Sample records for dechets tres faiblement

  1. The Tres Ventanas Mummies of Peru.


    Wann, L Samuel; Lombardi, Guido; Ojeda, Bernadino; Benfer, Robert A; Rivera, Ricardo; Finch, Caleb E; Thomas, Gregory S; Thompson, Randall C


    The Tres Ventanas mummies of Peru are thought to be among the oldest mummies in existence, dating to between 8,000 and 10,000 years ago. A preliminary assessment is made of the potential of these mummies for use in future research on mummified remains. Although the Tres Ventanas cave and the four mummies were explored and then excavated by Frederic Engel in 1966-67, and the project is named in his honor as the "Engel Study Group", the importance of both the physical remains and the context in which they were found has only come to light in the last few years. Most important is the paleopathological examination of these remains, since these mummies are found in a high altitude area of Peru where adaptation to the limited partial pressure of oxygen is perhaps a key component in broadening our understanding of human diversity in past populations. PMID:25998637


    SciTech Connect

    Kundurthy, P.; Becker, A. C.; Agol, E.; Barnes, R.; Williams, B.


    The Apache Point Survey of Transit Lightcurves of Exoplanets (APOSTLE) observed 11 transits of TrES-3b over two years in order to constrain system parameters and look for transit timing and depth variations. We describe an updated analysis protocol for APOSTLE data, including the reduction pipeline, transit model, and Markov Chain Monte Carlo analyzer. Our estimates of the system parameters for TrES-3b are consistent with previous estimates to within the 2{sigma} confidence level. We improved the errors (by 10%-30%) on system parameters such as the orbital inclination (i {sub orb}), impact parameter (b), and stellar density ({rho}{sub *}) compared to previous measurements. The near-grazing nature of the system, and incomplete sampling of some transits, limited our ability to place reliable uncertainties on individual transit depths and hence we do not report strong evidence for variability. Our analysis of the transit timing data shows no evidence for transit timing variations and our timing measurements are able to rule out super-Earth and gas giant companions in low-order mean motion resonance with TrES-3b.

  3. 78 FR 77445 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on December 6, 2013, Tres Palacios Gas Storage LLC (Tres Palacios) 700 Louisiana Street, Suite 2060,...

  4. 76 FR 41235 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF ENERGY Federal Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on July 5, 2011, Tres Palacios Gas Storage LLC (TPGS), Two Brush Creek Blvd., Suite 200, Kansas...

  5. The University of Arizona Astronomy Club Observations of Transiting Extrasolar Planets TrES-3b and TrES-4b

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Hardegree-Ullman, K.; Smart, B.; Walker-LaFollette, A.; Cunningham, K.; Hardegree-Ullman, E. E.; Crawford, B.; Mueting, J.; Carleton, T.; Schwarz, K.; Robertson, A.; Guvenen, B.; Towner, A.; Austin, C.; Henz, T.; Keys, D.; Johnson, K.


    Using the Steward Observatory 61" Kuiper Telescope, The University of Arizona Astronomy Club observed extrasolar planets TrES-3b and TrES-4b. We observed the planets with the Harris-B, V, and R filters as they transited their parent stars during the months of May-July 2009. The main goal of this project was to get undergraduates involved with a research astronomy project and allow them to gain experience beyond what they would receive in the classroom. Many of the team members were introduced to astronomical observing techniques and data reduction using IRAF. Part of the project involved determining the optimum number of flat-field and bias frames required for image calibrations. With our results, we have been able to confirm and refine previously published values for the planets' orbital inclination, mass, radius, and density.

  6. Chemical Composition of the Planet-Harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Yong, D.; Carney, B. W.; Laird, J. B.; Latham, D. W.; Torres, G.


    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck/HIRES and HET/HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]> = -0.02± 0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets, and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way Galaxy. TrES-1 is found to be a very likely member of the thin disk population. By comparing α -element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]> 0.0) stars with planets appear to be systematically underabundant in [α /Fe] by ˜ 0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  7. Chemical Composition of the Planet-harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, Alessandro; Yong, David; Carney, Bruce W.; Laird, John B.; Latham, David W.; Torres, Guillermo


    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck HIRES and Hobby-Eberly Telescope HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]>=-0.02+/-0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way. TrES-1 is found to be very likely a member of the thin-disk population. By comparing α-element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]>~0.0) stars with planets appear to be systematically underabundant in [α/Fe] by ~0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  8. VizieR Online Data Catalog: TrES-4b RV and Ic curves (Sozzetti+, 2015)

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Bonomo, A. S.; Biazzo, K.; Mancini, L.; Damasso, M.; Desidera, S.; Gratton, R.; Lanza, A. F.; Poretti, E.; Rainer, M.; Malavolta, L.; Affer, L.; Barbieri, M.; Bedin, L. R.; Boccato, C.; Bonavita, M.; Borsa, F.; Ciceri, S.; Claudi, R. U.; Gandolfi, D.; Giacobbe, P.; Henning, T.; Knapic, C.; Latham, D. W.; Lodato, G.; Maggio, A.; Maldonado, J.; Marzari, F.; Martinez Fiorenzano, A. F.; Micela, G.; Molinari, E.; Mordasini, C.; Nascimbeni, V.; Pagano, I.; Pedani, M.; Pepe, F.; Piotto, G.; Santos, N.; Scandariato, G.; Shkolnik, E.; Southworth, J.


    The TrES-4 system was observed with HARPS-N on 17 individual epochs between March 2013 and July 2014. We carried out Ic-band precision photometric observations of two complete transit events of TrES-4 b with the CAHA 1.23-m on UT 2013 July 6 and UT 2014 June 30. (2 data files).

  9. Optical and Near-UV Observations of the Transiting Extrasolar Planet TrES-4b

    NASA Astrophysics Data System (ADS)

    Smith, Carter-Thaxton; Turner, J.; Carleton, T.; Crawford, B.; Guvenen, B.; Hardegree-Ullman, K.; Small, L.; Towner, A. P.; Walker-LaFollette, A.; Henz, T.


    Using the Steward Observatory 61” Kuiper Telescope, The University of Arizona Astronomy Club conducted photometric observations of the transiting extrasolar planet TrES-4b as part of the Exoplanet Observation Project. Observations were made in the Bessell U, Harris B, and Harris R filters. Initial observations were made in 2009, with follow up observations in 2011. Basic data reduction and photometry was done using IRAF and determination of transit parameters was done using Transit Analysis Package (TAP) and JKTEBOP transit modeling code. We present an updated planetary mass, radius, density, surface gravity, Safronov number, equilibrium temperature, orbital distance, and orbital inclination for TrES-4b. In addition, we also searched for asymmetries between the near-UV and optical light curves. This project, started in spring 2009, has introduced many undergraduate students to research and given them valuable experience with data reduction and observation techniques.

  10. Detection of Planetary Emission from the Exoplanet TrES-2 Using Spitzer/IRAC

    NASA Technical Reports Server (NTRS)

    Donovan, Francis T.; Charbonneau, David; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake; Knutson, Heather A.


    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +/- 0.021%, 0.230% +/- 0.024%, 0.199% +/- 0.054%, and 0.359% +/- 0.060% at 3.6 microns, 4.5 microns, 5.8 microns, and 8.0 microns, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T(sub eff) = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four lRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet. Key words: eclipses - infrared: stars - planetary systems - stars: individual (OSC 03549-02811) - techniques: photometric


    SciTech Connect

    O'Donovan, Francis T.; Charbonneau, David; Knutson, Heather A.; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake


    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +- 0.021%, 0.230% +- 0.024%, 0.199% +- 0.054%, and 0.359% +- 0.060% at 3.6 {mu}m, 4.5 {mu}m, 5.8 {mu}m, and 8.0 {mu}m, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T{sub eff} = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four IRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet.

  12. Planetary transit observations at the University Observatory Jena: TrES-2

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Mugrauer, M.; Schmidt, T. O. B.; Roell, T.; Eisenbeiss, T.; Hohle, M. M.; Koeltzsch, A.; Vaňko, M.; Ginski, Ch.; Marka, C.; Moualla, M.; Tetzlaff, N.; Seifahrt, A.; Broeg, Ch.; Koppenhoefer, J.; Raetz, M.; Neuhäuser, R.


    We report on observations of several transit events of the transiting planet TrES-2 obtained with the Cassegrain-Teleskop-Kamera at the University Observatory Jena. Between March 2007 and November 2008 ten different transits and almost a complete orbital period were observed. Overall, in 40 nights of observation 4291 exposures (in total 71.52 h of observation) of the TrES-2 parent star were taken. With the transit timings for TrES-2 from the 34 events published by the TrES-network, the Transit Light Curve project and the Exoplanet Transit Database plus our own ten transits, we find that the orbital period is P=(2.470614± 0.000001) d, a slight change by ˜ 0.6 s compared to the previously published period. We present new ephemeris for this transiting planet. Furthermore, we found a second dip after the transit which could either be due to a blended variable star or occultation of a second star or even an additional object in the system. Our observations will be useful for future investigations of timing variations caused by additional perturbing planets and/or stellar spots and/or moons. Based on observations obtained with telescopes of the University Observatory Jena, which is operated by the Astrophysical Institute of the Friedrich-Schiller-University Jena and the 80cm telescope of the Wendelstein Observatory of the Ludwig-Maximilians-University Munich.

  13. TRES: Identification of Discriminatory and Informative SNPs from Population Genomic Data.


    Kavakiotis, Ioannis; Triantafyllidis, Alexandros; Ntelidou, Despoina; Alexandri, Panoraia; Megens, Hendrik-Jan; Crooijmans, Richard P M A; Groenen, Martien A M; Tsoumakas, Grigorios; Vlahavas, Ioannis


    The advent of high-throughput genomic technologies is enabling analyses on thousands or even millions of single-nucleotide polymorphisms (SNPs). At the same time, the selection of a minimum number of SNPs with the maximum information content is becoming increasingly problematic. Available locus ranking programs have been accused of providing upwardly biased results (concerning the predicted accuracy of the chosen set of markers for population assignment), cannot handle high-dimensional datasets, and some of them are computationally intensive. The toolbox for ranking and evaluation of SNPs (TRES) is a collection of algorithms built in a user-friendly and computationally efficient software that can manipulate and analyze datasets even in the order of millions of genotypes in a matter of seconds. It offers a variety of established methods for evaluating and ranking SNPs on user defined groups of populations and produces a set of predefined number of top ranked loci. Moreover, dataset manipulation algorithms enable users to convert datasets in different file formats, split the initial datasets into train and test sets, and finally create datasets containing only selected SNPs occurring from the SNP selection analysis for later on evaluation in dedicated software such as GENECLASS. This application can aid biologists to select loci with maximum power for optimization of cost-effective panels with applications related to e.g. species identification, wildlife management, and forensic problems. TRES is available for all operating systems at PMID:26137847


    SciTech Connect

    Scuderi, Louis J.; Dittmann, Jason A.; Males, Jared R.; Green, Elizabeth M.; Close, Laird M.


    On 2009 June 15 UT the transit of TrES-2b was detected using the University of Arizona's 1.55 m Kuiper Telescope with 2.0-2.5 millimag rms accuracy in the I band. We find a central transit time of T{sub c} = 2454997.76286 {+-} 0.00035 HJD, an orbital period of P = 2.4706127 {+-} 0.0000009 days, and an inclination angle of i = 83.{sup 0}92 {+-} 0{sup 0}.05, which is consistent with our re-fit of the original I-band light curve of O'Donovan et al. where we find i = 83.{sup 0}84 {+-} 0{sup 0}.05. We calculate an insignificant inclination change of {Delta}i = -0.{sup 0}08 {+-} 0{sup 0}.07 over the last three years, and as such, our observations rule out, at the {approx}11{sigma} level, the apparent change of orbital inclination to i{sub predicted} = 83.{sup 0}35 {+-} 0{sup 0}.1 as predicted by Mislis and Schmitt and Mislis et al. for our epoch. Moreover, our analysis of a recently published Kepler Space Telescope light curve for TrES-2b finds an inclination of i = 83.{sup 0}91 {+-} 0.{sup 0}03 for a similar epoch. These Kepler results definitively rule out change in i as a function of time. Indeed, we detect no significant changes in any of the orbital parameters of TrES-2b.

  15. A Spitzer Five-band Analysis of the Jupiter-sized Planet TrES-1

    NASA Astrophysics Data System (ADS)

    Cubillos, Patricio; Harrington, Joseph; Madhusudhan, Nikku; Foster, Andrew S. D.; Lust, Nate B.; Hardy, Ryan A.; Bowman, M. Oliver


    With an equilibrium temperature of 1200 K, TrES-1 is one of the coolest hot Jupiters observed by Spitzer. It was also the first planet discovered by any transit survey and one of the first exoplanets from which thermal emission was directly observed. We analyzed all Spitzer eclipse and transit data for TrES-1 and obtained its eclipse depths and brightness temperatures in the 3.6 μm (0.083% ± 0.024%, 1270 ± 110 K), 4.5 μm (0.094% ± 0.024%, 1126 ± 90 K), 5.8 μm (0.162% ± 0.042%, 1205 ± 130 K), 8.0 μm (0.213% ± 0.042%, 1190 ± 130 K), and 16 μm (0.33% ± 0.12%, 1270 ± 310 K) bands. The eclipse depths can be explained, within 1σ errors, by a standard atmospheric model with solar abundance composition in chemical equilibrium, with or without a thermal inversion. The combined analysis of the transit, eclipse, and radial-velocity ephemerides gives an eccentricity of e = 0.033+0.015 -0.031, consistent with a circular orbit. Since TrES-1's eclipses have low signal-to-noise ratios, we implemented optimal photometry and differential-evolution Markov Chain Monte Carlo (MCMC) algorithms in our Photometry for Orbits, Eclipses, and Transits pipeline. Benefits include higher photometric precision and ~10 times faster MCMC convergence, with better exploration of the phase space and no manual parameter tuning.

  16. A Spitzer five-band analysis of the Jupiter-sized planet TrES-1

    SciTech Connect

    Cubillos, Patricio; Harrington, Joseph; Foster, Andrew S. D.; Lust, Nate B.; Hardy, Ryan A.; Bowman, M. Oliver; Madhusudhan, Nikku


    With an equilibrium temperature of 1200 K, TrES-1 is one of the coolest hot Jupiters observed by Spitzer. It was also the first planet discovered by any transit survey and one of the first exoplanets from which thermal emission was directly observed. We analyzed all Spitzer eclipse and transit data for TrES-1 and obtained its eclipse depths and brightness temperatures in the 3.6 μm (0.083% ± 0.024%, 1270 ± 110 K), 4.5 μm (0.094% ± 0.024%, 1126 ± 90 K), 5.8 μm (0.162% ± 0.042%, 1205 ± 130 K), 8.0 μm (0.213% ± 0.042%, 1190 ± 130 K), and 16 μm (0.33% ± 0.12%, 1270 ± 310 K) bands. The eclipse depths can be explained, within 1σ errors, by a standard atmospheric model with solar abundance composition in chemical equilibrium, with or without a thermal inversion. The combined analysis of the transit, eclipse, and radial-velocity ephemerides gives an eccentricity of e=0.033{sub −0.031}{sup +0.015}, consistent with a circular orbit. Since TrES-1's eclipses have low signal-to-noise ratios, we implemented optimal photometry and differential-evolution Markov Chain Monte Carlo (MCMC) algorithms in our Photometry for Orbits, Eclipses, and Transits pipeline. Benefits include higher photometric precision and ∼10 times faster MCMC convergence, with better exploration of the phase space and no manual parameter tuning.

  17. Analysis of Kepler's Short-cadence Photometry for TrES-2b

    NASA Astrophysics Data System (ADS)

    Kipping, David; Bakos, Gáspár


    We present an analysis of 18 short-cadence (SC) transit light curves of TrES-2b using quarter 0 (Q0) and quarter 1 (Q1) from the Kepler Mission. The photometry is of unprecedented precision, 237 ppm minute-1, allowing for the most accurate determination of the transit parameters yet obtained for this system. Global fits of the transit photometry, radial velocities, and known transit times are used to obtain a self-consistent set of refined parameters for this system, including updated stellar and planetary parameters. Special attention is paid to fitting for limb darkening and eccentricity. We place an upper limit on the occultation depth to be <72.9 ppm to 3σ confidence, indicating TrES-2b has the lowest determined geometric albedo for an exoplanet, of Ag < 0.146. We also produce a transit timing analysis using Kepler's SC data and demonstrate exceptional timing precision at the level of a few seconds for each transit event. With 18 fully sampled transits at such high precision, we are able to produce stringent constraints on the presence of perturbing planets, Trojans, and extrasolar moons. We introduce the novel use of control data to identify phasing effects. We also exclude the previously proposed hypotheses of short-period transit time variation and additional transits but find that the hypothesis of long-term inclination change is neither supported nor refuted by our analysis. Based on archival data of the Kepler telescope.


    SciTech Connect

    Kipping, David; Bakos, Gaspar


    We present an analysis of 18 short-cadence (SC) transit light curves of TrES-2b using quarter 0 (Q0) and quarter 1 (Q1) from the Kepler Mission. The photometry is of unprecedented precision, 237 ppm minute{sup -1}, allowing for the most accurate determination of the transit parameters yet obtained for this system. Global fits of the transit photometry, radial velocities, and known transit times are used to obtain a self-consistent set of refined parameters for this system, including updated stellar and planetary parameters. Special attention is paid to fitting for limb darkening and eccentricity. We place an upper limit on the occultation depth to be <72.9 ppm to 3{sigma} confidence, indicating TrES-2b has the lowest determined geometric albedo for an exoplanet, of A{sub g} < 0.146. We also produce a transit timing analysis using Kepler's SC data and demonstrate exceptional timing precision at the level of a few seconds for each transit event. With 18 fully sampled transits at such high precision, we are able to produce stringent constraints on the presence of perturbing planets, Trojans, and extrasolar moons. We introduce the novel use of control data to identify phasing effects. We also exclude the previously proposed hypotheses of short-period transit time variation and additional transits but find that the hypothesis of long-term inclination change is neither supported nor refuted by our analysis.


    SciTech Connect

    Christiansen, Jessie L.; Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Deming, Drake; Barry, Richard K.; Livengood, Timothy A.; Hewagama, Tilak; Madhusudhan, Nikku; Seager, Sara; Wellnitz, Dennis D.; A'Hearn, Michael F.; Hampton, Don L.; Lisse, Carey M.


    As part of the NASA EPOXI Mission of Opportunity, we observed seven known transiting extrasolar planet systems in order to construct time series photometry of extremely high phase coverage and precision. Here we present the results for four 'hot-Jupiter systems' with near-solar stars-HAT-P-4, TrES-3, TrES-2, and WASP-3. We observe 10 transits of HAT-P-4, estimating the planet radius R{sub p} = 1.332 {+-} 0.052 R{sub Jup}, the stellar radius R{sub *} = 1.602 {+-} 0.061 R{sub sun}, the inclination i = 89.67 {+-} 0.30 deg, and the transit duration from first to fourth contact {tau} = 255.6 {+-} 1.9 minutes. For TrES-3, we observe seven transits and find R{sub p} = 1.320 {+-} 0.057 R{sub Jup}, R{sub *} = 0.817 {+-} 0.022 R{sub sun}, i = 81.99 {+-} 0.30 deg, and {tau} = 81.9 {+-} 1.1 minutes. We also note a long-term variability in the TrES-3 light curve, which may be due to star spots. We observe nine transits of TrES-2 and find R{sub p} = 1.169 {+-} 0.034 R{sub Jup}, R{sub *} = 0.940 {+-} 0.026 R{sub sun}, i = 84.15 {+-} 0.16 deg, and {tau} = 107.3 {+-} 1.1 minutes. Finally, we observe eight transits of WASP-3, finding R{sub p} = 1.385 {+-} 0.060 R{sub Jup}, R{sub *} = 1.354 {+-} 0.056 R{sub sun}, i = 84.22 {+-} 0.81 deg, and {tau} = 167.3 {+-} 1.3 minutes. We present refined orbital periods and times of transit for each target. We state 95% confidence upper limits on the secondary eclipse depths in our broadband visible bandpass centered on 650 nm. These limits are 0.073% for HAT-P-4, 0.062% for TrES-3, 0.16% for TrES-2, and 0.11% for WASP-3. We combine the TrES-3 secondary eclipse information with the existing published data and confirm that the atmosphere likely does not have a temperature inversion.

  20. Metazoan parasite community of blue sea catfish, Sciades guatemalensis (Ariidae), from Tres Palos Lagoon, Guerrero, Mexico.


    Violante-González, Juan; Aguirre-Macedo, Ma Leopoldina; Rojas-Herrera, Agustín; Guerrero, Salvador Gil


    The seasonal dynamic of the metazoan parasite community of the blue sea catfish (Sciades guatemalensis) from Tres Palos Lagoon, Guerrero, Mexico, was studied at the component community and infracommunity levels. A total of 382 fish were collected during the regional dry and rainy seasons (a total of seven seasons) between April 2000 and September 2007. Nine helminths were collected: Neotetraonchus sp., Pseudoacanthostomum panamense, Austrodiplostomum compactum, Clinostomum complanatum, Metadena sp., Pseudoleptorhynchoides lamothei, Neoechinorhynchus cf. golvani, Hysterothylacium perezi, and Contracaecum sp. The infection dynamics of some dominant helminths was influenced by environmental changes generated by the dry/rainy season cycle. Nested (non-random) species composition was observed in the infracommunities during almost all of the sample period. Variation in the intensity of nestedness was attributed to a sequential colonization process over time by the dominant helminths. PMID:19548005


    SciTech Connect

    Jiang, Ing-Guey; Wu, Yu-Ting; Chien, Ping; Lin, Yi-Ling; Chen, Hong-Yu; Hu, Juei-Hwa; Yeh, Li-Chin; Thakur, Parijat; Sun Zhao; Ji Jianghui


    Five newly observed transit light curves of the TrES-3 planetary system are presented. Together with other light-curve data from the literature, 23 transit light curves in total, which cover an overall timescale of 911 epochs, have been analyzed through a standard procedure. From these observational data, the system's orbital parameters are determined and possible transit timing variations (TTVs) are investigated. Given that a null TTV produces a fit with reduced {chi}{sup 2} = 1.52, our results agree with previous work, that TTVs might not exist in these data. However, a one-frequency oscillating TTV model, giving a fit with a reduced {chi}{sup 2} = 0.93, does possess a statistically higher probability. It is thus concluded that future observations and dynamical simulations for this planetary system will be very important.

  2. 77 FR 40628 - Draft Safe Harbor Agreement and Application for an Enhancement of Survival Permit for the Tres...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ...: . Include ``Arizona Ecological Services Field Office draft Tres Rios SHA'' in the.... FOR FURTHER INFORMATION CONTACT: Mike Martinez, at the U.S. Fish and Wildlife Service, by mail at the address under ADDRESSES, by phone at 602-242-0210 x224, or by email at...


    SciTech Connect

    Spiegel, David S.; Burrows, Adam E-mail: burrows@astro.princeton.ed


    We develop atmosphere models of two of the three Kepler-field planets that were known prior to the start of the Kepler mission (HAT-P-7b and TrES-2). We find that published Kepler and Spitzer data for HAT-P-7b appear to require an extremely hot upper atmosphere on the dayside, with a strong thermal inversion and little day-night redistribution. The Spitzer data for TrES-2 suggest a mild thermal inversion with moderate day-night redistribution. We examine the effect of nonequilibrium chemistry on TrES-2 model atmospheres and find that methane levels must be adjusted by extreme amounts in order to cause even mild changes in atmospheric structure and emergent spectra. Our best-fit models to the Spitzer data for TrES-2 lead us to predict a low secondary eclipse planet-star flux ratio ({approx}<2 x 10{sup -5}) in the Kepler bandpass, which is consistent with what very recent observations have found. Finally, we consider how the Kepler-band optical flux from a hot exoplanet depends on the strength of a possible extra optical absorber in the upper atmosphere. We find that the optical flux is not monotonic in optical opacity, and the non-monotonicity is greater for brighter, hotter stars.

