation zone. Therefore, the seaward boundary determined from tidal-effect information is the equivalent boundary in hydrodynamic characteristics rather than the true boundary of the confined aquifer Les sujets principaux des études d'instrusion saline dans les aquifères confinés en zone côtière sont la prédiction de la position de l'interface entre l'eau salée et l'eau fraîche, qui peut être déterminée à partir de l'extention du toit de l'aquifère sous la mer. Les enregistrements des niveaux des eaux souterraines influencés par les marées peuvent être utilisés pour préciser les conditions hydrologiques et déterminer les paramètres hydrauliques d'un aquifère possédant une extension sous la mer. Dans cet article, un modèle tridimensionnel comprenant des eaux souterraines de densité variable a été développé pour déterminer la longueur équivalente du toit d'un aquifère qui s'étend sous la mer à partir des données concernant les effets de marée sur les eaux souterraines dans le bassin de la rivière Jahe, dans la province de Shandong, Chine. La limite de salinité est déterminée en faisant converger les fluctuations des hauteurs piézométriques avec les valeurs calculées, et les paramètres de l'aquifère sont estimés dans la zone s'étendant sous la mer. L'incidence de la longueur de l'aquifère sous la mer sur les fluctuations des niveaux est étudiée. On en conclut que la longueur du toit de l'aquifère sous la mer peut correspondre à certains aquifères paramètres dans la zone d'extrapolation. Par conséquent, la limite de salinité déterminée à partir des effets de marée est l'équivalent d'une limite hydrodynamique plutôt que la véritable limite de l'aquifère. El principal objetivo de los estudios sobre intrusiones de agua salada en acuíferos costeros confinados es predecir la posición de la interfase agua dulce-agua salada, la cual puede determinarse a partir de la longitud del techo del acuífero que se extiende por debajo del mar. Los registros de niveles de agua subterránea afectados por las mareas puede utilizarse para inferir las condiciones hidrológicas y determinar los parámetros hidráulicos de un acuífero que se extiende por debajo del mar. En este artículo se ha desarrollado un modelo de flujo tri-dimensional de agua subterránea de densidad variable para determinar la longitud del techo equivalente de un acuífero que se extiende por debajo del mar a partir de datos, afectados por la marea, de niveles de agua subterránea en la Cuenca del Río Jahe, Provincia Shandong, China. El límite hacia el océano se obtiene por convergencia de fluctuaciones de presiones hidráulicas observadas en pozos con valores calculados, y se estiman los parámetros del acuífero en la zona extendida. Se estudian los impactos de la longitud del techo del acuífero y los parámetros del acuífero en la fluctuación del agua subterránea afectada por las mareas. Se concluye que la longitud del techo del acuífero que se extiende por debajo del mar debería corresponder con ciertos parámetros del acuífero en la zona de extrapolación. Por lo tanto, el límite hacia el océano determinado a partir de información de efectos de marea es el límite equivalente en características hidrodinámicas más que el límite real del acuífero confinado.

A phylogenetically distinct Middle East respiratory syndrome coronavirus detected in a dromedary calf from a closed dairy herd in Dubai with rising seroprevalence with age.

PubMed

Wernery, Ulrich; El Rasoul, I Hassab; Wong, Emily Y M; Joseph, Marina; Chen, Yixin; Jose, Shanty; Tsang, Alan K L; Patteril, Nissy Annie Georgy; Chen, Honglin; Elizabeth, Shyna K; Yuen, Kwok-Yung; Joseph, Sunitha; Xia, Ningshao; Wernery, Renate; Lau, Susanna K P; Woo, Patrick C Y

2015-12-02

Middle East respiratory syndrome coronavirus (MERS-CoV) was detected by monoclonal antibody-based nucleocapsid protein-capture enzyme-linked immunosorbent assay (ELISA), RNA detection, and viral culture from the nasal sample of a 1-month-old dromedary calf in Dubai with sudden death. Whole genome phylogeny showed that this MERS-CoV strain did not cluster with the other MERS-CoV strains from Dubai that we reported recently. Instead, it formed a unique branch more closely related to other MERS-CoV strains from patients in Qatar and Hafr-Al-Batin in Saudi Arabia, as well as the MERS-CoV strains from patients in the recent Korean outbreak, in which the index patient acquired the infection during travel in the eastern part of the Arabian Peninsula. Non-synonymous mutations, resulting in 11 unique amino acid differences, were observed between the MERS-CoV genome from the present study and all the other available MERS-CoV genomes. Among these 11 unique amino acid differences, four were found in ORF1ab, three were found in the S1 domain of the spike protein, and one each was found in the proteins encoded by ORF4b, ORF5, envelope gene, and ORF8. MERS-CoV detection for all other 254 dromedaries in this closed dairy herd was negative by nucleocapsid protein-capture ELISA and RNA detection. MERS-CoV IgG sero-positivity gradually increased in dromedary calves with increasing age, with positivity rates of 75% at zero to three months, 79% at four months, 89% at five to six months, and 90% at seven to twelve months. The development of a rapid antigen detection kit for instantaneous diagnosis is warranted.Emerging Microbes & Infections (2015) 4, e74; doi:10.1038/emi.2015.74; published online 2 December 2015.

Maintenance energy requirements in miniature colony dogs.

PubMed

Serisier, S; Weber, M; Feugier, A; Fardet, M-O; Garnier, F; Biourge, V; German, A J

2013-05-01

There are numerous reports of maintenance energy requirements (MER) in dogs, but little information is available about energy requirements of miniature dog breeds. In this prospective, observational, cohort study, we aimed to determine MER in dogs from a number of miniature breeds and to determine which factors were associated with it. Forty-two dogs participated in the study. MER was calculated by determining daily energy intake (EI) during a period of 196 days (28-359 days) when body weight did not change significantly (e.g. ±2% in 12 weeks). Estimated median MER was 473 kJ/kg(0.75) /day (285-766 kJ/kg(0.75) /day), that is, median 113 kcal/kg(0.75) /day (68-183 kcal/kg(0.75) /day). In the obese dogs that lost weight, median MER after weight loss was completed was 360 kJ/kg(0.75) /day (285-515 kJ/kg(0.75) /day), that is, 86 kcal/kg(0.75) /day, (68-123 kcal/kg(0.75) /day). Simple linear regression analysis suggested that three breeds (e.g. Chihuahua, p = 0.002; Yorkshire terrier, p = 0.039; dachshund, p = 0.035) had an effect on MER. In addition to breed, simple linear regression revealed that neuter status (p = 0.079) and having previously been overweight (p = 0.002) were also of significance. However, with multiple linear regression analysis, only previous overweight status (MER less in dogs previously overweight p = 0.008) and breed (MER greater in Yorkshire terriers [p = 0.029] and less in Chihuahuas [p = 0.089]) remained in the final model. This study is the first to estimate MER in dogs of miniature breeds. Although further information from pet dogs is now needed, the current work will be useful for setting energy and nutrient requirement in such dogs for the future. Journal of Animal Physiology and Animal Nutrition © 2013 Blackwell Verlag GmbH.

Rapid and Effective Virucidal Activity of Povidone-Iodine Products Against Middle East Respiratory Syndrome Coronavirus (MERS-CoV) and Modified Vaccinia Virus Ankara (MVA).

PubMed

Eggers, Maren; Eickmann, Markus; Zorn, Juergen

2015-12-01

Since the first case of Middle East Respiratory Syndrome coronavirus (MERS-CoV) infection was reported in 2012, the virus has infected more than 1300 individuals in 26 countries, and caused more than 480 deaths. Human-to-human transmission requires close contact, and has typically occurred in the healthcare setting. Improved global awareness, together with improved hygiene practices in healthcare facilities, has been highlighted as key strategies in controlling the spread of MERS-CoV. This study tested the in vitro efficacy of three formulations of povidone iodine (PVP-I: 4% PVP-I skin cleanser, 7.5% PVP-I surgical scrub, and 1% PVP-I gargle/mouthwash) against a reference virus (Modified vaccinia virus Ankara, MVA) and MERS-CoV. According to EN14476, a standard suspension test was used to assess virucidal activity against MVA and large volume plating was used for MERS-CoV. All products were tested under clean (0.3 g/L bovine serum albumin, BSA) and dirty conditions (3.0 g/L BSA + 3.0 mL/L erythrocytes), with application times of 15, 30, and 60 s for MVA, and 15 s for MERS-CoV. The products were tested undiluted, 1:10 and 1:100 diluted against MVA, and undiluted against MERS-CoV. A reduction in virus titer of ≥4 log10 (corresponding to an inactivation of ≥99.99%) was regarded as evidence of virucidal activity. This was achieved versus MVA and MERS-CoV, under both clean and dirty conditions, within 15 s of application of each undiluted PVP-I product. These data indicate that PVP-I-based hand wash products for potentially contaminated skin, and PVP-I gargle/mouthwash for reduction of viral load in the oral cavity and the oropharynx, may help to support hygiene measures to prevent transmission of MERS-CoV. Mundipharma Research GmbH & Co.

