Sample records for dantrolene binding sequence

  1. Dantrolene, a therapeutic agent for malignant hyperthermia, markedly improves the function of failing cardiomyocytes by stabilizing inter-domain interactions within the ryanodine receptor

    PubMed Central

    Kobayashi, Shigeki; Yano, Masafumi; Suetomi, Takeshi; Ono, Makoto; Tateishi, Hiroki; Mochizuki, Mamoru; Xu, Xiaojuan; Uchinoumi, Hitoshi; Okuda, Shinichi; Yamamoto, Takeshi; Koseki, Noritaka; Kyushiki, Hiroyuki; Ikemoto, Noriaki; Matsuzaki, Masunori

    2009-01-01

    Objectives To investigate the effect of dantrolene, a drug generally used to treat Malignant Hyperthermia (MH), on the Ca2+ release and cardiomyocyte function in failing hearts. Background The N-terminal (N: 1-600) and Central (C: 2000-2500) domains of the ryanodine receptor (RyR), harbor many mutations associated with MH in skeletal muscle RyR (RyR1) and polymorphic ventricular tachycardia in cardiac RyR (RyR2). There is strong evidence that inter-domain interaction between these regions plays an important role in the mechanism of channel regulation. Methods Sarcoplasmic reticulum (SR) vesicles and cardiomyocytes were isolated from dog LV muscles (normal or rapid ventricular pacing for 4 weeks), for Ca2+ leak, transient, and spark assays. To assess the zipped or unzipped state of the interacting domains, the RyR was fluorescently labeled with methylcoumarin acetate in a site-directed manner. We employed a quartz-crystal microbalance technique to identify the dantrolene binding site within the RyR2. Results Dantrolene specifically bound to domain 601-620 in RyR2. In the SR isolated from pacing-induced dog failing hearts, the defective inter-domain interaction_(domain unzipping) has already occurred, causing spontaneous Ca2+ leak. Dantrolene suppressed both domain unzipping and the Ca2+ leak, showing identical drug concentration-dependence (IC50=0.3 μmol/L). In failing cardiomyocytes, both diastolic Ca2+ sparks and delayed afterdepolarization were frequently observed, but 1 μmol/L dantrolene inhibited both events. Conclusions Dantrolene corrects defective inter-domain interactions within RyR2 in failing hearts, inhibits spontaneous Ca2+ leak, in turn improves cardiomyocyte function in failing hearts. Thus, dantrolene may have a potential to treat heart failure, specifically targeting the RyR2. PMID:19460614

  2. Dantrolene mediates vasorelaxation in cerebral vasoconstriction - A Case Series

    PubMed Central

    Muehlschlegel, Susanne; Rordorf, Guy; Bodock, Michael; Sims, John R.

    2009-01-01

    INTRODUCTION Cerebral vasoconstriction syndromes such as vasospasm after subarachnoid hemorrhage (SAH) and trauma, or Call-Fleming-Syndrome are difficult to treat, and can lead to substantial disability and death. Dantrolene, a ryanodine receptor antagonist, inhibits intracellular calcium release from the sarco-endoplasmic reticulum. We examined the effect of dantrolene on middle cerebral artery (MCA) blood flow velocities as measured by transcranial Doppler (TCD). METHODS Three consecutive patients with elevated MCA TCD velocities receiving dantrolene (2.5mg/kg IV q6h) were retrospectively reviewed. Average MCA peak systolic, mean flow velocities, and the pulsatility index (PI) before and after the dantrolene infusion were compared within patients. Systemic physiological parameters (blood pressure, heart rate, central venous pressure, intracranial pressure, body temperature and cooling water temperature) were recorded during 6 hours before and after the dantrolene infusion. RESULTS MCA peak systolic velocities (mean ± SE) for the three patients were 297 ± 3 cm/s, 248 ± 8 cm/s, and 268 ± 19 cm/s before dantrolene and 159 ± 9 cm/s, 169 ± 8 cm/s and 216 ± 12 cm/s after dantrolene. Average mean flow velocities showed the same trend. Interestingly, the PI increased slightly from 0.6, 0.52 and 0.67 before dantrolene, to 1.17, 0.71 and 0.77 after dantrolene. Systemic physiological parameters remained stable in all three patients. CONCLUSION Dantrolene attenuated cerebral vasoconstriction as measured by TCD without altering systemic physiological parameters. This suggests that intracellular calcium release from ryanodine channels in smooth muscle might play a role in vasospasm. A prospective study is underway to test this hypothesis. PMID:18696267

  3. Venous Thromboembolism Following Dantrolene Treatment for Neuroleptic Malignant Syndrome.

    PubMed

    Chen, Po-Hao; Lane, Hsien-Yuan; Lin, Chieh-Hsin

    2016-11-30

    Neuroleptic malignant syndrome (NMS) is one of the most severe iatrogenic emergencies in clinical service. The symptoms including sudden consciousness change, critical temperature elevation and electrolytes imbalance followed by mutli-organ system failure were common in NMS. In addition to aggressive interventions with intravenous fluid resuscitation and antipyretics, several antidotes have been suggested to prevent further progression of the muscle damage. Dantrolene has been reported to be one of the most effective treatments for NMS. However, the adverse effects of dantrolene treatment for NMS have not yet been evaluated thoroughly. Here we report a young male patient with bipolar I disorder who developed NMS after rapid tranquilization with haloperidol. Dantrolene was given intravenously for the treatment of NMS. However, fever accompanied with local tenderness, hardness with clear border and swelling with heat over the patient's left forearm occurred on the sixth day of dantrolene treatment. Venous thromboembolism (VTE) over intravenous indwelling site at the patient's forearm was noted and confirmed by Doppler ultrasound. The patient's VTE recovered after heparin and warfarin thrombolytic therapy. To our knowledge, this is the first case report demonstrating the possible relationship between dantrolene use and VTE in a patient with antipsychotic treatment. Although the causal relationship and the underlying pathogenesis require further studies, dantrolene should be used with caution for patients with NMS.

  4. Exertional heat stroke induced by amphetamine analogues. Does dantrolene have a place?

    PubMed

    Watson, J D; Ferguson, C; Hinds, C J; Skinner, R; Coakley, J H

    1993-12-01

    There are increasing numbers of patients admitted to hospital as a result of ingesting amphetamine-like drugs. The most severe cases exhibit hyperthermia, rhabdomyolysis, coagulopathy and renal failure. We describe six such patients with varying severity of intoxication, and have reviewed the recent literature with particular reference to the use of dantrolene. One of our patients died but the others all survived. There is little evidence that dantrolene influenced the outcome in patients reported to date. We believe that a controlled trial should be carried out in amphetamine-related hyperthermia before the use of dantrolene becomes widespread.

  5. Dantrolene: mechanisms of neuroprotection and possible clinical applications in the neurointensive care unit

    PubMed Central

    Muehlschlegel, Susanne; Sims, John R.

    2009-01-01

    Background and aims Calcium plays a central role in neuronal function and injury. Dantrolene, an inhibitor of the ryanodine receptor, inhibits intracellular calcium release from the sarcoendoplasmic reticulum and might serve as novel agent for neuroprotection and other applications in the Neurointensive Care Unit. Methods We reviewed the available data of dantrolene as a potential neuroprotective agent through literature searches on Ovid, Pubmed and Google Scholar. Results Dantrolene provides neuroprotection in multiple in vitro models and some in vivo models of neural injury. Its efficacy has an early and narrow time-window of protection. We briefly summarize its other pharmacologic effects that may have potential applications for patients in the neurointensive care unit. Areas with the need for continued research are identified. Conclusion Targeted use of dantrolene in selected ICU disease models of anticipated neural injury, such as impending ischemia from vasospastic syndromes, might provided neuroprotection. PMID:18696266

  6. Dantrolene Reduces the Threshold and Gain for Shivering

    PubMed Central

    Lin, Chun-Ming; Neeru, Sharma; Doufas, Anthony G.; Liem, Edwin; Shah, Yunus Muneer; Wadhwa, Anupama; Lenhardt, Rainer; Bjorksten, Andrew; Kurz, Andrea

    2005-01-01

    Dantrolene is used for treatment of life-threatening hyperthermia, yet its thermoregulatory effects are unknown. We tested the hypothesis that dantrolene reduces the threshold (triggering core temperature) and gain (incremental increase) of shivering. With IRB approval and informed consent, healthy volunteers were evaluated on two random days: control and dantrolene (≈2.5 mg/kg plus a continuous infusion). In study 1, 9 men were warmed until sweating was provoked and then cooled until arterio-venous shunt constriction and shivering occurred. Sweating was quantified on the chest using a ventilated capsule. Absolute right middle fingertip blood flow was quantified using venous-occlusion volume plethysmography. A sustained increase in oxygen consumption identified the shivering threshold. In study 2, 9 men were given cold Ringer's solution IV to reduce core temperature ≈2°C/h. Cooling was stopped when shivering intensity no longer increased with further core cooling. The gain of shivering was the slope of oxygen consumption vs. core temperature regression. In Study 1, sweating and vasoconstriction thresholds were similar on both days. In contrast, shivering threshold decreased 0.3±0.3°C, P=0.004, on the dantrolene day. In Study 2, dantrolene decreased the shivering threshold from 36.7±0.2 to 36.3±0.3°C, P=0.01 and systemic gain from 353±144 to 211±93 ml·min−1·°C−1, P=0.02. Thus, dantrolene substantially decreased the gain of shivering, but produced little central thermoregulatory inhibition. PMID:15105208

  7. Defective calmodulin binding to the cardiac ryanodine receptor plays a key role in CPVT-associated channel dysfunction

    PubMed Central

    Xu, Xiaojuan; Yano, Masafumi; Uchinoumi, Hitoshi; Hino, Akihiro; Suetomi, Takeshi; Ono, Makoto; Tateishi, Hiroki; Oda, Tetsuro; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Yamamoto, Takeshi; Ikeda, Yasuhiro; Ikemoto, Noriaki; Matsuzaki, Masunori

    2010-01-01

    Calmodulin (CaM), one of the accessory proteins of the cardiac ryanodine receptor (RyR2), is known to play a significant role in the channel regulation of the RyR2. However, the possible involvement of calmodulin in the pathogenic process of catecholaminergic polymorphic ventricular tachycardia (CPVT) has not been investigated. In this study, we investigated the state of RyR2-bound CaM and channel dysfunctions using a knock-in (KI) mouse model with CPVT-linked RyR2 mutation (R2474S). Without added effectors, the affinity of CaM binding to the RyR2 was indistinguishable between KI and WT hearts. In response to cAMP (1 μmol/L), the RyR2 phosphorylation at Ser2808 increased in both WT and KI hearts to the same extent. However, cAMP caused a significant decrease of the CaM binding affinity in KI hearts, but the affinity was unchanged in WT. Dantrolene restored a normal level of CaM-binding affinity in the cAMP-treated KI hearts, suggesting that defective inter-domain interaction between the N-terminal domain and the central domain of the RyR2 (the target of therapeutic effect of dantrolene) is involved in the cAMP-induced reduction of the CaM binding affinity. In saponin-permeabilized cardiomyocytes, the addition of cAMP increased the frequency of spontaneous Ca2+ sparks to a significantly larger extent in KI cardiomyocytes than in WT cardiomyocytes, whereas the addition of a high concentration of CaM attenuated the aberrant increase of Ca2+ sparks. In conclusion, CPVT mutation causes defective inter-domain interaction, significant reduction in the ability of CaM binding to the RyR2, spontaneous Ca2+ leak, and then lethal arrhythmia. PMID:20226167

  8. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model.

    PubMed

    Chen, Xi; Wu, Jun; Lvovskaya, Svetlana; Herndon, Emily; Supnet, Charlene; Bezprozvanny, Ilya

    2011-11-25

    Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as dantrolene should be considered as potential therapeutics for the treatment of HD and other polyQ-expansion disorders.

  9. Dantrolene is neuroprotective in Huntington's disease transgenic mouse model

    PubMed Central

    2011-01-01

    Background Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine expansion in the Huntingtin protein which results in the selective degeneration of striatal medium spiny neurons (MSNs). Our group has previously demonstrated that calcium (Ca2+) signaling is abnormal in MSNs from the yeast artificial chromosome transgenic mouse model of HD (YAC128). Moreover, we demonstrated that deranged intracellular Ca2+ signaling sensitizes YAC128 MSNs to glutamate-induced excitotoxicity when compared to wild type (WT) MSNs. In previous studies we also observed abnormal neuronal Ca2+ signaling in neurons from spinocerebellar ataxia 2 (SCA2) and spinocerebellar ataxia 3 (SCA3) mouse models and demonstrated that treatment with dantrolene, a ryanodine receptor antagonist and clinically relevant Ca2+ signaling stabilizer, was neuroprotective in experiments with these mouse models. The aim of the current study was to evaluate potential beneficial effects of dantrolene in experiments with YAC128 HD mouse model. Results The application of caffeine and glutamate resulted in increased Ca2+ release from intracellular stores in YAC128 MSN cultures when compared to WT MSN cultures. Pre-treatment with dantrolene protected YAC128 MSNs from glutamate excitotoxicty, with an effective concentration of 100 nM and above. Feeding dantrolene (5 mg/kg) twice a week to YAC128 mice between 2 months and 11.5 months of age resulted in significantly improved performance in the beam-walking and gait-walking assays. Neuropathological analysis revealed that long-term dantrolene feeding to YAC128 mice significantly reduced the loss of NeuN-positive striatal neurons and reduced formation of Httexp nuclear aggregates. Conclusions Our results support the hypothesis that deranged Ca2+ signaling plays an important role in HD pathology. Our data also implicate the RyanRs as a potential therapeutic target for the treatment of HD and demonstrate that RyanR inhibitors and Ca2+ signaling stabilizers such as dantrolene should be considered as potential therapeutics for the treatment of HD and other polyQ-expansion disorders. PMID:22118545

  10. Dantrolene, a treatment for Alzheimer disease?

    PubMed

    Liang, Li; Wei, Huafeng

    2015-01-01

    Alzheimer disease (AD) is a fatal progressive disease and the most common form of dementia without effective treatments. Previous studies support that the disruption of endoplasmic reticulum Ca through overactivation of ryanodine receptors plays an important role in the pathogenesis of AD. Normalization of intracellular Ca homeostasis could be an effective strategy for AD therapies. Dantrolene, an antagonist of ryanodine receptors and an FDA-approved drug for clinical treatment of malignant hyperthermia and muscle spasms, exhibits neuroprotective effects in multiple models of neurodegenerative disorders. Recent preclinical studies consistently support the therapeutic effects of dantrolene in various types of AD animal models and were summarized in the current review.

  11. Length dependence of staircase potentiation: interactions with caffeine and dantrolene sodium.

    PubMed

    Rassier, D E; MacIntosh, B R

    2000-04-01

    In skeletal muscle, there is a length dependence of staircase potentiation for which the mechanism is unclear. In this study we tested the hypothesis that abolition of this length dependence by caffeine is effected by a mechanism independent of enhanced Ca2+ release. To test this hypothesis we have used caffeine, which abolishes length dependence of potentiation, and dantrolene sodium, which inhibits Ca2+ release. In situ isometric twitch contractions of rat gastrocnemius muscle before and after 20 s of repetitive stimulation at 5 Hz were analyzed at optimal length (Lo), Lo - 10%, and Lo + 10%. Potentiation was observed to be length dependent, with an increase in developed tension (DT) of 78 +/- 12, 51 +/- 5, and 34 +/- 9% (mean +/- SEM), at Lo - 10%, Lo, and Lo + 10%, respectively. Caffeine diminished the length dependence of activation and suppressed the length dependence of staircase potentiation, giving increases in DT of 65+/-13, 53 +/- 11, and 45 +/- 12% for Lo - 10%, Lo, and Lo + 10%, respectively. Dantrolene administered after caffeine did not reverse this effect. Dantrolene alone depressed the potentiation response, but did not affect the length dependence of staircase potentiation, with increases in DT of 58 +/- 17, 26 +/- 8, and 18 +/- 7%, respectively. This study confirms that there is a length dependence of staircase potentiation in mammalian skeletal muscle which is suppressed by caffeine. Since dantrolene did not alter this suppression of the length dependence of potentiation by caffeine, it is apparently not directly modulated by Ca2+ availability in the myoplasm.

  12. Mutation-Linked Defective Inter-Domain Interactions within Ryanodine Receptor Cause Aberrant Ca2+ Release Leading to Catecholaminergic Polymorphic Ventricular Tachycardia

    PubMed Central

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiho; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-01-01

    Background The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia (CPVT) is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. Here, we investigated mutation-induced conformational defects of RyR2 using a knock-in (KI) mouse model expressing the human CPVT-associated RyR2 mutant (S2246L; Serine to Leucine mutation at the residue 2246). Methods and Results All KI mice we examined produced VT after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca2+ sparks was more pronounced in saponin-permeabilized KI cardiomyocytes than in WT cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232–2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741– 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of inter-domain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1-600)/central (2000–2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch, and stopped the exercise-induced ventricular tachycardia. Conclusions The CPVT-linked mutation of RyR2, S2246L, causes an abnormally tight local sub-domain/sub-domain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca2+ channel in a diastolic state reflecting on the increased Ca2+ spark frequency, which then leads to lethal arrhythmia. PMID:21768539

  13. Mutation-linked defective interdomain interactions within ryanodine receptor cause aberrant Ca²⁺release leading to catecholaminergic polymorphic ventricular tachycardia.

    PubMed

    Suetomi, Takeshi; Yano, Masafumi; Uchinoumi, Hitoshi; Fukuda, Masakazu; Hino, Akihiro; Ono, Makoto; Xu, Xiaojuan; Tateishi, Hiroki; Okuda, Shinichi; Doi, Masahiro; Kobayashi, Shigeki; Ikeda, Yasuhiro; Yamamoto, Takeshi; Ikemoto, Noriaki; Matsuzaki, Masunori

    2011-08-09

    The molecular mechanism by which catecholaminergic polymorphic ventricular tachycardia is induced by single amino acid mutations within the cardiac ryanodine receptor (RyR2) remains elusive. In the present study, we investigated mutation-induced conformational defects of RyR2 using a knockin mouse model expressing the human catecholaminergic polymorphic ventricular tachycardia-associated RyR2 mutant (S2246L; serine to leucine mutation at the residue 2246). All knockin mice we examined produced ventricular tachycardia after exercise on a treadmill. cAMP-dependent increase in the frequency of Ca²⁺ sparks was more pronounced in saponin-permeabilized knockin cardiomyocytes than in wild-type cardiomyocytes. Site-directed fluorescent labeling and quartz microbalance assays of the specific binding of DP2246 (a peptide corresponding to the 2232 to 2266 region: the 2246 domain) showed that DP2246 binds with the K201-binding sequence of RyR2 (1741 to 2270). Introduction of S2246L mutation into the DP2246 increased the affinity of peptide binding. Fluorescence quench assays of interdomain interactions within RyR2 showed that tight interaction of the 2246 domain/K201-binding domain is coupled with domain unzipping of the N-terminal (1 to 600)/central (2000 to 2500) domain pair in an allosteric manner. Dantrolene corrected the mutation-caused domain unzipping of the domain switch and stopped the exercise-induced ventricular tachycardia. The catecholaminergic polymorphic ventricular tachycardia-linked mutation of RyR2, S2246L, causes an abnormally tight local subdomain-subdomain interaction within the central domain involving the mutation site, which induces defective interaction between the N-terminal and central domains. This results in an erroneous activation of Ca²⁺ channel in a diastolic state reflecting on the increased Ca²⁺ spark frequency, which then leads to lethal arrhythmia.

  14. Radiosynthesis of [13N]dantrolene, a positron emission tomography probe for breast cancer resistant protein, using no-carrier-added [13N]ammonia.

    PubMed

    Kumata, Katsushi; Ogawa, Masanao; Takei, Makoto; Fujinaga, Masayuki; Yoshida, Yuichiro; Nengaki, Nobuki; Fukumura, Toshimitsu; Suzuki, Kazutoshi; Zhang, Ming-Rong

    2012-01-01

    Dantrolene (1) is a substrate for breast cancer resistant protein, which is widely distributed in the blood-brain-barrier, intestine, gall bladder, and liver. PET study with 1 labeled with a positron emitter can be used to visualize BCRP and to elucidate the effect of BCRP on the pharmacokinetics of drugs. The objective of this study was to label 1 using nitrogen-13 ((13)N, a positron emitter; half-life: 9.9min). Using no-carrier-added [(13)N]NH(3) as the labeling agent, we synthesized [(13)N]dantrolene ([(13)N]1) for the first time. The reaction of carbomyl chloride 2b with [(13)N]NH(3) gave an unsymmetrical urea [(13)N]3, followed by cyclization of [(13)N]3 to afford [(13)N]1. Due to its instability, 2b was prepared in situ by treating amine 5 with triphosgene in a ratio of 4 to 1 and used for subsequent [(13)N]ammonolysis without purification. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Calexcitin interaction with neuronal ryanodine receptors.

    PubMed Central

    Nelson, T J; Zhao, W Q; Yuan, S; Favit, A; Pozzo-Miller, L; Alkon, D L

    1999-01-01

    Calexcitin (CE), a Ca2+- and GTP-binding protein, which is phosphorylated during memory consolidation, is shown here to co-purify with ryanodine receptors (RyRs) and bind to RyRs in a calcium-dependent manner. Nanomolar concentrations of CE released up to 46% of the 45Ca label from microsomes preloaded with 45CaCl2. This release was Ca2+-dependent and was blocked by antibodies against the RyR or CE, by the RyR inhibitor dantrolene, and by a seven-amino-acid peptide fragment corresponding to positions 4689-4697 of the RyR, but not by heparin, an Ins(1,4,5)P3-receptor antagonist. Anti-CE antibodies, in the absence of added CE, also blocked Ca2+ release elicited by ryanodine, suggesting that the CE and ryanodine binding sites were in relative proximity. Calcium imaging with bis-fura-2 after loading CE into hippocampal CA1 pyramidal cells in hippocampal slices revealed slow, local calcium transients independent of membrane depolarization. Calexcitin also released Ca2+ from liposomes into which purified RyR had been incorporated, indicating that CE binding can be a proximate cause of Ca2+ release. These results indicated that CE bound to RyRs and suggest that CE may be an endogenous modulator of the neuronal RyR. PMID:10393102

  16. In vitro effects of oxytocin, acepromazine, detomidine, xylazine, butorphanol, terbutaline, isoproterenol, and dantrolene on smooth and skeletal muscles of the equine esophagus.

    PubMed

    Wooldridge, Anne A; Eades, Susan C; Hosgood, Giselle L; Moore, Rustin M

    2002-12-01

    To characterize the in vitro effects of oxytocin, acepromazine, xylazine, butorphanol, detomidine, dantrolene, isoproterenol, and terbutaline on skeletal and smooth muscle from the equine esophagus. 14 adult horses without digestive tract disease. Circular and longitudinal strips from the skeletal and smooth muscle of the esophagus were suspended in tissue baths, connected to force-displacement transducers interfaced with a physiograph, and electrical field stimulation was applied. Cumulative concentration-response curves were generated for oxytocin, acepromazine, xylazine, detomidine, butorphanol, isoproterenol, terbutaline, and dantrolene. Mean maximum twitch amplitude for 3 contractions/min was recorded and compared with predrug-vehicle values for the skeletal muscle segments, and area under the curve (AUC) for 3 contractions/min was compared with predrug-vehicle values for the smooth muscle segments. No drugs caused a significant change in skeletal muscle response. In smooth muscle, isoproterenol, terbutaline, and oxytocin significantly reduced AUC in a concentration-dependent manner. Maximum reduction in AUC was 69% at 10(-4) M for isoproterenol, 63% at 10(-6) M for terbutaline, and 64% at 10(-4) M for oxytocin. Isoproterenol, terbutaline, and oxytocin cause relaxation of the smooth muscle portion of the esophagus. The clinical relaxant effects on the proximal portion of the esophagus reported of drugs such as oxytocin, detomidine, and acepromazine may be the result of centrally mediated mechanisms.

  17. A case report of suspected malignant hyperthermia where patient survived the episode.

    PubMed

    Iqbal, Asif; Badoo, Shoaib; Naqeeb, Ruqsana

    2017-01-01

    Malignant hyperthermia is rare inherited disorder in our part of the world; there are only few cases reported in literature in India who were suspected of having this condition. The overall incidence of malignant hyperthermia during general anesthesia is estimated to range from 1: 5000 to 1: 50,000-100,000 and mortality rate is estimated to be <5% in the presence of standard care. In India, there is no center where in vitro halothane caffeine contraction test is performed to confirm diagnosis in suspected cases. Second, dantrolene drug of choice for this condition is not freely available in market in India and is stored only in some hospitals in few major cities. Among the cases reported of suspected of malignant hyperthermia in India almost 50% have survived the condition despite nonavailability of dantrolene emphasizing role of early detection and aggressive management in these cases.

  18. A case report of suspected malignant hyperthermia where patient survived the episode

    PubMed Central

    Iqbal, Asif; Badoo, Shoaib; Naqeeb, Ruqsana

    2017-01-01

    Malignant hyperthermia is rare inherited disorder in our part of the world; there are only few cases reported in literature in India who were suspected of having this condition. The overall incidence of malignant hyperthermia during general anesthesia is estimated to range from 1: 5000 to 1: 50,000–100,000 and mortality rate is estimated to be <5% in the presence of standard care. In India, there is no center where in vitro halothane caffeine contraction test is performed to confirm diagnosis in suspected cases. Second, dantrolene drug of choice for this condition is not freely available in market in India and is stored only in some hospitals in few major cities. Among the cases reported of suspected of malignant hyperthermia in India almost 50% have survived the condition despite nonavailability of dantrolene emphasizing role of early detection and aggressive management in these cases. PMID:28442967

  19. The putative imidazoline receptor agonist, harmane, promotes intracellular calcium mobilisation in pancreatic beta-cells.

    PubMed

    Squires, Paul E; Hills, Claire E; Rogers, Gareth J; Garland, Patrick; Farley, Sophia R; Morgan, Noel G

    2004-10-06

    beta-Carbolines (including harmane and pinoline) stimulate insulin secretion by a mechanism that may involve interaction with imidazoline I(3)-receptors but which also appears to be mediated by actions that are additional to imidazoline receptor agonism. Using the MIN6 beta-cell line, we now show that both the imidazoline I(3)-receptor agonist, efaroxan, and the beta-carboline, harmane, directly elevate cytosolic Ca(2+) and increase insulin secretion but that these responses display different characteristics. In the case of efaroxan, the increase in cytosolic Ca(2+) was readily reversible, whereas, with harmane, the effect persisted beyond removal of the agonist and resulted in the development of a repetitive train of Ca(2+)-oscillations whose frequency, but not amplitude, was concentration-dependent. Initiation of the Ca(2+)-oscillations by harmane was independent of extracellular calcium but was sensitive to both dantrolene and high levels (20 mM) of caffeine, suggesting the involvement of ryanodine receptor-gated Ca(2+)-release. The expression of ryanodine receptor-1 and ryanodine receptor-2 mRNA in MIN6 cells was confirmed using reverse transcription-polymerase chain reaction (RT-PCR) and, since low concentrations of caffeine (1 mM) or thimerosal (10 microM) stimulated increases in [Ca(2+)](i), we conclude that ryanodine receptors are functional in these cells. Furthermore, the increase in insulin secretion induced by harmane was attenuated by dantrolene, consistent with the involvement of ryanodine receptors in mediating this response. By contrast, the smaller insulin secretory response to efaroxan was unaffected by dantrolene. Harmane-evoked changes in cytosolic Ca(2+) were maintained by nifedipine-sensitive Ca(2+)-influx, suggesting the involvement of L-type voltage-gated Ca(2+)-channels. Taken together, these data imply that harmane may interact with ryanodine receptors to generate sustained Ca(2+)-oscillations in pancreatic beta-cells and that this effect contributes to the insulin secretory response.

  20. Arrhythmic effects of Epac-mediated ryanodine receptor activation in Langendorff-perfused murine hearts are associated with reduced conduction velocity.

    PubMed

    Li, Mengye; Hothi, Sandeep S; Salvage, Samantha C; Jeevaratnam, Kamalan; Grace, Andrew A; Huang, Christopher L-H

    2017-06-01

    Recent papers have attributed arrhythmic substrate in murine RyR2-P2328S hearts to reduced action potential (AP) conduction velocities (CV), reflecting acute functional inhibition and/or reduced expression of sodium channels. We explored for acute effects of direct exchange protein directly activated by cAMP (Epac)-mediated ryanodine receptor-2 (RyR2) activation on arrhythmic substrate and CV. Monophasic action potential (MAP) recordings demonstrated that initial steady (8 Hz) extrinsic pacing elicited ventricular tachycardia (VT) in 0 of 18 Langendorff-perfused wild-type mouse ventricles before pharmacological intervention. The Epac activator 8-CPT (8-(4-chlorophenylthio)-2'-O-methyladenosine-3',5'-cyclic monophosphate) (VT in 1 of 7 hearts), and the RyR2 blocker dantrolene, either alone (0 of 11) or with 8-CPT (0 of 9) did not then increase VT incidence (P>.05). Both progressively increased pacing rates and programmed extrasystolic (S2) stimuli similarly produced no VT in untreated hearts (n=20 and n=9 respectively). 8-CPT challenge then increased VT incidences (5 of 7 and 4 of 8 hearts respectively; P<.05). However, dantrolene, whether alone (0 of 10 and 1 of 13) or combined with 8-CPT (0 of 10 and 0 of 13) did not increase VT incidence relative to those observed in untreated hearts (P>.05). 8-CPT but not dantrolene, whether alone or combined with 8-CPT, correspondingly increased AP latencies (1.14±0.04 (n=7), 1.04±0.03 (n=10), 1.09±0.05 (n=8) relative to respective control values). In contrast, AP durations, conditions for 2:1 conduction block and ventricular effective refractory periods remained unchanged throughout. We thus demonstrate for the first time that acute RyR2 activation reversibly induces VT in specific association with reduced CV. © 2017 The Authors. Clinical and Experimental Pharmacology and Physiology Published by John Wiley & Sons Australia, Ltd.

  1. JSA guideline for the management of malignant hyperthermia crisis 2016.

    PubMed

    2017-04-01

    Malignant hyperthermia (MH) can be fatal if the crisis is not appropriately treated. It is an inherited disease usually triggered by the administration of volatile inhalational anesthetics and/or succinylcholine, a muscle relaxant. In a patient with suspected MH, the mechanism of calcium release from storage in the sarcoplasmic reticulum in the skeletal muscle is abnormally accelerated. Unexplained hypercarbia representing >55 mmHg of end-tidal carbon dioxide, tachycardia, and muscle rigidity (including masseter muscle rigidity) are early signs of the initiation of MH, because the metabolism is accelerated. The body temperature can rise by >0.5 °C/15 min and may reach ≥40 °C. Respiratory and metabolic acidosis, arrhythmia, cola-colored urine, increased levels of serum potassium, and tented T-waves on electrocardiogram are common and can lead to cardiac arrest. MH should be treated by discontinuation of the triggering agents, administration of intravenous dantrolene (initially 1 mg/kg), and reduction of the body temperature. Early diagnosis and sufficient dantrolene with body temperature reduction are essential to relieve the patient's MH crisis. This guideline in Japanese translation has been posted on the website: http://www.anesth.or.jp/guide/pdf/guideline_akuseikounetsu.pdf .

  2. Inhibitory effects of HgCl2 on excitation-secretion coupling at the motor nerve terminal and excitation-contraction coupling in the muscle cell.

    PubMed

    Røed, A; Herlofson, B B

    1994-12-01

    1. Indirect and direct twitch (0.1-Hz) stimulation of the rat phrenic nerve-diaphragm disclosed that the inhibitory effect of HgCl2, 3.7 x 10(-5) M, on the neuromuscular transmission and in the muscle cell, was accelerated by 10-sec periods of 50-Hz tetanic stimulation every 10 min. This activity-dependent enhancement suggested an inhibitory mechanism of HgCl2 related to the development of fatigue, like membrane depolarization or decreased excitability, decreased availability of transmitter, or interference with the factors controlling excitation-secretion coupling of the nerve terminal, i.e. (Ca2+)0 or (Ca2+)i, and excitation-contraction coupling in the muscle cell, i.e., (Ca2+)i. 2. During both indirect and direct stimulation, HgCl2-induced inhibition was enhanced markedly by pretreatment with caffeine, which releases Ca2+ from endoplasmic and sarcoplasmic reticulum in the nerve terminal and muscle cell, respectively. This caffeine-induced enhancement was completely antagonized by dantrolene, which inhibits the caffeine-induced release. However, dantrolene alone did not antagonize the HgCl2-induced inhibition. 3. Since caffeine depletes the intracellular Ca2+ stores of the smooth endoplasmic reticulum, HgCl2 probably inhibits by binding to SH groups of transport proteins conveying the messenger function of (Ca2+)i. In the muscle cell this leads to inhibition of contraction. In the nerve terminal, an additional enhancement of the HgCl2-induced inhibition, by inhibiting reuptake of choline by TEA and tetanic stimulation, suggested that HgCl2 inhibited a (Ca2+)i signal necessary for this limiting factor in resynthesis of acetylcholine. 4. The (Ca2+)0 signal necessary for stimulus-induced release of acetylcholine was not affected by HgCl2. Hyperpolarization in K(+)-free solution antagonized the inhibitory effect of HgCl2 at indirect stimulation, and Ca(2+)-free solution enhanced the inhibitory effect at direct stimulation. K+ depolarization, membrane electric field increase with high Ca2+, membrane stabilization with lidocaine, and half-threshold stimulation, did not change the inhibitory effect of HgCl CH3HgCl. 1.85 x 10(-5) M, disclosed a synergistic interaction with caffeine during direct, but not during indirect, stimulation.

  3. Modulating Calcium Signals to Boost AON Exon Skipping for DMD

    DTIC Science & Technology

    2016-10-01

    RNA Seq analysis to identify mechanisms of activity and specificity in order to guide discovery of second-generation skipping drugs or combinations...with greater activity. 15. SUBJECT TERMS Exon skipping, Dantrolene, Calcium, Duchenne, Dytrophy, Dystrophin, anti-sense-oligonucleatide, DMD, RNA ...for a subset of very rare mutations. Finally, we hypothesize that by combining chemical genomics with RNA Seq analysis we can begin to identify

  4. Discovery and information-theoretic characterization of transcription factor binding sites that act cooperatively.

    PubMed

    Clifford, Jacob; Adami, Christoph

    2015-09-02

    Transcription factor binding to the surface of DNA regulatory regions is one of the primary causes of regulating gene expression levels. A probabilistic approach to model protein-DNA interactions at the sequence level is through position weight matrices (PWMs) that estimate the joint probability of a DNA binding site sequence by assuming positional independence within the DNA sequence. Here we construct conditional PWMs that depend on the motif signatures in the flanking DNA sequence, by conditioning known binding site loci on the presence or absence of additional binding sites in the flanking sequence of each site's locus. Pooling known sites with similar flanking sequence patterns allows for the estimation of the conditional distribution function over the binding site sequences. We apply our model to the Dorsal transcription factor binding sites active in patterning the Dorsal-Ventral axis of Drosophila development. We find that those binding sites that cooperate with nearby Twist sites on average contain about 0.5 bits of information about the presence of Twist transcription factor binding sites in the flanking sequence. We also find that Dorsal binding site detectors conditioned on flanking sequence information make better predictions about what is a Dorsal site relative to background DNA than detection without information about flanking sequence features.

  5. Efficient Identification of Murine M2 Macrophage Peptide Targeting Ligands by Phage Display and Next-Generation Sequencing.

    PubMed

    Liu, Gary W; Livesay, Brynn R; Kacherovsky, Nataly A; Cieslewicz, Maryelise; Lutz, Emi; Waalkes, Adam; Jensen, Michael C; Salipante, Stephen J; Pun, Suzie H

    2015-08-19

    Peptide ligands are used to increase the specificity of drug carriers to their target cells and to facilitate intracellular delivery. One method to identify such peptide ligands, phage display, enables high-throughput screening of peptide libraries for ligands binding to therapeutic targets of interest. However, conventional methods for identifying target binders in a library by Sanger sequencing are low-throughput, labor-intensive, and provide a limited perspective (<0.01%) of the complete sequence space. Moreover, the small sample space can be dominated by nonspecific, preferentially amplifying "parasitic sequences" and plastic-binding sequences, which may lead to the identification of false positives or exclude the identification of target-binding sequences. To overcome these challenges, we employed next-generation Illumina sequencing to couple high-throughput screening and high-throughput sequencing, enabling more comprehensive access to the phage display library sequence space. In this work, we define the hallmarks of binding sequences in next-generation sequencing data, and develop a method that identifies several target-binding phage clones for murine, alternatively activated M2 macrophages with a high (100%) success rate: sequences and binding motifs were reproducibly present across biological replicates; binding motifs were identified across multiple unique sequences; and an unselected, amplified library accurately filtered out parasitic sequences. In addition, we validate the Multiple Em for Motif Elicitation tool as an efficient and principled means of discovering binding sequences.

  6. MDMA induced hyperthermia: a survivor with an initial body temperature of 42.9 degrees C.

    PubMed Central

    Mallick, A; Bodenham, A R

    1997-01-01

    A young male survived hyperpyrexia (42.9 degrees C) following MDMA ("Ecstasy") ingestion. He developed convulsions, rhabdomyolysis, metabolic acidosis, and respiratory failure. This was successfully managed by assisted ventilation, aggressive fluid therapy, and the early administration of dantrolene, in addition to cooling measures. This is the first report of a survivor with such a severe hyperpyrexia. Images Figure 1 PMID:9315942

  7. Isolation and characterization of target sequences of the chicken CdxA homeobox gene.

    PubMed Central

    Margalit, Y; Yarus, S; Shapira, E; Gruenbaum, Y; Fainsod, A

    1993-01-01

    The DNA binding specificity of the chicken homeodomain protein CDXA was studied. Using a CDXA-glutathione-S-transferase fusion protein, DNA fragments containing the binding site for this protein were isolated. The sources of DNA were oligonucleotides with random sequence and chicken genomic DNA. The DNA fragments isolated were sequenced and tested in DNA binding assays. Sequencing revealed that most DNA fragments are AT rich which is a common feature of homeodomain binding sites. By electrophoretic mobility shift assays it was shown that the different target sequences isolated bind to the CDXA protein with different affinities. The specific sequences bound by the CDXA protein in the genomic fragments isolated, were determined by DNase I footprinting. From the footprinted sequences, the CDXA consensus binding site was determined. The CDXA protein binds the consensus sequence A, A/T, T, A/T, A, T, A/G. The CAUDAL binding site in the ftz promoter is also included in this consensus sequence. When tested, some of the genomic target sequences were capable of enhancing the transcriptional activity of reporter plasmids when introduced into CDXA expressing cells. This study determined the DNA sequence specificity of the CDXA protein and it also shows that this protein can further activate transcription in cells in culture. Images PMID:7909943

  8. Special AT-rich sequence binding protein 1 promotes tumor growth and metastasis of esophageal squamous cell carcinoma.

    PubMed

    Ma, Jun; Wu, Kaiming; Zhao, Zhenxian; Miao, Rong; Xu, Zhe

    2017-03-01

    Esophageal squamous cell carcinoma is one of the most aggressive malignancies worldwide. Special AT-rich sequence binding protein 1 is a nuclear matrix attachment region binding protein which participates in higher order chromatin organization and tissue-specific gene expression. However, the role of special AT-rich sequence binding protein 1 in esophageal squamous cell carcinoma remains unknown. In this study, western blot and quantitative real-time polymerase chain reaction analysis were performed to identify differentially expressed special AT-rich sequence binding protein 1 in a series of esophageal squamous cell carcinoma tissue samples. The effects of special AT-rich sequence binding protein 1 silencing by two short-hairpin RNAs on cell proliferation, migration, and invasion were assessed by the CCK-8 assay and transwell assays in esophageal squamous cell carcinoma in vitro. Special AT-rich sequence binding protein 1 was significantly upregulated in esophageal squamous cell carcinoma tissue samples and cell lines. Silencing of special AT-rich sequence binding protein 1 inhibited the proliferation of KYSE450 and EC9706 cells which have a relatively high level of special AT-rich sequence binding protein 1, and the ability of migration and invasion of KYSE450 and EC9706 cells was distinctly suppressed. Special AT-rich sequence binding protein 1 could be a potential target for the treatment of esophageal squamous cell carcinoma and inhibition of special AT-rich sequence binding protein 1 may provide a new strategy for the prevention of esophageal squamous cell carcinoma invasion and metastasis.

  9. A putative carbohydrate-binding domain of the lactose-binding Cytisus sessilifolius anti-H(O) lectin has a similar amino acid sequence to that of the L-fucose-binding Ulex europaeus anti-H(O) lectin.

    PubMed

    Konami, Y; Yamamoto, K; Osawa, T; Irimura, T

    1995-04-01

    The complete amino acid sequence of a lactose-binding Cytisus sessilifolius anti-H(O) lectin II (CSA-II) was determined using a protein sequencer. After digestion of CSA-II with endoproteinase Lys-C or Asp-N, the resulting peptides were purified by reversed-phase high performance liquid chromatography (HPLC) and then subjected to sequence analysis. Comparison of the complete amino acid sequence of CSA-II with the sequences of other leguminous seed lectins revealed regions of extensive homology. The amino acid sequence of a putative carbohydrate-binding domain of CSA-II was found to be similar to those of several anti-H(O) leguminous lectins, especially to that of the L-fucose-binding Ulex europaeus lectin I (UEA-I).

  10. A novel class of plant-specific zinc-dependent DNA-binding protein that binds to A/T-rich DNA sequences

    PubMed Central

    Nagano, Yukio; Furuhashi, Hirofumi; Inaba, Takehito; Sasaki, Yukiko

    2001-01-01

    Complementary DNA encoding a DNA-binding protein, designated PLATZ1 (plant AT-rich sequence- and zinc-binding protein 1), was isolated from peas. The amino acid sequence of the protein is similar to those of other uncharacterized proteins predicted from the genome sequences of higher plants. However, no paralogous sequences have been found outside the plant kingdom. Multiple alignments among these paralogous proteins show that several cysteine and histidine residues are invariant, suggesting that these proteins are a novel class of zinc-dependent DNA-binding proteins with two distantly located regions, C-x2-H-x11-C-x2-C-x(4–5)-C-x2-C-x(3–7)-H-x2-H and C-x2-C-x(10–11)-C-x3-C. In an electrophoretic mobility shift assay, the zinc chelator 1,10-o-phenanthroline inhibited DNA binding, and two distant zinc-binding regions were required for DNA binding. A protein blot with 65ZnCl2 showed that both regions are required for zinc-binding activity. The PLATZ1 protein non-specifically binds to A/T-rich sequences, including the upstream region of the pea GTPase pra2 and plastocyanin petE genes. Expression of the PLATZ1 repressed those of the reporter constructs containing the coding sequence of luciferase gene driven by the cauliflower mosaic virus (CaMV) 35S90 promoter fused to the tandem repeat of the A/T-rich sequences. These results indicate that PLATZ1 is a novel class of plant-specific zinc-dependent DNA-binding protein responsible for A/T-rich sequence-mediated transcriptional repression. PMID:11600698

  11. Intravenous administration of azumolene to reverse malignant hyperthermia in swine.

    PubMed

    do Carmo, P L; Zapata-Sudo, G; Trachez, M M; Antunes, F; Guimarães, S E F; Debom, R; Rizzi, M D R; Sudo, R T

    2010-01-01

    The efficacy of intravenous (IV) administration of azumolene (Az), an analogue 30-fold more soluble than dantrolene, on pigs susceptible to malignant hyperthermia (MH) is incompletely understood. To evaluate efficacy of Az on MH crisis in pigs. Eight normal (MHN) and 7 susceptible to MH (MHS) pigs (Landrace × Large White × Pietran). Prospective, laboratory trial. Hypermetabolic crisis was observed in MHS pigs, but not in MHN pigs, after a combined administration of inhaled halothane (1.5%) and IV injection of succinylcholine (SCh; 2.5 mg/kg). Susceptibility was confirmed using a caffeine and halothane contracture test. Az was administered 15 minutes after administration of SCh. Respiratory acidosis (pH 7.16 ± 0.02; Pco(2) , 46.2 ± 9.1 mmHg, HCO(3) , 22.5 ± 2.3 mmol/L), fever (38.2 ± 1.1°C), cardiac arrhythmias, and muscle contracture were observed in MHS pigs. MHS pigs (n = 5) treated with Az (2 mg/kg IV) survived the crisis with attenuation of signs (pH 7.30 ± 0.10; Pco(2) , 36.3 ± 4.5 mmHg; HCO(3) , 22.9 ± 2.3 mmol/L) and recovery of normal muscle tone and cardiac rhythm. Az represents a possible substitute for dantrolene to reverse MH crisis in susceptible pigs. Copyright © 2010 by the American College of Veterinary Internal Medicine.

  12. Basis of altered RNA-binding specificity by PUF proteins revealed by crystal structures of yeast Puf4p

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Matthew T.; Higgin, Joshua J.; Hall, Traci M.Tanaka

    2008-06-06

    Pumilio/FBF (PUF) family proteins are found in eukaryotic organisms and regulate gene expression post-transcriptionally by binding to sequences in the 3' untranslated region of target transcripts. PUF proteins contain an RNA binding domain that typically comprises eight {alpha}-helical repeats, each of which recognizes one RNA base. Some PUF proteins, including yeast Puf4p, have altered RNA binding specificity and use their eight repeats to bind to RNA sequences with nine or ten bases. Here we report the crystal structures of Puf4p alone and in complex with a 9-nucleotide (nt) target RNA sequence, revealing that Puf4p accommodates an 'extra' nucleotide by modestmore » adaptations allowing one base to be turned away from the RNA binding surface. Using structural information and sequence comparisons, we created a mutant Puf4p protein that preferentially binds to an 8-nt target RNA sequence over a 9-nt sequence and restores binding of each protein repeat to one RNA base.« less

  13. Detecting cooperative sequences in the binding of RNA Polymerase-II

    NASA Astrophysics Data System (ADS)

    Glass, Kimberly; Rozenberg, Julian; Girvan, Michelle; Losert, Wolfgang; Ott, Ed; Vinson, Charles

    2008-03-01

    Regulation of the expression level of genes is a key biological process controlled largely by the 1000 base pair (bp) sequence preceding each gene (the promoter region). Within that region transcription factor binding sites (TFBS), 5-10 bp long sequences, act individually or cooperate together in the recruitment of, and therefore subsequent gene transcription by, RNA Polymerase-II (RNAP). We have measured the binding of RNAP to promoters on a genome-wide basis using Chromatin Immunoprecipitation (ChIP-on-Chip) microarray assays. Using all 8-base pair long sequences as a test set, we have identified the DNA sequences that are enriched in promoters with high RNAP binding values. We are able to demonstrate that virtually all sequences enriched in such promoters contain a CpG dinucleotide, indicating that TFBS that contain the CpG dinucleotide are involved in RNAP binding to promoters. Further analysis shows that the presence of pairs of CpG containing sequences cooperate to enhance the binding of RNAP to the promoter.

  14. Binding of resveratrol to the minor groove of DNA sequences with AATT and TTAA segments induces differential stability.

    PubMed

    Nair, Maya S; D'Mello, Samar; Pant, Rashmi; Poluri, Krishna Mohan

    2017-05-01

    Interactions of a natural stilbene compound, resveratrol with two DNA sequences containing AATT/TTAA segments have been studied. Resveratrol is found to interact with both the sequences. The mode of interaction has been studied using absorption, steady state fluorescence and circular dichroism spectroscopic techniques. UV-visible absorption and fluorescence studies provided the information regarding the binding constants and the stoichiometry of binding, whereas circular dichroism studies depicted the structural changes in DNA upon resveratrol binding. Our results evidenced that, though resveratrol showed similar affinity to both the sequences, the mode of interactions was different. The binding constants of resveratrol to AATT/TTAA sequences were found to be 7.55×10 5 M -1 and 5.42×10 5 M -1 respectively. Spectroscopic data evidenced for a groove binding interaction. Melting studies showed that the binding of resveratrol induces differential stability to the DNA sequences d(CGTTAACG) 2 and d(CGAATTCG) 2 . Fluorescence data showed a stoichiometry of 1:1 for d(CGAATTCG) 2 -resveratrol complex and 1:4 for d(CGTTAACG) 2 -resveratrol complex. Molecular docking studies demonstrated that resveratrol binds to the minor groove region of both the sequences to form stable complexes with varied atomic contacts to the DNA bases or backbone. Both the complexes are stabilized by hydrogen bond formation. Our results evidenced that modulation of DNA sequence within the same bases can greatly alter the binding geometry and stability of the complex upon binding to small molecule inhibitor compounds like resveratrol. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. A peptide sequence on carcinoembryonic antigen binds to a 80kD protein on Kupffer cells.

    PubMed

    Thomas, P; Petrick, A T; Toth, C A; Fox, E S; Elting, J J; Steele, G

    1992-10-30

    Clearance of carcinoembryonic antigen (CEA) from the circulation is by binding to Kupffer cells in the liver. We have shown that CEA binding to Kupffer cells occurs via a peptide sequence YPELPK representing amino acids 107-112 of the CEA sequence. This peptide sequence is located in the region between the N-terminal and the first immunoglobulin like loop domain. Using native CEA and peptides containing this sequence complexed with a heterobifunctional crosslinking agent and ligand blotting with biotinylated CEA and NCA we have shown binding to an 80kD protein on the Kupffer cell surface. This binding protein may be important in the development of hepatic metastases.

  16. Effects of thyroid hormone on Na sup + -K sup + transport in resting and stimulated rat skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Everts, M.E.; Clausen, T.

    1988-11-01

    The effects of hypothyroidism and 3,5,3{prime}-triiodothyronine (T{sub 3}) treatment on passive Na{sup +}-K{sup +} fluxes and Na{sup +}-K{sup +} pump concentration were investigated in isolated rat muscle. Within 12 h after a single dose of T{sub 3} (20 {mu}g/100 g body wt), K{sup +} efflux had increased by 21% in soleus and by 20% in extensor digitorum longus muscle. In the presence of ouabain, even larger effects were observed. These changes were associated with a 12% rise in amiloride-suppressible Na{sup +} influx but no significant increase in ({sup 3}H)ouabain binding site concentration. After 3 days of T{sub 3} treatment, themore » stimulating effect on K{sup +} efflux and Na{sup +} influx in soleus reached a plateau {approximately}80 and 40% above control levels, respectively, whereas the maximum increase in ({sup 3}H)ouabain binding site concentration (103%) was only fully developed after 8 days. Hypothyroidism decreased {sup 86}Rb efflux by 30%. The efflux of K{sup +} and the influx of Na{sup +} per contraction (both {approximately}7 nmol/g wet wt) as well as the net loss of K{sup +} induced by electrical stimulation were unaffected by T{sub 3} treatment. The rise in resting K{sup +} efflux after 12-24 h of T{sub 3} treatment could be partly blocked by dantrolene or trifluoroperazine, indicating that an increase in the cytoplasmic Ca{sup 2+} concentration may contribute to the early rise in K{sup +} efflux. It is concluded that the early rise in the resting passive leaks of Na{sup +} and K{sup +} induced by T{sub 3} is a major driving force for Na{sup +}-K{sup +} pump synthesis.« less

  17. In silico evolution of the Drosophila gap gene regulatory sequence under elevated mutational pressure.

    PubMed

    Chertkova, Aleksandra A; Schiffman, Joshua S; Nuzhdin, Sergey V; Kozlov, Konstantin N; Samsonova, Maria G; Gursky, Vitaly V

    2017-02-07

    Cis-regulatory sequences are often composed of many low-affinity transcription factor binding sites (TFBSs). Determining the evolutionary and functional importance of regulatory sequence composition is impeded without a detailed knowledge of the genotype-phenotype map. We simulate the evolution of regulatory sequences involved in Drosophila melanogaster embryo segmentation during early development. Natural selection evaluates gene expression dynamics produced by a computational model of the developmental network. We observe a dramatic decrease in the total number of transcription factor binding sites through the course of evolution. Despite a decrease in average sequence binding energies through time, the regulatory sequences tend towards organisations containing increased high affinity transcription factor binding sites. Additionally, the binding energies of separate sequence segments demonstrate ubiquitous mutual correlations through time. Fewer than 10% of initial TFBSs are maintained throughout the entire simulation, deemed 'core' sites. These sites have increased functional importance as assessed under wild-type conditions and their binding energy distributions are highly conserved. Furthermore, TFBSs within close proximity of core sites exhibit increased longevity, reflecting functional regulatory interactions with core sites. In response to elevated mutational pressure, evolution tends to sample regulatory sequence organisations with fewer, albeit on average, stronger functional transcription factor binding sites. These organisations are also shaped by the regulatory interactions among core binding sites with sites in their local vicinity.

  18. Hyperdiversity of Genes Encoding Integral Light-Harvesting Proteins in the Dinoflagellate Symbiodinium sp

    PubMed Central

    Boldt, Lynda; Yellowlees, David; Leggat, William

    2012-01-01

    The superfamily of light-harvesting complex (LHC) proteins is comprised of proteins with diverse functions in light-harvesting and photoprotection. LHC proteins bind chlorophyll (Chl) and carotenoids and include a family of LHCs that bind Chl a and c. Dinophytes (dinoflagellates) are predominantly Chl c binding algal taxa, bind peridinin or fucoxanthin as the primary carotenoid, and can possess a number of LHC subfamilies. Here we report 11 LHC sequences for the chlorophyll a-chlorophyll c 2-peridinin protein complex (acpPC) subfamily isolated from Symbiodinium sp. C3, an ecologically important peridinin binding dinoflagellate taxa. Phylogenetic analysis of these proteins suggests the acpPC subfamily forms at least three clades within the Chl a/c binding LHC family; Clade 1 clusters with rhodophyte, cryptophyte and peridinin binding dinoflagellate sequences, Clade 2 with peridinin binding dinoflagellate sequences only and Clades 3 with heterokontophytes, fucoxanthin and peridinin binding dinoflagellate sequences. PMID:23112815

  19. Regulation of Ca(2+)-dependent protein turnover in skeletal muscle by thyroxine

    NASA Technical Reports Server (NTRS)

    Zeman, Richard J.; Bernstein, Paul L.; Ludemann, Robert; Etlinger, Joseph D.

    1986-01-01

    Dantrolene, an agent that inhibits Ca(2+) mobilization, improved protein balance in skeletal muscle, as thyroid status was increased, by altering rates of protein synthesis and degradation. Thyroxine (T4) caused increases in protein degradation that were blocked by leupeptin, a proteinase inhibitor previously shown to inhibit Ca(2+)-dependent nonlysosomal proteolysis in these muscles. In addition, T4 abolished sensitivity to the lysosomotropic agent methylamine and the autophagy inhibitor 3-methyladenine, suggesting that T4 inhibits autophagic/lysosomal proteolysis.

  20. SMARTIV: combined sequence and structure de-novo motif discovery for in-vivo RNA binding data.

    PubMed

    Polishchuk, Maya; Paz, Inbal; Yakhini, Zohar; Mandel-Gutfreund, Yael

    2018-05-25

    Gene expression regulation is highly dependent on binding of RNA-binding proteins (RBPs) to their RNA targets. Growing evidence supports the notion that both RNA primary sequence and its local secondary structure play a role in specific Protein-RNA recognition and binding. Despite the great advance in high-throughput experimental methods for identifying sequence targets of RBPs, predicting the specific sequence and structure binding preferences of RBPs remains a major challenge. We present a novel webserver, SMARTIV, designed for discovering and visualizing combined RNA sequence and structure motifs from high-throughput RNA-binding data, generated from in-vivo experiments. The uniqueness of SMARTIV is that it predicts motifs from enriched k-mers that combine information from ranked RNA sequences and their predicted secondary structure, obtained using various folding methods. Consequently, SMARTIV generates Position Weight Matrices (PWMs) in a combined sequence and structure alphabet with assigned P-values. SMARTIV concisely represents the sequence and structure motif content as a single graphical logo, which is informative and easy for visual perception. SMARTIV was examined extensively on a variety of high-throughput binding experiments for RBPs from different families, generated from different technologies, showing consistent and accurate results. Finally, SMARTIV is a user-friendly webserver, highly efficient in run-time and freely accessible via http://smartiv.technion.ac.il/.

  1. Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.

    PubMed

    Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook

    2014-11-01

    As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  2. Structure and Sequence Search on Aptamer-Protein Docking

    NASA Astrophysics Data System (ADS)

    Xiao, Jiajie; Bonin, Keith; Guthold, Martin; Salsbury, Freddie

    2015-03-01

    Interactions between proteins and deoxyribonucleic acid (DNA) play a significant role in the living systems, especially through gene regulation. However, short nucleic acids sequences (aptamers) with specific binding affinity to specific proteins exhibit clinical potential as therapeutics. Our capillary and gel electrophoresis selection experiments show that specific sequences of aptamers can be selected that bind specific proteins. Computationally, given the experimentally-determined structure and sequence of a thrombin-binding aptamer, we can successfully dock the aptamer onto thrombin in agreement with experimental structures of the complex. In order to further study the conformational flexibility of this thrombin-binding aptamer and to potentially develop a predictive computational model of aptamer-binding, we use GPU-enabled molecular dynamics simulations to both examine the conformational flexibility of the aptamer in the absence of binding to thrombin, and to determine our ability to fold an aptamer. This study should help further de-novo predictions of aptamer sequences by enabling the study of structural and sequence-dependent effects on aptamer-protein docking specificity.

  3. How proteins bind to DNA: target discrimination and dynamic sequence search by the telomeric protein TRF1

    PubMed Central

    2017-01-01

    Abstract Target search as performed by DNA-binding proteins is a complex process, in which multiple factors contribute to both thermodynamic discrimination of the target sequence from overwhelmingly abundant off-target sites and kinetic acceleration of dynamic sequence interrogation. TRF1, the protein that binds to telomeric tandem repeats, faces an intriguing variant of the search problem where target sites are clustered within short fragments of chromosomal DNA. In this study, we use extensive (>0.5 ms in total) MD simulations to study the dynamical aspects of sequence-specific binding of TRF1 at both telomeric and non-cognate DNA. For the first time, we describe the spontaneous formation of a sequence-specific native protein–DNA complex in atomistic detail, and study the mechanism by which proteins avoid off-target binding while retaining high affinity for target sites. Our calculated free energy landscapes reproduce the thermodynamics of sequence-specific binding, while statistical approaches allow for a comprehensive description of intermediate stages of complex formation. PMID:28633355

  4. Nuclear proteins that bind the human gamma-globin gene promoter: alterations in binding produced by point mutations associated with hereditary persistence of fetal hemoglobin.

    PubMed Central

    Gumucio, D L; Rood, K L; Gray, T A; Riordan, M F; Sartor, C I; Collins, F S

    1988-01-01

    The molecular mechanisms responsible for the human fetal-to-adult hemoglobin switch have not yet been elucidated. Point mutations identified in the promoter regions of gamma-globin genes from individuals with nondeletion hereditary persistence of fetal hemoglobin (HPFH) may mark cis-acting sequences important for this switch, and the trans-acting factors which interact with these sequences may be integral parts in the puzzle of gamma-globin gene regulation. We have used gel retardation and footprinting strategies to define nuclear proteins which bind to the normal gamma-globin promoter and to determine the effect of HPFH mutations on the binding of a subset of these proteins. We have identified five proteins in human erythroleukemia cells (K562 and HEL) which bind to the proximal promoter region of the normal gamma-globin gene. One factor, gamma CAAT, binds the duplicated CCAAT box sequences; the -117 HPFH mutation increases the affinity of interaction between gamma CAAT and its cognate site. Two proteins, gamma CAC1 and gamma CAC2, bind the CACCC sequence. These proteins require divalent cations for binding. The -175 HPFH mutation interferes with the binding of a fourth protein, gamma OBP, which binds an octamer sequence (ATGCAAAT) in the normal gamma-globin promoter. The HPFH phenotype of the -175 mutation indicates that the octamer-binding protein may play a negative regulatory role in this setting. A fifth protein, EF gamma a, binds to sequences which overlap the octamer-binding site. The erythroid-specific distribution of EF gamma a and its close approximation to an apparent repressor-binding site suggest that it may be important in gamma-globin regulation. Images PMID:2468996

  5. Phage display selection of peptides that target calcium-binding proteins.

    PubMed

    Vetter, Stefan W

    2013-01-01

    Phage display allows to rapidly identify peptide sequences with binding affinity towards target proteins, for example, calcium-binding proteins (CBPs). Phage technology allows screening of 10(9) or more independent peptide sequences and can identify CBP binding peptides within 2 weeks. Adjusting of screening conditions allows selecting CBPs binding peptides that are either calcium-dependent or independent. Obtained peptide sequences can be used to identify CBP target proteins based on sequence homology or to quickly obtain peptide-based CBP inhibitors to modulate CBP-target interactions. The protocol described here uses a commercially available phage display library, in which random 12-mer peptides are displayed on filamentous M13 phages. The library was screened against the calcium-binding protein S100B.

  6. Analysis of sequencing data for probing RNA secondary structures and protein-RNA binding in studying posttranscriptional regulations.

    PubMed

    Hu, Xihao; Wu, Yang; Lu, Zhi John; Yip, Kevin Y

    2016-11-01

    High-throughput sequencing has been used to study posttranscriptional regulations, where the identification of protein-RNA binding is a major and fast-developing sub-area, which is in turn benefited by the sequencing methods for whole-transcriptome probing of RNA secondary structures. In the study of RNA secondary structures using high-throughput sequencing, bases are modified or cleaved according to their structural features, which alter the resulting composition of sequencing reads. In the study of protein-RNA binding, methods have been proposed to immuno-precipitate (IP) protein-bound RNA transcripts in vitro or in vivo By sequencing these transcripts, the protein-RNA interactions and the binding locations can be identified. For both types of data, read counts are affected by a combination of confounding factors, including expression levels of transcripts, sequence biases, mapping errors and the probing or IP efficiency of the experimental protocols. Careful processing of the sequencing data and proper extraction of important features are fundamentally important to a successful analysis. Here we review and compare different experimental methods for probing RNA secondary structures and binding sites of RNA-binding proteins (RBPs), and the computational methods proposed for analyzing the corresponding sequencing data. We suggest how these two types of data should be integrated to study the structural properties of RBP binding sites as a systematic way to better understand posttranscriptional regulations. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  7. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    PubMed

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  8. Two DNA-binding factors recognize specific sequences at silencers, upstream activating sequences, autonomously replicating sequences, and telomeres in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Buchman, A.R.; Kimmerly, W.J.; Rine, J.

    1988-01-01

    Two DNA-binding factors from Saccharomyces cerevisiae have been characterized, GRFI (general regulatory factor I) and ABFI (ARS-binding factor I), that recognize specific sequences within diverse genetic elements. GRFI bound to sequences at the negative regulatory elements (silencers) of the silent mating type loci HML E and HMR E and to the upstream activating sequence (UAS) required for transcription of the MAT ..cap alpha.. genes. A putative conserved UAS located at genes involved in translation (RPG box) was also recognized by GRFI. In addition, GRFI bound with high affinity to sequences within the (C/sub 1-3/A)-repeat region at yeast telomeres. Binding sitesmore » for GRFI with the highest affinity appeared to be of the form 5'-(A/G)(A/C)ACCCAN NCA(T/C)(T/C)-3', where N is any nucleotide. ABFI-binding sites were located next to autonomously replicating sequences (ARSs) at controlling elements of the silent mating type loci HMR E, HMR I, and HML I and were associated with ARS1, ARS2, and the 2..mu..m plasmid ARS. Two tandem ABFI binding sites were found between the HIS3 and DED1 genes, several kilobase pairs from any ARS, indicating that ABFI-binding sites are not restricted to ARSs. The sequences recognized by AFBI showed partial dyad-symmetry and appeared to be variations of the consensus 5'-TATCATTNNNNACGA-3'. GRFI and ABFI were both abundant DNA-binding factors and did not appear to be encoded by the SIR genes, whose product are required for repression of the silent mating type loci. Together, these results indicate that both GRFI and ABFI play multiple roles within the cell.« less

  9. Sequence specificity of single-stranded DNA-binding proteins: a novel DNA microarray approach

    PubMed Central

    Morgan, Hugh P.; Estibeiro, Peter; Wear, Martin A.; Max, Klaas E.A.; Heinemann, Udo; Cubeddu, Liza; Gallagher, Maurice P.; Sadler, Peter J.; Walkinshaw, Malcolm D.

    2007-01-01

    We have developed a novel DNA microarray-based approach for identification of the sequence-specificity of single-stranded nucleic-acid-binding proteins (SNABPs). For verification, we have shown that the major cold shock protein (CspB) from Bacillus subtilis binds with high affinity to pyrimidine-rich sequences, with a binding preference for the consensus sequence, 5′-GTCTTTG/T-3′. The sequence was modelled onto the known structure of CspB and a cytosine-binding pocket was identified, which explains the strong preference for a cytosine base at position 3. This microarray method offers a rapid high-throughput approach for determining the specificity and strength of ss DNA–protein interactions. Further screening of this newly emerging family of transcription factors will help provide an insight into their cellular function. PMID:17488853

  10. STAT1:DNA sequence-dependent binding modulation by phosphorylation, protein:protein interactions and small-molecule inhibition

    PubMed Central

    Bonham, Andrew J.; Wenta, Nikola; Osslund, Leah M.; Prussin, Aaron J.; Vinkemeier, Uwe; Reich, Norbert O.

    2013-01-01

    The DNA-binding specificity and affinity of the dimeric human transcription factor (TF) STAT1, were assessed by total internal reflectance fluorescence protein-binding microarrays (TIRF-PBM) to evaluate the effects of protein phosphorylation, higher-order polymerization and small-molecule inhibition. Active, phosphorylated STAT1 showed binding preferences consistent with prior characterization, whereas unphosphorylated STAT1 showed a weak-binding preference for one-half of the GAS consensus site, consistent with recent models of STAT1 structure and function in response to phosphorylation. This altered-binding preference was further tested by use of the inhibitor LLL3, which we show to disrupt STAT1 binding in a sequence-dependent fashion. To determine if this sequence-dependence is specific to STAT1 and not a general feature of human TF biology, the TF Myc/Max was analysed and tested with the inhibitor Mycro3. Myc/Max inhibition by Mycro3 is sequence independent, suggesting that the sequence-dependent inhibition of STAT1 may be specific to this system and a useful target for future inhibitor design. PMID:23180800

  11. Computational design of enzyme-ligand binding using a combined energy function and deterministic sequence optimization algorithm.

    PubMed

    Tian, Ye; Huang, Xiaoqiang; Zhu, Yushan

    2015-08-01

    Enzyme amino-acid sequences at ligand-binding interfaces are evolutionarily optimized for reactions, and the natural conformation of an enzyme-ligand complex must have a low free energy relative to alternative conformations in native-like or non-native sequences. Based on this assumption, a combined energy function was developed for enzyme design and then evaluated by recapitulating native enzyme sequences at ligand-binding interfaces for 10 enzyme-ligand complexes. In this energy function, the electrostatic interaction between polar or charged atoms at buried interfaces is described by an explicitly orientation-dependent hydrogen-bonding potential and a pairwise-decomposable generalized Born model based on the general side chain in the protein design framework. The energy function is augmented with a pairwise surface-area based hydrophobic contribution for nonpolar atom burial. Using this function, on average, 78% of the amino acids at ligand-binding sites were predicted correctly in the minimum-energy sequences, whereas 84% were predicted correctly in the most-similar sequences, which were selected from the top 20 sequences for each enzyme-ligand complex. Hydrogen bonds at the enzyme-ligand binding interfaces in the 10 complexes were usually recovered with the correct geometries. The binding energies calculated using the combined energy function helped to discriminate the active sequences from a pool of alternative sequences that were generated by repeatedly solving a series of mixed-integer linear programming problems for sequence selection with increasing integer cuts.

  12. Specific minor groove solvation is a crucial determinant of DNA binding site recognition

    PubMed Central

    Harris, Lydia-Ann; Williams, Loren Dean; Koudelka, Gerald B.

    2014-01-01

    The DNA sequence preferences of nearly all sequence specific DNA binding proteins are influenced by the identities of bases that are not directly contacted by protein. Discrimination between non-contacted base sequences is commonly based on the differential abilities of DNA sequences to allow narrowing of the DNA minor groove. However, the factors that govern the propensity of minor groove narrowing are not completely understood. Here we show that the differential abilities of various DNA sequences to support formation of a highly ordered and stable minor groove solvation network are a key determinant of non-contacted base recognition by a sequence-specific binding protein. In addition, disrupting the solvent network in the non-contacted region of the binding site alters the protein's ability to recognize contacted base sequences at positions 5–6 bases away. This observation suggests that DNA solvent interactions link contacted and non-contacted base recognition by the protein. PMID:25429976

  13. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  14. DNA sequence determinants controlling affinity, stability and shape of DNA complexes bound by the nucleoid protein Fis

    DOE PAGES

    Hancock, Stephen P.; Stella, Stefano; Cascio, Duilio; ...

    2016-03-09

    The abundant Fis nucleoid protein selectively binds poorly related DNA sequences with high affinities to regulate diverse DNA reactions. Fis binds DNA primarily through DNA backbone contacts and selects target sites by reading conformational properties of DNA sequences, most prominently intrinsic minor groove widths. High-affinity binding requires Fis-stabilized DNA conformational changes that vary depending on DNA sequence. In order to better understand the molecular basis for high affinity site recognition, we analyzed the effects of DNA sequence within and flanking the core Fis binding site on binding affinity and DNA structure. X-ray crystal structures of Fis-DNA complexes containing variable sequencesmore » in the noncontacted center of the binding site or variations within the major groove interfaces show that the DNA can adapt to the Fis dimer surface asymmetrically. We show that the presence and position of pyrimidine-purine base steps within the major groove interfaces affect both local DNA bending and minor groove compression to modulate affinities and lifetimes of Fis-DNA complexes. Sequences flanking the core binding site also modulate complex affinities, lifetimes, and the degree of local and global Fis-induced DNA bending. In particular, a G immediately upstream of the 15 bp core sequence inhibits binding and bending, and A-tracts within the flanking base pairs increase both complex lifetimes and global DNA curvatures. Taken together, our observations support a revised DNA motif specifying high-affinity Fis binding and highlight the range of conformations that Fis-bound DNA can adopt. Lastly, the affinities and DNA conformations of individual Fis-DNA complexes are likely to be tailored to their context-specific biological functions.« less

  15. Identification and application of self-binding zipper-like sequences in SARS-CoV spike protein.

    PubMed

    Zhang, Si Min; Liao, Ying; Neo, Tuan Ling; Lu, Yanning; Liu, Ding Xiang; Vahlne, Anders; Tam, James P

    2018-05-22

    Self-binding peptides containing zipper-like sequences, such as the Leu/Ile zipper sequence within the coiled coil regions of proteins and the cross-β spine steric zippers within the amyloid-like fibrils, could bind to the protein-of-origin through homophilic sequence-specific zipper motifs. These self-binding sequences represent opportunities for the development of biochemical tools and/or therapeutics. Here, we report on the identification of a putative self-binding β-zipper-forming peptide within the severe acute respiratory syndrome-associated coronavirus spike (S) protein and its application in viral detection. Peptide array scanning of overlapping peptides covering the entire length of S protein identified 34 putative self-binding peptides of six clusters, five of which contained octapeptide core consensus sequences. The Cluster I consensus octapeptide sequence GINITNFR was predicted by the Eisenberg's 3D profile method to have high amyloid-like fibrillation potential through steric β-zipper formation. Peptide C6 containing the Cluster I consensus sequence was shown to oligomerize and form amyloid-like fibrils. Taking advantage of this, C6 was further applied to detect the S protein expression in vitro by fluorescence staining. Meanwhile, the coiled-coil-forming Leu/Ile heptad repeat sequences within the S protein were under-represented during peptide array scanning, in agreement with that long peptide lengths were required to attain high helix-mediated interaction avidity. The data suggest that short β-zipper-like self-binding peptides within the S protein could be identified through combining the peptide scanning and predictive methods, and could be exploited as biochemical detection reagents for viral infection. Copyright © 2018. Published by Elsevier Ltd.

  16. Molecular simulations of polycation-DNA binding exploring the effect of peptide chemistry and sequence in nuclear localization sequence based polycations.

    PubMed

    Elder, Robert M; Jayaraman, Arthi

    2013-10-10

    Gene therapy relies on the delivery of DNA into cells, and polycations are one class of vectors enabling efficient DNA delivery. Nuclear localization sequences (NLS), cationic oligopeptides that target molecules for nuclear entry, can be incorporated into polycations to improve their gene delivery efficiency. We use simulations to study the effect of peptide chemistry and sequence on the DNA-binding behavior of NLS-grafted polycations by systematically mutating the residues in the grafts, which are based on the SV40 NLS (peptide sequence PKKKRKV). Replacing arginine (R) with lysine (K) reduces binding strength by eliminating arginine-DNA interactions, but placing R in a less hindered location (e.g., farther from the grafting point to the polycation backbone) has surprisingly little effect on polycation-DNA binding strength. Changing the positions of the hydrophobic proline (P) and valine (V) residues relative to the polycation backbone changes hydrophobic aggregation within the polycation and, consequently, changes the conformational entropy loss that occurs upon polycation-DNA binding. Since conformational entropy loss affects the free energy of binding, the positions of P and V in the grafts affect DNA binding affinity. The insight from this work guides synthesis of polycations with tailored DNA binding affinity and, in turn, efficient DNA delivery.