  4. The GAPS programme with HARPS-N at TNG. VI. The curious case of TrES-4b

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Bonomo, A. S.; Biazzo, K.; Mancini, L.; Damasso, M.; Desidera, S.; Gratton, R.; Lanza, A. F.; Poretti, E.; Rainer, M.; Malavolta, L.; Affer, L.; Barbieri, M.; Bedin, L. R.; Boccato, C.; Bonavita, M.; Borsa, F.; Ciceri, S.; Claudi, R. U.; Gandolfi, D.; Giacobbe, P.; Henning, T.; Knapic, C.; Latham, D. W.; Lodato, G.; Maggio, A.; Maldonado, J.; Marzari, F.; Martinez Fiorenzano, A. F.; Micela, G.; Molinari, E.; Mordasini, C.; Nascimbeni, V.; Pagano, I.; Pedani, M.; Pepe, F.; Piotto, G.; Santos, N.; Scandariato, G.; Shkolnik, E.; Southworth, J.


    We update the TrES-4 system parameters using high-precision HARPS-N radial-velocity measurements and new photometric light curves. A combined spectroscopic and photometric analysis allows us to determine a spectroscopic orbit with a semi-amplitude K = 51 ± 3 m s-1. The derived mass of TrES-4b is found to be Mp = 0.49 ± 0.04 MJup, significantly lower than previously reported. Combined with the large radius () inferred from our analysis, TrES-4b becomes the transiting hot Jupiter with the second-lowest density known. We discuss several scenarios to explain the puzzling discrepancy in the mass of TrES-4b in the context of the exotic class of highly inflated transiting giant planets. Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundacion Galileo Galilei of the INAF at the Spanish Observatorio del Roque de los Muchachos of the IAC in the frame of the program Global Architecture of Planetary Systems (GAPS), and with the Zeiss 1.23-m telescope at the German-Spanish Astronomical Center at Calar Alto, Spain. Tables 1 and 3 are available in electronic form at


    SciTech Connect

    Fressin, Francois; Knutson, Heather A.; Charbonneau, David; O'Donovan, Francis T.; Burrows, Adam; Spiegel, David; Deming, Drake; Mandushev, Georgi


    We use the Spitzer Space Telescope to estimate the dayside thermal emission of the exoplanet TrES-3 integrated in the 3.6, 4.5, 5.8, and 8.0 {mu}m bandpasses of the Infrared Array Camera (IRAC) instrument. We observe two secondary eclipses and find relative eclipse depths of 0.00346 +- 0.00035, 0.00372 +- 0.00054, 0.00449 +- 0.00097, and 0.00475 +- 0.00046, respectively, in the four IRAC bandpasses. We combine our results with the earlier K-band measurement of De Mooij et al., and compare them with models of the planetary emission. We find that the planet does not require the presence of an inversion layer in the high atmosphere. This is the first very strongly irradiated planet that does not have a temperature inversion, which indicates that stellar or planetary characteristics other than temperature have an important impact on temperature inversion. De Mooij and Snellen also detected a possible slight offset in the timing of the secondary eclipse in the K band. However, based on our four Spitzer channels, we place a 3sigma upper limit of |ecos(omega)| < 0.0056, where e is the planet's orbital eccentricity and omega is the longitude of the periastron. This result strongly indicates that the orbit is circular, as expected from tidal circularization theory.

  6. Observations of the transiting planet TrES-2 with the AIU Jena telescope in Großschwabhausen

    NASA Astrophysics Data System (ADS)

    Raetz, S.; Mugrauer, M.; Schmidt, T. O. B.; Roell, T.; Eisenbeiss, T.; Hohle, M.; Seifahrt, A.; Koeltzsch, A.; Vaňko, M.; Broeg, Ch.; Koppenhoefer, J.; Neuhäuser, R.


    We have started high precision photometric monitoring observations at the AIU Jena observatory in Großschwabhausen near Jena in fall 2006. We used a 25.4cm Cassegrain telescope equipped with a CCD-camera mounted piggyback on a 90cm telescope. To test the attainable photometric precision, we observed stars with known transiting planets. We could recover all planetary transits observed by us. We observed the parent star of the transiting planet TrES-2 over a longer period in Großschwabhausen. Between March and November 2007 seven different transits and almost a complete orbital period were analyzed. Overall, in 31 nights of observation 3423 exposures (in total 57.05h of observation) of the TrES-2 parent star were taken. Here, we present our methods and the resulting light curves. Using our observations we could improve the orbital parameters of the system.

  7. Influence of deposit architecture on intrastratal deformation, slope deposits of the Tres Pasos Formation, Chile

    NASA Astrophysics Data System (ADS)

    Auchter, Neal C.; Romans, Brian W.; Hubbard, Stephen M.


    Slope sediments on passive and active margins deform and fail across a broad range of scales ranging from loading and sediment remobilization near the sediment-water interface to submarine landslides and mass movements that incorporate significant volumes of slope deposits. Deformational styles are characterized by updip extension and downdip compressional features that occur above a detachment surface. Conditions for failure and deformation include the presence of weak layer(s) that serve as a detachment surface, competency contrasts that allow for detachment and downslope movement, deformation above a detachment surface, and a triggering mechanism(s) that initiates failure. Slope failure processes and products are well documented at scales resolvable by seismic-reflection surveys and in instances of extensive downslope failure, but the processes and products associated with intermediate-scale slope deformation are poorly understood. Intrastratal deformation is defined as stratigraphically isolated zones of deformation bounded above and below by concordant and undeformed strata. In this study, outcrop examples of intrastratal deformation from the Upper Cretaceous Tres Pasos Formation are used to elucidate the influence of depositional architecture on slope deformation. The facies distribution associated with compensational stacking of lobe deposits is shown to have a first-order control on the location and style of deformation. Detachment planes that form in mudstone deposits associated with lobe fringe and interlobe deposits are spatially limited and deformation is restricted to interbedded sandstone and mudstone associated with off-axial lobe positions. Downslope translation was arrested by stratigraphic buttresses associated with more sandstone-prone axial deposits. Emplacement of a regionally extensive mass transport deposit is interpreted as the triggering mechanism for contemporaneous intrastratal deformation of > 60 m of underlying stratigraphy. A vertical

  8. Transit timing of TrES-2: a combined analysis of ground- and space-based photometry

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Maciejewski, G.; Ginski, Ch.; Mugrauer, M.; Berndt, A.; Eisenbeiss, T.; Adam, Ch.; Raetz, M.; Roell, T.; Seeliger, M.; Marka, C.; Vaňko, M.; Bukowiecki, Ł.; Errmann, R.; Kitze, M.; Ohlert, J.; Pribulla, T.; Schmidt, J. G.; Sebastian, D.; Puchalski, D.; Tetzlaff, N.; Hohle, M. M.; Schmidt, T. O. B.; Neuhäuser, R.


    Homogeneous observations and careful analysis of transit light curves can lead to the identification of transit timing variations (TTVs). TrES-2 is one of few exoplanets, which offer the matchless possibility to combine long-term ground-based observations with continuous satellite data. Our research aimed at the search for TTVs that would be indicative of perturbations from additional bodies in the system. We also wanted to refine the system parameters and the orbital elements. We obtained 44 ground-based light curves of 31 individual transit events of TrES-2. Eight 0.2-2.2-m telescopes located at six observatories in Germany, Poland and Spain were used. In addition, we analysed 18 quarters (Q0-Q17) of observational data from NASA's space telescope Kepler including 435 individual transit events and 11 publicly available ground-based light curves. Assuming different limb darkening (LD) laws we performed an analysis for all light curves and redetermined the parameters of the system. We also carried out a joint analysis of the ground- and space-based data. The long observation period of seven years (2007-2013) allowed a very precise redetermination of the transit ephemeris. For a total of 490 transit light curves of TrES-2, the time of transit mid-point was determined. The transit times support neither variations on long time-scale nor on short time-scales. The nearly continuous observations of Kepler show no statistically significant increase or decrease in the orbital inclination i and the transit duration D. Only the transit depth shows a slight increase which could be an indication of an increasing stellar activity. In general, system parameters obtained by us were found to be in agreement with previous studies but are the most precise values to date.

  9. A new species of Myotis from the Islas Tres Marias, Nayarit, Mexico, with comments on variation in Myotis nigricans

    USGS Publications Warehouse

    Bogan, Michael A.


    A new Myotis is described from the Islas Tres Marias, Nayarit, Mexico. the new species is distinct from related taxa n the adjacent Mexican mainland (M. californicus, M. leibii, and M. carteri), although most closely related to M. carteri as shown by univariate and canonical variates analyses. An analysis of six groups of M. nigricans from Middle and South America supports the elevation of M. nigricans carteri to specific status, confirms the distinctness of M. nigricus extremus, but fails to substantiate subspecific status for bats from Columbia and Ecuador, recent recognized as M. n. punensis.


    SciTech Connect

    Barclay, Thomas; Huber, Daniel; Rowe, Jason F.; Quintana, Elisa V.; Christiansen, Jessie L.; Jenkins, Jon M.; Mullally, Fergal; Seader, Shaun E.; Tenenbaum, Peter; Thompson, Susan E.; Barentsen, Geert; Bloemen, Steven; Demory, Brice-Olivier; Fulton, Benjamin J.; Shporer, Avi; Ragozzine, Darin


    We measure the mass and radius of the star and planet in the TrES-2 system using 2.7 years of observations by the Kepler spacecraft. The light curve shows evidence for ellipsoidal variations and Doppler beaming on a period consistent with the orbital period of the planet with amplitudes of 2.79{sup +0.44}{sub -0.62} and 3.44{sup +0.32}{sub -0.37} parts per million (ppm), respectively, and a difference between the dayside and the nightside planetary flux of 3.41{sup +0.55}{sub -0.82} ppm. We present an asteroseismic analysis of solar-like oscillations on TrES-2A which we use to calculate the stellar mass of 0.94 {+-} 0.05 M{sub Sun} and radius of 0.95 {+-} 0.02 R{sub Sun }. Using these stellar parameters, a transit model fit and the phase-curve variations, we determine the planetary radius of 1.162{sup +0.020}{sub -0.024} R{sub Jup} and derive a mass for TrES-2b from the photometry of 1.44 {+-} 0.21 M{sub Jup}. The ratio of the ellipsoidal variation to the Doppler beaming amplitudes agrees to better than 2{sigma} with theoretical predications, while our measured planet mass and radius agree within 2{sigma} of previously published values based on spectroscopic radial velocity measurements. We measure a geometric albedo of 0.0136{sup +0.0022}{sub -0.0033} and an occultation (secondary eclipse) depth of 6.5{sup +1.7}{sub -1.8} ppm which we combined with the day/night planetary flux ratio to model the atmosphere of TrES-2b. We find that an atmosphere model that contains a temperature inversion is strongly preferred. We hypothesize that the Kepler bandpass probes a significantly greater atmospheric depth on the night side relative to the day side.

  11. Seasonal patterns in metazoan parasite community of the "Fat Sleeper" Dormitator latifrons (Pisces: Eleotridae) from Tres Palos Lagoon, Guerrero, Mexico.


    Violante-González, Juan; Rojas-Herrera, Agustín; Aguirre-Macedo, Ma Leopoldina


    Dormitator is among the most important fish genera in the Mexican Pacific coastal lagoon systems. In Tres Palos Lagoon, the Fat Sleeper Dormitator latifrons is one of the most significant species based on catch volume, although it is only consumed locally. Very little information exists on this species' parasitofauna. Composition and temporal variation in the metazoan parasite community structure of Dormitator latifrons from Tres Palos Lagoon (99 degrees 47' W, 16 degrees 48' N), Guerrero, Mexico, were determined using seasonal samples taken between April 2000 and June 2002. Ten parasite species (55 817 individuals) were recovered from 219 examined hosts. These species included eight helminths (Ascocotyle (Phagicola) longa, Echinochasmus leopoldinae, Clinostomum complanatum, Pseudoacanthostomum panamense, Saccocoelioides lamothei, Parvitaenia cochlearii, Contracaecum sp. and Neoechinorhynchus golvani) and two crustaceans (Argulus sp. and Ergasilus sp.). Five of the helminth species exhibited seasonal variation in their infection dynamics associated with environmental changes during the dry and rainy seasons. The variations in the infection dynamics generated changes in the community structure over time. PMID:19419054

  12. Spin-orbit alignment for KELT-7b and HAT-P-56b via Doppler tomography with TRES

    NASA Astrophysics Data System (ADS)

    Zhou, George; Latham, David W.; Bieryla, Allyson; Beatty, Thomas G.; Buchhave, Lars A.; Esquerdo, Gilbert A.; Berlind, Perry; Calkins, Michael L.


    We present Doppler tomographic analyses for the spectroscopic transits of KELT-7b and HAT-P-56b, two hot-Jupiters orbiting rapidly rotating F-dwarf host stars. These include analyses of archival Tillinghast Reflector Echelle Spectrograph (TRES) observations for KELT-7b, and a new TRES transit observation of HAT-P-56b. We report spin-orbit aligned geometries for KELT-7b (2.7° ± 0.6°) and HAT-P-56b (8° ± 2°). The host stars KELT-7 and HAT-P-56 are among some of the most rapidly rotating planet-hosting stars known. We examine the tidal re-alignment model for the evolution of the spin-orbit angle in the context of the spin rates of these stars. We find no evidence that the rotation rates of KELT-7 and HAT-P-56 have been modified by star-planet tidal interactions, suggesting that the spin-orbit angle of systems around these hot stars may represent their primordial configuration. In fact, KELT-7 and HAT-P-56 are two of three systems in supersynchronous, spin-orbit aligned states, where the rotation periods of the host stars are faster than the orbital periods of the planets.

  13. Spin-orbit alignment for KELT-7b and HAT-P-56b via Doppler tomography with TRES

    NASA Astrophysics Data System (ADS)

    Zhou, George; Latham, David W.; Bieryla, Allyson; Beatty, Thomas G.; Buchhave, Lars A.; Esquerdo, Gilbert A.; Berlind, Perry; Calkins, Michael L.


    We present Doppler tomographic analyses for the spectroscopic transits of KELT-7b and HAT-P-56b, two hot-Jupiters orbiting rapidly rotating F-dwarf host stars. These include analyses of archival TRES observations for KELT-7b, and a new TRES transit observation of HAT-P-56b. We report spin-orbit aligned geometries for KELT-7b (2.7 +/- 0.6 deg) and HAT-P-56b (8 +/- 2 deg). The host stars KELT-7 and HAT-P-56 are among some of the most rapidly rotating planet-hosting stars known. We examine the tidal re-alignment model for the evolution of the spin-orbit angle in the context of the spin rates of these stars. We find no evidence that the rotation rates of KELT-7 and HAT-P-56 have been modified by star-planet tidal interactions, suggesting that the spin-orbit angle of systems around these hot stars may represent their primordial configuration. In fact, KELT-7 and HAT-P-56 are two of three systems in super-synchronous, spin-orbit aligned states, where the rotation periods of the host stars are faster than the orbital periods of the planets.


    SciTech Connect

    Chan, Tucker; Ingemyr, Mikael; Winn, Joshua N.; Sanchis-Ojeda, Roberto; Holman, Matthew J.; Esquerdo, Gil; Everett, Mark


    We present transit photometry of three exoplanets, TrES-4b, HAT-P-3b, and WASP-12b, allowing for refined estimates of the systems' parameters. TrES-4b and WASP-12b were confirmed to be 'bloated' planets, with radii of 1.706 {+-} 0.056R{sub Jup} and 1.736 {+-} 0.092R{sub Jup}, respectively. These planets are too large to be explained with standard models of gas giant planets. In contrast, HAT-P-3b has a radius of 0.827 {+-} 0.055R{sub Jup}, smaller than a pure hydrogen-helium planet and indicative of a highly metal-enriched composition. Analyses of the transit timings revealed no significant departures from strict periodicity. For TrES-4, our relatively recent observations allow for improvement in the orbital ephemerides, which is useful for planning future observations.

  15. Dynamic study of the upper Sao Francisco River and the Tres Marias reservoir using MSS/LANDSAT images. [Brazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.


    The use of LANDSAT multispectral ban scanner imagery to verify the relationship between the behavior of the Tres Marias reservoir and the dynamics of the Sao Francisco River supply basin is described. The dispersion of suspended sediments and their concentration in the surface layers of the water are considered. A five year survey of the region during both dry and rainy seasons was performed. The drainage network was analyzed based on the patterns of dessication, water rises and soil use in the supply basin. Surface layers of the reservoir were tabulated as a function of the levels of gray in the imagery. In situ observations of water depth and reflectance were performed. Ground truth and LANDSAT data were correlated to determine the factors affecting the dynamics of the supply basin.

  16. High-precision multiband time series photometry of exoplanets Qatar-1b and TrES-5b

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Mancini, L.; Tregloan-Reed, J.; Ciceri, S.; Southworth, J.; D'Ago, G.; Bruni, I.; Baştürk, Ö.; Alsubai, K. A.; Bachelet, E.; Bramich, D. M.; Henning, Th.; Hinse, T. C.; Iannella, A. L.; Parley, N.; Schroeder, T.


    We present an analysis of the Qatar-1 and TrES-5 transiting exoplanetary systems, which contain Jupiter-like planets on short-period orbits around K-dwarf stars. Our data comprise a total of 20 transit light curves obtained using five medium-class telescopes, operated using the defocusing technique. The average precision we reach in all our data is RMSQ = 1.1 mmag for Qatar-1 (V = 12.8) and RMST = 1.0 mmag for TrES-5 (V = 13.7). We use these data to refine the orbital ephemeris, photometric parameters, and measured physical properties of the two systems. One transit event for each object was observed simultaneously in three passbands (gri) using the BUSCA imager. The QES survey light curve of Qatar-1 has a clear sinusoidal variation on a period of P⋆ = 23.697 ± 0.123 d, implying significant star-spot activity. We searched for star-spot crossing events in our light curves, but did not find clear evidence in any of the new data sets. The planet in the Qatar-1 system did not transit the active latitudes on the surfaces of its host star. Under the assumption that P⋆ corresponds to the rotation period of Qatar-1A, the rotational velocity of this star is very close to the vsin i⋆ value found from observations of the Rossiter-McLaughlin effect. The low projected orbital obliquity found in this system thus implies a low absolute orbital obliquity, which is also a necessary condition for the transit chord of the planet to avoid active latitudes on the stellar surface.


    SciTech Connect

    Gibson, N. P.; Pollacco, D.; Simpson, E. K.; Barros, S.; Joshi, Y. C.; Todd, I.; Keenan, F. P.; Skillen, I.; Benn, C.; Christian, D.; Hrudkova, M.; Steele, I. A.


    We present nine newly observed transits of TrES-3, taken as part of a transit timing program using the RISE instrument on the Liverpool Telescope. A Markov-Chain Monte Carlo analysis was used to determine the planet-star radius ratio and inclination of the system, which were found to be R{sub p} /R {sub *} = 0.1664{sup +0.0011} {sub -0.0018} and i = 81.73{sup +0.13} {sub -0.04}, respectively, consistent with previous results. The central transit times and uncertainties were also calculated, using a residual-permutation algorithm as an independent check on the errors. A re-analysis of eight previously published TrES-3 light curves was conducted to determine the transit times and uncertainties using consistent techniques. Whilst the transit times were not found to be in agreement with a linear ephemeris, giving {chi}{sup 2} = 35.07 for 15 degrees of freedom, we interpret this to be the result of systematics in the light curves rather than a real transit timing variation. This is because the light curves that show the largest deviation from a constant period either have relatively little out-of-transit coverage or have clear systematics. A new ephemeris was calculated using the transit times and was found to be T{sub c} (0) = 2454632.62610 {+-} 0.00006 HJD and P = 1.3061864 {+-} 0.0000005 days. The transit times were then used to place upper mass limits as a function of the period ratio of a potential perturbing planet, showing that our data are sufficiently sensitive to have probed sub-Earth mass planets in both interior and exterior 2:1 resonances, assuming that the additional planet is in an initially circular orbit.

  18. Impact de la varicocèle sur le volume testiculaire et les paramètres spermatiques

    PubMed Central

    Benazzouz, Mohamed Hicham; Essatara, Younes; El Sayegh, Hachem; Iken, Ali; Benslimane, Lounis; Nouini, Yassine


    Introduction La varicocèle est une pathologie masculine fréquente dont l'incidence est encore plus importante dans dans la population des hommes infertiles. Si ses mécanismes sont à ce jour incomplètement expliqués il semble acquis que la varicocèle peut être associée a une dysfonction testiculaire avec diminution du volume testiculaire et de la concentration en spermatozoïde de l’éjaculat. Méthodes Dans un premier temps nous exposons les résultats d'une étude rétrospective sur 5 ans (de Mars 2009 à Mars 2014), réalisée au service d'urologie A de l'hôpital Ibn Sina de Rabat et ayant comme objectif d’évaluer l'impact de la varicocèle palpable sur le volume testiculaire et les paramètres spermatiques. Tous les patients inclus dans notre étude avaient une varicocèle palpable. Dans un deuxième temps, et à travers une revue de la littérature nous discutons l'impact du traitement de la varicocèle sur la fertilité. Résultats 39 patients ont été inclus dans notre étude. L’âge moyen était de 29,71 ans et la varicocèle siégeait dans 89,74% des cas du coté gauche. Une atrophie testiculaire homolatérale à la varicocèle était retrouvée dans 7% des cas alors que des anomalies du spermogramme se voyaient dans 69,23% des cas. Conclusion L'impact de la varicocèle sur l'altération des paramètres spermatiques a été clairement établi bien que sa physio pathogénie ne soit pas bien élucidée. Le traitement chirurgical de la varicocèle semble indiqué chez les hommes infertiles présentant une varicocèle clinique et une altération significative du sperme. PMID:25918574

  19. Seismic activity and stress tensor inversion at Las Tres Vírgenes Volcanic and Geothermal Field (México)

    NASA Astrophysics Data System (ADS)

    Antayhua-Vera, Yanet; Lermo-Samaniego, Javier; Quintanar-Robles, Luis; Campos-Enríquez, Oscar


    We analyze local earthquakes occurring between 2003 and 2012 at the Las Tres Vírgenes Volcanic and Geothermal Field (TVVGF) to establish their temporal and spatial distribution, and relationships with local and regional fault systems, water injection, acid stimulation and steam production tests. We obtained focal mechanisms and inverted data for the stress tensor to understand the local and regional stress fields. We analyzed 423 local earthquakes with magnitudes between 0.1 and 2.9 Mc and hypocentral depths from 0.2 to 7.4 km b.s.l. The cutoff depth at ~ 7.4 km possibly delineates the brittle-ductile transition zone. We identified seven swarms (from 1 to 7). Swarms 1 (December 2009), 2 (May 2010), 3 (June-July 2010) and 7 (December 2012) are strongly correlated with injection processes; whereas swarms 5 (April 2012) and 6 (September 2012) are correlated with local tectonic faults. Stress inversion showed NW-SE, E-W and NE-SW extensional orientations (Shmin), in agreement with the local tectonic stress field; while NE-SW compressional orientations (SHmax) are correlated with the regional tectonic stress field.

  20. Collapse of the northern Jalisco continental slope:Subduction erosion, forearc slivering, or subduction beneath the Tres Marias escarpment?

    NASA Astrophysics Data System (ADS)

    Bandy, W. L.; Mortera-Gutierrez, C. A.; Ortiz-Zamora, G.; Ortega-Ramirez, J.; Galindo Dominguez, R. E.; Ponce-Núñez, F.; Pérez-Calderón, D.; Rufino-Contreras, I.; Valle-Hernández, S.; Pérez-González, E.


    Rivera Plate beneath the Tres Marias Escarpment.

  1. Near-Infrared Thermal Emission from the Hot Jupiter TrES-2b: Ground-based Detection of the Secondary Eclipse

    NASA Astrophysics Data System (ADS)

    Croll, Bryce; Albert, Loic; Lafreniere, David; Jayawardhana, Ray; Fortney, Jonathan J.