Brownian motion of solitons in a Bose-Einstein condensate.

PubMed

Aycock, Lauren M; Hurst, Hilary M; Efimkin, Dmitry K; Genkina, Dina; Lu, Hsin-I; Galitski, Victor M; Spielman, I B

2017-03-07

We observed and controlled the Brownian motion of solitons. We launched solitonic excitations in highly elongated [Formula: see text] Bose-Einstein condensates (BECs) and showed that a dilute background of impurity atoms in a different internal state dramatically affects the soliton. With no impurities and in one dimension (1D), these solitons would have an infinite lifetime, a consequence of integrability. In our experiment, the added impurities scatter off the much larger soliton, contributing to its Brownian motion and decreasing its lifetime. We describe the soliton's diffusive behavior using a quasi-1D scattering theory of impurity atoms interacting with a soliton, giving diffusion coefficients consistent with experiment.

Brownian motion of solitons in a Bose–Einstein condensate

PubMed Central

Aycock, Lauren M.; Hurst, Hilary M.; Efimkin, Dmitry K.; Genkina, Dina; Lu, Hsin-I; Galitski, Victor M.; Spielman, I. B.

2017-01-01

We observed and controlled the Brownian motion of solitons. We launched solitonic excitations in highly elongated Rb87 Bose–Einstein condensates (BECs) and showed that a dilute background of impurity atoms in a different internal state dramatically affects the soliton. With no impurities and in one dimension (1D), these solitons would have an infinite lifetime, a consequence of integrability. In our experiment, the added impurities scatter off the much larger soliton, contributing to its Brownian motion and decreasing its lifetime. We describe the soliton’s diffusive behavior using a quasi-1D scattering theory of impurity atoms interacting with a soliton, giving diffusion coefficients consistent with experiment. PMID:28196896

­­­Experimental Quantifications of Radiation Damage Annealing and Helium Diffusion Kinetics in Apatite

NASA Astrophysics Data System (ADS)

Willett, C. D.; Shuster, D. L.

2017-12-01

(U-Th)/He thermochronology in apatite requires a quantitative description of He diffusivity as a function of temperature and through geologic time. Although variability in diffusion kinetics across a range of natural apatite samples has revealed that higher concentrations of alpha-recoil radiation damage correlates with lower He diffusivity (i.e., at a given temperature, [1]), only one published study has experimentally quantified the effects of annealing for a single apatite specimen (Durango apatite, [2]). Although these effects have been incorporated into now widely applied numerical models, underlying assumptions in these models—in particular, that He diffusivity in all apatite crystals responds with the same rate of damage annealing—have been called into question, and further evaluation is warranted (e.g., [3], [4]). Here, we will describe a suite of experiments conducted on apatite from a single hand sample of granite from Sierra Nevada, CA as well as Durango apatite, to establish whether these two apatites with different chemical compositions and thermal pasts exhibit the same response to annealing conditions. Crystals from both samples were heated under vacuum to temperatures between 220 and 500 °C for 1, 10, 100 or 1000 hours. The samples were then irradiated with 220 MeV protons to produce spallation 3He, the diffusant used in subsequent step-heating degassing experiments. Our preliminary results indicate different minima in closure temperatures of 55 oC and 65 oC for the Durango and Sierra apatite, respectively, when exposed to sufficiently high temperatures (>350 oC) for durations > 1 hour, yet similar transitions from low diffusivities at T <200 oC (and higher activation energy, Ea) to higher diffusivity (lower Ea) across a range of experimental annealing temperatures and durations. We will interpret these results with a new model framework for describing the effects of annealing on diffusivity, and will discuss potential implications of our experimental results, the required assumptions in our analyses, and potential limitations of such empirical quantifications. References: [1] Shuster, D. et al. (2006), EPSL 294, 148-161; [2] Shuster, D., Farley, K. (2009), GCA 73 (1), 6183-6196; [3] Gautheron, C. et al. (2013), Chem. Geol. 351, 257-267; [4] Fox, M., Shuster, D. (2014), EPSL 397, 174-183.

Supervised segmentation of microelectrode recording artifacts using power spectral density.

PubMed

Bakstein, Eduard; Schneider, Jakub; Sieger, Tomas; Novak, Daniel; Wild, Jiri; Jech, Robert

2015-08-01

Appropriate detection of clean signal segments in extracellular microelectrode recordings (MER) is vital for maintaining high signal-to-noise ratio in MER studies. Existing alternatives to manual signal inspection are based on unsupervised change-point detection. We present a method of supervised MER artifact classification, based on power spectral density (PSD) and evaluate its performance on a database of 95 labelled MER signals. The proposed method yielded test-set accuracy of 90%, which was close to the accuracy of annotation (94%). The unsupervised methods achieved accuracy of about 77% on both training and testing data.

Optical second-harmonic diffraction study of anisotropic surface diffusion: CO on Ni(110)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, X.; Zhu, X.D.; Daum, W.

We describe in detail a technique using optical second-harmonic (SH) diffraction from a one-dimensional laser-induced monolayer grating to probe surface diffusion of adsorbates and its anisotropy on a solid surface. The case of CO on Ni(110) is used as a demonstration. The two orthogonal and independent diffusion tensor components along (1{bar 1}0) and (001) are measured, exhibiting a strong anisotropy in both the activation energy {ital E}{sub diff} and the preexponential factor {ital D}{sub 0} in the diffusion coefficients. A compensation effect between {ital E}{sub diff} and {ital D}{sub 0} is observed. In comparison with CO/Ni(111) and CO/Ni(100), our resultmore » suggests that the Ni(110) surface seen by CO is much smoother than Ni(111) and Ni(100). Both advantages and limitations of the present technique are mentioned and possible complications in the data analysis are discussed.« less

Diffusion in the presence of a local attracting factor: Theory and interdisciplinary applications.

PubMed

Veermäe, Hardi; Patriarca, Marco

2017-06-01

In many complex diffusion processes the drift of random walkers is not caused by an external force, as in the case of Brownian motion, but by local variations of fitness perceived by the random walkers. In this paper, a simple but general framework is presented that describes such a type of random motion and may be of relevance in different problems, such as opinion dynamics, cultural spreading, and animal movement. To this aim, we study the problem of a random walker in d dimensions moving in the presence of a local heterogeneous attracting factor expressed in terms of an assigned position-dependent "attractiveness function." At variance with standard Brownian motion, the attractiveness function introduced here regulates both the advection and diffusion of the random walker, thus providing testable predictions for a specific form of fluctuation-relations. We discuss the relation between the drift-diffusion equation based on the attractiveness function and that describing standard Brownian motion, and we provide some explicit examples illustrating its relevance in different fields, such as animal movement, chemotactic diffusion, and social dynamics.

Diffusion in the presence of a local attracting factor: Theory and interdisciplinary applications

NASA Astrophysics Data System (ADS)

Veermäe, Hardi; Patriarca, Marco

2017-06-01

In many complex diffusion processes the drift of random walkers is not caused by an external force, as in the case of Brownian motion, but by local variations of fitness perceived by the random walkers. In this paper, a simple but general framework is presented that describes such a type of random motion and may be of relevance in different problems, such as opinion dynamics, cultural spreading, and animal movement. To this aim, we study the problem of a random walker in d dimensions moving in the presence of a local heterogeneous attracting factor expressed in terms of an assigned position-dependent "attractiveness function." At variance with standard Brownian motion, the attractiveness function introduced here regulates both the advection and diffusion of the random walker, thus providing testable predictions for a specific form of fluctuation-relations. We discuss the relation between the drift-diffusion equation based on the attractiveness function and that describing standard Brownian motion, and we provide some explicit examples illustrating its relevance in different fields, such as animal movement, chemotactic diffusion, and social dynamics.