  17. Comparative genomics and evolution of the amylase-binding proteins of oral streptococci.

    PubMed

    Haase, Elaine M; Kou, Yurong; Sabharwal, Amarpreet; Liao, Yu-Chieh; Lan, Tianying; Lindqvist, Charlotte; Scannapieco, Frank A

    2017-04-20

    Successful commensal bacteria have evolved to maintain colonization in challenging environments. The oral viridans streptococci are pioneer colonizers of dental plaque biofilm. Some of these bacteria have adapted to life in the oral cavity by binding salivary α-amylase, which hydrolyzes dietary starch, thus providing a source of nutrition. Oral streptococcal species bind α-amylase by expressing a variety of amylase-binding proteins (ABPs). Here we determine the genotypic basis of amylase binding where proteins of diverse size and function share a common phenotype. ABPs were detected in culture supernatants of 27 of 59 strains representing 13 oral Streptococcus species screened using the amylase-ligand binding assay. N-terminal sequences from ABPs of diverse size were obtained from 18 strains representing six oral streptococcal species. Genome sequencing and BLAST searches using N-terminal sequences, protein size, and key words identified the gene associated with each ABP. Among the sequenced ABPs, 14 matched amylase-binding protein A (AbpA), 6 matched amylase-binding protein B (AbpB), and 11 unique ABPs were identified as peptidoglycan-binding, glutamine ABC-type transporter, hypothetical, or choline-binding proteins. Alignment and phylogenetic analyses performed to ascertain evolutionary relationships revealed that ABPs cluster into at least six distinct, unrelated families (AbpA, AbpB, and four novel ABPs) with no phylogenetic evidence that one group evolved from another, and no single ancestral gene found within each group. AbpA-like sequences can be divided into five subgroups based on the N-terminal sequences. Comparative genomics focusing on the abpA gene locus provides evidence of horizontal gene transfer. The acquisition of an ABP by oral streptococci provides an interesting example of adaptive evolution.

  18. Accurate Prediction of Inducible Transcription Factor Binding Intensities In Vivo

    PubMed Central

    Siepel, Adam; Lis, John T.

    2012-01-01

    DNA sequence and local chromatin landscape act jointly to determine transcription factor (TF) binding intensity profiles. To disentangle these influences, we developed an experimental approach, called protein/DNA binding followed by high-throughput sequencing (PB–seq), that allows the binding energy landscape to be characterized genome-wide in the absence of chromatin. We applied our methods to the Drosophila Heat Shock Factor (HSF), which inducibly binds a target DNA sequence element (HSE) following heat shock stress. PB–seq involves incubating sheared naked genomic DNA with recombinant HSF, partitioning the HSF–bound and HSF–free DNA, and then detecting HSF–bound DNA by high-throughput sequencing. We compared PB–seq binding profiles with ones observed in vivo by ChIP–seq and developed statistical models to predict the observed departures from idealized binding patterns based on covariates describing the local chromatin environment. We found that DNase I hypersensitivity and tetra-acetylation of H4 were the most influential covariates in predicting changes in HSF binding affinity. We also investigated the extent to which DNA accessibility, as measured by digital DNase I footprinting data, could be predicted from MNase–seq data and the ChIP–chip profiles for many histone modifications and TFs, and found GAGA element associated factor (GAF), tetra-acetylation of H4, and H4K16 acetylation to be the most predictive covariates. Lastly, we generated an unbiased model of HSF binding sequences, which revealed distinct biophysical properties of the HSF/HSE interaction and a previously unrecognized substructure within the HSE. These findings provide new insights into the interplay between the genomic sequence and the chromatin landscape in determining transcription factor binding intensity. PMID:22479205

  19. Architecture of a Fur Binding Site: a Comparative Analysis

    PubMed Central

    Lavrrar, Jennifer L.; McIntosh, Mark A.

    2003-01-01

    Fur is an iron-binding transcriptional repressor that recognizes a 19-bp consensus site of the sequence 5′-GATAATGATAATCATTATC-3′. This site can be defined as three adjacent hexamers of the sequence 5′-GATAAT-3′, with the third being slightly imperfect (an F-F-F configuration), or as two hexamers in the forward orientation separated by one base pair from a third hexamer in the reverse orientation (an F-F-x-R configuration). Although Fur can bind synthetic DNA sequences containing the F-F-F arrangement, most natural binding sites are variations of the F-F-x-R arrangement. The studies presented here compared the ability of Fur to recognize synthetic DNA sequences containing two to four adjacent hexamers with binding to sequences containing variations of the F-F-x-R arrangement (including natural operator sequences from the entS and fepB promoter regions of Escherichia coli). Gel retardation assays showed that the F-F-x-R architecture was necessary for high-affinity Fur-DNA interactions and that contiguous hexamers were not recognized as effectively. In addition, the stoichiometry of Fur at each binding site was determined, showing that Fur interacted with its minimal 19-bp binding site as two overlapping dimers. These data confirm the proposed overlapping-dimer binding model, where the unit of interaction with a single Fur dimer is two inverted hexamers separated by a C:G base pair, with two overlapping units comprising the 19-bp consensus binding site required for the high-affinity interaction with two Fur dimers. PMID:12644489

  20. Proteome-wide Identification of Novel Ceramide-binding Proteins by Yeast Surface cDNA Display and Deep Sequencing.

    PubMed

    Bidlingmaier, Scott; Ha, Kevin; Lee, Nam-Kyung; Su, Yang; Liu, Bin

    2016-04-01

    Although the bioactive sphingolipid ceramide is an important cell signaling molecule, relatively few direct ceramide-interacting proteins are known. We used an approach combining yeast surface cDNA display and deep sequencing technology to identify novel proteins binding directly to ceramide. We identified 234 candidate ceramide-binding protein fragments and validated binding for 20. Most (17) bound selectively to ceramide, although a few (3) bound to other lipids as well. Several novel ceramide-binding domains were discovered, including the EF-hand calcium-binding motif, the heat shock chaperonin-binding motif STI1, the SCP2 sterol-binding domain, and the tetratricopeptide repeat region motif. Interestingly, four of the verified ceramide-binding proteins (HPCA, HPCAL1, NCS1, and VSNL1) and an additional three candidate ceramide-binding proteins (NCALD, HPCAL4, and KCNIP3) belong to the neuronal calcium sensor family of EF hand-containing proteins. We used mutagenesis to map the ceramide-binding site in HPCA and to create a mutant HPCA that does not bind to ceramide. We demonstrated selective binding to ceramide by mammalian cell-produced wild type but not mutant HPCA. Intriguingly, we also identified a fragment from prostaglandin D2synthase that binds preferentially to ceramide 1-phosphate. The wide variety of proteins and domains capable of binding to ceramide suggests that many of the signaling functions of ceramide may be regulated by direct binding to these proteins. Based on the deep sequencing data, we estimate that our yeast surface cDNA display library covers ∼60% of the human proteome and our selection/deep sequencing protocol can identify target-interacting protein fragments that are present at extremely low frequency in the starting library. Thus, the yeast surface cDNA display/deep sequencing approach is a rapid, comprehensive, and flexible method for the analysis of protein-ligand interactions, particularly for the study of non-protein ligands. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Predicting protein-binding regions in RNA using nucleotide profiles and compositions.

    PubMed

    Choi, Daesik; Park, Byungkyu; Chae, Hanju; Lee, Wook; Han, Kyungsook

    2017-03-14

    Motivated by the increased amount of data on protein-RNA interactions and the availability of complete genome sequences of several organisms, many computational methods have been proposed to predict binding sites in protein-RNA interactions. However, most computational methods are limited to finding RNA-binding sites in proteins instead of protein-binding sites in RNAs. Predicting protein-binding sites in RNA is more challenging than predicting RNA-binding sites in proteins. Recent computational methods for finding protein-binding sites in RNAs have several drawbacks for practical use. We developed a new support vector machine (SVM) model for predicting protein-binding regions in mRNA sequences. The model uses sequence profiles constructed from log-odds scores of mono- and di-nucleotides and nucleotide compositions. The model was evaluated by standard 10-fold cross validation, leave-one-protein-out (LOPO) cross validation and independent testing. Since actual mRNA sequences have more non-binding regions than protein-binding regions, we tested the model on several datasets with different ratios of protein-binding regions to non-binding regions. The best performance of the model was obtained in a balanced dataset of positive and negative instances. 10-fold cross validation with a balanced dataset achieved a sensitivity of 91.6%, a specificity of 92.4%, an accuracy of 92.0%, a positive predictive value (PPV) of 91.7%, a negative predictive value (NPV) of 92.3% and a Matthews correlation coefficient (MCC) of 0.840. LOPO cross validation showed a lower performance than the 10-fold cross validation, but the performance remains high (87.6% accuracy and 0.752 MCC). In testing the model on independent datasets, it achieved an accuracy of 82.2% and an MCC of 0.656. Testing of our model and other state-of-the-art methods on a same dataset showed that our model is better than the others. Sequence profiles of log-odds scores of mono- and di-nucleotides were much more powerful features than nucleotide compositions in finding protein-binding regions in RNA sequences. But, a slight performance gain was obtained when using the sequence profiles along with nucleotide compositions. These are preliminary results of ongoing research, but demonstrate the potential of our approach as a powerful predictor of protein-binding regions in RNA. The program and supporting data are available at http://bclab.inha.ac.kr/RBPbinding .

  2. Predicting protein-binding RNA nucleotides with consideration of binding partners.

    PubMed

    Tuvshinjargal, Narankhuu; Lee, Wook; Park, Byungkyu; Han, Kyungsook

    2015-06-01

    In recent years several computational methods have been developed to predict RNA-binding sites in protein. Most of these methods do not consider interacting partners of a protein, so they predict the same RNA-binding sites for a given protein sequence even if the protein binds to different RNAs. Unlike the problem of predicting RNA-binding sites in protein, the problem of predicting protein-binding sites in RNA has received little attention mainly because it is much more difficult and shows a lower accuracy on average. In our previous study, we developed a method that predicts protein-binding nucleotides from an RNA sequence. In an effort to improve the prediction accuracy and usefulness of the previous method, we developed a new method that uses both RNA and protein sequence data. In this study, we identified effective features of RNA and protein molecules and developed a new support vector machine (SVM) model to predict protein-binding nucleotides from RNA and protein sequence data. The new model that used both protein and RNA sequence data achieved a sensitivity of 86.5%, a specificity of 86.2%, a positive predictive value (PPV) of 72.6%, a negative predictive value (NPV) of 93.8% and Matthews correlation coefficient (MCC) of 0.69 in a 10-fold cross validation; it achieved a sensitivity of 58.8%, a specificity of 87.4%, a PPV of 65.1%, a NPV of 84.2% and MCC of 0.48 in independent testing. For comparative purpose, we built another prediction model that used RNA sequence data alone and ran it on the same dataset. In a 10 fold-cross validation it achieved a sensitivity of 85.7%, a specificity of 80.5%, a PPV of 67.7%, a NPV of 92.2% and MCC of 0.63; in independent testing it achieved a sensitivity of 67.7%, a specificity of 78.8%, a PPV of 57.6%, a NPV of 85.2% and MCC of 0.45. In both cross-validations and independent testing, the new model that used both RNA and protein sequences showed a better performance than the model that used RNA sequence data alone in most performance measures. To the best of our knowledge, this is the first sequence-based prediction of protein-binding nucleotides in RNA which considers the binding partner of RNA. The new model will provide valuable information for designing biochemical experiments to find putative protein-binding sites in RNA with unknown structure. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  3. An Evolutionary/Biochemical Connection Between Promoter- and Primer-Dependent Polymerases Revealed by Selective Evolution of Ligands by Exponential Enrichment (SELEX).

    PubMed

    Fenstermacher, Katherine J; Achuthan, Vasudevan; Schneider, Thomas D; DeStefano, Jeffrey J

    2018-01-16

    DNA polymerases (DNAPs) recognize 3' recessed termini on duplex DNA and carry out nucleotide catalysis. Unlike promoter-specific RNA polymerases (RNAPs), no sequence specificity is required for binding or initiation of catalysis. Despite this, previous results indicate that viral reverse transcriptases bind much more tightly to DNA primers that mimic the polypurine tract. In the current report, primer sequences that bind with high affinity to Taq and Klenow polymerases were identified using a modified Selective Evolution of Ligands by Exponential Enrichment (SELEX) approach. Two Taq -specific primers that bound ∼10 (Taq1) and over 100 (Taq2) times more stably than controls to Taq were identified. Taq1 contained 8 nucleotides (5' -CACTAAAG-3') that matched the phage T3 RNAP "core" promoter. Both primers dramatically outcompeted primers with similar binding thermodynamics in PCR reactions. Similarly, exonuclease minus Klenow polymerase also selected a high affinity primer that contained a related core promoter sequence from phage T7 RNAP (5' -ACTATAG-3'). For both Taq and Klenow, even small modifications to the sequence resulted in large losses in binding affinity suggesting that binding was highly sequence-specific. The results are discussed in the context of possible effects on multi-primer (multiplex) PCR assays, molecular information theory, and the evolution of RNAPs and DNAPs. Importance This work further demonstrates that primer-dependent DNA polymerases can have strong sequence biases leading to dramatically tighter binding to specific sequences. These may be related to biological function, or be a consequences of the structural architecture of the enzyme. New sequence specificity for Taq and Klenow polymerases were uncovered and among them were sequences that contained the core promoter elements from T3 and T7 phage RNA polymerase promoters. This suggests the intriguing possibility that phage RNA polymerases exploited intrinsic binding affinities of ancestral DNA polymerases to develop their promotors. Conversely, DNA polymerases could have evolved from related RNA polymerases and retained the intrinsic binding preference despite there being no clear function for such a preference in DNA biology. Copyright © 2018 American Society for Microbiology.

  4. Tributyltin-induced endoplasmic reticulum stress and its Ca(2+)-mediated mechanism.

    PubMed

    Isomura, Midori; Kotake, Yaichiro; Masuda, Kyoichi; Miyara, Masatsugu; Okuda, Katsuhiro; Samizo, Shigeyoshi; Sanoh, Seigo; Hosoi, Toru; Ozawa, Koichiro; Ohta, Shigeru

    2013-10-01

    Organotin compounds, especially tributyltin chloride (TBT), have been widely used in antifouling paints for marine vessels, but exhibit various toxicities in mammals. The endoplasmic reticulum (ER) is a multifunctional organelle that controls post-translational modification and intracellular Ca(2+) signaling. When the capacity of the quality control system of ER is exceeded under stress including ER Ca(2+) homeostasis disruption, ER functions are impaired and unfolded proteins are accumulated in ER lumen, which is called ER stress. Here, we examined whether TBT causes ER stress in human neuroblastoma SH-SY5Y cells. We found that 700nM TBT induced ER stress markers such as CHOP, GRP78, spliced XBP1 mRNA and phosphorylated eIF2α. TBT also decreased the cell viability both concentration- and time-dependently. Dibutyltin and monobutyltin did not induce ER stress markers. We hypothesized that TBT induces ER stress via Ca(2+) depletion, and to test this idea, we examined the effect of TBT on intracellular Ca(2+) concentration using fura-2 AM, a Ca(2+) fluorescent probe. TBT increased intracellular Ca(2+) concentration in a TBT-concentration-dependent manner, and Ca(2+) increase in 700nM TBT was mainly blocked by 50μM dantrolene, a ryanodine receptor antagonist (about 70% inhibition). Dantrolene also partially but significantly inhibited TBT-induced GRP78 expression and cell death. These results suggest that TBT increases intracellular Ca(2+) concentration by releasing Ca(2+) from ER, thereby causing ER stress. Copyright © 2013 Elsevier Inc. All rights reserved.

  5. Does TATA matter? A structural exploration of the selectivity determinants in its complexes with TATA box-binding protein.

    PubMed Central

    Pastor, N; Pardo, L; Weinstein, H

    1997-01-01

    The binding of the TATA box-binding protein (TBP) to a TATA sequence in DNA is essential for eukaryotic basal transcription. TBP binds in the minor groove of DNA, causing a large distortion of the DNA helix. Given the apparent stereochemical equivalence of AT and TA basepairs in the minor groove, DNA deformability must play a significant role in binding site selection, because not all AT-rich sequences are bound effectively by TBP. To gain insight into the precise role that the properties of the TATA sequence have in determining the specificity of the DNA substrates of TBP, the solution structure and dynamics of seven DNA dodecamers have been studied by using molecular dynamics simulations. The analysis of the structural properties of basepair steps in these TATA sequences suggests a reason for the preference for alternating pyrimidine-purine (YR) sequences, but indicates that these properties cannot be the sole determinant of the sequence specificity of TBP. Rather, recognition depends on the interplay between the inherent deformability of the DNA and steric complementarity at the molecular interface. Images FIGURE 2 PMID:9251783

  6. A DNA sequence obtained by replacement of the dopamine RNA aptamer bases is not an aptamer.

    PubMed

    Álvarez-Martos, Isabel; Ferapontova, Elena E

    2017-08-05

    A unique specificity of the aptamer-ligand biorecognition and binding facilitates bioanalysis and biosensor development, contributing to discrimination of structurally related molecules, such as dopamine and other catecholamine neurotransmitters. The aptamer sequence capable of specific binding of dopamine is a 57 nucleotides long RNA sequence reported in 1997 (Biochemistry, 1997, 36, 9726). Later, it was suggested that the DNA homologue of the RNA aptamer retains the specificity of dopamine binding (Biochem. Biophys. Res. Commun., 2009, 388, 732). Here, we show that the DNA sequence obtained by the replacement of the RNA aptamer bases for their DNA analogues is not able of specific biorecognition of dopamine, in contrast to the original RNA aptamer sequence. This DNA sequence binds dopamine and structurally related catecholamine neurotransmitters non-specifically, as any DNA sequence, and, thus, is not an aptamer and cannot be used neither for in vivo nor in situ analysis of dopamine in the presence of structurally related neurotransmitters. Copyright © 2017 Elsevier Inc. All rights reserved.

  7. Purification and sequencing of the active site tryptic peptide from penicillin-binding protein 1b of Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nicholas, R.A.; Suzuki, H.; Hirota, Y.

    This paper reports the sequence of the active site peptide of penicillin-binding protein 1b from Escherichia coli. Purified penicillin-binding protein 1b was labeled with (/sup 14/C)penicillin G, digested with trypsin, and partially purified by gel filtration. Upon further purification by high-pressure liquid chromatography, two radioactive peaks were observed, and the major peak, representing over 75% of the applied radioactivity, was submitted to amino acid analysis and sequencing. The sequence Ser-Ile-Gly-Ser-Leu-Ala-Lys was obtained. The active site nucleophile was identified by digesting the purified peptide with aminopeptidase M and separating the radioactive products on high-pressure liquid chromatography. Amino acid analysis confirmed thatmore » the serine residue in the middle of the sequence was covalently bonded to the (/sup 14/C)penicilloyl moiety. A comparison of this sequence to active site sequences of other penicillin-binding proteins and beta-lactamases is presented.« less

  8. Probing the electrostatics and pharmacologic modulation of sequence-specific binding by the DNA-binding domain of the ETS-family transcription factor PU.1: a binding affinity and kinetics investigation

    PubMed Central

    Munde, Manoj; Poon, Gregory M. K.; Wilson, W. David

    2013-01-01

    Members of the ETS family of transcription factors regulate a functionally diverse array of genes. All ETS proteins share a structurally-conserved but sequence-divergent DNA-binding domain, known as the ETS domain. Although the structure and thermodynamics of the ETS-DNA complexes are well known, little is known about the kinetics of sequence recognition, a facet that offers potential insight into its molecular mechanism. We have characterized DNA binding by the ETS domain of PU.1 by biosensor-surface plasmon resonance (SPR). SPR analysis revealed a striking kinetic profile for DNA binding by the PU.1 ETS domain. At low salt concentrations, it binds high-affinity cognate DNA with a very slow association rate constant (≤105 M−1 s−1), compensated by a correspondingly small dissociation rate constant. The kinetics are strongly salt-dependent but mutually balance to produce a relatively weak dependence in the equilibrium constant. This profile contrasts sharply with reported data for other ETS domains (e.g., Ets-1, TEL) for which high-affinity binding is driven by rapid association (>107 M−1 s−1). We interpret this difference in terms of the hydration properties of ETS-DNA binding and propose that at least two mechanisms of sequence recognition are employed by this family of DNA-binding domain. Additionally, we use SPR to demonstrate the potential for pharmacological inhibition of sequence-specific ETS-DNA binding, using the minor groove-binding distamycin as a model compound. Our work establishes SPR as a valuable technique for extending our understanding of the molecular mechanisms of ETS-DNA interactions as well as developing potential small-molecule agents for biotechnological and therapeutic purposes. PMID:23416556

  9. Sequence2Vec: a novel embedding approach for modeling transcription factor binding affinity landscape.

    PubMed

    Dai, Hanjun; Umarov, Ramzan; Kuwahara, Hiroyuki; Li, Yu; Song, Le; Gao, Xin

    2017-11-15

    An accurate characterization of transcription factor (TF)-DNA affinity landscape is crucial to a quantitative understanding of the molecular mechanisms underpinning endogenous gene regulation. While recent advances in biotechnology have brought the opportunity for building binding affinity prediction methods, the accurate characterization of TF-DNA binding affinity landscape still remains a challenging problem. Here we propose a novel sequence embedding approach for modeling the transcription factor binding affinity landscape. Our method represents DNA binding sequences as a hidden Markov model which captures both position specific information and long-range dependency in the sequence. A cornerstone of our method is a novel message passing-like embedding algorithm, called Sequence2Vec, which maps these hidden Markov models into a common nonlinear feature space and uses these embedded features to build a predictive model. Our method is a novel combination of the strength of probabilistic graphical models, feature space embedding and deep learning. We conducted comprehensive experiments on over 90 large-scale TF-DNA datasets which were measured by different high-throughput experimental technologies. Sequence2Vec outperforms alternative machine learning methods as well as the state-of-the-art binding affinity prediction methods. Our program is freely available at https://github.com/ramzan1990/sequence2vec. xin.gao@kaust.edu.sa or lsong@cc.gatech.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  10. Phosphorylation-dependent mineral-type specificity for apatite-binding peptide sequences.

    PubMed

    Addison, William N; Miller, Sharon J; Ramaswamy, Janani; Mansouri, Ahmad; Kohn, David H; McKee, Marc D

    2010-12-01

    Apatite-binding peptides discovered by phage display provide an alternative design method for creating functional biomaterials for bone and tooth tissue repair. A limitation of this approach is the absence of display peptide phosphorylation--a post-translational modification important to mineral-binding proteins. To refine the material specificity of a recently identified apatite-binding peptide, and to determine critical design parameters (net charge, charge distribution, amino acid sequence and composition) controlling peptide affinity for mineral, we investigated the effects of phosphorylation and sequence scrambling on peptide adsorption to four different apatites (bone-like mineral, and three types of apatite containing initially 0, 5.6 and 10.5% carbonate). Phosphorylation of the VTKHLNQISQSY peptide (VTK peptide) led to a 10-fold increase in peptide adsorption (compared to nonphosphorylated peptide) to bone-like mineral, and a 2-fold increase in adsorption to the carbonated apatite, but there was no effect of phosphorylation on peptide affinity to pure hydroxyapatite (without carbonate). Sequence scrambling of the nonphosphorylated VTK peptide enhanced its specificity for the bone-like mineral, but scrambled phosphorylated VTK peptide (pVTK) did not significantly alter mineral-binding suggesting that despite the importance of sequence order and/or charge distribution to mineral-binding, the enhanced binding after phosphorylation exceeds any further enhancement by altered sequence order. Osteoblast culture mineralization was dose-dependently inhibited by pVTK and to a significantly lesser extent by scrambled pVTK, while the nonphosphorylated and scrambled forms had no effect, indicating that inhibition of osteoblast mineralization is dependent on both peptide sequence and charge. Computational modeling of peptide-mineral interactions indicated a favorable change in binding energy upon phosphorylation that was unaffected by scrambling. In conclusion, phosphorylation of serine residues increases peptide specificity for bone-like mineral, whose adsorption is determined primarily by sequence composition and net charge as opposed to sequence order. However, sequence order in addition to net charge modulates the mineralization of osteoblast cultures. The ability of such peptides to inhibit mineralization has potential utility in the management of pathologic calcification. Copyright © 2010 Elsevier Ltd. All rights reserved.

  11. A conserved mechanism for replication origin recognition and binding in archaea.

    PubMed

    Majerník, Alan I; Chong, James P J

    2008-01-15

    To date, methanogens are the only group within the archaea where firing DNA replication origins have not been demonstrated in vivo. In the present study we show that a previously identified cluster of ORB (origin recognition box) sequences do indeed function as an origin of replication in vivo in the archaeon Methanothermobacter thermautotrophicus. Although the consensus sequence of ORBs in M. thermautotrophicus is somewhat conserved when compared with ORB sequences in other archaea, the Cdc6-1 protein from M. thermautotrophicus (termed MthCdc6-1) displays sequence-specific binding that is selective for the MthORB sequence and does not recognize ORBs from other archaeal species. Stabilization of in vitro MthORB DNA binding by MthCdc6-1 requires additional conserved sequences 3' to those originally described for M. thermautotrophicus. By testing synthetic sequences bearing mutations in the MthORB consensus sequence, we show that Cdc6/ORB binding is critically dependent on the presence of an invariant guanine found in all archaeal ORB sequences. Mutation of a universally conserved arginine residue in the recognition helix of the winged helix domain of archaeal Cdc6-1 shows that specific origin sequence recognition is dependent on the interaction of this arginine residue with the invariant guanine. Recognition of a mutated origin sequence can be achieved by mutation of the conserved arginine residue to a lysine or glutamine residue. Thus despite a number of differences in protein and DNA sequences between species, the mechanism of origin recognition and binding appears to be conserved throughout the archaea.

  12. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

    PubMed Central

    Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

    1989-01-01

    The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

  13. Proliferating cell nuclear antigen (Pcna) as a direct downstream target gene of Hoxc8

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Min, Hyehyun; Lee, Ji-Yeon; Bok, Jinwoong

    2010-02-19

    Hoxc8 is a member of Hox family transcription factors that play crucial roles in spatiotemporal body patterning during embryogenesis. Hox proteins contain a conserved 61 amino acid homeodomain, which is responsible for recognition and binding of the proteins onto Hox-specific DNA binding motifs and regulates expression of their target genes. Previously, using proteome analysis, we identified Proliferating cell nuclear antigen (Pcna) as one of the putative target genes of Hoxc8. Here, we asked whether Hoxc8 regulates Pcna expression by directly binding to the regulatory sequence of Pcna. In mouse embryos at embryonic day 11.5, the expression pattern of Pcna wasmore » similar to that of Hoxc8 along the anteroposterior body axis. Moreover, Pcna transcript levels as well as cell proliferation rate were increased by overexpression of Hoxc8 in C3H10T1/2 mouse embryonic fibroblast cells. Characterization of 2.3 kb genomic sequence upstream of Pcna coding region revealed that the upstream sequence contains several Hox core binding sequences and one Hox-Pbx binding sequence. Direct binding of Hoxc8 proteins to the Pcna regulatory sequence was verified by chromatin immunoprecipitation assay. Taken together, our data suggest that Pcna is a direct downstream target of Hoxc8.« less

  14. The FOXP2 forkhead domain binds to a variety of DNA sequences with different rates and affinities.

    PubMed

    Webb, Helen; Steeb, Olga; Blane, Ashleigh; Rotherham, Lia; Aron, Shaun; Machanick, Philip; Dirr, Heini; Fanucchi, Sylvia

    2017-07-01

    FOXP2 is a member of the P subfamily of FOX transcription factors, the DNA-binding domain of which is the winged helix forkhead domain (FHD). In this work we show that the FOXP2 FHD is able to bind to various DNA sequences, including a novel sequence identified in this work, with different affinities and rates as detected using surface plasmon resonance. Combining the experimental work with molecular docking, we show that high-affinity sequences remain bound to the protein for longer, form a greater number of interactions with the protein and induce a greater structural change in the protein than low-affinity sequences. We propose a binding model for the FOXP2 FHD that involves three types of binding sequence: low affinity sites which allow for rapid scanning of the genome by the protein in a partially unstructured state; moderate affinity sites which serve to locate the protein near target sites and high-affinity sites which secure the protein to the DNA and induce a conformational change necessary for functional binding and the possible initiation of downstream transcriptional events. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  15. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  16. Characterisation of a DNA sequence element that directs Dictyostelium stalk cell-specific gene expression.

    PubMed

    Ceccarelli, A; Zhukovskaya, N; Kawata, T; Bozzaro, S; Williams, J

    2000-12-01

    The ecmB gene of Dictyostelium is expressed at culmination both in the prestalk cells that enter the stalk tube and in ancillary stalk cell structures such as the basal disc. Stalk tube-specific expression is regulated by sequence elements within the cap-site proximal part of the promoter, the stalk tube (ST) promoter region. Dd-STATa, a member of the STAT transcription factor family, binds to elements present in the ST promoter-region and represses transcription prior to entry into the stalk tube. We have characterised an activatory DNA sequence element, that lies distal to the repressor elements and that is both necessary and sufficient for expression within the stalk tube. We have mapped this activator to a 28 nucleotide region (the 28-mer) within which we have identified a GA-containing sequence element that is required for efficient gene transcription. The Dd-STATa protein binds to the 28-mer in an in vitro binding assay, and binding is dependent upon the GA-containing sequence. However, the ecmB gene is expressed in a Dd-STATa null mutant, therefore Dd-STATa cannot be responsible for activating the 28-mer in vivo. Instead, we identified a distinct 28-mer binding activity in nuclear extracts from the Dd-STATa null mutant, the activity of this GA binding activity being largely masked in wild type extracts by the high affinity binding of the Dd-STATa protein. We suggest, that in addition to the long range repression exerted by binding to the two known repressor sites, Dd-STATa inhibits transcription by direct competition with this putative activator for binding to the GA sequence.

  17. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene, and assayedmore » embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Measuring conservation of sequence features closely linked to function--such as binding-site clustering--makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  18. Dimeric PROP1 binding to diverse palindromic TAAT sequences promotes its transcriptional activity.

    PubMed

    Nakayama, Michie; Kato, Takako; Susa, Takao; Sano, Akiko; Kitahara, Kousuke; Kato, Yukio

    2009-08-13

    Mutations in the Prop1 gene are responsible for murine Ames dwarfism and human combined pituitary hormone deficiency with hypogonadism. Recently, we reported that PROP1 is a possible transcription factor for gonadotropin subunit genes through plural cis-acting sites composed of AT-rich sequences containing a TAAT motif which differs from its consensus binding sequence known as PRDQ9 (TAATTGAATTA). This study aimed to verify the binding specificity and sequence of PROP1 by applying the method of SELEX (Systematic Evolution of Ligands by EXponential enrichment), EMSA (electrophoretic mobility shift assay) and transient transfection assay. SELEX, after 5, 7 and 9 generations of selection using a random sequence library, showed that nucleotides containing one or two TAAT motifs were accumulated and accounted for 98.5% at the 9th generation. Aligned sequences and EMSA demonstrated that PROP1 binds preferentially to 11 nucleotides composed of an inverted TAAT motif separated by 3 nucleotides with variation in the half site of palindromic TAAT motifs and with preferential requirement of T at the nucleotide number 5 immediately 3' to a TAAT motif. Transient transfection assay demonstrated first that dimeric binding of PROP1 to an inverted TAAT motif and its cognates resulted in transcriptional activation, whereas monomeric binding of PROP1 to a single TAAT motif and an inverted ATTA motif did not mediate activation. Thus, this study demonstrated that dimeric binding of PROP1 is able to recognize diverse palindromic TAAT sequences separated by 3 nucleotides and to exhibit its transcriptional activity.

  19. The structural basis of actinomycin D–binding induces nucleotide flipping out, a sharp bend and a left-handed twist in CGG triplet repeats

    PubMed Central

    Lo, Yu-Sheng; Tseng, Wen-Hsuan; Chuang, Chien-Ying; Hou, Ming-Hon

    2013-01-01

    The potent anticancer drug actinomycin D (ActD) functions by intercalating into DNA at GpC sites, thereby interrupting essential biological processes including replication and transcription. Certain neurological diseases are correlated with the expansion of (CGG)n trinucleotide sequences, which contain many contiguous GpC sites separated by a single G:G mispair. To characterize the binding of ActD to CGG triplet repeat sequences, the structural basis for the strong binding of ActD to neighbouring GpC sites flanking a G:G mismatch has been determined based on the crystal structure of ActD bound to ATGCGGCAT, which contains a CGG triplet sequence. The binding of ActD molecules to GCGGC causes many unexpected conformational changes including nucleotide flipping out, a sharp bend and a left-handed twist in the DNA helix via a two site-binding model. Heat denaturation, circular dichroism and surface plasmon resonance analyses showed that adjacent GpC sequences flanking a G:G mismatch are preferred ActD-binding sites. In addition, ActD was shown to bind the hairpin conformation of (CGG)16 in a pairwise combination and with greater stability than that of other DNA intercalators. Our results provide evidence of a possible biological consequence of ActD binding to CGG triplet repeat sequences. PMID:23408860

  20. CENP-B binds a novel centromeric sequence in the Asian mouse Mus caroli.

    PubMed Central

    Kipling, D; Mitchell, A R; Masumoto, H; Wilson, H E; Nicol, L; Cooke, H J

    1995-01-01

    Minor satellite DNA, found at Mus musculus centromeres, is not present in the genome of the Asian mouse Mus caroli. This repetitive sequence family is speculated to have a role in centromere function by providing an array of binding sites for the centromere-associated protein CENP-B. The apparent absence of CENP-B binding sites in the M. caroli genome poses a major challenge to this hypothesis. Here we describe two abundant satellite DNA sequences present at M. caroli centromeres. These satellites are organized as tandem repeat arrays, over 1 Mb in size, of either 60- or 79-bp monomers. All autosomes carry both satellites and small amounts of a sequence related to the M. musculus major satellite. The Y chromosome contains small amounts of both major satellite and the 60-bp satellite, whereas the X chromosome carries only major satellite sequences. M. caroli chromosomes segregate in M. caroli x M. musculus interspecific hybrid cell lines, indicating that the two sets of chromosomes can interact with the same mitotic spindle. Using a polyclonal CENP-B antiserum, we demonstrate that M. caroli centromeres can bind murine CENP-B in such an interspecific cell line, despite the absence of canonical 17-bp CENP-B binding sites in the M. caroli genome. Sequence analysis of the 79-bp M. caroli satellite reveals a 17-bp motif that contains all nine bases previously shown to be necessary for in vitro binding of CENP-B. This M. caroli motif binds CENP-B from HeLa cell nuclear extract in vitro, as indicated by gel mobility shift analysis. We therefore suggest that this motif also causes CENP-B to associate with M. caroli centromeres in vivo. Despite the sequence differences, M. caroli presents a third, novel mammalian centromeric sequence producing an array of binding sites for CENP-B. PMID:7623797

  1. A statistical model for investigating binding probabilities of DNA nucleotide sequences using microarrays.

    PubMed

    Lee, Mei-Ling Ting; Bulyk, Martha L; Whitmore, G A; Church, George M

    2002-12-01

    There is considerable scientific interest in knowing the probability that a site-specific transcription factor will bind to a given DNA sequence. Microarray methods provide an effective means for assessing the binding affinities of a large number of DNA sequences as demonstrated by Bulyk et al. (2001, Proceedings of the National Academy of Sciences, USA 98, 7158-7163) in their study of the DNA-binding specificities of Zif268 zinc fingers using microarray technology. In a follow-up investigation, Bulyk, Johnson, and Church (2002, Nucleic Acid Research 30, 1255-1261) studied the interdependence of nucleotides on the binding affinities of transcription proteins. Our article is motivated by this pair of studies. We present a general statistical methodology for analyzing microarray intensity measurements reflecting DNA-protein interactions. The log probability of a protein binding to a DNA sequence on an array is modeled using a linear ANOVA model. This model is convenient because it employs familiar statistical concepts and procedures and also because it is effective for investigating the probability structure of the binding mechanism.

  2. Sequestration of cAMP response element-binding proteins by transcription factor decoys causes collateral elaboration of regenerating Aplysia motor neuron axons.

    PubMed

    Dash, P K; Tian, L M; Moore, A N

    1998-07-07

    Axonal injury increases intracellular Ca2+ and cAMP and has been shown to induce gene expression, which is thought to be a key event for regeneration. Increases in intracellular Ca2+ and/or cAMP can alter gene expression via activation of a family of transcription factors that bind to and modulate the expression of CRE (Ca2+/cAMP response element) sequence-containing genes. We have used Aplysia motor neurons to examine the role of CRE-binding proteins in axonal regeneration after injury. We report that axonal injury increases the binding of proteins to a CRE sequence-containing probe. In addition, Western blot analysis revealed that the level of ApCREB2, a CRE sequence-binding repressor, was enhanced as a result of axonal injury. The sequestration of CRE-binding proteins by microinjection of CRE sequence-containing plasmids enhanced axon collateral formation (both number and length) as compared with control plasmid injections. These findings show that Ca2+/cAMP-mediated gene expression via CRE-binding transcription factors participates in the regeneration of motor neuron axons.

  3. DNA sequence+shape kernel enables alignment-free modeling of transcription factor binding.

    PubMed

    Ma, Wenxiu; Yang, Lin; Rohs, Remo; Noble, William Stafford

    2017-10-01

    Transcription factors (TFs) bind to specific DNA sequence motifs. Several lines of evidence suggest that TF-DNA binding is mediated in part by properties of the local DNA shape: the width of the minor groove, the relative orientations of adjacent base pairs, etc. Several methods have been developed to jointly account for DNA sequence and shape properties in predicting TF binding affinity. However, a limitation of these methods is that they typically require a training set of aligned TF binding sites. We describe a sequence + shape kernel that leverages DNA sequence and shape information to better understand protein-DNA binding preference and affinity. This kernel extends an existing class of k-mer based sequence kernels, based on the recently described di-mismatch kernel. Using three in vitro benchmark datasets, derived from universal protein binding microarrays (uPBMs), genomic context PBMs (gcPBMs) and SELEX-seq data, we demonstrate that incorporating DNA shape information improves our ability to predict protein-DNA binding affinity. In particular, we observe that (i) the k-spectrum + shape model performs better than the classical k-spectrum kernel, particularly for small k values; (ii) the di-mismatch kernel performs better than the k-mer kernel, for larger k; and (iii) the di-mismatch + shape kernel performs better than the di-mismatch kernel for intermediate k values. The software is available at https://bitbucket.org/wenxiu/sequence-shape.git. rohs@usc.edu or william-noble@uw.edu. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.

  4. In vitro selection using a dual RNA library that allows primerless selection

    PubMed Central

    Jarosch, Florian; Buchner, Klaus; Klussmann, Sven

    2006-01-01

    High affinity target-binding aptamers are identified from random oligonucleotide libraries by an in vitro selection process called Systematic Evolution of Ligands by EXponential enrichment (SELEX). Since the SELEX process includes a PCR amplification step the randomized region of the oligonucleotide libraries need to be flanked by two fixed primer binding sequences. These primer binding sites are often difficult to truncate because they may be necessary to maintain the structure of the aptamer or may even be part of the target binding motif. We designed a novel type of RNA library that carries fixed sequences which constrain the oligonucleotides into a partly double-stranded structure, thereby minimizing the risk that the primer binding sequences become part of the target-binding motif. Moreover, the specific design of the library including the use of tandem RNA Polymerase promoters allows the selection of oligonucleotides without any primer binding sequences. The library was used to select aptamers to the mirror-image peptide of ghrelin. Ghrelin is a potent stimulator of growth-hormone release and food intake. After selection, the identified aptamer sequences were directly synthesized in their mirror-image configuration. The final 44 nt-Spiegelmer, named NOX-B11-3, blocks ghrelin action in a cell culture assay displaying an IC50 of 4.5 nM at 37°C. PMID:16855281

  5. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-08-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded.

  6. Specific DNA binding of the two chicken Deformed family homeodomain proteins, Chox-1.4 and Chox-a.

    PubMed Central

    Sasaki, H; Yokoyama, E; Kuroiwa, A

    1990-01-01

    The cDNA clones encoding two chicken Deformed (Dfd) family homeobox containing genes Chox-1.4 and Chox-a were isolated. Comparison of their amino acid sequences with another chicken Dfd family homeodomain protein and with those of mouse homologues revealed that strong homologies are located in the amino terminal regions and around the homeodomains. Although homologies in other regions were relatively low, some short conserved sequences were also identified. E. coli-made full length proteins were purified and used for the production of specific antibodies and for DNA binding studies. The binding profiles of these proteins to the 5'-leader and 5'-upstream sequences of Chox-1.4 and Chox-a coding regions were analyzed by immunoprecipitation and DNase I footprint assays. These two Chox proteins bound to the same sites in the 5'-flanking sequences of their coding regions with various affinities and their binding affinities to each site were nearly the same. The consensus sequences of the high and low affinity binding sites were TAATGA(C/G) and CTAATTTT, respectively. A clustered binding site was identified in the 5'-upstream of the Chox-a gene, suggesting that this clustered binding site works as a cis-regulatory element for auto- and/or cross-regulation of Chox-a gene expression. Images PMID:1970866

  7. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens

    PubMed Central

    Naz, Sadia; Ngo, Tony; Farooq, Umar

    2017-01-01

    Background The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis. The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Methods Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli, two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. Results High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis. Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Discussion Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner. PMID:28948099

  8. Analysis of drug binding pockets and repurposing opportunities for twelve essential enzymes of ESKAPE pathogens.

    PubMed

    Naz, Sadia; Ngo, Tony; Farooq, Umar; Abagyan, Ruben

    2017-01-01

    The rapid increase in antibiotic resistance by various bacterial pathogens underlies the significance of developing new therapies and exploring different drug targets. A fraction of bacterial pathogens abbreviated as ESKAPE by the European Center for Disease Prevention and Control have been considered a major threat due to the rise in nosocomial infections. Here, we compared putative drug binding pockets of twelve essential and mostly conserved metabolic enzymes in numerous bacterial pathogens including those of the ESKAPE group and Mycobacterium tuberculosis . The comparative analysis will provide guidelines for the likelihood of transferability of the inhibitors from one species to another. Nine bacterial species including six ESKAPE pathogens, Mycobacterium tuberculosis along with Mycobacterium smegmatis and Eschershia coli , two non-pathogenic bacteria, have been selected for drug binding pocket analysis of twelve essential enzymes. The amino acid sequences were obtained from Uniprot, aligned using ICM v3.8-4a and matched against the Pocketome encyclopedia. We used known co-crystal structures of selected target enzyme orthologs to evaluate the location of their active sites and binding pockets and to calculate a matrix of pairwise sequence identities across each target enzyme across the different species. This was used to generate sequence maps. High sequence identity of enzyme binding pockets, derived from experimentally determined co-crystallized structures, was observed among various species. Comparison at both full sequence level and for drug binding pockets of key metabolic enzymes showed that binding pockets are highly conserved (sequence similarity up to 100%) among various ESKAPE pathogens as well as Mycobacterium tuberculosis . Enzymes orthologs having conserved binding sites may have potential to interact with inhibitors in similar way and might be helpful for design of similar class of inhibitors for a particular species. The derived pocket alignments and distance-based maps provide guidelines for drug discovery and repurposing. In addition they also provide recommendations for the relevant model bacteria that may be used for initial drug testing. Comparing ligand binding sites through sequence identity calculation could be an effective approach to identify conserved orthologs as drug binding pockets have shown higher level of conservation among various species. By using this approach we could avoid the problems associated with full sequence comparison. We identified essential metabolic enzymes among ESKAPE pathogens that share high sequence identity in their putative drug binding pockets (up to 100%), of which known inhibitors can potentially antagonize these identical pockets in the various species in a similar manner.

  9. Patterns and plasticity in RNA-protein interactions enable recruitment of multiple proteins through a single site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Valley, Cary T.; Porter, Douglas F.; Qiu, Chen

    2012-06-28

    mRNA control hinges on the specificity and affinity of proteins for their RNA binding sites. Regulatory proteins must bind their own sites and reject even closely related noncognate sites. In the PUF [Pumilio and fem-3 binding factor (FBF)] family of RNA binding proteins, individual proteins discriminate differences in the length and sequence of binding sites, allowing each PUF to bind a distinct battery of mRNAs. Here, we show that despite these differences, the pattern of RNA interactions is conserved among PUF proteins: the two ends of the PUF protein make critical contacts with the two ends of the RNA sites.more » Despite this conserved 'two-handed' pattern of recognition, the RNA sequence is flexible. Among the binding sites of yeast Puf4p, RNA sequence dictates the pattern in which RNA bases are flipped away from the binding surface of the protein. Small differences in RNA sequence allow new modes of control, recruiting Puf5p in addition to Puf4p to a single site. This embedded information adds a new layer of biological meaning to the connections between RNA targets and PUF proteins.« less

  10. Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies.

    PubMed

    Rickert, Keith W; Grinberg, Luba; Woods, Robert M; Wilson, Susan; Bowen, Michael A; Baca, Manuel

    2016-01-01

    The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3-5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material.

  11. Combining phage display with de novo protein sequencing for reverse engineering of monoclonal antibodies

    PubMed Central

    Rickert, Keith W.; Grinberg, Luba; Woods, Robert M.; Wilson, Susan; Bowen, Michael A.; Baca, Manuel

    2016-01-01

    ABSTRACT The enormous diversity created by gene recombination and somatic hypermutation makes de novo protein sequencing of monoclonal antibodies a uniquely challenging problem. Modern mass spectrometry-based sequencing will rarely, if ever, provide a single unambiguous sequence for the variable domains. A more likely outcome is computation of an ensemble of highly similar sequences that can satisfy the experimental data. This outcome can result in the need for empirical testing of many candidate sequences, sometimes iteratively, to identity one which can replicate the activity of the parental antibody. Here we describe an improved approach to antibody protein sequencing by using phage display technology to generate a combinatorial library of sequences that satisfy the mass spectrometry data, and selecting for functional candidates that bind antigen. This approach was used to reverse engineer 2 commercially-obtained monoclonal antibodies against murine CD137. Proteomic data enabled us to assign the majority of the variable domain sequences, with the exception of 3–5% of the sequence located within or adjacent to complementarity-determining regions. To efficiently resolve the sequence in these regions, small phage-displayed libraries were generated and subjected to antigen binding selection. Following enrichment of antigen-binding clones, 2 clones were selected for each antibody and recombinantly expressed as antigen-binding fragments (Fabs). In both cases, the reverse-engineered Fabs exhibited identical antigen binding affinity, within error, as Fabs produced from the commercial IgGs. This combination of proteomic and protein engineering techniques provides a useful approach to simplifying the technically challenging process of reverse engineering monoclonal antibodies from protein material. PMID:26852694

  12. MutaBind estimates and interprets the effects of sequence variants on protein-protein interactions.

    PubMed

    Li, Minghui; Simonetti, Franco L; Goncearenco, Alexander; Panchenko, Anna R

    2016-07-08

    Proteins engage in highly selective interactions with their macromolecular partners. Sequence variants that alter protein binding affinity may cause significant perturbations or complete abolishment of function, potentially leading to diseases. There exists a persistent need to develop a mechanistic understanding of impacts of variants on proteins. To address this need we introduce a new computational method MutaBind to evaluate the effects of sequence variants and disease mutations on protein interactions and calculate the quantitative changes in binding affinity. The MutaBind method uses molecular mechanics force fields, statistical potentials and fast side-chain optimization algorithms. The MutaBind server maps mutations on a structural protein complex, calculates the associated changes in binding affinity, determines the deleterious effect of a mutation, estimates the confidence of this prediction and produces a mutant structural model for download. MutaBind can be applied to a large number of problems, including determination of potential driver mutations in cancer and other diseases, elucidation of the effects of sequence variants on protein fitness in evolution and protein design. MutaBind is available at http://www.ncbi.nlm.nih.gov/projects/mutabind/. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  13. HMG-D is an architecture-specific protein that preferentially binds to DNA containing the dinucleotide TG.

    PubMed Central

    Churchill, M E; Jones, D N; Glaser, T; Hefner, H; Searles, M A; Travers, A A

    1995-01-01

    The high mobility group (HMG) protein HMG-D from Drosophila melanogaster is a highly abundant chromosomal protein that is closely related to the vertebrate HMG domain proteins HMG1 and HMG2. In general, chromosomal HMG domain proteins lack sequence specificity. However, using both NMR spectroscopy and standard biochemical techniques we show that binding of HMG-D to a single DNA site is sequence selective. The preferred duplex DNA binding site comprises at least 5 bp and contains the deformable dinucleotide TG embedded in A/T-rich sequences. The TG motif constitutes a common core element in the binding sites of the well-characterized sequence-specific HMG domain proteins. We show that a conserved aromatic residue in helix 1 of the HMG domain may be involved in recognition of this core sequence. In common with other HMG domain proteins HMG-D binds preferentially to DNA sites that are stably bent and underwound, therefore HMG-D can be considered an architecture-specific protein. Finally, we show that HMG-D bends DNA and may confer a superhelical DNA conformation at a natural DNA binding site in the Drosophila fushi tarazu scaffold-associated region. Images PMID:7720717

  14. Identification of high-specificity H-NS binding site in LEE5 promoter of enteropathogenic Esherichia coli (EPEC).

    PubMed

    Bhat, Abhay Prasad; Shin, Minsang; Choy, Hyon E

    2014-07-01

    Histone-like nucleoid structuring protein (H-NS) is a small but abundant protein present in enteric bacteria and is involved in compaction of the DNA and regulation of the transcription. Recent reports have suggested that H-NS binds to a specific AT rich DNA sequence than to intrinsically curved DNA in sequence independent manner. We detected two high-specificity H-NS binding sites in LEE5 promoter of EPEC centered at -110 and -138, which were close to the proposed consensus H-NS binding motif. To identify H-NS binding sequence in LEE5 promoter, we took a random mutagenesis approach and found the mutations at around -138 were specifically defective in the regulation by H-NS. It was concluded that H-NS exerts maximum repression via the specific sequence at around -138 and subsequently contacts a subunit of RNAP through oligomerization.

  15. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-01-01

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

  16. Fibronectin tetrapeptide is target for syphilis spirochete cytadherence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thomas, D.D.; Baseman, J.B.; Alderete, J.F.

    1985-11-01

    The syphilis bacterium, Treponema pallidum, parasitizes host cells through recognition of fibronectin (Fn) on cell surfaces. The active site of the Fn molecule has been identified as a four-amino acid sequence, arg-gly-asp-ser (RGDS), located on each monomer of the cell-binding domain. The synthetic heptapeptide gly-arg-gly-asp-ser-pro-cys (GRGDSPC), with the active site sequence RGDS, specifically competed with SVI-labeled cell-binding domain acquisition by T. pallidum. Additionally, the same heptapeptide with the RGDS sequence diminished treponemal attachment to HEp-2 and HT1080 cell monolayers. Related heptapeptides altered in one key amino acid within the RGDS sequence failed to inhibit Fn cell-binding domain acquisition or parasitismmore » of host cells by T. pallidum. The data support the view that T. pallidum cytadherence of host cells is through recognition of the RGDS sequence also important for eukaryotic cell-Fn binding.« less

  17. Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation.

    PubMed

    Schneider, T D

    2001-12-01

    The sequence logo for DNA binding sites of the bacteriophage P1 replication protein RepA shows unusually high sequence conservation ( approximately 2 bits) at a minor groove that faces RepA. However, B-form DNA can support only 1 bit of sequence conservation via contacts into the minor groove. The high conservation in RepA sites therefore implies a distorted DNA helix with direct or indirect contacts to the protein. Here I show that a high minor groove conservation signature also appears in sequence logos of sites for other replication origin binding proteins (Rts1, DnaA, P4 alpha, EBNA1, ORC) and promoter binding proteins (sigma(70), sigma(D) factors). This finding implies that DNA binding proteins generally use non-B-form DNA distortion such as base flipping to initiate replication and transcription.

  18. Computational identification of developmental enhancers:conservation and function of transcription factor binding-site clustersin drosophila melanogaster and drosophila psedoobscura

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Berman, Benjamin P.; Pfeiffer, Barret D.; Laverty, Todd R.

    2004-08-06

    Background The identification of sequences that control transcription in metazoans is a major goal of genome analysis. In a previous study, we demonstrated that searching for clusters of predicted transcription factor binding sites could discover active regulatory sequences, and identified 37 regions of the Drosophila melanogaster genome with high densities of predicted binding sites for five transcription factors involved in anterior-posterior embryonic patterning. Nine of these clusters overlapped known enhancers. Here, we report the results of in vivo functional analysis of 27 remaining clusters. Results We generated transgenic flies carrying each cluster attached to a basal promoter and reporter gene,more » and assayed embryos for reporter gene expression. Six clusters are enhancers of adjacent genes: giant, fushi tarazu, odd-skipped, nubbin, squeeze and pdm2; three drive expression in patterns unrelated to those of neighboring genes; the remaining 18 do not appear to have enhancer activity. We used the Drosophila pseudoobscura genome to compare patterns of evolution in and around the 15 positive and 18 false-positive predictions. Although conservation of primary sequence cannot distinguish true from false positives, conservation of binding-site clustering accurately discriminates functional binding-site clusters from those with no function. We incorporated conservation of binding-site clustering into a new genome-wide enhancer screen, and predict several hundred new regulatory sequences, including 85 adjacent to genes with embryonic patterns. Conclusions Measuring conservation of sequence features closely linked to function - such as binding-site clustering - makes better use of comparative sequence data than commonly used methods that examine only sequence identity.« less

  19. Divalent Metal-Ion Complexes with Dipeptide Ligands Having Phe and His Side-Chain Anchors: Effects of Sequence, Metal Ion, and Anchor.

    PubMed

    Dunbar, Robert C; Berden, Giel; Martens, Jonathan K; Oomens, Jos

    2015-09-24

    Conformational preferences have been surveyed for divalent metal cation complexes with the dipeptide ligands AlaPhe, PheAla, GlyHis, and HisGly. Density functional theory results for a full set of complexes are presented, and previous experimental infrared spectra, supplemented by a number of newly recorded spectra obtained with infrared multiple photon dissociation spectroscopy, provide experimental verification of the preferred conformations in most cases. The overall structural features of these complexes are shown, and attention is given to comparisons involving peptide sequence, nature of the metal ion, and nature of the side-chain anchor. A regular progression is observed as a function of binding strength, whereby the weakly binding metal ions (Ba(2+) to Ca(2+)) transition from carboxylate zwitterion (ZW) binding to charge-solvated (CS) binding, while the stronger binding metal ions (Ca(2+) to Mg(2+) to Ni(2+)) transition from CS binding to metal-ion-backbone binding (Iminol) by direct metal-nitrogen bonds to the deprotonated amide nitrogens. Two new sequence-dependent reversals are found between ZW and CS binding modes, such that Ba(2+) and Ca(2+) prefer ZW binding in the GlyHis case but prefer CS binding in the HisGly case. The overall binding strength for a given metal ion is not strongly dependent on the sequence, but the histidine peptides are significantly more strongly bound (by 50-100 kJ mol(-1)) than the phenylalanine peptides.

  20. Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

    PubMed Central

    Zhao, A; Guo, A; Liu, Z; Pape, L

    1997-01-01

    The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

  1. Characterization of protein--DNA interactions using surface plasmon resonance spectroscopy with various assay schemes.

    PubMed

    Teh, Huey Fang; Peh, Wendy Y X; Su, Xiaodi; Thomsen, Jane S

    2007-02-27

    Specific protein-DNA interactions play a central role in transcription and other biological processes. A comprehensive characterization of protein-DNA interactions should include information about binding affinity, kinetics, sequence specificity, and binding stoichiometry. In this study, we have used surface plasmon resonance spectroscopy (SPR) to study the interactions between human estrogen receptors (ER, alpha and beta subtypes) and estrogen response elements (ERE), with four assay schemes. First, we determined the sequence-dependent receptors' binding capacity by monitoring the binding of ER to various ERE sequences immobilized on a sensor surface (assay format denoted as the direct assay). Second, we screened the relative affinity of ER for various ERE sequences using a competition assay, in which the receptors bind to an ERE-immobilized surface in the presence of competitor ERE sequences. Third, we monitored the assembly of ER-ERE complexes on a SPR surface and thereafter the removal and/or dissociation of the ER (assay scheme denoted as the dissociation assay) to determine the binding stoichiometry. Last, a sandwich assay (ER binding to ERE followed by anti-ER recognition of a specific ER subtype) was performed in an effort to understand how ERalpha and ERbeta may associate and compete when binding to the DNA. With these assay schemes, we reaffirmed that (1) ERalpha is more sensitive than ERbeta to base pair change(s) in the consensus ERE, (2) ERalpha and ERbeta form a heterodimer when they bind to the consensus ERE, and (3) the binding stoichiometry of both ERalpha- and ERbeta-ERE complexes is dependent on salt concentration. With this study, we demonstrate the versatility of the SPR analysis. With the involvement of various assay arrangements, the SPR analysis can be further extended to more than kinetics and affinity study.

  2. TIA-1 RRM23 binding and recognition of target oligonucleotides

    PubMed Central

    Waris, Saboora; García-Mauriño, Sofía M.; Sivakumaran, Andrew; Beckham, Simone A.; Loughlin, Fionna E.; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C.J.

    2017-01-01

    Abstract TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. PMID:28184449

  3. TIA-1 RRM23 binding and recognition of target oligonucleotides.

    PubMed

    Waris, Saboora; García-Mauriño, Sofía M; Sivakumaran, Andrew; Beckham, Simone A; Loughlin, Fionna E; Gorospe, Myriam; Díaz-Moreno, Irene; Wilce, Matthew C J; Wilce, Jacqueline A

    2017-05-05

    TIA-1 (T-cell restricted intracellular antigen-1) is an RNA-binding protein involved in splicing and translational repression. It mainly interacts with RNA via its second and third RNA recognition motifs (RRMs), with specificity for U-rich sequences directed by RRM2. It has recently been shown that RRM3 also contributes to binding, with preferential binding for C-rich sequences. Here we designed UC-rich and CU-rich 10-nt sequences for engagement of both RRM2 and RRM3 and demonstrated that the TIA-1 RRM23 construct preferentially binds the UC-rich RNA ligand (5΄-UUUUUACUCC-3΄). Interestingly, this binding depends on the presence of Lys274 that is C-terminal to RRM3 and binding to equivalent DNA sequences occurs with similar affinity. Small-angle X-ray scattering was used to demonstrate that, upon complex formation with target RNA or DNA, TIA-1 RRM23 adopts a compact structure, showing that both RRMs engage with the target 10-nt sequences to form the complex. We also report the crystal structure of TIA-1 RRM2 in complex with DNA to 2.3 Å resolution providing the first atomic resolution structure of any TIA protein RRM in complex with oligonucleotide. Together our data support a specific mode of TIA-1 RRM23 interaction with target oligonucleotides consistent with the role of TIA-1 in binding RNA to regulate gene expression. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  4. Fold independent structural comparisons of protein-ligand binding sites for exploring functional relationships.

    PubMed

    Gold, Nicola D; Jackson, Richard M

    2006-02-03

    The rapid growth in protein structural data and the emergence of structural genomics projects have increased the need for automatic structure analysis and tools for function prediction. Small molecule recognition is critical to the function of many proteins; therefore, determination of ligand binding site similarity is important for understanding ligand interactions and may allow their functional classification. Here, we present a binding sites database (SitesBase) that given a known protein-ligand binding site allows rapid retrieval of other binding sites with similar structure independent of overall sequence or fold similarity. However, each match is also annotated with sequence similarity and fold information to aid interpretation of structure and functional similarity. Similarity in ligand binding sites can indicate common binding modes and recognition of similar molecules, allowing potential inference of function for an uncharacterised protein or providing additional evidence of common function where sequence or fold similarity is already known. Alternatively, the resource can provide valuable information for detailed studies of molecular recognition including structure-based ligand design and in understanding ligand cross-reactivity. Here, we show examples of atomic similarity between superfamily or more distant fold relatives as well as between seemingly unrelated proteins. Assignment of unclassified proteins to structural superfamiles is also undertaken and in most cases substantiates assignments made using sequence similarity. Correct assignment is also possible where sequence similarity fails to find significant matches, illustrating the potential use of binding site comparisons for newly determined proteins.

  5. A TATA binding protein mutant with increased affinity for DNA directs transcription from a reversed TATA sequence in vivo.

    PubMed

    Spencer, J Vaughn; Arndt, Karen M

    2002-12-01

    The TATA-binding protein (TBP) nucleates the assembly and determines the position of the preinitiation complex at RNA polymerase II-transcribed genes. We investigated the importance of two conserved residues on the DNA binding surface of Saccharomyces cerevisiae TBP to DNA binding and sequence discrimination. Because they define a significant break in the twofold symmetry of the TBP-TATA interface, Ala100 and Pro191 have been proposed to be key determinants of TBP binding orientation and transcription directionality. In contrast to previous predictions, we found that substitution of an alanine for Pro191 did not allow recognition of a reversed TATA box in vivo; however, the reciprocal change, Ala100 to proline, resulted in efficient utilization of this and other variant TATA sequences. In vitro assays demonstrated that TBP mutants with the A100P and P191A substitutions have increased and decreased affinity for DNA, respectively. The TATA binding defect of TBP with the P191A mutation could be intragenically suppressed by the A100P substitution. Our results suggest that Ala100 and Pro191 are important for DNA binding and sequence recognition by TBP, that the naturally occurring asymmetry of Ala100 and Pro191 is not essential for function, and that a single amino acid change in TBP can lead to elevated DNA binding affinity and recognition of a reversed TATA sequence.

  6. SSMART: Sequence-structure motif identification for RNA-binding proteins.

    PubMed

    Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

    2018-06-11

    RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

  7. Sequence-selective binding of C8-conjugated pyrrolobenzodiazepines (PBDs) to DNA.

    PubMed

    Basher, Mohammad A; Rahman, Khondaker Miraz; Jackson, Paul J M; Thurston, David E; Fox, Keith R

    2017-11-01

    DNA footprinting and melting experiments have been used to examine the sequence-specific binding of C8-conjugates of pyrrolobenzodiazepines (PBDs) and benzofused rings including benzothiophene and benzofuran, which are attached using pyrrole- or imidazole-containing linkers. The conjugates modulate the covalent attachment points of the PBDs, so that they bind best to guanines flanked by A/T-rich sequences on either the 5'- or 3'-side. The linker affects the binding, and pyrrole produces larger changes than imidazole. Melting studies with 14-mer oligonucleotide duplexes confirm covalent attachment of the conjugates, which show a different selectivity to anthramycin and reveal that more than one ligand molecule can bind to each duplex. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. SNBRFinder: A Sequence-Based Hybrid Algorithm for Enhanced Prediction of Nucleic Acid-Binding Residues.

    PubMed

    Yang, Xiaoxia; Wang, Jia; Sun, Jun; Liu, Rong

    2015-01-01

    Protein-nucleic acid interactions are central to various fundamental biological processes. Automated methods capable of reliably identifying DNA- and RNA-binding residues in protein sequence are assuming ever-increasing importance. The majority of current algorithms rely on feature-based prediction, but their accuracy remains to be further improved. Here we propose a sequence-based hybrid algorithm SNBRFinder (Sequence-based Nucleic acid-Binding Residue Finder) by merging a feature predictor SNBRFinderF and a template predictor SNBRFinderT. SNBRFinderF was established using the support vector machine whose inputs include sequence profile and other complementary sequence descriptors, while SNBRFinderT was implemented with the sequence alignment algorithm based on profile hidden Markov models to capture the weakly homologous template of query sequence. Experimental results show that SNBRFinderF was clearly superior to the commonly used sequence profile-based predictor and SNBRFinderT can achieve comparable performance to the structure-based template methods. Leveraging the complementary relationship between these two predictors, SNBRFinder reasonably improved the performance of both DNA- and RNA-binding residue predictions. More importantly, the sequence-based hybrid prediction reached competitive performance relative to our previous structure-based counterpart. Our extensive and stringent comparisons show that SNBRFinder has obvious advantages over the existing sequence-based prediction algorithms. The value of our algorithm is highlighted by establishing an easy-to-use web server that is freely accessible at http://ibi.hzau.edu.cn/SNBRFinder.

  9. Saccharomyces cerevisiae SSB1 protein and its relationship to nucleolar RNA-binding proteins.

    PubMed Central

    Jong, A Y; Clark, M W; Gilbert, M; Oehm, A; Campbell, J L

    1987-01-01

    To better define the function of Saccharomyces cerevisiae SSB1, an abundant single-stranded nucleic acid-binding protein, we determined the nucleotide sequence of the SSB1 gene and compared it with those of other proteins of known function. The amino acid sequence contains 293 amino acid residues and has an Mr of 32,853. There are several stretches of sequence characteristic of other eucaryotic single-stranded nucleic acid-binding proteins. At the amino terminus, residues 39 to 54 are highly homologous to a peptide in calf thymus UP1 and UP2 and a human heterogeneous nuclear ribonucleoprotein. Residues 125 to 162 constitute a fivefold tandem repeat of the sequence RGGFRG, the composition of which suggests a nucleic acid-binding site. Near the C terminus, residues 233 to 245 are homologous to several RNA-binding proteins. Of 18 C-terminal residues, 10 are acidic, a characteristic of the procaryotic single-stranded DNA-binding proteins and eucaryotic DNA- and RNA-binding proteins. In addition, examination of the subcellular distribution of SSB1 by immunofluorescence microscopy indicated that SSB1 is a nuclear protein, predominantly located in the nucleolus. Sequence homologies and the nucleolar localization make it likely that SSB1 functions in RNA metabolism in vivo, although an additional role in DNA metabolism cannot be excluded. Images PMID:2823109

  10. Investigating intermolecular forces associated with thrombus initiation using optical tweezers

    NASA Astrophysics Data System (ADS)

    Arya, Maneesh; Lopez, Jose A.; Romo, Gabriel M.; Dong, Jing-Fei; McIntire, Larry V.; Moake, Joel L.; Anvari, Bahman

    2002-05-01

    Thrombus formation occurs when a platelet membrane receptor, glycoprotein (GP) Ib-IX-V complex, binds to its ligand, von Willebrand factor (vWf), in the subendothelium or plasma. To determine which GP Ib-IX-V amino acid sequences are critical for bond formation, we have used optical tweezers to measure forces involved in the binding of vWf to GP Ib-IX-V variants. Inasmuch as GP Ib(alpha) subunit is the primary component in human GP Ib-IX-V complex that binds to vWf, and that canine GP Ib(alpha) , on the other hand, does not bind to human vWf, we progressively replaced human GP Ib(alpha) amino acid sequences with canine GP Ib(alpha) sequences to determine the sequences essential for vWf/GP Ib(alpha) binding. After measuring the adhesive forces between optically trapped, vWf-coated beads and GP Ib(alpha) variants expressed on mammalian cells, we determined that leucine- rich repeat 2 of GP Ib(alpha) was necessary for vWf/GP Ib-IX- V bond formation. We also found that deletion of the N- terminal flanking sequence and leucine-rich repeat 1 reduced adhesion strength to vWf but did not abolish binding. While divalent cations are known to influence binding of vWf, addition of 1mM CaCl2 had no effect on measured vWf/GP Ib(alpha) bond strengths.

  11. Understanding the mechanisms of protein-DNA interactions

    NASA Astrophysics Data System (ADS)

    Lavery, Richard

    2004-03-01

    Structural, biochemical and thermodynamic data on protein-DNA interactions show that specific recognition cannot be reduced to a simple set of binary interactions between the partners (such as hydrogen bonds, ion pairs or steric contacts). The mechanical properties of the partners also play a role and, in the case of DNA, variations in both conformation and flexibility as a function of base sequence can be a significant factor in guiding a protein to the correct binding site. All-atom molecular modeling offers a means of analyzing the role of different binding mechanisms within protein-DNA complexes of known structure. This however requires estimating the binding strengths for the full range of sequences with which a given protein can interact. Since this number grows exponentially with the length of the binding site it is necessary to find a method to accelerate the calculations. We have achieved this by using a multi-copy approach (ADAPT) which allows us to build a DNA fragment with a variable base sequence. The results obtained with this method correlate well with experimental consensus binding sequences. They enable us to show that indirect recognition mechanisms involving the sequence dependent properties of DNA play a significant role in many complexes. This approach also offers a means of predicting protein binding sites on the basis of binding energies, which is complementary to conventional lexical techniques.

  12. Comprehensive analysis of RNA-protein interactions by high-throughput sequencing-RNA affinity profiling.

    PubMed

    Tome, Jacob M; Ozer, Abdullah; Pagano, John M; Gheba, Dan; Schroth, Gary P; Lis, John T

    2014-06-01

    RNA-protein interactions play critical roles in gene regulation, but methods to quantitatively analyze these interactions at a large scale are lacking. We have developed a high-throughput sequencing-RNA affinity profiling (HiTS-RAP) assay by adapting a high-throughput DNA sequencer to quantify the binding of fluorescently labeled protein to millions of RNAs anchored to sequenced cDNA templates. Using HiTS-RAP, we measured the affinity of mutagenized libraries of GFP-binding and NELF-E-binding aptamers to their respective targets and identified critical regions of interaction. Mutations additively affected the affinity of the NELF-E-binding aptamer, whose interaction depended mainly on a single-stranded RNA motif, but not that of the GFP aptamer, whose interaction depended primarily on secondary structure.

  13. The Liverwort Contains a Lectin That Is Structurally and Evolutionary Related to the Monocot Mannose-Binding Lectins1

    PubMed Central

    Peumans, Willy J.; Barre, Annick; Bras, Julien; Rougé, Pierre; Proost, Paul; Van Damme, Els J.M.

    2002-01-01

    A mannose (Man)-binding lectin has been isolated and characterized from the thallus of the liverwort Marchantia polymorpha. N-terminal sequencing indicated that the M. polymorpha agglutinin (Marpola) shares sequence similarity with the superfamily of monocot Man-binding lectins. Searches in the databases yielded expressed sequence tags encoding Marpola. Sequence analysis, molecular modeling, and docking experiments revealed striking structural similarities between Marpola and the monocot Man-binding lectins. Activity and specificity studies further indicated that Marpola is a much stronger agglutinin than the Galanthus nivalis agglutinin and exhibits a preference for methylated Man and glucose, which is unprecedented within the family of monocot Man-binding lectins. The discovery of Marpola allows us, for the first time, to corroborate the evolutionary relationship between a lectin from a lower plant and a well-established lectin family from flowering plants. In addition, the identification of Marpola sheds a new light on the molecular evolution of the superfamily of monocot Man-binding lectins. Beside evolutionary considerations, the occurrence of a G. nivalis agglutinin homolog in a lower plant necessitates the rethinking of the physiological role of the whole family of monocot Man-binding lectins. PMID:12114560

  14. TFBSshape: a motif database for DNA shape features of transcription factor binding sites.

    PubMed

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein-DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone.

  15. TFBSshape: a motif database for DNA shape features of transcription factor binding sites

    PubMed Central

    Yang, Lin; Zhou, Tianyin; Dror, Iris; Mathelier, Anthony; Wasserman, Wyeth W.; Gordân, Raluca; Rohs, Remo

    2014-01-01

    Transcription factor binding sites (TFBSs) are most commonly characterized by the nucleotide preferences at each position of the DNA target. Whereas these sequence motifs are quite accurate descriptions of DNA binding specificities of transcription factors (TFs), proteins recognize DNA as a three-dimensional object. DNA structural features refine the description of TF binding specificities and provide mechanistic insights into protein–DNA recognition. Existing motif databases contain extensive nucleotide sequences identified in binding experiments based on their selection by a TF. To utilize DNA shape information when analysing the DNA binding specificities of TFs, we developed a new tool, the TFBSshape database (available at http://rohslab.cmb.usc.edu/TFBSshape/), for calculating DNA structural features from nucleotide sequences provided by motif databases. The TFBSshape database can be used to generate heat maps and quantitative data for DNA structural features (i.e., minor groove width, roll, propeller twist and helix twist) for 739 TF datasets from 23 different species derived from the motif databases JASPAR and UniPROBE. As demonstrated for the basic helix-loop-helix and homeodomain TF families, our TFBSshape database can be used to compare, qualitatively and quantitatively, the DNA binding specificities of closely related TFs and, thus, uncover differential DNA binding specificities that are not apparent from nucleotide sequence alone. PMID:24214955

  16. Predicting RNA-protein binding sites and motifs through combining local and global deep convolutional neural networks.

    PubMed

    Pan, Xiaoyong; Shen, Hong-Bin

    2018-05-02

    RNA-binding proteins (RBPs) take over 5∼10% of the eukaryotic proteome and play key roles in many biological processes, e.g. gene regulation. Experimental detection of RBP binding sites is still time-intensive and high-costly. Instead, computational prediction of the RBP binding sites using pattern learned from existing annotation knowledge is a fast approach. From the biological point of view, the local structure context derived from local sequences will be recognized by specific RBPs. However, in computational modeling using deep learning, to our best knowledge, only global representations of entire RNA sequences are employed. So far, the local sequence information is ignored in the deep model construction process. In this study, we present a computational method iDeepE to predict RNA-protein binding sites from RNA sequences by combining global and local convolutional neural networks (CNNs). For the global CNN, we pad the RNA sequences into the same length. For the local CNN, we split a RNA sequence into multiple overlapping fixed-length subsequences, where each subsequence is a signal channel of the whole sequence. Next, we train deep CNNs for multiple subsequences and the padded sequences to learn high-level features, respectively. Finally, the outputs from local and global CNNs are combined to improve the prediction. iDeepE demonstrates a better performance over state-of-the-art methods on two large-scale datasets derived from CLIP-seq. We also find that the local CNN run 1.8 times faster than the global CNN with comparable performance when using GPUs. Our results show that iDeepE has captured experimentally verified binding motifs. https://github.com/xypan1232/iDeepE. xypan172436@gmail.com or hbshen@sjtu.edu.cn. Supplementary data are available at Bioinformatics online.

  17. Identification of Human Lineage-Specific Transcriptional Coregulators Enabled by a Glossary of Binding Modules and Tunable Genomic Backgrounds.