    We present near-infrared Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-2b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect its thermal emission with an eclipse depth of 0.062+0.013 -0.011% (5σ). Our best-fit secondary eclipse is consistent with a circular orbit (a 3σ upper limit on the eccentricity, e, and argument or periastron, ω, of |e cos ω| < 0.0090), in agreement with mid-infrared detections of the secondary eclipse of this planet. A secondary eclipse of this depth corresponds to a dayside Ks-band brightness temperature of TB = 1636+79 -88 K. Our thermal emission measurement, when combined with the thermal emission measurements using Spitzer/IRAC from O'Donovan and collaborators, suggests that this planet exhibits relatively efficient dayside to nightside redistribution of heat and a near isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. It is unclear if the atmosphere of TrES-2b requires a temperature inversion; if it does it is likely due to chemical species other than TiO/VO as the atmosphere of TrES-2b is too cool to allow TiO/VO to remain in gaseous form. Our secondary eclipse has the smallest depth of any detected from the ground, at around 2 μm, to date. Based on observations obtained with WIRCam, a joint project of Canada-France-Hawaii Telescope (CFHT), Taiwan, Korea, Canada, France, at the Canada-France-Hawaii Telescope (CFHT) which is operated by the National Research Council (NRC) of Canada, the Institute National des Sciences de l'Univers of the Centre National de la Recherche Scientifique of France, and the University of Hawaii.


    SciTech Connect

    Croll, Bryce; Jayawardhana, Ray; Albert, Loic; Lafreniere, David; Fortney, Jonathan J.


    We present near-infrared Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-2b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect its thermal emission with an eclipse depth of 0.062{sup +0.013}{sub -0.011}% (5{sigma}). Our best-fit secondary eclipse is consistent with a circular orbit (a 3{sigma} upper limit on the eccentricity, e, and argument or periastron, {omega}, of |e cos {omega}| < 0.0090), in agreement with mid-infrared detections of the secondary eclipse of this planet. A secondary eclipse of this depth corresponds to a dayside Ks-band brightness temperature of T{sub B} = 1636{sup +79}{sub -88} K. Our thermal emission measurement, when combined with the thermal emission measurements using Spitzer/IRAC from O'Donovan and collaborators, suggests that this planet exhibits relatively efficient dayside to nightside redistribution of heat and a near isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. It is unclear if the atmosphere of TrES-2b requires a temperature inversion; if it does it is likely due to chemical species other than TiO/VO as the atmosphere of TrES-2b is too cool to allow TiO/VO to remain in gaseous form. Our secondary eclipse has the smallest depth of any detected from the ground, at around 2 {mu}m, to date.

  3. A user`s manual for the program TRES4: Random vibration analysis of vertical-axis wind turbines in turbulent winds

    SciTech Connect


    TRES4 is a software package that works with the MSC/NASTRAN finite element analysis code to conduct random vibration analysis of vertical-axis wind turbines. The loads on the turbine are calculated in the time domain to retain the nonlinearities of stalled aerodynamic loadings. The loads are transformed into modal coordinates to reduce the number of degrees of freedom. Power spectra and cross spectra of the loads are calculated in the modal coordinate system. These loads are written in NASTRAN Bulk Data format to be read and applied in a random vibration analysis by NASTRAN. The resulting response is then transformed back to physical coordinates to facilitate user interpretation.

  4. Dynamic study of the upper Sao Francisco river and Tres Marias reservoir using MSS/LANDSAT images. M.S. Thesis; [BRazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.


    The relationship between the dispersion and concentration of sediment in the superficial layers of the Tres Marias reservoir and the dynamics of the drainage basins of its tributaries was verified using LANDSAT MSS imagery. The drainage network, dissection patterns, and land use of each watershed were considered in an analysis of multispectral images, corresponding to bands 4,5, and 7, of dry and rainy seasons in 1973, 1975, 1977, and 1978. The superficial layer water layers of the reservoir were also divided according to the grey level pattern of each image. Two field trips were made to collect Secchi depths and in situ water reflectance. It is concluded that it is possible to determine the main factors that act in the dynamics of the drainage basins of a reservoir by simultaneous control of the physical variables and the antropic action of each basin.

  5. Multi-phase submarine channel-fill history recorded by stratigraphic architectures in outcropping slope-channel deposits, Tres Pasos Formation, southern Chile

    NASA Astrophysics Data System (ADS)

    Auchter, N.; Romans, B.; Hubbard, S. M.; Daniels, B. G.; Reimchen, A. P.; Jackson, A. A.; Stright, L.


    The relationship between sediment transport processes, deposits, and channel morphology is well established for subaerial channel systems. Linking channel-fill patterns with planform morphology in submarine systems, however, is less constrained because of the difficulty in direct observation of sediment transport processes, including deposition of coarse-grained turbidites. Ever-increasing resolution of 3-D seismic-reflection and integrated bathymetry-sonar tools have led to significant improvement, but resolution issues still hinder effective analysis. For example, are inclined reflectors observed in seismic cross sections of channels associated with sinuous planforms indicative of turbidity-current-scale morphodynamics or are they composite surfaces that record larger-scale/longer-term evolution? Documenting the nature and variability of intra-channel fill architecture in outcropping submarine channel deposits provides insight into linking depositional processes and channel morphologies. The Late Cretaceous retroarc foreland Magallanes Basin in southern Chile formed during uplift of the Andean Cordillera. Deep-water slope strata of the Tres Pasos Formation are exposed along a depositional-dip-oriented outcrop belt up to 2000 m thick and at least 100 km long. These strata provide an excellent natural laboratory for comparison of slope channel architectures from different positions on the slope and stages of basin infilling. We consider channelized architectural element dimensions and internal stratigraphic surface characteristics from multiple exposures along the outcrop belt. We also document varying stacking patterns of channel elements over time, from both laterally to vertically offset end-members. Results suggest that for both lateral and vertical channel stacking patterns, phases of accommodation generation (e.g., incision or sediment bypass) and migration of the channel are temporally distinct from phases of channel infilling (e.g., turbidity current

  6. Polymorphisme de l'apolipoprotéine E dans la population du nord du Maroc: fréquence et influence sur les paramètres lipidiques

    PubMed Central

    Benyahya, Fatiha; Barakat, Amina; Ghailani, Naima; Bennani, Mohcine


    Introduction L'objectif de ce travail est de déterminer les fréquences alléliques et génotypiques des sites polymorphes situés dans le gène de l'apolipoprotéine E (apo E) ainsi que leur impact sur les paramètres cliniques et lipidiques dans un échantillon de la population du nord du Maroc cliniquement diagnostiqué ADH. Méthodes Le génotype de l'apo E a été analysé par séquençage direct chez 46 patients cliniquement diagnostiqués ADH selon les critères standards. Résultats Les fréquences des allèles epsilon 3, epsilon 2 et epsilon 4 ont été respectivement 78.3%, 2.2% et 19.6%. La fréquence de l'allèle epsilon 4 est très élevée chez la population du nord du Maroc en comparaison avec les populations des autres régions marocaines. Elle est similaire à celle rapportée dans les pays de l'Europe du nord. Les taux du cholestérol total, du cholestérol LDL ainsi que la présence des xanthomes et les maladies cardiovasculaires ne différent pas entre les génotypes de l'apoE. En revanche, les résultats ont montré une influence de l'allèle epsilon4 sur le taux des triglycérides chez les sujets obèses. Conclusion Le génotype de l'apoE ne peut expliquer le phénotype clinique et biochimique présenté par des patients du Nord du Maroc cliniquement diagnostiqués ADH. PMID:24396563

  7. Etude théorique des paramètres principaux réglant la sensibilité des capteurs d'accélération à cristal de quartz

    NASA Astrophysics Data System (ADS)

    Delaite, R.; Aïch, Y.


    A theoretical analysis of quartz accelerometers is performed to determine their optimal mechanical and sensitivity performances. A general analytical model is used to investigate the parameters and their effects on the sensitivity of these sensors. The analysis of physical characteristics shows that feasibility and performances depend on three factors such as dimensions of the quartz plate, quantity of holders located at the crystal edge and location of these holders with respect to the crystal's crystallographic reference. This study is applied to various design sensors with different supporting quartz crystal. The conditions on parameters are given to achieve optimum performances. Une étude théorique de la sensibilité des capteurs d'accélération à cristal de quartz est présentée. Son but est d'optimiser les performances mécaniques et métrologiques de ces capteurs. Les paramètres sensibles sont mis en évidence. L'analyse des caractéristiques physiques démontre que la faisabilité et les performances des accéléromètres à quartz dépendent, pour une coupe donnée du cristal, de trois facteurs : les dimensions de la lame de quartz, le nombre de liaisons à la périphérie du cristal et la position de ces liaisons par rapport à la référence cristallographique. L'étude est appliquée aux cas des capteurs bipodes, multipodes et monopodes. Pour chaque type de capteur, les valeurs des paramètres sensibles correspondant aux performances optimales sont précisées.

  8. Study of the relation between soil use, vegetation coverage, and the discharge of sediments from artificial reservoirs using MSS/LANDSAT images. Example: The Tres Marias reservoir and its supply basin

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.


    The land use and types of vegetation in the region of the upper Sao Francisco River, Brazil, are identified. This region comprises the supply basin of the Tres Marias reservoir. Imagery from channels 5 and 7 of the LANDSAT multispectral band scanner during wet and rainy seasons and ground truth data were employed to characterize and map the vegetation, land use, and sedimentary discharges from the reservoir. Agricultural and reforested lands, meadows, and forests are identified. Changes in land use due to human activity are demonstrated.

  9. Evaluation of SIR-A (Shuttle Imaging Radar) images from the Tres Marias region (Minas Gerais State, Brazil) using derived spatial features and registration with MSS-LANDSAT images

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Kux, H. J. H.; Dutra, L. V.


    Two image processing experiments are described using a MSS-LANDSAT scene from the Tres Marias region and a shuttle Imaging Radar SIR-A image digitized by a vidicon scanner. In the first experiment the study area is analyzed using the original and preprocessed SIR-A image data. The following thematic classes are obtained: (1) water, (2) dense savanna vegetation, (3) sparse savanna vegetation, (4) reforestation areas and (5) bare soil areas. In the second experiment, the SIR-A image was registered together with MSS-LANDSAT bands five, six, and seven. The same five classes mentioned above are obtained. These results are compared with those obtained using solely MSS-LANDSAT data. The spatial information as well as coregistered SIR-A and MSS-LANDSAT data can increase the separability between classes, as compared to the use of raw SIR-A data solely.

  10. Influence des paramètres de dépôt sur la morphologie de films minces de tétraborate de lithium obtenus par le procédé ``PYROSOL"

    NASA Astrophysics Data System (ADS)

    Bornand, V.; El Bouchikhi, A.; Papet, Ph.; Philippot, E.


    Li2B4O7 piezo-electric thin films were prepared by “PYROSOL" process which is a useful method for the elaboration of thin films. Morphological development and crystallization of thin films are very dependent on the experimental parameters like the substrate temperature, the concentration and the relative proportion of the precursors in methyl alcohol. The effect of these various parameters were studied in order to obtain homogeneous, crystallized and oriented thin films. La réalisation de couches minces de matériaux piézo-électriques de Li2B4O7 par le procédé “PYROSOL" révèle une grande diversité de conditions de dépôt. La température du substrat, la composition des solutions de précurseurs et leur concentration conditionnent la morphologie et l'état de cristallisation des films. En particulier, l'obtention de couches minces denses, homogènes et présentant une orientation préférentielle nécessite des températures de substrat supérieures à 620 ^{circ}C. L'influence de ces divers paramètres expérimentaux a été étudiée dans le but d'obtenir des dépôts homogènes, cristallisés et orientés.

  11. Mapping variations in weight percent silica measured from multispectral thermal infrared imagery - Examples from the Hiller Mountains, Nevada, USA and Tres Virgenes-La Reforma, Baja California Sur, Mexico

    USGS Publications Warehouse

    Hook, S.J.; Dmochowski, J.E.; Howard, K.A.; Rowan, L.C.; Karlstrom, K.E.; Stock, J.M.


    Remotely sensed multispectral thermal infrared (8-13 ??m) images are increasingly being used to map variations in surface silicate mineralogy. These studies utilize the shift to longer wavelengths in the main spectral feature in minerals in this wavelength region (reststrahlen band) as the mineralogy changes from felsic to mafic. An approach is described for determining the amount of this shift and then using the shift with a reference curve, derived from laboratory data, to remotely determine the weight percent SiO2 of the surface. The approach has broad applicability to many study areas and can also be fine-tuned to give greater accuracy in a particular study area if field samples are available. The approach was assessed using airborne multispectral thermal infrared images from the Hiller Mountains, Nevada, USA and the Tres Virgenes-La Reforma, Baja California Sur, Mexico. Results indicate the general approach slightly overestimates the weight percent SiO2 of low silica rocks (e.g. basalt) and underestimates the weight percent SiO2 of high silica rocks (e.g. granite). Fine tuning the general approach with measurements from field samples provided good results for both areas with errors in the recovered weight percent SiO2 of a few percent. The map units identified by these techniques and traditional mapping at the Hiller Mountains demonstrate the continuity of the crystalline rocks from the Hiller Mountains southward to the White Hills supporting the idea that these ranges represent an essentially continuous footwall block below a regional detachment. Results from the Baja California data verify the most recent volcanism to be basaltic-andesite. ?? 2005 Elsevier Inc. All rights reserved.

  12. Détermination des paramètres bioécologiques et entomologiques d’Anopheles gambiae sl dans la transmission du paludisme à Bandundu-ville, République Démocratique de Congo

    PubMed Central

    Matubi, Emery Metelo; Bukaka, Eric; Luemba, Trésor Bakambana; Situakibanza, Hyppolite; Sangaré, Ibrahim; Mesia, Gauthier; Ngoyi, Dieudonné Mumba; Maniania, Nguya Kalemba; Akikwa, Charles Ngandote; Kanza, Jean Pierre Basilua; Tamfum, Jean-Jacques Muyembe; sudi, Jonas Nagahuedi Bongo


    Introduction La présente étude a été menée à Bandundu-ville (RDC) en vue d'identifier les paramètres écologiques et entomologiques modulant la transmission du paludisme ainsi que leur tendance saisonnière dans cette agglomération. Méthodes Cette étude a été réalisée dans la période du 1er juin au 31 décembre 2011. Des prospections des gîtes larvaires d'anophèles avec récolte ont été réalisées, les paramètres physiques, physico-chimiques et environnementaux déterminés. La densité larvaire a été estimée selon une échelle de classes de densité, inspirée de la méthode de Carron pour chaque type de gîtes. Quarante-huit maisons ont été sélectionnées et prospectées pour la récolte des moustiques par pulvérisation intradomicilaire. L'identification des moustiques a été faite sur base des critères morphologiques de Gilles et Demeillon. L'Indice sporozoïtique (Is) a été déterminé par le test ELISA CSP de Plasmodium falciparum à l'Institut National de Recherche Biomédicale selon le protocole de Robert Wirtz. Les autres paramètres entomologiques comme la densité, le taux d'agressivité, le taux d'inoculation entomologique (TIE) ainsi que l'indice de stabilité ont été déterminés selon le protocole de l'OMS. La régression linéaire a été réalisée au seuil de signification de 0,05 pour identifier les déterminants de la densité larvaire. Résultats Cent-sept gîtes larvaires ont été identifiés et caractérisés en 5 types (digues et puits d'eau, collections d'eau maraîchère et concasseurs moellons, marais Régie de distribution d'eau, marais le long des rivières et ruisseaux et flaques d'eau de pluies). La densité larvaire moyenne a été de 117,4±64,1. Quatre mille cinq cents quatre-vingt-huit moustiques ont été capturés et identifiés, parmi lesquels 1.258 Anopheles gambiae sl avec une densité de 8,86, un taux d'agressivité de 1,55 piqûre par homme par nuit, l'Is de 5,6%, un TIE de 0,085 piq

  13. E Pluribus Tres: The 2009 Nobel Prize in Chemistry

    PubMed Central

    Carter, Charles W.


    Summary This year’s Nobel Prize in Chemistry celebrates a multitude of research areas, making the difficult selection of those most responsible for providing atomic details of the nanomachine that makes proteins according to genetic instructions. The Ribosome and RNA polymerase (recognized in 2006) structures highlight a puzzling asymmetry at the origins of biology. PMID:20004159

  14. Gallia Est Omnis Divisa in Partes Tres (All Gaul Is Divided into Three Parts).

    ERIC Educational Resources Information Center

    Seligson, Gerda


    Stresses the need for Latin instruction in the school curriculum today. The history of Latin instruction in the U.S. is traced starting from the time that writing Latin and analyzing texts in terms of grammatical, logical, and compositional categories were emphasized. (NCR)

  15. Home before You Know It = De regres en casa en un dos por tres.

    ERIC Educational Resources Information Center

    Vida Health Communications, Inc., Cambridge, MA.

    The arrival of a newborn requires a great deal of adjustment. Intended for new and expectant parents, this booklet and companion video provide practical advice and hands-on demonstrations of the essentials of mother and baby care, from birth to the first visit to the pediatrician. The first part of the booklet, which comes in both English- and…

  16. Las Tres Comidas del Dia (The Three Meals of the Day).

    ERIC Educational Resources Information Center

    Olais, Niltza M.

    A sixteen line poem in Spanish provides the text of this short booklet on the three meals of the day. Designed for use as supplementary reading materials for the elementary grade Spanish speaking child, the booklet was developed by students in the Bilingual Teacher Aide Program at Mesa Community College. Content and language have been controlled…

  17. Une mort tres douce: end-of-life decisions in France; reflections from a Dutch perspective.


    Haverkamp, Margje H; van Delden, Johannes J M


    This study considers the range of thinking about end-of-life decisions (ELD) in France from a Dutch point of view, taking a small number of interviews with important French opinion-leaders as a basis. Until today, end-of-life care in France has been clouded with uncertainty pending the enactment of more specific definitions and regulations. French physicians could face a dilemma in treating a dying patient, caught between an official ban on ELD and a professional obligation to treat cases individually. The practical consequence of this climate is a lack of accountability of the French physician towards colleagues and patients. Rationalistic, paternalistic, and religious traditions have been obstructive to the adoption of regulatory reforms. In November 2004, Parliament accepted a law proposal by which the practice of the withholding and withdrawal of life-saving therapies would become more transparent, which would diminish the physician's fear of legal persecution. This proposal was then converted into law by the Senate. In the Netherlands, euthanasia - the active termination of life - is legal and regulated according to specific criteria. The Dutch approach has been shaped by an Anglo-Saxon emphasis on individual autonomy, and conforms to a broad preference in Dutch society to disclose and regulate controversial activities rather than to tolerate them sub rosa. As the Dutch regulations have been enacted, reporting rates - but not euthanasia cases - have risen. Compliance with the criteria and doctor-patient communication have been high. The French vigilance of professional autonomy provides a valuable example to the Dutch. The Dutch, in return, offer the French concrete examples for ELD policy. PMID:16858623

  18. Les Maîtres de l'Orge: the proteome content of your beer mug.


    Fasoli, Elisa; Aldini, Giancarlo; Regazzoni, Luca; Kravchuk, Alexander V; Citterio, Attilio; Righetti, Pier Giorgio


    The beer proteome has been evaluated via prior capture with combinatorial peptide ligand libraries (ProteoMiner as well as a homemade library of reduced polydispersity) at three different pH (4.0, 7.0, and 9.3) values. Via mass spectrometry analysis of the recovered fractions, after elution of the captured populations in 4% boiling SDS, we could categorize such species in 20 different barley protein families and 2 maize proteins, the only ones that had survived the brewing process (the most abundant ones being Z-serpins and lipid transfer proteins). In addition to those, we could identify 40 unique gene products from Saccharomyces cerevisiae, one from S. bayanus and one from S. pastorianus as routinely used in the malting process for lager beer. These latter species must represent trace components, as in previous proteome investigations barely two such yeast proteins could be detected. Our protocol permits handling of very large beer volumes (liters, if needed) in a very simple and user-friendly manner and in a much reduced sample handling time. The knowledge of the residual proteome in beers might help brewers in selecting proper proteinaceous components that might enrich beer flavor and texture. PMID:20722451

  19. Análisis detallado de tres complejos estelares en NGC 300

    NASA Astrophysics Data System (ADS)

    Rodríguez, M. J.; Baume, G. L.; Feinstein, C.


    From images obtained with the Advance Camera for Surveys (ACS) of the Hubble Space Telescope (HST) and available in the MAST/STScI database, we have conducted a detailed study of three complexes of stellar associations located in particular regions of the NGC 300 galaxy. We built their respective radial density profiles, their photometric diagrams corrected by field contamination, and their initial mass functions. All these elements together with a comparison with theoretical evolutionary models yielded preliminary results about the characteristics of the studied associations.

  20. Tres Marias Reservoir, Minas Gerais State: Study of the dispersion of suspended sediments in surface waters using orbital images

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.


    Computer compatible tapes from LANDSAT were used to compartmentalize the Ires Marias reservoir according to respective grey level spectral response. Interactive and automatic, supervised classification, was executed from the IMAGE-100 system. From the simple correlation analysis and graphic representation, it is shown that grey tone levels are inversely proportional to Secchi Depth values. It is further shown that the most favorable period to conduct an analysis of this type is during the rainy season.

  1. 78 FR 57878 - Notice of Availability of the Proposed Bureau of Land Management Tres Rios Field Office and San...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... visual resources including air and water quality; wildlife habitat; forests and woodlands; and other... Field Office and San Juan National Forest Land and Resource Management Plan/Final Environmental Impact... Resource Management Plan/Final Environmental Impact Statement (LRMP/Final EIS) for the San Juan...

  2. Inversor Resonante de Tres Elementos L-LC con Caracteristica Cortocircuitable para Aplicaciones de Calentamiento por Induccion

    NASA Astrophysics Data System (ADS)

    Espi Huerta, Jose Miguel

    Los generadores de calentamiento por induccion son puentes inversores con carga resonante, cuya mision es basicamente crear una corriente sinusoidal de gran amplitud sobre la "bobina de caldeo", que forma parte del tanque resonante. En el interior de esta bobina se introduce la pieza que se desea calentar. EI campo magnetico creado induce corrientes superficiales (corrientes de Foucault) sobre la pieza, que producen su calentamiento. Los tanques resonantes (tambien llamados osciladores) utilizados en la actualidad son el resonante serie y el resonante paralelo. Aunque ya desde hace algun tiempo se vienen construyendo generadores de alta potencia basados en estos dos osciladores, el exito nunca ha. sido completo en ninguno de los dos casos. Tal y como se explica en la introduccion de esta memoria, los puentes inversores utilizados deben operar sobre una carga inductiva (corriente retrasada) para evitar el fenomeno de la recuperacion inversa de sus diodos y la consiguiente ruptura de los transistores. De la restriccion topologica anterior se deduce que el generador paralelo debe conmutar a frecuencias inferiores a la resonancia, y el serie a frecuencias superiores. A esta restriccion topologica hay que unir otra que es exclusiva del calentamiento por induccion: La corriente por la bobina de caldeo debe ser sinusoidal. De no ser asi, resultaria imposible disponer toda la potencia de calentamiento sobre la pieza en el espesor requerido por la aplicacion. Como consecuencia, los inversores no pueden operar por debajo de la frecuencia de resonancia del oscilador, pues en ese caso se amplifican los armonicos de orden superior de la tension/corriente de entrada situados sobre la resonancia, con la consiguiente distorsion de la corriente de salida. La conjuncion de las dos restricciones anteriores obligan al inversor paralelo a funcionar a la frecuencia de resonancia del oscilador. Esto imposibilita un control por variacion de frecuencia, regulandose la potencia desde la seccion de entrada mediante un mayor o menor aporte de corriente al puente. Como consecuencia, la seccion de entrada del paralelo, ya de por si mas voluminosa que lao del serie por el uso de grandes componentes magneticos (bobinas de filtro o de "alisamiento"), result a tambien mas complicada y costosa debido a la necesidad de ser implementada mediante rectificador controlado. Ademas, la regulacion que ofrece el rectificador es pobre, dada su baja frecuencia de conmutacion. En cambio, el circuito serie puede funcionar por encima de la resonancia manteniendo una secuencia de conmutacion sin riesgos de recuperacion inversa y con una corriente de salida practicamente sinusoidal, lo que permite un control de la potencia por variacion de frecuencia. Puesto que la tarea de regulacion se realiza desde el puente inversor, la regulacion resulta mucho mas eficaz y la seccion de entrada se puede implementar mediante un simple rectificador no controlado y un condensador de filtro. (Abstract shortened by UMI.).