Disulfiram can inhibit MERS and SARS coronavirus papain-like proteases via different modes.

PubMed

Lin, Min-Han; Moses, David C; Hsieh, Chih-Hua; Cheng, Shu-Chun; Chen, Yau-Hung; Sun, Chiao-Yin; Chou, Chi-Yuan

2018-02-01

Severe acute respiratory syndrome coronavirus (SARS-CoV) emerged in southern China in late 2002 and caused a global outbreak with a fatality rate around 10% in 2003. Ten years later, a second highly pathogenic human CoV, MERS-CoV, emerged in the Middle East and has spread to other countries in Europe, North Africa, North America and Asia. As of November 2017, MERS-CoV had infected at least 2102 people with a fatality rate of about 35% globally, and hence there is an urgent need to identify antiviral drugs that are active against MERS-CoV. Here we show that a clinically available alcohol-aversive drug, disulfiram, can inhibit the papain-like proteases (PL pro s) of MERS-CoV and SARS-CoV. Our findings suggest that disulfiram acts as an allosteric inhibitor of MERS-CoV PL pro but as a competitive (or mixed) inhibitor of SARS-CoV PL pro . The phenomenon of slow-binding inhibition and the irrecoverability of enzyme activity after removing unbound disulfiram indicate covalent inactivation of SARS-CoV PL pro by disulfiram, while synergistic inhibition of MERS-CoV PL pro by disulfiram and 6-thioguanine or mycophenolic acid implies the potential for combination treatments using these three clinically available drugs. Copyright © 2017 Elsevier B.V. All rights reserved.

Middle East respiratory syndrome.

PubMed

Zumla, Alimuddin; Hui, David S; Perlman, Stanley

2015-09-05

Middle East respiratory syndrome (MERS) is a highly lethal respiratory disease caused by a novel single-stranded, positive-sense RNA betacoronavirus (MERS-CoV). Dromedary camels, hosts for MERS-CoV, are implicated in direct or indirect transmission to human beings, although the exact mode of transmission is unknown. The virus was first isolated from a patient who died from a severe respiratory illness in June, 2012, in Jeddah, Saudi Arabia. As of May 31, 2015, 1180 laboratory-confirmed cases (483 deaths; 40% mortality) have been reported to WHO. Both community-acquired and hospital-acquired cases have been reported with little human-to-human transmission reported in the community. Although most cases of MERS have occurred in Saudi Arabia and the United Arab Emirates, cases have been reported in Europe, the USA, and Asia in people who travelled from the Middle East or their contacts. Clinical features of MERS range from asymptomatic or mild disease to acute respiratory distress syndrome and multiorgan failure resulting in death, especially in individuals with underlying comorbidities. No specific drug treatment exists for MERS and infection prevention and control measures are crucial to prevent spread in health-care facilities. MERS-CoV continues to be an endemic, low-level public health threat. However, the virus could mutate to have increased interhuman transmissibility, increasing its pandemic potential. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural Analysis of the Hg(II)-Regulatory Protein Tn501 MerR from Pseudomonas aeruginosa

NASA Astrophysics Data System (ADS)

Wang, Dan; Huang, Shanqing; Liu, Pingying; Liu, Xichun; He, Yafeng; Chen, Weizhong; Hu, Qingyuan; Wei, Tianbiao; Gan, Jianhua; Ma, Jing; Chen, Hao

2016-09-01

The metalloprotein MerR is a mercury(II)-dependent transcriptional repressor-activator that responds to mercury(II) with extraordinary sensitivity and selectivity. It’s widely distributed in both Gram-negative and Gram-positive bacteria but with barely detectable sequence identities between the two sources. To provide structural basis for the considerable biochemical and biophysical experiments previously performed on Tn501 and Tn21 MerR from Gram-negative bacteria, we analyzed the crystal structure of mercury(II)-bound Tn501 MerR. The structure in the metal-binding domain provides Tn501 MerR with a high affinity for mercury(II) and the ability to distinguish mercury(II) from other metals with its unique planar trigonal coordination geometry, which is adopted by both Gram-negative and Gram-positive bacteria. The mercury(II) coordination state in the C-terminal metal-binding domain is transmitted through the allosteric network across the dimer interface to the N-terminal DNA-binding domain. Together with the previous mutagenesis analyses, the present data indicate that the residues in the allosteric pathway have a central role in maintaining the functions of Tn501 MerR. In addition, the complex structure exhibits significant differences in tertiary and quaternary structural arrangements compared to those of Bacillus MerR from Gram-positive bacteria, which probably enable them to function with specific promoter DNA with different spacers between -35 and -10 elements.

Wavelength dependence of dust aerosol single scattering albedo as observed by the Compact Reconnaissance Imaging Spectrometer

NASA Astrophysics Data System (ADS)

Wolff, M. J.; Smith, M. D.; Clancy, R. T.; Arvidson, R.; Kahre, M.; Seelos, F.; Murchie, S.; Savijärvi, H.

2009-06-01

Observations by the Compact Reconnaissance Imaging Spectrometer (CRISM) onboard the Mars Reconnaissance Orbiter (MRO) over the range 440-2920 nm of the very dusty Martian atmosphere of the 2007 planet-encircling dust event are combined with those made by both Mars Exploration Rovers (MERs) to better characterize the single scattering albedo (ω 0) of Martian dust aerosols. Using the diagnostic geometry of the CRISM emission phase function (EPF) sequences and the “ground truth” connection provided at both MER locations allows one to more effectively isolate the single scattering albedo (ω 0). This approach eliminates a significant portion of the type of uncertainty involved in many of the earlier radiative transfer analyses. Furthermore, the use of a “first principles” or microphysical representation of the aerosol scattering properties offers a direct path to produce a set of complex refractive indices (m = n + ik) that are consistent with the retrieved ω 0 values. We consider a family of effective particle radii: 1.2, 1.4, 1.6, and 1.8 μm. The resulting set of model data comparisons, ω 0, and m are presented along with an assessment of potential sources of error and uncertainty. We discuss our results within the context of previous work, including the apparent dichotomy of the literature values: “dark” (solar band ω 0 = 0.89-0.90) and “bright” (solar band ω 0 = 0.92-0.94). Previous work suggests that a mean radius of 1.8 μm is representative for the conditions sampled by the CRISM observations. Using the m for this case and a smaller effective particle radius more appropriate for diffuse dust conditions (1.4 μm), we examine EPF-derived optical depths relative to the MER 880 nm optical depths. Finally, we explore the potential impact of the resulting brighter solar band ω 0 of 0.94 to atmospheric temperatures in the planetary boundary layer.

Iron and nickel isotope fractionation by diffusion, with applications to iron meteorites

NASA Astrophysics Data System (ADS)

Watson, Heather C.; Richter, Frank; Liu, Ankun; Huss, Gary R.

2016-10-01

Mass-dependent, kinetic fractionation of isotopes through processes such as diffusion can result in measurable isotopic signatures. When these signatures are retained in geologic materials, they can be used to help interpret their thermal histories. The mass dependence of the diffusion coefficient of isotopes 1 and 2 can be written as (D1 /D2) =(m2 /m1) β, where D1 and D2 are the diffusion coefficients of m1 and m2 respectively, and β is an empirical coefficient that relates the two ratios. Experiments have been performed to measure β in the Fe-Ni alloy system. Diffusion couple experiments between pure Fe and Ni metals were run in a piston cylinder at 1300-1400 °C and 1 GPa. Concentration and isotopic profiles were measured by electron microprobe and ion microprobe respectively. We find that a single β coefficient of β = 0.32 ± 0.04 can describe the isotopic effect in all experiments. This result is comparable to the isotope effect determined in many other similar alloy systems. The new β coefficient is used in a model of the isotopic profiles to be expected during the Widmanstätten pattern formation in iron meteorites. The results are consistent with previous estimates of the cooling rate of the iron meteorite Toluca. The application of isotopic constraints based on these results in addition to conventional cooling rate models could provide a more robust picture of the thermal history of these early planetary bodies.

Coding, modulation, and relays for deep space communication Mars Rovers Case Study

NASA Technical Reports Server (NTRS)

Statman, Joseph I.; Edwards, Charles D.

2004-01-01

This paper presents the communications challenges for the MER mission, the use of DSN and MER tools to maximize the science return, and the application of standards-based relays to the problem. To date, more than 90% of the data returned from MER has been returned via relays, not direct-to-Earath (DTE).