    PubMed

    Mariani, Luca; Weinand, Kathryn; Vedenko, Anastasia; Barrera, Luis A; Bulyk, Martha L

    2017-09-27

    Transcription factors (TFs) control cellular processes by binding specific DNA motifs to modulate gene expression. Motif enrichment analysis of regulatory regions can identify direct and indirect TF binding sites. Here, we created a glossary of 108 non-redundant TF-8mer "modules" of shared specificity for 671 metazoan TFs from publicly available and new universal protein binding microarray data. Analysis of 239 ENCODE TF chromatin immunoprecipitation sequencing datasets and associated RNA sequencing profiles suggest the 8mer modules are more precise than position weight matrices in identifying indirect binding motifs and their associated tethering TFs. We also developed GENRE (genomically equivalent negative regions), a tunable tool for construction of matched genomic background sequences for analysis of regulatory regions. GENRE outperformed four state-of-the-art approaches to background sequence construction. We used our TF-8mer glossary and GENRE in the analysis of the indirect binding motifs for the co-occurrence of tethering factors, suggesting novel TF-TF interactions. We anticipate that these tools will aid in elucidating tissue-specific gene-regulatory programs. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Structure and DNA-Binding Sites of the SWI1 AT-rich Interaction Domain (ARID) Suggest Determinants for Sequence-Specific DNA Recognition

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Suhkmann; Zhang, Ziming; Upchurch, Sean

    2004-04-16

    2 ARID is a homologous family of DNA-binding domains that occur in DNA binding proteins from a wide variety of species, ranging from yeast to nematodes, insects, mammals and plants. SWI1, a member of the SWI/SNF protein complex that is involved in chromatin remodeling during transcription, contains the ARID motif. The ARID domain of human SWI1 (also known as p270) does not select for a specific DNA sequence from a random sequence pool. The lack of sequence specificity shown by the SWI1 ARID domain stands in contrast to the other characterized ARID domains, which recognize specific AT-rich sequences. We havemore » solved the three-dimensional structure of human SWI1 ARID using solution NMR methods. In addition, we have characterized non-specific DNA-binding by the SWI1 ARID domain. Results from this study indicate that a flexible long internal loop in ARID motif is likely to be important for sequence specific DNA-recognition. The structure of human SWI1 ARID domain also represents a distinct structural subfamily. Studies of ARID indicate that boundary of the DNA binding structural and functional domains can extend beyond the sequence homologous region in a homologous family of proteins. Structural studies of homologous domains such as ARID family of DNA-binding domains should provide information to better predict the boundary of structural and functional domains in structural genomic studies. Key Words: ARID, SWI1, NMR, structural genomics, protein-DNA interaction.« less

  19. Sequence walkers: a graphical method to display how binding proteins interact with DNA or RNA sequences | Center for Cancer Research

    Cancer.gov

    A graphical method is presented for displaying how binding proteins and other macromolecules interact with individual bases of nucleotide sequences. Characters representing the sequence are either oriented normally and placed above a line indicating favorable contact, or upside-down and placed below the line indicating unfavorable contact. The positive or negative height of

  20. Special article: Creation of a guide for the transfer of care of the malignant hyperthermia patient from ambulatory surgery centers to receiving hospital facilities.

    PubMed

    Larach, Marilyn Green; Dirksen, Sharon J Hirshey; Belani, Kumar G; Brandom, Barbara W; Metz, Keith M; Policastro, Michael A; Rosenberg, Henry; Valedon, Arnaldo; Watson, Charles B

    2012-01-01

    Volatile anesthetics and/or succinylcholine may trigger a potentially lethal malignant hyperthermia (MH) event requiring critical care crisis management. If the MH triggering anesthetic is given in an ambulatory surgical center (ASC), then the patient will need to be transferred to a receiving hospital. Before May 2010, there was no clinical guide regarding the development of a specific transfer plan for MH patients in an ASC. MECHANISM BY WHICH THE STATEMENT WAS GENERATED: A consensual process lasting 18 months among 13 representatives of the Malignant Hyperthermia Association of the United States, the Ambulatory Surgery Foundation, the Society for Ambulatory Anesthesia, the Society for Academic Emergency Medicine, and the National Association of Emergency Medical Technicians led to the creation of this guide. EVIDENCE FOR THE STATEMENT: Most of the guide is based on the clinical experience and scientific expertise of the 13 representatives. The list of representatives appears in Appendix 1. The recommendation that IV dantrolene should be initiated pending transfer is also supported by clinical research demonstrating that the likelihood of significant MH complications doubles for every 30-minute delay in dantrolene administration (Anesth Analg 2010;110:498-507). This guide includes a list of potential clinical problems and therapeutic interventions to assist each ASC in the development of its own unique MH transfer plan. Points to consider include receiving health care facility capabilities, indicators of patient stability and necessary report data, transport team considerations and capabilities, implementation of transfer decisions, and coordination of communication among the ASC, the receiving hospital, and the transport team. See Appendix 2 for the guide.

  1. Effects of dantrolene and its derivatives on Ca2+ release from the sarcoplasmic reticulum of mouse skeletal muscle fibres

    PubMed Central

    Ikemoto, Takaaki; Hosoya, Takamitsu; Aoyama, Hiroshi; Kihara, Yasutaka; Suzuki, Masaaki; Endo, Makoto

    2001-01-01

    We analysed the effect of dantrolene (Dan) and five newly synthesized derivatives (GIFs) on Ca2+ release from the sarcoplasmic reticulum (SR) of mouse skeletal muscle.In intact muscles, GIF-0185 reduced the size of twitch contraction induced by electrical stimulation to the same extent as Dan. GIF-0082, an azido-functionalized Dan derivative, also inhibited twitch contraction, although the extent of inhibition was less than that of Dan and of GIF-0185.In skinned fibres, Dan inhibited Ca2+-induced Ca2+ release (CICR) under Mg2+-free conditions at room temperature. In contrast, GIF-0082 and GIF-0185 showed no inhibitory effect on CICR under the same conditions.Dan-induced inhibition of CICR was not affected by the presence of GIF-0082, whereas it was diminished in the presence of GIF-0185.GIF-0082 and GIF-0185 significantly inhibited clofibric acid (Clof)-induced Ca2+ release, as did Dan.Several Dan derivatives other than GIF-0082 and GIF-0185 showed an inhibitory effect on twitch tension but not on the CICR mechanism. All of these derivatives inhibited Clof-induced Ca2+ release.The magnitudes of inhibition of Clof-induced Ca2+ release by all Dan derivatives were well correlated with those of twitch inhibition. This supports the notion that the mode of Clof-induced opening of the RyR-Ca2+ release channel may be similar to that of physiological Ca2+ release (PCR).These results indicate that the difference in opening modes of the RyR-Ca2+ release channel is recognized by certain Dan derivatives. PMID:11606312

  2. Effects of manipulating tetanic calcium on the curvature of the force-velocity relationship in isolated rat soleus muscles.

    PubMed

    Kristensen, A M; Nielsen, O B; Overgaard, K

    2018-03-01

    In dynamically contracting muscles, increased curvature of the force-velocity relationship contributes to the loss of power during fatigue. It has been proposed that fatigue-induced reduction in [Ca ++ ] i causes this increased curvature. However, earlier studies on single fibres have been conducted at low temperatures. Here, we investigated the hypothesis that curvature is increased by reductions in tetanic [Ca ++ ] i in isolated skeletal muscle at near-physiological temperatures. Rat soleus muscles were stimulated at 60 Hz in standard Krebs-Ringer buffer, and contraction force and velocity were measured. Tetanic [Ca ++ ] i was in some experiments either lowered by addition of 10 μmol/L dantrolene or use of submaximal stimulation (30 Hz) or increased by addition of 2 mmol/L caffeine. Force-velocity curves were constructed by fitting shortening velocity at different loading forces to the Hill equation. Curvature was determined as the ratio a/F 0 with increased curvature reflecting decreased a/F 0 . Compared to control levels, lowering tetanic [Ca ++ ] i with dantrolene or reduced stimulation frequency decreased the curvature slightly as judged from increase in a/F 0 of 13 ± 1% (P = < .001) and 20 ± 2% (P = < .001) respectively. In contrast, increasing tetanic [Ca ++ ] i with caffeine increased the curvature (a/F 0 decreased by 17 ± 1%; P = < .001). Contrary to our hypothesis, interventions that reduced tetanic [Ca ++ ] i caused a decrease in curvature, while increasing tetanic [Ca ++ ] i increased the curvature. These results reject a simple causal relation between [Ca ++ ] i and curvature of the force-velocity relation during fatigue. © 2017 Scandinavian Physiological Society. Published by John Wiley & Sons Ltd.

  3. Detection and management of the neuroleptic malignant syndrome.

    PubMed

    Bond, W S

    1984-01-01

    Two patients who developed the neuroleptic malignant syndrome (NMS) are described, and pertinent literature is reviewed. A 30-year-old man developed NMS, apparently as a result of haloperidol treatment of chronic undifferentiated schizophrenia. Treatment with cooling blankets, acetaminophen, dantrolene sodium, and bromocriptine mesylate decreased abnormal vital signs, but catatonia continued. After 30 treatments with electroconvulsive therapy over a one-month period, the patient's catatonia was resolved, and he was discharged on no medication with the schizophrenia in remission. The second patient was a 22-year-old woman who developed NMS after five weeks of therapy with haloperidol and thiothixene for an acute episode of abnormal behavior. She did not respond to therapy with cooling blankets, acetaminophen, antibiotics, and amobarbital sodium. Dantrolene sodium therapy produced no improvement except for some relief of muscular rigidity. Electroconvulsive therapy (22 treatments over one month) successfully decreased the patient's elevated liver enzymes and leukocyte count, but periodic temperature elevations and catatonia continued. Prompt diagnosis and treatment of NMS are essential, as the mortality rate is 20%. Acute lethal catatonia and malignant hyperthermia are considered in differential diagnosis. Both central and peripheral pathophysiologic mechanisms are probably involved in NMS, and most cases are seen in patients with psychiatric illness. Onset of NMS does not seem related to duration of neuroleptic therapy and, in susceptible persons, additional factors may be required to trigger onset of NMS. Symptoms, including diffuse muscular rigidity, akinesia, and fever, develop within 24-72 hours. Neurologic symptoms may develop or worsen, and leukocytosis and elevated levels of liver enzymes occur. Death can result from respiratory or cardiovascular failure, and rhabdomyolysis can lead to acute renal failure.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. Calcium signaling, excitability, and synaptic plasticity defects in a mouse model of Alzheimer's disease.

    PubMed

    Zhang, Hua; Liu, Jie; Sun, Suya; Pchitskaya, Ekaterina; Popugaeva, Elena; Bezprozvanny, Ilya

    2015-01-01

    Alzheimer's disease (AD) and aging result in impaired ability to store memories, but the cellular mechanisms responsible for these defects are poorly understood. Presenilin 1 (PS1) mutations are responsible for many early-onset familial AD (FAD) cases. The phenomenon of hippocampal long-term potentiation (LTP) is widely used in studies of memory formation and storage. Recent data revealed long-term LTP maintenance (L-LTP) is impaired in PS1-M146V knock-in (KI) FAD mice. To understand the basis for this phenomenon, in the present study we analyzed structural synaptic plasticity in hippocampal cultures from wild type (WT) and KI mice. We discovered that exposure to picrotoxin induces formation of mushroom spines in both WT and KI cultures, but the maintenance of mushroom spines is impaired in KI neurons. This maintenance defect can be explained by an abnormal firing pattern during the consolidation phase of structural plasticity in KI neurons. Reduced frequency of neuronal firing in KI neurons is caused by enhanced calcium-induced calcium release (CICR), enhanced activity of calcium-activated potassium channels, and increased afterhyperpolarization. As a result, "consolidation" pattern of neuronal activity converted to "depotentiation" pattern of neuronal activity in KI neurons. Consistent with this model, we demonstrated that pharmacological inhibitors of CICR (dantrolene), of calcium-activated potassium channels (apamin), and of calcium-dependent phosphatase calcineurin (FK506) are able to rescue structural plasticity defects in KI neurons. Furthermore, we demonstrate that incubation with dantrolene or apamin also rescued L-LTP defects in KI hippocampal slices, suggesting a role for a similar mechanism. This proposed mechanism may be responsible for memory defects in AD but also for age-related memory decline.

  5. Ethanol enhances carbachol-induced protease activation and accelerates Ca2+ waves in isolated rat pancreatic acini.

    PubMed

    Orabi, Abrahim I; Shah, Ahsan U; Muili, Kamaldeen; Luo, Yuhuan; Mahmood, Syeda Maham; Ahmad, Asim; Reed, Anamika; Husain, Sohail Z

    2011-04-22

    Alcohol abuse is a leading cause of pancreatitis, accounting for 30% of acute cases and 70-90% of chronic cases, yet the mechanisms leading to alcohol-associated pancreatic injury are unclear. An early and critical feature of pancreatitis is the aberrant signaling of Ca(2+) within the pancreatic acinar cell. An important conductor of this Ca(2+) is the basolaterally localized, intracellular Ca(2+) channel ryanodine receptor (RYR). In this study, we examined the effect of ethanol on mediating both pathologic intra-acinar protease activation, a precursor to pancreatitis, as well as RYR Ca(2+) signals. We hypothesized that ethanol sensitizes the acinar cell to protease activation by modulating RYR Ca(2+). Acinar cells were freshly isolated from rat, pretreated with ethanol, and stimulated with the muscarinic agonist carbachol (1 μM). Ethanol caused a doubling in the carbachol-induced activation of the proteases trypsin and chymotrypsin (p < 0.02). The RYR inhibitor dantrolene abrogated the enhancement of trypsin and chymotrypsin activity by ethanol (p < 0.005 for both proteases). Further, ethanol accelerated the speed of the apical to basolateral Ca(2+) wave from 9 to 18 μm/s (p < 0.0005; n = 18-22 cells/group); an increase in Ca(2+) wave speed was also observed with a change from physiologic concentrations of carbachol (1 μM) to a supraphysiologic concentration (1 mM) that leads to protease activation. Dantrolene abrogated the ethanol-induced acceleration of wave speed (p < 0.05; n = 10-16 cells/group). Our results suggest that the enhancement of pathologic protease activation by ethanol is dependent on the RYR and that a novel mechanism for this enhancement may involve RYR-mediated acceleration of Ca(2+) waves.

  6. Ethanol Enhances Carbachol-induced Protease Activation and Accelerates Ca2+ Waves in Isolated Rat Pancreatic Acini*

    PubMed Central

    Orabi, Abrahim I.; Shah, Ahsan U.; Muili, Kamaldeen; Luo, Yuhuan; Mahmood, Syeda Maham; Ahmad, Asim; Reed, Anamika; Husain, Sohail Z.

    2011-01-01

    Alcohol abuse is a leading cause of pancreatitis, accounting for 30% of acute cases and 70–90% of chronic cases, yet the mechanisms leading to alcohol-associated pancreatic injury are unclear. An early and critical feature of pancreatitis is the aberrant signaling of Ca2+ within the pancreatic acinar cell. An important conductor of this Ca2+ is the basolaterally localized, intracellular Ca2+ channel ryanodine receptor (RYR). In this study, we examined the effect of ethanol on mediating both pathologic intra-acinar protease activation, a precursor to pancreatitis, as well as RYR Ca2+ signals. We hypothesized that ethanol sensitizes the acinar cell to protease activation by modulating RYR Ca2+. Acinar cells were freshly isolated from rat, pretreated with ethanol, and stimulated with the muscarinic agonist carbachol (1 μm). Ethanol caused a doubling in the carbachol-induced activation of the proteases trypsin and chymotrypsin (p < 0.02). The RYR inhibitor dantrolene abrogated the enhancement of trypsin and chymotrypsin activity by ethanol (p < 0.005 for both proteases). Further, ethanol accelerated the speed of the apical to basolateral Ca2+ wave from 9 to 18 μm/s (p < 0.0005; n = 18–22 cells/group); an increase in Ca2+ wave speed was also observed with a change from physiologic concentrations of carbachol (1 μm) to a supraphysiologic concentration (1 mm) that leads to protease activation. Dantrolene abrogated the ethanol-induced acceleration of wave speed (p < 0.05; n = 10–16 cells/group). Our results suggest that the enhancement of pathologic protease activation by ethanol is dependent on the RYR and that a novel mechanism for this enhancement may involve RYR-mediated acceleration of Ca2+ waves. PMID:21372126

  7. Hydrostatic Pressure–Induced Release of Stored Calcium in Cultured Rat Optic Nerve Head Astrocytes

    PubMed Central

    Mandal, Amritlal; Delamere, Nicholas A.

    2010-01-01

    Purpose. Elevated intraocular pressure is associated with glaucomatous optic nerve damage. Other investigators have shown functional changes in optic nerve head astrocytes subjected to elevated hydrostatic pressure (HP) for 1 to 5 days. Recently, the authors reported ERK1/2, p90RSK and NHE1 phosphorylation after 2 hours. Here they examine calcium responses at the onset of HP to determine what precedes ERK1/2 phosphorylation. Methods. Cytoplasmic calcium concentration ([Ca2+]i) was measured in cultured rat optic nerve astrocytes loaded with fura-2. The cells were placed in a closed imaging chamber and subjected to an HP increase of 15 mm Hg. Protein phosphorylation was detected by Western blot analysis. Results. The increase of HP caused an immediate slow increase in [Ca2+]i. The response persisted in calcium-free solution and when nickel chloride (4 mM) was added to suppress channel-mediated calcium entry. Previous depletion of the ER calcium stores by cyclopiazonic acid abolished the HP-induced calcium level increase. The HP-induced increase persisted in cells exposed to xestospongin C, an inhibitor of IP3R-mediated calcium release. In contrast, ryanodine receptor (RyR) antagonist ruthenium red (10 μM) or dantrolene (25 μM) inhibited the HP-induced calcium increase. The HP-induced calcium increase was abolished when ryanodine-sensitive calcium stores were pre-depleted with caffeine (3 mM). HP caused ERK1/2 phosphorylation. The magnitude of the ERK1/2 phosphorylation response was reduced by ruthenium red and dantrolene. Conclusions. Increasing HP causes calcium release from a ryanodine-sensitive cytoplasmic store and subsequent ERK1/2 activation. Calcium store release appears to be a required early step in the initial astrocyte response to an HP increase. PMID:20071675

  8. MOCCS: Clarifying DNA-binding motif ambiguity using ChIP-Seq data.

    PubMed

    Ozaki, Haruka; Iwasaki, Wataru

    2016-08-01

    As a key mechanism of gene regulation, transcription factors (TFs) bind to DNA by recognizing specific short sequence patterns that are called DNA-binding motifs. A single TF can accept ambiguity within its DNA-binding motifs, which comprise both canonical (typical) and non-canonical motifs. Clarification of such DNA-binding motif ambiguity is crucial for revealing gene regulatory networks and evaluating mutations in cis-regulatory elements. Although chromatin immunoprecipitation sequencing (ChIP-seq) now provides abundant data on the genomic sequences to which a given TF binds, existing motif discovery methods are unable to directly answer whether a given TF can bind to a specific DNA-binding motif. Here, we report a method for clarifying the DNA-binding motif ambiguity, MOCCS. Given ChIP-Seq data of any TF, MOCCS comprehensively analyzes and describes every k-mer to which that TF binds. Analysis of simulated datasets revealed that MOCCS is applicable to various ChIP-Seq datasets, requiring only a few minutes per dataset. Application to the ENCODE ChIP-Seq datasets proved that MOCCS directly evaluates whether a given TF binds to each DNA-binding motif, even if known position weight matrix models do not provide sufficient information on DNA-binding motif ambiguity. Furthermore, users are not required to provide numerous parameters or background genomic sequence models that are typically unavailable. MOCCS is implemented in Perl and R and is freely available via https://github.com/yuifu/moccs. By complementing existing motif-discovery software, MOCCS will contribute to the basic understanding of how the genome controls diverse cellular processes via DNA-protein interactions. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats.

    PubMed

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-11-16

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Methylene blue binding to DNA with alternating AT base sequence: minor groove binding is favored over intercalation.

    PubMed

    Rohs, Remo; Sklenar, Heinz

    2004-04-01

    The results presented in this paper on methylene blue (MB) binding to DNA with AT alternating base sequence complement the data obtained in two former modeling studies of MB binding to GC alternating DNA. In the light of the large amount of experimental data for both systems, this theoretical study is focused on a detailed energetic analysis and comparison in order to understand their different behavior. Since experimental high-resolution structures of the complexes are not available, the analysis is based on energy minimized structural models of the complexes in different binding modes. For both sequences, four different intercalation structures and two models for MB binding in the minor and major groove have been proposed. Solvent electrostatic effects were included in the energetic analysis by using electrostatic continuum theory, and the dependence of MB binding on salt concentration was investigated by solving the non-linear Poisson-Boltzmann equation. We find that the relative stability of the different complexes is similar for the two sequences, in agreement with the interpretation of spectroscopic data. Subtle differences, however, are seen in energy decompositions and can be attributed to the change from symmetric 5'-YpR-3' intercalation to minor groove binding with increasing salt concentration, which is experimentally observed for the AT sequence at lower salt concentration than for the GC sequence. According to our results, this difference is due to the significantly lower non-electrostatic energy for the minor groove complex with AT alternating DNA, whereas the slightly lower binding energy to this sequence is caused by a higher deformation energy of DNA. The energetic data are in agreement with the conclusions derived from different spectroscopic studies and can also be structurally interpreted on the basis of the modeled complexes. The simple static modeling technique and the neglect of entropy terms and of non-electrostatic solute-solvent interactions, which are assumed to be nearly constant for the compared complexes of MB with DNA, seem to be justified by the results.

  11. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIV mac239 and SIV agmTan-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Q Zhai; M Landesman; H Robinson

    2011-12-31

    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub MAC239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

  12. Identification and Structural Characterization of the ALIX-Binding Late Domains of Simian Immunodeficiency Virus SIVmac239 and SIVagmTan-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhai, Q.; Robinson, H.; Landesman, M. B.

    2011-01-01

    Retroviral Gag proteins contain short late-domain motifs that recruit cellular ESCRT pathway proteins to facilitate virus budding. ALIX-binding late domains often contain the core consensus sequence YPX{sub n}L (where X{sub n} can vary in sequence and length). However, some simian immunodeficiency virus (SIV) Gag proteins lack this consensus sequence, yet still bind ALIX. We mapped divergent, ALIX-binding late domains within the p6{sup Gag} proteins of SIV{sub mac239} ({sub 40}SREK{und P}YKE{und VT}ED{und L}LHLNSLF{sub 59}) and SIV{sub agmTan-1} ({sub 24}AAG{und A}YDP{und AR}KL{und L}EQYAKK{sub 41}). Crystal structures revealed that anchoring tyrosines (in lightface) and nearby hydrophobic residues (underlined) contact the ALIX V domain,more » revealing how lentiviruses employ a diverse family of late-domain sequences to bind ALIX and promote virus budding.« less

  13. Transcriptional activation of the Escherichia coli adaptive response gene aidB is mediated by binding of methylated Ada protein. Evidence for a new consensus sequence for Ada-binding sites.

    PubMed

    Landini, P; Volkert, M R

    1995-04-07

    The Escherichia coli aidB gene is part of the adaptive response to DNA methylation damage. Genes belonging to the adaptive response are positively regulated by the ada gene; the Ada protein acts as a transcriptional activator when methylated in one of its cysteine residues at position 69. Through DNaseI protection assays, we show that methylated Ada (meAda) is able to bind a DNA sequence between 40 and 60 base pairs upstream of the aidB transcriptional startpoint. Binding of meAda is necessary to activate transcription of the adaptive response genes; accordingly, in vitro transcription of aidB is dependent on the presence of meAda. Unmethylated Ada protein shows no protection against DNaseI digestion in the aidB promoter region nor does it promote aidB in vitro transcription. The aidB Ada-binding site shows only weak homology to the proposed consensus sequences for Ada-binding sites in E. coli (AAANNAA and AAAGCGCA) but shares a higher degree of similarity with the Ada-binding regions from other bacterial species, such as Salmonella typhimurium and Bacillus subtilis. Based on the comparison of five different Ada-dependent promoter regions, we suggest that a possible recognition sequence for meAda might be AATnnnnnnG-CAA. Higher concentrations of Ada are required for the binding of aidB than for the ada promoter, suggesting lower affinity of the protein for the aidB Ada-binding site. Common features in the Ada-binding regions of ada and aidB are a high A/T content, the presence of an inverted repeat structure, and their position relative to the transcriptional start site. We propose that these elements, in addition to the proposed recognition sequence, are important for binding of the Ada protein.

  14. The amino acid motif L/IIxxFE defines a novel actin-binding sequence in PDZ-RhoGEF

    PubMed Central

    Banerjee, Jayashree; Fischer, Christopher C.; Wedegaertner, Philip B.

    2009-01-01

    PDZ-RhoGEF is a member of the regulator of G protein signaling (RGS) domain-containing RhoGEFs (RGS-RhoGEFs) that link activated heterotrimeric G protein α subunits of the G12 family to activation of the small GTPase RhoA. Unique among the RGS-RhoGEFs, PDZ-RhoGEF contains a short sequence that localizes the protein to the actin cytoskeleton. In this report, we demonstrate that the actin-binding domain, located between amino acids 561–585, directly binds to F-actin in vitro. Extensive mutagenesis identifies isoleucine 568, isoleucine 569, phenylalanine 572, and glutamic acid 573 as necessary for binding to actin and for co-localization with the actin cytoskeleton in cells. These results define a novel actin-binding sequence in PDZ-RhoGEF with a critical amino acid motif of IIxxFE. Moreover, sequence analysis identifies a similar actin-binding motif in the N-terminus of the RhoGEF frabin, and, as with PDZ-RhoGEF, mutagenesis and actin interaction experiments demonstrate a motif of LIxxFE, consisting of the key amino acids leucine 23, isoleucine 24, phenylalanine 27, and glutamic acid 28. Taken together, results with PDZ-RhoGEF and frabin identify a novel actin binding sequence. Lastly, inducible dimerization of the actin-binding region of PDZ-RhoGEF revealed a dimerization-dependent actin bundling activity in vitro. PDZ-RhoGEF exists in cells as a dimer, raising the possibility that PDZ-RhoGEF could influence actin structure independent of its ability to activate RhoA. PMID:19618964

  15. Deciphering the genomic targets of alkylating polyamide conjugates using high-throughput sequencing

    PubMed Central

    Chandran, Anandhakumar; Syed, Junetha; Taylor, Rhys D.; Kashiwazaki, Gengo; Sato, Shinsuke; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2016-01-01

    Chemically engineered small molecules targeting specific genomic sequences play an important role in drug development research. Pyrrole-imidazole polyamides (PIPs) are a group of molecules that can bind to the DNA minor-groove and can be engineered to target specific sequences. Their biological effects rely primarily on their selective DNA binding. However, the binding mechanism of PIPs at the chromatinized genome level is poorly understood. Herein, we report a method using high-throughput sequencing to identify the DNA-alkylating sites of PIP-indole-seco-CBI conjugates. High-throughput sequencing analysis of conjugate 2 showed highly similar DNA-alkylating sites on synthetic oligos (histone-free DNA) and on human genomes (chromatinized DNA context). To our knowledge, this is the first report identifying alkylation sites across genomic DNA by alkylating PIP conjugates using high-throughput sequencing. PMID:27098039

  16. BiPPred: Combined sequence- and structure-based prediction of peptide binding to the Hsp70 chaperone BiP.

    PubMed

    Schneider, Markus; Rosam, Mathias; Glaser, Manuel; Patronov, Atanas; Shah, Harpreet; Back, Katrin Christiane; Daake, Marina Angelika; Buchner, Johannes; Antes, Iris

    2016-10-01

    Substrate binding to Hsp70 chaperones is involved in many biological processes, and the identification of potential substrates is important for a comprehensive understanding of these events. We present a multi-scale pipeline for an accurate, yet efficient prediction of peptides binding to the Hsp70 chaperone BiP by combining sequence-based prediction with molecular docking and MMPBSA calculations. First, we measured the binding of 15mer peptides from known substrate proteins of BiP by peptide array (PA) experiments and performed an accuracy assessment of the PA data by fluorescence anisotropy studies. Several sequence-based prediction models were fitted using this and other peptide binding data. A structure-based position-specific scoring matrix (SB-PSSM) derived solely from structural modeling data forms the core of all models. The matrix elements are based on a combination of binding energy estimations, molecular dynamics simulations, and analysis of the BiP binding site, which led to new insights into the peptide binding specificities of the chaperone. Using this SB-PSSM, peptide binders could be predicted with high selectivity even without training of the model on experimental data. Additional training further increased the prediction accuracies. Subsequent molecular docking (DynaDock) and MMGBSA/MMPBSA-based binding affinity estimations for predicted binders allowed the identification of the correct binding mode of the peptides as well as the calculation of nearly quantitative binding affinities. The general concept behind the developed multi-scale pipeline can readily be applied to other protein-peptide complexes with linearly bound peptides, for which sufficient experimental binding data for the training of classical sequence-based prediction models is not available. Proteins 2016; 84:1390-1407. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  17. Correlation of Local Effects of DNA Sequence and Position of Beta-Alanine Inserts with Polyamide-DNA Complex Binding Affinities and Kinetics

    PubMed Central

    Wang, Shuo; Nanjunda, Rupesh; Aston, Karl; Bashkin, James K.; Wilson, W. David

    2012-01-01

    In order to better understand the effects of β-alanine (β) substitution and the number of heterocycles on DNA binding affinity and selectivity, the interactions of an eight-ring hairpin polyamide (PA) and two β derivatives as well as a six-heterocycle analog have been investigated with their cognate DNA sequence, 5′-TGGCTT-3′. Binding selectivity and the effects of β have been investigated with the cognate and five mutant DNAs. A set of powerful and complementary methods have been employed for both energetic and structural evaluations: UV-melting, biosensor-surface plasmon resonance, isothermal titration calorimetry, circular dichroism and a DNA ligation ladder global structure assay. The reduced number of heterocycles in the six-ring PA weakens the binding affinity; however, the smaller PA aggregates significantly less than the larger PAs, and allows us to obtain the binding thermodynamics. The PA-DNA binding enthalpy is large and negative with a large negative ΔCp, and is the primary driving component of the Gibbs free energy. The complete SPR binding results clearly show that β substitutions can substantially weaken the binding affinity of hairpin PAs in a position-dependent manner. More importantly, the changes in PA binding to the mutant DNAs further confirm the position-dependent effects on PA-DNA interaction affinity. Comparison of mutant DNA sequences also shows a different effect in recognition of T•A versus A•T base pairs. The effects of DNA mutations on binding of a single PA as well as the effects of the position of β substitution on binding tell a clear and very important story about sequence dependent binding of PAs to DNA. PMID:23167504

  18. Molecular cloning of MSSP-2, a c-myc gene single-strand binding protein: characterization of binding specificity and DNA replication activity.

    PubMed Central

    Takai, T; Nishita, Y; Iguchi-Ariga, S M; Ariga, H

    1994-01-01

    We have previously reported the human cDNA encoding MSSP-1, a sequence-specific double- and single-stranded DNA binding protein [Negishi, Nishita, Saëgusa, Kakizaki, Galli, Kihara, Tamai, Miyajima, Iguchi-Ariga and Ariga (1994) Oncogene, 9, 1133-1143]. MSSP-1 binds to a DNA replication origin/transcriptional enhancer of the human c-myc gene and has turned out to be identical with Scr2, a human protein which complements the defect of cdc2 kinase in S.pombe [Kataoka and Nojima (1994) Nucleic Acid Res., 22, 2687-2693]. We have cloned the cDNA for MSSP-2, another member of the MSSP family of proteins. The MSSP-2 cDNA shares highly homologous sequences with MSSP-1 cDNA, except for the insertion of 48 bp coding 16 amino acids near the C-terminus. Like MSSP-1, MSSP-2 has RNP-1 consensus sequences. The results of the experiments using bacterially expressed MSSP-2, and its deletion mutants, as histidine fusion proteins suggested that the binding specificity of MSSP-2 to double- and single-stranded DNA is the same as that of MSSP-1, and that the RNP consensus sequences are required for the DNA binding of the protein. MSSP-2 stimulated the DNA replication of an SV40-derived plasmid containing the binding sequence for MSSP-1 or -2. MSSP-2 is hence suggested to play an important role in regulation of DNA replication. Images PMID:7838710

  19. Binding Site Turnover Produces Pervasive Quantitative Changes in Transcription Factor Binding between Closely Related Drosophila Species

    PubMed Central

    Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.

    2010-01-01

    Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773

  20. MUSI: an integrated system for identifying multiple specificity from very large peptide or nucleic acid data sets.

    PubMed

    Kim, Taehyung; Tyndel, Marc S; Huang, Haiming; Sidhu, Sachdev S; Bader, Gary D; Gfeller, David; Kim, Philip M

    2012-03-01

    Peptide recognition domains and transcription factors play crucial roles in cellular signaling. They bind linear stretches of amino acids or nucleotides, respectively, with high specificity. Experimental techniques that assess the binding specificity of these domains, such as microarrays or phage display, can retrieve thousands of distinct ligands, providing detailed insight into binding specificity. In particular, the advent of next-generation sequencing has recently increased the throughput of such methods by several orders of magnitude. These advances have helped reveal the presence of distinct binding specificity classes that co-exist within a set of ligands interacting with the same target. Here, we introduce a software system called MUSI that can rapidly analyze very large data sets of binding sequences to determine the relevant binding specificity patterns. Our pipeline provides two major advances. First, it can detect previously unrecognized multiple specificity patterns in any data set. Second, it offers integrated processing of very large data sets from next-generation sequencing machines. The results are visualized as multiple sequence logos describing the different binding preferences of the protein under investigation. We demonstrate the performance of MUSI by analyzing recent phage display data for human SH3 domains as well as microarray data for mouse transcription factors.

  1. The zinc fingers of YY1 bind single-stranded RNA with low sequence specificity.

    PubMed

    Wai, Dorothy C C; Shihab, Manar; Low, Jason K K; Mackay, Joel P

    2016-11-02

    Classical zinc fingers (ZFs) are traditionally considered to act as sequence-specific DNA-binding domains. More recently, classical ZFs have been recognised as potential RNA-binding modules, raising the intriguing possibility that classical-ZF transcription factors are involved in post-transcriptional gene regulation via direct RNA binding. To date, however, only one classical ZF-RNA complex, that involving TFIIIA, has been structurally characterised. Yin Yang-1 (YY1) is a multi-functional transcription factor involved in many regulatory processes, and binds DNA via four classical ZFs. Recent evidence suggests that YY1 also interacts with RNA, but the molecular nature of the interaction remains unknown. In the present work, we directly assess the ability of YY1 to bind RNA using in vitro assays. Systematic Evolution of Ligands by EXponential enrichment (SELEX) was used to identify preferred RNA sequences bound by the YY1 ZFs from a randomised library over multiple rounds of selection. However, a strong motif was not consistently recovered, suggesting that the RNA sequence selectivity of these domains is modest. YY1 ZF residues involved in binding to single-stranded RNA were identified by NMR spectroscopy and found to be largely distinct from the set of residues involved in DNA binding, suggesting that interactions between YY1 and ssRNA constitute a separate mode of nucleic acid binding. Our data are consistent with recent reports that YY1 can bind to RNA in a low-specificity, yet physiologically relevant manner. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. Ecstacy-induced delayed rhabdomyolysis and neuroleptic malignant syndrome in a patient with a novel variant in the ryanodine receptor type 1 gene.

    PubMed

    Russell, T; Riazi, S; Kraeva, N; Steel, A C; Hawryluck, L A

    2012-09-01

    We present the case of a 20-year-old woman who developed rhabdomyolysis, disseminated intravascular coagulopathy and multi-organ failure induced by ecstasy. Following initial improvement, she developed delayed rhabdomyolysis then haloperidol-induced neuroleptic malignant syndrome, which was treated with a total of 50 mg.kg(-1) dantrolene. Subsequent genetic testing revealed a novel potentially pathogenic variant in the ryanodine receptor type 1 gene. However, caffeine-halothane contracture testing of the patient's mother who carried the same gene variant was negative for malignant hyperthermia. Anaesthesia © 2012 The Association of Anaesthetists of Great Britain and Ireland.

  3. Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

    PubMed

    Lenzmeier, B A; Giebler, H A; Nyborg, J K

    1998-02-01

    Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

  4. Intercalation of XR5944 with the estrogen response element is modulated by the tri-nucleotide spacer sequence between half-sites

    PubMed Central

    Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou

    2011-01-01

    DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738

  5. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    PubMed

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  6. Identification of DNA-binding proteins by combining auto-cross covariance transformation and ensemble learning.

    PubMed

    Liu, Bin; Wang, Shanyi; Dong, Qiwen; Li, Shumin; Liu, Xuan

    2016-04-20

    DNA-binding proteins play a pivotal role in various intra- and extra-cellular activities ranging from DNA replication to gene expression control. With the rapid development of next generation of sequencing technique, the number of protein sequences is unprecedentedly increasing. Thus it is necessary to develop computational methods to identify the DNA-binding proteins only based on the protein sequence information. In this study, a novel method called iDNA-KACC is presented, which combines the Support Vector Machine (SVM) and the auto-cross covariance transformation. The protein sequences are first converted into profile-based protein representation, and then converted into a series of fixed-length vectors by the auto-cross covariance transformation with Kmer composition. The sequence order effect can be effectively captured by this scheme. These vectors are then fed into Support Vector Machine (SVM) to discriminate the DNA-binding proteins from the non DNA-binding ones. iDNA-KACC achieves an overall accuracy of 75.16% and Matthew correlation coefficient of 0.5 by a rigorous jackknife test. Its performance is further improved by employing an ensemble learning approach, and the improved predictor is called iDNA-KACC-EL. Experimental results on an independent dataset shows that iDNA-KACC-EL outperforms all the other state-of-the-art predictors, indicating that it would be a useful computational tool for DNA binding protein identification. .

  7. Molecular dynamics studies on the DNA-binding process of ERG.

    PubMed

    Beuerle, Matthias G; Dufton, Neil P; Randi, Anna M; Gould, Ian R

    2016-11-15

    The ETS family of transcription factors regulate gene targets by binding to a core GGAA DNA-sequence. The ETS factor ERG is required for homeostasis and lineage-specific functions in endothelial cells, some subset of haemopoietic cells and chondrocytes; its ectopic expression is linked to oncogenesis in multiple tissues. To date details of the DNA-binding process of ERG including DNA-sequence recognition outside the core GGAA-sequence are largely unknown. We combined available structural and experimental data to perform molecular dynamics simulations to study the DNA-binding process of ERG. In particular we were able to reproduce the ERG DNA-complex with a DNA-binding simulation starting in an unbound configuration with a final root-mean-square-deviation (RMSD) of 2.1 Å to the core ETS domain DNA-complex crystal structure. This allowed us to elucidate the relevance of amino acids involved in the formation of the ERG DNA-complex and to identify Arg385 as a novel key residue in the DNA-binding process. Moreover we were able to show that water-mediated hydrogen bonds are present between ERG and DNA in our simulations and that those interactions have the potential to achieve sequence recognition outside the GGAA core DNA-sequence. The methodology employed in this study shows the promising capabilities of modern molecular dynamics simulations in the field of protein DNA-interactions.

  8. Unexpected DNA affinity and sequence selectivity through core rigidity in guanidinium-based minor groove binders.

    PubMed

    Nagle, Padraic S; McKeever, Caitriona; Rodriguez, Fernando; Nguyen, Binh; Wilson, W David; Rozas, Isabel

    2014-09-25

    In this paper we report the design and biophysical evaluation of novel rigid-core symmetric and asymmetric dicationic DNA binders containing 9H-fluorene and 9,10-dihydroanthracene cores as well as the synthesis of one of these fluorene derivatives. First, the affinity toward particular DNA sequences of these compounds and flexible core derivatives was evaluated by means of surface plasmon resonance and thermal denaturation experiments finding that the position of the cations significantly influence the binding strength. Then their affinity and mode of binding were further studied by performing circular dichroism and UV studies and the results obtained were rationalized by means of DFT calculations. We found that the fluorene derivatives prepared have the ability to bind to the minor groove of certain DNA sequences and intercalate to others, whereas the dihydroanthracene compounds bind via intercalation to all the DNA sequences studied here.

  9. Bioinformatic Analysis of the Contribution of Primer Sequences to Aptamer Structures

    PubMed Central

    Ellington, Andrew D.

    2009-01-01

    Aptamers are nucleic acid molecules selected in vitro to bind a particular ligand. While numerous experimental studies have examined the sequences, structures, and functions of individual aptamers, considerably fewer studies have applied bioinformatics approaches to try to infer more general principles from these individual studies. We have used a large Aptamer Database to parse the contributions of both random and constant regions to the secondary structures of more than 2000 aptamers. We find that the constant, primer-binding regions do not, in general, contribute significantly to aptamer structures. These results suggest that (a) binding function is not contributed to nor constrained by constant regions; (b) in consequence, the landscape of functional binding sequences is sparse but robust, favoring scenarios for short, functional nucleic acid sequences near origins; and (c) many pool designs for the selection of aptamers are likely to prove robust. PMID:18594898

  10. Localization and characterization of an alpha-thrombin-binding site on platelet glycoprotein Ib alpha.

    PubMed

    De Marco, L; Mazzucato, M; Masotti, A; Ruggeri, Z M

    1994-03-04

    Glycoprotein (GP) Ib alpha is required for expression of the highest affinity alpha-thrombin-binding site on platelets, possibly contributing to platelet activation through a pathway involving cleavage of a specific receptor. This function may be important for the initiation of hemostasis and may also play a role in the development of pathological vascular occlusion. We have now identified a discrete sequence in the extracytoplasmic domain of GP Ib alpha, including residues 271-284 of the mature protein, which appears to be part of the high affinity alpha-thrombin-binding site. Synthetic peptidyl mimetics of this sequence inhibit alpha-thrombin binding to GP Ib as well as platelet activation and aggregation induced by subnanomolar concentrations of the agonist; they also inhibit alpha-thrombin binding to purified glycocalicin, the isolated extracytoplasmic portion of GP Ib alpha. The inhibitory peptides interfere with the clotting of fibrinogen by alpha-thrombin but not with the amidolytic activity of the enzyme on a small synthetic substrate, a finding compatible with the concept that the identified GP Ib alpha sequence interacts with the anion-binding exosite of alpha-thrombin but not with its active proteolytic site. The crucial structural elements of this sequence necessary for thrombin binding appear to be a cluster of negatively charged residues as well as three tyrosine residues that, in the native protein, may be sulfated. GP Ib alpha has no significant overall sequence homology with the thrombin inhibitor, hirudin, nor with the specific thrombin receptor on platelets; all three molecules, however, possess a distinct region rich in negatively charged residues that appear to be involved in thrombin binding. This may represent a case of convergent evolution of unrelated proteins for high affinity interaction with the same ligand.

  11. DNA binding specificity of the basic-helix-loop-helix protein MASH-1.

    PubMed

    Meierhan, D; el-Ariss, C; Neuenschwander, M; Sieber, M; Stackhouse, J F; Allemann, R K

    1995-09-05

    Despite the high degree of sequence similarity in their basic-helix-loop-helix (BHLH) domains, MASH-1 and MyoD are involved in different biological processes. In order to define possible differences between the DNA binding specificities of these two proteins, we investigated the DNA binding properties of MASH-1 by circular dichroism spectroscopy and by electrophoretic mobility shift assays (EMSA). Upon binding to DNA, the BHLH domain of MASH-1 underwent a conformational change from a mainly unfolded to a largely alpha-helical form, and surprisingly, this change was independent of the specific DNA sequence. The same conformational transition could be induced by the addition of 20% 2,2,2-trifluoroethanol. The apparent dissociation constants (KD) of the complexes of full-length MASH-1 with various oligonucleotides were determined from half-saturation points in EMSAs. MASH-1 bound as a dimer to DNA sequences containing an E-box with high affinity KD = 1.4-4.1 x 10(-14) M2). However, the specificity of DNA binding was low. The dissociation constant for the complex between MASH-1 and the highest affinity E-box sequence (KD = 1.4 x 10(-14) M2) was only a factor of 10 smaller than for completely unrelated DNA sequences (KD = approximately 1 x 10(-13) M2). The DNA binding specificity of MASH-1 was not significantly increased by the formation of an heterodimer with the ubiquitous E12 protein. MASH-1 and MyoD displayed similar binding site preferences, suggesting that their different target gene specificities cannot be explained solely by differential DNA binding. An explanation for these findings is provided on the basis of the known crystal structure of the BHLH domain of MyoD.

  12. DNA breathing dynamics distinguish binding from nonbinding consensus sites for transcription factor YY1 in cells.

    PubMed

    Alexandrov, Boian S; Fukuyo, Yayoi; Lange, Martin; Horikoshi, Nobuo; Gelev, Vladimir; Rasmussen, Kim Ø; Bishop, Alan R; Usheva, Anny

    2012-11-01

    The genome-wide mapping of the major gene expression regulators, the transcription factors (TFs) and their DNA binding sites, is of great importance for describing cellular behavior and phenotypic diversity. Presently, the methods for prediction of genomic TF binding produce a large number of false positives, most likely due to insufficient description of the physiochemical mechanisms of protein-DNA binding. Growing evidence suggests that, in the cell, the double-stranded DNA (dsDNA) is subject to local transient strands separations (breathing) that contribute to genomic functions. By using site-specific chromatin immunopecipitations, gel shifts, BIOBASE data, and our model that accurately describes the melting behavior and breathing dynamics of dsDNA we report a specific DNA breathing profile found at YY1 binding sites in cells. We find that the genomic flanking sequence variations and SNPs, may exert long-range effects on DNA dynamics and predetermine YY1 binding. The ubiquitous TF YY1 has a fundamental role in essential biological processes by activating, initiating or repressing transcription depending upon the sequence context it binds. We anticipate that consensus binding sequences together with the related DNA dynamics profile may significantly improve the accuracy of genomic TF binding sites and TF binding-related functional SNPs.

  13. Functional genetic selection of Helix 66 in Escherichia coli 23S rRNA identified the eukaryotic-binding sequence for ribosomal protein L2

    PubMed Central

    Kitahara, Kei; Kajiura, Akimasa; Sato, Neuza Satomi; Suzuki, Tsutomu

    2007-01-01

    Ribosomal protein L2 is a highly conserved primary 23S rRNA-binding protein. L2 specifically recognizes the internal bulge sequence in Helix 66 (H66) of 23S rRNA and is localized to the intersubunit space through formation of bridge B7b with 16S rRNA. The L2-binding site in H66 is highly conserved in prokaryotic ribosomes, whereas the corresponding site in eukaryotic ribosomes has evolved into distinct classes of sequences. We performed a systematic genetic selection of randomized rRNA sequences in Escherichia coli, and isolated 20 functional variants of the L2-binding site. The isolated variants consisted of eukaryotic sequences, in addition to prokaryotic sequences. These results suggest that L2/L8e does not recognize a specific base sequence of H66, but rather a characteristic architecture of H66. The growth phenotype of the isolated variants correlated well with their ability of subunit association. Upon continuous cultivation of a deleterious variant, we isolated two spontaneous mutations within domain IV of 23S rRNA that compensated for its weak subunit association, and alleviated its growth defect, implying that functional interactions between intersubunit bridges compensate ribosomal function. PMID:17553838

  14. A rapid, generally applicable method to engineer zinc fingers illustrated by targeting the HIV-1 promoter.

    PubMed

    Isalan, M; Klug, A; Choo, Y

    2001-07-01

    DNA-binding domains with predetermined sequence specificity are engineered by selection of zinc finger modules using phage display, allowing the construction of customized transcription factors. Despite remarkable progress in this field, the available protein-engineering methods are deficient in many respects, thus hampering the applicability of the technique. Here we present a rapid and convenient method that can be used to design zinc finger proteins against a variety of DNA-binding sites. This is based on a pair of pre-made zinc finger phage-display libraries, which are used in parallel to select two DNA-binding domains each of which recognizes given 5 base pair sequences, and whose products are recombined to produce a single protein that recognizes a composite (9 base pair) site of predefined sequence. Engineering using this system can be completed in less than two weeks and yields proteins that bind sequence-specifically to DNA with Kd values in the nanomolar range. To illustrate the technique, we have selected seven different proteins to bind various regions of the human immunodeficiency virus 1 (HIV-1) promoter.

  15. SELMAP - SELEX affinity landscape MAPping of transcription factor binding sites using integrated microfluidics

    PubMed Central

    Chen, Dana; Orenstein, Yaron; Golodnitsky, Rada; Pellach, Michal; Avrahami, Dorit; Wachtel, Chaim; Ovadia-Shochat, Avital; Shir-Shapira, Hila; Kedmi, Adi; Juven-Gershon, Tamar; Shamir, Ron; Gerber, Doron

    2016-01-01

    Transcription factors (TFs) alter gene expression in response to changes in the environment through sequence-specific interactions with the DNA. These interactions are best portrayed as a landscape of TF binding affinities. Current methods to study sequence-specific binding preferences suffer from limited dynamic range, sequence bias, lack of specificity and limited throughput. We have developed a microfluidic-based device for SELEX Affinity Landscape MAPping (SELMAP) of TF binding, which allows high-throughput measurement of 16 proteins in parallel. We used it to measure the relative affinities of Pho4, AtERF2 and Btd full-length proteins to millions of different DNA binding sites, and detected both high and low-affinity interactions in equilibrium conditions, generating a comprehensive landscape of the relative TF affinities to all possible DNA 6-mers, and even DNA10-mers with increased sequencing depth. Low quantities of both the TFs and DNA oligomers were sufficient for obtaining high-quality results, significantly reducing experimental costs. SELMAP allows in-depth screening of hundreds of TFs, and provides a means for better understanding of the regulatory processes that govern gene expression. PMID:27628341

  16. Molecular coevolution of mammalian ribosomal gene terminator sequences and the transcription termination factor TTF-I.

    PubMed Central

    Evers, R; Grummt, I

    1995-01-01

    Both the DNA elements and the nuclear factors that direct termination of ribosomal gene transcription exhibit species-specific differences. Even between mammals--e.g., human and mouse--the termination signals are not identical and the respective transcription termination factors (TTFs) which bind to the terminator sequence are not fully interchangeable. To elucidate the molecular basis for this species-specificity, we have cloned TTF-I from human and mouse cells and compared their structural and functional properties. Recombinant TTF-I exhibits species-specific DNA binding and terminates transcription both in cell-free transcription assays and in transfection experiments. Chimeric constructs of mouse TTF-I and human TTF-I reveal that the major determinant for species-specific DNA binding resides within the C terminus of TTF-I. Replacing 31 C-terminal amino acids of mouse TTF-I with the homologous human sequences relaxes the DNA-binding specificity and, as a consequence, allows the chimeric factor to bind the human terminator sequence and to specifically stop rDNA transcription. Images Fig. 2 Fig. 3 Fig. 4 PMID:7597036

  17. The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

    NASA Astrophysics Data System (ADS)

    Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

    2017-01-01

    Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

  18. Genomic Heat Shock Element Sequences Drive Cooperative Human Heat Shock Factor 1 DNA Binding and Selectivity*

    PubMed Central

    Jaeger, Alex M.; Makley, Leah N.; Gestwicki, Jason E.; Thiele, Dennis J.

    2014-01-01

    The heat shock transcription factor 1 (HSF1) activates expression of a variety of genes involved in cell survival, including protein chaperones, the protein degradation machinery, anti-apoptotic proteins, and transcription factors. Although HSF1 activation has been linked to amelioration of neurodegenerative disease, cancer cells exhibit a dependence on HSF1 for survival. Indeed, HSF1 drives a program of gene expression in cancer cells that is distinct from that activated in response to proteotoxic stress, and HSF1 DNA binding activity is elevated in cycling cells as compared with arrested cells. Active HSF1 homotrimerizes and binds to a DNA sequence consisting of inverted repeats of the pentameric sequence nGAAn, known as heat shock elements (HSEs). Recent comprehensive ChIP-seq experiments demonstrated that the architecture of HSEs is very diverse in the human genome, with deviations from the consensus sequence in the spacing, orientation, and extent of HSE repeats that could influence HSF1 DNA binding efficacy and the kinetics and magnitude of target gene expression. To understand the mechanisms that dictate binding specificity, HSF1 was purified as either a monomer or trimer and used to evaluate DNA-binding site preferences in vitro using fluorescence polarization and thermal denaturation profiling. These results were compared with quantitative chromatin immunoprecipitation assays in vivo. We demonstrate a role for specific orientations of extended HSE sequences in driving preferential HSF1 DNA binding to target loci in vivo. These studies provide a biochemical basis for understanding differential HSF1 target gene recognition and transcription in neurodegenerative disease and in cancer. PMID:25204655

  19. Deciphering the molecular mechanisms underlying the binding of the TWIST1/E12 complex to regulatory E-box sequences

    PubMed Central

    Bouard, Charlotte; Terreux, Raphael; Honorat, Mylène; Manship, Brigitte; Ansieau, Stéphane; Vigneron, Arnaud M.; Puisieux, Alain; Payen, Léa

    2016-01-01

    Abstract The TWIST1 bHLH transcription factor controls embryonic development and cancer processes. Although molecular and genetic analyses have provided a wealth of data on the role of bHLH transcription factors, very little is known on the molecular mechanisms underlying their binding affinity to the E-box sequence of the promoter. Here, we used an in silico model of the TWIST1/E12 (TE) heterocomplex and performed molecular dynamics (MD) simulations of its binding to specific (TE-box) and modified E-box sequences. We focused on (i) active E-box and inactive E-box sequences, on (ii) modified active E-box sequences, as well as on (iii) two box sequences with modified adjacent bases the AT- and TA-boxes. Our in silico models were supported by functional in vitro binding assays. This exploration highlighted the predominant role of protein side-chain residues, close to the heart of the complex, at anchoring the dimer to DNA sequences, and unveiled a shift towards adjacent ((-1) and (-1*)) bases and conserved bases of modified E-box sequences. In conclusion, our study provides proof of the predictive value of these MD simulations, which may contribute to the characterization of specific inhibitors by docking approaches, and their use in pharmacological therapies by blocking the tumoral TWIST1/E12 function in cancers. PMID:27151200

  20. Binding of Signal Recognition Particle Gives Ribosome/Nascent Chain Complexes a Competitive Advantage in Endoplasmic Reticulum Membrane Interaction

    PubMed Central

    Neuhof, Andrea; Rolls, Melissa M.; Jungnickel, Berit; Kalies, Kai-Uwe; Rapoport, Tom A.

    1998-01-01

    Most secretory and membrane proteins are sorted by signal sequences to the endoplasmic reticulum (ER) membrane early during their synthesis. Targeting of the ribosome-nascent chain complex (RNC) involves the binding of the signal sequence to the signal recognition particle (SRP), followed by an interaction of ribosome-bound SRP with the SRP receptor. However, ribosomes can also independently bind to the ER translocation channel formed by the Sec61p complex. To explain the specificity of membrane targeting, it has therefore been proposed that nascent polypeptide-associated complex functions as a cytosolic inhibitor of signal sequence- and SRP-independent ribosome binding to the ER membrane. We report here that SRP-independent binding of RNCs to the ER membrane can occur in the presence of all cytosolic factors, including nascent polypeptide-associated complex. Nontranslating ribosomes competitively inhibit SRP-independent membrane binding of RNCs but have no effect when SRP is bound to the RNCs. The protective effect of SRP against ribosome competition depends on a functional signal sequence in the nascent chain and is also observed with reconstituted proteoliposomes containing only the Sec61p complex and the SRP receptor. We conclude that cytosolic factors do not prevent the membrane binding of ribosomes. Instead, specific ribosome targeting to the Sec61p complex is provided by the binding of SRP to RNCs, followed by an interaction with the SRP receptor, which gives RNC–SRP complexes a selective advantage in membrane targeting over nontranslating ribosomes. PMID:9436994

  1. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain.

    PubMed

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein-nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5' TOPs (5' terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations.

  2. The binding of TIA-1 to RNA C-rich sequences is driven by its C-terminal RRM domain

    PubMed Central

    Cruz-Gallardo, Isabel; Aroca, Ángeles; Gunzburg, Menachem J; Sivakumaran, Andrew; Yoon, Je-Hyun; Angulo, Jesús; Persson, Cecilia; Gorospe, Myriam; Karlsson, B Göran; Wilce, Jacqueline A; Díaz-Moreno, Irene

    2014-01-01

    T-cell intracellular antigen-1 (TIA-1) is a key DNA/RNA binding protein that regulates translation by sequestering target mRNAs in stress granules (SG) in response to stress conditions. TIA-1 possesses three RNA recognition motifs (RRM) along with a glutamine-rich domain, with the central domains (RRM2 and RRM3) acting as RNA binding platforms. While the RRM2 domain, which displays high affinity for U-rich RNA sequences, is primarily responsible for interaction with RNA, the contribution of RRM3 to bind RNA as well as the target RNA sequences that it binds preferentially are still unknown. Here we combined nuclear magnetic resonance (NMR) and surface plasmon resonance (SPR) techniques to elucidate the sequence specificity of TIA-1 RRM3. With a novel approach using saturation transfer difference NMR (STD-NMR) to quantify protein–nucleic acids interactions, we demonstrate that isolated RRM3 binds to both C- and U-rich stretches with micromolar affinity. In combination with RRM2 and in the context of full-length TIA-1, RRM3 significantly enhanced the binding to RNA, particularly to cytosine-rich RNA oligos, as assessed by biotinylated RNA pull-down analysis. Our findings provide new insight into the role of RRM3 in regulating TIA-1 binding to C-rich stretches, that are abundant at the 5′ TOPs (5′ terminal oligopyrimidine tracts) of mRNAs whose translation is repressed under stress situations. PMID:24824036

  3. Sequences Flanking the Gephyrin-Binding Site of GlyRβ Tune Receptor Stabilization at Synapses

    PubMed Central

    Grünewald, Nora; Salvatico, Charlotte; Kress, Vanessa

    2018-01-01

    Abstract The efficacy of synaptic transmission is determined by the number of neurotransmitter receptors at synapses. Their recruitment depends upon the availability of postsynaptic scaffolding molecules that interact with specific binding sequences of the receptor. At inhibitory synapses, gephyrin is the major scaffold protein that mediates the accumulation of heteromeric glycine receptors (GlyRs) via the cytoplasmic loop in the β-subunit (β-loop). This binding involves high- and low-affinity interactions, but the molecular mechanism of this bimodal binding and its implication in GlyR stabilization at synapses remain unknown. We have approached this question using a combination of quantitative biochemical tools and high-density single molecule tracking in cultured rat spinal cord neurons. The high-affinity binding site could be identified and was shown to rely on the formation of a 310-helix C-terminal to the β-loop core gephyrin-binding motif. This site plays a structural role in shaping the core motif and represents the major contributor to the synaptic confinement of GlyRs by gephyrin. The N-terminal flanking sequence promotes lower affinity interactions by occupying newly identified binding sites on gephyrin. Despite its low affinity, this binding site plays a modulatory role in tuning the mobility of the receptor. Together, the GlyR β-loop sequences flanking the core-binding site differentially regulate the affinity of the receptor for gephyrin and its trapping at synapses. Our experimental approach thus bridges the gap between thermodynamic aspects of receptor-scaffold interactions and functional receptor stabilization at synapses in living cells. PMID:29464196

  4. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    PubMed

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  5. Non-B-DNA structures on the interferon-beta promoter?

    PubMed

    Robbe, K; Bonnefoy, E

    1998-01-01

    The high mobility group (HMG) I protein intervenes as an essential factor during the virus induced expression of the interferon-beta (IFN-beta) gene. It is a non-histone chromatine associated protein that has the dual capacity of binding to a non-B-DNA structure such as cruciform-DNA as well as to AT rich B-DNA sequences. In this work we compare the binding affinity of HMGI for a synthetic cruciform-DNA to its binding affinity for the HMGI-binding-site present in the positive regulatory domain II (PRDII) of the IFN-beta promoter. Using gel retardation experiments, we show that HMGI protein binds with at least ten times more affinity to the synthetic cruciform-DNA structure than to the PRDII B-DNA sequence. DNA hairpin sequences are present in both the human and the murine PRDII-DNAs. We discuss in this work the presence of, yet putative, non-B-DNA structures in the IFN-beta promoter.

  6. An improved SELEX technique for selection of DNA aptamers binding to M-type 11 of Streptococcus pyogenes.

    PubMed

    Hamula, Camille L A; Peng, Hanyong; Wang, Zhixin; Tyrrell, Gregory J; Li, Xing-Fang; Le, X Chris

    2016-03-15

    Streptococcus pyogenes is a clinically important pathogen consisting of various serotypes determined by different M proteins expressed on the cell surface. The M type is therefore a useful marker to monitor the spread of invasive S. pyogenes in a population. Serotyping and nucleic acid amplification/sequencing methods for the identification of M types are laborious, inconsistent, and usually confined to reference laboratories. The primary objective of this work is to develop a technique that enables generation of aptamers binding to specific M-types of S. pyogenes. We describe here an in vitro technique that directly used live bacterial cells and the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) strategy. Live S. pyogenes cells were incubated with DNA libraries consisting of 40-nucleotides randomized sequences. Those sequences that bound to the cells were separated, amplified using polymerase chain reaction (PCR), purified using gel electrophoresis, and served as the input DNA pool for the next round of SELEX selection. A specially designed forward primer containing extended polyA20/5Sp9 facilitated gel electrophoresis purification of ssDNA after PCR amplification. A counter-selection step using non-target cells was introduced to improve selectivity. DNA libraries of different starting sequence diversity (10(16) and 10(14)) were compared. Aptamer pools from each round of selection were tested for their binding to the target and non-target cells using flow cytometry. Selected aptamer pools were then cloned and sequenced. Individual aptamer sequences were screened on the basis of their binding to the 10 M-types that were used as targets. Aptamer pools obtained from SELEX rounds 5-8 showed high affinity to the target S. pyogenes cells. Tests against non-target Streptococcus bovis, Streptococcus pneumoniae, and Enterococcus species demonstrated selectivity of these aptamers for binding to S. pyogenes. Several aptamer sequences were found to bind preferentially to the M11 M-type of S. pyogenes. Estimated binding dissociation constants (Kd) were in the low nanomolar range for the M11 specific sequences; for example, sequence E-CA20 had a Kd of 7±1 nM. These affinities are comparable to those of a monoclonal antibody. The improved bacterial cell-SELEX technique is successful in generating aptamers selective for S. pyogenes and some of its M-types. These aptamers are potentially useful for detecting S. pyogenes, achieving binding profiles of the various M-types, and developing new M-typing technologies for non-specialized laboratories or point-of-care testing. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Theory on the mechanism of site-specific DNA-protein interactions in the presence of traps

    NASA Astrophysics Data System (ADS)

    Niranjani, G.; Murugan, R.

    2016-08-01

    The speed of site-specific binding of transcription factor (TFs) proteins with genomic DNA seems to be strongly retarded by the randomly occurring sequence traps. Traps are those DNA sequences sharing significant similarity with the original specific binding sites (SBSs). It is an intriguing question how the naturally occurring TFs and their SBSs are designed to manage the retarding effects of such randomly occurring traps. We develop a simple random walk model on the site-specific binding of TFs with genomic DNA in the presence of sequence traps. Our dynamical model predicts that (a) the retarding effects of traps will be minimum when the traps are arranged around the SBS such that there is a negative correlation between the binding strength of TFs with traps and the distance of traps from the SBS and (b) the retarding effects of sequence traps can be appeased by the condensed conformational state of DNA. Our computational analysis results on the distribution of sequence traps around the putative binding sites of various TFs in mouse and human genome clearly agree well the theoretical predictions. We propose that the distribution of traps can be used as an additional metric to efficiently identify the SBSs of TFs on genomic DNA.

  8. Xenopus origin recognition complex (ORC) initiates DNA replication preferentially at sequences targeted by Schizosaccharomyces pombe ORC

    PubMed Central

    Kong, Daochun; Coleman, Thomas R.; DePamphilis, Melvin L.

    2003-01-01

    Budding yeast (Saccharomyces cerevisiae) origin recognition complex (ORC) requires ATP to bind specific DNA sequences, whereas fission yeast (Schizosaccharomyces pombe) ORC binds to specific, asymmetric A:T-rich sites within replication origins, independently of ATP, and frog (Xenopus laevis) ORC seems to bind DNA non-specifically. Here we show that despite these differences, ORCs are functionally conserved. Firstly, SpOrc1, SpOrc4 and SpOrc5, like those from other eukaryotes, bound ATP and exhibited ATPase activity, suggesting that ATP is required for pre-replication complex (pre-RC) assembly rather than origin specificity. Secondly, SpOrc4, which is solely responsible for binding SpORC to DNA, inhibited up to 70% of XlORC-dependent DNA replication in Xenopus egg extract by preventing XlORC from binding to chromatin and assembling pre-RCs. Chromatin-bound SpOrc4 was located at AT-rich sequences. XlORC in egg extract bound preferentially to asymmetric A:T-sequences in either bare DNA or in sperm chromatin, and it recruited XlCdc6 and XlMcm proteins to these sequences. These results reveal that XlORC initiates DNA replication preferentially at the same or similar sites to those targeted in S.pombe. PMID:12840006

  9. GuiTope: an application for mapping random-sequence peptides to protein sequences.

    PubMed

    Halperin, Rebecca F; Stafford, Phillip; Emery, Jack S; Navalkar, Krupa Arun; Johnston, Stephen Albert

    2012-01-03

    Random-sequence peptide libraries are a commonly used tool to identify novel ligands for binding antibodies, other proteins, and small molecules. It is often of interest to compare the selected peptide sequences to the natural protein binding partners to infer the exact binding site or the importance of particular residues. The ability to search a set of sequences for similarity to a set of peptides may sometimes enable the prediction of an antibody epitope or a novel binding partner. We have developed a software application designed specifically for this task. GuiTope provides a graphical user interface for aligning peptide sequences to protein sequences. All alignment parameters are accessible to the user including the ability to specify the amino acid frequency in the peptide library; these frequencies often differ significantly from those assumed by popular alignment programs. It also includes a novel feature to align di-peptide inversions, which we have found improves the accuracy of antibody epitope prediction from peptide microarray data and shows utility in analyzing phage display datasets. Finally, GuiTope can randomly select peptides from a given library to estimate a null distribution of scores and calculate statistical significance. GuiTope provides a convenient method for comparing selected peptide sequences to protein sequences, including flexible alignment parameters, novel alignment features, ability to search a database, and statistical significance of results. The software is available as an executable (for PC) at http://www.immunosignature.com/software and ongoing updates and source code will be available at sourceforge.net.

  10. Systematic optimization model and algorithm for binding sequence selection in computational enzyme design

    PubMed Central

    Huang, Xiaoqiang; Han, Kehang; Zhu, Yushan

    2013-01-01

    A systematic optimization model for binding sequence selection in computational enzyme design was developed based on the transition state theory of enzyme catalysis and graph-theoretical modeling. The saddle point on the free energy surface of the reaction system was represented by catalytic geometrical constraints, and the binding energy between the active site and transition state was minimized to reduce the activation energy barrier. The resulting hyperscale combinatorial optimization problem was tackled using a novel heuristic global optimization algorithm, which was inspired and tested by the protein core sequence selection problem. The sequence recapitulation tests on native active sites for two enzyme catalyzed hydrolytic reactions were applied to evaluate the predictive power of the design methodology. The results of the calculation show that most of the native binding sites can be successfully identified if the catalytic geometrical constraints and the structural motifs of the substrate are taken into account. Reliably predicting active site sequences may have significant implications for the creation of novel enzymes that are capable of catalyzing targeted chemical reactions. PMID:23649589

  11. Wld S protein requires Nmnat activity and a short N-terminal sequence to protect axons in mice.

    PubMed

    Conforti, Laura; Wilbrey, Anna; Morreale, Giacomo; Janeckova, Lucie; Beirowski, Bogdan; Adalbert, Robert; Mazzola, Francesca; Di Stefano, Michele; Hartley, Robert; Babetto, Elisabetta; Smith, Trevor; Gilley, Jonathan; Billington, Richard A; Genazzani, Armando A; Ribchester, Richard R; Magni, Giulio; Coleman, Michael

    2009-02-23

    The slow Wallerian degeneration (Wld(S)) protein protects injured axons from degeneration. This unusual chimeric protein fuses a 70-amino acid N-terminal sequence from the Ube4b multiubiquitination factor with the nicotinamide adenine dinucleotide-synthesizing enzyme nicotinamide mononucleotide adenylyl transferase 1. The requirement for these components and the mechanism of Wld(S)-mediated neuroprotection remain highly controversial. The Ube4b domain is necessary for the protective phenotype in mice, but precisely which sequence is essential and why are unclear. Binding to the AAA adenosine triphosphatase valosin-containing protein (VCP)/p97 is the only known biochemical property of the Ube4b domain. Using an in vivo approach, we show that removing the VCP-binding sequence abolishes axon protection. Replacing the Wld(S) VCP-binding domain with an alternative ataxin-3-derived VCP-binding sequence restores its protective function. Enzyme-dead Wld(S) is unable to delay Wallerian degeneration in mice. Thus, neither domain is effective without the function of the other. Wld(S) requires both of its components to protect axons from degeneration.

  12. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome.

    PubMed

    Dresch, Jacqueline M; Zellers, Rowan G; Bork, Daniel K; Drewell, Robert A

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development.

  13. Nucleotide Interdependency in Transcription Factor Binding Sites in the Drosophila Genome

    PubMed Central

    Dresch, Jacqueline M.; Zellers, Rowan G.; Bork, Daniel K.; Drewell, Robert A.

    2016-01-01

    A long-standing objective in modern biology is to characterize the molecular components that drive the development of an organism. At the heart of eukaryotic development lies gene regulation. On the molecular level, much of the research in this field has focused on the binding of transcription factors (TFs) to regulatory regions in the genome known as cis-regulatory modules (CRMs). However, relatively little is known about the sequence-specific binding preferences of many TFs, especially with respect to the possible interdependencies between the nucleotides that make up binding sites. A particular limitation of many existing algorithms that aim to predict binding site sequences is that they do not allow for dependencies between nonadjacent nucleotides. In this study, we use a recently developed computational algorithm, MARZ, to compare binding site sequences using 32 distinct models in a systematic and unbiased approach to explore nucleotide dependencies within binding sites for 15 distinct TFs known to be critical to Drosophila development. Our results indicate that many of these proteins have varying levels of nucleotide interdependencies within their DNA recognition sequences, and that, in some cases, models that account for these dependencies greatly outperform traditional models that are used to predict binding sites. We also directly compare the ability of different models to identify the known KRUPPEL TF binding sites in CRMs and demonstrate that a more complex model that accounts for nucleotide interdependencies performs better when compared with simple models. This ability to identify TFs with critical nucleotide interdependencies in their binding sites will lead to a deeper understanding of how these molecular characteristics contribute to the architecture of CRMs and the precise regulation of transcription during organismal development. PMID:27330274

  14. Selection of a platinum-binding sequence in a loop of a four-helix bundle protein.

    PubMed

    Yagi, Sota; Akanuma, Satoshi; Kaji, Asumi; Niiro, Hiroya; Akiyama, Hayato; Uchida, Tatsuya; Yamagishi, Akihiko

    2018-02-01

    Protein-metal hybrids are functional materials with various industrial applications. For example, a redox enzyme immobilized on a platinum electrode is a key component of some biofuel cells and biosensors. To create these hybrid materials, protein molecules are bound to metal surfaces. Here, we report the selection of a novel platinum-binding sequence in a loop of a four-helix bundle protein, the Lac repressor four-helix protein (LARFH), an artificial protein in which four identical α-helices are connected via three identical loops. We created a genetic library in which the Ser-Gly-Gln-Gly-Gly-Ser sequence within the first inter-helical loop of LARFH was semi-randomly mutated. The library was then subjected to selection for platinum-binding affinity by using the T7 phage display method. The majority of the selected variants contained the Tyr-Lys-Arg-Gly-Tyr-Lys (YKRGYK) sequence in their randomized segment. We characterized the platinum-binding properties of mutant LARFH by using quartz crystal microbalance analysis. Mutant LARFH seemed to interact with platinum through its loop containing the YKRGYK sequence, as judged by the estimated exclusive area occupied by a single molecule. Furthermore, a 10-residue peptide containing the YKRGYK sequence bound to platinum with reasonably high affinity and basic side chains in the peptide were crucial in mediating this interaction. In conclusion, we have identified an amino acid sequence, YKRGYK, in the loop of a helix-loop-helix motif that shows high platinum-binding affinity. This sequence could be grafted into loops of other polypeptides as an approach to immobilize proteins on platinum electrodes for use as biosensors among other applications. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  15. Conformation of ryanodine receptor-2 gates store-operated calcium entry in rat pulmonary arterial myocytes

    PubMed Central

    Lin, Amanda H.Y.; Sun, Hui; Paudel, Omkar; Lin, Mo-Jun; Sham, James S.K.

    2016-01-01

    Aims Store-operated Ca2+ entry (SOCE) contributes to a multitude of physiological and pathophysiological functions in pulmonary vasculatures. SOCE attributable to inositol 1,4,5-trisphosphate receptor (InsP3R)-gated Ca2+ store has been studied extensively, but the role of ryanodine receptor (RyR)-gated store in SOCE remains unclear. The present study aims to delineate the relationship between RyR-gated Ca2+ stores and SOCE, and characterize the properties of RyR-gated Ca2+ entry in pulmonary artery smooth muscle cells (PASMCs). Methods and results PASMCs were isolated from intralobar pulmonary arteries of male Wister rats. Application of the RyR1/2 agonist 4-chloro-m-cresol (4-CmC) activated robust Ca2+ entry in PASMCs. It was blocked by Gd3+ and the RyR2 modulator K201 but was unaffected by the RyR1/3 antagonist dantrolene and the InsP3R inhibitor xestospongin C, suggesting RyR2 is mainly involved in the process. siRNA knockdown of STIM1, TRPC1, and Orai1, or interruption of STIM1 translocation with ML-9 significantly attenuated the 4-CmC-induced SOCE, similar to SOCE induced by thapsigargin. However, depletion of RyR-gated store with caffeine failed to activate Ca2+ entry. Inclusion of ryanodine, which itself did not cause Ca2+ entry, uncovered caffeine-induced SOCE in a concentration-dependent manner, suggesting binding of ryanodine to RyR is permissive for the process. This Ca2+ entry had the same molecular and pharmacological properties of 4-CmC-induced SOCE, and it persisted once activated even after caffeine washout. Measurement of Ca2+ in sarcoplasmic reticulum (SR) showed that 4-CmC and caffeine application with or without ryanodine reduced SR Ca2+ to similar extent, suggesting store-depletion was not the cause of the discrepancy. Moreover, caffeine/ryanodine and 4-CmC failed to initiate SOCE in cells transfected with the ryanodine-binding deficient mutant RyR2-I4827T. Conclusions RyR2-gated Ca2+ store contributes to SOCE in PASMCs; however, store-depletion alone is insufficient but requires a specific RyR conformation modifiable by ryanodine binding to activate Ca2+ entry. PMID:27013634

  16. Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation

    PubMed Central

    Huska, Matthew R.; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R.; Schwahn, Kevin; Cooper, Samantha B.; Yamamoto, Keith R.; Thomas-Chollier, Morgane; Vingron, Martin

    2017-01-01

    Abstract The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter–proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. PMID:27903902

  17. The 1.3 A resolution structure of the RNA tridecamer r(GCGUUUGAAACGC): metal ion binding correlates with base unstacking and groove contraction.