  3. El curriculo creativo para ninos de cero a tres anos (The Creative Curriculum for Infants and Toddlers).

    ERIC Educational Resources Information Center

    Dombro, Amy Laura; Colker, Laura J.; Dodge, Diane Trister

    Stemming from the core idea that infant and toddler care should be based on building relationships, this curriculum in Spanish-language version provides a foundation for staff development. Section 1, "Why a Curriculum for Infants and Toddlers?" examines key quality indicators, discusses curriculum components, describes how to use the curriculum to…

  4. Comparaison de méthodes d'identification des paramètres d'une machine asynchrone

    NASA Astrophysics Data System (ADS)

    Bellaaj-Mrabet, N.; Jelassi, K.


    Interests, in Genetic Algorithms (G.A.) expands rapidly. This paper consists initially to apply G.A. for identifying induction motor parameters. Next, we compare the performances with classical methods like Maximum Likelihood and classical electrotechnical methods. These methods are applied on three induction motors of different powers to compare results following a set of criteria. Les algorithmes génétiques sont des méthodes adaptatives de plus en plus utilisée pour la résolution de certains problèmes d'optimisation. Le présent travail consiste d'une part, à mettre en œuvre un A.G sur des problèmes d'identification des machines électriques, et d'autre part à comparer ses performances avec les méthodes classiques tels que la méthode du maximum de vraisemblance et la méthode électrotechnique basée sur des essais à vides et en court-circuit. Ces méthodes sont appliquées sur des machines asynchrones de différentes puissances. Les résultats obtenus sont comparés selon certains critères, permettant de conclure sur la validité et la performance de chaque méthode.

  5. 77 FR 5504 - Tres Palacios Gas Storage, L.L.C.; Notice of Intent To Prepare an Environmental Assessment for...

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... United States and Mexico. The general location of the Project facilities is shown in Appendix 1.\\1\\ \\1... and operation of the proposed Project, under these general headings: Geology and soils; Land use...

  6. Restauration fonctionnelle du rachis : effet du niveau initial de douleur sur les performances des sujets lombalgiques chroniques

    PubMed Central

    Caby, Isabelle; Olivier, N; Mendelek, F; Kheir, R Bou; Vanvelcenaher, J; Pelayo, P


    HISTORIQUE : La lombalgie chronique est une douleur lombaire persistante d’origine multifactorielle. Le niveau de douleur initial reste faiblement utilisé pour analyser et comparer les réponses des patients lombalgiques au programme de reconditionnement. OBJECTIFS : Apprécier et évaluer les réponses des sujets lombalgiques chroniques très douloureux à une prise en charge dynamique et intensive. MÉTHODOLOGIE : 144 sujets atteints de lombalgie chronique ont été inclus dans un programme de restauration fonctionnelle du rachis de 5 semaines. Les sujets ont été classés en deux groupes de niveau de douleur: un groupe atteint de douleur sévère (n = 28) et un groupe atteint de douleur légère à modérée (n = 106). L’ensemble des sujets ont bénéficié d’une prise en charge identique comprenant principalement de la kinésithérapie, de l’ergothérapie, du reconditionnement musculaire et cardio-vasculaire ainsi qu’un suivi psychologique. Les paramètres physiques (flexibilité, force musculaire) et psychologiques (qualité de vie) ont été mesurés avant (T0) et après le programme (T5sem). RÉSULTATS : L’ensemble des performances physiques et fonctionnelles des sujets très douloureux sont moins bonnes et le retentissement de la lombalgie sur la qualité de vie, pour ces mêmes sujets, est majoré à T0. Toutes les différences significatives constatées à T0 entre les deux groupes s’effacent à T5sem. CONCLUSIONS : Les sujets lombalgiques chroniques très douloureux répondent favorablement au programme dynamique et intensif. L’intensité douloureuse de la lombalgie n’aurait pas d’effet sur les réponses au programme. La restauration fonctionnelle du rachis apporterait aux sujets la possibilité de mieux gérer leur douleur quel que soit son niveau. PMID:25299476

  7. Experiencias, Sentido y Significado de la Consejeria en Justicia Social a Nivel Universitario: Estudio de Caso Cualitativo Mediante Tres Narrativas De Consejeros Profesionales en Educacion Superior

    ERIC Educational Resources Information Center

    Santiago Tosado, Virginia


    The purpose of the study was to understand and profoundly describe the nature of social justice practice, as is comes up from the experience of three professional counselors whose working settings are the academic arena. Detailed descriptions are presented concerning the meanings and sense of counseling for social justice, as the interviews…

  8. Very high temperature measurements: Applications to nuclear reactor safety tests; Mesures des tres hautes temperatures: Applications a des essais de surete des reacteurs nucleaires

    SciTech Connect

    Parga, Clemente-Jose


    This PhD dissertation focuses on the improvement of very high temperature thermometry (1100 deg. C to 2480 deg. C), with special emphasis on the application to the field of nuclear reactor safety and severe accident research. Two main projects were undertaken to achieve this objective: - The development, testing and transposition of high-temperature fixed point (HTFP) metal-carbon eutectic cells, from metrology laboratory precision (±0.001 deg. C) to applied research with a reasonable degradation of uncertainties (±3-5 deg. C). - The corrosion study and metallurgical characterization of Type-C thermocouple (service temp. 2300 deg. C) prospective sheath material was undertaken to extend the survivability of TCs used for molten metallic/oxide corium thermometry (below 2000 deg. C)

  9. Relantionships between gold mineralization and granite - Discussion with the support of a pluridisciplinary study of the Passa Tres gold deposit (South Brazil)

    NASA Astrophysics Data System (ADS)

    Dressel, Bárbara; Chauvet, Alain; Trzaskos, Barbara; Biondi, Joao Carlos; Bruguier, Olivier; Monie, Patrick; Villanova, Sandro; Bazille, Jose


    The Passa Três Granite, located at East of the Paraná State is elongated following a NNE-SSW direction. This sienogranite is emplaced within metapelites of the meso to neoproterozoic Açungui Group, between the Morro Agudo and Lancinha transcurrent faults, comprising the N040°E trending Lancinha Transcurrent Fault System. Gold mineralization within the Passa Três Granite is constituted by huge quartz veins with sulfides, variable quantities of fluorite and carbonates, forming orebodies with different internal textures, including massive, banded, sheared and brecciated. Structural data indicate the existence of two major fault systems, one N-S and the other E-W, with dips of 15-45°W and 20-75°S, respectively. Both NS and EW systems are interpreted to be contemporaneous and conjugate. Normal motions are everywhere suspected and main mineralized veins are located at opening sites at these fault systems, such as pull-aparts. The structural model suggests that the normal motion can be initiated by shearing along a "guide" level, in which sulfides and clay minerals are concentrated. This configuration can be observed at several scales, such as field, hand samples and thin section. Mineralized veins mainly contain, in addition to the quartz of the gangue, sulphides (pyrite, chalcopyrite, galena, molybdenite), fluorite, chlorite, muscovite, sericite, and carbonate. The presence of sericite, kaolinite and chlorite indicate the occurrence of, at least, propylitic and phyllic-type alterations, both in core of the granite and best-expressed at the rim of quartz-rich orebodies. Gold occurs as native grains in core of the quartz veins, within fractures that affect pyrite and frequently exhibiting normal motions consistent with the one observed at larger scale and systematically associated with chalcopyrite and galena. Quartz veins are sometimes bordered by aplitic dike. Additionally, some of the veins can exhibit a very thin margin of adularia minerals that seems to represent the early stage of vein formation. These observations favor the link between late-magmatic fluids and veins formation. In order to constrain this assumption, a campaign of absolute dating has been undertaken. Zircons from granite and aplite for the magmatic feature and adularia, muscovite, sericite and molybdenite grains for the hydrothermal ones were selected and will be dated by, respectively U-Pb, Ar-Ar and Re-Os methods. Preliminary field results may suggest that gold-quartz veins may formed during the magmatic-hydrothermal transition and that mineralizing fluids possibly represent the late stages of magmatic fluid. Their mode of formation looks to be consistent with an extensional setting. With the help of all these new data, a discussion will be initiated about the genetic model of granite-hosted gold deposits and particularly on this specific case represented by the Passa Três deposit in which huge quartz veins, and no stockwork, are only formed inside the granite and not in surrounding rocks.

  10. Integrated Approach To Producing High-Purity Trehalose from Maltose by the Yeast Yarrowia lipolytica Displaying Trehalose Synthase (TreS) on the Cell Surface.


    Li, Ning; Wang, Hengwei; Li, Lijuan; Cheng, Huiling; Liu, Dawen; Cheng, Hairong; Deng, Zixin


    An alternative strategy that integrated enzyme production, trehalose biotransformation, and bioremoval in one bioreactor was developed in this study, thus simplifying the traditional procedures used for trehalose production. The trehalose synthase gene from a thermophilic archaea, Picrophilus torridus, was first fused to the YlPir1 anchor gene and then inserted into the genome of Yarrowia lipolytica, thus yielding an engineered yeast strain. The trehalose yield reached 73% under optimal conditions. The thermal and pH stabilities of the displayed enzyme were improved compared to those of its free form purified from recombinant Escherichia coli. After biotransformation, the glucose byproduct and residual maltose were directly fermented to ethanol by a Saccharomyces cerevisiae strain. Ethanol can be separated by distillation, and high-purity trehalose can easily be obtained from the fermentation broth. The results show that this one-pot procedure is an efficient approach to the economical production of trehalose from maltose. PMID:27472444

  11. Catalysts for Change: Three Case Studies of Quality Education Worldwide = Catalizadores del Cambio: Tres Casos de Estudio sobre la Educacion de Calidad en el Mundo

    ERIC Educational Resources Information Center

    Puriefoy, Wendy D.


    Public education is the cornerstone of democracy and is absolutely fundamental to a democratic, civil and prosperous society. Beyond the boundaries of the United States, other countries are working to provide quality education to their children through civil society institutions. In particular, there are three extraordinary organizations in Peru,…

  12. Estimation de parametres structuraux des arbres dans une savane a partir de mesures LiDAR terrestre et d'imagerie a tres haute resolution spatiale

    NASA Astrophysics Data System (ADS)

    Beland, Martin

    This thesis takes its place in a context where information on the biophysical state of forest ecosystems at spatial scales only remote sensing can retrieve is in demand more than ever. In order to provide reliable information using validated approaches, the remote sensing research community recognises the need for new and innovative methods, especially in heterogeneous environments like savannas. The recent emergence of terrestrial LiDAR scanners (TLS) and the increase in the computational capability of computers which allow running ray tracing model simulations with a high level of realism hold great potential to improve our understanding of the processes influencing the radiance measured by satellite sensors. This thesis makes use of these two cutting edge technologies for estimating the spatial distribution of tree leaf area, a key element of modeling radiative transfer processes. The first part of the thesis concerns the development of methods for estimating tridimensional leaf area distribution in a savanna environment from TLS measurements. The methods presented address certain issues related to TLs measures affecting the application of classical theories (the probability of light transmission and the contact frequency) to the estimation of leaf area through indirect means. These issues pertain to the cross-section of laser pulses emitted by a TLS and the occlusion effects caused by the interception of laser pulses by material inside the crown. The developed methods also exploit additional information provided by the active nature of the TLS sensor that is not available to passive sensors like hemispherical photography, i.e. the intensity of a pulse return offers the possibility to distinguish between energy interception by wood and foliage. A simplified approach of this method is presented to promote its use by other research groups. This approach consists of a series of parameterisations and represents a significant gain in terms of the required resources to produce the leaf area, estimates. The second part of the thesis explores the combination of the tree representations generated in the first part with a ray tracing model to simulate the interactions of light with tree crowns. This approach is highly innovative and our study showed its potential to improve our understanding of the factors influencing the radiative environment in a savanna. The methods presented offer a solution to map leaf area at the individual tree scale over large areas from very high spatial resolution imagery. Mots-cles: Scanneur LiDAR terrestre, voxel, distribution 3D de surface foliaire, savanes, densite de surface foliaire (LAD), indice de surface foliaire (LAI), effets d'occlusion, parametrage, cartographie de la surface foliaire, lancer de rayons, modelisation du transfert radiatif.

  13. Conversacion sobre "Tres tristes tigres". Una entrevista de Rita Guibert (A Conversation about "Three Sad Tigers". An Interview with Rita Guibert)

    ERIC Educational Resources Information Center

    Cabrera Infante, Guillermo


    Interview took place in London, England, on October 5, 1970 between Cuban writer Guillermo Cabrera Infante and journalist Rita Guibert. Special issue dedicated to contemporary Spanish American literature. (DS)

  14. New Transit Observations for HAT-P-30 b, HAT-P-37 b, TrES-5 b, WASP-28 b, WASP-36 b and WASP-39 b

    NASA Astrophysics Data System (ADS)

    Maciejewski, G.; Dimitrov, D.; Mancini, L.; Southworth, J.; Ciceri, S.; D'Ago, G.; Bruni, I.; Raetz, St.; Nowak, G.; Ohlert, J.; Puchalski, D.; Saral, G.; Derman, E.; Petrucci, R.; Jofre, E.; Seeliger, M.; Henning, T.


    We present new transit light curves for planets in six extrasolar planetary systems. They were acquired with 0.4-2.2 m telescopes located in west Asia, Europe, and South America. When combined with literature data, they allowed us to redetermine system parameters in a homogeneous way. Our results for individual systems are in agreement with values reported in previous studies. We refined transit ephemerides and reduced uncertainties of orbital periods by a factor between 2 and 7. No sign of any variations in transit times was detected for the planets studied.

  15. Influence des conditions climatiques saisonnières sur quelques paramètres physiologiques dès boucs Créoles alimentés avec de l'ensilage de banane

    NASA Astrophysics Data System (ADS)

    Fauconneau, B.; Xande, A.


    Response of three groups of 12 male creole goats (weighing about 10 kg) to environmental variations was tested in Guadeloupe (French West Indies) respectively at three times in the year: end of humid season (October November), dry season (February March) and beginning of humid season (July August). Voluntary free intake of banana silage (silage of mixed green banana, bagassa, wheat bran and urea complemented with molasse) was not significantly affected by climatic variations. Three physiological parameters: rectal temperature, respiratory frequency and cardiac frequency were measured. These parameters were correlated with heat production dependent factors such as metabolic body weight, body weight gain and voluntary free intake. Rectal temperature increased all through the day until sunset and then decreased during the night. Both minimal rectal temperature and daily increase of rectal temperature were correlated with ambient temperature. Cardiac frequency increased during feeding. Generally cardiac frequency seemed to be correlated with activity of animals and so with behavioural response to environmental variations. Respiratory frequency was the most sensitive index of goat response to climate. The daily increase of respiratory frequency was important at the end of the humid season but was not observed in dry season. This increase was dependent on ambient temperature increase but also on air humidity characteristics and air velocity. These points are discussed according to integration of those physiological parameters in thermoregulation.

  16. La influencia de "los de abajo" en tres procesos de cambio linguistico en el espanol de Morelia, Michoacan (The Influence of "the Underclass" on Three Processes of Linguistic Change in the Spanish of Morelia, Michoacan).

    ERIC Educational Resources Information Center

    Gutierrez, Manuel J.


    Examines the role of the educational and socioeconomic levels of the speakers in advancing linguistic change. The study reviews three grammatical phenomena found at distinct stages of change. Individuals at the lower socioeconomic and educational strata of society embrace innovations in language more readily than their affluent and educated…

  17. GEDEON: A joint venture between research (CEA and CNRS) and industry (EDF and FRAMATOME)

    NASA Astrophysics Data System (ADS)

    Schapira, J. P.


    Nuclear waste partitionning and transmutation (P & T) are considered in France as an official line of research, in accordance with the Law of December 30, 1991 concerning research in the field of long lived and highly active nuclear waste. A research group called GEDEON ( GEstion des DEchets par des Options Nouvelles) has been set up between CEA, CNRS, EDF and FRAMATOME with the aim to carry out basic research related to the use of accelerator driven subcritical systems (ADS) and of thorium as an option to reduce the waste long term impacts. In the partners agreement of GEDEON, the following subjects have been identified: spallation physics, nuclear data, subcritical neutronic studies, materials, thorium, system and scenario studies. The organization as well as the scientific program and activities of GEDEON are presented.

  18. Lo que Piensan los Estudiantes y Profesores Sobre la Calidad de la Educacion Superior. Estudio Comparativo en 5 Instituciones de Educacion Superior--dos publicas y tres privadas--en Guadalajara, Jalisco, Mexico (What Students and Faculties Think about the Quality of Higher Education. Comparative Study of 5 Higher Education Institutions--Two Public and Three Private--in Guadalajara, Jalisco, Mexico).

    ERIC Educational Resources Information Center

    Yanez, Maria Lorena Hernandez

    This study, written in Spanish, compared attitudes of students (N=302) and faculty (N=28) at five institutions of higher education (two public and three private) in Guadalajara, Jalisco, Mexico. The study explored first, whether respondents believed there are significant quality differences between private and public universities and, second, what…

  19. Exploring EFL Pre-Service Teachers' Experience with Cultural Content and Intercultural Communicative Competence at Three Colombian Universities (Indagación sobre la experiencia con el contenido cultural y la competencia comunicativa intercultural de docentes de inglés en formación, en tres universidades colombianas)

    ERIC Educational Resources Information Center

    Olaya, Alba; Gómez Rodríguez, Luis Fernando


    This article reports the findings of a qualitative research project that explored pre-service English teachers' perceptions of and attitudes toward the aspects of culture and intercultural competence addressed in their English classes in the undergraduate programs at three Colombian universities. Findings reveal that pre-service teachers are…

  20. Etude du profil d'echelle des formes et de mesures d'energie de texture pour l'evaluation semi-automatique des degâts sur les bâtiments dans les images satellitaires de tres haute resolution

    NASA Astrophysics Data System (ADS)

    Dubois, David

    Dozens of natural disasters occur each year throughout the world. They cause the death of thousands of people and cost billions of dollars in losses and reconstruction. Considerable resources are invested in the various phases of the emergency cycle like response and reconstruction. To avoid mismanagement of human and material resources during the response to a disaster, decisions must be made very quickly. To make appropriate choices, decision makers need up to date information on conditions on the ground. The images acquired by satellite are a possible source for this information. The new satellites equipped with optical sensors having spatial resolution finer than a meter per pixel provide details useful for determining the status of roads and damage to buildings. Unfortunately, visual analysis of these very large images is time consuming and fatigue may increase the rate of human error. In this thesis, we propose a semi-automatic method for the extraction of buildings and damage assessment using geometric, radiometric and texture features. The work includes a review of the literature in order to identify gaps in current approaches and possible solutions, the development of a methodology to solve this difficult problem, the testing of the proposed method on a portion of images of the city of Port-au-Prince, Haiti captured before and after the earthquake of January 12, 2010, assessment of results and their comparison with the literature. The proposed method requires processing of the image in a hierarchical tree shapes through the fast level set transform. Once the image is represented in this way, an algorithm for extracting meaningful forms is used to assign a representative form for each pixel. Geometrical descriptors such as area, perimeter and others from central moments are extracted from these forms. In addition, for damage assessment, energy measurements of texture are calculated on the forms before and after the event. Buildings are extracted using a supervised classifier based on a support vector machine (SVM). The damage is classified according to three degrees: little or no damage, damaged and destroyed. After experiment, the proposed method for the evaluation of damage exceeds those proposed in the recent literature both in rapidity and accuracy. The use of the scale profile and Laws textures are considerable innovations in the field of remote sensing brought by this thesis.

  1. Étude de la variation spatio-temporelle des paramètres physico-chimiques caractérisant la qualité des eaux d'une lagune côtière et ses zonations écologiques : cas de Moulay Bousselham, Maroc

    NASA Astrophysics Data System (ADS)

    Labbardi, Hanane; Ettahiri, Omar; Lazar, Said; Massik, Zakia; El Antri, Said


    Our interest is related to the hydrological characteristics of the Moulay Bousselham lagoon. Water samples were taken monthly from July 2001 to June 2002 in 15 stations distributed along the lagoon. The various measured hydrological parameters (temperature, salinity, suspended matter, chlorophyll a) showed significant monthly variations ( p<0.001), whereas spatially among all sampled stations, only the salinity showed significant variations. The variability analysis approached by the analysis of the normalized principal components combined with discriminate analysis showed very small inter-stations variability. Its percentage is 11% and 9% of the total variance during high and low tide, respectively. To cite this article: H. Labbardi et al., C. R. Geoscience 337 (2005).

  2. La teneur en iode du sel de cuisine consommé à Lubumbashi et le statut iode des personnes vulnérables: cas de femmes enceintes de milieux défavorisés

    PubMed Central

    Banza, Bienvenue Ilunga; Lumbu, Jean Baptiste Simbi; Donnen, Philippe; Twite, Eugène Kabange; Kwete, Daniel Mikobi; Kazadi, Costa Mwadianvita; Ozoza, Jean Okolonken; Habimana, Laurence; Kalenga, Prosper Muenze Kayamba; Robert, Annie


    Introduction La consommation du sel faiblement iodé peut engendrer des troubles divers liés à la carence iodée Ce travail a pour objectif d’évaluer la teneur en iode du sel consommé à Lubumbashi et de déterminer le statut iodé des femmes enceintes, cible privilégiée de la carence iodée. Méthodes Une étude transversale descriptive a été consacrée à une analyse iodométrique d'iode dans 739 échantillons de sel collectés dans les ménages et marchés de Lubumbashi en 2014. Précédemment, l'iode urinaire a été déterminé par la technique de minéralisation au persulfate d'ammonium chez 225 femmes enceintes reçues en consultation du 15 mars 2009 au 25 avril 2011. Résultats Notre enquête a révélé 47,5% des échantillons de sels de cuisine adéquatement iodés (15 à 40 ppm), 36,9% d’échantillons faiblement iodés, 7,4% d’échantillons trop riches en iode et 8,1% des échantillons non iodés. La disponibilité en iode du sel de cuisine analysé était globalement de 54,9%, se trouvant nettement en dessous des normes OMS (90%). En mesurant l'iode urinaire chez la femme enceinte, la carence iodée (iode urinaire <150 µg/l) a été observée dans une proportion de 52%. Conclusion La faible disponibilité en iode du sel consommé à Lubumbashi pourrait être responsable d'une grande proportion de la carence iodée observée chez la femme enceinte, ce qui expose celle-ci aux risques majeurs des troubles dus à la carence en iode. PMID:27279956

  3. 75 FR 32932 - Combined Notice of Filings No. 2

    Federal Register 2010, 2011, 2012, 2013, 2014


    ... Commission has received the following Natural Gas Pipeline Rate and Refund Report filings: Docket Numbers: RP09-260-005. Applicants: Tres Palacios Gas Storage LLC. Description: Tres Palacios Gas Storage LLC submits Second Substitute First Revised Sheet 138 to FERC Gas Tariff, Original Volume 1. Filed Date:...

  4. In vitro comparative studies of resveratrol and triacetylresveratrol on cell proliferation, apoptosis, and STAT3 and NFκB signaling in pancreatic cancer cells.