Nordic Winter and Cold: Their Correspondence with Tomas Tranströmer's Poetry

ERIC Educational Resources Information Center

Hosian, Mohammad Akbar

2015-01-01

The Nobel Prize winning poet Tomas Tranströmer was born and bred in Sweden, a remarkably Scandinavian country. Topographically, Scandinavian countries are locations of extreme cold and snowing. This distinguishing climatic condition has had a dominant influence and impact on almost all Scandinavian art and literature, including Tomas Tranströmer's…

78 FR 33842 - Determination and Declaration Regarding Emergency Use of In Vitro Diagnostics for Detection of...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-06-05

... In Vitro Diagnostics for Detection of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) AGENCY... Middle East respiratory syndrome coronavirus (MERS-CoV). On the basis of this determination, she also... detection of Middle East respiratory syndrome coronavirus (MERS-CoV) pursuant to section 564 of the FD&C Act...

An axisymmetric non-hydrostatic model for double-diffusive water systems

NASA Astrophysics Data System (ADS)

Hilgersom, Koen; Zijlema, Marcel; van de Giesen, Nick

2018-02-01

The three-dimensional (3-D) modelling of water systems involving double-diffusive processes is challenging due to the large computation times required to solve the flow and transport of constituents. In 3-D systems that approach axisymmetry around a central location, computation times can be reduced by applying a 2-D axisymmetric model set-up. This article applies the Reynolds-averaged Navier-Stokes equations described in cylindrical coordinates and integrates them to guarantee mass and momentum conservation. The discretized equations are presented in a way that a Cartesian finite-volume model can be easily extended to the developed framework, which is demonstrated by the implementation into a non-hydrostatic free-surface flow model. This model employs temperature- and salinity-dependent densities, molecular diffusivities, and kinematic viscosity. One quantitative case study, based on an analytical solution derived for the radial expansion of a dense water layer, and two qualitative case studies demonstrate a good behaviour of the model for seepage inflows with contrasting salinities and temperatures. Four case studies with respect to double-diffusive processes in a stratified water body demonstrate that turbulent flows are not yet correctly modelled near the interfaces and that an advanced turbulence model is required.

Fractional calculus phenomenology in two-dimensional plasma models

NASA Astrophysics Data System (ADS)

Gustafson, Kyle; Del Castillo Negrete, Diego; Dorland, Bill

2006-10-01

Transport processes in confined plasmas for fusion experiments, such as ITER, are not well-understood at the basic level of fully nonlinear, three-dimensional kinetic physics. Turbulent transport is invoked to describe the observed levels in tokamaks, which are orders of magnitude greater than the theoretical predictions. Recent results show the ability of a non-diffusive transport model to describe numerical observations of turbulent transport. For example, resistive MHD modeling of tracer particle transport in pressure-gradient driven turbulence for a three-dimensional plasma reveals that the superdiffusive (2̂˜t^α where α> 1) radial transport in this system is described quantitatively by a fractional diffusion equation Fractional calculus is a generalization involving integro-differential operators, which naturally describe non-local behaviors. Our previous work showed the quantitative agreement of special fractional diffusion equation solutions with numerical tracer particle flows in time-dependent linearized dynamics of the Hasegawa-Mima equation (for poloidal transport in a two-dimensional cold-ion plasma). In pursuit of a fractional diffusion model for transport in a gyrokinetic plasma, we now present numerical results from tracer particle transport in the nonlinear Hasegawa-Mima equation and a planar gyrokinetic model. Finite Larmor radius effects will be discussed. D. del Castillo Negrete, et al, Phys. Rev. Lett. 94, 065003 (2005).

Infection control and prevention practices implemented to reduce transmission risk of Middle East respiratory syndrome-coronavirus in a tertiary care institution in Saudi Arabia.

PubMed

Butt, Taimur S; Koutlakis-Barron, Irene; AlJumaah, Suliman; AlThawadi, Sahar; AlMofada, Saleh

2016-05-01

Transmission of Middle East respiratory syndrome-coronavirus (MERS-CoV) among health care workers (HCWs) and patients has been documented with mortality rate approximating 36%. We propose advanced infection control measures (A-IC) used in conjunction with basic infection control measures (B-IC) help reduce pathogen transmission. B-IC include standard and transmission-based precautions. A-IC are initiatives implemented within our center to enhance effectiveness of B-IC. Study effectiveness of combining B-IC and A-IC to prevent transmission of MERS-CoV to HCWs. A retrospective observational study was undertaken. A-IC measures include administrative support with daily rounds; infection control risk assessment; timely screening, isolation, and specimen analysis; collaboration; epidemic planning; stockpiling; implementation of contingency plans; full personal protective equipment use for advanced airway management; use of a real-time electronic isolation flagging system; infection prevention and control team on-call protocols; pretransfer MERS-CoV testing; and education. A total of 874 real-time polymerase chain reaction MERS-CoV tests were performed during the period beginning July 1, 2013, and ending January 31, 2015. Six hundred ninety-four non-HCWs were tested, of these 16 tested positive for MERS-CoV and their infection was community acquired. Sixty-nine percent of the confirmed MERS-CoV-positive cases were men, with an average age of 56 years (range, 19-84 years). Of the total tested for MERS-CoV, 180 individuals were HCWs with zero positivity. Adhering to a combination of B-IC and A-IC reduces the risk of MERS-CoV transmission to HCWs. Copyright © 2016 Association for Professionals in Infection Control and Epidemiology, Inc. Published by Elsevier Inc. All rights reserved.

MERS coronaviruses from camels in Africa exhibit region-dependent genetic diversity.

PubMed

Chu, Daniel K W; Hui, Kenrie P Y; Perera, Ranawaka A P M; Miguel, Eve; Niemeyer, Daniela; Zhao, Jincun; Channappanavar, Rudragouda; Dudas, Gytis; Oladipo, Jamiu O; Traoré, Amadou; Fassi-Fihri, Ouafaa; Ali, Abraham; Demissié, Getnet F; Muth, Doreen; Chan, Michael C W; Nicholls, John M; Meyerholz, David K; Kuranga, Sulyman A; Mamo, Gezahegne; Zhou, Ziqi; So, Ray T Y; Hemida, Maged G; Webby, Richard J; Roger, Francois; Rambaut, Andrew; Poon, Leo L M; Perlman, Stanley; Drosten, Christian; Chevalier, Veronique; Peiris, Malik

2018-03-20

Middle East respiratory syndrome coronavirus (MERS-CoV) causes a zoonotic respiratory disease of global public health concern, and dromedary camels are the only proven source of zoonotic infection. Although MERS-CoV infection is ubiquitous in dromedaries across Africa as well as in the Arabian Peninsula, zoonotic disease appears confined to the Arabian Peninsula. MERS-CoVs from Africa have hitherto been poorly studied. We genetically and phenotypically characterized MERS-CoV from dromedaries sampled in Morocco, Burkina Faso, Nigeria, and Ethiopia. Viruses from Africa (clade C) are phylogenetically distinct from contemporary viruses from the Arabian Peninsula (clades A and B) but remain antigenically similar in microneutralization tests. Viruses from West (Nigeria, Burkina Faso) and North (Morocco) Africa form a subclade, C1, that shares clade-defining genetic signatures including deletions in the accessory gene ORF4b Compared with human and camel MERS-CoV from Saudi Arabia, virus isolates from Burkina Faso (BF785) and Nigeria (Nig1657) had lower virus replication competence in Calu-3 cells and in ex vivo cultures of human bronchus and lung. BF785 replicated to lower titer in lungs of human DPP4-transduced mice. A reverse genetics-derived recombinant MERS-CoV (EMC) lacking ORF4b elicited higher type I and III IFN responses than the isogenic EMC virus in Calu-3 cells. However, ORF4b deletions may not be the major determinant of the reduced replication competence of BF785 and Nig1657. Genetic and phenotypic differences in West African viruses may be relevant to zoonotic potential. There is an urgent need for studies of MERS-CoV at the animal-human interface. Copyright © 2018 the Author(s). Published by PNAS.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower on Launch Complex 17-A, Cape Canaveral Air Force Station, clears the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are in the clear after tower rollback in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - With smoke and steam billowing beneath, the Delta II rocket with its Mars Exploration Rover (MER-A) payload leaps off the launch pad into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Leaving smoke and steam behind, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower (right) and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower begins to roll back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are viewed as the launch tower overhead rolls back. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload are free of the tower and ready for launch. This will be the third launch attempt in as many days after weather concerns postponed the launches June 8 and June 9. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - The Delta II rocket with its Mars Exploration Rover (MER-A) payload breaks forth from the smoke and steam into the blue sky to begin its journey to Mars. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload is viewed from under the launch tower as it moves away on Launch Complex 17-A, Cape Canaveral Air Force Station. This will be a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - The launch tower (right) on Launch Complex 17-A, Cape Canaveral Air Force Station, has been rolled back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload (left) in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Amid billows of smoke and steam, the Delta II rocket with its Mars Exploration Rover (MER-A) payload lifts off the pad on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-09