    PubMed

    Timsit, Youri; Bombard, Sophie

    2007-12-01

    Metal ions play a key role in RNA folding and activity. Elucidating the rules that govern the binding of metal ions is therefore an essential step for better understanding the RNA functions. High-resolution data are a prerequisite for a detailed structural analysis of ion binding on RNA and, in particular, the observation of monovalent cations. Here, the high-resolution crystal structures of the tridecamer duplex r(GCGUUUGAAACGC) crystallized under different conditions provides new structural insights on ion binding on GAAA/UUU sequences that exhibit both unusual structural and functional properties in RNA. The present study extends the repertory of RNA ion binding sites in showing that the two first bases of UUU triplets constitute a specific site for sodium ions. A striking asymmetric pattern of metal ion binding in the two equivalent halves of the palindromic sequence demonstrates that sequence and its environment act together to bind metal ions. A highly ionophilic half that binds six metal ions allows, for the first time, the observation of a disodium cluster in RNA. The comparison of the equivalent halves of the duplex provides experimental evidences that ion binding correlates with structural alterations and groove contraction.

  18. Sequence- and Interactome-Based Prediction of Viral Protein Hotspots Targeting Host Proteins: A Case Study for HIV Nef

    PubMed Central

    Sarmady, Mahdi; Dampier, William; Tozeren, Aydin

    2011-01-01

    Virus proteins alter protein pathways of the host toward the synthesis of viral particles by breaking and making edges via binding to host proteins. In this study, we developed a computational approach to predict viral sequence hotspots for binding to host proteins based on sequences of viral and host proteins and literature-curated virus-host protein interactome data. We use a motif discovery algorithm repeatedly on collections of sequences of viral proteins and immediate binding partners of their host targets and choose only those motifs that are conserved on viral sequences and highly statistically enriched among binding partners of virus protein targeted host proteins. Our results match experimental data on binding sites of Nef to host proteins such as MAPK1, VAV1, LCK, HCK, HLA-A, CD4, FYN, and GNB2L1 with high statistical significance but is a poor predictor of Nef binding sites on highly flexible, hoop-like regions. Predicted hotspots recapture CD8 cell epitopes of HIV Nef highlighting their importance in modulating virus-host interactions. Host proteins potentially targeted or outcompeted by Nef appear crowding the T cell receptor, natural killer cell mediated cytotoxicity, and neurotrophin signaling pathways. Scanning of HIV Nef motifs on multiple alignments of hepatitis C protein NS5A produces results consistent with literature, indicating the potential value of the hotspot discovery in advancing our understanding of virus-host crosstalk. PMID:21738584

  19. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets.

    PubMed

    Nelson, Christopher S; Fuller, Chris K; Fordyce, Polly M; Greninger, Alexander L; Li, Hao; DeRisi, Joseph L

    2013-07-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein's DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2's-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved.

  20. Microfluidic affinity and ChIP-seq analyses converge on a conserved FOXP2-binding motif in chimp and human, which enables the detection of evolutionarily novel targets

    PubMed Central

    Nelson, Christopher S.; Fuller, Chris K.; Fordyce, Polly M.; Greninger, Alexander L.; Li, Hao; DeRisi, Joseph L.

    2013-01-01

    The transcription factor forkhead box P2 (FOXP2) is believed to be important in the evolution of human speech. A mutation in its DNA-binding domain causes severe speech impairment. Humans have acquired two coding changes relative to the conserved mammalian sequence. Despite intense interest in FOXP2, it has remained an open question whether the human protein’s DNA-binding specificity and chromatin localization are conserved. Previous in vitro and ChIP-chip studies have provided conflicting consensus sequences for the FOXP2-binding site. Using MITOMI 2.0 microfluidic affinity assays, we describe the binding site of FOXP2 and its affinity profile in base-specific detail for all substitutions of the strongest binding site. We find that human and chimp FOXP2 have similar binding sites that are distinct from previously suggested consensus binding sites. Additionally, through analysis of FOXP2 ChIP-seq data from cultured neurons, we find strong overrepresentation of a motif that matches our in vitro results and identifies a set of genes with FOXP2 binding sites. The FOXP2-binding sites tend to be conserved, yet we identified 38 instances of evolutionarily novel sites in humans. Combined, these data present a comprehensive portrait of FOXP2’s-binding properties and imply that although its sequence specificity has been conserved, some of its genomic binding sites are newly evolved. PMID:23625967

  1. DNABP: Identification of DNA-Binding Proteins Based on Feature Selection Using a Random Forest and Predicting Binding Residues.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2016-01-01

    DNA-binding proteins are fundamentally important in cellular processes. Several computational-based methods have been developed to improve the prediction of DNA-binding proteins in previous years. However, insufficient work has been done on the prediction of DNA-binding proteins from protein sequence information. In this paper, a novel predictor, DNABP (DNA-binding proteins), was designed to predict DNA-binding proteins using the random forest (RF) classifier with a hybrid feature. The hybrid feature contains two types of novel sequence features, which reflect information about the conservation of physicochemical properties of the amino acids, and the binding propensity of DNA-binding residues and non-binding propensities of non-binding residues. The comparisons with each feature demonstrated that these two novel features contributed most to the improvement in predictive ability. Furthermore, to improve the prediction performance of the DNABP model, feature selection using the minimum redundancy maximum relevance (mRMR) method combined with incremental feature selection (IFS) was carried out during the model construction. The results showed that the DNABP model could achieve 86.90% accuracy, 83.76% sensitivity, 90.03% specificity and a Matthews correlation coefficient of 0.727. High prediction accuracy and performance comparisons with previous research suggested that DNABP could be a useful approach to identify DNA-binding proteins from sequence information. The DNABP web server system is freely available at http://www.cbi.seu.edu.cn/DNABP/.

  2. Contacts between the factor TUF and RPG sequences.

    PubMed

    Vignais, M L; Huet, J; Buhler, J M; Sentenac, A

    1990-08-25

    The yeast TUF factor binds specifically to RPG-like sequences involved in multiple functions at enhancers, silencers, and telomeres. We have characterized the interaction of TUF with its optimal binding sequence, rpg-1 (1-ACACCCATACATTT-14), using a gel DNA-binding assay in combination with methylation protection and mutagenesis experiments. As many as 10 base pairs appear to be engaged in factor binding. Analysis of a collection of 30 different RPG mutants demonstrated the importance of 8 base pairs at position 2, 3, 4, 5, 6, 7, 10, and 12 and the critical role of the central GC pair at position 5. Methylation protection data on four different natural sites confirmed a close contact at positions 4, 5, 6, and 10 and suggested additional contacts at base pairs 8, 12, and 13. The derived consensus sequence was RCAAYCCRYNCAYY. A quantitative band shift analysis was used to determine the equilibrium dissociation constant for the complex of TUF and its optimal binding site rpg-1. The specific dissociation constant (K8) was found to be 1.3 x 10(-11) M. The comparison of the K8 value with the dissociation constant obtained for nonspecific DNA sites (Kn8 = 8.7 x 10(-6) M) shows the high binding selectivity of TUF for its specific RPG target.

  3. Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tsodikov, Oleg V.; Biswas, Tapan

    An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

  4. Structure and Function of Lipopolysaccharide Binding Protein

    NASA Astrophysics Data System (ADS)

    Schumann, Ralf R.; Leong, Steven R.; Flaggs, Gail W.; Gray, Patrick W.; Wright, Samuel D.; Mathison, John C.; Tobias, Peter S.; Ulevitch, Richard J.

    1990-09-01

    The primary structure of lipopolysaccharide binding protein (LBP), a trace plasma protein that binds to the lipid A moiety of bacterial lipopolysaccharides (LPSs), was deduced by sequencing cloned complementary DNA. LBP shares sequence identity with another LPS binding protein found in granulocytes, bactericidal/permeability-increasing protein, and with cholesterol ester transport protein of the plasma. LBP may control the response to LPS under physiologic conditions by forming high-affinity complexes with LPS that bind to monocytes and macrophages, which then secrete tumor necrosis factor. The identification of this pathway for LPS-induced monocyte stimulation may aid in the development of treatments for diseases in which Gram-negative sepsis or endotoxemia are involved.

  5. RCK: accurate and efficient inference of sequence- and structure-based protein-RNA binding models from RNAcompete data.

    PubMed

    Orenstein, Yaron; Wang, Yuhao; Berger, Bonnie

    2016-06-15

    Protein-RNA interactions, which play vital roles in many processes, are mediated through both RNA sequence and structure. CLIP-based methods, which measure protein-RNA binding in vivo, suffer from experimental noise and systematic biases, whereas in vitro experiments capture a clearer signal of protein RNA-binding. Among them, RNAcompete provides binding affinities of a specific protein to more than 240 000 unstructured RNA probes in one experiment. The computational challenge is to infer RNA structure- and sequence-based binding models from these data. The state-of-the-art in sequence models, Deepbind, does not model structural preferences. RNAcontext models both sequence and structure preferences, but is outperformed by GraphProt. Unfortunately, GraphProt cannot detect structural preferences from RNAcompete data due to the unstructured nature of the data, as noted by its developers, nor can it be tractably run on the full RNACompete dataset. We develop RCK, an efficient, scalable algorithm that infers both sequence and structure preferences based on a new k-mer based model. Remarkably, even though RNAcompete data is designed to be unstructured, RCK can still learn structural preferences from it. RCK significantly outperforms both RNAcontext and Deepbind in in vitro binding prediction for 244 RNAcompete experiments. Moreover, RCK is also faster and uses less memory, which enables scalability. While currently on par with existing methods in in vivo binding prediction on a small scale test, we demonstrate that RCK will increasingly benefit from experimentally measured RNA structure profiles as compared to computationally predicted ones. By running RCK on the entire RNAcompete dataset, we generate and provide as a resource a set of protein-RNA structure-based models on an unprecedented scale. Software and models are freely available at http://rck.csail.mit.edu/ bab@mit.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  6. p53 Specifically Binds Triplex DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Tichý, Vlastimil; Helma, Robert; Bažantová, Pavla; Polášková, Alena; Krejčí, Aneta; Petr, Marek; Navrátilová, Lucie; Tichá, Olga; Nejedlý, Karel; Bennink, Martin L.; Subramaniam, Vinod; Bábková, Zuzana; Martínek, Tomáš; Lexa, Matej; Adámik, Matej

    2016-01-01

    Triplex DNA is implicated in a wide range of biological activities, including regulation of gene expression and genomic instability leading to cancer. The tumor suppressor p53 is a central regulator of cell fate in response to different type of insults. Sequence and structure specific modes of DNA recognition are core attributes of the p53 protein. The focus of this work is the structure-specific binding of p53 to DNA containing triplex-forming sequences in vitro and in cells and the effect on p53-driven transcription. This is the first DNA binding study of full-length p53 and its deletion variants to both intermolecular and intramolecular T.A.T triplexes. We demonstrate that the interaction of p53 with intermolecular T.A.T triplex is comparable to the recognition of CTG-hairpin non-B DNA structure. Using deletion mutants we determined the C-terminal DNA binding domain of p53 to be crucial for triplex recognition. Furthermore, strong p53 recognition of intramolecular T.A.T triplexes (H-DNA), stabilized by negative superhelicity in plasmid DNA, was detected by competition and immunoprecipitation experiments, and visualized by AFM. Moreover, chromatin immunoprecipitation revealed p53 binding T.A.T forming sequence in vivo. Enhanced reporter transactivation by p53 on insertion of triplex forming sequence into plasmid with p53 consensus sequence was observed by luciferase reporter assays. In-silico scan of human regulatory regions for the simultaneous presence of both consensus sequence and T.A.T motifs identified a set of candidate p53 target genes and p53-dependent activation of several of them (ABCG5, ENOX1, INSR, MCC, NFAT5) was confirmed by RT-qPCR. Our results show that T.A.T triplex comprises a new class of p53 binding sites targeted by p53 in a DNA structure-dependent mode in vitro and in cells. The contribution of p53 DNA structure-dependent binding to the regulation of transcription is discussed. PMID:27907175

  7. Characterization of the Organic Component of Low-Molecular-Weight Chromium-Binding Substance and Its Binding of Chromium123

    PubMed Central

    Chen, Yuan; Watson, Heather M.; Gao, Junjie; Sinha, Sarmistha Halder; Cassady, Carolyn J.; Vincent, John B.

    2011-01-01

    Chromium was proposed to be an essential element over 50 y ago and was shown to have therapeutic potential in treating the symptoms of type 2 diabetes; however, its mechanism of action at a molecular level is unknown. One chromium-binding biomolecule, low-molecular weight chromium-binding substance (LMWCr or chromodulin), has been found to be biologically active in in vitro assays and proposed as a potential candidate for the in vivo biologically active form of chromium. Characterization of the organic component of LMWCr has proven difficult. Treating bovine LMWCr with trifluoroacetic acid followed by purification on a graphite powder micro-column generates a heptapeptide fragment of LMWCr. The peptide sequence of the fragment was analyzed by MS and tandem MS (MS/MS and MS/MS/MS) using collision-induced dissociation and post-source decay. Two candidate sequences, pEEEEGDD and pEEEGEDD (where pE is pyroglutamate), were identified from the MS/MS experiments; additional tandem MS suggests the sequence is pEEEEGDD. The N-terminal glutamate residues explain the inability to sequence LMWCr by the Edman method. Langmuir isotherms and Hill plots were used to analyze the binding constants of chromic ions to synthetic peptides similar in composition to apoLMWCr. The sequence pEEEEGDD was found to bind 4 chromic ions per peptide with nearly identical cooperativity and binding constants to those of apoLMWCr. This work should lead to further studies elucidating or eliminating a potential role for LMWCr in treating the symptoms of type 2 diabetes and other conditions resulting from improper carbohydrate and lipid metabolism. PMID:21593351

  8. Regulation of Bacteria-Induced Intercellular Adhesion Molecule-1 by CCAAT/Enhancer Binding Proteins

    PubMed Central

    Manzel, Lori J.; Chin, Cecilia L.; Behlke, Mark A.; Look, Dwight C.

    2009-01-01

    Direct interaction between bacteria and epithelial cells may initiate or amplify the airway response through induction of epithelial defense gene expression by nuclear factor-κB (NF-κB). However, multiple signaling pathways modify NF-κB effects to modulate gene expression. In this study, the effects of CCAAT/enhancer binding protein (C/EBP) family members on induction of the leukocyte adhesion glycoprotein intercellular adhesion molecule-1 (ICAM-1) was examined in primary cultures of human tracheobronchial epithelial cells incubated with nontypeable Haemophilus influenzae. Increased ICAM-1 gene transcription in response to H. influenzae required gene sequences located at −200 to −135 in the 5′-flanking region that contain a C/EBP-binding sequence immediately upstream of the NF-κB enhancer site. Constitutive C/EBPβ was found to have an important role in epithelial cell ICAM-1 regulation, while the adjacent NF-κB sequence binds the RelA/p65 and NF-κB1/p50 members of the NF-κB family to induce ICAM-1 expression in response to H. influenzae. The expression of C/EBP proteins is not regulated by p38 mitogen-activated protein kinase activation, but p38 affects gene transcription by increasing the binding of TATA-binding protein to TATA-box–containing gene sequences. Epithelial cell ICAM-1 expression in response to H. influenzae was decreased by expressing dominant-negative protein or RNA interference against C/EBPβ, confirming its role in ICAM-1 regulation. Although airway epithelial cells express multiple constitutive and inducible C/EBP family members that bind C/EBP sequences, the results indicate that C/EBPβ plays a central role in modulation of NF-κB–dependent defense gene expression in human airway epithelial cells after exposure to H. influenzae. PMID:18703796

  9. Genome-wide identification and characterization of Notch transcription complex-binding sequence paired sites in leukemia cells

    PubMed Central

    Severson, Eric; Arnett, Kelly L.; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S.; Liu, X. Shirley; Blacklow, Stephen C.; Aster, Jon C.

    2018-01-01

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and are linked to the Notch-responsiveness of a few genes, but their overall contribution to Notch-dependent gene regulation is unknown. To address this issue, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay, and applied insights from these in vitro studies to Notch-“addicted” leukemia cells. We find that SPSs contribute to the regulation of approximately a third of direct Notch target genes. While originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5. Our work provides a general method for identifying sequence-paired sites in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. PMID:28465412

  10. Recombinant soluble adenovirus receptor

    DOEpatents

    Freimuth, Paul I.

    2002-01-01

    Disclosed are isolated polypeptides from human CAR (coxsackievirus and adenovirus receptor) protein which bind adenovirus. Specifically disclosed are amino acid sequences which corresponds to adenovirus binding domain D1 and the entire extracellular domain of human CAR protein comprising D1 and D2. In other aspects, the disclosure relates to nucleic acid sequences encoding these domains as well as expression vectors which encode the domains and bacterial cells containing such vectors. Also disclosed is an isolated fusion protein comprised of the D1 polypeptide sequence fused to a polypeptide sequence which facilitates folding of D1 into a functional, soluble domain when expressed in bacteria. The functional D1 domain finds application for example in a therapeutic method for treating a patient infected with a virus which binds to D1, and also in a method for identifying an antiviral compound which interferes with viral attachment. Also included is a method for specifically targeting a cell for infection by a virus which binds to D1.

  11. [Screening specific recognition motif of RNA-binding proteins by SELEX in combination with next-generation sequencing technique].

    PubMed

    Zhang, Lu; Xu, Jinhao; Ma, Jinbiao

    2016-07-25

    RNA-binding protein exerts important biological function by specifically recognizing RNA motif. SELEX (Systematic evolution of ligands by exponential enrichment), an in vitro selection method, can obtain consensus motif with high-affinity and specificity for many target molecules from DNA or RNA libraries. Here, we combined SELEX with next-generation sequencing to study the protein-RNA interaction in vitro. A pool of RNAs with 20 bp random sequences were transcribed by T7 promoter, and target protein was inserted into plasmid containing SBP-tag, which can be captured by streptavidin beads. Through only one cycle, the specific RNA motif can be obtained, which dramatically improved the selection efficiency. Using this method, we found that human hnRNP A1 RRMs domain (UP1 domain) bound RNA motifs containing AGG and AG sequences. The EMSA experiment indicated that hnRNP A1 RRMs could bind the obtained RNA motif. Taken together, this method provides a rapid and effective method to study the RNA binding specificity of proteins.

  12. Changes in tau phosphorylation in hibernating rodents.

    PubMed

    León-Espinosa, Gonzalo; García, Esther; García-Escudero, Vega; Hernández, Félix; Defelipe, Javier; Avila, Jesús

    2013-07-01

    Tau is a cytoskeletal protein present mainly in the neurons of vertebrates. By comparing the sequence of tau molecule among different vertebrates, it was found that the variability of the N-terminal sequence in tau protein is higher than that of the C-terminal region. The N-terminal region is involved mainly in the binding of tau to cellular membranes, whereas the C-terminal region of the tau molecule contains the microtubule-binding sites. We have compared the sequence of Syrian hamster tau with the sequences of other hibernating and nonhibernating rodents and investigated how differences in the N-terminal region of tau could affect the phosphorylation level and tau binding to cell membranes. We also describe a change, in tau phosphorylation, on a casein kinase 1 (ck1)-dependent site that is found only in hibernating rodents. This ck1 site seems to play an important role in the regulation of tau binding to membranes. Copyright © 2013 Wiley Periodicals, Inc.

  13. MicroRNAs Form Triplexes with Double Stranded DNA at Sequence-Specific Binding Sites; a Eukaryotic Mechanism via which microRNAs Could Directly Alter Gene Expression

    PubMed Central

    Grace, Christy R.; Ferreira, Antonio M.; Waddell, M. Brett; Ridout, Granger; Naeve, Deanna; Leuze, Michael; LoCascio, Philip F.; Panetta, John C.; Wilkinson, Mark R.; Pui, Ching-Hon; Naeve, Clayton W.; Uberbacher, Edward C.; Bonten, Erik J.; Evans, William E.

    2016-01-01

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA) and typically down-regulating their stability or translation. Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence (i.e., NMR, FRET, SPR) that purine or pyrimidine-rich microRNAs of appropriate length and sequence form triple-helical structures with purine-rich sequences of duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show that several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 × 10−16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. This work has thus revealed a new mechanism by which microRNAs could interact with gene promoter regions to modify gene transcription. PMID:26844769

  14. Impact of cadmium, cobalt and nickel on sequence-specific DNA binding of p63 and p73 in vitro and in cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adámik, Matej; Bažantová, Pavla; Department of Biology and Ecology, Faculty of Science, University of Ostrava, Chittussiho 10, 701 03 Ostrava

    Highlights: • DNA binding of p53 family core domains is inhibited by cadmium, cobalt and nickel. • Binding to DNA protects p53 family core domains from metal induced inhibition. • Cadmium, cobalt and nickel induced inhibition was reverted by EDTA in vitro. - Abstract: Site-specific DNA recognition and binding activity belong to common attributes of all three members of tumor suppressor p53 family proteins: p53, p63 and p73. It was previously shown that heavy metals can affect p53 conformation, sequence-specific binding and suppress p53 response to DNA damage. Here we report for the first time that cadmium, nickel and cobalt,more » which have already been shown to disturb various DNA repair mechanisms, can also influence p63 and p73 sequence-specific DNA binding activity and transactivation of p53 family target genes. Based on results of electrophoretic mobility shift assay and luciferase reporter assay, we conclude that cadmium inhibits sequence-specific binding of all three core domains to p53 consensus sequences and abolishes transactivation of several promoters (e.g. BAX and MDM2) by 50 μM concentrations. In the presence of specific DNA, all p53 family core domains were partially protected against loss of DNA binding activity due to cadmium treatment. Effective cadmium concentration to abolish DNA–protein interactions was about two times higher for p63 and p73 proteins than for p53. Furthermore, we detected partial reversibility of cadmium inhibition for all p53 family members by EDTA. DTT was able to reverse cadmium inhibition only for p53 and p73. Nickel and cobalt abolished DNA–p53 interaction at sub-millimolar concentrations while inhibition of p63 and p73 DNA binding was observed at millimolar concentrations. In summary, cadmium strongly inhibits p53, p63 and p73 DNA binding in vitro and in cells in comparison to nickel and cobalt. The role of cadmium inhibition of p53 tumor suppressor family in carcinogenesis is discussed.« less

  15. Selection of peptides binding to metallic borides by screening M13 phage display libraries.

    PubMed

    Ploss, Martin; Facey, Sandra J; Bruhn, Carina; Zemel, Limor; Hofmann, Kathrin; Stark, Robert W; Albert, Barbara; Hauer, Bernhard

    2014-02-10

    Metal borides are a class of inorganic solids that is much less known and investigated than for example metal oxides or intermetallics. At the same time it is a highly versatile and interesting class of compounds in terms of physical and chemical properties, like semiconductivity, ferromagnetism, or catalytic activity. This makes these substances attractive for the generation of new materials. Very little is known about the interaction between organic materials and borides. To generate nanostructured and composite materials which consist of metal borides and organic modifiers it is necessary to develop new synthetic strategies. Phage peptide display libraries are commonly used to select peptides that bind specifically to metals, metal oxides, and semiconductors. Further, these binding peptides can serve as templates to control the nucleation and growth of inorganic nanoparticles. Additionally, the combination of two different binding motifs into a single bifunctional phage could be useful for the generation of new composite materials. In this study, we have identified a unique set of sequences that bind to amorphous and crystalline nickel boride (Ni3B) nanoparticles, from a random peptide library using the phage display technique. Using this technique, strong binders were identified that are selective for nickel boride. Sequence analysis of the peptides revealed that the sequences exhibit similar, yet subtle different patterns of amino acid usage. Although a predominant binding motif was not observed, certain charged amino acids emerged as essential in specific binding to both substrates. The 7-mer peptide sequence LGFREKE, isolated on amorphous Ni3B emerged as the best binder for both substrates. Fluorescence microscopy and atomic force microscopy confirmed the specific binding affinity of LGFREKE expressing phage to amorphous and crystalline Ni3B nanoparticles. This study is, to our knowledge, the first to identify peptides that bind specifically to amorphous and to crystalline Ni3B nanoparticles. We think that the identified strong binding sequences described here could potentially serve for the utilisation of M13 phage as a viable alternative to other methods to create tailor-made boride composite materials or new catalytic surfaces by a biologically driven nano-assembly synthesis and structuring.

  16. Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

    PubMed Central

    Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

    2010-01-01

    Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

  17. Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

    PubMed

    Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

    2010-04-01

    Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

  18. Improved pan-specific MHC class I peptide-binding predictions using a novel representation of the MHC-binding cleft environment.

    PubMed

    Carrasco Pro, S; Zimic, M; Nielsen, M

    2014-02-01

    Major histocompatibility complex (MHC) molecules play a key role in cell-mediated immune responses presenting bounded peptides for recognition by the immune system cells. Several in silico methods have been developed to predict the binding affinity of a given peptide to a specific MHC molecule. One of the current state-of-the-art methods for MHC class I is NetMHCpan, which has a core ingredient for the representation of the MHC class I molecule using a pseudo-sequence representation of the binding cleft amino acid environment. New and large MHC-peptide-binding data sets are constantly being made available, and also new structures of MHC class I molecules with a bound peptide have been published. In order to test if the NetMHCpan method can be improved by integrating this novel information, we created new pseudo-sequence definitions for the MHC-binding cleft environment from sequence and structural analyses of different MHC data sets including human leukocyte antigen (HLA), non-human primates (chimpanzee, macaque and gorilla) and other animal alleles (cattle, mouse and swine). From these constructs, we showed that by focusing on MHC sequence positions found to be polymorphic across the MHC molecules used to train the method, the NetMHCpan method achieved a significant increase in the predictive performance, in particular, of non-human MHCs. This study hence showed that an improved performance of MHC-binding methods can be achieved not only by the accumulation of more MHC-peptide-binding data but also by a refined definition of the MHC-binding environment including information from non-human species. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Cysteine-containing peptide tag for site-specific conjugation of proteins

    DOEpatents

    Backer, Marina V.; Backer, Joseph M.

    2008-04-08

    The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.

  20. Cysteine-containing peptide tag for site-specific conjugation of proteins

    DOEpatents

    Backer, Marina V.; Backer, Joseph M.

    2010-10-05

    The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety bound to the targeting moiety; the biological conjugate having a covalent bond between the thiol group of SEQ ID NO:2 and a functional group in the binding moiety. The present invention is directed to a biological conjugate, comprising: (a) a targeting moiety comprising a polypeptide having an amino acid sequence comprising the polypeptide sequence of SEQ ID NO:2 and the polypeptide sequence of a selected targeting protein; and (b) a binding moiety that comprises an adapter protein, the adapter protein having a thiol group; the biological conjugate having a disulfide bond between the thiol group of SEQ ID NO:2 and the thiol group of the adapter protein. The present invention is also directed to biological sequences employed in the above biological conjugates, as well as pharmaceutical preparations and methods using the above biological conjugates.

  1. Sequence-specific DNA binding Pyrrole-imidazole polyamides and their applications.

    PubMed

    Kawamoto, Yusuke; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-05-01

    Pyrrole-imidazole polyamides (Py-Im polyamides) are cell-permeable compounds that bind to the minor groove of double-stranded DNA in a sequence-specific manner without causing denaturation of the DNA. These compounds can be used to control gene expression and to stain specific sequences in cells. Here, we review the history, structural variations, and functional investigations of Py-Im polyamides. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Endogenous Hot Spots of De Novo Telomere Addition in the Yeast Genome Contain Proximal Enhancers That Bind Cdc13

    PubMed Central

    Obodo, Udochukwu C.; Epum, Esther A.; Platts, Margaret H.; Seloff, Jacob; Dahlson, Nicole A.; Velkovsky, Stoycho M.; Paul, Shira R.

    2016-01-01

    DNA double-strand breaks (DSBs) pose a threat to genome stability and are repaired through multiple mechanisms. Rarely, telomerase, the enzyme that maintains telomeres, acts upon a DSB in a mutagenic process termed telomere healing. The probability of telomere addition is increased at specific genomic sequences termed sites of repair-associated telomere addition (SiRTAs). By monitoring repair of an induced DSB, we show that SiRTAs on chromosomes V and IX share a bipartite structure in which a core sequence (Core) is directly targeted by telomerase, while a proximal sequence (Stim) enhances the probability of de novo telomere formation. The Stim and Core sequences are sufficient to confer a high frequency of telomere addition to an ectopic site. Cdc13, a single-stranded DNA binding protein that recruits telomerase to endogenous telomeres, is known to stimulate de novo telomere addition when artificially recruited to an induced DSB. Here we show that the ability of the Stim sequence to enhance de novo telomere addition correlates with its ability to bind Cdc13, indicating that natural sites at which telomere addition occurs at high frequency require binding by Cdc13 to a sequence 20 to 100 bp internal from the site at which telomerase acts to initiate de novo telomere addition. PMID:27044869

  3. Detection and quantitation of single nucleotide polymorphisms, DNA sequence variations, DNA mutations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.

  4. Human Lineage-Specific Transcriptional Regulation through GA-Binding Protein Transcription Factor Alpha (GABPa)

    PubMed Central

    Perdomo-Sabogal, Alvaro; Nowick, Katja; Piccini, Ilaria; Sudbrak, Ralf; Lehrach, Hans; Yaspo, Marie-Laure; Warnatz, Hans-Jörg; Querfurth, Robert

    2016-01-01

    A substantial fraction of phenotypic differences between closely related species are likely caused by differences in gene regulation. While this has already been postulated over 30 years ago, only few examples of evolutionary changes in gene regulation have been verified. Here, we identified and investigated binding sites of the transcription factor GA-binding protein alpha (GABPa) aiming to discover cis-regulatory adaptations on the human lineage. By performing chromatin immunoprecipitation-sequencing experiments in a human cell line, we found 11,619 putative GABPa binding sites. Through sequence comparisons of the human GABPa binding regions with orthologous sequences from 34 mammals, we identified substitutions that have resulted in 224 putative human-specific GABPa binding sites. To experimentally assess the transcriptional impact of those substitutions, we selected four promoters for promoter-reporter gene assays using human and African green monkey cells. We compared the activities of wild-type promoters to mutated forms, where we have introduced one or more substitutions to mimic the ancestral state devoid of the GABPa consensus binding sequence. Similarly, we introduced the human-specific substitutions into chimpanzee and macaque promoter backgrounds. Our results demonstrate that the identified substitutions are functional, both in human and nonhuman promoters. In addition, we performed GABPa knock-down experiments and found 1,215 genes as strong candidates for primary targets. Further analyses of our data sets link GABPa to cognitive disorders, diabetes, KRAB zinc finger (KRAB-ZNF), and human-specific genes. Thus, we propose that differences in GABPa binding sites played important roles in the evolution of human-specific phenotypes. PMID:26814189

  5. RNABindRPlus: a predictor that combines machine learning and sequence homology-based methods to improve the reliability of predicted RNA-binding residues in proteins.

    PubMed

    Walia, Rasna R; Xue, Li C; Wilkins, Katherine; El-Manzalawy, Yasser; Dobbs, Drena; Honavar, Vasant

    2014-01-01

    Protein-RNA interactions are central to essential cellular processes such as protein synthesis and regulation of gene expression and play roles in human infectious and genetic diseases. Reliable identification of protein-RNA interfaces is critical for understanding the structural bases and functional implications of such interactions and for developing effective approaches to rational drug design. Sequence-based computational methods offer a viable, cost-effective way to identify putative RNA-binding residues in RNA-binding proteins. Here we report two novel approaches: (i) HomPRIP, a sequence homology-based method for predicting RNA-binding sites in proteins; (ii) RNABindRPlus, a new method that combines predictions from HomPRIP with those from an optimized Support Vector Machine (SVM) classifier trained on a benchmark dataset of 198 RNA-binding proteins. Although highly reliable, HomPRIP cannot make predictions for the unaligned parts of query proteins and its coverage is limited by the availability of close sequence homologs of the query protein with experimentally determined RNA-binding sites. RNABindRPlus overcomes these limitations. We compared the performance of HomPRIP and RNABindRPlus with that of several state-of-the-art predictors on two test sets, RB44 and RB111. On a subset of proteins for which homologs with experimentally determined interfaces could be reliably identified, HomPRIP outperformed all other methods achieving an MCC of 0.63 on RB44 and 0.83 on RB111. RNABindRPlus was able to predict RNA-binding residues of all proteins in both test sets, achieving an MCC of 0.55 and 0.37, respectively, and outperforming all other methods, including those that make use of structure-derived features of proteins. More importantly, RNABindRPlus outperforms all other methods for any choice of tradeoff between precision and recall. An important advantage of both HomPRIP and RNABindRPlus is that they rely on readily available sequence and sequence-derived features of RNA-binding proteins. A webserver implementation of both methods is freely available at http://einstein.cs.iastate.edu/RNABindRPlus/.

  6. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-01-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163

  7. Degenerate Pax2 and Senseless binding motifs improve detection of low-affinity sites required for enhancer specificity

    PubMed Central

    Zandvakili, Arya; Campbell, Ian; Weirauch, Matthew T.

    2018-01-01

    Cells use thousands of regulatory sequences to recruit transcription factors (TFs) and produce specific transcriptional outcomes. Since TFs bind degenerate DNA sequences, discriminating functional TF binding sites (TFBSs) from background sequences represents a significant challenge. Here, we show that a Drosophila regulatory element that activates Epidermal Growth Factor signaling requires overlapping, low-affinity TFBSs for competing TFs (Pax2 and Senseless) to ensure cell- and segment-specific activity. Testing available TF binding models for Pax2 and Senseless, however, revealed variable accuracy in predicting such low-affinity TFBSs. To better define parameters that increase accuracy, we developed a method that systematically selects subsets of TFBSs based on predicted affinity to generate hundreds of position-weight matrices (PWMs). Counterintuitively, we found that degenerate PWMs produced from datasets depleted of high-affinity sequences were more accurate in identifying both low- and high-affinity TFBSs for the Pax2 and Senseless TFs. Taken together, these findings reveal how TFBS arrangement can be constrained by competition rather than cooperativity and that degenerate models of TF binding preferences can improve identification of biologically relevant low affinity TFBSs. PMID:29617378

  8. Identification of distant drug off-targets by direct superposition of binding pocket surfaces.

    PubMed

    Schumann, Marcel; Armen, Roger S

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target ("distant off-targets"). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target ("distant off-target").

  9. Identification of Distant Drug Off-Targets by Direct Superposition of Binding Pocket Surfaces

    PubMed Central

    Schumann, Marcel; Armen, Roger S.

    2013-01-01

    Correctly predicting off-targets for a given molecular structure, which would have the ability to bind a large range of ligands, is both particularly difficult and important if they share no significant sequence or fold similarity with the respective molecular target (“distant off-targets”). A novel approach for identification of off-targets by direct superposition of protein binding pocket surfaces is presented and applied to a set of well-studied and highly relevant drug targets, including representative kinases and nuclear hormone receptors. The entire Protein Data Bank is searched for similar binding pockets and convincing distant off-target candidates were identified that share no significant sequence or fold similarity with the respective target structure. These putative target off-target pairs are further supported by the existence of compounds that bind strongly to both with high topological similarity, and in some cases, literature examples of individual compounds that bind to both. Also, our results clearly show that it is possible for binding pockets to exhibit a striking surface similarity, while the respective off-target shares neither significant sequence nor significant fold similarity with the respective molecular target (“distant off-target”). PMID:24391782

  10. The pig CYP2E1 promoter is activated by COUP-TF1 and HNF-1 and is inhibited by androstenone.

    PubMed

    Tambyrajah, Winston S; Doran, Elena; Wood, Jeffrey D; McGivan, John D

    2004-11-15

    Functional analysis of the pig cytochrome P4502E1 (CYP2E1) promoter identified two major activating elements. One corresponded to the hepatic nuclear factor 1 (HNF-1) consensus binding sequence at nucleotides -128/-98 and the other was located in the region -292/-266. The binding of proteins in pig liver nuclear extracts to a synthetic double-stranded oligonucleotide corresponding to this more distal activating sequence was studied by electrophoretic mobility shift assay. The minimum protein binding sequence was identified as TGTTCTGACCTCTGGG. Gel super-shift assays identified the protein binding to this site as chick ovalbumin upstream promoter transcription factor 1 (COUP-TF1). Androstenone inhibited promoter activity in transfection experiments only with constructs which included the COUP-TF1 binding site. Androstenone inhibited COUP-TF1 binding to synthetic oligonucleotides but did not affect HNF-1 binding. The results offer an explanation for the inhibition of CYP2E1 protein expression by androstenone in isolated pig hepatocytes and may be relevant to the low expression of hepatic CYP2E1 in those pigs which accumulate high levels of androstenone in vivo.

  11. Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes.

    PubMed

    Srinivasulu, Yerukala Sathipati; Wang, Jyun-Rong; Hsu, Kai-Ti; Tsai, Ming-Ju; Charoenkwan, Phasit; Huang, Wen-Lin; Huang, Hui-Ling; Ho, Shinn-Ying

    2015-01-01

    Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes.

  12. Characterizing informative sequence descriptors and predicting binding affinities of heterodimeric protein complexes

    PubMed Central

    2015-01-01

    Background Protein-protein interactions (PPIs) are involved in various biological processes, and underlying mechanism of the interactions plays a crucial role in therapeutics and protein engineering. Most machine learning approaches have been developed for predicting the binding affinity of protein-protein complexes based on structure and functional information. This work aims to predict the binding affinity of heterodimeric protein complexes from sequences only. Results This work proposes a support vector machine (SVM) based binding affinity classifier, called SVM-BAC, to classify heterodimeric protein complexes based on the prediction of their binding affinity. SVM-BAC identified 14 of 580 sequence descriptors (physicochemical, energetic and conformational properties of the 20 amino acids) to classify 216 heterodimeric protein complexes into low and high binding affinity. SVM-BAC yielded the training accuracy, sensitivity, specificity, AUC and test accuracy of 85.80%, 0.89, 0.83, 0.86 and 83.33%, respectively, better than existing machine learning algorithms. The 14 features and support vector regression were further used to estimate the binding affinities (Pkd) of 200 heterodimeric protein complexes. Prediction performance of a Jackknife test was the correlation coefficient of 0.34 and mean absolute error of 1.4. We further analyze three informative physicochemical properties according to their contribution to prediction performance. Results reveal that the following properties are effective in predicting the binding affinity of heterodimeric protein complexes: apparent partition energy based on buried molar fractions, relations between chemical structure and biological activity in principal component analysis IV, and normalized frequency of beta turn. Conclusions The proposed sequence-based prediction method SVM-BAC uses an optimal feature selection method to identify 14 informative features to classify and predict binding affinity of heterodimeric protein complexes. The characterization analysis revealed that the average numbers of beta turns and hydrogen bonds at protein-protein interfaces in high binding affinity complexes are more than those in low binding affinity complexes. PMID:26681483

  13. Isolation from genomic DNA of sequences binding specific regulatory proteins by the acceleration of protein electrophoretic mobility upon DNA binding.

    PubMed

    Subrahmanyam, S; Cronan, J E

    1999-01-21

    We report an efficient and flexible in vitro method for the isolation of genomic DNA sequences that are the binding targets of a given DNA binding protein. This method takes advantage of the fact that binding of a protein to a DNA molecule generally increases the rate of migration of the protein in nondenaturing gel electrophoresis. By the use of a radioactively labeled DNA-binding protein and nonradioactive DNA coupled with PCR amplification from gel slices, we show that specific binding sites can be isolated from Escherichia coli genomic DNA. We have applied this method to isolate a binding site for FadR, a global regulator of fatty acid metabolism in E. coli. We have also isolated a second binding site for BirA, the biotin operon repressor/biotin ligase, from the E. coli genome that has a very low binding efficiency compared with the bio operator region.

  14. Effects of nucleoside analog incorporation on DNA binding to the DNA binding domain of the GATA-1 erythroid transcription factor.

    PubMed

    Foti, M; Omichinski, J G; Stahl, S; Maloney, D; West, J; Schweitzer, B I

    1999-02-05

    We investigate here the effects of the incorporation of the nucleoside analogs araC (1-beta-D-arabinofuranosylcytosine) and ganciclovir (9-[(1,3-dihydroxy-2-propoxy)methyl] guanine) into the DNA binding recognition sequence for the GATA-1 erythroid transcription factor. A 10-fold decrease in binding affinity was observed for the ganciclovir-substituted DNA complex in comparison to an unmodified DNA of the same sequence composition. AraC substitution did not result in any changes in binding affinity. 1H-15N HSQC and NOESY NMR experiments revealed a number of chemical shift changes in both DNA and protein in the ganciclovir-modified DNA-protein complex when compared to the unmodified DNA-protein complex. These changes in chemical shift and binding affinity suggest a change in the binding mode of the complex when ganciclovir is incorporated into the GATA DNA binding site.

  15. Sequence-specific binding of counterions to B-DNA

    PubMed Central

    Denisov, Vladimir P.; Halle, Bertil

    2000-01-01

    Recent studies by x-ray crystallography, NMR, and molecular simulations have suggested that monovalent counterions can penetrate deeply into the minor groove of B form DNA. Such groove-bound ions potentially could play an important role in AT-tract bending and groove narrowing, thereby modulating DNA function in vivo. To address this issue, we report here 23Na magnetic relaxation dispersion measurements on oligonucleotides, including difference experiments with the groove-binding drug netropsin. The exquisite sensitivity of this method to ions in long-lived and intimate association with DNA allows us to detect sequence-specific sodium ion binding in the minor groove AT tract of three B-DNA dodecamers. The sodium ion occupancy is only a few percent, however, and therefore is not likely to contribute importantly to the ensemble of B-DNA structures. We also report results of ion competition experiments, indicating that potassium, rubidium, and cesium ions bind to the minor groove with similarly weak affinity as sodium ions, whereas ammonium ion binding is somewhat stronger. The present findings are discussed in the light of previous NMR and diffraction studies of sequence-specific counterion binding to DNA. PMID:10639130

  16. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  17. Frequency of the first feature in action sequences influences feature binding.

    PubMed

    Mattson, Paul S; Fournier, Lisa R; Behmer, Lawrence P

    2012-10-01

    We investigated whether binding among perception and action feature codes is a preliminary step toward creating a more durable memory trace of an action event. If so, increasing the frequency of a particular event (e.g., a stimulus requiring a movement with the left or right hand in an up or down direction) should increase the strength and speed of feature binding for this event. The results from two experiments, using a partial-repetition paradigm, confirmed that feature binding increased in strength and/or occurred earlier for a high-frequency (e.g., left hand moving up) than for a low-frequency (e.g., right hand moving down) event. Moreover, increasing the frequency of the first-specified feature in the action sequence alone (e.g., "left" hand) increased the strength and/or speed of action feature binding (e.g., between the "left" hand and movement in an "up" or "down" direction). The latter finding suggests an update to the theory of event coding, as not all features in the action sequence equally determine binding strength. We conclude that action planning involves serial binding of features in the order of action feature execution (i.e., associations among features are not bidirectional but are directional), which can lead to a more durable memory trace. This is consistent with physiological evidence suggesting that serial order is preserved in an action plan executed from memory and that the first feature in the action sequence may be critical in preserving this serial order.

  18. Mass Spectrometric Determination of ILPR G-quadruplex Binding Sites in Insulin and IGF-2

    PubMed Central

    Xiao, JunFeng

    2009-01-01

    The insulin-linked polymorphic region (ILPR) of the human insulin gene promoter region forms G-quadruplex structures in vitro. Previous studies show that insulin and insulin-like growth factor-2 (IGF-2) exhibit high affinity binding in vitro to 2-repeat sequences of ILPR variants a and h, but negligible binding to variant i. Two-repeat sequences of variants a and h form intramolecular G-quadruplex structures that are not evidenced for variant i. Here we report on the use of protein digestion combined with affinity capture and MALDI-MS detection to pinpoint ILPR binding sites in insulin and IGF-2. Peptides captured by ILPR variants a and h were sequenced by MALDI-MS/MS, LC-MS and in silico digestion. On-bead digestion of insulin-ILPR variant a complexes supported the conclusions. The results indicate that the sequence VCG(N)RGF is generally present in the captured peptides and is likely involved in the affinity binding interactions of the proteins with the ILPR G-quadruplexes. The significance of arginine in the interactions was studied by comparing the affinities of synthesized peptides VCGERGF and VCGEAGF with ILPR variant a. Peptides from other regions of the proteins that are connected through disulfide linkages were also detected in some capture experiments. Identification of binding sites could facilitate design of DNA binding ligands for capture and detection of insulin and IGF-2. The interactions may have biological significance as well. PMID:19747845

  19. Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*

    PubMed Central

    Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.

    2012-01-01

    The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359

  20. Motif discovery with data mining in 3D protein structure databases: discovery, validation and prediction of the U-shape zinc binding ("Huf-Zinc") motif.

    PubMed

    Maurer-Stroh, Sebastian; Gao, He; Han, Hao; Baeten, Lies; Schymkowitz, Joost; Rousseau, Frederic; Zhang, Louxin; Eisenhaber, Frank

    2013-02-01

    Data mining in protein databases, derivatives from more fundamental protein 3D structure and sequence databases, has considerable unearthed potential for the discovery of sequence motif--structural motif--function relationships as the finding of the U-shape (Huf-Zinc) motif, originally a small student's project, exemplifies. The metal ion zinc is critically involved in universal biological processes, ranging from protein-DNA complexes and transcription regulation to enzymatic catalysis and metabolic pathways. Proteins have evolved a series of motifs to specifically recognize and bind zinc ions. Many of these, so called zinc fingers, are structurally independent globular domains with discontinuous binding motifs made up of residues mostly far apart in sequence. Through a systematic approach starting from the BRIX structure fragment database, we discovered that there exists another predictable subset of zinc-binding motifs that not only have a conserved continuous sequence pattern but also share a characteristic local conformation, despite being included in totally different overall folds. While this does not allow general prediction of all Zn binding motifs, a HMM-based web server, Huf-Zinc, is available for prediction of these novel, as well as conventional, zinc finger motifs in protein sequences. The Huf-Zinc webserver can be freely accessed through this URL (http://mendel.bii.a-star.edu.sg/METHODS/hufzinc/).

  1. PDNAsite: Identification of DNA-binding Site from Protein Sequence by Incorporating Spatial and Sequence Context

    PubMed Central

    Zhou, Jiyun; Xu, Ruifeng; He, Yulan; Lu, Qin; Wang, Hongpeng; Kong, Bing

    2016-01-01

    Protein-DNA interactions are involved in many fundamental biological processes essential for cellular function. Most of the existing computational approaches employed only the sequence context of the target residue for its prediction. In the present study, for each target residue, we applied both the spatial context and the sequence context to construct the feature space. Subsequently, Latent Semantic Analysis (LSA) was applied to remove the redundancies in the feature space. Finally, a predictor (PDNAsite) was developed through the integration of the support vector machines (SVM) classifier and ensemble learning. Results on the PDNA-62 and the PDNA-224 datasets demonstrate that features extracted from spatial context provide more information than those from sequence context and the combination of them gives more performance gain. An analysis of the number of binding sites in the spatial context of the target site indicates that the interactions between binding sites next to each other are important for protein-DNA recognition and their binding ability. The comparison between our proposed PDNAsite method and the existing methods indicate that PDNAsite outperforms most of the existing methods and is a useful tool for DNA-binding site identification. A web-server of our predictor (http://hlt.hitsz.edu.cn:8080/PDNAsite/) is made available for free public accessible to the biological research community. PMID:27282833

  2. Selection and Screening of DNA Aptamers for Inorganic Nanomaterials.

    PubMed

    Zhou, Yibo; Huang, Zhicheng; Yang, Ronghua; Liu, Juewen

    2018-02-21

    Searching for DNA sequences that can strongly and selectively bind to inorganic surfaces is a long-standing topic in bionanotechnology, analytical chemistry and biointerface research. This can be achieved either by aptamer selection starting with a very large library of ≈10 14 random DNA sequences, or by careful screening of a much smaller library (usually from a few to a few hundred) with rationally designed sequences. Unlike typical molecular targets, inorganic surfaces often have quite strong DNA adsorption affinities due to polyvalent binding and even chemical interactions. This leads to a very high background binding making aptamer selection difficult. Screening, on the other hand, can be designed to compare relative binding affinities of different DNA sequences and could be more appropriate for inorganic surfaces. The resulting sequences have been used for DNA-directed assembly, sorting of carbon nanotubes, and DNA-controlled growth of inorganic nanomaterials. It was recently discovered that poly-cytosine (C) DNA can strongly bind to a diverse range of nanomaterials including nanocarbons (graphene oxide and carbon nanotubes), various metal oxides and transition-metal dichalcogenides. In this Concept article, we articulate the need for screening and potential artifacts associated with traditional aptamer selection methods for inorganic surfaces. Representative examples of application are discussed, and a few future research opportunities are proposed towards the end of this article. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  3. A single amino-acid substitution in the Ets domain alters core DNA binding specificity of Ets1 to that of the related transcription factors Elf1 and E74.

    PubMed

    Bosselut, R; Levin, J; Adjadj, E; Ghysdael, J

    1993-11-11

    Ets proteins form a family of sequence specific DNA binding proteins which bind DNA through a 85 aminoacids conserved domain, the Ets domain, whose sequence is unrelated to any other characterized DNA binding domain. Unlike all other known Ets proteins, which bind specific DNA sequences centered over either GGAA or GGAT core motifs, E74 and Elf1 selectively bind to GGAA corecontaining sites. Elf1 and E74 differ from other Ets proteins in three residues located in an otherwise highly conserved region of the Ets domain, referred to as conserved region III (CRIII). We show that a restricted selectivity for GGAA core-containing sites could be conferred to Ets1 upon changing a single lysine residue within CRIII to the threonine found in Elf1 and E74 at this position. Conversely, the reciprocal mutation in Elf1 confers to this protein the ability to bind to GGAT core containing EBS. This, together with the fact that mutation of two invariant arginine residues in CRIII abolishes DNA binding, indicates that CRIII plays a key role in Ets domain recognition of the GGAA/T core motif and lead us to discuss a model of Ets proteins--core motif interaction.

  4. Structural analysis of DNA binding by C.Csp231I, a member of a novel class of R-M controller proteins regulating gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shevtsov, M. B.; Streeter, S. D.; Thresh, S.-J.

    2015-02-01

    The structure of the new class of controller proteins (exemplified by C.Csp231I) in complex with its 21 bp DNA-recognition sequence is presented, and the molecular basis of sequence recognition in this class of proteins is discussed. An unusual extended spacer between the dimer binding sites suggests a novel interaction between the two C-protein dimers. In a wide variety of bacterial restriction–modification systems, a regulatory ‘controller’ protein (or C-protein) is required for effective transcription of its own gene and for transcription of the endonuclease gene found on the same operon. We have recently turned our attention to a new class ofmore » controller proteins (exemplified by C.Csp231I) that have quite novel features, including a much larger DNA-binding site with an 18 bp (∼60 Å) spacer between the two palindromic DNA-binding sequences and a very different recognition sequence from the canonical GACT/AGTC. Using X-ray crystallography, the structure of the protein in complex with its 21 bp DNA-recognition sequence was solved to 1.8 Å resolution, and the molecular basis of sequence recognition in this class of proteins was elucidated. An unusual aspect of the promoter sequence is the extended spacer between the dimer binding sites, suggesting a novel interaction between the two C-protein dimers when bound to both recognition sites correctly spaced on the DNA. A U-bend model is proposed for this tetrameric complex, based on the results of gel-mobility assays, hydrodynamic analysis and the observation of key contacts at the interface between dimers in the crystal.« less

  5. SARNAclust: Semi-automatic detection of RNA protein binding motifs from immunoprecipitation data

    PubMed Central

    Dotu, Ivan; Adamson, Scott I.; Coleman, Benjamin; Fournier, Cyril; Ricart-Altimiras, Emma; Eyras, Eduardo

    2018-01-01

    RNA-protein binding is critical to gene regulation, controlling fundamental processes including splicing, translation, localization and stability, and aberrant RNA-protein interactions are known to play a role in a wide variety of diseases. However, molecular understanding of RNA-protein interactions remains limited; in particular, identification of RNA motifs that bind proteins has long been challenging, especially when such motifs depend on both sequence and structure. Moreover, although RNA binding proteins (RBPs) often contain more than one binding domain, algorithms capable of identifying more than one binding motif simultaneously have not been developed. In this paper we present a novel pipeline to determine binding peaks in crosslinking immunoprecipitation (CLIP) data, to discover multiple possible RNA sequence/structure motifs among them, and to experimentally validate such motifs. At the core is a new semi-automatic algorithm SARNAclust, the first unsupervised method to identify and deconvolve multiple sequence/structure motifs simultaneously. SARNAclust computes similarity between sequence/structure objects using a graph kernel, providing the ability to isolate the impact of specific features through the bulge graph formalism. Application of SARNAclust to synthetic data shows its capability of clustering 5 motifs at once with a V-measure value of over 0.95, while GraphClust achieves only a V-measure of 0.083 and RNAcontext cannot detect any of the motifs. When applied to existing eCLIP sets, SARNAclust finds known motifs for SLBP and HNRNPC and novel motifs for several other RBPs such as AGGF1, AKAP8L and ILF3. We demonstrate an experimental validation protocol, a targeted Bind-n-Seq-like high-throughput sequencing approach that relies on RNA inverse folding for oligo pool design, that can validate the components within the SLBP motif. Finally, we use this protocol to experimentally interrogate the SARNAclust motif predictions for protein ILF3. Our results support a newly identified partially double-stranded UUUUUGAGA motif similar to that known for the splicing factor HNRNPC. PMID:29596423

  6. DNA sequencing using polymerase substrate-binding kinetics

    PubMed Central

    Previte, Michael John Robert; Zhou, Chunhong; Kellinger, Matthew; Pantoja, Rigo; Chen, Cheng-Yao; Shi, Jin; Wang, BeiBei; Kia, Amirali; Etchin, Sergey; Vieceli, John; Nikoomanzar, Ali; Bomati, Erin; Gloeckner, Christian; Ronaghi, Mostafa; He, Molly Min

    2015-01-01

    Next-generation sequencing (NGS) has transformed genomic research by decreasing the cost of sequencing. However, whole-genome sequencing is still costly and complex for diagnostics purposes. In the clinical space, targeted sequencing has the advantage of allowing researchers to focus on specific genes of interest. Routine clinical use of targeted NGS mandates inexpensive instruments, fast turnaround time and an integrated and robust workflow. Here we demonstrate a version of the Sequencing by Synthesis (SBS) chemistry that potentially can become a preferred targeted sequencing method in the clinical space. This sequencing chemistry uses natural nucleotides and is based on real-time recording of the differential polymerase/DNA-binding kinetics in the presence of correct or mismatch nucleotides. This ensemble SBS chemistry has been implemented on an existing Illumina sequencing platform with integrated cluster amplification. We discuss the advantages of this sequencing chemistry for targeted sequencing as well as its limitations for other applications. PMID:25612848

  7. A pH-sensitive heparin-binding sequence from Baculovirus gp64 protein is important for binding to mammalian cells but not to Sf9 insect cells.

    PubMed

    Wu, Chunxiao; Wang, Shu

    2012-01-01

    Binding to heparan sulfate is essential for baculovirus transduction of mammalian cells. Our previous study shows that gp64, the major glycoprotein on the virus surface, binds to heparin in a pH-dependent way, with a stronger binding at pH 6.2 than at 7.4. Using fluorescently labeled peptides, we mapped the pH-dependent heparin-binding sequence of gp64 to a 22-amino-acid region between residues 271 and 292. Binding of this region to the cell surface was also pH dependent, and peptides containing this sequence could efficiently inhibit baculovirus transduction of mammalian cells at pH 6.2. When the heparin-binding peptide was immobilized onto the bead surface to mimic the high local concentration of gp64 on the virus surface, the peptide-coated magnetic beads could efficiently pull down cells expressing heparan sulfate but not cells pretreated with heparinase or cells not expressing heparan sulfate. Interestingly, although this heparin-binding function is essential for baculovirus transduction of mammalian cells, it is dispensable for infection of Sf9 insect cells. Virus infectivity on Sf9 cells was not reduced by the presence of heparin or the identified heparin-binding peptide, even though the peptide could bind to Sf9 cell surface and be efficiently internalized. Thus, our data suggest that, depending on the availability of the target molecules on the cell surface, baculoviruses can use two different methods, electrostatic interaction with heparan sulfate and more specific receptor binding, for cell attachment.

  8. Rapid comparison of protein binding site surfaces with Property Encoded Shape Distributions (PESD)

    PubMed Central

    Das, Sourav; Kokardekar, Arshad

    2009-01-01

    Patterns in shape and property distributions on the surface of binding sites are often conserved across functional proteins without significant conservation of the underlying amino-acid residues. To explore similarities of these sites from the viewpoint of a ligand, a sequence and fold-independent method was created to rapidly and accurately compare binding sites of proteins represented by property-mapped triangulated Gauss-Connolly surfaces. Within this paradigm, signatures for each binding site surface are produced by calculating their property-encoded shape distributions (PESD), a measure of the probability that a particular property will be at a specific distance to another on the molecular surface. Similarity between the signatures can then be treated as a measure of similarity between binding sites. As postulated, the PESD method rapidly detected high levels of similarity in binding site surface characteristics even in cases where there was very low similarity at the sequence level. In a screening experiment involving each member of the PDBBind 2005 dataset as a query against the rest of the set, PESD was able to retrieve a binding site with identical E.C. (Enzyme Commission) numbers as the top match in 79.5% of cases. The ability of the method in detecting similarity in binding sites with low sequence conservations were compared with state-of-the-art binding site comparison methods. PMID:19919089

  9. Role of the chromatin landscape and sequence in determining cell type-specific genomic glucocorticoid receptor binding and gene regulation.

    PubMed

    Love, Michael I; Huska, Matthew R; Jurk, Marcel; Schöpflin, Robert; Starick, Stephan R; Schwahn, Kevin; Cooper, Samantha B; Yamamoto, Keith R; Thomas-Chollier, Morgane; Vingron, Martin; Meijsing, Sebastiaan H

    2017-02-28

    The genomic loci bound by the glucocorticoid receptor (GR), a hormone-activated transcription factor, show little overlap between cell types. To study the role of chromatin and sequence in specifying where GR binds, we used Bayesian modeling within the universe of accessible chromatin. Taken together, our results uncovered that although GR preferentially binds accessible chromatin, its binding is biased against accessible chromatin located at promoter regions. This bias can only be explained partially by the presence of fewer GR recognition sequences, arguing for the existence of additional mechanisms that interfere with GR binding at promoters. Therefore, we tested the role of H3K9ac, the chromatin feature with the strongest negative association with GR binding, but found that this correlation does not reflect a causative link. Finally, we find a higher percentage of promoter-proximal GR binding for genes regulated by GR across cell types than for cell type-specific target genes. Given that GR almost exclusively binds accessible chromatin, we propose that cell type-specific regulation by GR preferentially occurs via distal enhancers, whose chromatin accessibility is typically cell type-specific, whereas ubiquitous target gene regulation is more likely to result from binding to promoter regions, which are often accessible regardless of cell type examined. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. UniPROBE, update 2011: expanded content and search tools in the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Robasky, Kimberly; Bulyk, Martha L

    2011-01-01

    The Universal PBM Resource for Oligonucleotide-Binding Evaluation (UniPROBE) database is a centralized repository of information on the DNA-binding preferences of proteins as determined by universal protein-binding microarray (PBM) technology. Each entry for a protein (or protein complex) in UniPROBE provides the quantitative preferences for all possible nucleotide sequence variants ('words') of length k ('k-mers'), as well as position weight matrix (PWM) and graphical sequence logo representations of the k-mer data. In this update, we describe >130% expansion of the database content, incorporation of a protein BLAST (blastp) tool for finding protein sequence matches in UniPROBE, the introduction of UniPROBE accession numbers and additional database enhancements. The UniPROBE database is available at http://uniprobe.org.

  11. Hardware Acceleration Of Multi-Deme Genetic Algorithm for DNA Codeword Searching

    DTIC Science & Technology

    2008-01-01

    C and G are complementary to each other. A Watson - Crick complement of a DNA sequence is another DNA sequence which replaces all the A with T or vise...versa and replaces all the T with A or vise versa, and also switches the 5’ and 3’ ends. A DNA sequence binds most stably with its Watson - Crick ...bind with 5 Watson - Crick pairs. The length of the longest complementary sequence between two flexible DNA strands, A and B, is the same as the

  12. Activation of erythropoietin receptor in the absence of hormone by a peptide that binds to a domain different from the hormone binding site

    PubMed Central

    Naranda, Tatjana; Wong, Kenneth; Kaufman, R. Ilene; Goldstein, Avram; Olsson, Lennart

    1999-01-01

    Applying a homology search method previously described, we identified a sequence in the extracellular dimerization site of the erythropoietin receptor, distant from the hormone binding site. A peptide identical to that sequence was synthesized. Remarkably, it activated receptor signaling in the absence of erythropoietin. Neither the peptide nor the hormone altered the affinity of the other for the receptor; thus, the peptide does not bind to the hormone binding site. The combined activation of signal transduction by hormone and peptide was strongly synergistic. In mice, the peptide acted like the hormone, protecting against the decrease in hematocrit caused by carboplatin. PMID:10377456

  13. Sequence-Based Prediction of RNA-Binding Proteins Using Random Forest with Minimum Redundancy Maximum Relevance Feature Selection.

    PubMed

    Ma, Xin; Guo, Jing; Sun, Xiao

    2015-01-01

    The prediction of RNA-binding proteins is one of the most challenging problems in computation biology. Although some studies have investigated this problem, the accuracy of prediction is still not sufficient. In this study, a highly accurate method was developed to predict RNA-binding proteins from amino acid sequences using random forests with the minimum redundancy maximum relevance (mRMR) method, followed by incremental feature selection (IFS). We incorporated features of conjoint triad features and three novel features: binding propensity (BP), nonbinding propensity (NBP), and evolutionary information combined with physicochemical properties (EIPP). The results showed that these novel features have important roles in improving the performance of the predictor. Using the mRMR-IFS method, our predictor achieved the best performance (86.62% accuracy and 0.737 Matthews correlation coefficient). High prediction accuracy and successful prediction performance suggested that our method can be a useful approach to identify RNA-binding proteins from sequence information.

  14. Biological Nanoplatforms for Self-Assembled Electronics

    DTIC Science & Technology

    2015-03-24

    as M13 , a virus that infects Escherichia coli. Approximately one billion different amino acid sequences are displayed on different viruses in the...sequence when contained within a phage M13 coat protein sequence, not chemically linked to the surface of phage MS2 VLPs. Thus, binding properties may...gallium arsenide in a bacteriophage M13 phage display library, MS2 VLPs modified with the metal binding peptides do not display the same activity

  15. Nonparametric Combinatorial Sequence Models

    NASA Astrophysics Data System (ADS)

    Wauthier, Fabian L.; Jordan, Michael I.; Jojic, Nebojsa

    This work considers biological sequences that exhibit combinatorial structures in their composition: groups of positions of the aligned sequences are "linked" and covary as one unit across sequences. If multiple such groups exist, complex interactions can emerge between them. Sequences of this kind arise frequently in biology but methodologies for analyzing them are still being developed. This paper presents a nonparametric prior on sequences which allows combinatorial structures to emerge and which induces a posterior distribution over factorized sequence representations. We carry out experiments on three sequence datasets which indicate that combinatorial structures are indeed present and that combinatorial sequence models can more succinctly describe them than simpler mixture models. We conclude with an application to MHC binding prediction which highlights the utility of the posterior distribution induced by the prior. By integrating out the posterior our method compares favorably to leading binding predictors.

  16. Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

    PubMed

    Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

    2007-09-15

    We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

  17. Genetic dissection of the consensus sequence for the class 2 and class 3 flagellar promoters

    PubMed Central

    Wozniak, Christopher E.; Hughes, Kelly T.

    2008-01-01

    Summary Computational searches for DNA binding sites often utilize consensus sequences. These search models make assumptions that the frequency of a base pair in an alignment relates to the base pair’s importance in binding and presume that base pairs contribute independently to the overall interaction with the DNA binding protein. These two assumptions have generally been found to be accurate for DNA binding sites. However, these assumptions are often not satisfied for promoters, which are involved in additional steps in transcription initiation after RNA polymerase has bound to the DNA. To test these assumptions for the flagellar regulatory hierarchy, class 2 and class 3 flagellar promoters were randomly mutagenized in Salmonella. Important positions were then saturated for mutagenesis and compared to scores calculated from the consensus sequence. Double mutants were constructed to determine how mutations combined for each promoter type. Mutations in the binding site for FlhD4C2, the activator of class 2 promoters, better satisfied the assumptions for the binding model than did mutations in the class 3 promoter, which is recognized by the σ28 transcription factor. These in vivo results indicate that the activator sites within flagellar promoters can be modeled using simple assumptions but that the DNA sequences recognized by the flagellar sigma factor require more complex models. PMID:18486950

  18. Conserved RNA binding activity of a Yin-Yang 1 homologue in the ova of the purple sea urchin Strongylocentrotus purpuratus.

    PubMed

    Belak, Zachery R; Ovsenek, Nicholas; Eskiw, Christopher H

    2018-05-23

    Yin-Yang 1 (YY1) is a highly conserved transcription factor possessing RNA-binding activity. A putative YY1 homologue was previously identified in the developmental model organism Strongylocentrotus purpuratus (the purple sea urchin) by genomic sequencing. We identified a high degree of sequence similarity with YY1 homologues of vertebrate origin which shared 100% protein sequence identity over the DNA- and RNA-binding zinc-finger region with high similarity in the N-terminal transcriptional activation domain. SpYY1 demonstrated identical DNA- and RNA-binding characteristics between Xenopus laevis and S. purpuratus indicating that it maintains similar functional and biochemical properties across widely divergent deuterostome species. SpYY1 binds to the consensus YY1 DNA element, and also to U-rich RNA sequences. Although we detected SpYY1 RNA-binding activity in ova lysates and observed cytoplasmic localization, SpYY1 was not associated with maternal mRNA in ova. SpYY1 expressed in Xenopus oocytes was excluded from the nucleus and associated with maternally expressed cytoplasmic mRNA molecules. These data demonstrate the existence of an YY1 homologue in S. purpuratus with similar structural and biochemical features to those of the well-studied vertebrate YY1; however, the data reveal major differences in the biological role of YY1 in the regulation of maternally expressed mRNA in the two species.

  19. Computational analysis of protein-protein interfaces involving an alpha helix: insights for terphenyl-like molecules binding.

    PubMed

    Isvoran, Adriana; Craciun, Dana; Martiny, Virginie; Sperandio, Olivier; Miteva, Maria A

    2013-06-14

    Protein-Protein Interactions (PPIs) are key for many cellular processes. The characterization of PPI interfaces and the prediction of putative ligand binding sites and hot spot residues are essential to design efficient small-molecule modulators of PPI. Terphenyl and its derivatives are small organic molecules known to mimic one face of protein-binding alpha-helical peptides. In this work we focus on several PPIs mediated by alpha-helical peptides. We performed computational sequence- and structure-based analyses in order to evaluate several key physicochemical and surface properties of proteins known to interact with alpha-helical peptides and/or terphenyl and its derivatives. Sequence-based analysis revealed low sequence identity between some of the analyzed proteins binding alpha-helical peptides. Structure-based analysis was performed to calculate the volume, the fractal dimension roughness and the hydrophobicity of the binding regions. Besides the overall hydrophobic character of the binding pockets, some specificities were detected. We showed that the hydrophobicity is not uniformly distributed in different alpha-helix binding pockets that can help to identify key hydrophobic hot spots. The presence of hydrophobic cavities at the protein surface with a more complex shape than the entire protein surface seems to be an important property related to the ability of proteins to bind alpha-helical peptides and low molecular weight mimetics. Characterization of similarities and specificities of PPI binding sites can be helpful for further development of small molecules targeting alpha-helix binding proteins.

  20. Binding of mitochondrial leader sequences to Tom20 assessed using a bacterial two-hybrid system shows that hydrophobic interactions are essential and that some mutated leaders that do not bind Tom20 can still be imported.

    PubMed

    Mukhopadhyay, Abhijit; Yang, Chun-Song; Weiner, Henry

    2006-12-01

    Previous studies pointed to the importance of leucine residues in the binding of mitochondrial leader sequences to Tom20, an outer membrane protein translocator that initially binds the leader during import. A bacteria two-hybrid assay was here employed to determine if this could be an alternative way to investigate the binding of leader to the receptor. Leucine to alanine and arginine to glutamine mutations were made in the leader sequence from rat liver aldehyde dehydrogenase (pALDH). The leucine residues in the C-terminal of pALDH leader were found to be essential for TOM20 binding. The hydrophobic residues of another mitochondrial leader F1beta-ATPase that were important for Tom20 binding were found at the C-terminus of the leader. In contrast, it was the leucines in the N-terminus of the leader of ornithine transcarbamylase that were essential for binding. Modeling the peptides to the structure of Tom20 showed that the hydrophobic residues from the three proteins could all fit into the hydrophobic binding pocket. The mutants of pALDH that did not bind to Tom20 were still imported in vivo in transformed HeLa cells or in vitro into isolated mitochondria. In contrast, the mutant from pOTC was imported less well ( approximately 50%) while the mutant from F1beta-ATPase was not imported to any measurable extent. Binding to Tom20 might not be a prerequisite for import; however, it also is possible that import can occur even if binding to a receptor component is poor, so long as the leader binds tightly to another component of the translocator.

  1. Comparison between TRF2 and TRF1 of their telomeric DNA-bound structures and DNA-binding activities

    PubMed Central

    Hanaoka, Shingo; Nagadoi, Aritaka; Nishimura, Yoshifumi

    2005-01-01

    Mammalian telomeres consist of long tandem arrays of double-stranded telomeric TTAGGG repeats packaged by the telomeric DNA-binding proteins TRF1 and TRF2. Both contain a similar C-terminal Myb domain that mediates sequence-specific binding to telomeric DNA. In a DNA complex of TRF1, only the single Myb-like domain consisting of three helices can bind specifically to double-stranded telomeric DNA. TRF2 also binds to double-stranded telomeric DNA. Although the DNA binding mode of TRF2 is likely identical to that of TRF1, TRF2 plays an important role in the t-loop formation that protects the ends of telomeres. Here, to clarify the details of the double-stranded telomeric DNA-binding modes of TRF1 and TRF2, we determined the solution structure of the DNA-binding domain of human TRF2 bound to telomeric DNA; it consists of three helices, and like TRF1, the third helix recognizes TAGGG sequence in the major groove of DNA with the N-terminal arm locating in the minor groove. However, small but significant differences are observed; in contrast to the minor groove recognition of TRF1, in which an arginine residue recognizes the TT sequence, a lysine residue of TRF2 interacts with the TT part. We examined the telomeric DNA-binding activities of both DNA-binding domains of TRF1 and TRF2 and found that TRF1 binds more strongly than TRF2. Based on the structural differences of both domains, we created several mutants of the DNA-binding domain of TRF2 with stronger binding activities compared to the wild-type TRF2. PMID:15608118

  2. Fungal-type carbohydrate binding modules from the coccolithophore Emiliania huxleyi show binding affinity to cellulose and chitin.

    PubMed

    Rooijakkers, Bart J M; Ikonen, Martina S; Linder, Markus B

    2018-01-01

    Six fungal-type cellulose binding domains were found in the genome of the coccolithophore Emiliania huxleyi and cloned and expressed in Escherichia coli. Sequence comparison indicate high similarity to fungal cellulose binding domains, raising the question of why these domains exist in coccolithophores. The proteins were tested for binding with cellulose and chitin as ligands, which resulted in the identification of two functional carbohydrate binding modules: EHUX2 and EHUX4. Compared to benchmark fungal cellulose binding domain Cel7A-CBM1 from Trichoderma reesei, these proteins showed slightly lower binding to birch and bacterial cellulose, but were more efficient chitin binders. Finally, a set of cellulose binding domains was created based on the shuffling of one well-functioning and one non-functional domain. These were characterized in order to get more information of the binding domain's sequence-function relationship, indicating characteristic differences between the molecular basis of cellulose versus chitin recognition. As previous reports have showed the presence of cellulose in coccoliths and here we find functional cellulose binding modules, a possible connection is discussed.

  3. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy

    PubMed Central

    Matkovich, Scot J.; Dorn, Gerald W.