    Duan, JingJing; Yue, Wen; E, JianYu; Malhotra, Jyoti; Lu, Shou-En; Gu, Jun; Xu, Feng; Tan, Xiang-Lin


    Resveratrol (RES) has been studied extensively as an anticancer agent. However, the anticancer effects of triacetylresveratrol (TRES, an acetylated analog of RES) which has higher bioavailability have not been well established. We comparatively evaluated their effects on cell proliferation, apoptosis and the molecular changes in STAT3, NFκB and apoptotic signaling pathways in pancreatic cancer cells. Apoptosis was determined by flow cytometry. The nuclear translocation and interaction of STAT3 and NFκB were detected by Western blotting and immunoprecipitation, respectively. Both TRES and RES inhibited cell viability, and induced apoptosis of pancreatic cancer cells in a concentration and incubation time-dependent manner. TRES, similarly to RES, inhibited the phosphorylation of STAT3 and NFκB, down-regulated Mcl-1, and up-regulated Bim and Puma in pancreatic cancer cells. Remarkably, we, for the first time, observed that both TRES and RES suppressed the nuclear translocation, and interrupted the interaction of STAT3 and NFκB in PANC-1 cells. Comparative anticancer effects of TRES and RES on pancreatic cancer suggested that TRES with higher bioavailability may be a potential agent for pancreatic cancer prevention and treatment. Further in vivo experiments and functional studies are warranted to investigate whether TRES exhibits better beneficial effects than RES in mice and humans. PMID:27539371

  5. Identification and Characterization of a Novel Trehalose Synthase Gene Derived from Saline-Alkali Soil Metagenomes

    PubMed Central

    Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang


    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn2+ and Hg2+. Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficientcy (Kcat/Km) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis. PMID:24146994

  6. In vitro comparative studies of resveratrol and triacetylresveratrol on cell proliferation, apoptosis, and STAT3 and NFκB signaling in pancreatic cancer cells

    PubMed Central

    Duan, JingJing; Yue, Wen; E, JianYu; Malhotra, Jyoti; Lu, Shou-en; Gu, Jun; Xu, Feng; Tan, Xiang-Lin


    Resveratrol (RES) has been studied extensively as an anticancer agent. However, the anticancer effects of triacetylresveratrol (TRES, an acetylated analog of RES) which has higher bioavailability have not been well established. We comparatively evaluated their effects on cell proliferation, apoptosis and the molecular changes in STAT3, NFκB and apoptotic signaling pathways in pancreatic cancer cells. Apoptosis was determined by flow cytometry. The nuclear translocation and interaction of STAT3 and NFκB were detected by Western blotting and immunoprecipitation, respectively. Both TRES and RES inhibited cell viability, and induced apoptosis of pancreatic cancer cells in a concentration and incubation time-dependent manner. TRES, similarly to RES, inhibited the phosphorylation of STAT3 and NFκB, down-regulated Mcl-1, and up-regulated Bim and Puma in pancreatic cancer cells. Remarkably, we, for the first time, observed that both TRES and RES suppressed the nuclear translocation, and interrupted the interaction of STAT3 and NFκB in PANC-1 cells. Comparative anticancer effects of TRES and RES on pancreatic cancer suggested that TRES with higher bioavailability may be a potential agent for pancreatic cancer prevention and treatment. Further in vivo experiments and functional studies are warranted to investigate whether TRES exhibits better beneficial effects than RES in mice and humans. PMID:27539371

  7. Facility design, construction, and operation

    SciTech Connect


    France has been disposing of low-level radioactive waste (LLW) at the Centre de Stockage de la Manche (CSM) since 1969 and now at the Centre de Stockage de l`Aube (CSA) since 1992. In France, several agencies and companies are involved in the development and implementation of LLW technology. The Commissariat a l`Energie Atomic (CEA), is responsible for research and development of new technologies. The Agence National pour la Gestion des Dechets Radioactifs is the agency responsible for the construction and operation of disposal facilities and for wastes acceptance for these facilities. Compagnie Generale des Matieres Nucleaires provides fuel services, including uranium enrichment, fuel fabrication, and fuel reprocessing, and is thus one generator of LLW. Societe pour les Techniques Nouvelles is an engineering company responsible for commercializing CEA waste management technology and for engineering and design support for the facilities. Numatec, Inc. is a US company representing these French companies and agencies in the US. In Task 1.1 of Numatec`s contract with Martin Marietta Energy Systems, Numatec provides details on the design, construction and operation of the LLW disposal facilities at CSM and CSA. Lessons learned from operation of CSM and incorporated into the design, construction and operating procedures at CSA are identified and discussed. The process used by the French for identification, selection, and evaluation of disposal technologies is provided. Specifically, the decisionmaking process resulting in the change in disposal facility design for the CSA versus the CSM is discussed. This report provides` all of the basic information in these areas and reflects actual experience to date.

  8. Prototype pushing robot for emplacing vitrified waste canisters into horizontal disposal drifts

    SciTech Connect

    Londe, L.; Seidler, W.K.; Bosgiraud, J.M.; Guenin, J.J.; Devaux, P.


    Within the French Underground Disposal concept, as described in ANDRA's (Agence Nationale pour la Gestion des Dechets Radioactifs) Dossier 2005, the Pushing Robot is an application envisaged for the emplacement (and the potential retrieval) of 'Vitrified waste packages', also called 'C type packages'. ANDRA has developed a Prototype Pushing Robot within the framework of the ESDRED Project (Engineering Studies and Demonstration of Repository Design) which is co-funded by the European Commission as part of the sixth EURATOM Research and Training Framework Programme (FP6) on nuclear energy (2002 - 2006). The Rationale of the Pushing Robot technology comes from various considerations, including the need for (1) a simple and robust system, capable of moving (and potentially retrieving) on up to 40 metres (m), a 2 tonne C type package (mounted on ceramic sliding runners) inside the carbon steel sleeve constituting the liner (and rock support) of a horizontal disposal cell, (2) small annular clearances between the package and the liner, (3) compactness of the device to be transferred from surface to underground, jointly with the package, inside a shielding cask, and (4) remote controlled operations for the sake of radioprotection. The initial design, based on gripping supports, has been replaced by a 'technical variant' based on inflatable toric jacks. It was then possible, using a test bench, to check that the Pushing Robot worked properly. Steps as high as 7 mm were successfully cleared by a dummy package pushed by the Prototype.. Based on the lessons learned by ANDRA's regarding the Prototype Pushing Robot, a new Scope of Work is being written for the Contract concerning an Industrial Scale Demonstrator. The Industrial Scale Demonstration should be completed by the end of the second Quarter of 2008. (authors)

  9. Epithelium


    The term "epithelium" refers to layers of cells that line hollow organs and glands. It is also those cells that make ... Epithelium. In: Kierszenbaum AL, Tres LL. Histology and Cell Biology - An Introduction to Pathology , 3rd ed. Philadelphia, ...


    SciTech Connect

    Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Christiansen, Jessie L.; Deming, Drake; Barry, Richard K.; Kuchner, Marc J.; Livengood, Timothy A.; Hewagama, Tilak; Hampton, Don L.; Lisse, Carey M.; Seager, Sara; Veverka, Joseph F.


    We present time series photometry and constraints on additional planets in five of the exoplanetary systems studied by the EPOCh (Extrasolar Planet Observation and Characterization) component of the NASA EPOXI mission: HAT-P-4, TrES-3, TrES-2, WASP-3, and HAT-P-7. We conduct a search of the high-precision time series for photometric transits of additional planets. We find no candidate transits with significance higher than our detection limit. From Monte Carlo tests of the time series using putative periods from 0.5 days to 7 days, we demonstrate the sensitivity to detect Neptune-sized companions around TrES-2, sub-Saturn-sized companions in the HAT-P-4, TrES-3, and WASP-3 systems, and Saturn-sized companions around HAT-P-7. We investigate in particular our sensitivity to additional transits in the dynamically favorable 3:2 and 2:1 exterior resonances with the known exoplanets: if we assume coplanar orbits with the known planets, then companions in these resonances with HAT-P-4b, WASP-3b, and HAT-P-7b would be expected to transit, and we can set lower limits on the radii of companions in these systems. In the nearly grazing exoplanetary systems TrES-3 and TrES-2, additional coplanar planets in these resonances are not expected to transit. However, we place lower limits on the radii of companions that would transit if the orbits were misaligned by 2.{sup 0}0 and 1.{sup 0}4 for TrES-3 and TrES-2, respectively.

  11. Probing the interaction of trans-resveratrol with bovine serum albumin: a fluorescence quenching study with Tachiya model.


    Xiao, J B; Chen, X Q; Jiang, X Y; Hilczer, M; Tachiya, M


    The interaction of trans-resveratrol (TRES) and bovine serum albumin (BSA) was investigated using fluorescence spectroscopy (FS) with Tachiya model. The binding number maximum of TRES was determined to be 8.86 at 293.15 K, 23.42 at 303.15 K and 33.94 at 313.15 K and the binding mechanism analyzed in detail. The apparent binding constants (K (a)) between TRES and BSA were 5.02 x 10(4) (293.15 K), 8.89 x 10(4) (303.15 K) and 1.60 x 10(5) L mol(-1) (313.15 K), and the binding distances (r) between TRES and BSA were 2.44, 3.01, and 3.38 nm at 293.15, 303.15, and 313.15 K, respectively. The addition of TRES to BSA solution leads to the enhancement in RLS intensity, exhibiting the formation of the aggregate in solution. The negative entropy change and enthalpy change indicated that the interaction of TRES and BSA was driven mainly by van der Waals interactions and hydrogen bonds. The process of binding was a spontaneous process in which Gibbs free energy change was negative. PMID:18351302

  12. TN International and ITS operational feedback regarding the decommissioning of obsolete casks dedicated to the transport and/or storage of nuclear raw materials, fuel and used fuel

    SciTech Connect

    Blachet, L.; Bimet, F.; Rennesson, N.


    Within the AREVA group, TN International is a major actor regarding the design of casks and transportation for the nuclear cycle. In the early 2005, TN International has started the project of decommissioning some of its own equipment and was hence the first company ever in the AREVA Group to implement this new approach. In order to do so, TN International has based this project by taking into account the AREVA Sustainable Development Charter, the French regulatory framework, the ANDRA (Agence Nationale pour la Gestion des Dechets Radioactifs - National Agency for the radioactive waste management) requirements and has deployed a step by step methodology such as radiological characterization following a logical route. The aim was to define a standardized process with optimized solutions regarding the diversity of the cask's fleet. As a general matter, decommissioning of nuclear casks is a brand new field as the nuclear field is more familiar with the dismantling of nuclear facilities and/or nuclear power plant. Nevertheless existing workshops, maintenance facilities, measurements equipments and techniques have been exploited and adapted by TN International in order to turn an ambitious project into a permanent and cost-effective activity. The decommissioning of the nuclear casks implemented by TN International regarding its own needs and the French regulatory framework is formalized by several processes and is materialized for instance by the final disposal of casks as they are or in ISO container packed with cut-off casks and big bags filled with crushed internal cask equipments, etc. The first part of this paper aims to describe the history of the project that started with a specific environmental analysis which took into account the values of AREVA as regards the Sustainable Development principles that were at the time and are still a topic of current concern in the world. The second part will deal with the definition, the design and the implementation of the

  13. Identification of active transcriptional regulatory elements from GRO-seq data.


    Danko, Charles G; Hyland, Stephanie L; Core, Leighton J; Martins, Andre L; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G; Kraus, W Lee; Lis, John T; Siepel, Adam


    Modifications to the global run-on and sequencing (GRO-seq) protocol that enrich for 5'-capped RNAs can be used to reveal active transcriptional regulatory elements (TREs) with high accuracy. Here, we introduce discriminative regulatory-element detection from GRO-seq (dREG), a sensitive machine learning method that uses support vector regression to identify active TREs from GRO-seq data without requiring cap-based enrichment ( This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Predicted TREs are more enriched for several marks of transcriptional activation—including expression quantitative trait loci, disease-associated polymorphisms, acetylated histone 3 lysine 27 (H3K27ac) and transcription factor binding—than those identified by alternative functional assays. Using dREG, we surveyed TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  14. Homology modeling and function of trehalose synthase from Pseudomonas putida P06.


    Su, Jing; Wang, Tengfei; Ma, Chunling; Li, Zhongkui; Li, Zhenzhen; Wang, Ruiming


    Trehalose is a non-reducing disaccharide that has wide applications in the food industry and pharmaceutical manufacturing. Trehalose synthase (TreS) from Pseudomonas putida P06 catalyzes the reversible interconversion of maltose and trehalose and may have applications in the food industry. However, the catalytic mechanism of TreS is not well understood. Here, we investigated the structural characteristics of this enzyme by homology modeling. The highly conserved Asp294 residue was identified to be critical for catalytic activity. In addition, flexible docking studies of the enzyme-substrate system were performed to predict the interactions between TreS and its substrate, maltose. Amino acids that interact extensively with the substrate and stabilize the substrate in an orientation suitable for enzyme catalysis were identified. The importance of these residues for catalytic activity was confirmed by the biochemical characterization of the relevant mutants generated by site-directed mutagenesis. PMID:24563286

  15. Atmospheric characterization of five hot Jupiters with the wide field Camera 3 on the Hubble space telescope

    SciTech Connect

    Ranjan, Sukrit; Charbonneau, David; Désert, Jean-Michel; Madhusudhan, Nikku; Deming, Drake; Wilkins, Ashlee; Mandell, Avi M.


    We probe the structure and composition of the atmospheres of five hot Jupiter exoplanets using the Hubble Space Telescope Wide Field Camera 3 (WFC3) instrument. We use the G141 grism (1.1-1.7 μm) to study TrES-2b, TrES-4b, and CoRoT-1b in transit; TrES-3b in secondary eclipse; and WASP-4b in both. This wavelength region includes a predicted absorption feature from water at 1.4 μm, which we expect to be nondegenerate with the other molecules that are likely to be abundant for hydrocarbon-poor (e.g., solar composition) hot Jupiter atmospheres. We divide our wavelength regions into 10 bins. For each bin we produce a spectrophotometric light curve spanning the time of transit or eclipse. We correct these light curves for instrumental systematics without reference to an instrument model. For our transmission spectra, our mean 1σ precision per bin corresponds to variations of 2.1, 2.8, and 3.0 atmospheric scale heights for TrES-2b, TrES-4b, and CoRoT-1b, respectively. We find featureless spectra for these three planets. We are unable to extract a robust transmission spectrum for WASP-4b. For our dayside emission spectra, our mean 1σ precision per bin corresponds to a planet-to-star flux ratio of 1.5 × 10{sup –4} and 2.1 × 10{sup –4} for WASP-4b and TrES-3b, respectively. We combine these estimates with previous broadband measurements and conclude that for both planets isothermal atmospheres are disfavored. We find no signs of features due to water. We confirm that WFC3 is suitable for studies of transiting exoplanets, but in staring mode multivisit campaigns are necessary to place strong constraints on water abundance.

  16. Cryptographie quantique avec des états cohérents à longueur d'onde télécom

    NASA Astrophysics Data System (ADS)

    Lodewyck, J.; Tualle-Brouri, R.; Debuisschert, T.; Grangier, P.


    Nous proposons un système de distribution quantique de clé avec des variables continues, implémenté avec des technologies télécom à 1550 nm. Le dispositif actuel nous a permis de transmettre une clé secrète brute au taux de 1 Mb/s sur une distance de quelques mètres. Une extension en cours de réalisation nous permettra de transmettre des clés sur des distances allant jusqu'à plusieurs dizaines dekilomètres.

  17. VET Workers' Problem-Solving Skills in Technology-Rich Environments: European Approach

    ERIC Educational Resources Information Center

    Hämäläinen, Raija; Cincinnato, Sebastiano; Malin, Antero; De Wever, Bram


    The European workplace is challenging VET adults' problem-solving skills in technology-rich environments (TREs). So far, no international large-scale assessment data has been available for VET. The PIAAC data comprise the most comprehensive source of information on adults' skills to date. The present study (N = 50 369) focuses on gaining…

  18. 75 FR 18232 - Endangered and Threatened Wildlife and Plants; 5-Year Status Reviews of 15 Caribbean Species

    Federal Register 2010, 2011, 2012, 2013, 2014


    .... mirabilis (no common name), chupacallos (Pleodendron macranthum), Vahl's boxwood or diablito de tres cuernos...), palo de nigua (Cornutia obovata), palo de Ram n (Banara vanderbiltii), uvillo (Eugenia haematocarpa... mature. B. Endangered means any species that is in danger of extinction throughout all or a...

  19. Dos dosis de vacuna contra los VPH pueden proteger

    Dos dosis de Cervarix, la vacuna contra virus del papiloma humano (VPH), fueron tan efectivas como la pauta normal actual de tres dosis después de cuatro años de seguimiento. El estudio de vacuna en Costa Rica, patrocinado por el NCI, fue diseñado para ev

  20. Imagining the Mexican Immigrant Worker: (Inter)Nationalism, Identity, and Insurgency in the Chicano Movement in Los Angeles.

    ERIC Educational Resources Information Center

    Chavez, Ernesto


    Traces the history of two organizations of the 1970s Chicano Movement: the Committee to Free Los Tres and the Centro de Accion Social Autonomo (CASA). Discusses their Marxist ideology, notion of Chicano cultural nationalism, involvement of college students and other youth, campaigns supporting immigrant workers' rights and affirmative action at…

  1. Radiations cosmiques : danger dans l'Espace

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.; Dzitko, H.


    Au sol, l'atmosphere nous protege plus ou moins bien. Mais dans l'espace ou a bord des avions de ligne, l'homme est directement expose aux rayonnements cosmiques qui peuvent etre mortels. Un veritable frein a la presence humaine prolongee dans l'espace. Une menace que les agences spatiales prennent tres au serieux.

  2. Estudios ALCHEMIST para el cáncer de pulmón en estadio inicial

    ALCHEMIST comprende tres estudios clínicos integrados de medicina de precisión diseñados para identificar a personas con cáncer de pulmón en estadio inicial cuyos tumores tienen ciertos cambios genéticos poco comunes.

  3. Cigarrillos electrónicos | Smokefree Español

    Seguramente ha oído a personas hablar del uso de los cigarrillos electrónicos como una manera de dejar de fumar. Si esta pensando en usar un cigarrillo electrónico, aquí hay tres cosas que debe de saber.

  4. El pronóstico del cáncer

    Tres pacientes con cáncer y su médico, el doctor Anthony L. Back, un oncólogo quien también es experto a nivel nacional en la comunicación entre médicos y pacientes, comparten sus puntos de vista sobre sus pronósticos de cáncer.

  5. Review of thermally regenerative electrochemical systems. Volume I. Synopsis and executive summary

    SciTech Connect

    Chum, H. L.; Osteryoung, R. A.


    Thermally regenerative electrochemical systems (TRES) are closed systems that convert heat into electricity in an electrochemical heat engine that is Carnot cycle limited in efficiency. Past and present work on such systems is reviewed. Two broad classes of TRES are based on the types of energy inputs required for regeneration: thermal alone and coupled thermal and electrolytic. The thermal regeneration alone encompasses electrochemical systems (galvanic or fuel cells) in which one or more products are formed. The regeneration can be performed in single or multiple steps. The compounds include metal hydrides, halides, oxides, chalcogenides, and alloys or bimetallic systems. The coupled thermal and electrolytic regeneration encompasses electrochemical systems (galvanic or fuel cells) regenerated by electrolysis at a different temperature or different pressure. Examples include metal halides and water. Thermogalvanic or nonisothermal cells are included in this category. Also included are electrochemical engines in which the working electroactive fluid is isothermally expanded through an electrolyte. TRES cover temperature ranges from about 20/sup 0/C to 1000/sup 0/C. Engines with power outputs of 0.1 mW/cm/sup 2/ to 1 W/cm/sup 2/ have been demonstrated. Recommendations are made of areas of research in science and engineering that would have long-range benefit to a TRES program.

  6. Critical Muralism

    ERIC Educational Resources Information Center

    Rosette, Arturo


    This study focuses on the development and practices of Critical Muralists--community-educator-artist-leader-activists--and situates these specifically in relation to the Mexican mural tradition of los Tres Grandes and in relation to the history of public art more generally. The study examines how Critical Muralists address artistic and…

  7. Preliminary Report from the 2005 Conference on Teacher Research Experiences

    NASA Astrophysics Data System (ADS)

    Scowcroft, G. A.; Knowlton, C.


    There is a clearly expressed need from the field for a coordination of efforts and a sharing of best practices among institutions and projects providing teacher research experiences for K-12 science educators. To address these needs, over 100 participants from 30 Teacher Research Experience (TRE) Projects met at the University of Rhode Island in April 2005 to participate in the Conference on Teacher Research Experiences (CTRE). Three member teams from each project included principle investigators, project directors and evaluators, teachers, scientists, and other professionals engaged in TREs. The CTRE goals were to: 1.) initiate a community of professionals that engage in TREs; 2.) build a foundation of best practices for TREs; 3.) work toward standardizing teacher mentoring activities; 4.) establish connections and collaborations between projects; 5.) provide opportunities for meeting individual project challenges. This presentation will discuss conference results as well as highlight data collected from the participating projects describing project design elements, successes, and needs. There are common experiences shared by those participating in TREs that help to build an informed and supportive professional community.

  8. Identification of thyroid hormone receptor binding sites in developing mouse cerebellum

    PubMed Central


    Background Thyroid hormones play an essential role in early vertebrate development as well as other key processes. One of its modes of action is to bind to the thyroid hormone receptor (TR) which, in turn, binds to thyroid response elements (TREs) in promoter regions of target genes. The sequence motif for TREs remains largely undefined as does the precise chromosomal location of the TR binding sites. A chromatin immunoprecipitation on microarray (ChIP-chip) experiment was conducted using mouse cerebellum post natal day (PND) 4 and PND15 for the thyroid hormone receptor (TR) beta 1 to map its binding sites on over 5000 gene promoter regions. We have performed a detailed computational analysis of these data. Results By analysing a recent spike-in study, the optimal normalization and peak identification approaches were determined for our dataset. Application of these techniques led to the identification of 211 ChIP-chip peaks enriched for TR binding in cerebellum samples. ChIP-PCR validation of 25 peaks led to the identification of 16 true positive TREs. Following a detailed literature review to identify all known mouse TREs, a position weight matrix (PWM) was created representing the classic TRE sequence motif. Various classes of promoter regions were investigated for the presence of this PWM, including permuted sequences, randomly selected promoter sequences, and genes known to be regulated by TH. We found that while the occurrence of the TRE motif is strongly correlated with gene regulation by TH for some genes, other TH-regulated genes do not exhibit an increased density of TRE half-site motifs. Furthermore, we demonstrate that an increase in the rate of occurrence of the half-site motifs does not always indicate the specific location of the TRE within the promoter region. To account for the fact that TR often operates as a dimer, we introduce a novel dual-threshold PWM scanning approach for identifying TREs with a true positive rate of 0.73 and a false positive

  9. Analysis of hydrocarbon-bearing fluid inclusions (HCFI) using time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Przyjalgowski, Milosz A.; Ryder, Alan G.; Feely, Martin; Glynn, Thomas J.


    Hydrocarbon-bearing fluid inclusions (HCFI) are microscopic cavities within rocks that are filled with petroleum oil, the composition of which may not have changed since the trapping event. Thus, the composition of that entrapped oil can provide information about the formation and evolution of the oil reservoir. This type of information is important to the petroleum production and exploration industries. Crude oil fluorescence originates from the presence of cyclic aromatic compounds and the nature of the emission is governed by the chemical composition of the oil. Fluorescence based methods are widely used for analysis of crude oil because they offer robust, non-contact and non-destructive measurement options. The goal of our group is the development of a non-destructive analytical method for HCFI using time-resolved fluorescence methods. In broad terms, crude oil fluorescence behavior is governed by the concentration of quenching species and the distribution of fluorophores. For the intensity averaged fluorescence lifetime, the best correlations have been found between polar or alkane concentrations, but these are not suitable for robust, quantitative analysis. We have recently started to investigate another approach for characterizing oils by looking at Time-resolved Emission Spectra (TRES). TRES are constructed from intensities sampled at discrete times during the fluorescence decay of the sample. In this study, TRES, from a series of 10 crude oils from the Middle East, have been measured at discrete time gates (0.5 ns, 1 ns, 2 ns, 4 ns) over the 450-700 nm wavelength range. The spectral changes in TRES, such as time gate dependent Stokes' shift and spectral broadening, are analyzed in the context of energy transfer rates. In this work, the efficacy of using TRES for fingerprinting individual oils and HCFI is also demonstrated.