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload waits for rollback of the launch tower in preparation for a second attempt at launch. The first attempt on June 8, 2003, was scrubbed due to bad weather in the vicinity. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - On Launch Complex 17-A, Cape Canaveral Air Force Station, the launch tower rolls back from the Boeing Delta II rocket and its Mars Exploration Rover (MER-A) payload in preparation for another launch attempt. The first two attempts, June 8 and June 9, were postponed due to weather concerns. MER-A is the first of two rovers being launched to Mars. When the two rovers arrive at Mars in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

NASA Image and Video Library

2003-06-10

KENNEDY SPACE CENTER, FLA. - Blue sky and sun give a dramatic backdrop for the launch of the Delta II rocket with its Mars Exploration Rover (MER-A) payload. Liftoff occurred on time at 1:58 p.m. EDT from Launch Complex 17-A, Cape Canaveral Air Force Station. MER-A, known as "Spirit," is the first of two rovers being launched to Mars. When the two rovers arrive at the red planet in 2004, they will bounce to airbag-cushioned landings at sites offering a balance of favorable conditions for safe landings and interesting science. The rovers see sharper images, can explore farther and examine rocks better than anything that has ever landed on Mars. The designated site for the MER-A mission is Gusev Crater, which appears to have been a crater lake. The second rover, MER-B, is scheduled to launch June 25.

Middle East respiratory syndrome coronavirus neutralising serum antibodies in dromedary camels: a comparative serological study.

PubMed

Reusken, Chantal B E M; Haagmans, Bart L; Müller, Marcel A; Gutierrez, Carlos; Godeke, Gert-Jan; Meyer, Benjamin; Muth, Doreen; Raj, V Stalin; Smits-De Vries, Laura; Corman, Victor M; Drexler, Jan-Felix; Smits, Saskia L; El Tahir, Yasmin E; De Sousa, Rita; van Beek, Janko; Nowotny, Norbert; van Maanen, Kees; Hidalgo-Hermoso, Ezequiel; Bosch, Berend-Jan; Rottier, Peter; Osterhaus, Albert; Gortázar-Schmidt, Christian; Drosten, Christian; Koopmans, Marion P G

2013-10-01

A new betacoronavirus-Middle East respiratory syndrome coronavirus (MERS-CoV)-has been identified in patients with severe acute respiratory infection. Although related viruses infect bats, molecular clock analyses have been unable to identify direct ancestors of MERS-CoV. Anecdotal exposure histories suggest that patients had been in contact with dromedary camels or goats. We investigated possible animal reservoirs of MERS-CoV by assessing specific serum antibodies in livestock. We took sera from animals in the Middle East (Oman) and from elsewhere (Spain, Netherlands, Chile). Cattle (n=80), sheep (n=40), goats (n=40), dromedary camels (n=155), and various other camelid species (n=34) were tested for specific serum IgG by protein microarray using the receptor-binding S1 subunits of spike proteins of MERS-CoV, severe acute respiratory syndrome coronavirus, and human coronavirus OC43. Results were confirmed by virus neutralisation tests for MERS-CoV and bovine coronavirus. 50 of 50 (100%) sera from Omani camels and 15 of 105 (14%) from Spanish camels had protein-specific antibodies against MERS-CoV spike. Sera from European sheep, goats, cattle, and other camelids had no such antibodies. MERS-CoV neutralising antibody titres varied between 1/320 and 1/2560 for the Omani camel sera and between 1/20 and 1/320 for the Spanish camel sera. There was no evidence for cross-neutralisation by bovine coronavirus antibodies. MERS-CoV or a related virus has infected camel populations. Both titres and seroprevalences in sera from different locations in Oman suggest widespread infection. European Union, European Centre For Disease Prevention and Control, Deutsche Forschungsgemeinschaft. Copyright © 2013 Elsevier Ltd. All rights reserved.

Host cell entry of Middle East respiratory syndrome coronavirus after two-step, furin-mediated activation of the spike protein

PubMed Central

Millet, Jean Kaoru; Whittaker, Gary R.

2014-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is a newly identified betacoronavirus causing high morbidity and mortality in humans. The coronavirus spike (S) protein is the main determinant of viral entry, and although it was previously shown that MERS-CoV S can be activated by various proteases, the details of the mechanisms of proteolytic activation of fusion are still incompletely characterized. Here, we have uncovered distinctive characteristics of MERS-CoV S. We identify, by bioinformatics and peptide cleavage assays, two cleavage sites for furin, a ubiquitously expressed protease, which are located at the S1/S2 interface and at the S2′ position of the S protein. We show that although the S1/S2 site is proteolytically processed by furin during protein biosynthesis, the S2′ site is cleaved upon viral entry. MERS-CoV pseudovirion infection was shown to be enhanced by elevated levels of furin expression, and entry could be decreased by furin siRNA silencing. Enhanced furin activity appeared to partially override the low pH-dependent nature of MERS-CoV entry. Inhibition of furin activity was shown to decrease MERS-CoV S-mediated entry, as well as infection by the virus. Overall, we show that MERS-CoV has evolved an unusual two-step furin activation for fusion, suggestive of a role during the process of emergence into the human population. The ability of MERS-CoV to use furin in this manner, along with other proteases, may explain the polytropic nature of the virus. PMID:25288733

Mapping Potential Amplification and Transmission Hotspots for MERS-CoV, Kenya.

PubMed

Gikonyo, Stephen; Kimani, Tabitha; Matere, Joseph; Kimutai, Joshua; Kiambi, Stella G; Bitek, Austine O; Juma Ngeiywa, K J Z; Makonnen, Yilma J; Tripodi, Astrid; Morzaria, Subhash; Lubroth, Juan; Rugalema, Gabriel; Fasina, Folorunso Oludayo

2018-03-16

Dromedary camels have been implicated consistently as the source of Middle East respiratory syndrome coronavirus (MERS-CoV) human infections and attention to prevent and control it has focused on camels. To understanding the epidemiological role of camels in the transmission of MERS-CoV, we utilized an iterative empirical process in Geographic Information System (GIS) to identify and qualify potential hotspots for maintenance and circulation of MERS-CoV, and produced risk-based surveillance sites in Kenya. Data on camel population and distribution were used to develop camel density map, while camel farming system was defined using multi-factorial criteria including the agro-ecological zones (AEZs), production and marketing practices. Primary and secondary MERS-CoV seroprevalence data from specific sites were analyzed, and location-based prevalence matching with camel densities was conducted. High-risk convergence points (migration zones, trade routes, camel markets, slaughter slabs) were profiled and frequent cross-border camel movement mapped. Results showed that high camel-dense areas and interaction (markets and migration zones) were potential hotspot for transmission and spread. Cross-border contacts occurred with in-migrated herds at hotspot locations. AEZ differential did not influence risk distribution and plausible risk factors for spatial MERS-CoV hotspots were camel densities, previous cases of MERS-CoV, high seroprevalence and points of camel convergences. Although Kenyan camels are predisposed to MERS-CoV, no shedding is documented to date. These potential hotspots, determined using anthropogenic, system and trade characterizations should guide selection of sampling/surveillance sites, high-risk locations, critical areas for interventions and policy development in Kenya, as well as instigate further virological examination of camels.

Inhibitor recognition specificity of MERS-CoV papain-like protease may differ from that of SARS-CoV.