    2018-01-01

    Summary MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicates purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses. PMID:25836573

  4. Deep sequencing of cardiac microRNA-mRNA interactomes in clinical and experimental cardiomyopathy.

    PubMed

    Matkovich, Scot J; Dorn, Gerald W

    2015-01-01

    MicroRNAs are a family of short (~21 nucleotide) noncoding RNAs that serve key roles in cellular growth and differentiation and the response of the heart to stress stimuli. As the sequence-specific recognition element of RNA-induced silencing complexes (RISCs), microRNAs bind mRNAs and prevent their translation via mechanisms that may include transcript degradation and/or prevention of ribosome binding. Short microRNA sequences and the ability of microRNAs to bind to mRNA sites having only partial/imperfect sequence complementarity complicate purely computational analyses of microRNA-mRNA interactomes. Furthermore, computational microRNA target prediction programs typically ignore biological context, and therefore the principal determinants of microRNA-mRNA binding: the presence and quantity of each. To address these deficiencies we describe an empirical method, developed via studies of stressed and failing hearts, to determine disease-induced changes in microRNAs, mRNAs, and the mRNAs targeted to the RISC, without cross-linking mRNAs to RISC proteins. Deep sequencing methods are used to determine RNA abundances, delivering unbiased, quantitative RNA data limited only by their annotation in the genome of interest. We describe the laboratory bench steps required to perform these experiments, experimental design strategies to achieve an appropriate number of sequencing reads per biological replicate, and computer-based processing tools and procedures to convert large raw sequencing data files into gene expression measures useful for differential expression analyses.

  5. An RNA motif that binds ATP

    NASA Technical Reports Server (NTRS)

    Sassanfar, M.; Szostak, J. W.

    1993-01-01

    RNAs that contain specific high-affinity binding sites for small molecule ligands immobilized on a solid support are present at a frequency of roughly one in 10(10)-10(11) in pools of random sequence RNA molecules. Here we describe a new in vitro selection procedure designed to ensure the isolation of RNAs that bind the ligand of interest in solution as well as on a solid support. We have used this method to isolate a remarkably small RNA motif that binds ATP, a substrate in numerous biological reactions and the universal biological high-energy intermediate. The selected ATP-binding RNAs contain a consensus sequence, embedded in a common secondary structure. The binding properties of ATP analogues and modified RNAs show that the binding interaction is characterized by a large number of close contacts between the ATP and RNA, and by a change in the conformation of the RNA.

  6. BIPAD: A web server for modeling bipartite sequence elements

    PubMed Central

    Bi, Chengpeng; Rogan, Peter K

    2006-01-01

    Background Many dimeric protein complexes bind cooperatively to families of bipartite nucleic acid sequence elements, which consist of pairs of conserved half-site sequences separated by intervening distances that vary among individual sites. Results We introduce the Bipad Server [1], a web interface to predict sequence elements embedded within unaligned sequences. Either a bipartite model, consisting of a pair of one-block position weight matrices (PWM's) with a gap distribution, or a single PWM matrix for contiguous single block motifs may be produced. The Bipad program performs multiple local alignment by entropy minimization and cyclic refinement using a stochastic greedy search strategy. The best models are refined by maximizing incremental information contents among a set of potential models with varying half site and gap lengths. Conclusion The web service generates information positional weight matrices, identifies binding site motifs, graphically represents the set of discovered elements as a sequence logo, and depicts the gap distribution as a histogram. Server performance was evaluated by generating a collection of bipartite models for distinct DNA binding proteins. PMID:16503993

  7. Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of Rat Liver-Derived Cell Lines

    DTIC Science & Technology

    2010-05-22

    member B8 Blue 1370939_at Acsl1 acyl-CoA synthetase long-chain family member 1 Yellow 1372006_at --- --- Blue 1372101_at Ppap2b phosphatidic acid ...Stress L-ascorbic Acid Binding Cation Binding Identical Protein Binding Protein Dimerization Activity Dioxygenase Activity Oxidoreductase...Reference Sequence (RefSeq): a curated non-redundant sequence database of genomes, transcripts, and proteins. Nucleic Acid Research. 35: D61-65. Ryter SW

  8. Identification and verification of hybridoma-derived monoclonal antibody variable region sequences using recombinant DNA technology and mass spectrometry

    USDA-ARS?s Scientific Manuscript database

    Antibody engineering requires the identification of antigen binding domains or variable regions (VR) unique to each antibody. It is the VR that define the unique antigen binding properties and proper sequence identification is essential for functional evaluation and performance of recombinant antibo...

  9. Trichoderma genes

    DOEpatents

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  10. Possible involvement of AMPK in acute exercise-induced expression of monocarboxylate transporters MCT1 and MCT4 mRNA in fast-twitch skeletal muscle.

    PubMed

    Takimoto, Masaki; Takeyama, Mirei; Hamada, Taku

    2013-11-01

    The regulatory mechanisms responsible for acute exercise-induced expression of monocarboxylate transporters MCT1 and MCT4 mRNA in skeletal muscle remain unclear. 5'-adenosine-activated protein kinase (AMPK) is a key signaling molecule that regulates gene expression at the mRNA level. We examined whether AMPK activation is involved in acute exercise-induced expression of MCT1 and MCT4 mRNA in fast-twitch muscle. Male Sprague-Dawley rats were subjected to an acute bout of either 5min high-intensity intermittent swimming (HIS) or 6-h low-intensity prolonged swimming (LIS). The effects of acute exercise on the phosphorylation of AMPK (p-AMPK), calcium/calmodulin pendent kinase II (p-CaMKII), p38 mitogen-activated protein kinase (p-p38MAPK), and MCTs mRNA were analyzed in vivo. To observe the direct effects of AMPK activation on MCTs mRNA, the effects of 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR), caffeine, and dantrolene were analyzed in vitro using an isolated muscle incubation model. The p-AMPK increased in response to both HIS and LIS, although the p-CaMKII and p-p38MAPK were increased only following HIS. Irrespective of exercise intensity, MCT1 and MCT4 mRNA was also transiently upregulated by both HIS and LIS. Direct exposure of the epitrochlearis muscle to 0.5mmol/L AICAR or 1mmol/L caffeine, which activated p-AMPK increased both MCT1 and MCT4 mRNA levels. When pAMPK was inhibited by dantrolene, neither MCT1 nor MCT4 mRNA was increased. These results suggest that acute exercise-induced increases in MCT1 and MCT4 mRNA expression may be possibly mediated by AMPK activation, at least in part in fast-twitch muscle. © 2013.

  11. Tributyltin-induced endoplasmic reticulum stress and its Ca{sup 2+}-mediated mechanism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Isomura, Midori; Kotake, Yaichiro, E-mail: yaichiro@hiroshima-u.ac.jp; Masuda, Kyoichi

    2013-10-01

    Organotin compounds, especially tributyltin chloride (TBT), have been widely used in antifouling paints for marine vessels, but exhibit various toxicities in mammals. The endoplasmic reticulum (ER) is a multifunctional organelle that controls post-translational modification and intracellular Ca{sup 2+} signaling. When the capacity of the quality control system of ER is exceeded under stress including ER Ca{sup 2+} homeostasis disruption, ER functions are impaired and unfolded proteins are accumulated in ER lumen, which is called ER stress. Here, we examined whether TBT causes ER stress in human neuroblastoma SH-SY5Y cells. We found that 700 nM TBT induced ER stress markers suchmore » as CHOP, GRP78, spliced XBP1 mRNA and phosphorylated eIF2α. TBT also decreased the cell viability both concentration- and time-dependently. Dibutyltin and monobutyltin did not induce ER stress markers. We hypothesized that TBT induces ER stress via Ca{sup 2+} depletion, and to test this idea, we examined the effect of TBT on intracellular Ca{sup 2+} concentration using fura-2 AM, a Ca{sup 2+} fluorescent probe. TBT increased intracellular Ca{sup 2+} concentration in a TBT-concentration-dependent manner, and Ca{sup 2+} increase in 700 nM TBT was mainly blocked by 50 μM dantrolene, a ryanodine receptor antagonist (about 70% inhibition). Dantrolene also partially but significantly inhibited TBT-induced GRP78 expression and cell death. These results suggest that TBT increases intracellular Ca{sup 2+} concentration by releasing Ca{sup 2+} from ER, thereby causing ER stress. - Highlights: • We established that tributyltin induces endoplasmic reticulum (ER) stress. • Tributyltin induces ER stress markers in a concentration-dependent manner. • Tributyltin increases Ca{sup 2+} release from ER, thereby causing ER stress. • Dibutyltin and monobutyltin did not increase GRP78 or intracellular Ca{sup 2+}.« less

  12. Localized nuclear and perinuclear Ca(2+) signals in intact mouse skeletal muscle fibers.

    PubMed

    Georgiev, Tihomir; Svirin, Mikhail; Jaimovich, Enrique; Fink, Rainer H A

    2015-01-01

    Nuclear Ca(2+) is important for the regulation of several nuclear processes such as gene expression. Localized Ca(2+) signals (LCSs) in skeletal muscle fibers of mice have been mainly studied as Ca(2+) release events from the sarcoplasmic reticulum. Their location with regard to cell nuclei has not been investigated. Our study is based on the hypothesis that LCSs associated with nuclei are present in skeletal muscle fibers of adult mice. Therefore, we carried out experiments addressing this question and we found novel Ca(2+) signals associated with nuclei of skeletal muscle fibers (with possibly attached satellite cells). We measured localized nuclear and perinuclear Ca(2+) signals (NLCSs and PLCSs) alongside cytosolic localized Ca(2+) signals (CLCSs) during a hypertonic treatment. We also observed NLCSs under isotonic conditions. The NLCSs and PLCSs are Ca(2+) signals in the range of micrometer [FWHM (full width at half maximum): 2.75 ± 0.27 μm (NLCSs) and 2.55 ± 0.17 μm (PLCSs), S.E.M.]. Additionally, global nuclear Ca(2+) signals (NGCSs) were observed. To investigate which type of Ca(2+) channels contribute to the Ca(2+) signals associated with nuclei in skeletal muscle fibers, we performed measurements with the RyR blocker dantrolene, the DHPR blocker nifedipine or the IP3R blocker Xestospongin C. We observed Ca(2+) signals associated with nuclei in the presence of each blocker. Nifedipine and dantrolene had an inhibitory effect on the fraction of fibers with PLCSs. The situation for the fraction of fibers with NLCSs is more complex indicating that RyR is less important for the generation of NLCSs compared to the generation of PLCSs. The fraction of fibers with NLCSs and PLCSs is not reduced in the presence of Xestospongin C. The localized perinuclear and intranuclear Ca(2+) signals may be a powerful tool for the cell to regulate adaptive processes as gene expression. The intranuclear Ca(2+) signals may be particularly interesting in this respect.

  13. From synthetic coiled coils to functional proteins: automated design of a receptor for the calmodulin-binding domain of calcineurin.

    PubMed

    Ghirlanda, G; Lear, J D; Lombardi, A; DeGrado, W F

    1998-08-14

    A series of synthetic receptors capable of binding to the calmodulin-binding domain of calcineurin (CN393-414) was designed, synthesized and characterized. The design was accomplished by docking CN393-414 against a two-helix receptor, using an idealized three-stranded coiled coil as a starting geometry. The sequence of the receptor was chosen using a side-chain re-packing program, which employed a genetic algorithm to select potential binders from a total of 7.5x10(6) possible sequences. A total of 25 receptors were prepared, representing 13 sequences predicted by the algorithm as well as 12 related sequences that were not predicted. The receptors were characterized by CD spectroscopy, analytical ultracentrifugation, and binding assays. The receptors predicted by the algorithm bound CN393-414 with apparent dissociation constants ranging from 0.2 microM to >50 microM. Many of the receptors that were not predicted by the algorithm also bound to CN393-414. Methods to circumvent this problem and to improve the automated design of functional proteins are discussed. Copyright 1998 Academic Press

  14. Predicting the binding preference of transcription factors to individual DNA k-mers.

    PubMed

    Alleyne, Trevis M; Peña-Castillo, Lourdes; Badis, Gwenael; Talukder, Shaheynoor; Berger, Michael F; Gehrke, Andrew R; Philippakis, Anthony A; Bulyk, Martha L; Morris, Quaid D; Hughes, Timothy R

    2009-04-15

    Recognition of specific DNA sequences is a central mechanism by which transcription factors (TFs) control gene expression. Many TF-binding preferences, however, are unknown or poorly characterized, in part due to the difficulty associated with determining their specificity experimentally, and an incomplete understanding of the mechanisms governing sequence specificity. New techniques that estimate the affinity of TFs to all possible k-mers provide a new opportunity to study DNA-protein interaction mechanisms, and may facilitate inference of binding preferences for members of a given TF family when such information is available for other family members. We employed a new dataset consisting of the relative preferences of mouse homeodomains for all eight-base DNA sequences in order to ask how well we can predict the binding profiles of homeodomains when only their protein sequences are given. We evaluated a panel of standard statistical inference techniques, as well as variations of the protein features considered. Nearest neighbour among functionally important residues emerged among the most effective methods. Our results underscore the complexity of TF-DNA recognition, and suggest a rational approach for future analyses of TF families.

  15. Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

    PubMed Central

    Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

    2018-01-01

    Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

  16. Role of indirect readout mechanism in TATA box binding protein-DNA interaction.

    PubMed

    Mondal, Manas; Choudhury, Devapriya; Chakrabarti, Jaydeb; Bhattacharyya, Dhananjay

    2015-03-01

    Gene expression generally initiates from recognition of TATA-box binding protein (TBP) to the minor groove of DNA of TATA box sequence where the DNA structure is significantly different from B-DNA. We have carried out molecular dynamics simulation studies of TBP-DNA system to understand how the DNA structure alters for efficient binding. We observed rigid nature of the protein while the DNA of TATA box sequence has an inherent flexibility in terms of bending and minor groove widening. The bending analysis of the free DNA and the TBP bound DNA systems indicate presence of some similar structures. Principal coordinate ordination analysis also indicates some structural features of the protein bound and free DNA are similar. Thus we suggest that the DNA of TATA box sequence regularly oscillates between several alternate structures and the one suitable for TBP binding is induced further by the protein for proper complex formation.

  17. Specificity determinants for the abscisic acid response element.

    PubMed

    Sarkar, Aditya Kumar; Lahiri, Ansuman

    2013-01-01

    Abscisic acid (ABA) response elements (ABREs) are a group of cis-acting DNA elements that have been identified from promoter analysis of many ABA-regulated genes in plants. We are interested in understanding the mechanism of binding specificity between ABREs and a class of bZIP transcription factors known as ABRE binding factors (ABFs). In this work, we have modeled the homodimeric structure of the bZIP domain of ABRE binding factor 1 from Arabidopsis thaliana (AtABF1) and studied its interaction with ACGT core motif-containing ABRE sequences. We have also examined the variation in the stability of the protein-DNA complex upon mutating ABRE sequences using the protein design algorithm FoldX. The high throughput free energy calculations successfully predicted the ability of ABF1 to bind to alternative core motifs like GCGT or AAGT and also rationalized the role of the flanking sequences in determining the specificity of the protein-DNA interaction.

  18. Direct inhibition of the DNA-binding activity of POU transcription factors Pit-1 and Brn-3 by selective binding of a phenyl-furan-benzimidazole dication.

    PubMed

    Peixoto, Paul; Liu, Yang; Depauw, Sabine; Hildebrand, Marie-Paule; Boykin, David W; Bailly, Christian; Wilson, W David; David-Cordonnier, Marie-Hélène

    2008-06-01

    The development of small molecules to control gene expression could be the spearhead of future-targeted therapeutic approaches in multiple pathologies. Among heterocyclic dications developed with this aim, a phenyl-furan-benzimidazole dication DB293 binds AT-rich sites as a monomer and 5'-ATGA sequence as a stacked dimer, both in the minor groove. Here, we used a protein/DNA array approach to evaluate the ability of DB293 to specifically inhibit transcription factors DNA-binding in a single-step, competitive mode. DB293 inhibits two POU-domain transcription factors Pit-1 and Brn-3 but not IRF-1, despite the presence of an ATGA and AT-rich sites within all three consensus sequences. EMSA, DNase I footprinting and surface-plasmon-resonance experiments determined the precise binding site, affinity and stoichiometry of DB293 interaction to the consensus targets. Binding of DB293 occurred as a cooperative dimer on the ATGA part of Brn-3 site but as two monomers on AT-rich sites of IRF-1 sequence. For Pit-1 site, ATGA or AT-rich mutated sequences identified the contribution of both sites for DB293 recognition. In conclusion, DB293 is a strong inhibitor of two POU-domain transcription factors through a cooperative binding to ATGA. These findings are the first to show that heterocyclic dications can inhibit major groove transcription factors and they open the door to the control of transcription factors activity by those compounds.

  19. Sequence-specific DNA binding by MYC/MAX to low-affinity non-E-box motifs.

    PubMed

    Allevato, Michael; Bolotin, Eugene; Grossman, Mark; Mane-Padros, Daniel; Sladek, Frances M; Martinez, Ernest

    2017-01-01

    The MYC oncoprotein regulates transcription of a large fraction of the genome as an obligatory heterodimer with the transcription factor MAX. The MYC:MAX heterodimer and MAX:MAX homodimer (hereafter MYC/MAX) bind Enhancer box (E-box) DNA elements (CANNTG) and have the greatest affinity for the canonical MYC E-box (CME) CACGTG. However, MYC:MAX also recognizes E-box variants and was reported to bind DNA in a "non-specific" fashion in vitro and in vivo. Here, in order to identify potential additional non-canonical binding sites for MYC/MAX, we employed high throughput in vitro protein-binding microarrays, along with electrophoretic mobility-shift assays and bioinformatic analyses of MYC-bound genomic loci in vivo. We identified all hexameric motifs preferentially bound by MYC/MAX in vitro, which include the low-affinity non-E-box sequence AACGTT, and found that the vast majority (87%) of MYC-bound genomic sites in a human B cell line contain at least one of the top 21 motifs bound by MYC:MAX in vitro. We further show that high MYC/MAX concentrations are needed for specific binding to the low-affinity sequence AACGTT in vitro and that elevated MYC levels in vivo more markedly increase the occupancy of AACGTT sites relative to CME sites, especially at distal intergenic and intragenic loci. Hence, MYC binds diverse DNA motifs with a broad range of affinities in a sequence-specific and dose-dependent manner, suggesting that MYC overexpression has more selective effects on the tumor transcriptome than previously thought.

  20. The gene for stinging nettle lectin (Urtica dioica agglutinin) encodes both a lectin and a chitinase.

    PubMed

    Lerner, D R; Raikhel, N V

    1992-06-05

    Chitin-binding proteins are present in a wide range of plant species, including both monocots and dicots, even though these plants contain no chitin. To investigate the relationship between in vitro antifungal and insecticidal activities of chitin-binding proteins and their unknown endogenous functions, the stinging nettle lectin (Urtica dioica agglutinin, UDA) cDNA was cloned using a synthetic gene as the probe. The nettle lectin cDNA clone contained an open reading frame encoding 374 amino acids. Analysis of the deduced amino acid sequence revealed a 21-amino acid putative signal sequence and the 86 amino acids encoding the two chitin-binding domains of nettle lectin. These domains were fused to a 19-amino acid "spacer" domain and a 244-amino acid carboxyl extension with partial identity to a chitinase catalytic domain. The authenticity of the cDNA clone was confirmed by deduced amino acid sequence identity with sequence data obtained from tryptic digests, RNA gel blot, and polymerase chain reaction analyses. RNA gel blot analysis also showed the nettle lectin message was present primarily in rhizomes and inflorescence (with immature seeds) but not in leaves or stems. Chitinase enzymatic activity was found when the chitinase-like domain alone or the chitinase-like domain with the chitin-binding domains were expressed in Escherichia coli. This is the first example of a chitin-binding protein with both a duplication of the 43-amino acid chitin-binding domain and a fusion of the chitin-binding domains to a structurally unrelated domain, the chitinase domain.

  1. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain.

    PubMed

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-06-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  2. The NH2-terminal php domain of the alpha subunit of the Escherichia coli replicase binds the epsilon proofreading subunit.

    PubMed

    Wieczorek, Anna; McHenry, Charles S

    2006-05-05

    The alpha subunit of the replicase of all bacteria contains a php domain, initially identified by its similarity to histidinol phosphatase but of otherwise unknown function (Aravind, L., and Koonin, E. V. (1998) Nucleic Acids Res. 26, 3746-3752). Deletion of 60 residues from the NH2 terminus of the alpha php domain destroys epsilon binding. The minimal 255-residue php domain, estimated by sequence alignment with homolog YcdX, is insufficient for epsilon binding. However, a 320-residue segment including sequences that immediately precede the polymerase domain binds epsilon with the same affinity as the 1160-residue full-length alpha subunit. A subset of mutations of a conserved acidic residue (Asp43 in Escherichia coli alpha) present in the php domain of all bacterial replicases resulted in defects in epsilon binding. Using sequence alignments, we show that the prototypical gram+ Pol C, which contains the polymerase and proofreading activities within the same polypeptide chain, has an epsilon-like sequence inserted in a surface loop near the center of the homologous YcdX protein. These findings suggest that the php domain serves as a platform to enable coordination of proofreading and polymerase activities during chromosomal replication.

  3. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik

    2014-01-01

    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  4. Characterization of monocarboxylate transporter 1 (MCT1) binding affinity for Basigin gene products and L1cam.

    PubMed

    Howard, John; Finch, Nicole A; Ochrietor, Judith D

    2010-07-01

    The purpose of this study was to determine the binding affinities of Basigin gene products and neural cell adhesion molecule L1cam for monocarboxylate transporter-1 (MCT1). ELISA binding assays were performed in which recombinant proteins of the transmembrane domains of Basigin gene products and L1cam were incubated with MCT1 captured from mouse brain. It was determined that Basigin gene products bind MCT1 with moderate affinity, but L1cam does not bind MCT1. Despite a high degree of sequence conservation between Basigin gene products and L1cam, the sequences are different enough to prevent L1cam from interacting with MCT1.

  5. Characterization of a protein that binds multiple sequences in mammalian type C retrovirus enhancers.

    PubMed Central

    Sun, W; O'Connell, M; Speck, N A

    1993-01-01

    Mammalian type C retrovirus enhancer factor 1 (MCREF-1) is a nuclear protein that binds several directly repeated sequences (CNGGN6CNGG) in the Moloney and Friend murine leukemia virus (MLV) enhancers (N. R. Manley, M. O'Connell, W. Sun, N. A. Speck, and N. Hopkins, J. Virol. 67:1967-1975, 1993). In this paper, we describe the partial purification of MCREF-1 from calf thymus nuclei and further characterize the binding properties of MCREF-1. MCREF-1 binds four sites in the Moloney MLV enhancer and three sites in the Friend MLV enhancer. Ethylation interference analysis suggests that the MCREF-1 binding site spans two adjacent minor grooves of DNA. Images PMID:8445719

  6. A Feature-Based Approach to Modeling Protein–DNA Interactions

    PubMed Central

    Segal, Eran

    2008-01-01

    Transcription factor (TF) binding to its DNA target site is a fundamental regulatory interaction. The most common model used to represent TF binding specificities is a position specific scoring matrix (PSSM), which assumes independence between binding positions. However, in many cases, this simplifying assumption does not hold. Here, we present feature motif models (FMMs), a novel probabilistic method for modeling TF–DNA interactions, based on log-linear models. Our approach uses sequence features to represent TF binding specificities, where each feature may span multiple positions. We develop the mathematical formulation of our model and devise an algorithm for learning its structural features from binding site data. We also developed a discriminative motif finder, which discovers de novo FMMs that are enriched in target sets of sequences compared to background sets. We evaluate our approach on synthetic data and on the widely used TF chromatin immunoprecipitation (ChIP) dataset of Harbison et al. We then apply our algorithm to high-throughput TF ChIP data from mouse and human, reveal sequence features that are present in the binding specificities of mouse and human TFs, and show that FMMs explain TF binding significantly better than PSSMs. Our FMM learning and motif finder software are available at http://genie.weizmann.ac.il/. PMID:18725950

  7. Discovery of 12-mer peptides that bind to wood lignin

    PubMed Central

    Yamaguchi, Asako; Isozaki, Katsuhiro; Nakamura, Masaharu; Takaya, Hikaru; Watanabe, Takashi

    2016-01-01

    Lignin, an abundant terrestrial polymer, is the only large-volume renewable feedstock composed of an aromatic skeleton. Lignin has been used mostly as an energy source during paper production; however, recent interest in replacing fossil fuels with renewable resources has highlighted its potential value in providing aromatic chemicals. Highly selective degradation of lignin is pivotal for industrial production of paper, biofuels, chemicals, and materials. However, few studies have examined natural and synthetic molecular components recognizing the heterogeneous aromatic polymer. Here, we report the first identification of lignin-binding peptides possessing characteristic sequences using a phage display technique. The consensus sequence HFPSP was found in several lignin-binding peptides, and the outer amino acid sequence affected the binding affinity of the peptides. Substitution of phenylalanine7 with Ile in the lignin-binding peptide C416 (HFPSPIFQRHSH) decreased the affinity of the peptide for softwood lignin without changing its affinity for hardwood lignin, indicating that C416 recognised structural differences between the lignins. Circular dichroism spectroscopy demonstrated that this peptide adopted a highly flexible random coil structure, allowing key residues to be appropriately arranged in relation to the binding site in lignin. These results provide a useful platform for designing synthetic and biological catalysts selectively bind to lignin. PMID:26903196

  8. Crystal Structures of the Scaffolding Protein LGN Reveal the General Mechanism by Which GoLoco Binding Motifs Inhibit the Release of GDP from Gαi *

    PubMed Central

    Jia, Min; Li, Jianchao; Zhu, Jinwei; Wen, Wenyu; Zhang, Mingjie; Wang, Wenning

    2012-01-01

    GoLoco (GL) motif-containing proteins regulate G protein signaling by binding to Gα subunit and acting as guanine nucleotide dissociation inhibitors. GLs of LGN are also known to bind the GDP form of Gαi/o during asymmetric cell division. Here, we show that the C-terminal GL domain of LGN binds four molecules of Gαi·GDP. The crystal structures of Gαi·GDP in complex with LGN GL3 and GL4, respectively, reveal distinct GL/Gαi interaction features when compared with the only high resolution structure known with GL/Gαi interaction between RGS14 and Gαi1. Only a few residues C-terminal to the conserved GL sequence are required for LGN GLs to bind to Gαi·GDP. A highly conserved “double Arg finger” sequence (RΨ(D/E)(D/E)QR) is responsible for LGN GL to bind to GDP bound to Gαi. Together with the sequence alignment, we suggest that the LGN GL/Gαi interaction represents a general binding mode between GL motifs and Gαi. We also show that LGN GLs are potent guanine nucleotide dissociation inhibitors. PMID:22952234

  9. Inverted repeats in the promoter as an autoregulatory sequence for TcrX in Mycobacterium tuberculosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhattacharya, Monolekha; Das, Amit Kumar, E-mail: amitk@hijli.iitkgp.ernet.in

    Highlights: Black-Right-Pointing-Pointer The regulatory sequences recognized by TcrX have been identified. Black-Right-Pointing-Pointer The regulatory region comprises of inverted repeats segregated by 30 bp region. Black-Right-Pointing-Pointer The mode of binding of TcrX with regulatory sequence is unique. Black-Right-Pointing-Pointer In silico TcrX-DNA docked model binds one of the inverted repeats. Black-Right-Pointing-Pointer Both phosphorylated and unphosphorylated TcrX binds regulatory sequence in vitro. -- Abstract: TcrY, a histidine kinase, and TcrX, a response regulator, constitute a two-component system in Mycobacterium tuberculosis. tcrX, which is expressed during iron scarcity, is instrumental in the survival of iron-dependent M. tuberculosis. However, the regulator of tcrX/Y has notmore » been fully characterized. Crosslinking studies of TcrX reveal that it can form oligomers in vitro. Electrophoretic mobility shift assays (EMSAs) show that TcrX recognizes two regions in the promoter that are comprised of inverted repeats separated by {approx}30 bp. The dimeric in silico model of TcrX predicts binding to one of these inverted repeat regions. Site-directed mutagenesis and radioactive phosphorylation indicate that D54 of TcrX is phosphorylated by H256 of TcrY. However, phosphorylated and unphosphorylated TcrX bind the regulatory sequence with equal efficiency, which was shown with an EMSA using the D54A TcrX mutant.« less

  10. NMR studies of DNA oligomers and their interactions with minor groove binding ligands

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fagan, Patricia A.

    1996-05-01

    The cationic peptide ligands distamycin and netropsin bind noncovalently to the minor groove of DNA. The binding site, orientation, stoichiometry, and qualitative affinity of distamycin binding to several short DNA oligomers were investigated by NMR spectroscopy. The oligomers studied contain A,T-rich or I,C-rich binding sites, where I = 2-desaminodeoxyguanosine. I•C base pairs are functional analogs of A•T base pairs in the minor groove. The different behaviors exhibited by distamycin and netropsin binding to various DNA sequences suggested that these ligands are sensitive probes of DNA structure. For sites of five or more base pairs, distamycin can form 1:1 or 2:1more » ligand:DNA complexes. Cooperativity in distamycin binding is low in sites such as AAAAA which has narrow minor grooves, and is higher in sites with wider minor grooves such as ATATAT. The distamycin binding and base pair opening lifetimes of I,C-containing DNA oligomers suggest that the I,C minor groove is structurally different from the A,T minor groove. Molecules which direct chemistry to a specific DNA sequence could be used as antiviral compounds, diagnostic probes, or molecular biology tools. The author studied two ligands in which reactive groups were tethered to a distamycin to increase the sequence specificity of the reactive agent.« less

  11. A novel progesterone receptor membrane component (PGRMC) in the human and swine parasite Taenia solium: implications to the host-parasite relationship.

    PubMed

    Aguilar-Díaz, Hugo; Nava-Castro, Karen E; Escobedo, Galileo; Domínguez-Ramírez, Lenin; García-Varela, Martín; Del Río-Araiza, Víctor H; Palacios-Arreola, Margarita I; Morales-Montor, Jorge

    2018-03-09

    We have previously reported that progesterone (P 4 ) has a direct in vitro effect on the scolex evagination and growth of Taenia solium cysticerci. Here, we explored the hypothesis that the P 4 direct effect on T. solium might be mediated by a novel steroid-binding parasite protein. By way of using immunofluorescent confocal microscopy, flow cytometry analysis, double-dimension electrophoresis analysis, and sequencing the corresponding protein spot, we detected a novel PGRMC in T. solium. Molecular modeling studies accompanied by computer docking using the sequenced protein, together with phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is from parasite origin. Our results show that P 4 in vitro increases parasite evagination and scolex size. Using immunofluorescent confocal microscopy, we detected that parasite cells showed expression of a P 4 -binding like protein exclusively located at the cysticercus subtegumental tissue. Presence of the P 4 -binding protein in cyst cells was also confirmed by flow cytometry. Double-dimension electrophoresis analysis, followed by sequencing the corresponding protein spot, revealed a protein that was previously reported in the T. solium genome belonging to a membrane-associated progesterone receptor component (PGRMC). Molecular modeling studies accompanied by computer docking using the sequenced protein showed that PGRMC is potentially able to bind steroid hormones such as progesterone, estradiol, testosterone and dihydrodrotestosterone with different affinities. Phylogenetic analysis and sequence alignment clearly demonstrated that T. solium PGRMC is related to a steroid-binding protein of Echinoccocus granulosus, both of them being nested within a cluster including similar proteins present in platyhelminths such as Schistocephalus solidus and Schistosoma haematobium. Progesterone may directly act upon T. solium cysticerci probably by binding to PGRMC. This research has implications in the field of host-parasite co-evolution as well as the sex-associated susceptibility to this infection. In a more practical matter, present results may contribute to the molecular design of new drugs with anti-parasite actions.

  12. Phyloscan: locating transcription-regulating binding sites in mixed aligned and unaligned sequence data.

    PubMed

    Palumbo, Michael J; Newberg, Lee A

    2010-07-01

    The transcription of a gene from its DNA template into an mRNA molecule is the first, and most heavily regulated, step in gene expression. Especially in bacteria, regulation is typically achieved via the binding of a transcription factor (protein) or small RNA molecule to the chromosomal region upstream of a regulated gene. The protein or RNA molecule recognizes a short, approximately conserved sequence within a gene's promoter region and, by binding to it, either enhances or represses expression of the nearby gene. Since the sought-for motif (pattern) is short and accommodating to variation, computational approaches that scan for binding sites have trouble distinguishing functional sites from look-alikes. Many computational approaches are unable to find the majority of experimentally verified binding sites without also finding many false positives. Phyloscan overcomes this difficulty by exploiting two key features of functional binding sites: (i) these sites are typically more conserved evolutionarily than are non-functional DNA sequences; and (ii) these sites often occur two or more times in the promoter region of a regulated gene. The website is free and open to all users, and there is no login requirement. Address: (http://bayesweb.wadsworth.org/phyloscan/).

  13. Expression cloning and characterization of a novel gene that encodes the RNA-binding protein FAU-1 from Pyrococcus furiosus.

    PubMed Central

    Kanai, Akio; Oida, Hanako; Matsuura, Nana; Doi, Hirofumi

    2003-01-01

    We systematically screened a genomic DNA library to identify proteins of the hyperthermophilic archaeon Pyrococcus furiosus using an expression cloning method. One gene product, which we named FAU-1 (P. furiosus AU-binding), demonstrated the strongest binding activity of all the genomic library-derived proteins tested against an AU-rich RNA sequence. The protein was purified to near homogeneity as a 54 kDa single polypeptide, and the gene locus corresponding to this FAU-1 activity was also sequenced. The FAU-1 gene encoded a 472-amino-acid protein that was characterized by highly charged domains consisting of both acidic and basic amino acids. The N-terminal half of the gene had a degree of similarity (25%) with RNase E from Escherichia coli. Five rounds of RNA-binding-site selection and footprinting analysis showed that the FAU-1 protein binds specifically to the AU-rich sequence in a loop region of a possible RNA ligand. Moreover, we demonstrated that the FAU-1 protein acts as an oligomer, and mainly as a trimer. These results showed that the FAU-1 protein is a novel heat-stable protein with an RNA loop-binding characteristic. PMID:12614195

  14. Definition of IgG- and albumin-binding regions of streptococcal protein G.

    PubMed

    Akerström, B; Nielsen, E; Björck, L

    1987-10-05

    Protein G, the immunoglobin G-binding surface protein of group C and G streptococci, also binds serum albumin. The albumin-binding site on protein G is distinct from the immunoglobulin G-binding site. By mild acid hydrolysis of the papain-liberated protein G fragment (35 kDa), a 28-kDa fragment was produced which retained full immunoglobulin G-binding activity (determined by Scatchard plotting) but had lost all albumin-binding capacity. A protein G (65 kDa), isolated after cloning and expression of the protein G gene in Escherichia coli, had comparable affinity to immunoglobulin G (5-10 X 10(10)M-1), but much higher affinity to albumin than the 35- and 28-kDa protein G fragments (31, 2.6, and 0 X 10(9)M-1, respectively). The amino-terminal amino acid sequences of the 65-, 35-, and 28-kDa fragments allowed us to exactly locate the three fragments in an overall sequence map of protein G, based on the partial gene sequences published by Guss et al. (Guss, B., Eliasson, M., Olsson, A., Uhlen, M., Frej, A.-K., Jörnvall, H., Flock, J.-I., and Lindberg, M. (1986) EMBO J. 5, 1567-1575) and Fahnestock et al. (Fahnestock, S. R., Alexander, P., Nagle, J., and Filpula, D. (1986) J. Bacteriol. 167, 870-880). In this map could then be deduced the location of three homologous albumin-binding regions and three homologous immunoglobulin G-binding regions.

  15. The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.

    PubMed

    Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M

    1992-02-01

    The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs. The presence in shark liver of an FABP which differs substantially in primary structure from mammalian liver FABP, while being closely related to the FABP expressed in mammalian heart muscle, peripheral nerve myelin and adipocytes, opens a further dimension regarding the question of the existence of structure-dependent and tissue-specific specialization of FABP function in lipid metabolism.

  16. Transcription Factor Information System (TFIS): A Tool for Detection of Transcription Factor Binding Sites.

    PubMed

    Narad, Priyanka; Kumar, Abhishek; Chakraborty, Amlan; Patni, Pranav; Sengupta, Abhishek; Wadhwa, Gulshan; Upadhyaya, K C

    2017-09-01

    Transcription factors are trans-acting proteins that interact with specific nucleotide sequences known as transcription factor binding site (TFBS), and these interactions are implicated in regulation of the gene expression. Regulation of transcriptional activation of a gene often involves multiple interactions of transcription factors with various sequence elements. Identification of these sequence elements is the first step in understanding the underlying molecular mechanism(s) that regulate the gene expression. For in silico identification of these sequence elements, we have developed an online computational tool named transcription factor information system (TFIS) for detecting TFBS for the first time using a collection of JAVA programs and is mainly based on TFBS detection using position weight matrix (PWM). The database used for obtaining position frequency matrices (PFM) is JASPAR and HOCOMOCO, which is an open-access database of transcription factor binding profiles. Pseudo-counts are used while converting PFM to PWM, and TFBS detection is carried out on the basis of percent score taken as threshold value. TFIS is equipped with advanced features such as direct sequence retrieving from NCBI database using gene identification number and accession number, detecting binding site for common TF in a batch of gene sequences, and TFBS detection after generating PWM from known raw binding sequences in addition to general detection methods. TFIS can detect the presence of potential TFBSs in both the directions at the same time. This feature increases its efficiency. And the results for this dual detection are presented in different colors specific to the orientation of the binding site. Results obtained by the TFIS are more detailed and specific to the detected TFs as integration of more informative links from various related web servers are added in the result pages like Gene Ontology, PAZAR database and Transcription Factor Encyclopedia in addition to NCBI and UniProt. Common TFs like SP1, AP1 and NF-KB of the Amyloid beta precursor gene is easily detected using TFIS along with multiple binding sites. In another scenario of embryonic developmental process, TFs of the FOX family (FOXL1 and FOXC1) were also identified. TFIS is platform-independent which is publicly available along with its support and documentation at http://tfistool.appspot.com and http://www.bioinfoplus.com/tfis/ . TFIS is licensed under the GNU General Public License, version 3 (GPL-3.0).

  17. Elucidating the 16S rRNA 3' boundaries and defining optimal SD/aSD pairing in Escherichia coli and Bacillus subtilis using RNA-Seq data.

    PubMed

    Wei, Yulong; Silke, Jordan R; Xia, Xuhua

    2017-12-15

    Bacterial translation initiation is influenced by base pairing between the Shine-Dalgarno (SD) sequence in the 5' UTR of mRNA and the anti-SD (aSD) sequence at the free 3' end of the 16S rRNA (3' TAIL) due to: 1) the SD/aSD sequence binding location and 2) SD/aSD binding affinity. In order to understand what makes an SD/aSD interaction optimal, we must define: 1) terminus of the 3' TAIL and 2) extent of the core aSD sequence within the 3' TAIL. Our approach to characterize these components in Escherichia coli and Bacillus subtilis involves 1) mapping the 3' boundary of the mature 16S rRNA using high-throughput RNA sequencing (RNA-Seq), and 2) identifying the segment within the 3' TAIL that is strongly preferred in SD/aSD pairing. Using RNA-Seq data, we resolve previous discrepancies in the reported 3' TAIL in B. subtilis and recovered the established 3' TAIL in E. coli. Furthermore, we extend previous studies to suggest that both highly and lowly expressed genes favor SD sequences with intermediate binding affinity, but this trend is exclusive to SD sequences that complement the core aSD sequences defined herein.

  18. Accurate and sensitive quantification of protein-DNA binding affinity.

    PubMed

    Rastogi, Chaitanya; Rube, H Tomas; Kribelbauer, Judith F; Crocker, Justin; Loker, Ryan E; Martini, Gabriella D; Laptenko, Oleg; Freed-Pastor, William A; Prives, Carol; Stern, David L; Mann, Richard S; Bussemaker, Harmen J

    2018-04-17

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. Copyright © 2018 the Author(s). Published by PNAS.

  19. Accurate and sensitive quantification of protein-DNA binding affinity

    PubMed Central

    Rastogi, Chaitanya; Rube, H. Tomas; Kribelbauer, Judith F.; Crocker, Justin; Loker, Ryan E.; Martini, Gabriella D.; Laptenko, Oleg; Freed-Pastor, William A.; Prives, Carol; Stern, David L.; Mann, Richard S.; Bussemaker, Harmen J.

    2018-01-01

    Transcription factors (TFs) control gene expression by binding to genomic DNA in a sequence-specific manner. Mutations in TF binding sites are increasingly found to be associated with human disease, yet we currently lack robust methods to predict these sites. Here, we developed a versatile maximum likelihood framework named No Read Left Behind (NRLB) that infers a biophysical model of protein-DNA recognition across the full affinity range from a library of in vitro selected DNA binding sites. NRLB predicts human Max homodimer binding in near-perfect agreement with existing low-throughput measurements. It can capture the specificity of the p53 tetramer and distinguish multiple binding modes within a single sample. Additionally, we confirm that newly identified low-affinity enhancer binding sites are functional in vivo, and that their contribution to gene expression matches their predicted affinity. Our results establish a powerful paradigm for identifying protein binding sites and interpreting gene regulatory sequences in eukaryotic genomes. PMID:29610332

  20. Context influences on TALE–DNA binding revealed by quantitative profiling

    PubMed Central

    Rogers, Julia M.; Barrera, Luis A.; Reyon, Deepak; Sander, Jeffry D.; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L.

    2015-01-01

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE–DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000–20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE–DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design. PMID:26067805

  1. Context influences on TALE-DNA binding revealed by quantitative profiling.

    PubMed

    Rogers, Julia M; Barrera, Luis A; Reyon, Deepak; Sander, Jeffry D; Kellis, Manolis; Joung, J Keith; Bulyk, Martha L

    2015-06-11

    Transcription activator-like effector (TALE) proteins recognize DNA using a seemingly simple DNA-binding code, which makes them attractive for use in genome engineering technologies that require precise targeting. Although this code is used successfully to design TALEs to target specific sequences, off-target binding has been observed and is difficult to predict. Here we explore TALE-DNA interactions comprehensively by quantitatively assaying the DNA-binding specificities of 21 representative TALEs to ∼5,000-20,000 unique DNA sequences per protein using custom-designed protein-binding microarrays (PBMs). We find that protein context features exert significant influences on binding. Thus, the canonical recognition code does not fully capture the complexity of TALE-DNA binding. We used the PBM data to develop a computational model, Specificity Inference For TAL-Effector Design (SIFTED), to predict the DNA-binding specificity of any TALE. We provide SIFTED as a publicly available web tool that predicts potential genomic off-target sites for improved TALE design.

  2. Sequence-Based Prediction of RNA-Binding Residues in Proteins.

    PubMed

    Walia, Rasna R; El-Manzalawy, Yasser; Honavar, Vasant G; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein-RNA complexes is important for understanding the molecular determinants of protein-RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein-RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein-RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner.

  3. Sequence-Based Prediction of RNA-Binding Residues in Proteins

    PubMed Central

    Walia, Rasna R.; EL-Manzalawy, Yasser; Honavar, Vasant G.; Dobbs, Drena

    2017-01-01

    Identifying individual residues in the interfaces of protein–RNA complexes is important for understanding the molecular determinants of protein–RNA recognition and has many potential applications. Recent technical advances have led to several high-throughput experimental methods for identifying partners in protein–RNA complexes, but determining RNA-binding residues in proteins is still expensive and time-consuming. This chapter focuses on available computational methods for identifying which amino acids in an RNA-binding protein participate directly in contacting RNA. Step-by-step protocols for using three different web-based servers to predict RNA-binding residues are described. In addition, currently available web servers and software tools for predicting RNA-binding sites, as well as databases that contain valuable information about known protein–RNA complexes, RNA-binding motifs in proteins, and protein-binding recognition sites in RNA are provided. We emphasize sequence-based methods that can reliably identify interfacial residues without the requirement for structural information regarding either the RNA-binding protein or its RNA partner. PMID:27787829

  4. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE PAGES

    Paugh, Steven W.; Coss, David R.; Bao, Ju; ...

    2016-02-04

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  5. Generation of Aptamers from A Primer-Free Randomized ssDNA Library Using Magnetic-Assisted Rapid Aptamer Selection

    NASA Astrophysics Data System (ADS)

    Tsao, Shih-Ming; Lai, Ji-Ching; Horng, Horng-Er; Liu, Tu-Chen; Hong, Chin-Yih

    2017-04-01

    Aptamers are oligonucleotides that can bind to specific target molecules. Most aptamers are generated using random libraries in the standard systematic evolution of ligands by exponential enrichment (SELEX). Each random library contains oligonucleotides with a randomized central region and two fixed primer regions at both ends. The fixed primer regions are necessary for amplifying target-bound sequences by PCR. However, these extra-sequences may cause non-specific bindings, which potentially interfere with good binding for random sequences. The Magnetic-Assisted Rapid Aptamer Selection (MARAS) is a newly developed protocol for generating single-strand DNA aptamers. No repeat selection cycle is required in the protocol. This study proposes and demonstrates a method to isolate aptamers for C-reactive proteins (CRP) from a randomized ssDNA library containing no fixed sequences at 5‧ and 3‧ termini using the MARAS platform. Furthermore, the isolated primer-free aptamer was sequenced and binding affinity for CRP was analyzed. The specificity of the obtained aptamer was validated using blind serum samples. The result was consistent with monoclonal antibody-based nephelometry analysis, which indicated that a primer-free aptamer has high specificity toward targets. MARAS is a feasible platform for efficiently generating primer-free aptamers for clinical diagnoses.

  6. MicroRNAs form triplexes with double stranded DNA at sequence-specific binding sites; a eukaryotic mechanism via which microRNAs could directly alter gene expression

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Paugh, Steven W.; Coss, David R.; Bao, Ju

    MicroRNAs are important regulators of gene expression, acting primarily by binding to sequence-specific locations on already transcribed messenger RNAs (mRNA). Recent studies indicate that microRNAs may also play a role in up-regulating mRNA transcription levels, although a definitive mechanism has not been established. Double-helical DNA is capable of forming triple-helical structures through Hoogsteen and reverse Hoogsteen interactions in the major groove of the duplex, and we show physical evidence that microRNAs form triple-helical structures with duplex DNA, and identify microRNA sequences that favor triplex formation. We developed an algorithm (Trident) to search genome-wide for potential triplex-forming sites and show thatmore » several mammalian and non-mammalian genomes are enriched for strong microRNA triplex binding sites. We show that those genes containing sequences favoring microRNA triplex formation are markedly enriched (3.3 fold, p<2.2 x 10 -16) for genes whose expression is positively correlated with expression of microRNAs targeting triplex binding sequences. As a result, this work has thus revealed a new mechanism by which microRNAs can interact with gene promoter regions to modify gene transcription.« less

  7. Structural basis of UGUA recognition by the Nudix protein CFIm25 and implications for a regulatory role in mRNA 3′ processing

    PubMed Central

    Yang, Qin; Gilmartin, Gregory M.; Doublié, Sylvie

    2010-01-01

    Human Cleavage Factor Im (CFIm) is an essential component of the pre-mRNA 3′ processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFIm25) of the CFIm complex possesses a characteristic α/β/α Nudix fold, CFIm25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFIm25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFIm25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson–Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap4A (diadenosine tetraphosphate) by CFIm25 suggests a potential role for small molecules in the regulation of mRNA 3′ processing. PMID:20479262

  8. Structural basis of UGUA recognition by the Nudix protein CFI(m)25 and implications for a regulatory role in mRNA 3' processing.

    PubMed

    Yang, Qin; Gilmartin, Gregory M; Doublié, Sylvie

    2010-06-01

    Human Cleavage Factor Im (CFI(m)) is an essential component of the pre-mRNA 3' processing complex that functions in the regulation of poly(A) site selection through the recognition of UGUA sequences upstream of the poly(A) site. Although the highly conserved 25 kDa subunit (CFI(m)25) of the CFI(m) complex possesses a characteristic alpha/beta/alpha Nudix fold, CFI(m)25 has no detectable hydrolase activity. Here we report the crystal structures of the human CFI(m)25 homodimer in complex with UGUAAA and UUGUAU RNA sequences. CFI(m)25 is the first Nudix protein to be reported to bind RNA in a sequence-specific manner. The UGUA sequence contributes to binding specificity through an intramolecular G:A Watson-Crick/sugar-edge base interaction, an unusual pairing previously found to be involved in the binding specificity of the SAM-III riboswitch. The structures, together with mutational data, suggest a novel mechanism for the simultaneous sequence-specific recognition of two UGUA elements within the pre-mRNA. Furthermore, the mutually exclusive binding of RNA and the signaling molecule Ap(4)A (diadenosine tetraphosphate) by CFI(m)25 suggests a potential role for small molecules in the regulation of mRNA 3' processing.

  9. Using RSAT to scan genome sequences for transcription factor binding sites and cis-regulatory modules.

    PubMed

    Turatsinze, Jean-Valery; Thomas-Chollier, Morgane; Defrance, Matthieu; van Helden, Jacques

    2008-01-01

    This protocol shows how to detect putative cis-regulatory elements and regions enriched in such elements with the regulatory sequence analysis tools (RSAT) web server (http://rsat.ulb.ac.be/rsat/). The approach applies to known transcription factors, whose binding specificity is represented by position-specific scoring matrices, using the program matrix-scan. The detection of individual binding sites is known to return many false predictions. However, results can be strongly improved by estimating P value, and by searching for combinations of sites (homotypic and heterotypic models). We illustrate the detection of sites and enriched regions with a study case, the upstream sequence of the Drosophila melanogaster gene even-skipped. This protocol is also tested on random control sequences to evaluate the reliability of the predictions. Each task requires a few minutes of computation time on the server. The complete protocol can be executed in about one hour.

  10. Protein sequences bound to mineral surfaces persist into deep time

    PubMed Central

    Demarchi, Beatrice; Hall, Shaun; Roncal-Herrero, Teresa; Freeman, Colin L; Woolley, Jos; Crisp, Molly K; Wilson, Julie; Fotakis, Anna; Fischer, Roman; Kessler, Benedikt M; Rakownikow Jersie-Christensen, Rosa; Olsen, Jesper V; Haile, James; Thomas, Jessica; Marean, Curtis W; Parkington, John; Presslee, Samantha; Lee-Thorp, Julia; Ditchfield, Peter; Hamilton, Jacqueline F; Ward, Martyn W; Wang, Chunting Michelle; Shaw, Marvin D; Harrison, Terry; Domínguez-Rodrigo, Manuel; MacPhee, Ross DE; Kwekason, Amandus; Ecker, Michaela; Kolska Horwitz, Liora; Chazan, Michael; Kröger, Roland; Thomas-Oates, Jane; Harding, John H; Cappellini, Enrico; Penkman, Kirsty; Collins, Matthew J

    2016-01-01

    Proteins persist longer in the fossil record than DNA, but the longevity, survival mechanisms and substrates remain contested. Here, we demonstrate the role of mineral binding in preserving the protein sequence in ostrich (Struthionidae) eggshell, including from the palaeontological sites of Laetoli (3.8 Ma) and Olduvai Gorge (1.3 Ma) in Tanzania. By tracking protein diagenesis back in time we find consistent patterns of preservation, demonstrating authenticity of the surviving sequences. Molecular dynamics simulations of struthiocalcin-1 and -2, the dominant proteins within the eggshell, reveal that distinct domains bind to the mineral surface. It is the domain with the strongest calculated binding energy to the calcite surface that is selectively preserved. Thermal age calculations demonstrate that the Laetoli and Olduvai peptides are 50 times older than any previously authenticated sequence (equivalent to ~16 Ma at a constant 10°C). DOI: http://dx.doi.org/10.7554/eLife.17092.001 PMID:27668515

  11. Preferential binding of daunomycin to 5'ATCG and 5'ATGC sequences revealed by footprinting titration experiments.

    PubMed

    Chaires, J B; Herrera, J E; Waring, M J

    1990-07-03

    Results from a high-resolution deoxyribonuclease I (DNase I) footprinting titration procedure are described that identify preferred daunomycin binding sites within the 160 bp tyr T DNA fragment. We have obtained single-bond resolution at 65 of the 160 potential binding sites within the tyr T fragment and have examined the effect of 0-3.0 microM total daunomycin concentration on the susceptibility of these sites toward digestion by DNase I. Four types of behavior are observed: (i) protection from DNase I cleavage; (ii) protection, but only after reaching a critical total daunomycin concentration; (iii) enhanced cleavage; (iv) no effect of added drug. Ten sites were identified as the most strongly protected on the basis of the magnitude of the reduction of their digestion product band areas in the presence of daunomycin. These were identified as the preferred daunomycin binding sites. Seven of these 10 sites are found at the end of the triplet sequences 5'ATGC and 5'ATCG, where the notation AT indicates that either A or T may occupy the position. The remaining three strongly protected sites are found at the ends of the triplet sequence 5'ATCAT. Of the preferred daunomycin binding sites we identify in this study, the sequence 5'ATCG is consistent with the specificity predicted by the theoretical studies of Chen et al. [Chen, K.-X., Gresh, N., & Pullman, B. (1985) J. Biomol. Struct. Dyn. 3, 445-466] and is the very sequence to which daunomycin is observed to be bound in two recent X-ray crystallographic studies. Solution studies, theoretical studies, and crystallographic studies have thus converged to provide a consistent and coherent picture of the sequence preference of this important anticancer antibiotic.

  12. Homologous kappa-neurotoxins exhibit residue-specific interactions with the alpha 3 subunit of the nicotinic acetylcholine receptor: a comparison of the structural requirements for kappa-bungarotoxin and kappa-flavitoxin binding.

    PubMed

    McLane, K E; Weaver, W R; Lei, S; Chiappinelli, V A; Conti-Tronconi, B M

    1993-07-13

    kappa-Flavotoxin (kappa-FTX), a snake neurotoxin that is a selective antagonist of certain neuronal nicotinic acetylcholine receptors (AChRs), has recently been isolated and characterized [Grant, G. A., Frazier, M. W., & Chiappinelli, V. A. (1988) Biochemistry 27, 1532-1537]. Like the related snake toxin kappa-bungarotoxin (kappa-BTX), kappa-FTX binds with high affinity to alpha 3 subtypes of neuronal AChRs, even though there are distinct sequence differences between the two toxins. To further characterize the sequence regions of the neuronal AChR alpha 3 subunit involved in formation of the binding site for this family of kappa-neurotoxins, we investigated kappa-FTX binding to overlapping synthetic peptides screening the alpha 3 subunit sequence. A sequence region forming a "prototope" for kappa-FTX was identified within residues alpha 3 (51-70), confirming the suggestions of previous studies on the binding of kappa-BTX to the alpha 3 subunit [McLane, K. E., Tang, F., & Conti-Tronconi, B. M. (1990) J. Biol. Chem. 265, 1537-1544] and alpha-bungarotoxin to the Torpedo AChR alpha subunit [Conti-Tronconi, B. M., Tang, F., Diethelm, B. M., Spencer, S. R., Reinhardt-Maelicke, S., & Maelicke, A. (1990) Biochemistry 29, 6221-6230] that this sequence region is involved in formation of a cholinergic site. Single residue substituted analogues, where each residue of the sequence alpha 3 (51-70) was sequentially replaced by a glycine, were used to identify the amino acid side chains involved in the interaction of this prototope with kappa-FTX.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. De novo design and engineering of functional metal and porphyrin-binding protein domains

    NASA Astrophysics Data System (ADS)

    Everson, Bernard H.

    In this work, I describe an approach to the rational, iterative design and characterization of two functional cofactor-binding protein domains. First, a hybrid computational/experimental method was developed with the aim of algorithmically generating a suite of porphyrin-binding protein sequences with minimal mutual sequence information. This method was explored by generating libraries of sequences, which were then expressed and evaluated for function. One successful sequence is shown to bind a variety of porphyrin-like cofactors, and exhibits light- activated electron transfer in mixed hemin:chlorin e6 and hemin:Zn(II)-protoporphyrin IX complexes. These results imply that many sophisticated functions such as cofactor binding and electron transfer require only a very small number of residue positions in a protein sequence to be fixed. Net charge and hydrophobic content are important in determining protein solubility and stability. Accordingly, rational modifications were made to the aforementioned design procedure in order to improve its overall success rate. The effects of these modifications are explored using two `next-generation' sequence libraries, which were separately expressed and evaluated. Particular modifications to these design parameters are demonstrated to effectively double the purification success rate of the procedure. Finally, I describe the redesign of the artificial di-iron protein DF2 into CDM13, a single chain di-Manganese four-helix bundle. CDM13 acts as a functional model of natural manganese catalase, exhibiting a kcat of 0.08s-1 under steady-state conditions. The bound manganese cofactors have a reduction potential of +805 mV vs NHE, which is too high for efficient dismutation of hydrogen peroxide. These results indicate that as a high-potential manganese complex, CDM13 may represent a promising first step toward a polypeptide model of the Oxygen Evolving Complex of the photosynthetic enzyme Photosystem II.

  14. Use of eluted peptide sequence data to identify the binding characteristics of peptides to the insulin-dependent diabetes susceptibility allele HLA-DQ8 (DQ 3.2).

    PubMed

    Godkin, A; Friede, T; Davenport, M; Stevanovic, S; Willis, A; Jewell, D; Hill, A; Rammensee, H G

    1997-06-01

    HLA-DQ8 (A1*0301, B1*0302) and -DQ2 (A1*0501, B1*0201) are both associated with diseases such as insulin-dependent diabetes mellitus and coeliac disease. We used the technique of pool sequencing to look at the requirements of peptides binding to HLA-DQ8, and combined these data with naturally sequenced ligands and in vitro binding assays to describe a novel motif for HLA-DQ8. The motif, which has the same basic format as many HLA-DR molecules, consists of four or five anchor regions, in the positions from the N-terminus of the binding core of n, n + 3, n + 5/6 and n + 8, i.e. P1, P4, P6/7 and P9. P1 and P9 require negative or polar residues, with mainly aliphatic residues at P4 and P6/7. The features of the HLA-DQ8 motif were then compared to a pool sequence of peptides eluted from HLA-DQ2. A consensus motif for the binding of a common peptide which may be involved in disease pathogenesis is described. Neither of the disease-associated alleles HLA-DQ2 and -DQ8 have Asp at position 57 of the beta-chain. This Asp, if present, may form a salt bridge with an Arg at position 79 of the alpha-chain and so alter the binding specificity of P9. HLA-DQ2 and -DQ8 both appear to prefer negatively charged amino acids at P9. In contrast, HLA-DQ7 (A1*0301, B1*0301), which is not associated with diabetes, has Asp at beta 57, allowing positively charged amino acids at P9. This analysis of the sequence features of DQ-binding peptides suggests molecular characteristics which may be useful to predict epitopes involved in disease pathogenesis.

  15. Plasma proteins of rainbow trout (Oncorhynchus mykiss) isolated by binding to lipopolysaccharide from Aeromonas salmonicida.

    PubMed

    Hoover, G J; el-Mowafi, A; Simko, E; Kocal, T E; Ferguson, H W; Hayes, M A

    1998-07-01

    In an attempt to find plasma proteins that might be involved in the constitutive resistance of rainbow trout to furunculosis, a disease caused by Aeromonas salmonicida (AS), we purified serum and plasma proteins based on their calcium- and carbohydrate-dependent affinity for A. salmonicida lipopolysaccharide (LPS) coupled to an epoxy-activated synthetic matrix (Toyopearl AF Epoxy 650M). A multimeric family of high molecular weight (96 to 200-kDa) LPS-binding proteins exhibiting both calcium and mannose dependent binding was isolated. Upon reduction the multimers collapsed to subunits of approximately 16-kDa as estimated by 1D-PAGE and exhibited pI values of 5.30 and 5.75 as estimated from 2D-PAGE. Their N-terminal sequences were related to rainbow trout ladderlectin (RT-LL), a Sepharose-binding protein. Polyclonal antibodies to the LPS-purified 16-kDa subunits recognized both the reduced 16-kDa subunits and the non-reduced multimeric forms. A calcium- and N-acetylglucosamine (GlcNAc)-dependent LPS-binding multimeric protein (approximately 207-kDa) composed of 34.5-kDa subunits was purified and found to be identical to trout serum amyloid P (SAP) by N-terminal sequence (DLQDLSGKVFV). A protein of 24-kDa, in reduced and non-reduced conditions, was isolated and had N-terminal sequence identity with a known C-reactive protein (CRP) homologue, C-polysaccharide-binding protein 2 (TCBP2) of rainbow trout. A novel calcium-dependent LPS-binding protein was purified and termed rainbow trout lectin 37 (RT-L37). This protein, composed of dimers, tetramers and pentamers of 37 kDa subunits (pI 5.50-6.10) with N-terminal sequence (IQE(D/N)GHAEAPGATTVLNEILR) showed no close homology to proteins known or predicted from cDNA sequences. These findings demonstrate that rainbow trout have several blood proteins with lectin properties for the LPS of A. salmonicida; the biological functions of these proteins in resistance to furunculosis are still unknown.

  16. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats☆

    PubMed Central

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-01-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. PMID:23648487

  17. Identification of multiple binding sites for the THAP domain of the Galileo transposase in the long terminal inverted-repeats.

    PubMed

    Marzo, Mar; Liu, Danxu; Ruiz, Alfredo; Chalmers, Ronald

    2013-08-01

    Galileo is a DNA transposon responsible for the generation of several chromosomal inversions in Drosophila. In contrast to other members of the P-element superfamily, it has unusually long terminal inverted-repeats (TIRs) that resemble those of Foldback elements. To investigate the function of the long TIRs we derived consensus and ancestral sequences for the Galileo transposase in three species of Drosophilids. Following gene synthesis, we expressed and purified their constituent THAP domains and tested their binding activity towards the respective Galileo TIRs. DNase I footprinting located the most proximal DNA binding site about 70 bp from the transposon end. Using this sequence we identified further binding sites in the tandem repeats that are found within the long TIRs. This suggests that the synaptic complex between Galileo ends may be a complicated structure containing higher-order multimers of the transposase. We also attempted to reconstitute Galileo transposition in Drosophila embryos but no events were detected. Thus, although the limited numbers of Galileo copies in each genome were sufficient to provide functional consensus sequences for the THAP domains, they do not specify a fully active transposase. Since the THAP recognition sequence is short, and will occur many times in a large genome, it seems likely that the multiple binding sites within the long, internally repetitive, TIRs of Galileo and other Foldback-like elements may provide the transposase with its binding specificity. Copyright © 2013 The Authors. Published by Elsevier B.V. All rights reserved.

  18. Transcription initiation from the dihydrofolate reductase promoter is positioned by HIP1 binding at the initiation site.

    PubMed

    Means, A L; Farnham, P J

    1990-02-01

    We have identified a sequence element that specifies the position of transcription initiation for the dihydrofolate reductase gene. Unlike the functionally analogous TATA box that directs RNA polymerase II to initiate transcription 30 nucleotides downstream, the positioning element of the dihydrofolate reductase promoter is located directly at the site of transcription initiation. By using DNase I footprint analysis, we have shown that a protein binds to this initiator element. Transcription initiated at the dihydrofolate reductase initiator element when 28 nucleotides were inserted between it and all other upstream sequences, or when it was placed on either side of the DNA helix, suggesting that there is no strict spatial requirement between the initiator and an upstream element. Although neither a single Sp1-binding site nor a single initiator element was sufficient for transcriptional activity, the combination of one Sp1-binding site and the dihydrofolate reductase initiator element cloned into a plasmid vector resulted in transcription starting at the initiator element. We have also shown that the simian virus 40 late major initiation site has striking sequence homology to the dihydrofolate reductase initiation site and that the same, or a similar, protein binds to both sites. Examination of the sequences at other RNA polymerase II initiation sites suggests that we have identified an element that is important in the transcription of other housekeeping genes. We have thus named the protein that binds to the initiator element HIP1 (Housekeeping Initiator Protein 1).

  19. Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

    PubMed Central

    Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

    2013-01-01

    Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

  20. Mutations in type 3 reovirus that determine binding to sialic acid are contained in the fibrous tail domain of viral attachment protein sigma1.

    PubMed

    Chappell, J D; Gunn, V L; Wetzel, J D; Baer, G S; Dermody, T S

    1997-03-01

    The reovirus attachment protein, sigma1, determines numerous aspects of reovirus-induced disease, including viral virulence, pathways of spread, and tropism for certain types of cells in the central nervous system. The sigma1 protein projects from the virion surface and consists of two distinct morphologic domains, a virion-distal globular domain known as the head and an elongated fibrous domain, termed the tail, which is anchored into the virion capsid. To better understand structure-function relationships of sigma1 protein, we conducted experiments to identify sequences in sigma1 important for viral binding to sialic acid, a component of the receptor for type 3 reovirus. Three serotype 3 reovirus strains incapable of binding sialylated receptors were adapted to growth in murine erythroleukemia (MEL) cells, in which sialic acid is essential for reovirus infectivity. MEL-adapted (MA) mutant viruses isolated by serial passage in MEL cells acquired the capacity to bind sialic acid-containing receptors and demonstrated a dependence on sialic acid for infection of MEL cells. Analysis of reassortant viruses isolated from crosses of an MA mutant virus and a reovirus strain that does not bind sialic acid indicated that the sigma1 protein is solely responsible for efficient growth of MA mutant viruses in MEL cells. The deduced sigma1 amino acid sequences of the MA mutant viruses revealed that each strain contains a substitution within a short region of sequence in the sigma1 tail predicted to form beta-sheet. These studies identify specific sequences that determine the capacity of reovirus to bind sialylated receptors and suggest a location for a sialic acid-binding domain. Furthermore, the results support a model in which type 3 sigma1 protein contains discrete receptor binding domains, one in the head and another in the tail that binds sialic acid.

  1. CIP1 polypeptides and their uses

    DOEpatents

    Foreman, Pamela [Los Altos, CA; Van Solingen, Pieter [Naaldwijk, NL; Goedegebuur, Frits [Vlaardingen, NL; Ward, Michael [San Francisco, CA

    2011-04-12

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  2. A homolog of an Escherichia coli phosphate-binding protein gene from Xanthomonas oryzae pv. oryzae

    NASA Technical Reports Server (NTRS)

    Hopkins, C. M.; White, F. F.; Heaton, L. A.; Guikema, J. A.; Leach, J. E.; Spooner, B. S. (Principal Investigator)

    1995-01-01

    A Xanthomonas oryzae pv. oryzae gene with sequence similarity to an Escherichia coli phosphate-binding protein gene (phoS) produces a periplasmic protein of apparent M(r) 35,000 when expressed in E. coli. Amino terminal sequencing revealed that a signal peptide is removed during transport to the periplasm in E. coli.

  3. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    DOEpatents

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  4. ssHMM: extracting intuitive sequence-structure motifs from high-throughput RNA-binding protein data

    PubMed Central

    Krestel, Ralf; Ohler, Uwe; Vingron, Martin; Marsico, Annalisa

    2017-01-01

    Abstract RNA-binding proteins (RBPs) play an important role in RNA post-transcriptional regulation and recognize target RNAs via sequence-structure motifs. The extent to which RNA structure influences protein binding in the presence or absence of a sequence motif is still poorly understood. Existing RNA motif finders either take the structure of the RNA only partially into account, or employ models which are not directly interpretable as sequence-structure motifs. We developed ssHMM, an RNA motif finder based on a hidden Markov model (HMM) and Gibbs sampling which fully captures the relationship between RNA sequence and secondary structure preference of a given RBP. Compared to previous methods which output separate logos for sequence and structure, it directly produces a combined sequence-structure motif when trained on a large set of sequences. ssHMM’s model is visualized intuitively as a graph and facilitates biological interpretation. ssHMM can be used to find novel bona fide sequence-structure motifs of uncharacterized RBPs, such as the one presented here for the YY1 protein. ssHMM reaches a high motif recovery rate on synthetic data, it recovers known RBP motifs from CLIP-Seq data, and scales linearly on the input size, being considerably faster than MEMERIS and RNAcontext on large datasets while being on par with GraphProt. It is freely available on Github and as a Docker image. PMID:28977546

  5. Structure-affinity relationships for the binding of actinomycin D to DNA

    NASA Astrophysics Data System (ADS)

    Gallego, José; Ortiz, Angel R.; de Pascual-Teresa, Beatriz; Gago, Federico

    1997-03-01

    Molecular models of the complexes between actinomycin D and 14 different DNA hexamers were built based on the X-ray crystal structure of the actinomycin-d(GAAGCTTC)2 complex. The DNA sequences included the canonical GpC binding step flanked by different base pairs, nonclassical binding sites such as GpG and GpT, and sites containing 2,6-diamino- purine. A good correlation was found between the intermolecular interaction energies calculated for the refined complexes and the relative preferences of actinomycin binding to standard and modified DNA. A detailed energy decomposition into van der Waals and electrostatic components for the interactions between the DNA base pairs and either the chromophore or the peptidic part of the antibiotic was performed for each complex. The resulting energy matrix was then subjected to principal component analysis, which showed that actinomycin D discriminates among different DNA sequences by an interplay of hydrogen bonding and stacking interactions. The structure-affinity relationships for this important antitumor drug are thus rationalized and may be used to advantage in the design of novel sequence-specific DNA-binding agents.

  6. Mapping Argonaute and conventional RNA-binding protein interactions with RNA at single-nucleotide resolution using HITS-CLIP and CIMS analysis

    PubMed Central

    Moore, Michael; Zhang, Chaolin; Gantman, Emily Conn; Mele, Aldo; Darnell, Jennifer C.; Darnell, Robert B.

    2014-01-01

    Summary Identifying sites where RNA binding proteins (RNABPs) interact with target RNAs opens the door to understanding the vast complexity of RNA regulation. UV-crosslinking and immunoprecipitation (CLIP) is a transformative technology in which RNAs purified from in vivo cross-linked RNA-protein complexes are sequenced to reveal footprints of RNABP:RNA contacts. CLIP combined with high throughput sequencing (HITS-CLIP) is a generalizable strategy to produce transcriptome-wide RNA binding maps with higher accuracy and resolution than standard RNA immunoprecipitation (RIP) profiling or purely computational approaches. Applying CLIP to Argonaute proteins has expanded the utility of this approach to mapping binding sites for microRNAs and other small regulatory RNAs. Finally, recent advances in data analysis take advantage of crosslinked-induced mutation sites (CIMS) to refine RNA-binding maps to single-nucleotide resolution. Once IP conditions are established, HITS-CLIP takes approximately eight days to prepare RNA for sequencing. Established pipelines for data analysis, including for CIMS, take 3-4 days. PMID:24407355

  7. Direct association of Csk homologous kinase (CHK) with the diphosphorylated site Tyr568/570 of the activated c-KIT in megakaryocytes.

    PubMed

    Price, D J; Rivnay, B; Fu, Y; Jiang, S; Avraham, S; Avraham, H

    1997-02-28

    The Csk homologous kinase (CHK), formerly MATK, has previously been shown to bind to activated c-KIT. In this report, we characterize the binding of SH2(CHK) to specific phosphotyrosine sites on the c-KIT protein sequence. Phosphopeptide inhibition of the in vitro interaction of SH2(CHK)-glutathione S-transferase fusion protein/c-KIT from SCF/KL-treated Mo7e megakaryocytic cells indicated that two sites on c-KIT were able to bind SH2(CHK). These sites were the Tyr568/570 diphosphorylated sequence and the monophosphorylated Tyr721 sequence. To confirm this, we precipitated native CHK from cellular extracts using phosphorylated peptides linked to Affi-Gel 15. In addition, purified SH2(CHK)-glutathione S-transferase fusion protein was precipitated with the same peptide beads. All of the peptide bead-binding studies were consistent with the direct binding of SH2(CHK) to phosphorylated Tyr568/570 and Tyr721 sites. Binding of FYN and SHC to the diphosphorylated Tyr568/570 site was observed, while binding of Csk to this site was not observed. The SH2(CHK) binding to the two sites is direct and not through phosphorylated intermediates such as FYN or SHC. Site-directed mutagenesis of the full-length c-KIT cDNA followed by transient transfection indicated that only the Tyr568/570, and not the Tyr721, is able to bind SH2(CHK). This indicates that CHK binds to the same site on c-KIT to which FYN binds, possibly bringing the two into proximity on associated c-KIT subunits and leading to the down-regulation of FYN by CHK.

  8. Incorporating evolution of transcription factor binding sites into annotated alignments.

    PubMed

    Bais, Abha S; Grossmann, Stefen; Vingron, Martin

    2007-08-01

    Identifying transcription factor binding sites (TFBSs) is essential to elucidate putative regulatory mechanisms. A common strategy is to combine cross-species conservation with single sequence TFBS annotation to yield "conserved TFBSs". Most current methods in this field adopt a multi-step approach that segregates the two aspects. Again, it is widely accepted that the evolutionary dynamics of binding sites differ from those of the surrounding sequence. Hence, it is desirable to have an approach that explicitly takes this factor into account. Although a plethora of approaches have been proposed for the prediction of conserved TFBSs, very few explicitly model TFBS evolutionary properties, while additionally being multi-step. Recently, we introduced a novel approach to simultaneously align and annotate conserved TFBSs in a pair of sequences. Building upon the standard Smith-Waterman algorithm for local alignments, SimAnn introduces additional states for profiles to output extended alignments or annotated alignments. That is, alignments with parts annotated as gaplessly aligned TFBSs (pair-profile hits)are generated. Moreover,the pair- profile related parameters are derived in a sound statistical framework. In this article, we extend this approach to explicitly incorporate evolution of binding sites in the SimAnn framework. We demonstrate the extension in the theoretical derivations through two position-specific evolutionary models, previously used for modelling TFBS evolution. In a simulated setting, we provide a proof of concept that the approach works given the underlying assumptions,as compared to the original work. Finally, using a real dataset of experimentally verified binding sites in human-mouse sequence pairs,we compare the new approach (eSimAnn) to an existing multi-step tool that also considers TFBS evolution. Although it is widely accepted that binding sites evolve differently from the surrounding sequences, most comparative TFBS identification methods do not explicitly consider this.Additionally, prediction of conserved binding sites is carried out in a multi-step approach that segregates alignment from TFBS annotation. In this paper, we demonstrate how the simultaneous alignment and annotation approach of SimAnn can be further extended to incorporate TFBS evolutionary relationships. We study how alignments and binding site predictions interplay at varying evolutionary distances and for various profile qualities.

  9. Regulation of expression of the ada gene controlling the adaptive response. Interactions with the ada promoter of the Ada protein and RNA polymerase.