  10. Novel Resveratrol-Based Substrates for Human Hepatic, Renal, and Intestinal UDP-Glucuronosyltransferases

    PubMed Central


    Trans-Resveratrol (tRes) has been shown to have powerful antioxidant, anti-inflammatory, anticarcinogenic, and antiaging properties; however, its use as a therapeutic agent is limited by its rapid metabolism into its conjugated forms by UDP-glucuronosyltransferases (UGTs). The aim of the current study was to test the hypothesis that the limited bioavailability of tRes can be improved by modifying its structure to create analogs which would be glucuronidated at a lower rate than tRes itself. In this work, three synthetic stilbenoids, (E)-3-(3-hydroxy-4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)acrylic acid (NI-12a), (E)-2,4-dimethoxy-6-(4-methoxystyryl)benzaldehyde oxime (NI-ST-05), and (E)-4-(3,5-dimethoxystyryl)-2,6-dinitrophenol (DNR-1), have been designed based on the structure of tRes and synthesized in our laboratory. UGTs recognize and glucuronidate tRes at each of the 3 hydroxyl groups attached to its aromatic rings. Therefore, each of the above compounds was designed with the majority of the hydroxyl groups blocked by methylation and the addition of other novel functional groups as part of a drug optimization program. The activities of recombinant human UGTs from the 1A and 2B families were examined for their capacity to metabolize these compounds. Glucuronide formation was identified using HPLC and verified by β-glucuronidase hydrolysis and LC–MS/MS analysis. NI-12a was glucuronidated at both the −COOH and −OH functions, NI-ST-05 formed a novel N–O-glucuronide, and no product was observed for DNR-1. NI-12a is primarily metabolized by the hepatic and renal enzyme UGT1A9, whereas NI-ST-05 is primarily metabolized by an extrahepatic enzyme, UGT1A10, with apparent Km values of 240 and 6.2 μM, respectively. The involvement of hepatic and intestinal UGTs in the metabolism of both compounds was further confirmed using a panel of human liver and intestinal microsomes, and high individual variation in activity was demonstrated between donors. In summary

  11. A 'Swinging Cradle' model for in vitro classification of different types of response elements of a nuclear receptor

    SciTech Connect

    Malo, Madhu S.; Pushpakaran, Premraj; Hodin, Richard A. . E-mail:


    Nuclear receptors are hormone-activated transcription factors that bind to specific target sequences termed hormone-response element (HRE). A HRE usually consists of two half-sites (5'-AGGTCA-3' consensus sequence) arranged as a direct, everted or inverted repeat with variable spacer region. Assignment of a HRE as a direct, everted or inverted repeat is based on its homology to the consensus half-site, but minor variations can make such an assignment confusing. We hypothesize a 'Swinging Cradle' model for HRE classification, whereby the core HRE functions as the 'sitting platform' for the NR, and the extra nucleotides at either end act as the 'sling' of the Cradle. We show that in vitro binding of the thyroid hormone receptor and 9-cis retinoic acid receptor heterodimer to an everted repeat TRE follows the 'Swinging Cradle' model, whereas the other TREs do not. We also show that among these TREs, the everted repeat mediates the highest biological activity.

  12. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2012 CFR


    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  13. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2013 CFR


    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  14. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2014 CFR


    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  15. The reprint of a chapter of Nicolaus Copernicus' principal book by Heinrich Brucaeus, Rostock 1573 (German Title: Der Nachdruck eines Kapitels des Hauptwerkes von Nicolaus Copernicus durch Heinrich Brucaeus, Rostock 1573)

    NASA Astrophysics Data System (ADS)

    Hamel, Jürgen

    The book "De motu primo libri tres" of the Rostock professor Heinrich Brucaeus (1530-1593), which appeared in 1573, contains an unmodified reprint of a section of Copernicus` principal work, first book, 14th chapter, exercise 3. This reprint, hitherto unnoticed, is of interest for the reception of Copernicus' work. This article reproduces the text and presents some research on Brucaeus, who was Tycho Brahe's teacher in Rostock. His biography and his scientific achievements are outlined.

  16. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2010 CFR


    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  17. Case Study of Small Molecules As Antimalarials: 2-Amino-1-phenylethanol (APE) Derivatives

    PubMed Central


    Antiparasitic oral drugs have been associated to lipophilic molecules due to their intrinsic permeability. However, these kind of molecules are associated to numerous adverse effects, which have been extensively studied. Within the Tres Cantos Antimalarial Set (TCAMS) we have identified two small, soluble and simple hits that even presenting antiplasmodial activities in the range of 0.4–0.5 μM are able to show in vivo activity. PMID:24944739

  18. Magnétométrie à hélium par pompage laser: le bilan

    NASA Astrophysics Data System (ADS)

    Gilles, H.; Hamel, J.; Monfort, Y.


    Depuis 1986, l'équipe Physique Atomique et Capteurs du CIRIL-ISMRA de Caen étudie les magnétomètres à hélium par pompage laser. On présente ici le bilan de ces travaux de recherche et les performances des deux prototypes (hélium4 et hélium3) réalisés au Laboratoire.

  19. The Meteoritical Bulletin, No. 77, 1994 November

    NASA Astrophysics Data System (ADS)

    Wlotzka, Frank


    This Meteoritical Bulletin is again dominated by meteorite finds from hot and cold deserts: 99 from the Nullarbor, 12 from the Sahara, and 35 from Antarctica. Besides 161 ordinary chondrites, it lists 5 irons (Colton, Hidden Valley, Miles, Tagounite, Tres Castillos), 2 ureilites (FRO90168, Hughes 009), 1 howardite (ALH 88135), 1 CV3 (Axtell), 1 CK4 (Sleeper Camp 006), and 2 enstatite chondrites (ALH 88070, Forrest 033). Three of the meteorites are falls.

  20. Geoffrey Burbidge : L'art de la critique

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.


    Avec pres de cinquante ans de carriere derriere lui, Geoffrey Burbidge n'a rien perdu de son gout du débat et de la controverse. Mondialement reconnu pour ses travaux sur les quasars, il en agace aujourd'hui plus d'un en venant deranger le bel ordonnancement de la cosmologie. Il porte sur le monde scientifique un regard tres critique, condamnant notamment ces chercheurs qui acceptent trop volontiers d'emprunter les chemins tout traces.

  1. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2011 CFR


    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  2. Astronomía y Física: un matrimonio Sartriano

    NASA Astrophysics Data System (ADS)

    Vucetich, H.

    Desde el siglo XVII, Física y Astronomía han formado un matrimonio similar al de Sartre y Beauvoir: lleno de amores contingentes, pero firme y duradero. En la charla examino tres de los frutos más recientes de este matrimonio: - La confirmación de la Relatividad General con datos astronómicos. - Astrofísica y Física de neutrinos. - Teorías de supercuerdas y astronomía.

  3. La distribución multimodal de cúmulos globulares en la galaxia NGC 1399

    NASA Astrophysics Data System (ADS)

    Forte, J. C.; Ostrov, P. G.

    Se presenta una discusión de las características del diagrama de dos colores para un muestreo de 400 cúmulos globulares asociados con NGC 1399. Los resultados indican la presencia de, por lo menos, tres familias de cúmulos. La naturaleza de una cuarta componente, muy azul, no es clara aunque podría tratarse de cúmulos ``sueltos" asociados con el sistema de Fornax.

  4. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin

    PubMed Central


    Background Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. Results By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven “bookmarked” regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Conclusion Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the

  5. Identification of thyroid hormone response elements in vivo using mice expressing a tagged thyroid hormone receptor α1

    PubMed Central

    Dudazy-Gralla, Susi; Nordström, Kristina; Hofmann, Peter Josef; Meseh, Dina Abdul; Schomburg, Lutz; Vennström, Björn; Mittag, Jens


    TRα1 (thyroid hormone receptor α1) is well recognized for its importance in brain development. However, due to the difficulties in predicting TREs (thyroid hormone response elements) in silico and the lack of suitable antibodies against TRα1 for ChIP (chromatin immunoprecipitation), only a few direct TRα1 target genes have been identified in the brain. Here we demonstrate that mice expressing a TRα1–GFP (green fluorescent protein) fusion protein from the endogenous TRα locus provide a valuable animal model to identify TRα1 target genes. To this end, we analysed DNA–TRα1 interactions in vivo using ChIP with an anti-GFP antibody. We validated our system using established TREs from neurogranin and hairless, and by verifying additional TREs from known TRα1 target genes in brain and heart. Moreover, our model system enabled the identification of novel TRα1 target genes such as RNF166 (ring finger protein 166). Our results demonstrate that transgenic mice expressing a tagged nuclear receptor constitute a feasible approach to study receptor–DNA interactions in vivo, circumventing the need for specific antibodies. Models like the TRα1–GFP mice may thus pave the way for genome-wide mapping of nuclear receptor-binding sites, and advance the identification of novel target genes in vivo. PMID:23398480

  6. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference

    PubMed Central

    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin


    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice. PMID:27328657

  7. Genetic differentiation in the Mexican endemic Rufous-backed Robin, Turdus rufopalliatus (Passeriformes: Turdidae).


    Montaño-Rendón, Mauricio; Sánchez-González, Luis A; Hernández-Alonso, Germán; Navarro-Sigüenza, Adolfo G


    The Rufous-backed Robin (Turdus rufopalliatus) is endemic to deciduous and semideciduous tropical forests of western Mexico. Of the currently recognized subspecies, T. r. graysoni, from the Tres Marías Islands and nearby coastal Nayarit, has been considered a separate species; however, this treatment has been challenged due to an apparent contact zone on the mainland, although no hybrids have ever been recorded. Here, we use mitochondrial DNA sequences from individuals sampled across the species' range to assess their phylogeographic relationships. We found reciprocal monophyly between Tres Marías Islands and mainland populations, which share no haplotypes between them. Evolutionary divergence detected within T. rufopalliatus suggests that mainland and island populations have been isolated from each other, and divergence decreases if insular populations are excluded. Demographic parameters suggest that populations are in the process of a rapid expansion from ancestral populations with a lower population size. These results are consistent with morphometric and plumage differences that have been used to recognize the Tres Marías Islands populations from the mainland ones, thus suggesting species status of the island form. PMID:26624454

  8. Improvement of the Spatial Amplitude Isotropy of a ^4He Magnetometer Using a Modulated Pumping Beam

    NASA Astrophysics Data System (ADS)

    Chéron, B.; Gilles, H.; Hamel, J.; Moreau, O.; Noël, E.


    Optically pumped magnetometers are scalar magnetometers. Contrary to vectoriel magnetometers, they measure the total magnetic field whatever the direction of the sensor. However, for some orientations of the magnetometer with respect to the magnetic field direction, the resonant signal vanishes and the measurement is impossible. In this paper we present a simple solution to reduce the amplitude spatial anisotropy and apply it to a ^4He magnetometer developed in our Laboratory. Les magnétomètres à pompage optique sont des magnétomètres scalaires. Contrairement aux magnétomètres vectoriels, ils mesurent le module du champ magnétique quelle que soit l'orientation du capteur dans l'espace. Cependant, pour certaines orientations du magnétomètre par rapport à la direction du champ à mesurer, l'amplitude du signal de résonance s'annule et la mesure devient impossible. Dans cet article, nous présentons une solution simple pour réduire l'anisotropie spatiale d'amplitude et nous l'appliquons à un magnétomètre à hélium-4 développé dans notre Laboratoire.

  9. Parasite communities of the neotropical cormorant Phalacrocorax brasilianus (Gmelin) (Aves, Phalacrocoracidae) from two coastal lagoons in Guerrero state, Mexico.


    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín; Flores-Garza, Rafael; Larumbe-Morán, Edvino


    The parasite community structure of the neotropical cormorant, Phalacrocorax brasilianus, from two lagoons (Coyuca and Tres Palos) from Guerrero state, México, was examined. Fourteen species of adult helminths (6,391 individuals) from 48 cormorants were identified: 9 digeneans, 1 acanthocephalan, 1 cestode, and 3 nematodes. A total of 11 species were collected in Coyuca Lagoon and 12 in Tres Palos Lagoon. Nine species co-occurred in cormorants of both lagoons but, with the exception of Contracaecum multipapillatum and Drepanocephalus olivaceus, species were not equally common in both lagoons. The prevalence values of six species of helminth and the mean abundance of four species varied significantly between lagoons, and C. multipapillatum was numerically dominant in both lagoons. The qualitative similarity between the two communities at the component level was 64%. All cormorants examined were infected, and parasite species richness was 3-5 in Coyuca and 4-9 in Tres Palos lagoon. The results indicate that both communities presented a similar structure at the component level, probably because the cormorants of both lagoons feed on the same species of fish and thus acquire almost the same species of parasites. Differences observed at the infracommunity level were attributed to variations in the degree of dominance of the particular species. PMID:21503640

  10. Supplement to the site observational work plan for the UMTRA Project Site at Ambrosia Lake, New Mexico

    SciTech Connect


    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of (1) the average linear velocity of the ground water in the alluvium; (2) the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale; and (3) the fate and transport of contaminants from the uppermost aquifer to the Westwater Canyon Member of the Morrison Formation. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Shale unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. Figure 1 is a geologic cross section depicting the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Table 1 presents hydrogeologic information of each hydrostratigraphic unit.

  11. Supplement to the site observational work plan for the UMTRA project site at Ambrosia Lake, New Mexico

    SciTech Connect


    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) (DOE, 1995) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of the average linear velocity of the ground water in the alluvium and a discussion of the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Sahel unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. A geologic cross section depicts the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Hydrogeologic information of each hydrostratigraphic unit is presented.

  12. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference.


    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin


    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice. PMID:27328657

  13. Reproductive success of three passerine species exposed to dioxin-like compounds near Midland, Michigan, USA.


    Fredricks, Timothy B; Zwiernik, Matthew J; Seston, Rita M; Coefield, Sarah J; Glaspie, Cassandra N; Tazelaar, Dustin L; Kay, Denise P; Newsted, John L; Giesy, John P


    Nests of three passerine birds, house wren (HOWR), tree swallow (TRES), and eastern bluebird (EABL) were monitored daily (2005-2007) at study areas (SAs) downstream of Midland, Michigan where soil and sediment concentrations of polychlorinated dibenzofurans (PCDFs) were significantly greater than the regional background concentrations and upstream reference areas (RAs). Similarly, TRES research conducted at sites contaminated with dioxin-like compounds indicated that concentrations of polychlorinated dibenzo-p-dioxins and PCDFs, expressed as ΣPCDD/DFs and 2,3,7,8-tetrachlorodibenzo-p-dioxin equivalents observed in the diet and eggs of these three species would be predicted to cause significant effects on reproduction. However, site-specific reproductive parameters including hatching success and fledging success at downstream SAs were similar to or greater than those at upstream RAs. Specifically, hatching success was not significantly different among years, species, locations, or between early and late nesting attempts. Of all initiated clutches, 66% (n = 427), 73% (n = 245), and 64% (n = 122) successfully fledged at least one nestling for HOWR, TRES, and EABL, respectively. Overall reproductive performance was similar between SAs and RAs. The reason for these unexpected results is consistent with the fact that there are species-specific and congener-specific differences in sensitivities to the effects of aryl hydrocarbon receptor agonists. PMID:22392542

  14. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B. M.; Pearson, K. A.; Biddle, L. I.; Cates, I. T.; Berube, M.; Thompson, R. M.; Smith, C. W.; Teske, J. K.; Hardegree-Ullman, K. K.; Robertson, A. N.; Crawfod, B. E.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K. L.; Hoglund, S.; Hofmann, R. A.; Jones, C.; Towner, A.; Small, L. C.; Walker-LaFollette, A. M.; Sanford, B.; Griffith, C. C.; Sagan, T.


    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  15. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B.; Pearson, K.; Biddle, L. I.; Cates, I.; Berube, M.; Thompson, R.; Smith, C.; Teske, J. K.; Hardegree-Ullman, K.; Robertson, A.; Crawfod, B.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K.; Hoglund, S.; Hofmann, R.; Jones, C.; Towner, A. P.; Small, L.; Walker-LaFollette, A.; Sanford, B.; Sagan, T.


    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  16. Mixtures of ultracold gases: Fermi sea and Bose-Einstein condensate of lithium isotopes

    NASA Astrophysics Data System (ADS)

    Schreck, F.


    régime quantique à très basse température. Le refroidissement est obtenu par évaporation du ^7Li dans un piège magnétique très confinant. Puisque le refroidissement évaporatif d'un gaz de fermion polarisé est impossible, le ^6Li est refroidi sympathiquement par contact thermique avec le ^7Li. Dans une première série d'expériences, les propriétés des gaz quantiques dans les états hyperfins les plus élevés, piégés magnétiquement, sont étudiées. Un gaz de 10^5 fermions a une température de 0,25(5) fois la température de Fermi (T_F) est obtenu. L'instabilité du condensat pour plus de 300 atomes condensés, à cause des interactions attractives, limite la dégénérescence que l'on peut atteindre. Pour s'affranchir de cette limite, une autre série d'expérience est menée dans les états hyperfins bas, piégeable magnétiquement, où les interactions entre bosons sont faiblement répulsives. Les collisions inter-isotopiques permettent alors la thermalisation du mélange. Le mélange d'un condensat de Bose-Einstein (CBE) de ^7Li et d'un mer de Fermi de ^6Li est produit. Le condensat est quasi unidimensionnel et la fraction thermique peut être négligeable. La dégénérescence atteinte correspond à T/T_C=T/T_F=0{,}2(1). La température est mesurée à partir de la fraction thermique des bosons qui disparaît aux plus basses températures, et limite notre précision de mesure. Dans une troisième série d'expérience, les bosons sont transférés dans un piège optique, et placé dans l'état interne |F=1,m_F=1rangle, l'état fondamental pour les bosons. Une résonance de Feshbach est repérée puis exploitée pour former un condensai où les interactions sont ajustables. Quand les interactions effectives entre les atomes sont attractives, on observe la formation d'un soliton brillant de matière. La propagation de ce soliton sans dispersion sur une distance de 1{,}1 mm est observée.

  17. Phase transitions and reentrant phenomena in liquid crystals having both rigid and flexible intramolecular joints

    NASA Astrophysics Data System (ADS)

    Pyżuk, W.; Górecka, E.; Mieczkowski, J.; Przedmojski, J.


    : monocouche et partiellement bicouche. Pour des homologues plus longs dans la série des composés azoxy, on a constaté l'existence d'autres phases smectiques ce qui implique l'apparition, sur les diagrammes des phases, de nouveau points multicritiques, par exemple le point Ad Cd N^re. Sur chaque ligne séparant les phases smectiques A de la phase nématique les transitions sont faiblement du premier ordre ou du deuxième ordre ce qui mène dans certain cas à plus qu'un point tricritique. Sur la ligne A{1} N/A{1} N^re on observe à T_NI/T_AN = 0,834 un simple point tricritique N A{1} — l'apparition des autres dépend du choix des constituants du système binaire. Dans le cas de quatre composés azoxy on a constaté une transition du deuxième ordre entre les phases smectiques partiellement bicouches, Ad et Cd. La transition est accompagnée d'un brusque changement de la chaleur spécifique qui varie linéairement avec la longueur de la queue de la molécule. Pour des homologues suivants de la série des composés azoxy on observe différentes dépendances en température de la distance entre les couches de la phase Ad.

  18. Application of MODIS-ASTER (MASTER) simulator data to geological mapping of young volcanic regions in Baja California, Mexico

    NASA Astrophysics Data System (ADS)

    Dmochowski, Jane Ellen

    Visible, near infrared, short-wave infrared, and thermal infrared multi-channel remote sensing data, MODIS-ASTER (MASTER), are used to extract geologic information from two volcanic regions in Baja California, Mexico: Tres Virgenes-La Reforma Volcanic Region and the volcanic island of Isla San Luis. The visible and near infrared and short-wave infrared data were atmospherically corrected and classified. The resulting classification roughly delineates surfaces that vary in their secondary minerals. Attempts to identify these minerals using ENVI's Spectral Analyst(TM) were moderately successful. The analysis of the thermal infrared data utilizes the shift to longer wavelengths in the Reststrahlen band as the mineralogy changes from felsic to mafic to translate the data into values of weight percent SiO2. The results indicate that the general approach tends to underestimate the weight percent SiO2 in the image. This discrepancy is removed with a "site calibration," which provides good results in the calculated weight percent SiO2 with errors of a few percent. However, errors become larger with rugged topography or low solar angle at the time of image acquisition. Analysis of bathymetric data around Isla San Luis, and consideration of the island's alignment with the Ballenas transform fault zone to the south and volcanic seamounts nearby, suggest Isla San Luis is potentially volcanically active and could be the product of a "leaky" transform fault. The results from the image analysis in the Tres Virgenes-La Reforma Volcanic Region show the La Reforma and El Aguajito volcanic centers to be bimodal in composition and verify the most recent volcanism in the Tres Virgenes region to be basaltic-andesite. The results of fieldwork and image analysis indicate that the volcanic products of the central dome of La Reforma are likely a sequence of welded ash flow tuffs and lavas of varied composition, evidence of its origin as a caldera.

  19. The inflammatory and normal transcriptome of mouse bladder detrusor and mucosa

    PubMed Central

    Saban, Marcia R; Hellmich, Helen L; Turner, Mary; Nguyen, Ngoc-Bich; Vadigepalli, Rajanikanth; Dyer, David W; Hurst, Robert E; Centola, Michael; Saban, Ricardo


    Background An organ such as the bladder consists of complex, interacting set of tissues and cells. Inflammation has been implicated in every major disease of the bladder, including cancer, interstitial cystitis, and infection. However, scanty is the information about individual detrusor and urothelium transcriptomes in response to inflammation. Here, we used suppression subtractive hybridizations (SSH) to determine bladder tissue- and disease-specific genes and transcriptional regulatory elements (TRE)s. Unique TREs and genes were assembled into putative networks. Results It was found that the control bladder mucosa presented regulatory elements driving genes such as myosin light chain phosphatase and calponin 1 that influence the smooth muscle phenotype. In the control detrusor network the Pax-3 TRE was significantly over-represented. During development, the Pax-3 transcription factor (TF) maintains progenitor cells in an undifferentiated state whereas, during inflammation, Pax-3 was suppressed and genes involved in neuronal development (synapsin I) were up-regulated. Therefore, during inflammation, an increased maturation of neural progenitor cells in the muscle may underlie detrusor instability. NF-κB was specifically over-represented in the inflamed mucosa regulatory network. When the inflamed detrusor was compared to control, two major pathways were found, one encoding synapsin I, a neuron-specific phosphoprotein, and the other an important apoptotic protein, siva. In response to LPS-induced inflammation, the liver X receptor was over-represented in both mucosa and detrusor regulatory networks confirming a role for this nuclear receptor in LPS-induced gene expression. Conclusion A new approach for understanding bladder muscle-urothelium interaction was developed by assembling SSH, real time PCR, and TRE analysis results into regulatory networks. Interestingly, some of the TREs and their downstream transcripts originally involved in organogenesis and

  20. Fluctuations quantiques et instabilites structurales dans les conducteurs a basse dimensionalite

    NASA Astrophysics Data System (ADS)

    Dikande, Alain Moise

    Un engouement particulier s'est manifeste ces dernieres annees pour les systemes electroniques fortement correles, ce en rapport avec l'immense richesse de leurs proprietes physiques. En general, ces proprietes sont induites par la presence d'interactions entre electrons qui, combinees a la structure du reseau moleculaire, donnent parfois lieu a une tres grande variete de phases electroniques et structurales ayant des incidences directes sur les phenomenes de transport dans ces materiaux. Les systemes electroniques couples a un reseau moleculaire et designes systemes electron-phonon font partie de cette classe de materiaux qui ont recemment capte l'attention, en raison notamment de la competition entre plusieurs echelles d'energie dans un environnement caracterise par une forte anisotropie cristalline et une dynamique moleculaire assez importante. En effet, en plus des proprietes electroniques et structurales particulieres la dimensionalite de ces systemes contribue egalement a leur richesse. Ainsi, une tres forte anisotropie structurale peut rehausser de facon considerable l'importance des interactions entre electrons et entre molecules constituant le reseau au point ou la physique du systeme soit regie par de tres fortes fluctuations. Ce dernier contexte est devenu un domaine a part de la physique des systemes fortement correles, a savoir celui des les phenomenes critiques quantiques . Parmi les systemes electron-phonon, on retrouve les composes inorganique KCP et organique TTF-TCNQ decouverts durant les annees 70, et explores en profondeur a cause de leur tendance vers une instabilite du type onde de densite de charge a basse temperature. Ces composes, en general designes systemes de Peierls en reference a l'instabilite de leurs structures electroniques regie par le reseau moleculaire, ont recemment connu un regain d'interet a la lumiere des nouveaux developpements dans les techniques de caracterisation des structures electroniques ainsi que sur le plan de

  1. Validation of a hybrid Doppler ultrasound vessel-based registration algorithm for neurosurgery

    PubMed Central

    Chen, Sean Jy-Shyang; Reinertsen, Ingerid; Coupé, Pierrick; Yan, Charles X B; Mercier, Laurence; Del Maestro, D Rolando; Collins, D Louis


    Purpose We describe and validate a novel hybrid non-linear vessel registration algorithm for intraoperative updating of preoperative magnetic resonance (MR) images using Doppler ultrasound (US) images acquired on the dura for the correction of brain-shift and registration inaccuracies. We also introduce an US vessel appearance simulator that generates vessel images similar in appearance to that acquired with US from MR angiography data. Methods Our registration uses the minimum amount of preprocessing to extract vessels from the raw volumetric images. This prevents the removal of important registration information and minimizes the introduction of artifacts that may affect robustness, while reducing the amount of extraneous information in the image to be processed, thus improving the convergence speed of the algorithm. We then completed 3 rounds of validation for our vessel registration method for robustness and accuracy using (i)a large number of synthetic trials generated with our US vessel simulator, (ii)US images acquired from a real physical phantom made from polyvinyl alcohol cryogel (PVAc), and (iii)real clinical data gathered intraoperatively from 3 patients. Results Resulting target registration errors (TRE) of less than 2.5mm are achieved in more than 90% of the synthetic trials when the initial TREs are less than 20mm. TREs of less than 2mm were achieved when the technique was applied to the physical phantom, and TREs of less than 3mm were achieved on clinical data. Conclusions These test trials show that the proposed algorithm is not only accurate but also highly robust to noise and missing vessel segments when working with US images acquired in a wide range of real-world conditions. PMID:22447435

  2. [Not Available].