PubMed

Lee, Hyun; Lei, Hao; Santarsiero, Bernard D; Gatuz, Joseph L; Cao, Shuyi; Rice, Amy J; Patel, Kavankumar; Szypulinski, Michael Z; Ojeda, Isabel; Ghosh, Arun K; Johnson, Michael E

2015-06-19

The Middle East Respiratory Syndrome coronavirus (MERS-CoV) papain-like protease (PLpro) blocking loop 2 (BL2) structure differs significantly from that of SARS-CoV PLpro, where it has been proven to play a crucial role in SARS-CoV PLpro inhibitor binding. Four SARS-CoV PLpro lead inhibitors were tested against MERS-CoV PLpro, none of which were effective against MERS-CoV PLpro. Structure and sequence alignments revealed that two residues, Y269 and Q270, responsible for inhibitor binding to SARS-CoV PLpro, were replaced by T274 and A275 in MERS-CoV PLpro, making critical binding interactions difficult to form for similar types of inhibitors. High-throughput screening (HTS) of 25 000 compounds against both PLpro enzymes identified a small fragment-like noncovalent dual inhibitor. Mode of inhibition studies by enzyme kinetics and competition surface plasmon resonance (SPR) analyses suggested that this compound acts as a competitive inhibitor with an IC50 of 6 μM against MERS-CoV PLpro, indicating that it binds to the active site, whereas it acts as an allosteric inhibitor against SARS-CoV PLpro with an IC50 of 11 μM. These results raised the possibility that inhibitor recognition specificity of MERS-CoV PLpro may differ from that of SARS-CoV PLpro. In addition, inhibitory activity of this compound was selective for SARS-CoV and MERS-CoV PLpro enzymes over two human homologues, the ubiquitin C-terminal hydrolases 1 and 3 (hUCH-L1 and hUCH-L3).

Turtle: identifying frequent k-mers with cache-efficient algorithms.

PubMed

Roy, Rajat Shuvro; Bhattacharya, Debashish; Schliep, Alexander

2014-07-15

Counting the frequencies of k-mers in read libraries is often a first step in the analysis of high-throughput sequencing data. Infrequent k-mers are assumed to be a result of sequencing errors. The frequent k-mers constitute a reduced but error-free representation of the experiment, which can inform read error correction or serve as the input to de novo assembly methods. Ideally, the memory requirement for counting should be linear in the number of frequent k-mers and not in the, typically much larger, total number of k-mers in the read library. We present a novel method that balances time, space and accuracy requirements to efficiently extract frequent k-mers even for high-coverage libraries and large genomes such as human. Our method is designed to minimize cache misses in a cache-efficient manner by using a pattern-blocked Bloom filter to remove infrequent k-mers from consideration in combination with a novel sort-and-compact scheme, instead of a hash, for the actual counting. Although this increases theoretical complexity, the savings in cache misses reduce the empirical running times. A variant of method can resort to a counting Bloom filter for even larger savings in memory at the expense of false-negative rates in addition to the false-positive rates common to all Bloom filter-based approaches. A comparison with the state-of-the-art shows reduced memory requirements and running times. The tools are freely available for download at http://bioinformatics.rutgers.edu/Software/Turtle and http://figshare.com/articles/Turtle/791582. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Noble internal transport barriers and radial subdiffusion of toroidal magnetic lines

NASA Astrophysics Data System (ADS)

Misguich, J. H.; Reuss, J.-D.; Constantinescu, D.; Steinbrecher, G.; Vlad, M.; Spineanu, F.; Weyssow, B.; Balescu, R.

2003-11-01

Internal transport barriers (ITB's) observed in tokamaks are described by a purely magnetic approach. Magnetic line motion in toroidal geometry with broken magnetic surfaces is studied from a previously derived Hamiltonian map in situation of incomplete chaos. This appears to reproduce in a realistic way the main features of a tokamak, for a given safety factor profile and in terms of a single parameter L representing the amplitude of the magnetic perturbation. New results are given concerning the Shafranov shift as function of L. The phase space (psi ,θ ) of the "tokamap" describes the poloidal section of the line trajectories, where psi is the toroidal flux labelling the surfaces. For small values of L, closed magnetic surfaces exist (KAM tori) and island chains begin to appear on rational surfaces for higher values of L, with chaotic zones around hyperbolic points, as expected. Island remnants persist in the chaotic domain for all relevant values of L at the main rational q-values. Single trajectories of magnetic line motion indicate the persistence of a central protected plasma core, surrounded by a chaotic shell enclosed in a double-sided transport barrier: the latter is identified as being composed of two Cantori located on two successive “most-noble” numbers values of the perturbed safety factor, and forming an internal transport barrier (ITB). Magnetic lines which succeed to escape across this barrier begin to wander in a wide chaotic sea extending up to a very robust barrier (as long as Lprecsim 1) which is identified mathematically as a robust KAM surface at the plasma edge. In this case the motion is shown to be intermittent, with long stages of pseudo-trapping in the chaotic shell, or of sticking around island remnants, as expected for a continuous time random walk. For values of Lsucceq 1, above the escape threshold, most magnetic lines succeed to escape out of the external barrier which has become a permeable Cantorus. Statistical analysis of a large number of trajectories, representing the evolution of a bunch of magnetic lines, indicate that the flux variable psi asymptotically grows in a diffusive manner as (L2t) with a L2 scaling as expected, but that the average radial position rm(t) asymptotically grows as (L2t)^{1/4} while the mean square displacement around this average radius asymptotically grows in a subdiffusive manner as (L2t)^{1/2}. This result shows the slower dispersion in the present incomplete chaotic regime, which is different from the usual quasilinear diffusion in completely chaotic situations. For physical times t_{\\varphi } of the order of the escape time defined by xm(t_{\\varphi })sim 1, the motion appears to be superdiffusive, however, but less dangerous than the generally admitted quasi-linear diffusion. The orders of magnitude of the relevant times in Tore Supra are finally discussed. Barrières internes de transport " nobles " et sous-diffusion radiale des lignes magnétiques toroïdales Les barrières internes de transport observées dans les tokamaks sont décrites ici dans une approche purement magnétique. Le mouvement des lignes magnétiques en géométrie toroïdale avec brisure des surfaces magnétiques est étudié à partir d'une application hamiltonienne "tokamap" développée précédemment en situation de chaos incomplet, et dans laquelle le "temps" est représenté par la coordonnée toroïdale. Cette application reproduit de façon réaliste les principales caractéristiques d'un tokamak, pour un profil donné du facteur de sécurité q, et en terme d'un seul paramètre L représentant l'amplitude de la perturbation magnétique. On obtient des résultats nouveaux concernant le déplacement de Shafranov en fonction de L. L'espace des phases (psi,θ) du "tokamap" décrit la section poloïdale des trajectoires des lignes, où psisim r^2 est le flux toroïdal caractérisant les surfaces magnétiques (proportionnel au carré du rayon r de cette surface). Pour de faibles valeurs de L, des surfaces magnétiques fermées existent (tores de KAM) et des chaînes d'îlots commencent à apparaître sur les surfaces rationnelles pour des valeurs de L supérieures, avec, comme attendu, des zones chaotiques autour des points hyperboliques. Des résidus d'îlots magnétiques persistent dans le domaine chaotique pour toutes les valeurs de L, sur les surfaces caractérisées par les principales valeurs rationnelles de q. Des trajectoires individuelles de ligne magnétique indiquent la persistance d'un cœur protégé au sein du plasma, entouré d'une couche chaotique, incluse dans une double barrière de transport : celle-ci est composée de deux Cantori situés sur deux valeurs successives du facteur de sécurité perturbé que l'on a pu identifier comme étant les nombres "les plus nobles", formant ainsi une barrière de transport interne. Les lignes magnétiques qui réussissent à s'échapper à travers cette barrière commencent à voyager dans une vaste mer chaotique qui s'étend jusqu'à une barrière très robuste (tant que Lprecsim 1) qui a été identifiée mathématiquement comme étant une surface KAM robuste au bord du plasma. Dans ce cas le mouvement observé est intermittent, avec de longues périodes de pseudo-piégeage dans la couche chaotique, ou du collage (sticking) autour des îlots résiduels, comme attendu pour une marche aléatoire en temps continu. Pour des valeurs de Lsucceq 1, au-dessus du seuil d'échappement, la plupart des lignes magnétiques parviennent à s'échapper à travers la barrière externe qui est devenue un Cantorus perméable. L'analyse statistique d'un grand nombre de trajectoires, représentant l'évolution d'un faisceau de lignes magnétiques, indique qu'en moyenne la variable de flux psi croît asymptotiquement de manière diffusive (comme L^2t) avec une loi d'échelle en L^2 comme attendu, mais avec une position radiale moyenne r_m(t) croissant asymptotiquement comme (L^2t)^{1/4}, tandis que le déplacement quadratique moyen autour de ce rayon moyen croît asymptotiquement de manière sous-diffusive comme (L^2t)^{1/2}. Ce résultat indique une dispersion plus lente dans le cas étudié d'un régime de chaos incomplet, qui est différente de la diffusion quasi-linéaire en situation de chaos complet. Pour des temps physiques t_{\\varphi} de l'ordre du temps d'échappement, défini par r_m(t_{\\varphi}) sim 1, le mouvement apparaît comme super-diffusif, mais cependant moins " dangereux " que la diffusion quasi-linéaire généralement admise. On discute finalement les ordres de grandeur des temps caractéristiques dans le tokamak TORE SUPRA.