    PubMed

    Sakumi, K; Sekiguchi, M

    1989-01-20

    The Ada protein of Escherichia coli catalyzes transfer of methyl groups from methylated DNA to its own molecule, and the methylated form of Ada protein promotes transcription of its own gene, ada. Using an in vitro reconstituted system, we found that both the sigma factor and the methylated Ada protein are required for transcription of the ada gene. To elucidate molecular mechanisms involved in the regulation of the ada transcription, we investigated interactions of the non-methylated and methylated forms of Ada protein and the RNA polymerase holo enzyme (the core enzyme and sigma factor) with a DNA fragment carrying the ada promoter region. Footprinting analyses revealed that the methylated Ada protein binds to a region from positions -63 to -31, which includes the ada regulatory sequence AAAGCGCA. No firm binding was observed with the non-methylated Ada protein, although some DNase I-hypersensitive sites were produced in the promoter by both types of Ada protein. RNA polymerase did bind to the promoter once the methylated Ada protein had bound to the upstream sequence. To correlate these phenomena with the process in vivo, we used the DNAs derived from promoter-defective mutants. No binding of Ada protein nor of RNA polymerase occurred with a mutant DNA having a C to G substitution at position -47 within the ada regulatory sequence. In the case of a -35 box mutant with a T to A change at position -34, the methylated Ada protein did bind to the ada regulatory sequence, yet there was no RNA polymerase binding. Thus, the binding of the methylated Ada protein to the upstream region apparently facilitates binding of the RNA polymerase to the proper region of the promoter. The Ada protein possesses two known methyl acceptor sites, Cys69 and Cys321. The role of methylation of each cysteine residue was investigated using mutant forms of the Ada protein. The Ada protein with the cysteine residue at position 69 replaced by alanine was incapable of binding to the ada promoter even when the cysteine residue at position 321 of the protein was methylated. When the Ada protein with alanine at position 321 was methylated, it acquired the potential to bind to the ada promoter. These results are compatible with the notion that methylation of the cysteine residue at position 69 causes a conformational change of the Ada protein, thereby facilitating binding of the protein to the upstream regulatory sequence.

  10. Identification of the DNA-Binding Domains of Human Replication Protein A That Recognize G-Quadruplex DNA

    PubMed Central

    Prakash, Aishwarya; Natarajan, Amarnath; Marky, Luis A.; Ouellette, Michel M.; Borgstahl, Gloria E. O.

    2011-01-01

    Replication protein A (RPA), a key player in DNA metabolism, has 6 single-stranded DNA-(ssDNA-) binding domains (DBDs) A-F. SELEX experiments with the DBDs-C, -D, and -E retrieve a 20-nt G-quadruplex forming sequence. Binding studies show that RPA-DE binds preferentially to the G-quadruplex DNA, a unique preference not observed with other RPA constructs. Circular dichroism experiments show that RPA-CDE-core can unfold the G-quadruplex while RPA-DE stabilizes it. Binding studies show that RPA-C binds pyrimidine- and purine-rich sequences similarly. This difference between RPA-C and RPA-DE binding was also indicated by the inability of RPA-CDE-core to unfold an oligonucleotide containing a TC-region 5′ to the G-quadruplex. Molecular modeling studies of RPA-DE and telomere-binding proteins Pot1 and Stn1 reveal structural similarities between the proteins and illuminate potential DNA-binding sites for RPA-DE and Stn1. These data indicate that DBDs of RPA have different ssDNA recognition properties. PMID:21772997

  11. [Vecuronium in dystrophia myotonica (Curschmann-Steinert)].

    PubMed

    Wruck, G; Tryba, M

    1989-05-01

    An emergency laparotomy was performed in a 31-year-old female (body wt 48 kg) with known myotonic dystrophy. Premedication with dantrolene (1 mg/kg i.v.) was used to prevent a myotonic response. Muscle relaxation was monitored electromyographically. Following induction with fentanyl (0.3 mg) and thiopental (200 mg), muscle relaxation was achieved with 2 mg vecuronium titrated for about 3 min until the T1-response was reduced to 10%. The recovery time was normal. A repetitive dose of 0.5 mg vecuronium was necessary after 20 min, when the T1 reached 60%. Extubation and the early postoperative period were uneventful. Because of the unknown predisposition of our patient for the development of malignant hyperthermia, anesthesia was performed with trigger-free anesthetics.

  12. Violation of an Evolutionarily Conserved Immunoglobulin Diversity Gene Sequence Preference Promotes Production of dsDNA-Specific IgG Antibodies

    PubMed Central

    Silva-Sanchez, Aaron; Liu, Cun Ren; Vale, Andre M.; Khass, Mohamed; Kapoor, Pratibha; Elgavish, Ada; Ivanov, Ivaylo I.; Ippolito, Gregory C.; Schelonka, Robert L.; Schoeb, Trenton R.; Burrows, Peter D.; Schroeder, Harry W.

    2015-01-01

    Variability in the developing antibody repertoire is focused on the third complementarity determining region of the H chain (CDR-H3), which lies at the center of the antigen binding site where it often plays a decisive role in antigen binding. The power of VDJ recombination and N nucleotide addition has led to the common conception that the sequence of CDR-H3 is unrestricted in its variability and random in its composition. Under this view, the immune response is solely controlled by somatic positive and negative clonal selection mechanisms that act on individual B cells to promote production of protective antibodies and prevent the production of self-reactive antibodies. This concept of a repertoire of random antigen binding sites is inconsistent with the observation that diversity (DH) gene segment sequence content by reading frame (RF) is evolutionarily conserved, creating biases in the prevalence and distribution of individual amino acids in CDR-H3. For example, arginine, which is often found in the CDR-H3 of dsDNA binding autoantibodies, is under-represented in the commonly used DH RFs rearranged by deletion, but is a frequent component of rarely used inverted RF1 (iRF1), which is rearranged by inversion. To determine the effect of altering this germline bias in DH gene segment sequence on autoantibody production, we generated mice that by genetic manipulation are forced to utilize an iRF1 sequence encoding two arginines. Over a one year period we collected serial serum samples from these unimmunized, specific pathogen-free mice and found that more than one-fifth of them contained elevated levels of dsDNA-binding IgG, but not IgM; whereas mice with a wild type DH sequence did not. Thus, germline bias against the use of arginine enriched DH sequence helps to reduce the likelihood of producing self-reactive antibodies. PMID:25706374

  13. Sequence-Specific Affinity Chromatography of Bacterial Small Regulatory RNA-Binding Proteins from Bacterial Cells.

    PubMed

    Gans, Jonathan; Osborne, Jonathan; Cheng, Juliet; Djapgne, Louise; Oglesby-Sherrouse, Amanda G

    2018-01-01

    Bacterial small RNA molecules (sRNAs) are increasingly recognized as central regulators of bacterial stress responses and pathogenesis. In many cases, RNA-binding proteins are critical for the stability and function of sRNAs. Previous studies have adopted strategies to genetically tag an sRNA of interest, allowing isolation of RNA-protein complexes from cells. Here we present a sequence-specific affinity purification protocol that requires no prior genetic manipulation of bacterial cells, allowing isolation of RNA-binding proteins bound to native RNA molecules.

  14. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    PubMed

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Structure-based Analysis to Hu-DNA Binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Swinger,K.; Rice, P.

    2007-01-01

    HU and IHF are prokaryotic proteins that induce very large bends in DNA. They are present in high concentrations in the bacterial nucleoid and aid in chromosomal compaction. They also function as regulatory cofactors in many processes, such as site-specific recombination and the initiation of replication and transcription. HU and IHF have become paradigms for understanding DNA bending and indirect readout of sequence. While IHF shows significant sequence specificity, HU binds preferentially to certain damaged or distorted DNAs. However, none of the structurally diverse HU substrates previously studied in vitro is identical with the distorted substrates in the recently publishedmore » Anabaena HU(AHU)-DNA cocrystal structures. Here, we report binding affinities for AHU and the DNA in the cocrystal structures. The binding free energies for formation of these AHU-DNA complexes range from 10-14.5 kcal/mol, representing K{sub d} values in the nanomolar to low picomolar range, and a maximum stabilization of at least 6.3 kcal/mol relative to complexes with undistorted, non-specific DNA. We investigated IHF binding and found that appropriate structural distortions can greatly enhance its affinity. On the basis of the coupling of structural and relevant binding data, we estimate the amount of conformational strain in an IHF-mediated DNA kink that is relieved by a nick (at least 0.76 kcal/mol) and pinpoint the location of the strain. We show that AHU has a sequence preference for an A+T-rich region in the center of its DNA-binding site, correlating with an unusually narrow minor groove. This is similar to sequence preferences shown by the eukaryotic nucleosome.« less

  16. NMR and computational methods applied to the 3- dimensional structure determination of DNA and ligand-DNA complexes in solution

    NASA Astrophysics Data System (ADS)

    Smith, Jarrod Anson

    2D homonuclear 1H NMR methods and restrained molecular dynamics (rMD) calculations have been applied to determining the three-dimensional structures of DNA and minor groove-binding ligand-DNA complexes in solution. The structure of the DNA decamer sequence d(GCGTTAACGC)2 has been solved both with a distance-based rMD protocol and an NOE relaxation matrix backcalculation-based protocol in order to probe the relative merits of the different refinement methods. In addition, three minor groove binding ligand-DNA complexes have been examined. The solution structure of the oligosaccharide moiety of the antitumor DNA scission agent calicheamicin γ1I has been determined in complex with a decamer duplex containing its high affinity 5'-TCCT- 3' binding sequence. The structure of the complex reinforces the belief that the oligosaccharide moiety is responsible for the sequence selective minor-groove binding activity of the agent, and critical intermolecular contacts are revealed. The solution structures of both the (+) and (-) enantiomers of the minor groove binding DNA alkylating agent duocarmycin SA have been determined in covalent complex with the undecamer DNA duplex d(GACTAATTGTC).d(GAC AATTAGTC). The results support the proposal that the alkylation activity of the duocarmycin antitumor antibiotics is catalyzed by a binding-induced conformational change in the ligand which activates the cyclopropyl group for reaction with the DNA. Comparisons between the structures of the two enantiomers covalently bound to the same DNA sequence at the same 5'-AATTA-3 ' site have provided insight into the binding orientation and site selectivity, as well as the relative rates of reactivity of these two agents.

  17. Inadequate Reference Datasets Biased toward Short Non-epitopes Confound B-cell Epitope Prediction*

    PubMed Central

    Rahman, Kh. Shamsur; Chowdhury, Erfan Ullah; Sachse, Konrad; Kaltenboeck, Bernhard

    2016-01-01

    X-ray crystallography has shown that an antibody paratope typically binds 15–22 amino acids (aa) of an epitope, of which 2–5 randomly distributed amino acids contribute most of the binding energy. In contrast, researchers typically choose for B-cell epitope mapping short peptide antigens in antibody binding assays. Furthermore, short 6–11-aa epitopes, and in particular non-epitopes, are over-represented in published B-cell epitope datasets that are commonly used for development of B-cell epitope prediction approaches from protein antigen sequences. We hypothesized that such suboptimal length peptides result in weak antibody binding and cause false-negative results. We tested the influence of peptide antigen length on antibody binding by analyzing data on more than 900 peptides used for B-cell epitope mapping of immunodominant proteins of Chlamydia spp. We demonstrate that short 7–12-aa peptides of B-cell epitopes bind antibodies poorly; thus, epitope mapping with short peptide antigens falsely classifies many B-cell epitopes as non-epitopes. We also show in published datasets of confirmed epitopes and non-epitopes a direct correlation between length of peptide antigens and antibody binding. Elimination of short, ≤11-aa epitope/non-epitope sequences improved datasets for evaluation of in silico B-cell epitope prediction. Achieving up to 86% accuracy, protein disorder tendency is the best indicator of B-cell epitope regions for chlamydial and published datasets. For B-cell epitope prediction, the most effective approach is plotting disorder of protein sequences with the IUPred-L scale, followed by antibody reactivity testing of 16–30-aa peptides from peak regions. This strategy overcomes the well known inaccuracy of in silico B-cell epitope prediction from primary protein sequences. PMID:27189949

  18. A Novel WRKY transcription factor is required for induction of PR-1a gene expression by salicylic acid and bacterial elicitors.

    PubMed

    van Verk, Marcel C; Pappaioannou, Dimitri; Neeleman, Lyda; Bol, John F; Linthorst, Huub J M

    2008-04-01

    PR-1a is a salicylic acid-inducible defense gene of tobacco (Nicotiana tabacum). One-hybrid screens identified a novel tobacco WRKY transcription factor (NtWRKY12) with specific binding sites in the PR-1a promoter at positions -564 (box WK(1)) and -859 (box WK(2)). NtWRKY12 belongs to the class of transcription factors in which the WRKY sequence is followed by a GKK rather than a GQK sequence. The binding sequence of NtWRKY12 (WK box TTTTCCAC) deviated significantly from the consensus sequence (W box TTGAC[C/T]) shown to be recognized by WRKY factors with the GQK sequence. Mutation of the GKK sequence in NtWRKY12 into GQK or GEK abolished binding to the WK box. The WK(1) box is in close proximity to binding sites in the PR-1a promoter for transcription factors TGA1a (as-1 box) and Myb1 (MBSII box). Expression studies with PR-1a promoterbeta-glucuronidase (GUS) genes in stably and transiently transformed tobacco indicated that NtWRKY12 and TGA1a act synergistically in PR-1a expression induced by salicylic acid and bacterial elicitors. Cotransfection of Arabidopsis thaliana protoplasts with 35SNtWRKY12 and PR-1aGUS promoter fusions showed that overexpression of NtWRKY12 resulted in a strong increase in GUS expression, which required functional WK boxes in the PR-1a promoter.

  19. BayesPI-BAR: a new biophysical model for characterization of regulatory sequence variations

    PubMed Central

    Wang, Junbai; Batmanov, Kirill

    2015-01-01

    Sequence variations in regulatory DNA regions are known to cause functionally important consequences for gene expression. DNA sequence variations may have an essential role in determining phenotypes and may be linked to disease; however, their identification through analysis of massive genome-wide sequencing data is a great challenge. In this work, a new computational pipeline, a Bayesian method for protein–DNA interaction with binding affinity ranking (BayesPI-BAR), is proposed for quantifying the effect of sequence variations on protein binding. BayesPI-BAR uses biophysical modeling of protein–DNA interactions to predict single nucleotide polymorphisms (SNPs) that cause significant changes in the binding affinity of a regulatory region for transcription factors (TFs). The method includes two new parameters (TF chemical potentials or protein concentrations and direct TF binding targets) that are neglected by previous methods. The new method is verified on 67 known human regulatory SNPs, of which 47 (70%) have predicted true TFs ranked in the top 10. Importantly, the performance of BayesPI-BAR, which uses principal component analysis to integrate multiple predictions from various TF chemical potentials, is found to be better than that of existing programs, such as sTRAP and is-rSNP, when evaluated on the same SNPs. BayesPI-BAR is a publicly available tool and is able to carry out parallelized computation, which helps to investigate a large number of TFs or SNPs and to detect disease-associated regulatory sequence variations in the sea of genome-wide noncoding regions. PMID:26202972

  20. bfr1+, a novel gene of Schizosaccharomyces pombe which confers brefeldin A resistance, is structurally related to the ATP-binding cassette superfamily.

    PubMed Central

    Nagao, K; Taguchi, Y; Arioka, M; Kadokura, H; Takatsuki, A; Yoda, K; Yamasaki, M

    1995-01-01

    We have isolated a Schizosaccharomyces pombe gene, bfr1+, which on a multicopy plasmid vector, pDB248', confers resistance to brefeldin A (BFA), an inhibitor of intracellular protein transport. This gene encodes a novel protein of 1,531 amino acids with an intramolecular duplicated structure, each half containing a single ATP-binding consensus sequence and a set of six transmembrane sequences. This structural characteristic of bfr1+ protein resembles that of mammalian P-glycoprotein, which, by exporting a variety of anticancer drugs, has been shown to be responsible for multidrug resistance in tumor cells. Consistent with this is that S. pombe cells harboring bfr1+ on pDB248' are resistant to actinomycin D, cerulenin, and cytochalasin B, as well as to BFA. The relative positions of the ATP-binding sequences and the clusters of transmembrane sequences within the bfr1+ protein are, however, transposed in comparison with those in P-glycoprotein; the bfr1+ protein has N-terminal ATP-binding sequence followed by transmembrane segments in each half of the molecule. The bfr1+ protein exhibited significant homology in primary and secondary structures with two recently identified multidrug resistance gene products of Saccharomyces cerevisiae, Snq2 and Sts1/Pdr5/Ydr1. The bfr1+ gene is not essential for cell growth or mating, but a delta bfr1 mutant exhibited hypersensitivity to BFA. We propose that the bfr1+ protein is another member of the ATP-binding cassette superfamily and serves as an efflux pump of various antibiotics. PMID:7883711

  1. Heterogeneous RNA-binding protein M4 is a receptor for carcinoembryonic antigen in Kupffer cells.

    PubMed

    Bajenova, O V; Zimmer, R; Stolper, E; Salisbury-Rowswell, J; Nanji, A; Thomas, P

    2001-08-17

    Here we report the isolation of the recombinant cDNA clone from rat macrophages, Kupffer cells (KC) that encodes a protein interacting with carcinoembryonic antigen (CEA). To isolate and identify the CEA receptor gene we used two approaches: screening of a KC cDNA library with a specific antibody and the yeast two-hybrid system for protein interaction using as a bait the N-terminal part of the CEA encoding the binding site. Both techniques resulted in the identification of the rat heterogeneous RNA-binding protein (hnRNP) M4 gene. The rat ortholog cDNA sequence has not been previously described. The open reading frame for this gene contains a 2351-base pair sequence with the polyadenylation signal AATAAA and a termination poly(A) tail. The mRNA shows ubiquitous tissue expression as a 2.4-kilobase transcript. The deduced amino acid sequence comprised a 78-kDa membrane protein with 3 putative RNA-binding domains, arginine/methionine/glutamine-rich C terminus and 3 potential membrane spanning regions. When hnRNP M4 protein is expressed in pGEX4T-3 vector system in Escherichia coli it binds (125)I-labeled CEA in a Ca(2+)-dependent fashion. Transfection of rat hnRNP M4 cDNA into a non-CEA binding mouse macrophage cell line p388D1 resulted in CEA binding. These data provide evidence for a new function of hnRNP M4 protein as a CEA-binding protein in Kupffer cells.

  2. GenProBiS: web server for mapping of sequence variants to protein binding sites.

    PubMed

    Konc, Janez; Skrlj, Blaz; Erzen, Nika; Kunej, Tanja; Janezic, Dusanka

    2017-07-03

    Discovery of potentially deleterious sequence variants is important and has wide implications for research and generation of new hypotheses in human and veterinary medicine, and drug discovery. The GenProBiS web server maps sequence variants to protein structures from the Protein Data Bank (PDB), and further to protein-protein, protein-nucleic acid, protein-compound, and protein-metal ion binding sites. The concept of a protein-compound binding site is understood in the broadest sense, which includes glycosylation and other post-translational modification sites. Binding sites were defined by local structural comparisons of whole protein structures using the Protein Binding Sites (ProBiS) algorithm and transposition of ligands from the similar binding sites found to the query protein using the ProBiS-ligands approach with new improvements introduced in GenProBiS. Binding site surfaces were generated as three-dimensional grids encompassing the space occupied by predicted ligands. The server allows intuitive visual exploration of comprehensively mapped variants, such as human somatic mis-sense mutations related to cancer and non-synonymous single nucleotide polymorphisms from 21 species, within the predicted binding sites regions for about 80 000 PDB protein structures using fast WebGL graphics. The GenProBiS web server is open and free to all users at http://genprobis.insilab.org. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  3. A Method for Preparing DNA Sequencing Templates Using a DNA-Binding Microplate

    PubMed Central

    Yang, Yu; Hebron, Haroun R.; Hang, Jun

    2009-01-01

    A DNA-binding matrix was immobilized on the surface of a 96-well microplate and used for plasmid DNA preparation for DNA sequencing. The same DNA-binding plate was used for bacterial growth, cell lysis, DNA purification, and storage. In a single step using one buffer, bacterial cells were lysed by enzymes, and released DNA was captured on the plate simultaneously. After two wash steps, DNA was eluted and stored in the same plate. Inclusion of phosphates in the culture medium was found to enhance the yield of plasmid significantly. Purified DNA samples were used successfully in DNA sequencing with high consistency and reproducibility. Eleven vectors and nine libraries were tested using this method. In 10 μl sequencing reactions using 3 μl sample and 0.25 μl BigDye Terminator v3.1, the results from a 3730xl sequencer gave a success rate of 90–95% and read-lengths of 700 bases or more. The method is fully automatable and convenient for manual operation as well. It enables reproducible, high-throughput, rapid production of DNA with purity and yields sufficient for high-quality DNA sequencing at a substantially reduced cost. PMID:19568455

  4. Spectroscopic studies of the binding of Cu(II) complexes of oxicam NSAIDs to alternating G-C and homopolymeric G-C sequences

    NASA Astrophysics Data System (ADS)

    Chakraborty, Sreeja; Bose, Madhuparna; Sarkar, Munna

    2014-03-01

    Drugs belonging to the Non-steroidal anti-inflammatory (NSAID) group are not only used as anti-inflammatory, analgesic and anti-pyretic agents, but also show anti-cancer effects. Complexing them with a bioactive metal like copper, show an enhancement in their anti-cancer effects compared to the bare drugs, whose exact mechanism of action is not yet fully understood. For the first time, it was shown by our group that Cu(II)-NSAIDs can directly bind to the DNA backbone. The ability of the copper complexes of NSAIDs namely meloxicam and piroxicam to bind to the DNA backbone could be a possible molecular mechanism behind their enhanced anticancer effects. Elucidating base sequence specific interaction of Cu(II)-NSAIDs to the DNA will provide information on their possible binding sites in the genome sequence. In this work, we present how these complexes respond to differences in structure and hydration pattern of GC rich sequences. For this, binding studies of Cu(II) complexes of piroxicam [Cu(II)-(Px)2 (L)2] and meloxicam [Cu(II)-(Mx)2 (L)] with alternating GC (polydG-dC) and homopolymeric GC (polydG-polydC) sequences were carried out using a combination of spectroscopic techniques that include UV-Vis absorption, fluorescence and circular dichroism (CD) spectroscopy. The Cu(II)-NSAIDs show strong binding affinity to both polydG-dC and polydG-polydC. The role reversal of Cu(II)-meloxicam from a strong binder of polydG-dC (Kb = 11.5 × 103 M-1) to a weak binder of polydG-polydC (Kb = 5.02 × 103 M-1), while Cu(II)-piroxicam changes from a strong binder of polydG-polydC (Kb = 8.18 × 103 M-1) to a weak one of polydG-dC (Kb = 2.18 × 103 M-1), point to the sensitivity of these complexes to changes in the backbone structures/hydration. Changes in the profiles of UV absorption band and CD difference spectra, upon complex binding to polynucleotides and the results of competitive binding assay using ethidium bromide (EtBr) fluorescence indicate different binding modes in each case.

  5. Binding properties of SUMO-interacting motifs (SIMs) in yeast.

    PubMed

    Jardin, Christophe; Horn, Anselm H C; Sticht, Heinrich

    2015-03-01

    Small ubiquitin-like modifier (SUMO) conjugation and interaction play an essential role in many cellular processes. A large number of yeast proteins is known to interact non-covalently with SUMO via short SUMO-interacting motifs (SIMs), but the structural details of this interaction are yet poorly characterized. In the present work, sequence analysis of a large dataset of 148 yeast SIMs revealed the existence of a hydrophobic core binding motif and a preference for acidic residues either within or adjacent to the core motif. Thus the sequence properties of yeast SIMs are highly similar to those described for human. Molecular dynamics simulations were performed to investigate the binding preferences for four representative SIM peptides differing in the number and distribution of acidic residues. Furthermore, the relative stability of two previously observed alternative binding orientations (parallel, antiparallel) was assessed. For all SIMs investigated, the antiparallel binding mode remained stable in the simulations and the SIMs were tightly bound via their hydrophobic core residues supplemented by polar interactions of the acidic residues. In contrary, the stability of the parallel binding mode is more dependent on the sequence features of the SIM motif like the number and position of acidic residues or the presence of additional adjacent interaction motifs. This information should be helpful to enhance the prediction of SIMs and their binding properties in different organisms to facilitate the reconstruction of the SUMO interactome.

  6. Prediction of small molecule binding property of protein domains with Bayesian classifiers based on Markov chains.

    PubMed

    Bulashevska, Alla; Stein, Martin; Jackson, David; Eils, Roland

    2009-12-01

    Accurate computational methods that can help to predict biological function of a protein from its sequence are of great interest to research biologists and pharmaceutical companies. One approach to assume the function of proteins is to predict the interactions between proteins and other molecules. In this work, we propose a machine learning method that uses a primary sequence of a domain to predict its propensity for interaction with small molecules. By curating the Pfam database with respect to the small molecule binding ability of its component domains, we have constructed a dataset of small molecule binding and non-binding domains. This dataset was then used as training set to learn a Bayesian classifier, which should distinguish members of each class. The domain sequences of both classes are modelled with Markov chains. In a Jack-knife test, our classification procedure achieved the predictive accuracies of 77.2% and 66.7% for binding and non-binding classes respectively. We demonstrate the applicability of our classifier by using it to identify previously unknown small molecule binding domains. Our predictions are available as supplementary material and can provide very useful information to drug discovery specialists. Given the ubiquitous and essential role small molecules play in biological processes, our method is important for identifying pharmaceutically relevant components of complete proteomes. The software is available from the author upon request.

  7. Sequence information gain based motif analysis.

    PubMed

    Maynou, Joan; Pairó, Erola; Marco, Santiago; Perera, Alexandre

    2015-11-09

    The detection of regulatory regions in candidate sequences is essential for the understanding of the regulation of a particular gene and the mechanisms involved. This paper proposes a novel methodology based on information theoretic metrics for finding regulatory sequences in promoter regions. This methodology (SIGMA) has been tested on genomic sequence data for Homo sapiens and Mus musculus. SIGMA has been compared with different publicly available alternatives for motif detection, such as MEME/MAST, Biostrings (Bioconductor package), MotifRegressor, and previous work such Qresiduals projections or information theoretic based detectors. Comparative results, in the form of Receiver Operating Characteristic curves, show how, in 70% of the studied Transcription Factor Binding Sites, the SIGMA detector has a better performance and behaves more robustly than the methods compared, while having a similar computational time. The performance of SIGMA can be explained by its parametric simplicity in the modelling of the non-linear co-variability in the binding motif positions. Sequence Information Gain based Motif Analysis is a generalisation of a non-linear model of the cis-regulatory sequences detection based on Information Theory. This generalisation allows us to detect transcription factor binding sites with maximum performance disregarding the covariability observed in the positions of the training set of sequences. SIGMA is freely available to the public at http://b2slab.upc.edu.

  8. Sequence Alignment to Predict Across Species Susceptibility ...

    EPA Pesticide Factsheets

    Conservation of a molecular target across species can be used as a line-of-evidence to predict the likelihood of chemical susceptibility. The web-based Sequence Alignment to Predict Across Species Susceptibility (SeqAPASS) tool was developed to simplify, streamline, and quantitatively assess protein sequence/structural similarity across taxonomic groups as a means to predict relative intrinsic susceptibility. The intent of the tool is to allow for evaluation of any potential protein target, so it is amenable to variable degrees of protein characterization, depending on available information about the chemical/protein interaction and the molecular target itself. To allow for flexibility in the analysis, a layered strategy was adopted for the tool. The first level of the SeqAPASS analysis compares primary amino acid sequences to a query sequence, calculating a metric for sequence similarity (including detection of candidate orthologs), the second level evaluates sequence similarity within selected domains (e.g., ligand-binding domain, DNA binding domain), and the third level of analysis compares individual amino acid residue positions identified as being of importance for protein conformation and/or ligand binding upon chemical perturbation. Each level of the SeqAPASS analysis provides increasing evidence to apply toward rapid, screening-level assessments of probable cross species susceptibility. Such analyses can support prioritization of chemicals for further ev

  9. footprintDB: a database of transcription factors with annotated cis elements and binding interfaces.

    PubMed

    Sebastian, Alvaro; Contreras-Moreira, Bruno

    2014-01-15

    Traditional and high-throughput techniques for determining transcription factor (TF) binding specificities are generating large volumes of data of uneven quality, which are scattered across individual databases. FootprintDB integrates some of the most comprehensive freely available libraries of curated DNA binding sites and systematically annotates the binding interfaces of the corresponding TFs. The first release contains 2422 unique TF sequences, 10 112 DNA binding sites and 3662 DNA motifs. A survey of the included data sources, organisms and TF families was performed together with proprietary database TRANSFAC, finding that footprintDB has a similar coverage of multicellular organisms, while also containing bacterial regulatory data. A search engine has been designed that drives the prediction of DNA motifs for input TFs, or conversely of TF sequences that might recognize input regulatory sequences, by comparison with database entries. Such predictions can also be extended to a single proteome chosen by the user, and results are ranked in terms of interface similarity. Benchmark experiments with bacterial, plant and human data were performed to measure the predictive power of footprintDB searches, which were able to correctly recover 10, 55 and 90% of the tested sequences, respectively. Correctly predicted TFs had a higher interface similarity than the average, confirming its diagnostic value. Web site implemented in PHP,Perl, MySQL and Apache. Freely available from http://floresta.eead.csic.es/footprintdb.

  10. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed Central

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-01-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery. PMID:9811800

  11. Cooperative DNA binding and sequence discrimination by the Opaque2 bZIP factor.

    PubMed

    Yunes, J A; Vettore, A L; da Silva, M J; Leite, A; Arruda, P

    1998-11-01

    The maize Opaque2 (O2) protein is a basic leucine zipper transcription factor that controls the expression of distinct classes of endosperm genes through the recognition of different cis-acting elements in their promoters. The O2 target region in the promoter of the alpha-coixin gene was analyzed in detail and shown to comprise two closely adjacent binding sites, named O2u and O2d, which are related in sequence to the GCN4 binding site. Quantitative DNase footprint analysis indicated that O2 binding to alpha-coixin target sites is best described by a cooperative model. Transient expression assays showed that the two adjacent sites act synergistically. This synergy is mediated in part by cooperative DNA binding. In tobacco protoplasts, O2 binding at the O2u site is more important for enhancer activity than is binding at the O2d site, suggesting that the architecture of the O2-DNA complex is important for interaction with the transcriptional machinery.

  12. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-11-11

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

  13. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed Central

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-01-01

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

  14. Evaluation of simultaneous binding of Chromomycin A3 to the multiple sites of DNA by the new restriction enzyme assay.

    PubMed

    Murase, Hirotaka; Noguchi, Tomoharu; Sasaki, Shigeki

    2018-06-01

    Chromomycin A3 (CMA3) is an aureolic acid-type antitumor antibiotic. CMA3 forms dimeric complexes with divalent cations, such as Mg 2+ , which strongly binds to the GC rich sequence of DNA to inhibit DNA replication and transcription. In this study, the binding property of CMA3 to the DNA sequence containing multiple GC-rich binding sites was investigated by measuring the protection from hydrolysis by the restriction enzymes, AccII and Fnu4HI, for the center of the CGCG site and the 5'-GC↓GGC site, respectively. In contrast to the standard DNase I footprinting method, the DNA substrates are fully hydrolyzed by the restriction enzymes, therefore, the full protection of DNA at all the cleavable sites indicates that CMA3 simultaneously binds to all the binding sites. The restriction enzyme assay has suggested that CMA3 has a high tendency to bind the successive CGCG sites and the CGG repeat. Copyright © 2018 Elsevier Ltd. All rights reserved.

  15. Human mRNA polyadenylate binding protein: evolutionary conservation of a nucleic acid binding motif.

    PubMed Central

    Grange, T; de Sa, C M; Oddos, J; Pictet, R

    1987-01-01

    We have isolated a full length cDNA (cDNA) coding for the human poly(A) binding protein. The cDNA derived 73 kd basic translation product has the same Mr, isoelectric point and peptidic map as the poly(A) binding protein. DNA sequence analysis reveals a 70,244 dalton protein. The N terminal part, highly homologous to the yeast poly(A) binding protein, is sufficient for poly(A) binding activity. This domain consists of a four-fold repeated unit of approximately 80 amino acids present in other nucleic acid binding proteins. In the C terminal part there is, as in the yeast protein, a sequence of approximately 150 amino acids, rich in proline, alanine and glutamine which together account for 48% of the residues. A 2,9 kb mRNA corresponding to this cDNA has been detected in several vertebrate cell types and in Drosophila melanogaster at every developmental stage including oogenesis. Images PMID:2885805

  16. Engineered proteins with PUF scaffold to manipulate RNA metabolism

    PubMed Central

    Wang, Yang; Wang, Zefeng; Tanaka Hall, Traci M.

    2013-01-01

    Pumilio/fem-3 mRNA binding factor (FBF) proteins are characterized by a sequence-specific RNA-binding domain. This unique single-stranded RNA recognition module, whose sequence specificity can be reprogrammed, has been fused with functional modules to engineer protein factors with various functions. Here we summarize the advancement in developing RNA regulatory tools and opportunities for the future. PMID:23731364

  17. Evaluation of DNA Binding Drugs as Inhibitors of ESX, and ETS Domain Transcription Factor Associated With Breast Cancer: Effects of ESX/DNA Complex Disruption

    DTIC Science & Technology

    2000-08-01

    4). Sequence recognition of all four DNA bases is achieved by positioning an N- methylimidazole opposite guanine or N-methylpyrrole opposite...unique sequences of DNA based upon selective binding motifs to all four DNA bases , although relatively little is known about the ability of these agents to

  18. Identification of a factor in HeLa cells specific for an upstream transcriptional control sequence of an EIA-inducible adenovirus promoter and its relative abundance in infected and uninfected cells.

    PubMed Central

    SivaRaman, L; Subramanian, S; Thimmappaya, B

    1986-01-01

    Utilizing the gel electrophoresis/DNA binding assay, a factor specific for the upstream transcriptional control sequence of the EIA-inducible adenovirus EIIA-early promoter has been detected in HeLa cell nuclear extract. Analysis of linker-scanning mutants of the promoter by DNA binding assays and methylation-interference experiments show that the factor binds to the 17-nucleotide sequence 5' TGGAGATGACGTAGTTT 3' located between positions -66 and -82 upstream from the cap site. This sequence has been shown to be essential for transcription of this promoter. The EIIA-early-promoter specific factor was found to be present at comparable levels in uninfected HeLa cells and in cells infected with either wild-type adenovirus or the EIA-deletion mutant dl312 under conditions in which the EIA proteins are induced to high levels [7 or 20 hr after infection in the presence of arabinonucleoside (cytosine arabinoside)]. Based on the quantitation in DNA binding assays, it appears that the mechanism of EIA-activated transcription of the EIIA-early promoter does not involve a net change in the amounts of this factor. Images PMID:2942943

  19. In vitro fluorescence studies of transcription factor IIB-DNA interaction.

    PubMed

    Górecki, Andrzej; Figiel, Małgorzata; Dziedzicka-Wasylewska, Marta

    2015-01-01

    General transcription factor TFIIB is one of the basal constituents of the preinitiation complex of eukaryotic RNA polymerase II, acting as a bridge between the preinitiation complex and the polymerase, and binding promoter DNA in an asymmetric manner, thereby defining the direction of the transcription. Methods of fluorescence spectroscopy together with circular dichroism spectroscopy were used to observe conformational changes in the structure of recombinant human TFIIB after binding to specific DNA sequence. To facilitate the exploration of the structural changes, several site-directed mutations have been introduced altering the fluorescence properties of the protein. Our observations showed that binding of specific DNA sequences changed the protein structure and dynamics, and TFIIB may exist in two conformational states, which can be described by a different microenvironment of W52. Fluorescence studies using both intrinsic and exogenous fluorophores showed that these changes significantly depended on the recognition sequence and concerned various regions of the protein, including those interacting with other transcription factors and RNA polymerase II. DNA binding can cause rearrangements in regions of proteins interacting with the polymerase in a manner dependent on the recognized sequences, and therefore, influence the gene expression.

  20. Predicting DNA binding proteins using support vector machine with hybrid fractal features.

    PubMed

    Niu, Xiao-Hui; Hu, Xue-Hai; Shi, Feng; Xia, Jing-Bo

    2014-02-21

    DNA-binding proteins play a vitally important role in many biological processes. Prediction of DNA-binding proteins from amino acid sequence is a significant but not fairly resolved scientific problem. Chaos game representation (CGR) investigates the patterns hidden in protein sequences, and visually reveals previously unknown structure. Fractal dimensions (FD) are good tools to measure sizes of complex, highly irregular geometric objects. In order to extract the intrinsic correlation with DNA-binding property from protein sequences, CGR algorithm, fractal dimension and amino acid composition are applied to formulate the numerical features of protein samples in this paper. Seven groups of features are extracted, which can be computed directly from the primary sequence, and each group is evaluated by the 10-fold cross-validation test and Jackknife test. Comparing the results of numerical experiments, the group of amino acid composition and fractal dimension (21-dimension vector) gets the best result, the average accuracy is 81.82% and average Matthew's correlation coefficient (MCC) is 0.6017. This resulting predictor is also compared with existing method DNA-Prot and shows better performances. © 2013 The Authors. Published by Elsevier Ltd All rights reserved.

  1. A coarse-grained biophysical model of sequence evolution and the population size dependence of the speciation rate

    PubMed Central

    Khatri, Bhavin S.; Goldstein, Richard A.

    2015-01-01

    Speciation is fundamental to understanding the huge diversity of life on Earth. Although still controversial, empirical evidence suggests that the rate of speciation is larger for smaller populations. Here, we explore a biophysical model of speciation by developing a simple coarse-grained theory of transcription factor-DNA binding and how their co-evolution in two geographically isolated lineages leads to incompatibilities. To develop a tractable analytical theory, we derive a Smoluchowski equation for the dynamics of binding energy evolution that accounts for the fact that natural selection acts on phenotypes, but variation arises from mutations in sequences; the Smoluchowski equation includes selection due to both gradients in fitness and gradients in sequence entropy, which is the logarithm of the number of sequences that correspond to a particular binding energy. This simple consideration predicts that smaller populations develop incompatibilities more quickly in the weak mutation regime; this trend arises as sequence entropy poises smaller populations closer to incompatible regions of phenotype space. These results suggest a generic coarse-grained approach to evolutionary stochastic dynamics, allowing realistic modelling at the phenotypic level. PMID:25936759

  2. Diversity of Functionally Permissive Sequences in the Receptor-Binding Site of Influenza Hemagglutinin.

    PubMed

    Wu, Nicholas C; Xie, Jia; Zheng, Tianqing; Nycholat, Corwin M; Grande, Geramie; Paulson, James C; Lerner, Richard A; Wilson, Ian A

    2017-06-14

    Influenza A virus hemagglutinin (HA) initiates viral entry by engaging host receptor sialylated glycans via its receptor-binding site (RBS). The amino acid sequence of the RBS naturally varies across avian and human influenza virus subtypes and is also evolvable. However, functional sequence diversity in the RBS has not been fully explored. Here, we performed a large-scale mutational analysis of the RBS of A/WSN/33 (H1N1) and A/Hong Kong/1/1968 (H3N2) HAs. Many replication-competent mutants not yet observed in nature were identified, including some that could escape from an RBS-targeted broadly neutralizing antibody. This functional sequence diversity is made possible by pervasive epistasis in the RBS 220-loop and can be buffered by avidity in viral receptor binding. Overall, our study reveals that the HA RBS can accommodate a much greater range of sequence diversity than previously thought, which has significant implications for the complex evolutionary interrelationships between receptor specificity and immune escape. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. An immunoassay for the study of DNA-binding activities of herpes simplex virus protein ICP8.

    PubMed

    Lee, C K; Knipe, D M

    1985-06-01

    An immunoassay was used to examine the interaction between a herpes simplex virus protein, ICP8, and various types of DNA. The advantage of this assay is that the protein is not subjected to harsh purification procedures. We characterized the binding of ICP8 to both single-stranded (ss) and double-stranded (ds) DNA. ICP8 bound ss DNA fivefold more efficiently than ds DNA, and both binding activities were most efficient in 150 mM NaCl. Two lines of evidence indicate that the binding activities were not identical: (i) ds DNA failed to complete with ss DNA binding even with a large excess of ds DNA; (ii) Scatchard plots of DNA binding with various amounts of DNA were fundamentally different for ss DNA and ds DNA. However, the two activities were related in that ss DNA efficiently competed with the binding of ds DNA. We conclude that the ds DNA-binding activity of ICP8 is probably distinct from the ss DNA-binding activity. No evidence for sequence-specific ds DNA binding was obtained for either the entire herpes simplex virus genome or cloned viral sequences.

  4. Improve the prediction of RNA-binding residues using structural neighbours.

    PubMed

    Li, Quan; Cao, Zanxia; Liu, Haiyan

    2010-03-01

    The interactions between RNA-binding proteins (RBPs) with RNA play key roles in managing some of the cell's basic functions. The identification and prediction of RNA binding sites is important for understanding the RNA-binding mechanism. Computational approaches are being developed to predict RNA-binding residues based on the sequence- or structure-derived features. To achieve higher prediction accuracy, improvements on current prediction methods are necessary. We identified that the structural neighbors of RNA-binding and non-RNA-binding residues have different amino acid compositions. Combining this structure-derived feature with evolutionary (PSSM) and other structural information (secondary structure and solvent accessibility) significantly improves the predictions over existing methods. Using a multiple linear regression approach and 6-fold cross validation, our best model can achieve an overall correct rate of 87.8% and MCC of 0.47, with a specificity of 93.4%, correctly predict 52.4% of the RNA-binding residues for a dataset containing 107 non-homologous RNA-binding proteins. Compared with existing methods, including the amino acid compositions of structure neighbors lead to clearly improvement. A web server was developed for predicting RNA binding residues in a protein sequence (or structure),which is available at http://mcgill.3322.org/RNA/.

  5. Genome-wide survey of DNA-binding proteins in Arabidopsis thaliana: analysis of distribution and functions.

    PubMed

    Malhotra, Sony; Sowdhamini, Ramanathan

    2013-08-01

    The interaction of proteins with their respective DNA targets is known to control many high-fidelity cellular processes. Performing a comprehensive survey of the sequenced genomes for DNA-binding proteins (DBPs) will help in understanding their distribution and the associated functions in a particular genome. Availability of fully sequenced genome of Arabidopsis thaliana enables the review of distribution of DBPs in this model plant genome. We used profiles of both structure and sequence-based DNA-binding families, derived from PDB and PFam databases, to perform the survey. This resulted in 4471 proteins, identified as DNA-binding in Arabidopsis genome, which are distributed across 300 different PFam families. Apart from several plant-specific DNA-binding families, certain RING fingers and leucine zippers also had high representation. Our search protocol helped to assign DNA-binding property to several proteins that were previously marked as unknown, putative or hypothetical in function. The distribution of Arabidopsis genes having a role in plant DNA repair were particularly studied and noted for their functional mapping. The functions observed to be overrepresented in the plant genome harbour DNA-3-methyladenine glycosylase activity, alkylbase DNA N-glycosylase activity and DNA-(apurinic or apyrimidinic site) lyase activity, suggesting their role in specialized functions such as gene regulation and DNA repair.

  6. Flexible DNA binding of the BTB/POZ-domain protein FBI-1.

    PubMed

    Pessler, Frank; Hernandez, Nouria

    2003-08-01

    POZ-domain transcription factors are characterized by the presence of a protein-protein interaction domain called the POZ or BTB domain at their N terminus and zinc fingers at their C terminus. Despite the large number of POZ-domain transcription factors that have been identified to date and the significant insights that have been gained into their cellular functions, relatively little is known about their DNA binding properties. FBI-1 is a BTB/POZ-domain protein that has been shown to modulate HIV-1 Tat trans-activation and to repress transcription of some cellular genes. We have used various viral and cellular FBI-1 binding sites to characterize the interaction of a POZ-domain protein with DNA in detail. We find that FBI-1 binds to inverted sequence repeats downstream of the HIV-1 transcription start site. Remarkably, it binds efficiently to probes carrying these repeats in various orientations and spacings with no particular rotational alignment, indicating that its interaction with DNA is highly flexible. Indeed, FBI-1 binding sites in the adenovirus 2 major late promoter, the c-fos gene, and the c-myc P1 and P2 promoters reveal variously spaced direct, inverted, and everted sequence repeats with the consensus sequence G(A/G)GGG(T/C)(C/T)(T/C)(C/T) for each repeat.

  7. The binding modes of carbazole derivatives with telomere G-quadruplex

    NASA Astrophysics Data System (ADS)

    Zhang, Xiu-feng; Zhang, Hui-juan; Xiang, Jun-feng; Li, Qian; Yang, Qian-fan; Shang, Qian; Zhang, Yan-xia; Tang, Ya-lin

    2010-10-01

    It is reported that carbazole derivatives can stabilize G-quadruplex DNA structure formed by human telomeric sequence, and therefore, they have the potential to serve as anti-cancer agents. In this present study, in order to further explore the binding mode between carbazole derivatives and G-quadruplex formed by human telomeric sequence, two carbazole iodides (BMVEC, MVEC) molecules were synthesized and used to investigate the interaction with the human telomeric parallel and antiparallel G-quadruplex structures by NMR, CD and molecular modeling study. Interestingly, it is the pivotal the cationic charge pendant groups of pyridinium rings of carbazole that plays an essential role in the stabilizing and binding mode of the human telomeric sequences G-quadruplex structure. It was found that BMVEC with two cationic charge pendant groups of pyridinium rings of 9-ethylcarbazole cannot only stabilize parallel G-quadruple of Hum6 by groove binding and G-tetrad stacking modes and antiparallel G-quadruplex of Hum22 by groove binding, but also induce the formation of mixed G-quadruplex of Hum22. While MVEC with one cationic charge pendant groups of pyridinium ring only can bind with the parallel G-quadruplex of Hum6 by the stacking onto the G4 G-tetrad and could not interact with the G-quadruplex of Hum22.

  8. Oxidative stress/reactive metabolite gene expression signature in rat liver detects idiosyncratic hepatotoxicants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Leone, Angelique; Nie, Alex; Brandon Parker, J.

    Previously we reported a gene expression signature in rat liver for detecting a specific type of oxidative stress (OS) related to reactive metabolites (RM). High doses of the drugs disulfiram, ethinyl estradiol and nimesulide were used with another dozen paradigm OS/RM compounds, and three other drugs flutamide, phenacetin and sulindac were identified by this signature. In a second study, antiepileptic drugs were compared for covalent binding and their effects on OS/RM; felbamate, carbamazepine, and phenobarbital produced robust OS/RM gene expression. In the present study, liver RNA samples from drug-treated rats from more recent experiments were examined for statistical fit tomore » the OS/RM signature. Of all 97 drugs examined, in addition to the nine drugs noted above, 19 more were identified as OS/RM-producing compounds—chlorpromazine, clozapine, cyproterone acetate, dantrolene, dipyridamole, glibenclamide, isoniazid, ketoconazole, methapyrilene, naltrexone, nifedipine, sulfamethoxazole, tamoxifen, coumarin, ritonavir, amitriptyline, valproic acid, enalapril, and chloramphenicol. Importantly, all of the OS/RM drugs listed above have been linked to idiosyncratic hepatotoxicity, excepting chloramphenicol, which does not have a package label for hepatotoxicity, but does have a black box warning for idiosyncratic bone marrow suppression. Most of these drugs are not acutely toxic in the rat. The OS/RM signature should be useful to avoid idiosyncratic hepatotoxicity of drug candidates. - Highlights: • 28 of 97 drugs gave a positive OS/RM gene expression signature in rat liver. • The specificity of the signature for human idiosyncratic hepatotoxicants was 98%. • The sensitivity of the signature for human idiosyncratic hepatotoxicants was 75%. • The signature can help eliminate hepatotoxicants from drug development.« less

  9. Informative priors based on transcription factor structural class improve de novo motif discovery.

    PubMed

    Narlikar, Leelavati; Gordân, Raluca; Ohler, Uwe; Hartemink, Alexander J

    2006-07-15

    An important problem in molecular biology is to identify the locations at which a transcription factor (TF) binds to DNA, given a set of DNA sequences believed to be bound by that TF. In previous work, we showed that information in the DNA sequence of a binding site is sufficient to predict the structural class of the TF that binds it. In particular, this suggests that we can predict which locations in any DNA sequence are more likely to be bound by certain classes of TFs than others. Here, we argue that traditional methods for de novo motif finding can be significantly improved by adopting an informative prior probability that a TF binding site occurs at each sequence location. To demonstrate the utility of such an approach, we present priority, a powerful new de novo motif finding algorithm. Using data from TRANSFAC, we train three classifiers to recognize binding sites of basic leucine zipper, forkhead, and basic helix loop helix TFs. These classifiers are used to equip priority with three class-specific priors, in addition to a default prior to handle TFs of other classes. We apply priority and a number of popular motif finding programs to sets of yeast intergenic regions that are reported by ChIP-chip to be bound by particular TFs. priority identifies motifs the other methods fail to identify, and correctly predicts the structural class of the TF recognizing the identified binding sites. Supplementary material and code can be found at http://www.cs.duke.edu/~amink/.

  10. Changes in solvation during DNA binding and cleavage are critical to altered specificity of the EcoRI endonuclease

    PubMed Central

    Robinson, Clifford R.; Sligar, Stephen G.

    1998-01-01

    Restriction endonucleases such as EcoRI bind and cleave DNA with great specificity and represent a paradigm for protein–DNA interactions and molecular recognition. Using osmotic pressure to induce water release, we demonstrate the participation of bound waters in the sequence discrimination of substrate DNA by EcoRI. Changes in solvation can play a critical role in directing sequence-specific DNA binding by EcoRI and are also crucial in assisting site discrimination during catalysis. By measuring the volume change for complex formation, we show that at the cognate sequence (GAATTC) EcoRI binding releases about 70 fewer water molecules than binding at an alternate DNA sequence (TAATTC), which differs by a single base pair. EcoRI complexation with nonspecific DNA releases substantially less water than either of these specific complexes. In cognate substrates (GAATTC) kcat decreases as osmotic pressure is increased, indicating the binding of about 30 water molecules accompanies the cleavage reaction. For the alternate substrate (TAATTC), release of about 40 water molecules accompanies the reaction, indicated by a dramatic acceleration of the rate when osmotic pressure is raised. These large differences in solvation effects demonstrate that water molecules can be key players in the molecular recognition process during both association and catalytic phases of the EcoRI reaction, acting to change the specificity of the enzyme. For both the protein–DNA complex and the transition state, there may be substantial conformational differences between cognate and alternate sites, accompanied by significant alterations in hydration and solvent accessibility. PMID:9482860

  11. Genome-wide profiling of DNA-binding proteins using barcode-based multiplex Solexa sequencing.

    PubMed

    Raghav, Sunil Kumar; Deplancke, Bart

    2012-01-01

    Chromatin immunoprecipitation (ChIP) is a commonly used technique to detect the in vivo binding of proteins to DNA. ChIP is now routinely paired to microarray analysis (ChIP-chip) or next-generation sequencing (ChIP-Seq) to profile the DNA occupancy of proteins of interest on a genome-wide level. Because ChIP-chip introduces several biases, most notably due to the use of a fixed number of probes, ChIP-Seq has quickly become the method of choice as, depending on the sequencing depth, it is more sensitive, quantitative, and provides a greater binding site location resolution. With the ever increasing number of reads that can be generated per sequencing run, it has now become possible to analyze several samples simultaneously while maintaining sufficient sequence coverage, thus significantly reducing the cost per ChIP-Seq experiment. In this chapter, we provide a step-by-step guide on how to perform multiplexed ChIP-Seq analyses. As a proof-of-concept, we focus on the genome-wide profiling of RNA Polymerase II as measuring its DNA occupancy at different stages of any biological process can provide insights into the gene regulatory mechanisms involved. However, the protocol can also be used to perform multiplexed ChIP-Seq analyses of other DNA-binding proteins such as chromatin modifiers and transcription factors.

  12. Systematic evaluation of the impact of ChIP-seq read designs on genome coverage, peak identification, and allele-specific binding detection.

    PubMed

    Zhang, Qi; Zeng, Xin; Younkin, Sam; Kawli, Trupti; Snyder, Michael P; Keleş, Sündüz

    2016-02-24

    Chromatin immunoprecipitation followed by sequencing (ChIP-seq) experiments revolutionized genome-wide profiling of transcription factors and histone modifications. Although maturing sequencing technologies allow these experiments to be carried out with short (36-50 bps), long (75-100 bps), single-end, or paired-end reads, the impact of these read parameters on the downstream data analysis are not well understood. In this paper, we evaluate the effects of different read parameters on genome sequence alignment, coverage of different classes of genomic features, peak identification, and allele-specific binding detection. We generated 101 bps paired-end ChIP-seq data for many transcription factors from human GM12878 and MCF7 cell lines. Systematic evaluations using in silico variations of these data as well as fully simulated data, revealed complex interplay between the sequencing parameters and analysis tools, and indicated clear advantages of paired-end designs in several aspects such as alignment accuracy, peak resolution, and most notably, allele-specific binding detection. Our work elucidates the effect of design on the downstream analysis and provides insights to investigators in deciding sequencing parameters in ChIP-seq experiments. We present the first systematic evaluation of the impact of ChIP-seq designs on allele-specific binding detection and highlights the power of pair-end designs in such studies.

  13. cAMP-Mediated Stimulation of Tyrosine Hydroxylase mRNA Translation Is Mediated by Polypyrimidine-Rich Sequences within Its 3′-Untranslated Region and Poly(C)-Binding Protein 2

    PubMed Central

    Xu, Lu; Sterling, Carol R.

    2009-01-01

    Tyrosine hydroxylase (TH) plays a critical role in maintaining the appropriate concentrations of catecholamine neurotransmitters in brain and periphery, particularly during long-term stress, long-term drug treatment, or neurodegenerative diseases. Its expression is controlled by both transcriptional and post-transcriptional mechanisms. In a previous report, we showed that treatment of rat midbrain slice explant cultures or mouse MN9D cells with cAMP analog or forskolin leads to induction of TH protein without concomitant induction of TH mRNA. We further showed that cAMP activates mechanisms that regulate TH mRNA translation via cis-acting sequences within its 3′-untranslated region (UTR). In the present report, we extend these studies to show that MN9D cytoplasmic proteins bind to the same TH mRNA 3′-UTR domain that is required for the cAMP response. RNase T1 mapping demonstrates binding of proteins to a 27-nucleotide polypyrimidine-rich sequence within this domain. A specific mutation within the polypyrimidine-rich sequence inhibits protein binding and cAMP-mediated translational activation. UV-cross-linking studies identify a ∼44-kDa protein as a major TH mRNA 3′-UTR binding factor, and cAMP induces the 40- to 42-kDa poly(C)-binding protein-2 (PCBP2) in MN9D cells. We show that PCBP2 binds to the TH mRNA 3′-UTR domain that participates in the cAMP response. Overexpression of PCBP2 induces TH protein without concomitant induction of TH mRNA. These results support a model in which cAMP induces PCBP2, leading to increased interaction with its cognate polypyrimidine binding site in the TH mRNA 3′-UTR. This increased interaction presumably plays a role in the activation of TH mRNA translation by cAMP in dopaminergic neurons. PMID:19620256

  14. The Interaction of Integrin αIIbβ3 with Fibrin Occurs through Multiple Binding Sites in the αIIb β-Propeller Domain*

    PubMed Central

    Podolnikova, Nataly P.; Yakovlev, Sergiy; Yakubenko, Valentin P.; Wang, Xu; Gorkun, Oleg V.; Ugarova, Tatiana P.

    2014-01-01

    The currently available antithrombotic agents target the interaction of platelet integrin αIIbβ3 (GPIIb-IIIa) with fibrinogen during platelet aggregation. Platelets also bind fibrin formed early during thrombus growth. It was proposed that inhibition of platelet-fibrin interactions may be a necessary and important property of αIIbβ3 antagonists; however, the mechanisms by which αIIbβ3 binds fibrin are uncertain. We have previously identified the γ370–381 sequence (P3) in the γC domain of fibrinogen as the fibrin-specific binding site for αIIbβ3 involved in platelet adhesion and platelet-mediated fibrin clot retraction. In the present study, we have demonstrated that P3 can bind to several discontinuous segments within the αIIb β-propeller domain of αIIbβ3 enriched with negatively charged and aromatic residues. By screening peptide libraries spanning the sequence of the αIIb β-propeller, several sequences were identified as candidate contact sites for P3. Synthetic peptides duplicating these segments inhibited platelet adhesion and clot retraction but not platelet aggregation, supporting the role of these regions in fibrin recognition. Mutant αIIbβ3 receptors in which residues identified as critical for P3 binding were substituted for homologous residues in the I-less integrin αMβ2 exhibited reduced cell adhesion and clot retraction. These residues are different from those that are involved in the coordination of the fibrinogen γ404–411 sequence and from auxiliary sites implicated in binding of soluble fibrinogen. These results map the binding of fibrin to multiple sites in the αIIb β-propeller and further indicate that recognition specificity of αIIbβ3 for fibrin differs from that for soluble fibrinogen. PMID:24338009

  15. Integrin-Using Rotaviruses Bind α2β1 Integrin α2 I Domain via VP4 DGE Sequence and Recognize αXβ2 and αVβ3 by Using VP7 during Cell Entry

    PubMed Central

    Graham, Kate L.; Halasz, Peter; Tan, Yan; Hewish, Marilyn J.; Takada, Yoshikazu; Mackow, Erich R.; Robinson, Martyn K.; Coulson, Barbara S.

    2003-01-01

    Integrins α2β1, αXβ2, and αVβ3 have been implicated in rotavirus cell attachment and entry. The virus spike protein VP4 contains the α2β1 ligand sequence DGE at amino acid positions 308 to 310, and the outer capsid protein VP7 contains the αXβ2 ligand sequence GPR. To determine the viral proteins and sequences involved and to define the roles of α2β1, αXβ2, and αVβ3, we analyzed the ability of rotaviruses and their reassortants to use these integrins for cell binding and infection and the effect of peptides DGEA and GPRP on these events. Many laboratory-adapted human, monkey, and bovine viruses used integrins, whereas all porcine viruses were integrin independent. The integrin-using rotavirus strains each interacted with all three integrins. Integrin usage related to VP4 serotype independently of sialic acid usage. Analysis of rotavirus reassortants and assays of virus binding and infectivity in integrin-transfected cells showed that VP4 bound α2β1, and VP7 interacted with αXβ2 and αVβ3 at a postbinding stage. DGEA inhibited rotavirus binding to α2β1 and infectivity, whereas GPRP binding to αXβ2 inhibited infectivity but not binding. The truncated VP5* subunit of VP4, expressed as a glutathione S-transferase fusion protein, bound the expressed α2 I domain. Alanine mutagenesis of D308 and G309 in VP5* eliminated VP5* binding to the α2 I domain. In a novel process, integrin-using viruses bind the α2 I domain of α2β1 via DGE in VP4 and interact with αXβ2 (via GPR) and αVβ3 by using VP7 to facilitate cell entry and infection. PMID:12941907

  16. Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

    EPA Science Inventory

    The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

  17. Targeted binding of the M13 bacteriophage to thiamethoxam organic crystals.

    PubMed

    Cho, Whirang; Fowler, Jeffrey D; Furst, Eric M

    2012-04-10

    Phage display screening with a combinatorial library was used to identify M13-type bacteriophages that express peptides with selective binding to organic crystals of thiamethoxam. The six most strongly binding phages exhibit at least 1000 times the binding affinity of wild-type M13 and express heptapeptide sequences that are rich in hydrophobic, hydrogen-bonding amino acids and proline. Among the peptide sequences identified, M13 displaying the pIII domain heptapeptide ASTLPKA exhibits the strongest binding to thiamethoxam in competitive binding assays. Electron and confocal microscopy confirm the specific binding affinity of ASTLPKA to thiamethoxam. Using atomic force microscope (AFM) probes functionalized with ASTLPKA expressing phage, we found that the average adhesion force between the bacteriophage and a thiamethoxam surface is 1.47 ± 0.80 nN whereas the adhesion force of wild-type M13KE phage is 0.18 ± 0.07 nN. Such a strongly binding bacteriophage could be used to modify the surface chemistry of thiamethoxam crystals and other organic solids with a high degree of specificity. © 2012 American Chemical Society

  18. Scanpath memory binding: multiple read-out experiments

    NASA Astrophysics Data System (ADS)

    Stark, Lawrence W.; Privitera, Claudio M.; Yang, Huiyang; Azzariti, Michela; Ho, Yeuk F.; Chan, Angie; Krischer, Christof; Weinberger, Adam

    1999-05-01

    The scanpath theory proposed that an internal spatial- cognitive model controls perception and the active looking eye movements, EMs, of the scanpath sequence. Evidence for this came from new quantitative methods, experiments with ambiguous figures and visual imagery and from MRI studies, all on cooperating human subjects. Besides recording EMs, we introduce other experimental techniques wherein the subject must depend upon memory bindings as in visual imagery, but may call upon other motor behaviors than EMs to read-out the remembered patterns. How is the internal model distributed and operationally assembled. The concept of binding speaks to the assigning of values for the model and its execution in various parts of the brain. Current neurological information helps to localize different aspects of the spatial-cognitive model in the brain. We suppose that there are several levels of 'binding' -- semantic or symbolic binding, structural binding for the spatial locations of the regions-of-interest and sequential binding for the dynamic execution program that yields the sequence of EMs. Our aim is to dissect out respective contributions of these different forms of binding.

  19. Novel ZnO-binding peptides obtained by the screening of a phage display peptide library

    NASA Astrophysics Data System (ADS)

    Golec, Piotr; Karczewska-Golec, Joanna; Łoś, Marcin; Węgrzyn, Grzegorz

    2012-11-01

    Zinc oxide (ZnO) is a semiconductor compound with a potential for wide use in various applications, including biomaterials and biosensors, particularly as nanoparticles (the size range of ZnO nanoparticles is from 2 to 100 nm, with an average of about 35 nm). Here, we report isolation of novel ZnO-binding peptides, by screening of a phage display library. Interestingly, amino acid sequences of the ZnO-binding peptides reported in this paper and those described previously are significantly different. This suggests that there is a high variability in sequences of peptides which can bind particular inorganic molecules, indicating that different approaches may lead to discovery of different peptides of generally the same activity (e.g., binding of ZnO) but having various detailed properties, perhaps crucial under specific conditions of different applications.

  20. Mapping specificity landscapes of RNA-protein interactions by high throughput sequencing.

    PubMed

    Jankowsky, Eckhard; Harris, Michael E

    2017-04-15

    To function in a biological setting, RNA binding proteins (RBPs) have to discriminate between alternative binding sites in RNAs. This discrimination can occur in the ground state of an RNA-protein binding reaction, in its transition state, or in both. The extent by which RBPs discriminate at these reaction states defines RBP specificity landscapes. Here, we describe the HiTS-Kin and HiTS-EQ techniques, which combine kinetic and equilibrium binding experiments with high throughput sequencing to quantitatively assess substrate discrimination for large numbers of substrate variants at ground and transition states of RNA-protein binding reactions. We discuss experimental design, practical considerations and data analysis and outline how a combination of HiTS-Kin and HiTS-EQ allows the mapping of RBP specificity landscapes. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. In vivo binding of PRDM9 reveals interactions with noncanonical genomic sites

    PubMed Central

    Grey, Corinne; Clément, Julie A.J.; Buard, Jérôme; Leblanc, Benjamin; Gut, Ivo; Gut, Marta; Duret, Laurent

    2017-01-01

    In mouse and human meiosis, DNA double-strand breaks (DSBs) initiate homologous recombination and occur at specific sites called hotspots. The localization of these sites is determined by the sequence-specific DNA binding domain of the PRDM9 histone methyl transferase. Here, we performed an extensive analysis of PRDM9 binding in mouse spermatocytes. Unexpectedly, we identified a noncanonical recruitment of PRDM9 to sites that lack recombination activity and the PRDM9 binding consensus motif. These sites include gene promoters, where PRDM9 is recruited in a DSB-dependent manner. Another subset reveals DSB-independent interactions between PRDM9 and genomic sites, such as the binding sites for the insulator protein CTCF. We propose that these DSB-independent sites result from interactions between hotspot-bound PRDM9 and genomic sequences located on the chromosome axis. PMID:28336543

  2. Convergent evolution of adenosine aptamers spanning bacterial, human, and random sequences revealed by structure-based bioinformatics and genomic SELEX

    PubMed Central

    Vu, Michael M. K.; Jameson, Nora E.; Masuda, Stuart J.; Lin, Dana; Larralde-Ridaura, Rosa; Lupták, Andrej

    2012-01-01

    SUMMARY Aptamers are structured macromolecules in vitro evolved to bind molecular targets, whereas in nature they form the ligand-binding domains of riboswitches. Adenosine aptamers of a single structural family were isolated several times from random pools but they have not been identified in genomic sequences. We used two unbiased methods, structure-based bioinformatics and human genome-based in vitro selection, to identify aptamers that form the same adenosine-binding structure in a bacterium, and several vertebrates, including humans. Two of the human aptamers map to introns of RAB3C and FGD3 genes. The RAB3C aptamer binds ATP with dissociation constants about ten times lower than physiological ATP concentration, while the minimal FGD3 aptamer binds ATP only co-transcriptionally. PMID:23102219

  3. CLIP-related methodologies and their application to retrovirology.

    PubMed

    Bieniasz, Paul D; Kutluay, Sebla B

    2018-05-02

    Virtually every step of HIV-1 replication and numerous cellular antiviral defense mechanisms are regulated by the binding of a viral or cellular RNA-binding protein (RBP) to distinct sequence or structural elements on HIV-1 RNAs. Until recently, these protein-RNA interactions were studied largely by in vitro binding assays complemented with genetics approaches. However, these methods are highly limited in the identification of the relevant targets of RBPs in physiologically relevant settings. Development of crosslinking-immunoprecipitation sequencing (CLIP) methodology has revolutionized the analysis of protein-nucleic acid complexes. CLIP combines immunoprecipitation of covalently crosslinked protein-RNA complexes with high-throughput sequencing, providing a global account of RNA sequences bound by a RBP of interest in cells (or virions) at near-nucleotide resolution. Numerous variants of the CLIP protocol have recently been developed, some with major improvements over the original. Herein, we briefly review these methodologies and give examples of how CLIP has been successfully applied to retrovirology research.

  4. Electrophoretic mobility shift scanning using an automated infrared DNA sequencer.

    PubMed

    Sano, M; Ohyama, A; Takase, K; Yamamoto, M; Machida, M

    2001-11-01

    Electrophoretic mobility shift assay (EMSA) is widely used in the study of sequence-specific DNA-binding proteins, including transcription factors and mismatch binding proteins. We have established a non-radioisotope-based protocol for EMSA that features an automated DNA sequencer with an infrared fluorescent dye (IRDye) detection unit. Our modification of the elec- trophoresis unit, which includes cooling the gel plates with a reduced well-to-read length, has made it possible to detect shifted bands within 1 h. Further, we have developed a rapid ligation-based method for generating IRDye-labeled probes with an approximately 60% cost reduction. This method has the advantages of real-time scanning, stability of labeled probes, and better safety associated with nonradioactive methods of detection. Analysis of a promoter from an industrially important filamentous fungus, Aspergillus oryzae, in a prototype experiment revealed that the method we describe has potential for use in systematic scanning and identification of the functionally important elements to which cellular factors bind in a sequence-specific manner.

  5. RNA-dependent RNA polymerase of hepatitis C virus binds to its coding region RNA stem-loop structure, 5BSL3.2, and its negative strand.

    PubMed

    Kanamori, Hiroshi; Yuhashi, Kazuhito; Ohnishi, Shin; Koike, Kazuhiko; Kodama, Tatsuhiko

    2010-05-01

    The hepatitis C virus NS5B RNA-dependent RNA polymerase (RdRp) is a key enzyme involved in viral replication. Interaction between NS5B RdRp and the viral RNA sequence is likely to be an important step in viral RNA replication. The C-terminal half of the NS5B-coding sequence, which contains the important cis-acting replication element, has been identified as an NS5B-binding sequence. In the present study, we confirm the specific binding of NS5B to one of the RNA stem-loop structures in the region, 5BSL3.2. In addition, we show that NS5B binds to the complementary strand of 5BSL3.2 (5BSL3.2N). The bulge structure of 5BSL3.2N was shown to be indispensable for tight binding to NS5B. In vitro RdRp activity was inhibited by 5BSL3.2N, indicating the importance of the RNA element in the polymerization by RdRp. These results suggest the involvement of the RNA stem-loop structure of the negative strand in the replication process.

  6. UniPROBE, update 2015: new tools and content for the online database of protein-binding microarray data on protein-DNA interactions.

    PubMed

    Hume, Maxwell A; Barrera, Luis A; Gisselbrecht, Stephen S; Bulyk, Martha L

    2015-01-01

    The Universal PBM Resource for Oligonucleotide Binding Evaluation (UniPROBE) serves as a convenient source of information on published data generated using universal protein-binding microarray (PBM) technology, which provides in vitro data about the relative DNA-binding preferences of transcription factors for all possible sequence variants of a length k ('k-mers'). The database displays important information about the proteins and displays their DNA-binding specificity data in terms of k-mers, position weight matrices and graphical sequence logos. This update to the database documents the growth of UniPROBE since the last update 4 years ago, and introduces a variety of new features and tools, including a new streamlined pipeline that facilitates data deposition by universal PBM data generators in the research community, a tool that generates putative nonbinding (i.e. negative control) DNA sequences for one or more proteins and novel motifs obtained by analyzing the PBM data using the BEEML-PBM algorithm for motif inference. The UniPROBE database is available at http://uniprobe.org. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Selection of staphylococcal enterotoxin B (SEB)-binding peptide using phage display technology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Soykut, Esra Acar; Dudak, Fahriye Ceyda; Boyaci, Ismail Hakki

    In this study, peptides were selected to recognize staphylococcal enterotoxin B (SEB) which cause food intoxication and can be used as a biological war agent. By using commercial M13 phage library, single plaque isolation of 38 phages was done and binding affinities were investigated with phage-ELISA. The specificities of the selected phage clones showing high affinity to SEB were checked by using different protein molecules which can be found in food samples. Furthermore, the affinities of three selected phage clones were determined by using surface plasmon resonance (SPR) sensors. Sequence analysis was realized for three peptides showing high binding affinitymore » to SEB and WWRPLTPESPPA, MNLHDYHRLFWY, and QHPQINQTLYRM amino acid sequences were obtained. The peptide sequence with highest affinity to SEB was synthesized with solid phase peptide synthesis technique and thermodynamic constants of the peptide-SEB interaction were determined by using isothermal titration calorimetry (ITC) and compared with those of antibody-SEB interaction. The binding constant of the peptide was determined as 4.2 {+-} 0.7 x 10{sup 5} M{sup -1} which indicates a strong binding close to that of antibody.« less

  8. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein.

    PubMed

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S; Prasad, Manoj

    2011-10-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncations of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T][T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein.

  9. Electrophoretic mobility shift assay reveals a novel recognition sequence for Setaria italica NAC protein

    PubMed Central

    Puranik, Swati; Kumar, Karunesh; Srivastava, Prem S

    2011-01-01

    The NAC (NAM/ATAF1,2/CUC2) proteins are among the largest family of plant transcription factors. Its members have been associated with diverse plant processes and intricately regulate the expression of several genes. Inspite of this immense progress, knowledge of their DNA-binding properties are still limited. In our recent publication,1 we reported isolation of a membrane-associated NAC domain protein from Setaria italica (SiNAC). Transactivation analysis revealed that it was a functionally active transcription factor as it could stimulate expression of reporter genes in vivo. Truncation of the transmembrane region of the protein lead to its nuclear localization. Here we describe expression and purification of SiNAC DNA-binding domain. We further report identification of a novel DNA-binding site, [C/G][A/T] [T/A][G/C]TC[C/G][A/T][C/G][G/C] for SiNAC by electrophoretic mobility shift assay. The SiNAC-GST protein could bind to the NAC recognition sequence in vitro as well as to sequences where some bases had been reshuffled. The results presented here contribute to our understanding of the DNA-binding specificity of SiNAC protein. PMID:21918373

  10. Structure of adenovirus bound to cellular receptor car

    DOEpatents

    Freimuth, Paul I.

    2007-01-02

    Disclosed is a mutant CAR-DI-binding adenovirus which has a genome comprising one or more mutations in sequences which encode the fiber protein knob domain wherein the mutation causes the encoded viral particle to have a significantly weakened binding affinity for CAR-DI relative to wild-type adenovirus. Such mutations may be in sequences which encode either the AB loop, or the HI loop of the fiber protein knob domain. Specific residues and mutations are described. Also disclosed is a method for generating a mutant adenovirus which is characterized by a receptor binding affinity or specificity which differs substantially from wild type.

  11. Chimeric proteins for detection and quantitation of DNA mutations, DNA sequence variations, DNA damage and DNA mismatches

    DOEpatents

    McCutchen-Maloney, Sandra L.

    2002-01-01

    Chimeric proteins having both DNA mutation binding activity and nuclease activity are synthesized by recombinant technology. The proteins are of the general formula A-L-B and B-L-A where A is a peptide having DNA mutation binding activity, L is a linker and B is a peptide having nuclease activity. The chimeric proteins are useful for detection and identification of DNA sequence variations including DNA mutations (including DNA damage and mismatches) by binding to the DNA mutation and cutting the DNA once the DNA mutation is detected.

  12. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A

    PubMed Central

    2018-01-01

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus. In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of KD = 20 ± 1 nM. PMID:29495282

  13. Refining the Results of a Classical SELEX Experiment by Expanding the Sequence Data Set of an Aptamer Pool Selected for Protein A.