    San Mauro Martin, Ismael; Mendive Dubourdieu, Paula; Paredes Barato, Víctor; Garicano Vilar, Elena


    Introducción: la tradición de la comida picante desempeña un papel muy importante en el gusto por este tipo de comida y su tolerancia. Las preferencias alimentarias muestran influencia genética y ambiental.Objetivos: estudiar la tolerancia y el gusto por el picante de tres poblaciones, y la influencia hereditaria y del ambiente.Métodos:se realizó una encuesta a 522 sujetos, de tres continentes (Asia, Europa y Latinoamérica) en tres idiomas (español, inglés y chino) a través de Internet. Se realizaron preguntas acerca de la tolerancia al picante, el gusto por los alimentos picantes, su uso, la edad de comienzo de consumo, el gusto del padre y de la madre y si ella lo consumía durante el embarazo y/o lactancia.Resultados: existe diferencia entre el gusto por el picante del hijo y el sexo (p < 0,001), la tolerancia (p < 0,001) y, solo en el sexo femenino, el gusto de la madre por el picante (p < 0,001), su consumo durante el embarazo (p < 0,001) y la lactancia (p = 0,005) y el gusto del padre por el picante (p = 0,003). Existe correlación entre el continente de residencia (p = 0,007) y de nacimiento (p = 0,012) y la tolerancia a los alimentos picantes.Conclusión: la influencia de los progenitores, el género y la composición corporal se relacionaron con gustos y tolerancias diferentes. PMID:27571668

  3. Controlled Vocabulary Service Application for Environmental Data Store

    NASA Astrophysics Data System (ADS)

    Ji, P.; Piasecki, M.; Lovell, R.


    In this paper we present a controlled vocabulary service application for Environmental Data Store (EDS). The purpose for such application is to help researchers and investigators to archive, manage, share, search, and retrieve data efficiently in EDS. The Simple Knowledge Organization System (SKOS) is used in the application for the representation of the controlled vocabularies coming from EDS. The controlled vocabularies of EDS are created by collecting, comparing, choosing and merging controlled vocabularies, taxonomies and ontologies widely used and recognized in geoscience/environmental informatics community, such as Environment ontology (EnvO), Semantic Web for Earth and Environmental Terminology (SWEET) ontology, CUAHSI Hydrologic Ontology and ODM Controlled Vocabulary, National Environmental Methods Index (NEMI), National Water Information System (NWIS) codes, EPSG Geodetic Parameter Data Set, WQX domain value etc. TemaTres, an open-source, web -based thesaurus management package is employed and extended to create and manage controlled vocabularies of EDS in the application. TemaTresView and VisualVocabulary that work well with TemaTres, are also integrated in the application to provide tree view and graphical view of the structure of vocabularies. The Open Source Edition of Virtuoso Universal Server is set up to provide a Web interface to make SPARQL queries against controlled vocabularies hosted on the Environmental Data Store. The replicas of some of the key vocabularies commonly used in the community, are also maintained as part of the application, such as General Multilingual Environmental Thesaurus (GEMET), NetCDF Climate and Forecast (CF) Standard Names, etc.. The application has now been deployed as an elementary and experimental prototype that provides management, search and download controlled vocabularies of EDS under SKOS framework.

  4. Searches for extra-solar Earths with astro-combs, why and how

    NASA Astrophysics Data System (ADS)

    Li, Chih-Hao


    Searches for Earth-like extra-solar planets using the precision radial velocity (PRV) technique requires <10 cm/s accuracy on stellar RVs, which is ˜10 times smaller than the current sensitivity, over several years. Astro-combs, a combination of an octave spanning femtosecond laser and a mode-filtering cavity, provide a promising route to increased accuracy and long-term stability on the astrophysical spectrograph calibration. Here I present several techniques to achieve the required calibration accuracy and our calibration results on the TRES spectrograph for a 1.5-m telescope at the Whipple Observatory.

  5. Cellules solaires photovoltaïques plastiques enjeux et perspectives

    NASA Astrophysics Data System (ADS)

    Sicot, L.; Dumarcher, V.; Raimond, P.; Rosilio, C.; Sentein, C.; Fiorini, C.


    Après avoir détaillé le fonctionnement d'une cellule photovoltaïque plastique et les paramètres photovoltaïques permettant de caractéiser son efficacité, un état de l'art des technologies de fabrication des cellules est présenté. Des moyens d'amélioration des performances des cellules photovoltaïques organiques sont ensuite illustrés par l'étude de dispositifs développés au Laboratoire Composants Organiques (LCO) du CEA Saclay.

  6. Una visita en Sud America

    NASA Astrophysics Data System (ADS)


    Oisfrute de una estadfa en el Hotel La Silla, el mejor hotel de Sud America con su tan unica atmosfera extraterrestre! Los espera su calificado personal de experimentados hoteleros, jefes de cocina, etc., ansiosos todos de satisfacer sus deseos hasta el mas mfnimo detalle. Naturalmente nuestro espacioso restaurant de tres estrellas ofrece un completo surtido de exquisitas comidas y deliciosos tragos (conocedores usualmente eligen "Oelicia Orion" 0 "Centauro Especial"). EI servicio cempleto durante 24 horas incluye nuestra ya mundialmente famosa "Cena de medianoche para los miradores de estrellas", por eso - no olvide: No pierda la oportunidad de una estadfa en EL HOTEL LA SILLA - una experiencia maravillosa!

  7. Les fluctuations supraconductrices dans le compose praseodyme-cerium-oxyde de cuivre

    NASA Astrophysics Data System (ADS)

    Renaud, Jacques

    Ce travail etudie les fluctuations supraconductrices dans le compose supraconducteur a haute temperature critique dope aux electrons Pr2-xCe xCuO4+delta. La technique utilisee pour sonder ces fluctuations est le transport electrique DC dans le plan ab. Il s'agit, a notre connaissance, de la premiere etude de ce type dans la classe generale des supraconducteurs a haute temperature critique dopes aux electrons et, plus particulierement, dans Pr2-xCe xCuO4+delta. De plus, l'etude est effectuee pour trois regimes de dopage, soit sous-dope x = 0.135, dopage optimal x = 0.15 et surdope x = 0.17. Les echantillons etudies sont des couches minces d'epaisseur plus grande que 100 nm crues par ablation laser. Les mesures electriques DC effectuees dans ce travail sont la resistance en reponse lineaire et les courbes IV en reponse non lineaire en fonction de la temperature. La mise en oeuvre experimentale de ces mesures a necessite une grande attention au filtrage et aux effets de chauffage a haut courant. Nous montrons que, sans cette attention, les donnees experimentales sont toujours erronees dans le regime pertinent pour nos echantillons. Les resultats pour le dopage optimal x = 0.15 sont expliques de facon tres convaincante dans le cadre de fluctuations purement 2D. D'abord, le regime des fluctuations gaussiennes est tres bien decrit par le modele d'Aslamazov-Larkin en deux dimensions. Ensuite, le regime de fluctuations critiques, se trouvant a plus basse temperature que le regime gaussien, est tres bien decrit par la physique 2D de Kosterlitz-Thouless. Dans cette analyse, les deux regimes ont des temperatures critiques coherentes entre elles, ce qui semble confirmer ce scenario 2D. Une analyse des donnees dans le cadre de fluctuations 3D est exploree mais donne des conclusions incoherentes. Les resultats pour les autres dopages sont qualitativement equivalents avec le dopage optimal et permettent donc une explication purement 2D. Par contre, contrairement au dopage optimal

  8. Les rivières et les sources de la Plaine du Cul-de-Sac: extrait du rapport sur les eaux souterraines de la Plaine du Cul-de-Sac

    USGS Publications Warehouse

    Taylor, George C., Jr.; Lemoine, Rémy C.


    Les principales rivières de la Plaine du Cul-de-Sac, la Rivière Grise ou Grande Rivière du Cul-de-Sac et la Rivière Blanche, prennent naissance sur le flanc Nord du Massif de la Selle à des altitudes de 1,300 à 1,800 mètres au dessus du niveau de la mer. Elles coulent à l’amont à travers des gorges profondes et sont éloignées de 9 Kms. dans la partie central de la bordure Sud de la plaine.

  9. Polycomb/Trithorax response elements and epigenetic memory of cell identity.


    Ringrose, Leonie; Paro, Renato


    Polycomb/Trithorax group response elements (PRE/TREs) are fascinating chromosomal pieces. Just a few hundred base pairs long, these elements can remember and maintain the active or silent transcriptional state of their associated genes for many cell generations, long after the initial determining activators and repressors have disappeared. Recently, substantial progress has been made towards understanding the nuts and bolts of PRE/TRE function at the molecular level and in experimentally mapping PRE/TRE sites across whole genomes. Here we examine the insights, controversies and new questions that have been generated by this recent flood of data. PMID:17185323

  10. Ground-based near-UV observations of 15 transiting exoplanets: constraints on their atmospheres and no evidence for asymmetrical transits

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Pearson, Kyle A.; Biddle, Lauren I.; Smart, Brianna M.; Zellem, Robert T.; Teske, Johanna K.; Hardegree-Ullman, Kevin K.; Griffith, Caitlin C.; Leiter, Robin M.; Cates, Ian T.; Nieberding, Megan N.; Smith, Carter-Thaxton W.; Thompson, Robert M.; Hofmann, Ryan; Berube, Michael P.; Nguyen, Chi H.; Small, Lindsay C.; Guvenen, Blythe C.; Richardson, Logan; McGraw, Allison; Raphael, Brandon; Crawford, Benjamin E.; Robertson, Amy N.; Tombleson, Ryan; Carleton, Timothy M.; Towner, Allison P. M.; Walker-LaFollette, Amanda M.; Hume, Jeffrey R.; Watson, Zachary T.; Jones, Christen K.; Lichtenberger, Matthew J.; Hoglund, Shelby R.; Cook, Kendall L.; Crossen, Cory A.; Jorgensen, Curtis R.; Romine, James M.; Thompson, Alejandro R.; Villegas, Christian F.; Wilson, Ashley A.; Sanford, Brent; Taylor, Joanna M.; Henz, Triana N.


    Transits of exoplanets observed in the near-UV have been used to study the scattering properties of their atmospheres and possible star-planet interactions. We observed the primary transits of 15 exoplanets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-16b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-12b, WASP-33b, WASP-36b, WASP-44b, WASP-48b, and WASP-77Ab) in the near-UV and several optical photometric bands to update their planetary parameters, ephemerides, search for a wavelength dependence in their transit depths to constrain their atmospheres, and determine if asymmetries are visible in their light curves. Here, we present the first ground-based near-UV light curves for 12 of the targets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-33b, WASP-36b, WASP-48b, and WASP-77Ab). We find that none of the near-UV transits exhibit any non-spherical asymmetries, this result is consistent with recent theoretical predictions by Ben-Jaffel et al. and Turner et al. The multiwavelength photometry indicates a constant transit depth from near-UV to optical wavelengths in 10 targets (suggestive of clouds), and a varying transit depth with wavelength in 5 targets (hinting at Rayleigh or aerosol scattering in their atmospheres). We also present the first detection of a smaller near-UV transit depth than that measured in the optical in WASP-1b and a possible opacity source that can cause such radius variations is currently unknown. WASP-36b also exhibits a smaller near-UV transit depth at 2.6σ. Further observations are encouraged to confirm the transit depth variations seen in this study.

  11. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    PubMed Central

    Morabia, Alfredo


    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico? PMID:25124247

  12. Cooperative development of antimicrobials: looking back to look ahead.


    Nathan, Carl


    As foundations and governments mobilize to tackle antimicrobial resistance (AMR), several experiments in academic-industrial collaboration have emerged. Here, I examine two historical precedents, the Penicillin Project and the Malaria Project of the Second World War, and two contemporary examples, the Tuberculosis Drug Accelerator programme and the Tres Cantos Open Lab. These and related experiments suggest that different strategies can be effective in managing academic-industrial collaborations, and that such joint projects can prosper in both multisite and single-site forms, depending on the specific challenges and goals of each project. The success of these strategies and the crisis of AMR warrant additional investment in similar projects. PMID:26373373

  13. Spatially explicit exposure assessment for small streams in catchments of the orchard growing region `Lake Constance

    NASA Astrophysics Data System (ADS)

    Golla, B.; Bach, M.; Krumpe, J.


    drift values in the authorization procedure for plant protection products, pp. 133-141. In Workshop on risk management and risk mitigation measures in the context of authorization of plant protection products [3] Klein, A. W., Dechet, F., and Streloke, M (2003): Probabilistic Assessment Method for Risk Analysis in the framework of Plant Protection Product Authorisation, Industrieverband Agrar (IVA, 2006), Frankfurt/Main [4] Schulz R, Stehle S, Elsaesser F, Matezki S, Müller A, Neumann M, Ohliger R, Wogram J, Zenker K. 2008. Geodata-based Probabilistic Risk Assessment and Management of Pesticides in Germany, a Conceptual Framework. IEAM_2008-032R [5] Kubiak, R., Hommen, Bach, M., Classen, G. Fent, H.-G. Frede, A. Gergs, B. Golla, M. Klein, J. Krumpe, S. Matetzki, A. Müller, M. Neumann,T. G. Preuss, H. T. Ratte, M. Roß-Nickoll, S. Reichenberger, C. Schäfers, T. Strauss, A. Toschki, M. Trapp, J. Wogram (2009): A new GIS based approach for the assessment and management of environmental risks of plant protection, SETAC EUROPE Göteborg [6] Enzian, S. ,Golla., B. (2006) A method for the identification and classification of "save distance" cropland to the potential drift exposure of pesticides towards surface waters. UBA-Texte [7] Bach, M., Träbing, K. and Frede, H.-G. (2004): Morphological Characteristics of small rivers in the context of probabilistic exposure assessment. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 56

  14. [In Process Citation].


    Reyna, Nadia; Moreno Rojas, Rafael; Mendoza, Laura; Parra, Karla; Linares, Sergia; Reyna, Eduardo; Cámara Martos, Fernando


    Se ha estudiado el índice glicémico, la carga glicémica y el efecto de saciedad producido en adultos jóvenes (12 hombres y 8 mujeres) por el consumo de tres tipos de barritas nutricionales formuladas con proteínas lactoséricas (LS), caseínas (CS) o hidratos de carbono (HC) frente a un control (C). Los valores de glucemia en la sangre a los 30 min fueron significativamente mayores (p < 0,05) para la barra HC (129 ± 8 mg/dl) frente a las barras CS (103 ± 6 mg/dl) y LS (86 ± 8 mg/dl). Asimismo, también se encontraron diferencias estadísticamente significativas (p < 0,05) entre los índices glicémicos de los tres tipos de barras estudiadas (LS = 11,5 ± 3,9; CS = 40,7 ± 6,5; HC = 68,8 ± 13,0). Por otro lado, las barritas nutricionales formuladas con proteínas lácteas (LS y CS) muestran un efecto de saciedad mucho más intenso y prolongado que la formulada con hidratos de carbono (HC), lo que pone de manifiesto el potencial de estas proteínas para ser utilizadas en la formulación de productos para diabéticos y dietéticos. PMID:27238803

  15. Musical structure modulates semantic priming in vocal music.


    Poulin-Charronnat, Bénédicte; Bigand, Emmanuel; Madurell, François; Peereman, Ronald


    It has been shown that harmonic structure may influence the processing of phonemes whatever the extent of participants' musical expertise [Bigand, E., Tillmann, B., Poulin, B., D'Adamo, D. A., & Madurell, F. (2001). The effect of harmonic context on phoneme monitoring in vocal music. Cognition, 81, B11-B20]. The present study goes a step further by investigating how musical harmony may potentially interfere with the processing of words in vocal music. Eight-chord sung sentences were presented, their last word being either semantically related (La girafe a un tres grand cou, The giraffe has a very long neck) or unrelated to the previous linguistic context (La girafe a un tres grand pied, The giraffe has a very long foot). The target word was sung on a chord that acted either as a referential tonic chord or as a congruent but less referential subdominant chord. Participants performed a lexical decision task on the target word. A significant interaction was observed between semantic and harmonic relatedness suggesting that music modulates semantic priming in vocal music. Following Jones' dynamic attention theory, we argue that music can modulate semantic priming in vocal music, by modifying the allocation of attentional resource necessary for linguistic computation. PMID:15617668

  16. Helminth communities of two species of piscivorous birds, Ardea alba (Linnaeus) and Nyctanassa violacea (Gmelin) (Ciconiiformes: Ardeidae), in two coastal lagoons from Guerrero state, Mexico.


    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín A; Flores-Rodríguez, Pedro


    The composition and species richness in helminth communities of two species of heron, Ardea alba and Nyctanassa violacea, in two coastal lagoons from Guerrero, Mexico were examined. Nineteen species of helminth (7,804 individuals) were identified in 43 adult birds: 15 digeneans, 1 acanthocephalan, 1 cestode, and 2 nematodes. Eight species co-occurred in herons of both species and lagoons. The prevalence values of seven species and the mean abundance of five species varied significantly between species of birds and between lagoons. The heterophyid, Ascocotyle (Phagicola) longa, was the helminth numerically dominant in the helminth community of A. alba in both lagoons, while the cestode, Parvitaenia cochlearii, dominated the community of N. violacea. At the component community level, species richness varied significantly: 10 species in A. alba from Coyuca to 16 in N. violacea (Tres Palos). All of the birds examined were infected with helminth parasites: three to seven species per host in A. alba from Coyuca, and two to eight species in A. alba and N. violacea from Tres Palos. The results indicate that even though species composition was similar between both species of heron, the structure of their communities was not the same. Differences in the feeding behavior of the birds (day/night habits), as well as local differences in the abundance of species of fish, and infection levels of helminths in each lagoon are suggested as being responsible for the variations registered in the structure of the helminth communities. PMID:22314783

  17. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie


    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384


    SciTech Connect

    Knutson, Heather A.; Howard, Andrew W.; Isaacson, Howard


    We present evidence for a correlation between the observed properties of hot Jupiter emission spectra and the activity levels of the host stars measured using Ca II H and K emission lines. We find that planets with dayside emission spectra that are well-described by standard one-dimensional atmosphere models with water in absorption (HD 189733, TrES-1, TrES-3, WASP-4) orbit chromospherically active stars, while planets with emission spectra that are consistent with the presence of a strong high-altitude temperature inversion and water in emission orbit quieter stars. We estimate that active G and K stars have Lyman {alpha} fluxes that are typically a factor of 4-7 times higher than quiet stars with analogous spectral types and propose that the increased UV flux received by planets orbiting active stars destroys the compounds responsible for the formation of the observed temperature inversions. In this paper, we also derive a model-independent method for differentiating between these two atmosphere types using the secondary eclipse depths measured in the 3.6 and 4.5 {mu}m bands on the Spitzer Space Telescope and argue that the observed correlation is independent of the inverted/non-inverted paradigm for classifying hot Jupiter atmospheres.

  19. Múltiples estados de desorden en el etanol sólido

    NASA Astrophysics Data System (ADS)

    Fernández-Perea, R.

    El diagrama de fases del etanol por debajo de los 169 K será presentado. Se mostrará que el etanol puede solidificarse en tres fases con diversos niveles de desorden,(como un vidrio(G), como un vidrio orientacional (OG) y como un cristal de fase rotora (RP)) además de en una fase totalmente cristalina. Las estructuras de estas tres fases serán presentadas tal y como se deducen a partir de diversas medidas de difracción de neutrones al igual que las proporciones de los isómeros de dicho material en las fases desordenadas y se compararán con los resultados de la fase cristalina y del líquido superenfriado. Igualmente diversas medidas sobre su dinámica serán presentadas, tanto de dispersión de neutrones, como de capacidad calorífica y de medidas dieléctricas y comparadas con modelos teóricos y simulaciones para tratar de explicar los procesos de relajación observados y las transiciones entre las diversas fases.

  20. Estudio ab initio del mecanismo de la reacción HSO + O3

    NASA Astrophysics Data System (ADS)

    Nebot Gil, I.

    La reacción entre el radical HSO y el ozono ha sido ampliamente estudiada desde el punto de vista experimental debido a la importancia que tiene el radical HSO en la oxidación de los compuestos de azufre reductores y a que puede contribuir a la producción de H2SO4 [1-4]. Se realizaron diversos estudios teóricos sobre la cinética de la reacción entre el radical HSO y el ozono. La reacción del HSO con el ozono presenta tres canales diferentes : HSO + O3 &rightarrow &HSO2 + O2 &rightarrow &HS + 2 O2 &rightarrow &SO + OH + O2 La controversia existente entre los grupos experimentales sobre cuál de las tres vías es la predominante, se ha resuelto mediante un estudio teórico de todas ellas utilizando métodos ab initio. La estructura de todos los reactivos, productos, intermedios y estados de transición ha sido optimizada a nivel ab initio utilizando los métodos UMP2 /6-31G** y QCISD/6-31G**.

  1. Origin of the DUPAL anomaly in mantle xenoliths of Patagonia (Argentina) and geodynamic consequences

    NASA Astrophysics Data System (ADS)

    Mazzucchelli, Maurizio; Cipriani, Anna; Hémond, Christophe; Zanetti, Alberto; Bertotto, Gustavo Walter; Cingolani, Carlos Alberto


    The sub-continental lithospheric mantle of South America has been known for some time to carry the DUPAL isotope anomaly as seen in volcanics from the Paraná volcanic province. However, this has not allowed discriminating whether the DUPAL anomaly is a primary feature of the mantle source or acquired during the upwelling and emplacement of the primary magmas. We discovered mantle xenoliths from the Tres Lagos location in Patagonia that carry evidence of percolation by metasomatic melts that imparted the DUPAL isotope anomaly signature. We discuss a model that requires four isotope components (LCC, EM2, HIMU and DM) to account for the Sr, Nd and Pb isotope variability of our samples. We propose that upwelling of hot astenosphere during the Miocene could have triggered the melting of the LCC and EM2 components carrying the DUPAL anomaly, previously entrained in the subcontinental mantle by subduction. These ascending melts would have then metasomatised the local SCLM characterised by DMM and HIMU geochemical affinity generating the hybrid DUPAL-bearing mantle sampled by the Tres Lagos xenoliths.

  2. Neogene stratigraphy, foraminifera, diatoms, and depositional history of Maria Madre Island, Mexico: Evidence of early Neogene marine conditions in the southern Gulf of California

    USGS Publications Warehouse

    McCloy, C.; Ingle, J.C.; Barron, J.A.