Diffusion-controlled formation and collapse of a d-dimensional A-particle island in the B-particle sea.

PubMed

Shipilevsky, Boris M

2017-06-01

We consider diffusion-controlled evolution of a d-dimensional A-particle island in the B-particle sea at propagation of the sharp reaction front A+B→0 at equal species diffusivities. The A-particle island is formed by a localized (point) A-source with a strength λ that acts for a finite time T. We reveal the conditions under which the island collapse time t_{c} becomes much longer than the injection period T (long-living island) and demonstrate that regardless of d the evolution of the long-living island radius r_{f}(t) is described by the universal law ζ_{f}=r_{f}/r_{f}^{M}=sqrt[eτ|lnτ|], where τ=t/t_{c} and r_{f}^{M} is the maximal island expansion radius at the front turning point t_{M}=t_{c}/e. We find that in the long-living island regime the ratio t_{c}/T changes with the increase of the injection period T by the law ∝(λ^{2}T^{2-d})^{1/d}, i.e., increases with the increase of T in the one-dimensional (1D) case, does not change with the increase of T in the 2D case and decreases with the increase of T in the 3D case. We derive the scaling laws for particles death in the long-living island and determine the limits of their applicability. We demonstrate also that these laws describe asymptotically the evolution of the d-dimensional spherical island with a uniform initial particle distribution generalizing the results obtained earlier for the quasi-one-dimensional geometry. As striking results, we present a systematic analysis of the front relative width evolution for fluctuation, logarithmically modified, and mean-field regimes, and we demonstrate that in a wide range of parameters the front remains sharp up to a narrow vicinity of the collapse point.

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities

PubMed Central

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo

2015-01-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning. PMID:26788414

Dromedary camels and the transmission of Middle East Respiratory Syndrome Coronavirus (MERS-CoV)

PubMed Central

Hemida, Maged G; Elmoslemany, Ahmed; Al-Hizab, Fahad; Alnaeem, Abdulmohsen; Almathen, Faisal; Faye, Bernard; Chu, Daniel KW; Perera, Ranawaka A; Peiris, Malik

2015-01-01

Middle East respiratory syndrome coronavirus (MERS-CoV) is an existential threat to global public health. The virus has been repeatedly detected in dromedary camels (Camelus dromedarius). Adult animals in many countries in the Middle East as well as in North and East Africa showed high (>90%) sero-prevalence to the virus. MERS-CoV isolated from dromedaries is genetically and phenotypically similar to viruses from humans. We summarise current understanding of the ecology of MERS-CoV in animals and transmission at the animal-human interface. We review aspects of husbandry, animal movements and trade and the use and consumption of camel dairy and meat products in the Middle East that may be relevant to the epidemiology of MERS. We also highlight the gaps in understanding the transmission of this virus in animals and from animals to humans. PMID:26256102

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013-2014.

PubMed

Al Hosani, Farida Ismail; Pringle, Kimberly; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N; Khudhair, Ahmed; Hall, Aron J; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L; Haynes, Lia M; Curns, Aaron; Gerber, Susan I

2016-07-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority-Abu Dhabi during January 2013-May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies.

Middle East Respiratory Syndrome Infection Control and Prevention Guideline for Healthcare Facilities.

PubMed

Kim, Jin Yong; Song, Joon Young; Yoon, Young Kyung; Choi, Seong-Ho; Song, Young Goo; Kim, Sung-Ran; Son, Hee-Jung; Jeong, Sun-Young; Choi, Jung-Hwa; Kim, Kyung Mi; Yoon, Hee Jung; Choi, Jun Yong; Kim, Tae Hyong; Choi, Young Hwa; Kim, Hong Bin; Yoon, Ji Hyun; Lee, Jacob; Eom, Joong Sik; Lee, Sang-Oh; Oh, Won Sup; Choi, Jung-Hyun; Yoo, Jin-Hong; Kim, Woo Joo; Cheong, Hee Jin

2015-12-01

Middle East Respiratory Syndrome (MERS) is an acute viral respiratory illness with high mortality caused by a new strain of betacoronavirus (MERS-CoV). Since the report of the first patient in Saudi Arabia in 2012, large-scale outbreaks through hospital-acquired infection and inter-hospital transmission have been reported. Most of the patients reported in South Korea were also infected in hospital settings. Therefore, to eliminate the spread of MERS-CoV, infection prevention and control measures should be implemented with rigor. The present guideline has been drafted on the basis of the experiences of infection control in the South Korean hospitals involved in the recent MERS outbreak and on domestic and international infection prevention and control guidelines. To ensure efficient MERS-CoV infection prevention and control, care should be taken to provide comprehensive infection control measures including contact control, hand hygiene, personal protective equipment, disinfection, and environmental cleaning.

Response to Emergence of Middle East Respiratory Syndrome Coronavirus, Abu Dhabi, United Arab Emirates, 2013–2014

PubMed Central

Al Hosani, Farida Ismail; Al Mulla, Mariam; Kim, Lindsay; Pham, Huong; Alami, Negar N.; Khudhair, Ahmed; Hall, Aron J.; Aden, Bashir; El Saleh, Feda; Al Dhaheri, Wafa; Al Bandar, Zyad; Bunga, Sudhir; Abou Elkheir, Kheir; Tao, Ying; Hunter, Jennifer C.; Nguyen, Duc; Turner, Andrew; Pradeep, Krishna; Sasse, Jurgen; Weber, Stefan; Tong, Suxiang; Whitaker, Brett L.; Haynes, Lia M.; Curns, Aaron; Gerber, Susan I.

2016-01-01

In January 2013, several months after Middle East respiratory syndrome coronavirus (MERS-CoV) was first identified in Saudi Arabia, Abu Dhabi, United Arab Emirates, began surveillance for MERS-CoV. We analyzed medical chart and laboratory data collected by the Health Authority–Abu Dhabi during January 2013–May 2014. Using real-time reverse transcription PCR, we tested respiratory tract samples for MERS-CoV and identified 65 case-patients. Of these patients, 23 (35%) were asymptomatic at the time of testing, and 4 (6%) showed positive test results for >3 weeks (1 had severe symptoms and 3 had mild symptoms). We also identified 6 clusters of MERS-CoV cases. This report highlights the potential for virus shedding by mildly ill and asymptomatic case-patients. These findings will be useful for MERS-CoV management and infection prevention strategies. PMID:27314227

A recipe for designing water-soluble, beta-sheet-forming peptides.

PubMed Central

Mayo, K. H.; Ilyina, E.; Park, H.

1996-01-01

Based on observations of solubility and folding properties of peptide 33-mers derived from the beta-sheet domains of platelet factor-4 (PF4), interleukin-8 (IL-8), and growth related protein (Gro-alpha), as well as other beta-sheet-forming peptides, general guidelines have been developed to aid in the design of water soluble, self-association-induced beta-sheet-forming peptides. CD, 1H-NMR, and pulsed field gradient NMR self-diffusion measurements have been used to assess the degree of folding and state of aggregation. PF4 peptide forms native-like beta-sheet tetramers and is sparingly soluble above pH 6. IL-8 peptide is insoluble between pH 4.5 and pH 7.5, yet forms stable, native-like beta-sheet dimers at higher pH. Gro-alpha peptide is soluble at all pH values, yet displays no discernable beta-sheet structure even when diffusion data indicate dimer-tetramer aggregation. A recipe used in the de novo design of water-soluble beta-sheet-forming peptides calls for the peptide to contain 40-50% hydrophobic residues, usually aliphatic ones (I, L, V, A, M) (appropriately paired and mostly but not always alternating with polar residues in the sheet sequence), a positively charged (K, R) to negatively charged (E, D) residue ratio between 4/2 and 6/2, and a noncharged polar residue (N, Q, T, S) composition of about 20% or less. Results on four de novo designed, 33-residue peptides are presented supporting this approach. Under near physiologic conditions, all four peptides are soluble, form beta-sheet structures to varying degrees, and self-associate. One peptide folds as a stable, compact beta-sheet tetramer, whereas the others are transient beta-sheet-containing aggregates. PMID:8819163

The history and epidemiology of Middle East respiratory syndrome corona virus.