    PubMed

    Stoltenburg, Regina; Strehlitz, Beate

    2018-02-24

    New, as yet undiscovered aptamers for Protein A were identified by applying next generation sequencing (NGS) to a previously selected aptamer pool. This pool was obtained in a classical SELEX (Systematic Evolution of Ligands by EXponential enrichment) experiment using the FluMag-SELEX procedure followed by cloning and Sanger sequencing. PA#2/8 was identified as the only Protein A-binding aptamer from the Sanger sequence pool, and was shown to be able to bind intact cells of Staphylococcus aureus . In this study, we show the extension of the SELEX results by re-sequencing of the same aptamer pool using a medium throughput NGS approach and data analysis. Both data pools were compared. They confirm the selection of a highly complex and heterogeneous oligonucleotide pool and show consistently a high content of orphans as well as a similar relative frequency of certain sequence groups. But in contrast to the Sanger data pool, the NGS pool was clearly dominated by one sequence group containing the known Protein A-binding aptamer PA#2/8 as the most frequent sequence in this group. In addition, we found two new sequence groups in the NGS pool represented by PA-C10 and PA-C8, respectively, which also have high specificity for Protein A. Comparative affinity studies reveal differences between the aptamers and confirm that PA#2/8 remains the most potent sequence within the selected aptamer pool reaching affinities in the low nanomolar range of K D = 20 ± 1 nM.

  14. Human La binds mRNAs through contacts to the poly(A) tail.

    PubMed

    Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

    2018-05-04

    In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3'OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3'OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail.

  15. Identification of distal silencing elements in the murine interferon-A11 gene promoter.

    PubMed

    Roffet, P; Lopez, S; Navarro, S; Bandu, M T; Coulombel, C; Vignal, M; Doly, J; Vodjdani, G

    1996-08-01

    The murine interferon-A11 (Mu IFN-A11) gene is a member of the IFN-A multigenic family. In mouse L929 cells, the weak response of the gene's promoter to viral induction is due to a combination of both a point mutation in the virus responsive element (VRE) and the presence of negatively regulating sequences surrounding the VRE. In the distal part of the promoter, the negatively acting E1E2 sequence was delimited. This sequence displays an inhibitory effect in either orientation or position on the inducibility of a virus-responsive heterologous promoter. It selectively represses VRE-dependent transcription but is not able to reduce the transcriptional activity of a VRE-lacking promoter. In a transient transfection assay, an E1E2-containing DNA competitor was able to derepress the native Mu IFN-A11 promoter. Specific nuclear factors bind to this sequence; thus the binding of trans-regulators participates in the repression of the Mu IFN-A11 gene. The E1E2 sequence contains an IFN regulatory factor (IRF)-binding site. Recombinant IRF2 binds this sequence and anti-IRF2 antibodies supershift a major complex formed with nuclear extracts. The protein composing the complex is 50 kDa in size, indicating the presence of IRF2 or antigenically related proteins in the complex. The Mu IFN-A11 gene is the first example within the murine IFN-A family, in which a distal promoter element has been identified that can negatively modulate the transcriptional response to viral induction.

  16. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene.

    PubMed

    Okuda, A; Imagawa, M; Maeda, Y; Sakai, M; Muramatsu, M

    1989-10-05

    We have recently identified a typical enhancer, termed GPEI, located about 2.5 kilobases upstream from the transcription initiation site of the rat glutathione transferase P gene. Analyses of 5' and 3' deletion mutants revealed that the cis-acting sequence of GPEI contained the phorbol 12-O-tetradecanoate 13-acetate responsive element (TRE)-like sequence in it. For the maximal activity, however, GPEI required an adjacent upstream sequence of about 19 base pairs in addition to the TRE-like sequence. With the DNA binding gel-shift assay, we could detect protein(s) that specifically binds to the TRE-like sequence of GPEI fragment, which was possibly c-jun.c-fos complex or a similar protein complex. The sequence immediately upstream of the TRE-like sequence did not have any activity by itself, but augmented the latter activity by about 5-fold.

  17. An SRY mutation causing human sex reversal resolves a general mechanism of structure-specific DNA recognition: application to the four-way DNA junction.

    PubMed

    Peters, R; King, C Y; Ukiyama, E; Falsafi, S; Donahoe, P K; Weiss, M A

    1995-04-11

    SRY, a genetic "master switch" for male development in mammals, exhibits two biochemical activities: sequence-specific recognition of duplex DNA and sequence-independent binding to the sharp angles of four-way DNA junctions. Here, we distinguish between these activities by analysis of a mutant SRY associated with human sex reversal (46, XY female with pure gonadal dysgenesis). The substitution (168T in human SRY) alters a nonpolar side chain in the minor-groove DNA recognition alpha-helix of the HMG box [Haqq, C.M., King, C.-Y., Ukiyama, E., Haqq, T.N., Falsalfi, S., Donahoe, P.K., & Weiss, M.A. (1994) Science 266, 1494-1500]. The native (but not mutant) side chain inserts between specific base pairs in duplex DNA, interrupting base stacking at a site of induced DNA bending. Isotope-aided 1H-NMR spectroscopy demonstrates that analogous side-chain insertion occurs on binding of SRY to a four-way junction, establishing a shared mechanism of sequence- and structure-specific DNA binding. Although the mutant DNA-binding domain exhibits > 50-fold reduction in sequence-specific DNA recognition, near wild-type affinity for four-way junctions is retained. Our results (i) identify a shared SRY-DNA contact at a site of either induced or intrinsic DNA bending, (ii) demonstrate that this contact is not required to bind an intrinsically bent DNA target, and (iii) rationalize patterns of sequence conservation or diversity among HMG boxes. Clinical association of the I68T mutation with human sex reversal supports the hypothesis that specific DNA recognition by SRY is required for male sex determination.

  18. A mammary cell-specific enhancer in mouse mammary tumor virus DNA is composed of multiple regulatory elements including binding sites for CTF/NFI and a novel transcription factor, mammary cell-activating factor.

    PubMed Central

    Mink, S; Härtig, E; Jennewein, P; Doppler, W; Cato, A C

    1992-01-01

    Mouse mammary tumor virus (MMTV) is a milk-transmitted retrovirus involved in the neoplastic transformation of mouse mammary gland cells. The expression of this virus is regulated by mammary cell type-specific factors, steroid hormones, and polypeptide growth factors. Sequences for mammary cell-specific expression are located in an enhancer element in the extreme 5' end of the long terminal repeat region of this virus. This enhancer, when cloned in front of the herpes simplex thymidine kinase promoter, endows the promoter with mammary cell-specific response. Using functional and DNA-protein-binding studies with constructs mutated in the MMTV long terminal repeat enhancer, we have identified two main regulatory elements necessary for the mammary cell-specific response. These elements consist of binding sites for a transcription factor in the family of CTF/NFI proteins and the transcription factor mammary cell-activating factor (MAF) that recognizes the sequence G Pu Pu G C/G A A G G/T. Combinations of CTF/NFI- and MAF-binding sites or multiple copies of either one of these binding sites but not solitary binding sites mediate mammary cell-specific expression. The functional activities of these two regulatory elements are enhanced by another factor that binds to the core sequence ACAAAG. Interdigitated binding sites for CTF/NFI, MAF, and/or the ACAAAG factor are also found in the 5' upstream regions of genes encoding whey milk proteins from different species. These findings suggest that mammary cell-specific regulation is achieved by a concerted action of factors binding to multiple regulatory sites. Images PMID:1328867

  19. The disorderly conduct of Hsc70 and its interaction with the Alzheimer's related Tau protein.

    PubMed

    Taylor, Isabelle R; Ahmad, Atta; Wu, Taia; Nordhues, Bryce A; Bhullar, Anup; Gestwicki, Jason E; Zuiderweg, Erik R P

    2018-05-15

    Hsp70 chaperones bind to various protein substrates for folding, trafficking, and degradation. Considerable structural information is available about how prokaryotic Hsp70 (DnaK) binds substrates, but less is known about mammalian Hsp70s, of which there are 13 isoforms encoded in the human genome. Here, we report the interaction between the human Hsp70 isoform heat shock cognate 71 KDa protein (Hsc70 or HSPA8) and peptides derived from the microtubule-associated protein tau, which is linked to Alzheimer's disease. For structural studies, we used an Hsc70 construct (called BETA) comprising the substrate-binding domain, but lacking the lid. Importantly, we found that truncating the lid does not significantly impair Hsc70's chaperone activity or allostery in vitro. Using NMR, we show that BETA is partially dynamically disordered in the absence of substrate and that binding of the tau sequence GKVQIINKKG (with a KD = 500 nM) causes dramatic rigidification of BETA. Nuclear Overhauser effect distance measurements revealed that tau binds to the canonical substrate-binding cleft, similar to the binding observed with DnaK. To further develop BETA as a tool for studying Hsc70 interactions, we also measured BETA binding in NMR and fluorescent competition assays to peptides derived from huntingtin, insulin, a second tau-recognition sequence, and a KFERQ-like sequence linked to chaperone-mediated autophagy. We found that the insulin C-peptide binds BETA with high affinity (KD < 100 nM), whereas the others do not (KD > 100 μM). Together, our findings reveal several similarities and differences in how prokaryotic and mammalian Hsp70 isoforms interact with different substrate peptides. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  20. Prediction of Ras-effector interactions using position energy matrices.

    PubMed

    Kiel, Christina; Serrano, Luis

    2007-09-01

    One of the more challenging problems in biology is to determine the cellular protein interaction network. Progress has been made to predict protein-protein interactions based on structural information, assuming that structural similar proteins interact in a similar way. In a previous publication, we have determined a genome-wide Ras-effector interaction network based on homology models, with a high accuracy of predicting binding and non-binding domains. However, for a prediction on a genome-wide scale, homology modelling is a time-consuming process. Therefore, we here successfully developed a faster method using position energy matrices, where based on different Ras-effector X-ray template structures, all amino acids in the effector binding domain are sequentially mutated to all other amino acid residues and the effect on binding energy is calculated. Those pre-calculated matrices can then be used to score for binding any Ras or effector sequences. Based on position energy matrices, the sequences of putative Ras-binding domains can be scanned quickly to calculate an energy sum value. By calibrating energy sum values using quantitative experimental binding data, thresholds can be defined and thus non-binding domains can be excluded quickly. Sequences which have energy sum values above this threshold are considered to be potential binding domains, and could be further analysed using homology modelling. This prediction method could be applied to other protein families sharing conserved interaction types, in order to determine in a fast way large scale cellular protein interaction networks. Thus, it could have an important impact on future in silico structural genomics approaches, in particular with regard to increasing structural proteomics efforts, aiming to determine all possible domain folds and interaction types. All matrices are deposited in the ADAN database (http://adan-embl.ibmc.umh.es/). Supplementary data are available at Bioinformatics online.

  1. ETS target genes: Identification of Egr1 as a target by RNA differential display and whole genome PCR techniques

    PubMed Central

    Robinson, Lois; Panayiotakis, Alexandra; Papas, Takis S.; Kola, Ismail; Seth, Arun

    1997-01-01

    ETS transcription factors play important roles in hematopoiesis, angiogenesis, and organogenesis during murine development. The ETS genes also have a role in neoplasia, for example in Ewing’s sarcomas and retrovirally induced cancers. The ETS genes encode transcription factors that bind to specific DNA sequences and activate transcription of various cellular and viral genes. To isolate novel ETS target genes, we used two approaches. In the first approach, we isolated genes by the RNA differential display technique. Previously, we have shown that the overexpression of ETS1 and ETS2 genes effects transformation of NIH 3T3 cells and specific transformants produce high levels of the ETS proteins. To isolate ETS1 and ETS2 responsive genes in these transformed cells, we prepared RNA from ETS1, ETS2 transformants, and normal NIH 3T3 cell lines and converted it into cDNA. This cDNA was amplified by PCR and displayed on sequencing gels. The differentially displayed bands were subcloned into plasmid vectors. By Northern blot analysis, several clones showed differential patterns of mRNA expression in the NIH 3T3-, ETS1-, and ETS2-expressing cell lines. Sixteen clones were analyzed by DNA sequence analysis, and 13 of them appeared to be unique because their DNA sequences did not match with any of the known genes present in the gene bank. Three known genes were found to be identical to the CArG box binding factor, phospholipase A2-activating protein, and early growth response 1 (Egr1) genes. In the second approach, to isolate ETS target promoters directly, we performed ETS1 binding with MboI-cleaved genomic DNA in the presence of a specific mAb followed by whole genome PCR. The immune complex-bound ETS binding sites containing DNA fragments were amplified and subcloned into pBluescript and subjected to DNA sequence and computer analysis. We found that, of a large number of clones isolated, 43 represented unique sequences not previously identified. Three clones turned out to contain regulatory sequences derived from human serglycin, preproapolipoprotein C II, and Egr1 genes. The ETS binding sites derived from these three regulatory sequences showed specific binding with recombinant ETS proteins. Of interest, Egr1 was identified by both of these techniques, suggesting strongly that it is indeed an ETS target gene. PMID:9207063

  2. Sequence analyses of fimbriae subunit FimA proteins on Actinomyces naeslundii genospecies 1 and 2 and Actinomyces odontolyticus with variant carbohydrate binding specificities

    PubMed Central

    Drobni, Mirva; Hallberg, Kristina; Öhman, Ulla; Birve, Anna; Persson, Karina; Johansson, Ingegerd; Strömberg, Nicklas

    2006-01-01

    Background Actinomyces naeslundii genospecies 1 and 2 express type-2 fimbriae (FimA subunit polymers) with variant Galβ binding specificities and Actinomyces odontolyticus a sialic acid specificity to colonize different oral surfaces. However, the fimbrial nature of the sialic acid binding property and sequence information about FimA proteins from multiple strains are lacking. Results Here we have sequenced fimA genes from strains of A.naeslundii genospecies 1 (n = 4) and genospecies 2 (n = 4), both of which harboured variant Galβ-dependent hemagglutination (HA) types, and from A.odontolyticus PK984 with a sialic acid-dependent HA pattern. Three unique subtypes of FimA proteins with 63.8–66.4% sequence identity were present in strains of A. naeslundii genospecies 1 and 2 and A. odontolyticus. The generally high FimA sequence identity (>97.2%) within a genospecies revealed species specific sequences or segments that coincided with binding specificity. All three FimA protein variants contained a signal peptide, pilin motif, E box, proline-rich segment and an LPXTG sorting motif among other conserved segments for secretion, assembly and sorting of fimbrial proteins. The highly conserved pilin, E box and LPXTG motifs are present in fimbriae proteins from other Gram-positive bacteria. Moreover, only strains of genospecies 1 were agglutinated with type-2 fimbriae antisera derived from A. naeslundii genospecies 1 strain 12104, emphasizing that the overall folding of FimA may generate different functionalities. Western blot analyses with FimA antisera revealed monomers and oligomers of FimA in whole cell protein extracts and a purified recombinant FimA preparation, indicating a sortase-independent oligomerization of FimA. Conclusion The genus Actinomyces involves a diversity of unique FimA proteins with conserved pilin, E box and LPXTG motifs, depending on subspecies and associated binding specificity. In addition, a sortase independent oligomerization of FimA subunit proteins in solution was indicated. PMID:16686953

  3. In silico characterization and analysis of RTBP1 and NgTRF1 protein through MD simulation and molecular docking - A comparative study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-02-06

    Gaining access to sequence and structure information of telomere binding proteins helps in understanding the essential biological processes involve in conserved sequence specific interaction between DNA and the proteins. Rice telomere binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix turn helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain but till now there is very less communication on the in silico studies of these complete proteins.Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK web server.Digging up all the facts about the proteins it was reveled that around 120 amino acids in the tail part was showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicates the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and Energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  4. In Silico Characterization and Analysis of RTBP1 and NgTRF1 Protein Through MD Simulation and Molecular Docking: A Comparative Study.

    PubMed

    Mukherjee, Koel; Pandey, Dev Mani; Vidyarthi, Ambarish Saran

    2015-09-01

    Gaining access to sequence and structure information of telomere-binding proteins helps in understanding the essential biological processes involve in conserved sequence-specific interaction between DNA and the proteins. Rice telomere-binding protein (RTBP1) and Nicotiana glutinosa telomere repeat binding factor (NgTRF1) are helix-turn-helix motif type of proteins that plays role in telomeric DNA protection and length regulation. Both the proteins share same type of domain, but till now there is very less communication on the in silico studies of these complete proteins. Here we intend to do a comparative study between two proteins through modeling of the complete proteins, physiochemical characterization, MD simulation and DNA-protein docking. I-TASSER and CLC protein work bench was performed to find out the protein 3D structure as well as the different parameters to characterize the proteins. MD simulation was completed by GROMOS forcefield of GROMACS for 10 ns of time stretch. The simulated 3D structures were docked with template DNA (3D DNA modeled through 3D-DART) of TTTAGGG conserved sequence motif using HADDOCK Web server. By digging up all the facts about the proteins, it was revealed that around 120 amino acids in the tail part were showing a good sequence similarity between the proteins. Molecular modeling, sequence characterization and secondary structure prediction also indicate the similarity between the protein's structure and sequence. The result of MD simulation highlights on the RMSD, RMSF, Rg, PCA and energy plots which also conveys the similar type of motional behavior between them. The best complex formation for both the proteins in docking result also indicates for the first interaction site which is mainly the helix3 region of the DNA-binding domain. The overall computational analysis reveals that RTBP1 and NgTRF1 proteins display good amount of similarity in their physicochemical properties, structure, dynamics and binding mode.

  5. Finding the target sites of RNA-binding proteins

    PubMed Central

    Li, Xiao; Kazan, Hilal; Lipshitz, Howard D; Morris, Quaid D

    2014-01-01

    RNA–protein interactions differ from DNA–protein interactions because of the central role of RNA secondary structure. Some RNA-binding domains (RBDs) recognize their target sites mainly by their shape and geometry and others are sequence-specific but are sensitive to secondary structure context. A number of small- and large-scale experimental approaches have been developed to measure RNAs associated in vitro and in vivo with RNA-binding proteins (RBPs). Generalizing outside of the experimental conditions tested by these assays requires computational motif finding. Often RBP motif finding is done by adapting DNA motif finding methods; but modeling secondary structure context leads to better recovery of RBP-binding preferences. Genome-wide assessment of mRNA secondary structure has recently become possible, but these data must be combined with computational predictions of secondary structure before they add value in predicting in vivo binding. There are two main approaches to incorporating structural information into motif models: supplementing primary sequence motif models with preferred secondary structure contexts (e.g., MEMERIS and RNAcontext) and directly modeling secondary structure recognized by the RBP using stochastic context-free grammars (e.g., CMfinder and RNApromo). The former better reconstruct known binding preferences for sequence-specific RBPs but are not suitable for modeling RBPs that recognize shape and geometry of RNAs. Future work in RBP motif finding should incorporate interactions between multiple RBDs and multiple RBPs in binding to RNA. WIREs RNA 2014, 5:111–130. doi: 10.1002/wrna.1201 PMID:24217996

  6. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides

    PubMed Central

    Yoga, Yano M. K.; Traore, Daouda A. K.; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R.; Barker, Andrew; Leedman, Peter J.; Wilce, Jacqueline A.; Wilce, Matthew C. J.

    2012-01-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5′-CCCTCCCT-3′ DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5′-ACCCCA-3′ DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad. PMID:22344691

  7. Contribution of the first K-homology domain of poly(C)-binding protein 1 to its affinity and specificity for C-rich oligonucleotides.

    PubMed

    Yoga, Yano M K; Traore, Daouda A K; Sidiqi, Mahjooba; Szeto, Chris; Pendini, Nicole R; Barker, Andrew; Leedman, Peter J; Wilce, Jacqueline A; Wilce, Matthew C J

    2012-06-01

    Poly-C-binding proteins are triple KH (hnRNP K homology) domain proteins with specificity for single stranded C-rich RNA and DNA. They play diverse roles in the regulation of protein expression at both transcriptional and translational levels. Here, we analyse the contributions of individual αCP1 KH domains to binding C-rich oligonucleotides using biophysical and structural methods. Using surface plasmon resonance (SPR), we demonstrate that KH1 makes the most stable interactions with both RNA and DNA, KH3 binds with intermediate affinity and KH2 only interacts detectibly with DNA. The crystal structure of KH1 bound to a 5'-CCCTCCCT-3' DNA sequence shows a 2:1 protein:DNA stoichiometry and demonstrates a molecular arrangement of KH domains bound to immediately adjacent oligonucleotide target sites. SPR experiments, with a series of poly-C-sequences reveals that cytosine is preferred at all four positions in the oligonucleotide binding cleft and that a C-tetrad binds KH1 with 10 times higher affinity than a C-triplet. The basis for this high affinity interaction is finally detailed with the structure determination of a KH1.W.C54S mutant bound to 5'-ACCCCA-3' DNA sequence. Together, these data establish the lead role of KH1 in oligonucleotide binding by αCP1 and reveal the molecular basis of its specificity for a C-rich tetrad.

  8. Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

    PubMed

    Mouw, M; Pintel, D J

    1998-11-10

    GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

  9. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.

    2016-01-01

    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm), an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: http://www.scfbio-iitd.res.in/software/onco/NavSite/index.htm PMID:27515825

  10. Novel DNA packaging recognition in the unusual bacteriophage N15

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

    Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

  11. Isoforms of the major peanut allergen Ara h 2: IgE binding in children with peanut allergy.

    PubMed

    Hales, Belinda J; Bosco, Anthony; Mills, Kristina L; Hazell, Lee A; Loh, Richard; Holt, Patrick G; Thomas, Wayne R

    2004-10-01

    The major peanut allergen Ara h 2 consists of two isoforms, namely Ara h 2.0101 and Ara h 2.0201. The recently identified Ara h 2.0201 isoform contains an extra 12 amino acids including an extra copy of the reported immunodominant epitope DPYSPS. This study aimed to evaluate the IgE binding of the two Ara h 2 isoforms. Ten clones of Ara h 2 were sequenced to assess the relative frequency of the Ara h 2 isoforms and to identify whether there was further variation in the Ara h 2 sequence. IgE binding to Ara h 2.0101 and Ara h 2.0201 was measured for 70 peanut-allergic children using an IgE DELFIA assay to quantitate specific IgE binding. A competition assay was used to measure whether Ara h 2.0201 contained IgE epitopes other than those found for Ara h 2.0101. The original Ara h 2.0101 sequence was found for 6/10 clones and Ara h 2.0201 was found for 2/10 clones. Ara h 2.0201 had the expected insertion of 12 amino acids as well as substitutions at positions 40 (40G) and 142 (142E). Two new isoforms were identified as different polymorphisms of position 142. One Ara h 2.01 clone (Ara h 2.0102) contained 142E and one Ara h 2.02 clone (Ara h 2.0202) contained 142D. A polymorphism that was previously identified by other investigators at position 77 (77Q or 77R) was not found for any of the 10 sequences. Although the level of IgE binding to Ara h 2.0201 of individual patients was frequently higher than the binding to Ara h 2.0101 (p < 0.01), there was a strong correlation in binding to both isoforms (r = 0.987, p < 0.0001) and when analyzed as a group the means were similar. Ara h 2.0101 was not as efficient at blocking reactivity to Ara h 2.0201 indicating there is an additional IgE specificity for the Ara h 2.0201 isoform. Ara h 2.0201 has similar but higher IgE binding than the originally sequenced Ara h 2.0101 isoform and contains other IgE specificities.

  12. Sequence analysis of serum albumins reveals the molecular evolution of ligand recognition properties.

    PubMed

    Fanali, Gabriella; Ascenzi, Paolo; Bernardi, Giorgio; Fasano, Mauro

    2012-01-01

    Serum albumin (SA) is a circulating protein providing a depot and carrier for many endogenous and exogenous compounds. At least seven major binding sites have been identified by structural and functional investigations mainly in human SA. SA is conserved in vertebrates, with at least 49 entries in protein sequence databases. The multiple sequence analysis of this set of entries leads to the definition of a cladistic tree for the molecular evolution of SA orthologs in vertebrates, thus showing the clustering of the considered species, with lamprey SAs (Lethenteron japonicum and Petromyzon marinus) in a separate outgroup. Sequence analysis aimed at searching conserved domains revealed that most SA sequences are made up by three repeated domains (about 600 residues), as extensively characterized for human SA. On the contrary, lamprey SAs are giant proteins (about 1400 residues) comprising seven repeated domains. The phylogenetic analysis of the SA family reveals a stringent correlation with the taxonomic classification of the species available in sequence databases. A focused inspection of the sequences of ligand binding sites in SA revealed that in all sites most residues involved in ligand binding are conserved, although the versatility towards different ligands could be peculiar of higher organisms. Moreover, the analysis of molecular links between the different sites suggests that allosteric modulation mechanisms could be restricted to higher vertebrates.

  13. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  14. Evaluation of Phage Display Discovered Peptides as Ligands for Prostate-Specific Membrane Antigen (PSMA)

    PubMed Central

    Edwards, W. Barry

    2013-01-01

    The aim of this study was to identify potential ligands of PSMA suitable for further development as novel PSMA-targeted peptides using phage display technology. The human PSMA protein was immobilized as a target followed by incubation with a 15-mer phage display random peptide library. After one round of prescreening and two rounds of screening, high-stringency screening at the third round of panning was performed to identify the highest affinity binders. Phages which had a specific binding activity to PSMA in human prostate cancer cells were isolated and the DNA corresponding to the 15-mers were sequenced to provide three consensus sequences: GDHSPFT, SHFSVGS and EVPRLSLLAVFL as well as other sequences that did not display consensus. Two of the peptide sequences deduced from DNA sequencing of binding phages, SHSFSVGSGDHSPFT and GRFLTGGTGRLLRIS were labeled with 5-carboxyfluorescein and shown to bind and co-internalize with PSMA on human prostate cancer cells by fluorescence microscopy. The high stringency requirements yielded peptides with affinities KD∼1 µM or greater which are suitable starting points for affinity maturation. While these values were less than anticipated, the high stringency did yield peptide sequences that apparently bound to different surfaces on PSMA. These peptide sequences could be the basis for further development of peptides for prostate cancer tumor imaging and therapy. PMID:23935860

  15. Cryptic glucocorticoid receptor-binding sites pervade genomic NF-κB response elements.

    PubMed

    Hudson, William H; Vera, Ian Mitchelle S de; Nwachukwu, Jerome C; Weikum, Emily R; Herbst, Austin G; Yang, Qin; Bain, David L; Nettles, Kendall W; Kojetin, Douglas J; Ortlund, Eric A

    2018-04-06

    Glucocorticoids (GCs) are potent repressors of NF-κB activity, making them a preferred choice for treatment of inflammation-driven conditions. Despite the widespread use of GCs in the clinic, current models are inadequate to explain the role of the glucocorticoid receptor (GR) within this critical signaling pathway. GR binding directly to NF-κB itself-tethering in a DNA binding-independent manner-represents the standing model of how GCs inhibit NF-κB-driven transcription. We demonstrate that direct binding of GR to genomic NF-κB response elements (κBREs) mediates GR-driven repression of inflammatory gene expression. We report five crystal structures and solution NMR data of GR DBD-κBRE complexes, which reveal that GR recognizes a cryptic response element between the binding footprints of NF-κB subunits within κBREs. These cryptic sequences exhibit high sequence and functional conservation, suggesting that GR binding to κBREs is an evolutionarily conserved mechanism of controlling the inflammatory response.

  16. Structure-Templated Predictions of Novel Protein Interactions from Sequence Information

    PubMed Central

    Betel, Doron; Breitkreuz, Kevin E; Isserlin, Ruth; Dewar-Darch, Danielle; Tyers, Mike; Hogue, Christopher W. V

    2007-01-01

    The multitude of functions performed in the cell are largely controlled by a set of carefully orchestrated protein interactions often facilitated by specific binding of conserved domains in the interacting proteins. Interacting domains commonly exhibit distinct binding specificity to short and conserved recognition peptides called binding profiles. Although many conserved domains are known in nature, only a few have well-characterized binding profiles. Here, we describe a novel predictive method known as domain–motif interactions from structural topology (D-MIST) for elucidating the binding profiles of interacting domains. A set of domains and their corresponding binding profiles were derived from extant protein structures and protein interaction data and then used to predict novel protein interactions in yeast. A number of the predicted interactions were verified experimentally, including new interactions of the mitotic exit network, RNA polymerases, nucleotide metabolism enzymes, and the chaperone complex. These results demonstrate that new protein interactions can be predicted exclusively from sequence information. PMID:17892321

  17. A novel Arg H52/Tyr H33 conservative motif in antibodies: A correlation between sequence of antibodies and antigen binding.

    PubMed

    Petrov, Artem; Arzhanik, Vladimir; Makarov, Gennady; Koliasnikov, Oleg

    2016-08-01

    Antibodies are the family of proteins, which are responsible for antigen recognition. The computational modeling of interaction between an antigen and an antibody is very important when crystallographic structure is unavailable. In this research, we have discovered the correlation between the amino acid sequence of antibody and its specific binding characteristics on the example of the novel conservative binding motif, which consists of four residues: Arg H52, Tyr H33, Thr H59, and Glu H61. These residues are specifically oriented in the binding site and interact with each other in a specific manner. The residues of the binding motif are involved in interaction strictly with negatively charged groups of antigens, and form a binding complex. Mechanism of interaction and characteristics of the complex were also discovered. The results of this research can be used to increase the accuracy of computational antibody-antigen interaction modeling and for post-modeling quality control of the modeled structures.

  18. Isolation and preliminary characterization of a Cd-binding protein from Tenebrio molitor (Coleoptera).

    PubMed

    Pedersen, S A; Kristiansen, E; Andersen, R A; Zachariassen, K E

    2007-04-01

    The effect of cadmium (Cd) exposure on Cd-binding ligands was investigated for the first time in a beetle (Coleoptera), using the mealworm Tenebrio molitor (L) as a model species. Exposure to Cd resulted in an approximate doubling of the Cd-binding capacity of the protein extracts from whole animals. Analysis showed that the increase was mainly explained by the induction of a Cd-binding protein of 7134.5 Da, with non-metallothionein characteristics. Amino acid analysis and de novo sequencing revealed that the protein has an unusually high content of the acidic amino acids aspartic and glutamic acid that may explain how this protein can bind Cd even without cysteine residues. Similarities in the amino acid composition suggest it to belong to a group of little studied proteins often referred to as "Cd-binding proteins without high cysteine content". This is the first report on isolation and peptide sequence determination of such a protein from a coleopteran.

  19. Activation of a Ca(2+)-dependent protein kinase involves intramolecular binding of a calmodulin-like regulatory domain

    NASA Technical Reports Server (NTRS)

    Huang, J. F.; Teyton, L.; Harper, J. F.; Evans, M. L. (Principal Investigator)

    1996-01-01

    Ca(2+)-dependent protein kinases (CDPKs) are regulated by a C-terminal calmodulin-like domain (CaM-LD). The CaM-LD is connected to the kinase by a short junction sequence which contains a pseudosubstrate autoinhibitor. To understand how the CaM-LD regulates a CDPK, a recombinant CDPK (isoform CPK-1 from Arabidopsis, accession no. L14771) was made as a fusion protein in Escherichia coli. We show here that a truncated CDPK lacking a CaM-LD (e.g. mutant delta NC-26H) can be activated by exogenous calmodulin or an isolated CaM-LD (Kact approximately 2 microM). We propose that Ca2+ activation of a CDPK normally occurs through intramolecular binding of the CaM-LD to the junction. When the junction and CaM-LD are made as two separate polypeptides, the CaM-LD can bind the junction in a Ca(2+)-dependent fashion with a dissociation constant (KD) of 6 x 10(-6) M, as determined by kinetic binding analyses. When the junction and CaM-LD are tethered in a single polypeptide (e.g. in protein JC-1), their ability to engage in bimolecular binding is suppressed (e.g. the tethered CaM-LD cannot bind a separate junction). A mutation which disrupts the putative CaM-LD binding sequence (e.g. substitution LRV-1444 to DLPG) appears to block intramolecular binding, as indicated by the restored ability of a tethered CaM-LD to engage in bimolecular binding. This mutation, in the context of a full-length enzyme (mutant KJM46H), appears to block Ca2+ activation. Thus, a disruption of intramolecular binding correlates with a disruption of the Ca2+ activation mechanism. CDPKs provide the first example of a member of the calmodulin superfamily where a target binding sequence is located within the same polypeptide.

  20. Solution structure of telomere binding domain of AtTRB2 derived from Arabidopsis thaliana

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yun, Ji-Hye; Lee, Won Kyung; Kim, Heeyoun

    Highlights: • We have determined solution structure of Myb domain of AtTRB2. • The Myb domain of AtTRB2 is located in the N-terminal region. • The Myb domain of AtTRB2 binds to plant telomeric DNA without fourth helix. • Helix 2 and 3 of the Myb domain of AtTRB2 are involved in DNA recognition. • AtTRB2 is a novel protein distinguished from other known plant TBP. - Abstract: Telomere homeostasis is regulated by telomere-associated proteins, and the Myb domain is well conserved for telomere binding. AtTRB2 is a member of the SMH (Single-Myb-Histone)-like family in Arabidopsis thaliana, having an N-terminalmore » Myb domain, which is responsible for DNA binding. The Myb domain of AtTRB2 contains three α-helices and loops for DNA binding, which is unusual given that other plant telomere-binding proteins have an additional fourth helix that is essential for DNA binding. To understand the structural role for telomeric DNA binding of AtTRB2, we determined the solution structure of the Myb domain of AtTRB2 (AtTRB2{sub 1–64}) using nuclear magnetic resonance (NMR) spectroscopy. In addition, the inter-molecular interaction between AtTRB2{sub 1–64} and telomeric DNA has been characterized by the electrophoretic mobility shift assay (EMSA) and NMR titration analyses for both plant (TTTAGGG)n and human (TTAGGG)n telomere sequences. Data revealed that Trp28, Arg29, and Val47 residues located in Helix 2 and Helix 3 are crucial for DNA binding, which are well conserved among other plant telomere binding proteins. We concluded that although AtTRB2 is devoid of the additional fourth helix in the Myb-extension domain, it is able to bind to plant telomeric repeat sequences as well as human telomeric repeat sequences.« less

  1. Modular probes for enriching and detecting complex nucleic acid sequences

    NASA Astrophysics Data System (ADS)

    Wang, Juexiao Sherry; Yan, Yan Helen; Zhang, David Yu

    2017-12-01

    Complex DNA sequences are difficult to detect and profile, but are important contributors to human health and disease. Existing hybridization probes lack the capability to selectively bind and enrich hypervariable, long or repetitive sequences. Here, we present a generalized strategy for constructing modular hybridization probes (M-Probes) that overcomes these challenges. We demonstrate that M-Probes can tolerate sequence variations of up to 7 nt at prescribed positions while maintaining single nucleotide sensitivity at other positions. M-Probes are also shown to be capable of sequence-selectively binding a continuous DNA sequence of more than 500 nt. Furthermore, we show that M-Probes can detect genes with triplet repeats exceeding a programmed threshold. As a demonstration of this technology, we have developed a hybrid capture method to determine the exact triplet repeat expansion number in the Huntington's gene of genomic DNA using quantitative PCR.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Xiong, J.-P.; Stehle, T.; Zhang, R.

    The structural basis for the divalent cation-dependent binding of heterodimeric alpha beta integrins to their ligands, which contain the prototypical Arg-Gly-Asp sequence, is unknown. Interaction with ligands triggers tertiary and quaternary structural rearrangements in integrins that are needed for cell signaling. Here we report the crystal structure of the extracellular segment of integrin alpha Vbeta 3 in complex with a cyclic peptide presenting the Arg-Gly-Asp sequence. The ligand binds at the major interface between the alpha V and beta 3 subunits and makes extensive contacts with both. Both tertiary and quaternary changes are observed in the presence of ligand. Themore » tertiary rearrangements take place in beta A, the ligand-binding domain of beta 3; in the complex, beta A acquires two cations, one of which contacts the ligand Asp directly and the other stabilizes the ligand-binding surface. Ligand binding induces small changes in the orientation of alpha V relative to beta 3.« less

  3. Selection of the simplest RNA that binds isoleucine

    PubMed Central

    LOZUPONE, CATHERINE; CHANGAYIL, SHANKAR; MAJERFELD, IRENE; YARUS, MICHAEL

    2003-01-01

    We have identified the simplest RNA binding site for isoleucine using selection-amplification (SELEX), by shrinking the size of the randomized region until affinity selection is extinguished. Such a protocol can be useful because selection does not necessarily make the simplest active motif most prominent, as is often assumed. We find an isoleucine binding site that behaves exactly as predicted for the site that requires fewest nucleotides. This UAUU motif (16 highly conserved positions; 27 total), is also the most abundant site in successful selections on short random tracts. The UAUU site, now isolated independently at least 63 times, is a small asymmetric internal loop. Conserved loop sequences include isoleucine codon and anticodon triplets, whose nucleotides are required for amino acid binding. This reproducible association between isoleucine and its coding sequences supports the idea that the genetic code is, at least in part, a stereochemical residue of the most easily isolated RNA–amino acid binding structures. PMID:14561881

  4. Potential ligand-binding residues in rat olfactory receptors identified by correlated mutation analysis

    NASA Technical Reports Server (NTRS)

    Singer, M. S.; Oliveira, L.; Vriend, G.; Shepherd, G. M.

    1995-01-01

    A family of G-protein-coupled receptors is believed to mediate the recognition of odor molecules. In order to identify potential ligand-binding residues, we have applied correlated mutation analysis to receptor sequences from the rat. This method identifies pairs of sequence positions where residues remain conserved or mutate in tandem, thereby suggesting structural or functional importance. The analysis supported molecular modeling studies in suggesting several residues in positions that were consistent with ligand-binding function. Two of these positions, dominated by histidine residues, may play important roles in ligand binding and could confer broad specificity to mammalian odor receptors. The presence of positive (overdominant) selection at some of the identified positions provides additional evidence for roles in ligand binding. Higher-order groups of correlated residues were also observed. Each group may interact with an individual ligand determinant, and combinations of these groups may provide a multi-dimensional mechanism for receptor diversity.

  5. Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦

    PubMed Central

    Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.

    2016-01-01

    Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566

  6. Identification and characterization of a HeLa nuclear protein that specifically binds to the trans-activation-response (TAR) element of human immunodeficiency virus.

    PubMed Central

    Marciniak, R A; Garcia-Blanco, M A; Sharp, P A

    1990-01-01

    Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305

  7. Quantitative relation between intermolecular and intramolecular binding of pro-rich peptides to SH3 domains.

    PubMed

    Zhou, Huan-Xiang

    2006-11-01

    Flexible linkers are often found to tether binding sequence motifs or connect protein domains. Here we analyze three usages of flexible linkers: 1), intramolecular binding of proline-rich peptides (PRPs) to SH3 domains for kinase regulation; 2), intramolecular binding of PRP for increasing the folding stability of SH3 domains; and 3), covalent linking of PRPs and other ligands for high-affinity bivalent binding. The basis of these analyses is a quantitative relation between intermolecular and intramolecular binding constants. This relation has the form K(i) = K(e0)p for intramolecular binding and K(e) = K(e01)K(e02)p for bivalent binding. The effective concentration p depends on the length of the linker and the distance between the linker attachment points in the bound state. Several applications illustrate the usefulness of the quantitative relation. These include intramolecular binding to the Itk SH3 domain by an internal PRP and to a circular permutant of the alpha-spectrin SH3 domain by a designed PRP, and bivalent binding to the two SH3 domains of Grb2 by two linked PRPs. These and other examples suggest that flexible linkers and sequence motifs tethered to them, like folded protein domains, are also subject to tight control during evolution.

  8. DNA Binding of Centromere Protein C (CENPC) Is Stabilized by Single-Stranded RNA

    PubMed Central

    Du, Yaqing; Topp, Christopher N.; Dawe, R. Kelly

    2010-01-01

    Centromeres are the attachment points between the genome and the cytoskeleton: centromeres bind to kinetochores, which in turn bind to spindles and move chromosomes. Paradoxically, the DNA sequence of centromeres has little or no role in perpetuating kinetochores. As such they are striking examples of genetic information being transmitted in a manner that is independent of DNA sequence (epigenetically). It has been found that RNA transcribed from centromeres remains bound within the kinetochore region, and this local population of RNA is thought to be part of the epigenetic marking system. Here we carried out a genetic and biochemical study of maize CENPC, a key inner kinetochore protein. We show that DNA binding is conferred by a localized region 122 amino acids long, and that the DNA-binding reaction is exquisitely sensitive to single-stranded RNA. Long, single-stranded nucleic acids strongly promote the binding of CENPC to DNA, and the types of RNAs that stabilize DNA binding match in size and character the RNAs present on kinetochores in vivo. Removal or replacement of the binding module with HIV integrase binding domain causes a partial delocalization of CENPC in vivo. The data suggest that centromeric RNA helps to recruit CENPC to the inner kinetochore by altering its DNA binding characteristics. PMID:20140237

  9. Structure of homeodomain-leucine zipper/DNA complexes studied using hydroxyl radical cleavage of DNA and methylation interference.

    PubMed

    Tron, Adriana E; Comelli, Raúl N; Gonzalez, Daniel H

    2005-12-27

    Homeodomain-leucine zipper (HD-Zip) proteins, unlike most homeodomain proteins, bind a pseudopalindromic DNA sequence as dimers. We have investigated the structure of the DNA complexes formed by two HD-Zip proteins with different nucleotide preferences at the central position of the binding site using footprinting and interference methods. The results indicate that the respective complexes are not symmetric, with the strand bearing a central purine (top strand) showing higher protection around the central region and the bottom strand protected toward the 3' end. Binding to a sequence with a nonpreferred central base pair produces a decrease in protection in either the top or the bottom strand, depending upon the protein. Modeling studies derived from the complex formed by the monomeric Antennapedia homeodomain with DNA indicate that in the HD-Zip/DNA complex the recognition helix of one of the monomers is displaced within the major groove respective to the other one. This monomer seems to lose contacts with a part of the recognition sequence upon binding to the nonpreferred site. The results show that the structure of the complex formed by HD-Zip proteins with DNA is dependent upon both protein intrinsic characteristics and the nucleotides present at the central position of the recognition sequence.

  10. A target-unrelated peptide in an M13 phage display library traced to an advantageous mutation in the gene II ribosome-binding site.

    PubMed

    Brammer, Leighanne A; Bolduc, Benjamin; Kass, Jessica L; Felice, Kristin M; Noren, Christopher J; Hall, Marilena Fitzsimons

    2008-02-01

    Screening of the commercially available Ph.D.-7 phage-displayed heptapeptide library for peptides that bind immobilized Zn2+ resulted in the repeated selection of the peptide HAIYPRH, although binding assays indicated that HAIYPRH is not a zinc-binding peptide. HAIYPRH has also been selected in several other laboratories using completely different targets, and its ubiquity suggests that it is a target-unrelated peptide. We demonstrated that phage displaying HAIYPRH are enriched after serial amplification of the library without exposure to target. The amplification of phage displaying HAIYPRH was found to be dramatically faster than that of the library itself. DNA sequencing uncovered a mutation in the Shine-Dalgarno (SD) sequence for gIIp, a protein involved in phage replication, imparting to the SD sequence better complementarity to the 16S ribosomal RNA (rRNA). Introducing this mutation into phage lacking a displayed peptide resulted in accelerated propagation, whereas phage displaying HAIYPRH with a wild-type SD sequence were found to amplify normally. The SD mutation may alter gIIp expression and, consequently, the rate of propagation of phage. In the Ph.D.-7 library, the mutation is coincident with the displayed peptide HAIYPRH, accounting for the target-unrelated selection of this peptide in multiple reported panning experiments.

  11. Isolation and N-terminal sequencing of a novel cadmium-binding protein from Boletus edulis

    NASA Astrophysics Data System (ADS)

    Collin-Hansen, C.; Andersen, R. A.; Steinnes, E.

    2003-05-01

    A Cd-binding protein was isolated from the popular edible mushroom Boletus edulis, which is a hyperaccumulator of both Cd and Hg. Wild-growing samples of B. edulis were collected from soils rich in Cd. Cd radiotracer was added to the crude protein preparation obtained from ethanol precipitation of heat-treated cytosol. Proteins were then further separated in two consecutive steps; gel filtration and anion exchange chromatography. In both steps the Cd radiotracer profile showed only one distinct peak, which corresponded well with the profiles of endogenous Cd obtained by atomic absorption spectrophotometry (AAS). Concentrations of the essential elements Cu and Zn were low in the protein fractions high in Cd. N-terminal sequencing performed on the Cd-binding protein fractions revealed a protein with a novel amino acid sequence, which contained aromatic amino acids as well as proline. Both the N-terminal sequencing and spectrofluorimetric analysis with EDTA and ABD-F (4-aminosulfonyl-7-fluoro-2, 1, 3-benzoxadiazole) failed to detect cysteine in the Cd-binding fractions. These findings conclude that the novel protein does not belong to the metallothionein family. The results suggest a role for the protein in Cd transport and storage, and they are of importance in view of toxicology and food chemistry, but also for environmental protection.

  12. In silico modeling of epigenetic-induced changes in photoreceptor cis-regulatory elements.

    PubMed

    Hossain, Reafa A; Dunham, Nicholas R; Enke, Raymond A; Berndsen, Christopher E

    2018-01-01

    DNA methylation is a well-characterized epigenetic repressor of mRNA transcription in many plant and vertebrate systems. However, the mechanism of this repression is not fully understood. The process of transcription is controlled by proteins that regulate recruitment and activity of RNA polymerase by binding to specific cis-regulatory sequences. Cone-rod homeobox (CRX) is a well-characterized mammalian transcription factor that controls photoreceptor cell-specific gene expression. Although much is known about the functions and DNA binding specificity of CRX, little is known about how DNA methylation modulates CRX binding affinity to genomic cis-regulatory elements. We used bisulfite pyrosequencing of human ocular tissues to measure DNA methylation levels of the regulatory regions of RHO , PDE6B, PAX6 , and LINE1 retrotransposon repeats. To describe the molecular mechanism of repression, we used molecular modeling to illustrate the effect of DNA methylation on human RHO regulatory sequences. In this study, we demonstrate an inverse correlation between DNA methylation in regulatory regions adjacent to the human RHO and PDE6B genes and their subsequent transcription in human ocular tissues. Docking of CRX to the DNA models shows that CRX interacts with the grooves of these sequences, suggesting changes in groove structure could regulate binding. Molecular dynamics simulations of the RHO promoter and enhancer regions show changes in the flexibility and groove width upon epigenetic modification. Models also demonstrate changes in the local dynamics of CRX binding sites within RHO regulatory sequences which may account for the repression of CRX-dependent transcription. Collectively, these data demonstrate epigenetic regulation of CRX binding sites in human retinal tissue and provide insight into the mechanism of this mode of epigenetic regulation to be tested in future experiments.

  13. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe.

    PubMed

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R; McQueen, Philip G; Yang, Andrew X; Mizuguchi, Takeshi; Grewal, Shiv I S; Levin, Henry L

    2015-11-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and -9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. Copyright © 2015 by the Genetics Society of America.

  14. Single-Nucleotide-Specific Targeting of the Tf1 Retrotransposon Promoted by the DNA-Binding Protein Sap1 of Schizosaccharomyces pombe

    PubMed Central

    Hickey, Anthony; Esnault, Caroline; Majumdar, Anasuya; Chatterjee, Atreyi Ghatak; Iben, James R.; McQueen, Philip G.; Yang, Andrew X.; Mizuguchi, Takeshi; Grewal, Shiv I. S.; Levin, Henry L.

    2015-01-01

    Transposable elements (TEs) constitute a substantial fraction of the eukaryotic genome and, as a result, have a complex relationship with their host that is both adversarial and dependent. To minimize damage to cellular genes, TEs possess mechanisms that target integration to sequences of low importance. However, the retrotransposon Tf1 of Schizosaccharomyces pombe integrates with a surprising bias for promoter sequences of stress-response genes. The clustering of integration in specific promoters suggests that Tf1 possesses a targeting mechanism that is important for evolutionary adaptation to changes in environment. We report here that Sap1, an essential DNA-binding protein, plays an important role in Tf1 integration. A mutation in Sap1 resulted in a 10-fold drop in Tf1 transposition, and measures of transposon intermediates support the argument that the defect occurred in the process of integration. Published ChIP-Seq data on Sap1 binding combined with high-density maps of Tf1 integration that measure independent insertions at single-nucleotide positions show that 73.4% of all integration occurs at genomic sequences bound by Sap1. This represents high selectivity because Sap1 binds just 6.8% of the genome. A genome-wide analysis of promoter sequences revealed that Sap1 binding and amounts of integration correlate strongly. More important, an alignment of the DNA-binding motif of Sap1 revealed integration clustered on both sides of the motif and showed high levels specifically at positions +19 and −9. These data indicate that Sap1 contributes to the efficiency and position of Tf1 integration. PMID:26358720

  15. Structural studies of polypeptides: Mechanism of immunoglobin catalysis and helix propagation in hybrid sequence, disulfide containing peptides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Storrs, Richard Wood

    1992-08-01

    Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by 31P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal of cis,more » syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 Å of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an α-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.« less

  16. Structural studies of polypeptides: Mechanism of immunoglobin catalysis and helix propagation in hybrid sequence, disulfide containing peptides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Storrs, R.W.

    1992-08-01

    Catalytic immunoglobin fragments were studied Nuclear Magnetic Resonance spectroscopy to identify amino acid residues responsible for the catalytic activity. Small, hybrid sequence peptides were analyzed for helix propagation following covalent initiation and for activity related to the protein from which the helical sequence was derived. Hydrolysis of p-nitrophenyl carbonates and esters by specific immunoglobins is thought to involve charge complementarity. The pK of the transition state analog P-nitrophenyl phosphate bound to the immunoglobin fragment was determined by [sup 31]P-NMR to verify the juxtaposition of a positively charged amino acid to the binding/catalytic site. Optical studies of immunoglobin mediated photoreversal ofmore » cis, syn cyclobutane thymine dimers implicated tryptophan as the photosensitizing chromophore. Research shows the chemical environment of a single tryptophan residue is altered upon binding of the thymine dimer. This tryptophan residue was localized to within 20 [Angstrom] of the binding site through the use of a nitroxide paramagnetic species covalently attached to the thymine dimer. A hybrid sequence peptide was synthesized based on the bee venom peptide apamin in which the helical residues of apamin were replaced with those from the recognition helix of the bacteriophage 434 repressor protein. Oxidation of the disufide bonds occured uniformly in the proper 1-11, 3-15 orientation, stabilizing the 434 sequence in an [alpha]-helix. The glycine residue stopped helix propagation. Helix propagation in 2,2,2-trifluoroethanol mixtures was investigated in a second hybrid sequence peptide using the apamin-derived disulfide scaffold and the S-peptide sequence. The helix-stop signal previously observed was not observed in the NMR NOESY spectrum. Helical connectivities were seen throughout the S-peptide sequence. The apamin/S-peptide hybrid binded to the S-protein (residues 21-166 of ribonuclease A) and reconstituted enzymatic activity.« less

  17. Neuroleptic malignant syndrome: case report and discussion

    PubMed Central

    Chandran, Geethan J.; Mikler, John R.; Keegan, David L.

    2003-01-01

    WE REPORT A CASE INVOLVING AN 81-YEAR-OLD man with schizoaffective disorder who presented with neuroleptic malignant syndrome (NMS) after an increase in his neuroleptic dose. NMS, a rare but potentially fatal complication of neuroleptic medications (e.g., antipsychotics, sedatives and antinauseants), is characterized by hyperthermia, muscle rigidity, an elevated creatine kinase level and autonomic instability. The syndrome often develops after a sudden increase in dosage of the neuroleptic medication or in states of dehydration. Treatment is mainly supportive and includes withdrawal of the neuroleptic medication and, possibly, administration of drugs such as dantrolene and bromocriptine. Complications of NMS include acute renal failure and acute respiratory failure. Given the widespread prescription of neuroleptics by physicians in a variety of fields, all physicians need to be able to recognize and appropriately manage NMS. PMID:12952806

  18. Electrostatically Biased Binding of Kinesin to Microtubules

    PubMed Central

    Zheng, Wenjun; Alonso, Maria; Huber, Gary; Dlugosz, Maciej; McCammon, J. Andrew; Cross, Robert A.

    2011-01-01

    The minimum motor domain of kinesin-1 is a single head. Recent evidence suggests that such minimal motor domains generate force by a biased binding mechanism, in which they preferentially select binding sites on the microtubule that lie ahead in the progress direction of the motor. A specific molecular mechanism for biased binding has, however, so far been lacking. Here we use atomistic Brownian dynamics simulations combined with experimental mutagenesis to show that incoming kinesin heads undergo electrostatically guided diffusion-to-capture by microtubules, and that this produces directionally biased binding. Kinesin-1 heads are initially rotated by the electrostatic field so that their tubulin-binding sites face inwards, and then steered towards a plus-endwards binding site. In tethered kinesin dimers, this bias is amplified. A 3-residue sequence (RAK) in kinesin helix alpha-6 is predicted to be important for electrostatic guidance. Real-world mutagenesis of this sequence powerfully influences kinesin-driven microtubule sliding, with one mutant producing a 5-fold acceleration over wild type. We conclude that electrostatic interactions play an important role in the kinesin stepping mechanism, by biasing the diffusional association of kinesin with microtubules. PMID:22140358

  19. A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.

    Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

  20. A divergent Pumilio repeat protein family for pre-rRNA processing and mRNA localization

    DOE PAGES

    Qiu, Chen; McCann, Kathleen L.; Wine, Robert N.; ...

    2014-12-15

    Pumilio/feminization of XX and XO animals (fem)-3 mRNA-binding factor (PUF) proteins bind sequence specifically to mRNA targets using a single-stranded RNA-binding domain comprising eight Pumilio (PUM) repeats. PUM repeats have now been identified in proteins that function in pre-rRNA processing, including human Puf-A and yeast Puf6. This is a role not previously ascribed to PUF proteins. In this paper we present crystal structures of human Puf-A that reveal a class of nucleic acid-binding proteins with 11 PUM repeats arranged in an “L”-like shape. In contrast to classical PUF proteins, Puf-A forms sequence-independent interactions with DNA or RNA, mediated by conservedmore » basic residues. We demonstrate that equivalent basic residues in yeast Puf6 are important for RNA binding, pre-rRNA processing, and mRNA localization. Finally, PUM repeats can be assembled into alternative folds that bind to structured nucleic acids in addition to forming canonical eight-repeat crescent-shaped RNA-binding domains found in classical PUF proteins.« less

  1. ChIP-nexus: a novel ChIP-exo protocol for improved detection of in vivo transcription factor binding footprints

    PubMed Central

    He, Qiye; Johnston, Jeff; Zeitlinger, Julia

    2014-01-01

    Understanding how eukaryotic enhancers are bound and regulated by specific combinations of transcription factors is still a major challenge. To better map transcription factor binding genome-wide at nucleotide resolution in vivo, we have developed a robust ChIP-exo protocol called ChIP experiments with nucleotide resolution through exonuclease, unique barcode and single ligation (ChIP-nexus), which utilizes an efficient DNA self-circularization step during library preparation. Application of ChIP-nexus to four proteins—human TBP and Drosophila NFkB, Twist and Max— demonstrates that it outperforms existing ChIP protocols in resolution and specificity, pinpoints relevant binding sites within enhancers containing multiple binding motifs and allows the analysis of in vivo binding specificities. Notably, we show that Max frequently interacts with DNA sequences next to its motif, and that this binding pattern correlates with local DNA sequence features such as DNA shape. ChIP-nexus will be broadly applicable to studying in vivo transcription factor binding specificity and its relationship to cis-regulatory changes in humans and model organisms. PMID:25751057

  2. Hydroxyapatite-binding peptides for bone growth and inhibition

    DOEpatents

    Bertozzi, Carolyn R [Berkeley, CA; Song, Jie [Shrewsbury, MA; Lee, Seung-Wuk [Walnut Creek, CA

    2011-09-20

    Hydroxyapatite (HA)-binding peptides are selected using combinatorial phage library display. Pseudo-repetitive consensus amino acid sequences possessing periodic hydroxyl side chains in every two or three amino acid sequences are obtained. These sequences resemble the (Gly-Pro-Hyp).sub.x repeat of human type I collagen, a major component of extracellular matrices of natural bone. A consistent presence of basic amino acid residues is also observed. The peptides are synthesized by the solid-phase synthetic method and then used for template-driven HA-mineralization. Microscopy reveal that the peptides template the growth of polycrystalline HA crystals .about.40 nm in size.

  3. System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells.

    PubMed

    Malina, Halina Z

    2011-01-19

    The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases.

  4. System in biology leading to cell pathology: stable protein-protein interactions after covalent modifications by small molecules or in transgenic cells

    PubMed Central

    2011-01-01

    Background The physiological processes in the cell are regulated by reversible, electrostatic protein-protein interactions. Apoptosis is such a regulated process, which is critically important in tissue homeostasis and development and leads to complete disintegration of the cell. Pathological apoptosis, a process similar to apoptosis, is associated with aging and infection. The current study shows that pathological apoptosis is a process caused by the covalent interactions between the signaling proteins, and a characteristic of this pathological network is the covalent binding of calmodulin to regulatory sequences. Results Small molecules able to bind covalently to the amino group of lysine, histidine, arginine, or glutamine modify the regulatory sequences of the proteins. The present study analyzed the interaction of calmodulin with the BH3 sequence of Bax, and the calmodulin-binding sequence of myristoylated alanine-rich C-kinase substrate in the presence of xanthurenic acid in primary retinal epithelium cell cultures and murine epithelial fibroblast cell lines transformed with SV40 (wild type [WT], Bid knockout [Bid-/-], and Bax-/-/Bak-/- double knockout [DKO]). Cell death was observed to be associated with the covalent binding of calmodulin, in parallel, to the regulatory sequences of proteins. Xanthurenic acid is known to activate caspase-3 in primary cell cultures, and the results showed that this activation is also observed in WT and Bid-/- cells, but not in DKO cells. However, DKO cells were not protected against death, but high rates of cell death occurred by detachment. Conclusions The results showed that small molecules modify the basic amino acids in the regulatory sequences of proteins leading to covalent interactions between the modified sequences (e.g., calmodulin to calmodulin-binding sites). The formation of these polymers (aggregates) leads to an unregulated and, consequently, pathological protein network. The results suggest a mechanism for the involvement of small molecules in disease development. In the knockout cells, incorrect interactions between proteins were observed without the protein modification by small molecules, indicating the abnormality of the protein network in the transgenic system. The irreversible protein-protein interactions lead to protein aggregation and cell degeneration, which are observed in all aging-associated diseases. PMID:21247434

  5. Diversity of the luciferin binding protein gene in bioluminescent dinoflagellates--insights from a new gene in Noctiluca scintillans and sequences from gonyaulacoid genera.

    PubMed

    Valiadi, Martha; Iglesias-Rodriguez, Maria Debora

    2014-01-01

    Dinoflagellate bioluminescence systems operate with or without a luciferin binding protein, representing two distinct modes of light production. However, the distribution, diversity, and evolution of the luciferin binding protein gene within bioluminescent dinoflagellates are not well known. We used PCR to detect and partially sequence this gene from the heterotrophic dinoflagellate Noctiluca scintillans and a group of ecologically important gonyaulacoid species. We report an additional luciferin binding protein gene in N. scintillans which is not attached to luciferase, further to its typical combined bioluminescence gene. This supports the hypothesis that a profound re-organization of the bioluminescence system has taken place in this organism. We also show that the luciferin binding protein gene is present in the genera Ceratocorys, Gonyaulax, and Protoceratium, and is prevalent in bioluminescent species of Alexandrium. Therefore, this gene is an integral component of the standard molecular bioluminescence machinery in dinoflagellates. Nucleotide sequences showed high within-strain variation among gene copies, revealing a highly diverse gene family comprising multiple gene types in some organisms. Phylogenetic analyses showed that, in some species, the evolution of the luciferin binding protein gene was different from the organism's general phylogenies, highlighting the complex evolutionary history of dinoflagellate bioluminescence systems. © 2013 The Author(s) Journal of Eukaryotic Microbiology © 2013 International Society of Protistologists.

  6. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Osipiuk, J.; Gornicki, P.; Maj, L.

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 Angstroms. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 Angstroms from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer {alpha}/{beta} sandwich with the overall shape of a cylinder and shows no structural homology to proteins of knownmore » structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the {alpha}-{beta} plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.« less

  7. Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

    PubMed Central

    Kamenova, Ivanka; Warfield, Linda

    2014-01-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

  8. Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

    PubMed

    Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

    2014-08-01

    Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

  9. Streptococcus pneumonia YlxR at 1.35 A shows a putative new fold.

    PubMed

    Osipiuk, J; Górnicki, P; Maj, L; Dementieva, I; Laskowski, R; Joachimiak, A

    2001-11-01

    The structure of the YlxR protein of unknown function from Streptococcus pneumonia was determined to 1.35 A. YlxR is expressed from the nusA/infB operon in bacteria and belongs to a small protein family (COG2740) that shares a conserved sequence motif GRGA(Y/W). The family shows no significant amino-acid sequence similarity with other proteins. Three-wavelength diffraction MAD data were collected to 1.7 A from orthorhombic crystals using synchrotron radiation and the structure was determined using a semi-automated approach. The YlxR structure resembles a two-layer alpha/beta sandwich with the overall shape of a cylinder and shows no structural homology to proteins of known structure. Structural analysis revealed that the YlxR structure represents a new protein fold that belongs to the alpha-beta plait superfamily. The distribution of the electrostatic surface potential shows a large positively charged patch on one side of the protein, a feature often found in nucleic acid-binding proteins. Three sulfate ions bind to this positively charged surface. Analysis of potential binding sites uncovered several substantial clefts, with the largest spanning 3/4 of the protein. A similar distribution of binding sites and a large sharply bent cleft are observed in RNA-binding proteins that are unrelated in sequence and structure. It is proposed that YlxR is an RNA-binding protein.

  10. Protein binding hot spots prediction from sequence only by a new ensemble learning method.

    PubMed

    Hu, Shan-Shan; Chen, Peng; Wang, Bing; Li, Jinyan

    2017-10-01

    Hot spots are interfacial core areas of binding proteins, which have been applied as targets in drug design. Experimental methods are costly in both time and expense to locate hot spot areas. Recently, in-silicon computational methods have been widely used for hot spot prediction through sequence or structure characterization. As the structural information of proteins is not always solved, and thus hot spot identification from amino acid sequences only is more useful for real-life applications. This work proposes a new sequence-based model that combines physicochemical features with the relative accessible surface area of amino acid sequences for hot spot prediction. The model consists of 83 classifiers involving the IBk (Instance-based k means) algorithm, where instances are encoded by important properties extracted from a total of 544 properties in the AAindex1 (Amino Acid Index) database. Then top-performance classifiers are selected to form an ensemble by a majority voting technique. The ensemble classifier outperforms the state-of-the-art computational methods, yielding an F1 score of 0.80 on the benchmark binding interface database (BID) test set. http://www2.ahu.edu.cn/pchen/web/HotspotEC.htm .

  11. The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5'TOP sequence.

    PubMed

    Lahr, Roni M; Mack, Seshat M; Héroux, Annie; Blagden, Sarah P; Bousquet-Antonelli, Cécile; Deragon, Jean-Marc; Berman, Andrea J

    2015-09-18

    La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. A putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. These studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. The La-related protein 1-specific domain repurposes HEAT-like repeats to directly bind a 5'TOP sequence

    DOE PAGES

    Lahr, Roni M.; Mack, Seshat M.; Heroux, Annie; ...

    2015-07-22

    La-related protein 1 (LARP1) regulates the stability of many mRNAs. These include 5'TOPs, mTOR-kinase responsive mRNAs with pyrimidine-rich 5' UTRs, which encode ribosomal proteins and translation factors. We determined that the highly conserved LARP1-specific C-terminal DM15 region of human LARP1 directly binds a 5'TOP sequence. The crystal structure of this DM15 region refined to 1.86 Å resolution has three structurally related and evolutionarily conserved helix-turn-helix modules within each monomer. These motifs resemble HEAT repeats, ubiquitous helical protein-binding structures, but their sequences are inconsistent with consensus sequences of known HEAT modules, suggesting this structure has been repurposed for RNA interactions. Amore » putative mTORC1-recognition sequence sits within a flexible loop C-terminal to these repeats. We also present modelling of pyrimidine-rich single-stranded RNA onto the highly conserved surface of the DM15 region. Ultimately, these studies lay the foundation necessary for proceeding toward a structural mechanism by which LARP1 links mTOR signalling to ribosome biogenesis.« less

  13. A sequence-specific transcription activator motif and powerful synthetic variants that bind Mediator using a fuzzy protein interface.

    PubMed

    Warfield, Linda; Tuttle, Lisa M; Pacheco, Derek; Klevit, Rachel E; Hahn, Steven

    2014-08-26

    Although many transcription activators contact the same set of coactivator complexes, the mechanism and specificity of these interactions have been unclear. For example, do intrinsically disordered transcription activation domains (ADs) use sequence-specific motifs, or do ADs of seemingly different sequence have common properties that encode activation function? We find that the central activation domain (cAD) of the yeast activator Gcn4 functions through a short, conserved sequence-specific motif. Optimizing the residues surrounding this short motif by inserting additional hydrophobic residues creates very powerful ADs that bind the Mediator subunit Gal11/Med15 with high affinity via a "fuzzy" protein interface. In contrast to Gcn4, the activity of these synthetic ADs is not strongly dependent on any one residue of the AD, and this redundancy is similar to that of some natural ADs in which few if any sequence-specific residues have been identified. The additional hydrophobic residues in the synthetic ADs likely allow multiple faces of the AD helix to interact with the Gal11 activator-binding domain, effectively forming a fuzzier interface than that of the wild-type cAD.

  14. Identification of trimannoside-recognizing peptide sequences from a T7 phage display screen using a QCM device.

    PubMed

    Nishiyama, Kazusa; Takakusagi, Yoichi; Kusayanagi, Tomoe; Matsumoto, Yuki; Habu, Shiori; Kuramochi, Kouji; Sugawara, Fumio; Sakaguchi, Kengo; Takahashi, Hideyo; Natsugari, Hideaki; Kobayashi, Susumu

    2009-01-01

    Here, we report on the identification of trimannoside-recognizing peptide sequences from a T7 phage display screen using a quartz-crystal microbalance (QCM) device. A trimannoside derivative that can form a self-assembled monolayer (SAM) was synthesized and used for immobilization on the gold electrode surface of a QCM sensor chip. After six sets of one-cycle affinity selection, T7 phage particles displaying PSVGLFTH (8-mer) and SVGLGLGFSTVNCF (14-mer) were found to be enriched at a rate of 17/44, 9/44, respectively, suggesting that these peptides specifically recognize trimannoside. Binding checks using the respective single T7 phage and synthetic peptide also confirmed the specific binding of these sequences to the trimannoside-SAM. Subsequent analysis revealed that these sequences correspond to part of the primary amino acid sequence found in many mannose- or hexose-related proteins. Taken together, these results demonstrate the effectiveness of our T7 phage display environment for affinity selection of binding peptides. We anticipate this screening result will also be extremely useful in the development of inhibitors or drug delivery systems targeting polysaccharides as well as further investigations into the function of carbohydrates in vivo.

  15. The ribosome as a missing link in prebiotic evolution II: Ribosomes encode ribosomal proteins that bind to common regions of their own mRNAs and rRNAs.

    PubMed

    Root-Bernstein, Robert; Root-Bernstein, Meredith

    2016-05-21

    We have proposed that the ribosome may represent a missing link between prebiotic chemistries and the first cells. One of the predictions that follows from this hypothesis, which we test here, is that ribosomal RNA (rRNA) must have encoded the proteins necessary for ribosomal function. In other words, the rRNA also functioned pre-biotically as mRNA. Since these ribosome-binding proteins (rb-proteins) must bind to the rRNA, but the rRNA also functioned as mRNA, it follows that rb-proteins should bind to their own mRNA as well. This hypothesis can be contrasted to a "null" hypothesis in which rb-proteins evolved independently of the rRNA sequences and therefore there should be no necessary similarity between the rRNA to which rb-proteins bind and the mRNA that encodes the rb-protein. Five types of evidence reported here support the plausibility of the hypothesis that the mRNA encoding rb-proteins evolved from rRNA: (1) the ubiquity of rb-protein binding to their own mRNAs and autogenous control of their own translation; (2) the higher-than-expected incidence of Arginine-rich modules associated with RNA binding that occurs in rRNA-encoded proteins; (3) the fact that rRNA-binding regions of rb-proteins are homologous to their mRNA binding regions; (4) the higher than expected incidence of rb-protein sequences encoded in rRNA that are of a high degree of homology to their mRNA as compared with a random selection of other proteins; and (5) rRNA in modern prokaryotes and eukaryotes encodes functional proteins. None of these results can be explained by the null hypothesis that assumes independent evolution of rRNA and the mRNAs encoding ribosomal proteins. Also noteworthy is that very few proteins bind their own mRNAs that are not associated with ribosome function. Further tests of the hypothesis are suggested: (1) experimental testing of whether rRNA-encoded proteins bind to rRNA at their coding sites; (2) whether tRNA synthetases, which are also known to bind to their own mRNAs, are encoded by the tRNA sequences themselves; (3) and the prediction that archaeal and prokaryotic (DNA-based) genomes were built around rRNA "genes" so that rRNA-related sequences will be found to make up an unexpectedly high proportion of these genomes. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

  16. Effects of ligand binding on the dynamics of rice nonspecific lipid transfer protein 1: a model from molecular simulations.

    PubMed

    Lai, Yen-Ting; Cheng, Chao-Sheng; Liu, Yu-Nan; Liu, Yaw-Jen; Lyu, Ping-Chiang

    2008-09-01

    Plant nonspecific lipid transfer proteins (nsLTPs) are small, basic proteins constituted mainly of alpha-helices and stabilized by four conserved disulfide bridges. They are characterized by the presence of a tunnel-like hydrophobic cavity, capable of transferring various lipid molecules between lipid bilayers in vitro. In this study, molecular dynamics (MD) simulations were performed at room temperature to investigate the effects of lipid binding on the dynamic properties of rice nsLTP1. Rice nsLTP1, either in the free form or complexed with one or two lipids was subjected to MD simulations. The C-terminal loop was very flexible both before and after lipid binding, as revealed by calculating the root-mean-square fluctuation. After lipid binding, the flexibility of some residues that were not in direct contact with lipid molecules increased significantly, indicating an increase of entropy in the region distal from the binding site. Essential dynamics analysis revealed clear differences in motion between unliganded and liganded rice nsLTP1s. In the free form of rice nsLTP1, loop1 exhibited the largest directional motion. This specific essential motion mode diminished after binding one or two lipid molecules. To verify the origin of the essential motion observed in the free form of rice nsLTP1, we performed multiple sequence alignments to probe the intrinsic motion encoded in the primary sequence. We found that the amino acid sequence of loop1 is highly conserved among plant nsLTP1s, thus revealing its functional importance during evolution. Furthermore, the sequence of loop1 is composed mainly of amino acids with short side chains. In this study, we show that MD simulations, together with essential dynamics analysis, can be used to determine structural and dynamic differences of rice nsLTP1 upon lipid binding. 2008 Wiley-Liss, Inc.

  17. DNA condensing effects and sequence selectivity of DNA binding of antitumor noncovalent polynuclear platinum complexes.

    PubMed

    Malina, Jaroslav; Farrell, Nicholas P; Brabec, Viktor

    2014-02-03

    The noncovalent analogues of antitumor polynuclear platinum complexes represent a structurally discrete class of platinum drugs. Their chemical and biological properties differ significantly from those of most platinum chemotherapeutics, which bind to DNA in a covalent manner by formation of Pt-DNA adducts. In spite of the fact that these noncovalent polynuclear platinum complexes contain no leaving groups, they have been shown to bind to DNA with high affinity. We report here on the DNA condensation properties of a series of noncovalent analogues of antitumor polynuclear platinum complexes described by biophysical and biochemical methods. The results demonstrate that these polynuclear platinum compounds are capable of inducing DNA condensation at more than 1 order of magnitude lower concentrations than conventional spermine. Atomic force microscopy studies of DNA condensation confined to a mica substrate have revealed that the DNA morphologies become more compact with increasing concentration of the platinum complexes. Moreover, we also found that the noncovalent polynuclear platinum complex [{Pt(NH3)3}2-μ-{trans-Pt(NH3)2(NH2(CH2)6NH2)2}](6+) (TriplatinNC-A) binds to DNA in a sequence-dependent manner, namely, to A/T-rich sequences and A-tract regions, and that noncovalent polynuclear platinum complexes protect DNA from enzymatic cleavage by DNase I. The results suggest that mechanisms of antitumor and cytotoxic activities of these complexes may be associated with their unique ability to condense DNA along with their sequence-specific DNA binding. Owing to their high cellular accumulation, it is also reasonable to suggest that their mechanism of action is based on the competition with naturally occurring DNA condensing agents, such as polyamines spermine, spermidine, and putrescine, for intracellular binding sites, resulting in the disturbance of the correct binding of regulatory proteins initiating the onset of apoptosis.

  18. Binding to the DNA Minor Groove by Heterocyclic Dications: From AT Specific Monomers to GC Recognition with Dimers

    PubMed Central

    Nanjunda, Rupesh; Wilson, W. David

    2012-01-01

    Compounds that bind in the DNA minor groove have provided critical information on DNA molecular recognition, they have found extensive uses in biotechnology and they are providing clinically useful drugs against diseases as diverse as cancer and sleeping sickness. This review focuses on the development of clinically useful heterocyclic diamidine minor groove binders. These compounds have shown us that the classical model for minor groove binding in AT DNA sequences must be expanded in several ways: compounds with nonstandard shapes can bind strongly to the groove, water can be directly incorporated into the minor groove complex in an interfacial interaction, and the compounds can form cooperative stacked dimers to recognize GC and mixed AT/GC base pair sequences. PMID:23255206

  19. Genome-wide identification and characterization of Notch transcription complex-binding sequence-paired sites in leukemia cells.

    PubMed

    Severson, Eric; Arnett, Kelly L; Wang, Hongfang; Zang, Chongzhi; Taing, Len; Liu, Hudan; Pear, Warren S; Shirley Liu, X; Blacklow, Stephen C; Aster, Jon C

    2017-05-02

    Notch transcription complexes (NTCs) drive target gene expression by binding to two distinct types of genomic response elements, NTC monomer-binding sites and sequence-paired sites (SPSs) that bind NTC dimers. SPSs are conserved and have been linked to the Notch responsiveness of a few genes. To assess the overall contribution of SPSs to Notch-dependent gene regulation, we determined the DNA sequence requirements for NTC dimerization using a fluorescence resonance energy transfer (FRET) assay and applied insights from these in vitro studies to Notch-"addicted" T cell acute lymphoblastic leukemia (T-ALL) cells. We found that SPSs contributed to the regulation of about a third of direct Notch target genes. Although originally described in promoters, SPSs are present mainly in long-range enhancers, including an enhancer containing a newly described SPS that regulates HES5 expression. Our work provides a general method for identifying SPSs in genome-wide data sets and highlights the widespread role of NTC dimerization in Notch-transformed leukemia cells. Copyright © 2017, American Association for the Advancement of Science.

  20. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies

    NASA Astrophysics Data System (ADS)

    Shlyakhtenko, Luda S.; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S.; Lyubchenko, Yuri L.

    2015-10-01

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  1. APOBEC3G Interacts with ssDNA by Two Modes: AFM Studies.

    PubMed

    Shlyakhtenko, Luda S; Dutta, Samrat; Banga, Jaspreet; Li, Ming; Harris, Reuben S; Lyubchenko, Yuri L

    2015-10-27

    APOBEC3G (A3G) protein has antiviral activity against HIV and other pathogenic retroviruses. A3G has two domains: a catalytic C-terminal domain (CTD) that deaminates cytidine, and a N-terminal domain (NTD) that binds to ssDNA. Although abundant information exists about the biological activities of A3G protein, the interplay between sequence specific deaminase activity and A3G binding to ssDNA remains controversial. We used the topographic imaging and force spectroscopy modalities of Atomic Force Spectroscopy (AFM) to characterize the interaction of A3G protein with deaminase specific and nonspecific ssDNA substrates. AFM imaging demonstrated that A3G has elevated affinity for deaminase specific ssDNA than for nonspecific ssDNA. AFM force spectroscopy revealed two distinct binding modes by which A3G interacts with ssDNA. One mode requires sequence specificity, as demonstrated by stronger and more stable complexes with deaminase specific ssDNA than with nonspecific ssDNA. Overall these observations enforce prior studies suggesting that both domains of A3G contribute to the sequence specific binding of ssDNA.

  2. Sequence of ligand binding and structure change in the diphtheria toxin repressor upon activation by divalent transition metals.

    PubMed

    Rangachari, Vijayaraghavan; Marin, Vedrana; Bienkiewicz, Ewa A; Semavina, Maria; Guerrero, Luis; Love, John F; Murphy, John R; Logan, Timothy M

    2005-04-19

    The diphtheria toxin repressor (DtxR) is an Fe(II)-activated transcriptional regulator of iron homeostatic and virulence genes in Corynebacterium diphtheriae. DtxR is a two-domain protein that contains two structurally and functionally distinct metal binding sites. Here, we investigate the molecular steps associated with activation by Ni(II)Cl(2) and Cd(II)Cl(2). Equilibrium binding energetics for Ni(II) were obtained from isothermal titration calorimetry, indicating apparent metal dissociation constants of 0.2 and 1.7 microM for two independent sites. The binding isotherms for Ni(II) and Cd(II) exhibited a characteristic exothermic-endothermic pattern that was used to infer the metal binding sequence by comparing the wild-type isotherm with those of several binding site mutants. These data were complemented by measuring the distance between specific backbone amide nitrogens and the first equivalent of metal through heteronuclear NMR relaxation measurements. Previous studies indicated that metal binding affects a disordered to ordered transition in the metal binding domain. The coupling between metal binding and structure change was investigated using near-UV circular dichroism spectroscopy. Together, the data show that the first equivalent of metal is bound by the primary metal binding site. This binding orients the DNA binding helices and begins to fold the N-terminal domain. Subsequent binding at the ancillary site completes the folding of this domain and formation of the dimer interface. This model is used to explain the behavior of several mutants.

  3. Rapid evolution of cis-regulatory sequences via local point mutations

    NASA Technical Reports Server (NTRS)

    Stone, J. R.; Wray, G. A.

    2001-01-01

    Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

  4. QueTAL: a suite of tools to classify and compare TAL effectors functionally and phylogenetically

    PubMed Central

    Pérez-Quintero, Alvaro L.; Lamy, Léo; Gordon, Jonathan L.; Escalon, Aline; Cunnac, Sébastien; Szurek, Boris; Gagnevin, Lionel

    2015-01-01

    Transcription Activator-Like (TAL) effectors from Xanthomonas plant pathogenic bacteria can bind to the promoter region of plant genes and induce their expression. DNA-binding specificity is governed by a central domain made of nearly identical repeats, each determining the recognition of one base pair via two amino acid residues (a.k.a. Repeat Variable Di-residue, or RVD). Knowing how TAL effectors differ from each other within and between strains would be useful to infer functional and evolutionary relationships, but their repetitive nature precludes reliable use of traditional alignment methods. The suite QueTAL was therefore developed to offer tailored tools for comparison of TAL effector genes. The program DisTAL considers each repeat as a unit, transforms a TAL effector sequence into a sequence of coded repeats and makes pair-wise alignments between these coded sequences to construct trees. The program FuncTAL is aimed at finding TAL effectors with similar DNA-binding capabilities. It calculates correlations between position weight matrices of potential target DNA sequence predicted from the RVD sequence, and builds trees based on these correlations. The programs accurately represented phylogenetic and functional relationships between TAL effectors using either simulated or literature-curated data. When using the programs on a large set of TAL effector sequences, the DisTAL tree largely reflected the expected species phylogeny. In contrast, FuncTAL showed that TAL effectors with similar binding capabilities can be found between phylogenetically distant taxa. This suite will help users to rapidly analyse any TAL effector genes of interest and compare them to other available TAL genes and should improve our understanding of TAL effectors evolution. It is available at http://bioinfo-web.mpl.ird.fr/cgi-bin2/quetal/quetal.cgi. PMID:26284082

  5. Interactions between the R2R3-MYB Transcription Factor, AtMYB61, and Target DNA Binding Sites

    PubMed Central

    Prouse, Michael B.; Campbell, Malcolm M.

    2013-01-01

    Despite the prominent roles played by R2R3-MYB transcription factors in the regulation of plant gene expression, little is known about the details of how these proteins interact with their DNA targets. For example, while Arabidopsis thaliana R2R3-MYB protein AtMYB61 is known to alter transcript abundance of a specific set of target genes, little is known about the specific DNA sequences to which AtMYB61 binds. To address this gap in knowledge, DNA sequences bound by AtMYB61 were identified using cyclic amplification and selection of targets (CASTing). The DNA targets identified using this approach corresponded to AC elements, sequences enriched in adenosine and cytosine nucleotides. The preferred target sequence that bound with the greatest affinity to AtMYB61 recombinant protein was ACCTAC, the AC-I element. Mutational analyses based on the AC-I element showed that ACC nucleotides in the AC-I element served as the core recognition motif, critical for AtMYB61 binding. Molecular modelling predicted interactions between AtMYB61 amino acid residues and corresponding nucleotides in the DNA targets. The affinity between AtMYB61 and specific target DNA sequences did not correlate with AtMYB61-driven transcriptional activation with each of the target sequences. CASTing-selected motifs were found in the regulatory regions of genes previously shown to be regulated by AtMYB61. Taken together, these findings are consistent with the hypothesis that AtMYB61 regulates transcription from specific cis-acting AC elements in vivo. The results shed light on the specifics of DNA binding by an important family of plant-specific transcriptional regulators. PMID:23741471

  6. Double-stranded telomeric DNA binding proteins: Diversity matters.

    PubMed

    Červenák, Filip; Juríková, Katarína; Sepšiová, Regina; Neboháčová, Martina; Nosek, Jozef; Tomáška, L'ubomír

    2017-01-01

    Telomeric sequences constitute only a small fraction of the whole genome yet they are crucial for ensuring genomic stability. This function is in large part mediated by protein complexes recruited to telomeric sequences by specific telomere-binding proteins (TBPs). Although the principal tasks of nuclear telomeres are the same in all eukaryotes, TBPs in various taxa exhibit a surprising diversity indicating their distinct evolutionary origin. This diversity is especially pronounced in ascomycetous yeasts where they must have co-evolved with rapidly diversifying sequences of telomeric repeats. In this article we (i) provide a historical overview of the discoveries leading to the current list of TBPs binding to double-stranded (ds) regions of telomeres, (ii) describe examples of dsTBPs highlighting their diversity in even closely related species, and (iii) speculate about possible evolutionary trajectories leading to a long list of various dsTBPs fulfilling the same general role(s) in their own unique ways.

  7. Functional specificity of a Hox protein mediated by the recognition of minor groove structure.

    PubMed

    Joshi, Rohit; Passner, Jonathan M; Rohs, Remo; Jain, Rinku; Sosinsky, Alona; Crickmore, Michael A; Jacob, Vinitha; Aggarwal, Aneel K; Honig, Barry; Mann, Richard S

    2007-11-02

    The recognition of specific DNA-binding sites by transcription factors is a critical yet poorly understood step in the control of gene expression. Members of the Hox family of transcription factors bind DNA by making nearly identical major groove contacts via the recognition helices of their homeodomains. In vivo specificity, however, often depends on extended and unstructured regions that link Hox homeodomains to a DNA-bound cofactor, Extradenticle (Exd). Using a combination of structure determination, computational analysis, and in vitro and in vivo assays, we show that Hox proteins recognize specific Hox-Exd binding sites via residues located in these extended regions that insert into the minor groove but only when presented with the correct DNA sequence. Our results suggest that these residues, which are conserved in a paralog-specific manner, confer specificity by recognizing a sequence-dependent DNA structure instead of directly reading a specific DNA sequence.

  8. Principles of regulatory information conservation between mouse and human.

    PubMed

    Cheng, Yong; Ma, Zhihai; Kim, Bong-Hyun; Wu, Weisheng; Cayting, Philip; Boyle, Alan P; Sundaram, Vasavi; Xing, Xiaoyun; Dogan, Nergiz; Li, Jingjing; Euskirchen, Ghia; Lin, Shin; Lin, Yiing; Visel, Axel; Kawli, Trupti; Yang, Xinqiong; Patacsil, Dorrelyn; Keller, Cheryl A; Giardine, Belinda; Kundaje, Anshul; Wang, Ting; Pennacchio, Len A; Weng, Zhiping; Hardison, Ross C; Snyder, Michael P

    2014-11-20

    To broaden our understanding of the evolution of gene regulation mechanisms, we generated occupancy profiles for 34 orthologous transcription factors (TFs) in human-mouse erythroid progenitor, lymphoblast and embryonic stem-cell lines. By combining the genome-wide transcription factor occupancy repertoires, associated epigenetic signals, and co-association patterns, here we deduce several evolutionary principles of gene regulatory features operating since the mouse and human lineages diverged. The genomic distribution profiles, primary binding motifs, chromatin states, and DNA methylation preferences are well conserved for TF-occupied sequences. However, the extent to which orthologous DNA segments are bound by orthologous TFs varies both among TFs and with genomic location: binding at promoters is more highly conserved than binding at distal elements. Notably, occupancy-conserved TF-occupied sequences tend to be pleiotropic; they function in several tissues and also co-associate with many TFs. Single nucleotide variants at sites with potential regulatory functions are enriched in occupancy-conserved TF-occupied sequences.

  9. G quadruplex-based FRET probes with the thrombin-binding aptamer (TBA) sequence designed for the efficient fluorometric detection of the potassium ion.

    PubMed

    Nagatoishi, Satoru; Nojima, Takahiko; Galezowska, Elzbieta; Juskowiak, Bernard; Takenaka, Shigeori

    2006-11-01

    The dual-labeled oligonucleotide derivative, FAT-0, carrying 6- carboxyfluorescein (FAM) and 6-carboxytetramethylrhodamine (TAMRA) labels at the 5' and 3' termini of the thrombin-binding aptamer (TBA) sequence 5'-GGT TGG TGT GGT TGG-3', and its derivatives, FAT-n (n=3, 5, and 7) with a spacer at the 5'-end of a TBA sequence of T(m)A (m=2, 4, and 6) have been designed and synthesized. These fluorescent probes were developed for monitoring K(+) concentrations in living organisms. Circular dichroism, UV-visible absorption, and fluorescence studies revealed that all FAT-n probes could form intramolecular tetraplex structures after binding K(+). Fluorescence resonance energy transfer and quenching results are discussed taking into account dye-dye contact interactions. The relationship between the fluorescence behavior of the probes and the spacer length in FAT-n was studied in detail and is discussed.

  10. Structural determinants of nuclear export signal orientation in binding to exportin CRM1

    DOE PAGES

    Fung, Ho Yee Joyce; Fu, Szu -Chin; Brautigam, Chad A.; ...

    2015-09-08

    The Chromosome Region of Maintenance 1 (CRM1) protein mediates nuclear export of hundreds of proteins through recognition of their nuclear export signals (NESs), which are highly variable in sequence and structure. The plasticity of the CRM1-NES interaction is not well understood, as there are many NES sequences that seem incompatible with structures of the NES-bound CRM1 groove. Crystal structures of CRM1 bound to two different NESs with unusual sequences showed the NES peptides binding the CRM1 groove in the opposite orientation (minus) to that of previously studied NESs (plus). A comparison of minus and plus NESs identified structural and sequencemore » determinants for NES orientation. The binding of NESs to CRM1 in both orientations results in a large expansion in NES consensus patterns and therefore a corresponding expansion of potential NESs in the proteome.« less

  11. A Single Rainbow Trout Cobalamin-binding Protein Stands in for Three Human Binders

    PubMed Central

    Greibe, Eva; Fedosov, Sergey; Sorensen, Boe S.; Højrup, Peter; Poulsen, Steen S.; Nexo, Ebba

    2012-01-01

    Cobalamin uptake and transport in mammals are mediated by three cobalamin-binding proteins: haptocorrin, intrinsic factor, and transcobalamin. The nature of cobalamin-binding proteins in lower vertebrates remains to be elucidated. The aim of this study was to characterize the cobalamin-binding proteins of the rainbow trout (Oncorhynchus mykiss) and to compare their properties with those of the three human cobalamin-binding proteins. High cobalamin-binding capacity was found in trout stomach (210 pmol/g), roe (400 pmol/g), roe fluid (390 nmol/liter), and plasma (2500 nmol/liter). In all cases, it appeared to be the same protein based on analysis of partial sequences and immunological responses. The trout cobalamin-binding protein was purified from roe fluid, sequenced, and further characterized. Like haptocorrin, the trout cobalamin-binding protein was stable at low pH and had a high binding affinity for the cobalamin analog cobinamide. Like haptocorrin and transcobalamin, the trout cobalamin-binding protein was present in plasma and recognized ligands with altered nucleotide moiety. Like intrinsic factors, the trout cobalamin-binding protein was present in the stomach and resisted degradation by trypsin and chymotrypsin. It also resembled intrinsic factor in the composition of conserved residues in the primary cobalamin-binding site in the C terminus. The trout cobalamin-binding protein was glycosylated and displayed spectral properties comparable with those of haptocorrin and intrinsic factor. In conclusion, only one soluble cobalamin-binding protein was identified in the rainbow trout, a protein that structurally behaves like an intermediate between the three human cobalamin-binding proteins. PMID:22872637

  12. Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

    PubMed

    Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

    2018-03-20

    A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  13. Mutation of mapped TIA-1/TIAR binding sites in the 3' terminal stem-loop of West Nile virus minus-strand RNA in an infectious clone negatively affects genomic RNA amplification.

    PubMed

    Emara, Mohamed M; Liu, Hsuan; Davis, William G; Brinton, Margo A

    2008-11-01

    Previous data showed that the cellular proteins TIA-1 and TIAR bound specifically to the West Nile virus 3' minus-strand stem-loop [WNV3'(-)SL] RNA (37) and colocalized with flavivirus replication complexes in WNV- and dengue virus-infected cells (21). In the present study, the sites on the WNV3'(-)SL RNA required for efficient in vitro T-cell intracellular antigen-related (TIAR) and T-cell intracellular antigen-1 (TIA-1) protein binding were mapped to short AU sequences (UAAUU) located in two internal loops of the WNV3'(-)SL RNA structure. Infectious clone RNAs with all or most of the binding site nucleotides in one of the 3' (-)SL loops deleted or substituted did not produce detectable virus after transfection or subsequent passage. With one exception, deletion/mutation of a single terminal nucleotide in one of the binding sequences had little effect on the efficiency of protein binding or virus production, but mutation of a nucleotide in the middle of a binding sequence reduced both the in vitro protein binding efficiency and virus production. Plaque size, intracellular genomic RNA levels, and virus production progressively decreased with decreasing in vitro TIAR/TIA-1 binding activity, but the translation efficiency of the various mutant RNAs was similar to that of the parental RNA. Several of the mutant RNAs that inefficiently interacted with TIAR/TIA-1 in vitro rapidly reverted in vivo, indicating that they could replicate at a low level and suggesting that an interaction between TIAR/TIA-1 and the viral 3'(-)SL RNA is not required for initial low-level symmetric RNA replication but instead facilitates the subsequent asymmetric amplification of genome RNA from the minus-strand template.

  14. MNDA binds NPM/B23 and the NPM-MLF1 chimera generated by the t(3;5) associated with myelodysplastic syndrome and acute myeloid leukemia.

    PubMed

    Xie, J; Briggs, J A; Morris, S W; Olson, M O; Kinney, M C; Briggs, R C

    1997-10-01

    The myeloid cell nuclear differentiation antigen (MNDA) is a nuclear protein expressed specifically in developing cells of the human myelomonocytic lineage, including the end-stage monocytes/macrophages and granulocytes. Nuclear localization, lineage- and stage-specific expression, association with chromatin, and regulation by interferon alpha indicate that this protein is involved in regulating gene expression uniquely associated with the differentiation process and/or function of the monocyte/macrophage. MNDA does not bind specific DNA sequences, but rather a set of nuclear proteins that includes nucleolin (C23). Both in vitro binding assays and co-immunoprecipitation were used to demonstrate that MNDA also binds protein B23 (nucleophosmin/NPM). Three reciprocal chromosome translocations found in certain cases of leukemia/lymphoma involve fusions with the NPM/B23 gene, t(5;17) NPM-RARalpha, t(2;5) NPM-ALK, and the t(3;5) NPM-MLF1. In the current study, MNDA was not able to bind the NPM-ALK chimera originating from the t(2;5) and containing residues 1-117 of NPM. However, MNDA did bind the NPM-MLF1 product of the t(3;5) that contains the N-terminal 175 residues of NPM. The additional 58 amino acids (amino acids 117-175) of the NPM sequence that are contained in the product of the NPM-MLF1 fusion gene relative to the product of the NPM-ALK fusion appear responsible for MNDA binding. This additional NPM sequence contains a nuclear localization signal and clusters of acidic residues believed to bind nuclear localization signals of other proteins. Whereas NPM and nucleolin are primarily localized within the nucleolus, MNDA is distributed throughout the nucleus including the nucleolus, suggesting that additional interactions define overall MNDA localization.

  15. DNA Recognition by a σ 54 Transcriptional Activator from Aquifex aeolicus

    DOE PAGES

    Vidangos, Natasha K.; Heideker, Johanna; Lyubimov, Artem; ...

    2014-08-23

    Transcription initiation by bacterial σ 54-polymerase requires the action of a transcriptional activator protein. Activators bind sequence-specifically upstream of the transcription initiation site via a DNA-binding domain. The structurally characterized DNA-binding domains from activators all belong to the Factor for Inversion Stimulation (Fis) family of helix-turn-helix DNA-binding proteins. We report here structures of the free and DNA-bound forms of the DNA-binding domain of NtrC4 (4DBD) from Aquifex aeolicus, a member of the NtrC family of σ 54 activators. Two NtrC4 binding sites were identified upstream (-145 and -85 base pairs) from the start of the lpxC gene, which is responsiblemore » for the first committed step in Lipid A biosynthesis. This is the first experimental evidence for σ 54 regulation in lpxC expression. 4DBD was crystallized both without DNA and in complex with the -145 binding site. The structures, together with biochemical data, indicate that NtrC4 binds to DNA in a manner that is similar to that of its close homologue, Fis. Ultimately, the greater sequence specificity for the binding of 4DBD relative to Fis seems to arise from a larger number of base specific contacts contributing to affinity than for Fis.« less

  16. Human La binds mRNAs through contacts to the poly(A) tail

    PubMed Central

    Vinayak, Jyotsna; Marrella, Stefano A; Hussain, Rawaa H; Rozenfeld, Leonid; Solomon, Karine; Bayfield, Mark A

    2018-01-01

    Abstract In addition to a role in the processing of nascent RNA polymerase III transcripts, La proteins are also associated with promoting cap-independent translation from the internal ribosome entry sites of numerous cellular and viral coding RNAs. La binding to RNA polymerase III transcripts via their common UUU-3’OH motif is well characterized, but the mechanism of La binding to coding RNAs is poorly understood. Using electromobility shift assays and cross-linking immunoprecipitation, we show that in addition to a sequence specific UUU-3’OH binding mode, human La exhibits a sequence specific and length dependent poly(A) binding mode. We demonstrate that this poly(A) binding mode uses the canonical nucleic acid interaction winged helix face of the eponymous La motif, previously shown to be vacant during uridylate binding. We also show that cytoplasmic, but not nuclear La, engages poly(A) RNA in human cells, that La entry into polysomes utilizes the poly(A) binding mode, and that La promotion of translation from the cyclin D1 internal ribosome entry site occurs in competition with cytoplasmic poly(A) binding protein (PABP). Our data are consistent with human La functioning in translation through contacts to the poly(A) tail. PMID:29447394

  17. Crystallization and preliminary X-ray diffraction analysis of the Bacillus subtilis replication termination protein in complex with the 37-base-pair TerI-binding site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vivian, J. P.; Porter, C.; Wilce, J. A.

    2006-11-01

    A preparation of replication terminator protein (RTP) of B. subtilis and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. The replication terminator protein (RTP) of Bacillus subtilis binds to specific DNA sequences that halt the progression of the replisome in a polar manner. These terminator complexes flank a defined region of the chromosome into which they allow replication forks to enter but not exit. Forcing the fusion of replication forks in a specific zone is thought to allow the coordination of post-replicative processes. The functional terminator complex comprises two homodimers each of 29more » kDa bound to overlapping binding sites. A preparation of RTP and a 37-base-pair TerI sequence (comprising two binding sites for RTP) has been purified and crystallized. A data set to 3.9 Å resolution with 97.0% completeness and an R{sub sym} of 12% was collected from a single flash-cooled crystal using synchrotron radiation. The diffraction data are consistent with space group P622, with unit-cell parameters a = b = 118.8, c = 142.6 Å.« less

  18. Functional display of platelet-binding VWF fragments on filamentous bacteriophage.

    PubMed

    Yee, Andrew; Tan, Fen-Lai; Ginsburg, David

    2013-01-01

    von Willebrand factor (VWF) tethers platelets to sites of vascular injury via interaction with the platelet surface receptor, GPIb. To further define the VWF sequences required for VWF-platelet interaction, a phage library displaying random VWF protein fragments was screened against formalin-fixed platelets. After 3 rounds of affinity selection, DNA sequencing of platelet-bound clones identified VWF peptides mapping exclusively to the A1 domain. Aligning these sequences defined a minimal, overlapping segment spanning P1254-A1461, which encompasses the C1272-C1458 cystine loop. Analysis of phage carrying a mutated A1 segment (C1272/1458A) confirmed the requirement of the cystine loop for optimal binding. Four rounds of affinity maturation of a randomly mutagenized A1 phage library identified 10 and 14 unique mutants associated with enhanced platelet binding in the presence and absence of botrocetin, respectively, with 2 mutants (S1370G and I1372V) common to both conditions. These results demonstrate the utility of filamentous phage for studying VWF protein structure-function and identify a minimal, contiguous peptide that bind to formalin-fixed platelets, confirming the importance of the VWF A1 domain with no evidence for another independently platelet-binding segment within VWF. These findings also point to key structural elements within the A1 domain that regulate VWF-platelet adhesion.

  19. Specific and non-specific interactions of ParB with DNA: implications for chromosome segregation

    PubMed Central

    Taylor, James A.; Pastrana, Cesar L.; Butterer, Annika; Pernstich, Christian; Gwynn, Emma J.; Sobott, Frank; Moreno-Herrero, Fernando; Dillingham, Mark S.

    2015-01-01

    The segregation of many bacterial chromosomes is dependent on the interactions of ParB proteins with centromere-like DNA sequences called parS that are located close to the origin of replication. In this work, we have investigated the binding of Bacillus subtilis ParB to DNA in vitro using a variety of biochemical and biophysical techniques. We observe tight and specific binding of a ParB homodimer to the parS sequence. Binding of ParB to non-specific DNA is more complex and displays apparent positive co-operativity that is associated with the formation of larger, poorly defined, nucleoprotein complexes. Experiments with magnetic tweezers demonstrate that non-specific binding leads to DNA condensation that is reversible by protein unbinding or force. The condensed DNA structure is not well ordered and we infer that it is formed by many looping interactions between neighbouring DNA segments. Consistent with this view, ParB is also able to stabilize writhe in single supercoiled DNA molecules and to bridge segments from two different DNA molecules in trans. The experiments provide no evidence for the promotion of non-specific DNA binding and/or condensation events by the presence of parS sequences. The implications of these observations for chromosome segregation are discussed. PMID:25572315

  20. Influence of arginine-glycine-aspartic acid (RGD), integrins (alphaV and alpha5) and osteopontin on bovine sperm-egg binding, and fertilization in vitro.

    PubMed

    Gonçalves, R F; Wolinetz, C D; Killian, G J

    2007-02-01

    Osteopontin (OPN), a phosphoprotein containing an arginine-glycine-aspartic acid (RGD) sequence, has been identified in cow oviduct epithelium and fluid. To investigate the potential role OPN in fertilization, we evaluated the ability of RGD peptide (arginine-glycine-aspartic), RGE peptide (arginine-glycine-glutamic acid), integrins alphaV and alpha5 antibodies and OPN antibody to influence bovine in vitro sperm-egg binding and fertilization. Treatment of sperm or oocytes with the RGD peptide prior fertilization significantly decreased in vitro sperm-egg binding and fertilization compared to the non-treated controls or those treated with RGE peptide. Binding and fertilization were also significantly decreased when in vitro matured bovine oocytes or sperm were pre-incubated with integrins alphaV and alpha5 antibodies at concentration ranging from 5 to 20 microg/mL. Addition of a rabbit polyclonal IgG antibody against purified bovine milk OPN with sperm or/and oocytes decreased (P<0.05) fertilization compared to the in vitro-fertilized control. These data provided evidence that integrin ligands existed on bovine oocytes and spermatozoa that contained RGD recognition sequences, and that antibody to OPN, a protein that contains that RGD sequence, was capable of reducing sperm-egg binding and fertilization in vitro.

  1. Inhibition of HMGA2 binding to DNA by netropsin

    PubMed Central

    Miao, Yi; Cui, Tengjiao; Leng, Fenfei; Wilson, W. David

    2008-01-01

    The design of small synthetic molecules that can be used to affect gene expression is an area of active interest for development of agents in therapeutic and biotechnology applications. Many compounds that target the minor groove in AT sequences in DNA are well characterized and are promising reagents for use as modulators of protein-DNA complexes. The mammalian high mobility group transcriptional factor, HMGA2, also targets the DNA minor groove and plays critical roles in disease processes from cancer to obesity. Biosensor-surface plasmon resonance methods were used to monitor HMGA2 binding to target sites on immobilized DNA and a competition assay for inhibition of the HMGA2-DNA complex was designed. HMGA2 binds strongly to the DNA through AT hook domains with KD values of 20 - 30 nM depending on the DNA sequence. The well-characterized minor groove binder, netropsin, was used to develop and test the assay. The compound has two binding sites in the protein-DNA interaction sequence and this provides an advantage for inhibition. An equation for analysis of results when the inhibitor has two binding sites in the biopolymer recognition surface is presented with the results. The assay provides a platform for discovery of HMGA2 inhibitors. PMID:18023407

  2. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed Central

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-01-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result. PMID:7853501

  3. The NS1 polypeptide of the murine parvovirus minute virus of mice binds to DNA sequences containing the motif [ACCA]2-3.

    PubMed

    Cotmore, S F; Christensen, J; Nüesch, J P; Tattersall, P

    1995-03-01

    A DNA fragment containing the minute virus of mice 3' replication origin was specifically coprecipitated in immune complexes containing the virally coded NS1, but not the NS2, polypeptide. Antibodies directed against the amino- or carboxy-terminal regions of NS1 precipitated the NS1-origin complexes, but antibodies directed against NS1 amino acids 284 to 459 blocked complex formation. Using affinity-purified histidine-tagged NS1 preparations, we have shown that the specific protein-DNA interaction is of moderate affinity, being stable in 0.1 M salt but rapidly lost at higher salt concentrations. In contrast, generalized (or nonspecific) DNA binding by NS1 could be demonstrated only in low salt. Addition of ATP or gamma S-ATP enhanced specific DNA binding by wild-type NS1 severalfold, but binding was lost under conditions which favored ATP hydrolysis. NS1 molecules with mutations in a critical lysine residue (amino acid 405) in the consensus ATP-binding site bound to the origin, but this binding could not be enhanced by ATP addition. DNase I protection assays carried out with wild-type NS1 in the presence of gamma S-ATP gave footprints which extended over 43 nucleotides on both DNA strands, from the middle of the origin bubble sequence to a position some 14 bp beyond the nick site. The DNA-binding site for NS1 was mapped to a 22-bp fragment from the middle of the 3' replication origin which contains the sequence ACCAACCA. This conforms to a reiterated motif (ACCA)2-3, which occurs, in more or less degenerate form, at many sites throughout the minute virus of mice genome (J. W. Bodner, Virus Genes 2:167-182, 1989). Insertion of a single copy of the sequence (ACCA)3 was shown to be sufficient to confer NS1 binding on an otherwise unrecognized plasmid fragment. The functions of NS1 in the viral life cycle are reevaluated in the light of this result.

  4. Genome-wide localization and expression profiling establish Sp2 as a sequence-specific transcription factor regulating vitally important genes

    PubMed Central

    Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram

    2012-01-01

    The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502

  5. ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Visel, Axel; Blow, Matthew J.; Li, Zirong

    2009-02-01

    A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. Wemore » tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.« less

  6. Interaction of recombinant human epidermal growth factor with phospholipid vesicles. A steady-state and time-resolved fluorescence study of the bis-tryptophan sequence (Trp49-Trp50).

    PubMed

    Li De La Sierra, I M; Vincent, M; Padron, G; Gallay, J

    1992-01-01

    The interaction of recombinant human epidermal growth factor with small unilamellar phospholipid vesicles was studied by steady-state and time-resolved fluorescence of the bis-tryptophan sequence (Trp49-Trp50). Steady-state anisotropy measurements demonstrate that strong binding occurred with small unilamellar vesicles made up of acidic phospholipids at acidic pH only (pH < or = 4.7). An apparent stoichiometry for 1,2-dimyristoyl-sn-phosphoglycerol of about 12 phospholipid molecules per molecule of human epidermal growth factor was estimated. The binding appears to be more efficient at temperatures above the gel to liquid-crystalline phase transition. The conformation and the environment of the Trp-Trp sequence are not greatly modified after binding, as judged from the invariance of the excited state lifetime distribution and from that of the fast processes affecting the anisotropy decay. This suggests that the Trp-Trp sequence is not embedded within the bilayer, in contrast to the situation in surfactant micelles (Mayo et al. 1987; Kohda and Inigaki 1992).

  7. Exploiting three kinds of interface propensities to identify protein binding sites.

    PubMed

    Liu, Bin; Wang, Xiaolong; Lin, Lei; Dong, Qiwen; Wang, Xuan

    2009-08-01

    Predicting the binding sites between two interacting proteins provides important clues to the function of a protein. In this study, we present a building block of proteins called order profiles to use the evolutionary information of the protein sequence frequency profiles and apply this building block to produce a class of propensities called order profile interface propensities. For comparisons, we revisit the usage of residue interface propensities and binary profile interface propensities for protein binding site prediction. Each kind of propensities combined with sequence profiles and accessible surface areas are inputted into SVM. When tested on four types of complexes (hetero-permanent complexes, hetero-transient complexes, homo-permanent complexes and homo-transient complexes), experimental results show that the order profile interface propensities are better than residue interface propensities and binary profile interface propensities. Therefore, order profile is a suitable profile-level building block of the protein sequences and can be widely used in many tasks of computational biology, such as the sequence alignment, the prediction of domain boundary, the designation of knowledge-based potentials and the protein remote homology detection.

  8. Evolutionary and biophysical relationships among the papillomavirus E2 proteins.

    PubMed

    Blakaj, Dukagjin M; Fernandez-Fuentes, Narcis; Chen, Zigui; Hegde, Rashmi; Fiser, Andras; Burk, Robert D; Brenowitz, Michael

    2009-01-01

    Infection by human papillomavirus (HPV) may result in clinical conditions ranging from benign warts to invasive cancer. The HPV E2 protein represses oncoprotein transcription and is required for viral replication. HPV E2 binds to palindromic DNA sequences of highly conserved four base pair sequences flanking an identical length variable 'spacer'. E2 proteins directly contact the conserved but not the spacer DNA. Variation in naturally occurring spacer sequences results in differential protein affinity that is dependent on their sensitivity to the spacer DNA's unique conformational and/or dynamic properties. This article explores the biophysical character of this core viral protein with the goal of identifying characteristics that associated with risk of virally caused malignancy. The amino acid sequence, 3d structure and electrostatic features of the E2 protein DNA binding domain are highly conserved; specific interactions with DNA binding sites have also been conserved. In contrast, the E2 protein's transactivation domain does not have extensive surfaces of highly conserved residues. Rather, regions of high conservation are localized to small surface patches. Implications to cancer biology are discussed.

  9. Sequence-Specific Recognition of DNA by Proteins: Binding Motifs Discovered Using a Novel Statistical/Computational Analysis

    PubMed Central

    Jakubec, David; Laskowski, Roman A.; Vondrasek, Jiri

    2016-01-01

    Decades of intensive experimental studies of the recognition of DNA sequences by proteins have provided us with a view of a diverse and complicated world in which few to no features are shared between individual DNA-binding protein families. The originally conceived direct readout of DNA residue sequences by amino acid side chains offers very limited capacity for sequence recognition, while the effects of the dynamic properties of the interacting partners remain difficult to quantify and almost impossible to generalise. In this work we investigated the energetic characteristics of all DNA residue—amino acid side chain combinations in the conformations found at the interaction interface in a very large set of protein—DNA complexes by the means of empirical potential-based calculations. General specificity-defining criteria were derived and utilised to look beyond the binding motifs considered in previous studies. Linking energetic favourability to the observed geometrical preferences, our approach reveals several additional amino acid motifs which can distinguish between individual DNA bases. Our results remained valid in environments with various dielectric properties. PMID:27384774

  10. Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cruzen, M.E.

    1993-01-01

    Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less

  11. Recognition of platinum-DNA adducts by HMGB1a.

    PubMed

    Ramachandran, Srinivas; Temple, Brenda; Alexandrova, Anastassia N; Chaney, Stephen G; Dokholyan, Nikolay V

    2012-09-25

    Cisplatin (CP) and oxaliplatin (OX), platinum-based drugs used widely in chemotherapy, form adducts on intrastrand guanines (5'GG) in genomic DNA. DNA damage recognition proteins, transcription factors, mismatch repair proteins, and DNA polymerases discriminate between CP- and OX-GG DNA adducts, which could partly account for differences in the efficacy, toxicity, and mutagenicity of CP and OX. In addition, differential recognition of CP- and OX-GG adducts is highly dependent on the sequence context of the Pt-GG adduct. In particular, DNA binding protein domain HMGB1a binds to CP-GG DNA adducts with up to 53-fold greater affinity than to OX-GG adducts in the TGGA sequence context but shows much smaller differences in binding in the AGGC or TGGT sequence contexts. Here, simulations of the HMGB1a-Pt-DNA complex in the three sequence contexts revealed a higher number of interface contacts for the CP-DNA complex in the TGGA sequence context than in the OX-DNA complex. However, the number of interface contacts was similar in the TGGT and AGGC sequence contexts. The higher number of interface contacts in the CP-TGGA sequence context corresponded to a larger roll of the Pt-GG base pair step. Furthermore, geometric analysis of stacking of phenylalanine 37 in HMGB1a (Phe37) with the platinated guanines revealed more favorable stacking modes correlated with a larger roll of the Pt-GG base pair step in the TGGA sequence context. These data are consistent with our previous molecular dynamics simulations showing that the CP-TGGA complex was able to sample larger roll angles than the OX-TGGA complex or either CP- or OX-DNA complexes in the AGGC or TGGT sequences. We infer that the high binding affinity of HMGB1a for CP-TGGA is due to the greater flexibility of CP-TGGA compared to OX-TGGA and other Pt-DNA adducts. This increased flexibility is reflected in the ability of CP-TGGA to sample larger roll angles, which allows for a higher number of interface contacts between the Pt-DNA adduct and HMGB1a.

  12. Response to benzodiazepines and the clinical course in malignant catatonia associated with schizophrenia: A case report.

    PubMed

    Ohi, Kazutaka; Kuwata, Aki; Shimada, Takamitsu; Yasuyama, Toshiki; Nitta, Yusuke; Uehara, Takashi; Kawasaki, Yasuhiro

    2017-04-01

    Malignant catatonia (MC) is a disorder consisting of catatonic symptoms, hyperthermia, autonomic instability, and altered mental status. Neuroleptic malignant syndrome (NMS) caused by antipsychotics is considered a variant of MC. Benzodiazepine (BZD) medications are safe and effective treatments providing rapid relief from MC. This case study reports a detailed clinical course of a case of MC associated with schizophrenia initially diagnosed as NMS that responded successfully to BZDs but not to dantrolene. A 53-year-old man with schizophrenia was admitted to the psychiatric hospital because of excitement, monologue, muscle rigidity, and insomnia. In the 3 days before admission, the patient had discontinued his medications after his family member's death. He presented with hyperthermia, tachycardia, hypertension, excessive sweating, and an elevated serum creatine phosphokinase (CPK) level. On the basis of these features, he was suspected to have NMS. The patient was treated with dantrolene for 7 days without improvement despite having a normalized serum CPK level. The patient was transferred to our university hospital for an in-depth examination and treatment of his physical status. Infection and pulmonary embolism were excluded as possible causes. To treat his excitement and auditory hallucination, an intravenous drip (IVD) of haloperidol was initiated, but this treatment increased the patient's catatonic and psychotic symptoms, although his serum CPK level had remained within a normal range. As a result, the treatment was changed to diazepam. After an IVD of diazepam, the patient's symptoms rapidly improved, and the IVD was subsequently replaced with oral administration of lorazepam. Eventually, the patient was diagnosed with MC associated with schizophrenia. BZD therapy was dramatically effective. Catatonia, MNS, and MC may be due to a common brain pathophysiology and these conditions may be in a spectrum, although uncertainty in the boundaries among conditions, and the BZD treatment may be useful. Most importantly, catatonia has not been described as a subtype of schizophrenia on the basis of the Diagnostic and Statistical Manual of Mental Disorders (DSM)-5 criteria, and the medications for catatonia and schizophrenia are different. Antipsychotics are not effective in relieving catatonia, or they may induce NMS, whereas BZDs are effective for treating both MC and NMS.

  13. Practice Parameter: Pharmacologic treatment of spasticity in children and adolescents with cerebral palsy (an evidence-based review)

    PubMed Central

    Delgado, M R.; Hirtz, D; Aisen, M; Ashwal, S; Fehlings, D L.; McLaughlin, J; Morrison, L A.; Shrader, M W.; Tilton, A; Vargus-Adams, J

    2010-01-01

    Objective: To evaluate published evidence of efficacy and safety of pharmacologic treatments for childhood spasticity due to cerebral palsy. Methods: A multidisciplinary panel systematically reviewed relevant literature from 1966 to July 2008. Results: For localized/segmental spasticity, botulinum toxin type A is established as an effective treatment to reduce spasticity in the upper and lower extremities. There is conflicting evidence regarding functional improvement. Botulinum toxin type A was found to be generally safe in children with cerebral palsy; however, the Food and Drug Administration is presently investigating isolated cases of generalized weakness resulting in poor outcomes. No studies that met criteria are available on the use of phenol, alcohol, or botulinum toxin type B injections. For generalized spasticity, diazepam is probably effective in reducing spasticity, but there are insufficient data on its effect on motor function and its side-effect profile. Tizanidine is possibly effective, but there are insufficient data on its effect on function and its side-effect profile. There were insufficient data on the use of dantrolene, oral baclofen, and intrathecal baclofen, and toxicity was frequently reported. Recommendations: For localized/segmental spasticity that warrants treatment, botulinum toxin type A should be offered as an effective and generally safe treatment (Level A). There are insufficient data to support or refute the use of phenol, alcohol, or botulinum toxin type B (Level U). For generalized spasticity that warrants treatment, diazepam should be considered for short-term treatment, with caution regarding toxicity (Level B), and tizanidine may be considered (Level C). There are insufficient data to support or refute use of dantrolene, oral baclofen, or continuous intrathecal baclofen (Level U). GLOSSARY AAN = American Academy of Neurology; AE = adverse event; AS = Ashworth scale; BoNT-A = botulinum toxin type A; BoNT-B = botulinum toxin type B; CP = cerebral palsy; FDA = Food and Drug Administration; GAS = Goal Attainment Scale; GMFM = Gross Motor Function Measure; ITB = intrathecal baclofen; MAS = Modified Ashworth scale; OT = occupational therapy; PT = physiotherapy; QUEST = Quality of Upper Extremity Skills Test; TS = Tardieu scale. PMID:20101040

  14. The PpaA/AerR regulators of photosynthesis gene expression from anoxygenic phototrophic proteobacteria contain heme-binding SCHIC domains.

    PubMed

    Moskvin, Oleg V; Gilles-Gonzalez, Marie-Alda; Gomelsky, Mark

    2010-10-01

    The SCHIC domain of the B12-binding domain family present in the Rhodobacter sphaeroides AppA protein binds heme and senses oxygen. Here we show that the predicted SCHIC domain PpaA/AerR regulators also bind heme and respond to oxygen in vitro, despite their low sequence identity with AppA.

  15. Full trans-activation mediated by the immediate-early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence.

    PubMed

    Kim, Seong K; Shakya, Akhalesh K; O'Callaghan, Dennis J

    2016-01-04

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt -89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). Copyright © 2015 Elsevier B.V. All rights reserved.

  16. Full trans–activation mediated by the immediate–early protein of equine herpesvirus 1 requires a consensus TATA box, but not its cognate binding sequence

    PubMed Central

    Kim, Seong K.; Shakya, Akhalesh K.; O'Callaghan, Dennis J.

    2015-01-01

    The immediate-early protein (IEP) of equine herpesvirus 1 (EHV-1) has extensive homology to the IEP of alphaherpesviruses and possesses domains essential for trans-activation, including an acidic trans-activation domain (TAD) and binding domains for DNA, TFIIB, and TBP. Our data showed that the IEP directly interacted with transcription factor TFIIA, which is known to stabilize the binding of TBP and TFIID to the TATA box of core promoters. When the TATA box of the EICP0 promoter was mutated to a nonfunctional TATA box, IEP-mediated trans-activation was reduced from 22-fold to 7-fold. The IEP trans-activated the viral promoters in a TATA motif-dependent manner. Our previous data showed that the IEP is able to repress its own promoter when the IEP-binding sequence (IEBS) is located within 26-bp from the TATA box. When the IEBS was located at 100 bp upstream of the TATA box, IEP-mediated trans-activation was very similar to that of the minimal IE(nt −89 to +73) promoter lacking the IEBS. As the distance from the IEBS to the TATA box decreased, IEP-mediated trans-activation progressively decreased, indicating that the IEBS located within 100 bp from the TATA box sequence functions as a distance-dependent repressive element. These results indicated that IEP-mediated full trans-activation requires a consensus TATA box of core promoters, but not its binding to the cognate sequence (IEBS). PMID:26541315

  17. Determinants of the Differential Antizyme-Binding Affinity of Ornithine Decarboxylase

    PubMed Central

    Liu, Yen-Chin; Hsu, Den-Hua; Huang, Chi-Liang; Liu, Yi-Liang; Liu, Guang-Yaw; Hung, Hui-Chih

    2011-01-01

    Ornithine decarboxylase (ODC) is a ubiquitous enzyme that is conserved in all species from bacteria to humans. Mammalian ODC is degraded by the proteasome in a ubiquitin-independent manner by direct binding to the antizyme (AZ). In contrast, Trypanosoma brucei ODC has a low binding affinity toward AZ. In this study, we identified key amino acid residues that govern the differential AZ binding affinity of human and Trypanosoma brucei ODC. Multiple sequence alignments of the ODC putative AZ-binding site highlights several key amino acid residues that are different between the human and Trypanosoma brucei ODC protein sequences, including residue 119, 124,125, 129, 136, 137 and 140 (the numbers is for human ODC). We generated a septuple human ODC mutant protein where these seven bases were mutated to match the Trypanosoma brucei ODC protein sequence. The septuple mutant protein was much less sensitive to AZ inhibition compared to the WT protein, suggesting that these amino acid residues play a role in human ODC-AZ binding. Additional experiments with sextuple mutants suggest that residue 137 plays a direct role in AZ binding, and residues 119 and 140 play secondary roles in AZ binding. The dissociation constants were also calculated to quantify the affinity of the ODC-AZ binding interaction. The K d value for the wild type ODC protein-AZ heterodimer ([ODC_WT]-AZ) is approximately 0.22 μM, while the K d value for the septuple mutant-AZ heterodimer ([ODC_7M]-AZ) is approximately 12.4 μM. The greater than 50-fold increase in [ODC_7M]-AZ binding affinity shows that the ODC-7M enzyme has a much lower binding affinity toward AZ. For the mutant proteins ODC_7M(-Q119H) and ODC_7M(-V137D), the K d was 1.4 and 1.2 μM, respectively. These affinities are 6-fold higher than the WT_ODC K d, which suggests that residues 119 and 137 play a role in AZ binding. PMID:22073206

  18. Mapping Hfq-RNA interaction surfaces using tryptophan fluorescence quenching

    PubMed Central

    Robinson, Kirsten E.; Orans, Jillian; Kovach, Alexander R.; Link, Todd M.; Brennan, Richard G.

    2014-01-01

    Hfq is a posttranscriptional riboregulator and RNA chaperone that binds small RNAs and target mRNAs to effect their annealing and message-specific regulation in response to environmental stressors. Structures of Hfq-RNA complexes indicate that U-rich sequences prefer the proximal face and A-rich sequences the distal face; however, the Hfq-binding sites of most RNAs are unknown. Here, we present an Hfq-RNA mapping approach that uses single tryptophan-substituted Hfq proteins, all of which retain the wild-type Hfq structure, and tryptophan fluorescence quenching (TFQ) by proximal RNA binding. TFQ properly identified the respective distal and proximal binding of A15 and U6 RNA to Gram-negative Escherichia coli (Ec) Hfq and the distal face binding of (AA)3A, (AU)3A and (AC)3A to Gram-positive Staphylococcus aureus (Sa) Hfq. The inability of (GU)3G to bind the distal face of Sa Hfq reveals the (R-L)n binding motif is a more restrictive (A-L)n binding motif. Remarkably Hfq from Gram-positive Listeria monocytogenes (Lm) binds (GU)3G on its proximal face. TFQ experiments also revealed the Ec Hfq (A-R-N)n distal face-binding motif should be redefined as an (A-A-N)n binding motif. TFQ data also demonstrated that the 5′-untranslated region of hfq mRNA binds both the proximal and distal faces of Ec Hfq and the unstructured C-terminus. PMID:24288369

  19. Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

    PubMed Central

    Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

    2016-01-01

    Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

  20. Substrate sequence selectivity of APOBEC3A implicates intra-DNA interactions.

    PubMed

    Silvas, Tania V; Hou, Shurong; Myint, Wazo; Nalivaika, Ellen; Somasundaran, Mohan; Kelch, Brian A; Matsuo, Hiroshi; Kurt Yilmaz, Nese; Schiffer, Celia A

    2018-05-14

    The APOBEC3 (A3) family of human cytidine deaminases is renowned for providing a first line of defense against many exogenous and endogenous retroviruses. However, the ability of these proteins to deaminate deoxycytidines in ssDNA makes A3s a double-edged sword. When overexpressed, A3s can mutate endogenous genomic DNA resulting in a variety of cancers. Although the sequence context for mutating DNA varies among A3s, the mechanism for substrate sequence specificity is not well understood. To characterize substrate specificity of A3A, a systematic approach was used to quantify the affinity for substrate as a function of sequence context, length, secondary structure, and solution pH. We identified the A3A ssDNA binding motif as (T/C)TC(A/G), which correlated with enzymatic activity. We also validated that A3A binds RNA in a sequence specific manner. A3A bound tighter to substrate binding motif within a hairpin loop compared to linear oligonucleotide, suggesting A3A affinity is modulated by substrate structure. Based on these findings and previously published A3A-ssDNA co-crystal structures, we propose a new model with intra-DNA interactions for the molecular mechanism underlying A3A sequence preference. Overall, the sequence and structural preferences identified for A3A leads to a new paradigm for identifying A3A's involvement in mutation of endogenous or exogenous DNA.

  1. An ensemble model of competitive multi-factor binding of the genome

    PubMed Central

    Wasson, Todd; Hartemink, Alexander J.

    2009-01-01

    Hundreds of different factors adorn the eukaryotic genome, binding to it in large number. These DNA binding factors (DBFs) include nucleosomes, transcription factors (TFs), and other proteins and protein complexes, such as the origin recognition complex (ORC). DBFs compete with one another for binding along the genome, yet many current models of genome binding do not consider different types of DBFs together simultaneously. Additionally, binding is a stochastic process that results in a continuum of binding probabilities at any position along the genome, but many current models tend to consider positions as being either binding sites or not. Here, we present a model that allows a multitude of DBFs, each at different concentrations, to compete with one another for binding sites along the genome. The result is an “occupancy profile,” a probabilistic description of the DNA occupancy of each factor at each position. We implement our model efficiently as the software package COMPETE. We demonstrate genome-wide and at specific loci how modeling nucleosome binding alters TF binding, and vice versa, and illustrate how factor concentration influences binding occupancy. Binding cooperativity between nearby TFs arises implicitly via mutual competition with nucleosomes. Our method applies not only to TFs, but also recapitulates known occupancy profiles of a well-studied replication origin with and without ORC binding. Importantly, the sequence preferences our model takes as input are derived from in vitro experiments. This ensures that the calculated occupancy profiles are the result of the forces of competition represented explicitly in our model and the inherent sequence affinities of the constituent DBFs. PMID:19720867

  2. DNA/RNA hybrid substrates modulate the catalytic activity of purified AID.

    PubMed

    Abdouni, Hala S; King, Justin J; Ghorbani, Atefeh; Fifield, Heather; Berghuis, Lesley; Larijani, Mani

    2018-01-01

    Activation-induced cytidine deaminase (AID) converts cytidine to uridine at Immunoglobulin (Ig) loci, initiating somatic hypermutation and class switching of antibodies. In vitro, AID acts on single stranded DNA (ssDNA), but neither double-stranded DNA (dsDNA) oligonucleotides nor RNA, and it is believed that transcription is the in vivo generator of ssDNA targeted by AID. It is also known that the Ig loci, particularly the switch (S) regions targeted by AID are rich in transcription-generated DNA/RNA hybrids. Here, we examined the binding and catalytic behavior of purified AID on DNA/RNA hybrid substrates bearing either random sequences or GC-rich sequences simulating Ig S regions. If substrates were made up of a random sequence, AID preferred substrates composed entirely of DNA over DNA/RNA hybrids. In contrast, if substrates were composed of S region sequences, AID preferred to mutate DNA/RNA hybrids over substrates composed entirely of DNA. Accordingly, AID exhibited a significantly higher affinity for binding DNA/RNA hybrid substrates composed specifically of S region sequences, than any other substrates composed of DNA. Thus, in the absence of any other cellular processes or factors, AID itself favors binding and mutating DNA/RNA hybrids composed of S region sequences. AID:DNA/RNA complex formation and supporting mutational analyses suggest that recognition of DNA/RNA hybrids is an inherent structural property of AID. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Determining ERβ Binding Affinity to Singly Mutant ERE Using Dual Polarization Interferometry

    NASA Astrophysics Data System (ADS)

    Song, Hong Yan; Su, Xiaodi

    In a classic mode of estrogen action, estrogen receptors (ERs) bind to estrogen responsive element (ERE) to activate gene transcription. A perfect ERE contains a 13-base pair sequence of a palindromic repeat separated by a three-base spacer, 5‧-GGTCAnnnTGACC-3‧. In addition to the consensus or wild-type ERE (wtERE), naturally occurring EREs often have one or two base pairs’ alternation. Based on the newly constructed Thermodynamic Modeling of ChIP-seq (TherMos) model, binding energy between ERβ and a series of 34-bp mutant EREs (mutERE) was simulated to predict the binding affinity between ERs and EREs with single base pair deviation at different sites of the 13-bp inverted sequence. Experimentally, dual polarization interferometry (DPI) method was developed to measure ERβ-mutEREs binding affinity. On a biotin-NeutrAvidin (NA)-biotin treated DPI chip, wtERE is immobilized. In a direct binding assay, ERβ-wtERE binding affinity is determined. In a competition assay, ERβ was preincubated with mutant EREs before being added for competitive binding to the immobilized wtERE. This competition strategy provided a successful platform to evaluate the binding affinity variation among large number of ERE with different base mutations. The experimental result correlates well with the mathematically predicted binding energy with a Spearman correlation coefficient of 0.97.

  4. DNA Cloning of Plasmodium falciparum Circumsporozoite Gene: Amino Acid Sequence of Repetitive Epitope

    NASA Astrophysics Data System (ADS)

    Enea, Vincenzo; Ellis, Joan; Zavala, Fidel; Arnot, David E.; Asavanich, Achara; Masuda, Aoi; Quakyi, Isabella; Nussenzweig, Ruth S.

    1984-08-01

    A clone of complementary DNA encoding the circumsporozoite (CS) protein of the human malaria parasite Plasmodium falciparum has been isolated by screening an Escherichia coli complementary DNA library with a monoclonal antibody to the CS protein. The DNA sequence of the complementary DNA insert encodes a four-amino acid sequence: proline-asparagine-alanine-asparagine, tandemly repeated 23 times. The CS β -lactamase fusion protein specifically binds monoclonal antibodies to the CS protein and inhibits the binding of these antibodies to native Plasmodium falciparum CS protein. These findings provide a basis for the development of a vaccine against Plasmodium falciparum malaria.

  5. Mapping a nucleolar targeting sequence of an RNA binding nucleolar protein, Nop25

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fujiwara, Takashi; Suzuki, Shunji; Kanno, Motoko

    2006-06-10

    Nop25 is a putative RNA binding nucleolar protein associated with rRNA transcription. The present study was undertaken to determine the mechanism of Nop25 localization in the nucleolus. Deletion experiments of Nop25 amino acid sequence showed Nop25 to contain a nuclear targeting sequence in the N-terminal and a nucleolar targeting sequence in the C-terminal. By expressing derivative peptides from the C-terminal as GFP-fusion proteins in the cells, a lysine and arginine residue-enriched peptide (KRKHPRRAQDSTKKPPSATRTSKTQRRRR) allowed a GFP-fusion protein to be transported and fully retained in the nucleolus. When the peptide was fused with cMyc epitope and expressed in the cells, amore » cMyc epitope was then detected in the nucleolus. Nop25 did not localize in the nucleolus by deletion of the peptide from Nop25. Furthermore, deletion of a subdomain (KRKHPRRAQ) in the peptide or amino acid substitution of lysine and arginine residues in the subdomain resulted in the loss of Nop25 nucleolar localization. These results suggest that the lysine and arginine residue-enriched peptide is the most prominent nucleolar targeting sequence of Nop25 and that the long stretch of basic residues might play an important role in the nucleolar localization of Nop25. Although Nop25 contained putative SUMOylation, phosphorylation and glycosylation sites, the amino acid substitution in these sites had no effect on the nucleolar localization, thus suggesting that these post-translational modifications did not contribute to the localization of Nop25 in the nucleolus. The treatment of the cells, which expressed a GFP-fusion protein with a nucleolar targeting sequence of Nop25, with RNase A resulted in a complete dislocation of the protein from the nucleolus. These data suggested that the nucleolar targeting sequence might therefore play an important role in the binding of Nop25 to RNA molecules and that the RNA binding of Nop25 might be essential for the nucleolar localization of Nop25.« less

  6. A murine host cell factor required for nicking of the dimer bridge of MVM recognizes two CG nucleotides displaced by 10 basepairs.

    PubMed

    Liu, Q; Astell, C R

    1996-10-01

    During replication of the minute virus of mice (MVM) genome, a dimer replicative form (RF) intermediate is resolved into two monomer RF molecules in such a way as to retain a unique sequence within the left hand hairpin terminus of the viral genome. Although the proposed mechanism for resolution of the dimer RF remains uncertain, it likely involves site-specific nicking of the dimer bridge. The RF contains two double-stranded copies of the viral genome joined by the extended 3' hairpin. Minor sequence asymmetries within the 3' hairpin allow the two halves of the dimer bridge to be distinguished. The A half contains the sequence [sequence: see text], whereas the B half contains the sequence [sequence: see text]. Using an in vitro assay, we show that only the B half of the MVM dimer bridge is nicked site-specifically when incubated with crude NS-1 protein (expressed in insect cells) and mouse LA9 cellular extract. When highly purified NS-1, the major nonstructural protein of MVM, is used in this nicking reaction, there is an absolute requirement for the LA9 cellular extract, suggesting a cellular factor (or factors) is (are) required. A series of mutations were created in the putative host factor binding region (HFBR) on the B half of the MVM dimer bridge adjacent to the NS-1 binding site. Nicking assays of these B half mutants showed that two CG motifs displaced by 10 nucleotides are important for nicking. Gel mobility shift assays demonstrated that a host factor(s) can bind to the HFBR of the B half of the dimer bridge and efficient binding depends on the presence of both CG motifs. Competitor DNA containing the wild-type HFBR sequence is able to specifically inhibit nicking of the B half, indicating that the host factor(s) bound to the HFBR is(are) essential for site-specific nicking to occur.

  7. Method and apparatus for detection of fluorescently labeled materials

    DOEpatents

    Stern, David; Fiekowsky, Peter

    2004-05-25

    Fluorescently marked targets bind to a substrate 230 synthesized with polymer sequences at known locations. The targets are detected by exposing selected regions of the substrate 230 to light from a light source 100 and detecting the photons from the light fluoresced therefrom, and repeating the steps of exposure and detection until the substrate 230 is completely examined. The resulting data can be used to determine binding affinity of the targets to specific polymer sequences.

  8. Yeast one-hybrid system used to identify the binding proteins for rat glutathione S-transferase P enhancer I.

    PubMed

    Liao, Ming-Xiang; Liu, Dong-Yuan; Zuo, Jin; Fang, Fu-De

    2002-03-01

    To detect the trans-factors specifically binding to the strong enhancer element (GPEI) in the upstream of rat glutathione S-transferase P (GST-P) gene. Yeast one-hybrid system was used to screen rat lung MATCHMAKER cDNA library to identify potential trans-factors that can interact with core sequence of GPEI(cGPEI). Electrophoresis mobility shift assay (EMSA) was used to analyze the binding of transfactors to cGPEI. cDNA fragments coding for the C-terminal part of the transcription factor c-Jun and rat adenine nucleotide translocator (ANT) were isolated. The binding of c-Jun and ANT to GPEI core sequence were confirmed. Rat c-jun transcriptional factor and ANT may interact with cGPEI. They could play an important role in the induced expression of GST-P gene.

  9. Context-dependent control of alternative splicing by RNA-binding proteins

    PubMed Central

    Fu, Xiang-Dong; Ares, Manuel

    2015-01-01

    Sequence-specific RNA-binding proteins (RBPs) bind to pre-mRNA to control alternative splicing, but it is not yet possible to read the ‘splicing code’ that dictates splicing regulation on the basis of genome sequence. Each alternative splicing event is controlled by multiple RBPs, the combined action of which creates a distribution of alternatively spliced products in a given cell type. As each cell type expresses a distinct array of RBPs, the interpretation of regulatory information on a given RNA target is exceedingly dependent on the cell type. RBPs also control each other’s functions at many levels, including by mutual modulation of their binding activities on specific regulatory RNA elements. In this Review, we describe some of the emerging rules that govern the highly context-dependent and combinatorial nature of alternative splicing regulation. PMID:25112293

  10. The Interaction Properties of the Human Rab GTPase Family – A Comparative Analysis Reveals Determinants of Molecular Binding Selectivity

    PubMed Central

    Stein, Matthias; Pilli, Manohar; Bernauer, Sabine; Habermann, Bianca H.; Zerial, Marino; Wade, Rebecca C.

    2012-01-01

    Background Rab GTPases constitute the largest subfamily of the Ras protein superfamily. Rab proteins regulate organelle biogenesis and transport, and display distinct binding preferences for effector and activator proteins, many of which have not been elucidated yet. The underlying molecular recognition motifs, binding partner preferences and selectivities are not well understood. Methodology/Principal Findings Comparative analysis of the amino acid sequences and the three-dimensional electrostatic and hydrophobic molecular interaction fields of 62 human Rab proteins revealed a wide range of binding properties with large differences between some Rab proteins. This analysis assists the functional annotation of Rab proteins 12, 14, 26, 37 and 41 and provided an explanation for the shared function of Rab3 and 27. Rab7a and 7b have very different electrostatic potentials, indicating that they may bind to different effector proteins and thus, exert different functions. The subfamily V Rab GTPases which are associated with endosome differ subtly in the interaction properties of their switch regions, and this may explain exchange factor specificity and exchange kinetics. Conclusions/Significance We have analysed conservation of sequence and of molecular interaction fields to cluster and annotate the human Rab proteins. The analysis of three dimensional molecular interaction fields provides detailed insight that is not available from a sequence-based approach alone. Based on our results, we predict novel functions for some Rab proteins and provide insights into their divergent functions and the determinants of their binding partner selectivity. PMID:22523562

  11. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    PubMed

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  12. Characterization of the ligand-binding site of the transferrin receptor in Trypanosoma brucei demonstrates a structural relationship with the N-terminal domain of the variant surface glycoprotein.

    PubMed

    Salmon, D; Hanocq-Quertier, J; Paturiaux-Hanocq, F; Pays, A; Tebabi, P; Nolan, D P; Michel, A; Pays, E

    1997-12-15

    The Trypanosoma brucei transferrin (Tf) receptor is a heterodimer encoded by ESAG7 and ESAG6, two genes contained in the different polycistronic transcription units of the variant surface glycoprotein (VSG) gene. The sequence of ESAG7/6 differs slightly between different units, so that receptors with different affinities for Tf are expressed alternatively following transcriptional switching of VSG expression sites during antigenic variation of the parasite. Based on the sequence homology between pESAG7/6 and the N-terminal domain of VSGs, it can be predicted that the four blocks containing the major sequence differences between pESAG7 and pESAG6 form surface-exposed loops and generate the ligand-binding site. The exchange of a few amino acids in this region between pESAG6s encoded by different VSG units greatly increased the affinity for bovine Tf. Similar changes in other regions were ineffective, while mutations predicted to alter the VSG-like structure abolished the binding. Chimeric proteins containing the N-terminal dimerization domain of VSG and the C-terminal half of either pESAG7 or pESAG6, which contains the ligand-binding domain, can form heterodimers that bind Tf. Taken together, these data provided evidence that the T.brucei Tf receptor is structurally related to the N-terminal domain of the VSG and that the ligand-binding site corresponds to the exposed surface loops of the protein.

  13. Main immunogenic region structure promotes binding of conformation-dependent myasthenia gravis autoantibodies, nicotinic acetylcholine receptor conformation maturation, and agonist sensitivity

    PubMed Central

    Luo, Jie; Taylor, Palmer; Losen, Mario; de Baets, Marc H.; Shelton, G. Diane; Lindstrom, Jon

    2009-01-01

    The main immunogenic region (MIR) is a conformation-dependent region at the extracellular apex of α1 subunits of muscle nicotinic acetylcholine receptor (AChR) that is the target of half or more of the autoantibodies to muscle AChRs in human myasthenia gravis and rat experimental autoimmune myasthenia gravis. By making chimeras of human α1 subunits with α7 subunits, both MIR epitopes recognized by rat mAbs and by the patient-derived human mAb 637 to the MIR were determined to consist of two discontiguous sequences, which are adjacent only in the native conformation. The MIR, including loop α1 67–76 in combination with the N-terminal α helix α1 1–14, conferred high-affinity binding for most rat mAbs to the MIR. However, an additional sequence corresponding to α1 15–32 was required for high-affinity binding of human mAb 637. A water soluble chimera of Aplysia acetylcholine binding protein with the same α1 MIR sequences substituted was recognized by a majority of human, feline, and canine MG sera. The presence of the α1 MIR sequences in α1/α7 chimeras greatly promoted AChR expression and significantly altered the sensitivity to activation. This reveals a structural and functional, as well as antigenic, significance of the MIR. PMID:19890000

  14. Structure and specificity of the RNA-guided endonuclease Cas9 during DNA interrogation, target binding and cleavage

    PubMed Central

    Josephs, Eric A.; Kocak, D. Dewran; Fitzgibbon, Christopher J.; McMenemy, Joshua; Gersbach, Charles A.; Marszalek, Piotr E.

    2015-01-01

    CRISPR-associated endonuclease Cas9 cuts DNA at variable target sites designated by a Cas9-bound RNA molecule. Cas9's ability to be directed by single ‘guide RNA’ molecules to target nearly any sequence has been recently exploited for a number of emerging biological and medical applications. Therefore, understanding the nature of Cas9's off-target activity is of paramount importance for its practical use. Using atomic force microscopy (AFM), we directly resolve individual Cas9 and nuclease-inactive dCas9 proteins as they bind along engineered DNA substrates. High-resolution imaging allows us to determine their relative propensities to bind with different guide RNA variants to targeted or off-target sequences. Mapping the structural properties of Cas9 and dCas9 to their respective binding sites reveals a progressive conformational transformation at DNA sites with increasing sequence similarity to its target. With kinetic Monte Carlo (KMC) simulations, these results provide evidence of a ‘conformational gating’ mechanism driven by the interactions between the guide RNA and the 14th–17th nucleotide region of the targeted DNA, the stabilities of which we find correlate significantly with reported off-target cleavage rates. KMC simulations also reveal potential methodologies to engineer guide RNA sequences with improved specificity by considering the invasion of guide RNAs into targeted DNA duplex. PMID:26384421

  15. Exploring the active site binding specificity of kallikrein-related peptidase 5 (KLK5) guides the design of new peptide substrates and inhibitors.

    PubMed

    de Veer, Simon J; Swedberg, Joakim E; Brattsand, Maria; Clements, Judith A; Harris, Jonathan M

    2016-12-01

    Kallikrein-related peptidase 5 (KLK5) is a promising therapeutic target in several skin diseases, including Netherton syndrome, and is emerging as a potential target in various cancers. In this study, we used a sparse matrix library of 125 individually synthesized peptide substrates to characterize the binding specificity of KLK5. The sequences most favored by KLK5 were GRSR, YRSR and GRNR, and we identified sequence-specific interactions involving the peptide N-terminus by analyzing kinetic constants (kcat and KM) and performing molecular dynamics simulations. KLK5 inhibitors were subsequently engineered by substituting substrate sequences into the binding loop (P1, P2 and P4 residues) of sunflower trypsin inhibitor-1 (SFTI-1). These inhibitors were effective against KLK5 but showed limited selectivity, and performing a further substitution at P2' led to the design of a new variant that displayed improved activity against KLK5 (Ki=4.2±0.2 nm), weak activity against KLK7 and 12-fold selectivity over KLK14. Collectively, these findings provide new insight into the design of highly favored binding sequences for KLK5 and reveal several opportunities for modulating inhibitor selectivity over closely related proteases that will be useful for future studies aiming to develop therapeutic molecules targeting KLK5.

  16. Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

    PubMed Central

    Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

    2003-01-01

    Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

  17. Base substitutions at scissile bond sites are sufficient to alter RNA-binding and cleavage activity of RNase III.

    PubMed

    Kim, Kyungsub; Sim, Se-Hoon; Jeon, Che Ok; Lee, Younghoon; Lee, Kangseok

    2011-02-01

    RNase III, a double-stranded RNA-specific endoribonuclease, degrades bdm mRNA via cleavage at specific sites. To better understand the mechanism of cleavage site selection by RNase III, we performed a genetic screen for sequences containing mutations at the bdm RNA cleavage sites that resulted in altered mRNA stability using a transcriptional bdm'-'cat fusion construct. While most of the isolated mutants showed the increased bdm'-'cat mRNA stability that resulted from the inability of RNase III to cleave the mutated sequences, one mutant sequence (wt-L) displayed in vivo RNA stability similar to that of the wild-type sequence. In vivo and in vitro analyses of the wt-L RNA substrate showed that it was cut only once on the RNA strand to the 5'-terminus by RNase III, while the binding constant of RNase III to this mutant substrate was moderately increased. A base substitution at the uncleaved RNase III cleavage site in wt-L mutant RNA found in another mutant lowered the RNA-binding affinity by 11-fold and abolished the hydrolysis of scissile bonds by RNase III. Our results show that base substitutions at sites forming the scissile bonds are sufficient to alter RNA cleavage as well as the binding activity of RNase III. © 2010 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  18. SACCHARIS: an automated pipeline to streamline discovery of carbohydrate active enzyme activities within polyspecific families and de novo sequence datasets.

    PubMed

    Jones, Darryl R; Thomas, Dallas; Alger, Nicholas; Ghavidel, Ata; Inglis, G Douglas; Abbott, D Wade

    2018-01-01

    Deposition of new genetic sequences in online databases is expanding at an unprecedented rate. As a result, sequence identification continues to outpace functional characterization of carbohydrate active enzymes (CAZymes). In this paradigm, the discovery of enzymes with novel functions is often hindered by high volumes of uncharacterized sequences particularly when the enzyme sequence belongs to a family that exhibits diverse functional specificities (i.e., polyspecificity). Therefore, to direct sequence-based discovery and characterization of new enzyme activities we have developed an automated in silico pipeline entitled: Sequence Analysis and Clustering of CarboHydrate Active enzymes for Rapid Informed prediction of Specificity (SACCHARIS). This pipeline streamlines the selection of uncharacterized sequences for discovery of new CAZyme or CBM specificity from families currently maintained on the CAZy website or within user-defined datasets. SACCHARIS was used to generate a phylogenetic tree of a GH43, a CAZyme family with defined subfamily designations. This analysis confirmed that large datasets can be organized into sequence clusters of manageable sizes that possess related functions. Seeding this tree with a GH43 sequence from Bacteroides dorei DSM 17855 (BdGH43b, revealed it partitioned as a single sequence within the tree. This pattern was consistent with it possessing a unique enzyme activity for GH43 as BdGH43b is the first described α-glucanase described for this family. The capacity of SACCHARIS to extract and cluster characterized carbohydrate binding module sequences was demonstrated using family 6 CBMs (i.e., CBM6s). This CBM family displays a polyspecific ligand binding profile and contains many structurally determined members. Using SACCHARIS to identify a cluster of divergent sequences, a CBM6 sequence from a unique clade was demonstrated to bind yeast mannan, which represents the first description of an α-mannan binding CBM. Additionally, we have performed a CAZome analysis of an in-house sequenced bacterial genome and a comparative analysis of B. thetaiotaomicron VPI-5482 and B. thetaiotaomicron 7330, to demonstrate that SACCHARIS can generate "CAZome fingerprints", which differentiate between the saccharolytic potential of two related strains in silico. Establishing sequence-function and sequence-structure relationships in polyspecific CAZyme families are promising approaches for streamlining enzyme discovery. SACCHARIS facilitates this process by embedding CAZyme and CBM family trees generated from biochemically to structurally characterized sequences, with protein sequences that have unknown functions. In addition, these trees can be integrated with user-defined datasets (e.g., genomics, metagenomics, and transcriptomics) to inform experimental characterization of new CAZymes or CBMs not currently curated, and for researchers to compare differential sequence patterns between entire CAZomes. In this light, SACCHARIS provides an in silico tool that can be tailored for enzyme bioprospecting in datasets of increasing complexity and for diverse applications in glycobiotechnology.

  19. Method for nucleic acid hybridization using single-stranded DNA binding protein

    DOEpatents

    Tabor, Stanley; Richardson, Charles C.

    1996-01-01

    Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

  20. Characterization of DNA-protein interactions using high-throughput sequencing data from pulldown experiments

    NASA Astrophysics Data System (ADS)

    Moreland, Blythe; Oman, Kenji; Curfman, John; Yan, Pearlly; Bundschuh, Ralf

    Methyl-binding domain (MBD) protein pulldown experiments have been a valuable tool in measuring the levels of methylated CpG dinucleotides. Due to the frequent use of this technique, high-throughput sequencing data sets are available that allow a detailed quantitative characterization of the underlying interaction between methylated DNA and MBD proteins. Analyzing such data sets, we first found that two such proteins cannot bind closer to each other than 2 bp, consistent with structural models of the DNA-protein interaction. Second, the large amount of sequencing data allowed us to find rather weak but nevertheless clearly statistically significant sequence preferences for several bases around the required CpG. These results demonstrate that pulldown sequencing is a high-precision tool in characterizing DNA-protein interactions. This material is based upon work supported by the National Science Foundation under Grant No. DMR-1410172.

Top