PubMed

Al-Osail, Aisha M; Al-Wazzah, Marwan J

2017-01-01

Corona viruses cause common cold, and infections caused by corona viruses are generally self-resolving. During the last 4 years, corona viruses have become the most important viruses worldwide because of the occurrence of several recent deaths caused by corona viruses in Saudi Arabia. Spread of the infection occurred worldwide; however, most cases of mortality have occurred in the Middle East. Owing to the predominance of outbreaks in the Middle Eastern countries, the virus was renamed a Middle East respiratory syndrome corona virus (MERS-CoV) by the Corona virus Study Group. The Center for Diseases Control and Prevention and World Health Organization maintain a website that is updated frequently with new cases of MERS-CoV infection. In this review, we describe the history and epidemiology of this novel virus. Studies of the genetics and molecular mechanisms of this virus are expected to facilitate the development of vaccines in the future.

Results from Automated Cloud and Dust Devil Detection Onboard the MER

NASA Technical Reports Server (NTRS)

Chien, Steve; Castano, Rebecca; Bornstein, Benjamin; Fukunaga, Alex; Castano, Andres; Biesiadecki, Jeffrey; Greeley, Ron; Whelley, Patrick; Lemmon, Mark

2008-01-01

We describe a new capability to automatically detect dust devils and clouds in imagery onboard rovers, enabling downlink of just the images with the targets or only portions of the images containing the targets. Previously, the MER rovers conducted campaigns to image dust devils and clouds by commanding a set of images be collected at fixed times and downloading the entire image set. By increasing the efficiency of the campaigns, more campaigns can be executed. Software for these new capabilities was developed, tested, integrated, uploaded, and operationally checked out on both rovers as part of the R9.2 software upgrade. In April 2007 on Sol 1147 a dust devil was automatically detected onboard the Spirit rover for the first time. We discuss the operational usage of the capability and present initial dust devil results showing how this preliminary application has demonstrated the feasibility and potential benefits of the approach.

Quantum-dot-based quantitative identification of pathogens in complex mixture

NASA Astrophysics Data System (ADS)

Lim, Sun Hee; Bestwater, Felix; Buchy, Philippe; Mardy, Sek; Yu, Alexey Dan Chin

2010-02-01

In the present study we describe sandwich design hybridization probes consisting of magnetic particles (MP) and quantum dots (QD) with target DNA, and their application in the detection of avian influenza virus (H5N1) sequences. Hybridization of 25-, 40-, and 100-mer target DNA with both probes was analyzed and quantified by flow cytometry and fluorescence microscopy on the scale of single particles. The following steps were used in the assay: (i) target selection by MP probes and (ii) target detection by QD probes. Hybridization efficiency between MP conjugated probes and target DNA hybrids was controlled by a fluorescent dye specific for nucleic acids. Fluorescence was detected by flow cytometry to distinguish differences in oligo sequences as short as 25-mer capturing in target DNA and by gel-electrophoresis in the case of QD probes. This report shows that effective manipulation and control of micro- and nanoparticles in hybridization assays is possible.

Extracting Diffusion Constants from Echo-Time-Dependent PFG NMR Data Using Relaxation-Time Information

NASA Astrophysics Data System (ADS)

Vandusschoten, D.; Dejager, P. A.; Vanas, H.

Heterogeneous (bio)systems are often characterized by several water-containing compartments that differ in relaxation time values and diffusion constants. Because of the relatively small differences among these diffusion constants, nonoptimal measuring conditions easily lead to the conclusion that a single diffusion constant suffices to describe the water mobility in a heterogeneous (bio)system. This paper demonstrates that the combination of a T2 measurement and diffusion measurements at various echo times (TE), based on the PFG MSE sequence, enables the accurate determination of diffusion constants which are less than a factor of 2 apart. This new method gives errors of the diffusion constant below 10% when two fractions are present, while the standard approach of a biexponential fit to the diffusion data in identical circumstances gives larger (>25%) errors. On application of this approach to water in apple parenchyma tissue, the diffusion constant of water in the vacuole of the cells ( D = 1.7 × 10 -9 m 2/s) can be distinguished from that of the cytoplasm ( D = 1.0 × 10 -9 m 2/s). Also, for mung bean seedlings, the cell size determined by PFG MSE measurements increased from 65 to 100 μm when the echo time increased from 150 to 900 ms, demonstrating that the interpretation of PFG SE data used to investigate cell sizes is strongly dependent on the T2 values of the fractions within the sample. Because relaxation times are used to discriminate the diffusion constants, we propose to name this approach diffusion analysis by relaxation- time- separated (DARTS) PFG NMR.

Identification of Information Types and Sources by the Public for Promoting Awareness of Middle East Respiratory Syndrome Coronavirus in Saudi Arabia

ERIC Educational Resources Information Center

Hoda, Jradi

2016-01-01

Middle East Respiratory Syndrome (MERS) is a viral respiratory disease of serious consequences caused by MERS Coronavirus (MERS-CoV). Saudi communities still lack awareness of available protective measures to prevent the transmission of the virus. It is necessary to explore the current information-seeking strategies and preferences for…

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared

The Mars Exploration Rovers Entry Descent and Landing and the Use of Aerodynamic Decelerators

NASA Technical Reports Server (NTRS)

Steltzner, Adam; Desai, Prasun; Lee, Wayne; Bruno, Robin

2003-01-01

The Mars Exploration Rovers (MER) project, the next United States mission to the surface of Mars, uses aerodynamic decelerators in during its entry, descent and landing (EDL) phase. These two identical missions (MER-A and MER-B), which deliver NASA s largest mobile science suite to date to the surface of Mars, employ hypersonic entry with an ablative energy dissipating aeroshell, a supersonic/subsonic disk-gap-band parachute and an airbag landing system within EDL. This paper gives an overview of the MER EDL system and speaks to some of the challenges faced by the various aerodynamic decelerators.

Monoclonal Antibody Shows Promise as Potential Therapeutic for MERS | Poster

Cancer.gov

A monoclonal antibody has proven effective in preventing Middle Eastern Respiratory Syndrome (MERS) in lab animals, suggesting further development as a potential intervention for the deadly disease in humans, according to new research. MERS is a newly emerged coronavirus first detected in humans in 2012. Most cases have occurred in the Middle East, but the disease has appeared elsewhere. In all, MERS has infected more than 1,700 individuals and killed more than 600, according to the World Health Organization. No vaccines or antiviral therapies currently exist. Several candidate vaccines are being developed, and some have been tested in animal models, a prerequisite to human clinical trials.

Two deletion variants of Middle East respiratory syndrome coronavirus found in a patient with characteristic symptoms.

PubMed

Xie, Qian; Cao, Yujuan; Su, Juan; Wu, Jie; Wu, Xianbo; Wan, Chengsong; He, Mingliang; Ke, Changwen; Zhang, Bao; Zhao, Wei

2017-08-01

Significant sequence variation of Middle East respiratory syndrome coronavirus (MERS CoV) has never been detected since it was first reported in 2012. A MERS patient came from Korea to China in late May 2015. The patient was 44 years old and had symptoms including high fever, dry cough with a little phlegm, and shortness of breath, which are roughly consistent with those associated with MERS, and had had close contact with individuals with confirmed cases of MERS.After one month of therapy with antiviral, anti-infection, and immune-enhancing agents, the patient recovered in the hospital and was discharged. A nasopharyngeal swab sample was collected for direct sequencing, which revealed two deletion variants of MERS CoV. Deletions of 414 and 419 nt occurred between ORF5 and the E protein, resulting in a partial protein fusion or truncation of ORF5 and the E protein. Functional analysis by bioinformatics and comparison to previous studies implied that the two variants might be defective in their ability to package MERS CoV. However, the mechanism of how these deletions occurred and what effects they have need to be further investigated.