    Foraminifera and diatoms have been analyzed from an upper Miocene through Pleistocene(?) sequence of marine sediments exposed on Maria Madre Island, largest of the Tre??s Marias Islands off the Pacific coast of Mexico. The Neogene stratigraphic sequence exposed on Maria Madre Island includes a mid-Miocene(?) non-marine and/or shallow marine sandstone unconformably overlain by a lower upper Miocene to uppermost Miocene upper to middle bathyal laminated and massive diatomite, mudstone, and siltstone unit. This unit is unconformably overlain by lower Pliocene middle to lower bathyal sandstones and siltstones which, in turn, are unconformably overlain by upper Pliocene through Pleistocene(?) upper bathyal to upper middle bathyal foraminiferal limestones and siltstones. These beds are unconformably capped by Pleistocene terrace deposits. Basement rocks on the island include Cretaceous granite and granodiorite, and Tertiary(?) andesites and rhyolites. The upper Miocene diatomaceous unit contains a low diversity foraminiferal fauna dominated by species of Bolivina indicating low oxygen conditions in the proto-Gulf Maria Madre basin. The diatomaceous unit grades into a mudstone that contains a latest Miocene upper to middle bathyal biofacies characterized by Baggina californica and Uvigerina hootsi along with displaced neritic taxa. An angular unconformity separates the upper Miocene middle bathyal sediments from overlying lower Pliocene siltstones and mudstones that contain a middle to lower bathyal biofacies and abundant planktonic species including Neogloboquadrina acostaensis and Pulleniatina primalis indicating an early Pliocene age. Significantly, this Pliocene unit contains common occurrences of benthic species restricted to Miocene sediments in California including Bulimina uvigerinaformis. Pliocene to Pleistocene(?) foraminiferal limestones and siltstones characterize submarine bank accumulations formed during uplift of the Tre??s Marias Island area, and include

  3. Characterizing the Atmospheres of Super-Earths and Hot-Jupiters with Narrow-Band Photometry

    NASA Astrophysics Data System (ADS)

    Colon, Knicole D.; Gaidos, E.; Wilson, P. A.; Ford, E. B.; Sing, D. K.; Ballester, G. E.; Desert, J.; Ehrenreich, D.; Fortney, J. J.; Lecavelier des Etangs, A.; Lopez-Morales, M.; Morley, C.; Pettitt, A.; Pont, F.; Vidal-Madjar, A.


    Nearly one thousand extrasolar planets have been discovered, but none are considered true analogs to solar system planets. Instead, we characterize some planets as “super-Earths” or “hot-Jupiters.” It has been possible to characterize the atmospheres of some of these planets via transit observations, which is a crucial stepping stone towards future studies of true solar system analogs. We present narrow-band photometry of several transiting planets, including the super-Earth GJ 1214b and the hot-Jupiters XO-2b and TrES-2b. For GJ 1214b, most studies find that the transmission spectrum is flat, which favors either a high mean molecular weight or cloudy/hazy hydrogen (H) rich atmosphere model. We observed seven transits of GJ 1214b through a narrow K-band (2.141 micron) filter with the Wide Field Camera on the 3.8 meter United Kingdom Infrared Telescope. We observed another five transits at 800-900 nm using tunable filters with the Optical System for Imaging and low Resolution Integrated Spectroscopy (OSIRIS) on the 10.4 meter Gran Telescopio Canarias (GTC). Our observations support a flat transmission spectrum for GJ 1214b, but we also find that a hydrogen-dominated upper atmosphere cannot be excluded. For hot-Jupiters, potassium has been predicted to be one of the strongest sources of opacity at optical wavelengths and has been previously detected in the atmospheres of XO-2b and TrES-2b. Using OSIRIS on the GTC, we observed three transits of XO-2b and two transits of TrES-2b in multiple bandpasses around the potassium absorption feature at 770 nm. Our technique is somewhat different than in previous studies, and we use our observations to constrain the amount of potassium in these exoplanet atmospheres. We consider how our studies set the stage for future investigations of true Earth and Jupiter analogs that have not yet been discovered.

  4. Sensitized luminescence from water-soluble LaF3:Eu nanocrystals via partially-capped 1,10-phenanthroline: time-gated emission and multiple lifetimes.


    Irfanullah, Mir; Bhardwaj, Navneet; Chowdhury, Arindam


    Water dispersible citrate-capped LaF3:Eu(5%) nanocrystals (NCs) have been partially surface-functionalized by 1,10-phenanthroline (phen) via a ligand exchange method to produce novel water dispersed citrate/phen-capped LaF3:Eu(5%) NCs in which citrate ligands preserve the water dispersibility of the NCs and phen ligands act as sensitizers of surface Eu(3+)-dopant sites. The partial ligand exchange and the formation of water dispersed NCs have been monitored by (1)H NMR spectroscopy, as well as luminescence measurements at different time intervals during the reaction. These NCs display a distinct phen-sensitized Eu(3+)-emission profile with enhanced intensity in water as compared to the emission profile and intensity obtained upon direct excitation. Time-resolved (or time-gated) emission spectroscopy (TRES) has been used to probe PL dynamics of Eu(3+)-sites of LaF3:Eu(5%) NCs by taking advantage of selectively sensitizing surface Eu(3+)-dopant sites by phen ligands as well as by exciting all the Eu(3+)-sites in the NCs upon direct excitation. TRES upon direct excitation of the citrate-capped LaF3:Eu(5%) NCs reveals that Eu(3+)-dopants occupy at least three different sites, each with a different emission profile and lifetime, and emission from purely interior Eu(3+)-sites has been resolved due to their long lifetime as compared to the lifetime of purely surface and near surface Eu(3+)-sites. In contrast, the phen-sensitized emission from citrate/phen-capped LaF3:Eu(5%) NCs displays similar emission profiles and lifetimes in TRES measurements, which reveal that phen truly sensitizes purely surface dopant sites of the NCs in water, all of which have nearly the same local environment. The phen-sensitized Eu(3+)-emission of the NCs in water remains stable even upon addition of various buffer solutions at physiological pH, as well as upon addition of water-miscible organic solvents. Furthermore, the two-photon excitation (λex. = 720 nm) of these water-soluble phen

  5. Use of IPA to demonstrate loss of forest interior birds from isolated woodlots

    USGS Publications Warehouse

    Robbins, C.S.; Boone, D.D.


    'Empleo de indices puntuales de abundancia (IPA) para demostrar la perdida de aves forestales en bosques aislados'. En Maryland, E.U., se seleccionaron bloques boscosos de diferente superficie, divididos en seis clase de tamano (2,8-6 ha, 7-14, 20-30, 34-80, 105-1300, mayores de 4000 ha). En estas ?islas' forestales fue programado un conjunto de muestreos puntuales con estas caracteristicas: 1) Cada punto se visito tres veces. 2) En cada visita se hicieron cuatro censos consecutivos de 5 minutos de duracion, empleando diferentes simbolos para machos cantores, adultos no cantores, aves en vuelo y aves inmaduras. 3) Los conteos se hicieron en tres epocas: final de Mayo, mitad de Junio y final de Junio. 4) Se dividio el tiempo de censo en tres priodos horarios: 5,15-6,30 ; 6,30-8; 8-9,30 hrs. 5) Los puntos se agruparon en co juntos de 4 a 9, considerando que un conjunto es el nlimero que un observador puede cubrir por manana. 6) La vegetacion fue descrita exhaustivamente en cuanto composicion y fisionomla. El principal objetivo que se busca consiste en conocer los requisitos areales de ciertas especies de bosque muy sensibles a la fragmentacion del habitat. Puede observarse (Figura 1) que una serie de migrantes de largo alcance se asientan en relacion con el aumento de la superficie del rodal arbo1ado, sabre todo en macizos de 4.000 o mas hectareas. Sin embargo, las especies sedentarias (Fig. 2) tienen pauta de presencia irregular en funcion del area, forestal, con tendencia a presentarse menos en los bosques mas extensos, Dryocopus pileatus, por excepcion, reacciona negativamente al pequeno tamano de la parcela arbolado, prefiriendo bosques grandes. Parecida respuesta da tambien Sitta carolinensis. Aunque se sabe poco de las exigencias areales de las aves forestales americanas, el metodo de los IPA resulta muy adecuado para esta clase de investigacion de tanto interes en gestion ambiental, posibilitando colectar gran cantidad de datos comparables en un periodo de

  6. Revision curricular a partir de un analisis comparativo de las discrepancias en los curriculos de una escuela de optometria en Puerto Rico con las competencias requeridas para las agencias de revalida y acreditacion 2004

    NASA Astrophysics Data System (ADS)

    Rivera Pacheco, Andres

    El proposito de esta investigacion, un estudio cualitativo de caso, fue comparar y contrastar el curriculo vigente de la Escuela de Optometria de la UIAPR con las competencias y estandares requeridos por las agencias de acreditacion y de revalida. Con este proposito, decidimos realizar una revision y un analisis de documentos: el prontuario de cada uno de los cursos de los curriculos implantados en el 1993 y en el 2001; las competencias y estandares establecidos por las agencias de revalida y de acreditacion; y las estadisticas en las que se analiza el porcentaje de estudiantes que aprueban cada una de las partes de los examenes de revalida entre el 1998 al 2003. Se realizaron entrevistas dirigidas para dar apoyo y complementar la revision y el analisis de estos documentos. Los participantes de las entrevistas fueron tres estudiantes de la clase de optometria del 2004 (ultima clase del curriculo del 1993); tres estudiantes de la clase de optometria del 2005 (primera clase graduanda del curriculo vigente) y tres profesores y/o directores de los Departamentos de Ciencias Basicas, Ciencias Clinicas y Cuidado al Paciente. Esta investigacion se enmarco en el modelo de evaluacion curricular de discrepancia de Malcolm Provus y en el modelo de desarrollo basado en competencias. Uno de los hallazgos mas importantes del estudio es que los cambios que se implantaron al curriculo del 2001 no han logrado que los estudiantes mejoren su ejecucion en los examenes de revalida. Por otro lado, se encontro que el curriculo vigente atiende completamente los estandares de la practica de Optometria, pero no las competencias. Esta informacion fue validada mediante el uso de una tabla de cotejo para el analisis de los cursos y de la informacion obtenida de las entrevistas. El estudio determina y concluye que existen discrepancias entre los prontuarios de los cursos del curriculo y las competencias requeridas por la agencia de revalida. Segundo, que el Departamento de Ciencias Basicas es el

  7. Astro-comb calibration of an Echelle Spectrograph

    NASA Astrophysics Data System (ADS)

    Li, C.-H.; Phillips, D. F.; Glenday, A. G.; Benedick, A. J.; Chang, G.; Chen, L.-J.; Cramer, C.; Furesz, G.; Kärtner, F. X.; Sasselov, D.; Szentgyorgyi, A.; Walsworth, R. L.


    We describe recent work calibrating a cross-dispersed spectrograph with an "astro-comb" i.e., a high repetition rate, octave spanning femtosecond laser frequency comb; and a filter cavity suppressing laser modes to match the resolution of the spectrograph. Our astro-comb provides ~1500 evenly spaced (~0.6 A) calibration lines of roughly 100 nW per line between 7800 and 8800 Angstroms. The calibration lines of the laser are stabilized to atomic clocks which can be referenced to GPS providing intrinsic stability of the source laser below 1 cm/s in stellar radial velocity sensitivity, as well as long term stability and reproducibility over years. We present calibration of the TRES spectrograph at the 1.5 m telescope at the Fred L Whipple Observatory below 1 m/s radial velocity sensitivity in six orders from 7800-8800 A.

  8. Statistique des photons d'un laser à 4 niveaux soumis à un pompage optique

    NASA Astrophysics Data System (ADS)

    Chusseau, L.; Arnaud, J.; Philippe, F.


    Les lasers conventionnels à 4 niveaux peuvent délivrer de la lumière de statistique sous-Poissonienne même lorsqu'ils sont soumis à un pompage optique. Nous retrouvons exactement ces prédictions de l'optique quantique en supposant simplement que les atomes ont des niveaux d'énergie quantifiés interagissant avec un champ électromagnétique classique, la source du bruit optique étant les sauts quantiques entre niveaux. Des formules analytiques sont obtenues pour les deux paramètres clefs de la statistique des photons du laser: le facteur de Fano et la densité spectrale des photons émis.

  9. Vers une méthode de réglage expérimentale des commandes PID floues : application aux systèmes électromécaniques

    NASA Astrophysics Data System (ADS)

    Maussion, P.; Hissel, D.


    Electrical and electromechanical systems have to satisfy to more and more constrained specifications. Therefore, non-linear control structures must be spread out. Among them, fuzzy logic control can be one interessant and performant alternative. The main handicap of this kind of stucture resides in the fact that the tuning parameters are very numerous. In this paper, we first propose an on-site tuning strategy of this set of parameters in the case of a fuzzy proportionnal-integrative controller based on the experimental designs methodology and on a limited number of pre-defined closed-loop experiments. Then, a complete set of predetermined parameters for a fuzzy proportionnal-integrative-derivative controller will be given. These parameters have been optimized on a specified benchmark according to an IAE criterion. They are calculated like the Ziegler-Nichols or Broïda methodology on conventional controllers; that is, using a single open-loop step response to obtain a model of a first-order plus delay transfert function. Validity limits for this method are provided. Les systèmes électriques ou électromécaniques doivent satisfaire à des spécifications de plus en plus contraignantes qui nécessitent la mise au point de structures de commande non linéaires. Parmi celles-ci, la commande par logique floue constitue une alternative intéressante et performante. Son principal handicap réside dans le nombre très important de paramètres à régler. Dans cet article, nous nous proposons de systématiser ces réglages dans deux cas de figure. Tout d'abord nous utiliserons la méthodologie des plans d'expérimentations pour effectuer un réglage sur site d'un contrôleur flou de type proportionnel-intégral. Ce réglage sera obtenu en ne réalisant qu'un nombre limité d'essais expérimentaux en boucle fermée avec des combinaisons prédéfinies des paramètres à régler. La combinaison optimale de ces paramètres au sens d'un critère de type IAE (Intégrale de la

  10. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica

    SciTech Connect

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, T. B. K.; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed; Baeshen, Nabih; Kyrpides, Nikos; Reeve, Wayne


    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project proposal.

  11. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica


    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, T. B. K.; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed; Baeshen, Nabih; et al


    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Rootmore » Nodule Bacteria (GEBA-RNB) project proposal.« less

  12. Effet de la substitution du cuivre par du lithium sur les proprietes de l'oxyde spinelle lithium(x)cuivre(y-x)cobalt(3-y)oxygen(4) etudie pour l'electrocatalyse de la reaction de degagement de l'oxygene en milieu alcalin

    NASA Astrophysics Data System (ADS)

    Fatih, Khalid

    L'electrolyse de l'eau demeure la seule technologie industrielle de generation de l'hydrogene et de l'oxygene tres purs sans rejet de CO2 dans l'atmosphere, ce qui le rend tres attrayant par rapport a la combustion de carburants fossiles qui provoque presentement de serieux problemes environnementaux. Dans le but d'ameliorer le rendement de ce procede, nous avons developpe de nouveaux materiaux d'anode peu couteux, a base de l'oxyde mixte CuyCo3-yO 4, qui possedent une cinetique rapide pour la reaction de degagement de l'oxygene (RDO). Cette reaction suscite un interet particulier en raison de la surtension d'activation relativement elevee a l'anode qui cause la principale perte de rendement du procede. Une etude systematique a ete effectuee sur la substitution du Cu par du Li (0 a 40%), afin d'elucider les proprietes electrocatalytiques des oxydes LixCuy-xCo3-yO4. Ces oxydes, prepares sous forme de poudres par decomposition thermique des nitrates precurseurs entre 300 et 500°C, ont montre (DRX et FTIR) une structure spinelle inverse non-stcechiometrique avec une diminution du volume de la maille cristalline. La surface specifique par BET est d'environ 6 m2 g-1. Le pcn, obtenu par titrage acido-basique, a indique une diminution de la force du lien M-OH avec le taux du Li dans l'oxyde. Les analyses par XPS, realisees sur des films d'oxyde prepares par nebulisation reactive sur un substrat lisse de nickel, revelent un enrichissement de la surface en Cu a partir de 30% Li, et la presence des cations de surface Co2+, Co3+, Cu +, Cu2+ et Cu3+. La concentration de ce dernier montre un maximum a 10 et 20% Li. Suite a la substitution du Cu par du Li, la compensation de la charge serait assuree principalement par la formation d'especes Cu3+ pour les oxydes contenant jusqu'a 20% Li, et par la formation d'especes Co3+ aux taux de substitution superieurs. Les micrographies MEB montrent une morphologie hemispherique des particules d'oxyde reparties uniformement sur le substrat

  13. Use of LANDSAT images to study cerrado vegetation. [Mato Grosso Sul, Brazil

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Filho, P. H.


    Channel 5 and 7 LANDSAT imagery at the scale of 1:250,000 made during passes in the dry and rainy seasons were used to select the optimal season for cerrado characterization in Mato Grosso do Sul State. The study area is located around the cities of Campo Grande and Tres Lagoas, a region being used for reforestation and rangeland activities. Imagery acquired during the dry season permitted a good discrimination between "cerrado" (woodsy pasture) vegetation and reforestation. In relation to the altered areas, only the recently modified area presented good discrimination of cerrado vegetation. Imagery of the rainy season did not provide a reasonable separation between cerrado and reforestation areas but the altered area could be easily discriminated.

  14. Release of 50 new, drug-like compounds and their computational target predictions for open source anti-tubercular drug discovery

    PubMed Central

    Rebollo-Lopez, María Jose; Lelièvre, Joël; Alvarez-Gomez, Daniel; Castro-Pichel, Julia; Martínez-Jiménez, Francisco; Papadatos, George; Kumar, Vinod; Colmenarejo, Gonzalo; Mugumbate, Grace; Hurle, Mark; Barroso, Vanessa; Young, Rob J.; Martinez-Hoyos, María; González del Río, Rubén; Bates, Robert H.; Lopez-Roman, Eva Maria; Mendoza-Losana, Alfonso; Brown, James R.; Alvarez-Ruiz, Emilio; Marti-Renom, Marc A.; Overington, John P.; Cammack, Nicholas; Ballell, Lluís; Barros-Aguire, David


    As a follow up to the antimycobacterial screening exercise and the release of GSK´s first Tres Cantos Antimycobacterial Set (TCAMS-TB), this paper presents the results of a second antitubercular screening effort of two hundred and fifty thousand compounds recently added to the GSK collection. The compounds were further prioritized based on not only antitubercular potency but also on physicochemical characteristics. The 50 most attractive compounds were then progressed for evaluation in three different predictive computational biology algorithms based on structural similarity or GSK historical biological assay data in order to determine their possible mechanisms of action. This effort has resulted in the identification of novel compounds and their hypothesized targets that will hopefully fuel future TB drug discovery and target validation programs alike. PMID:26642067

  15. Field based analysis of sediment entrainment in two high gradient streams located in Alpine and Andine environments

    NASA Astrophysics Data System (ADS)

    Mao, Luca; Uyttendaele, Geertrui Paula; Iroumé, Andrés; Lenzi, Mario Aristide


    This paper presents an analysis of critical thresholds for bedload transport based on field measurements conducted in two small, high gradient streams: the Rio Cordon (Italian Alps) and the Tres Arroyos (Chilean Andes). The threshold of incipient motion was identified by using marked particles displacement and both flood and flow competence approaches. The findings are expressed in terms of Shields parameter, dimensionless discharge, and specific stream power, and are used to identify the effects of relative grain size, relative depth, and bedform resistance. Overall, particle entrainment tends to be size selective, rather than exhibiting equal mobility, and the high values of dimensionless critical shear stress observed at both study sites confirm the additional roughness effects of step-pool morphologies that are very effective in reducing the bed shear stress and causing an apparent increase in critical shear stress.

  16. Vegetation ecological restoration during geothermic exploratory perforation: A case study in Mexico

    SciTech Connect

    Ortega-Rubio, A.; Salinas, F.; Naranjo, A.


    At Las Tres Virgenes, B.C.S., Mexico developed the Geothermic exploratory drilling of the area. One of the main recommendations of our Environmental Impact Assessment Study includes transplantation of the plant individuals found in the zones of roads and drilling platforms. In this work we describe the methodologies used to transplant the vegetal individuals found in such zones. We listed the species selected and the survivorship rate obtained for every one of them. From a total of 4,266 transplanted individuals, including many endemic species, a total of 2349 survived. Members of the Agavaceae and Cactaceae families show the maximum survivorship rate, meanwhile the members of the Burseraceae, Euphorbiaceae and Fouqueriaceae families exhibited the minimum survivorship rate (between 12.7% and 20%).

  17. The quest for mammalian Polycomb response elements: are we there yet?


    Bauer, Moritz; Trupke, Johanna; Ringrose, Leonie


    A long-standing mystery in the field of Polycomb and Trithorax regulation is how these proteins, which are highly conserved between flies and mammals, can regulate several hundred equally highly conserved target genes, but recognise these targets via cis-regulatory elements that appear to show no conservation in their DNA sequence. These elements, termed Polycomb/Trithorax response elements (PRE/TREs or PREs), are relatively well characterised in flies, but their mammalian counterparts have proved to be extremely difficult to identify. Recent progress in this endeavour has generated a wealth of data and raised several intriguing questions. Here, we ask why and to what extent mammalian PREs are so different to those of the fly. We review recent advances, evaluate current models and identify open questions in the quest for mammalian PREs. PMID:26453572

  18. Banderas Rift Zone: A plausible NW limit of the Jalisco Block

    NASA Astrophysics Data System (ADS)

    Alvarez, Román


    Echo soundings recently made in Bahía de Banderas show that this region is a graben with steeply dipping walls and several basins; it is the offshore continuation of the Valle de Banderas graben, and of a branching rift (Río Ameca rift) originating in the Tepic-Zacoalco rift zone. The general trend of the three structures is ENE with some NE trending offsets, and they have a total length of 150 km; this Banderas Rift Zone is proposed as the NW limit of the Jalisco block. The existence of this limit suggests that there is another platelet, or block, between the Jalisco block and a portion of the Rivera plate, probably bounded by the Tres Marías escarpment, the Jalisco block and the North America plate.

  19. TeV blazars as seen by the CAT telescope

    NASA Astrophysics Data System (ADS)

    Piron, Frederic; CAT Collaboration


    Les blazars de type Lacertide sont des noyaux actifs de galaxies possedant un jet relativiste de matiere dirige vers la Terre. L'emis- sion de ce jet, amplifiee par effet Doppler, domine celle de l'objet central sur un large domaine en energie, avec des variations parfois tres courtes dans le repere de l'observateur. Les resultats d'observation par C.A.T. de Lacertides extremes seront presentes. L'etude de leur emission au TeV, et de sa corre- lation avec celle observee dans le domaine des rayons X, permet de sonder les mecanismes d'acceleration a l'oeuvre dans les jets, dans l'environnement proche du trou noir central.

  20. Novel 2-Phenoxyanilide Congeners Derived from a Hit Structure of the TCAMS: Synthesis and Evaluation of Their in Vitro Activity against Plasmodium falciparum.


    Weidner, Thomas; Nasereddin, Abed; Preu, Lutz; Grünefeld, Johann; Dzikowski, Ron; Kunick, Conrad


    The Tres Cantos Antimalarial Compound Set (TCAMS) is a publicly available compound library which contains 13533 hit structures with confirmed activity against Plasmodium falciparum, the infective agent responsible for malaria tropica. The TCAMS provides a variety of starting points for the investigation of new antiplasmodial drug leads. One of the promising compounds is TCMDC-137332, which seemed to be a good starting point due to its antiplasmodial potency and its predicted physicochemical properties. Several new analogues based on a 2-phenoxyanilide scaffold were synthesized by standard amide coupling reactions and were fully characterized regarding their identity and purity by spectroscopic and chromatographic methods. Furthermore, the results of the biological evaluation of all congeners against Plasmodium falciparum NF54 strains are presented. The findings of our in vitro screening could not confirm the presumed nanomolar antiplasmodial activity of TCMDC-137332 and its derivatives. PMID:26901174

  1. Formación estelar en NGC 6357: viendo a través del polvo con Gemini

    NASA Astrophysics Data System (ADS)

    Bosch, G.; Morrell, N.; Barbá, R.

    Presentamos aquí los primeros resultados de fotometría JHKs obtenidos con Flamingos I en el telescopio Gemini Sur. El mosaico comprendido por tres posiciones adyacentes tomadas a lo largo de varios semestres nos permite caracterizar la población estelar en la zona que presenta una interacción más importante entre las estrellas masivas y la nube molecular que les dió origen. Los diagramas color-magnitud nos permiten identificar numerosas fuentes con exceso infrarrojo, la mayoría de ellas imposible de detectarse en el rango óptico debido a la fuerte absorción del polvo presente en la región. Es altamente probable que la mayoría de estas fuentes con exceso sean protoestrellas, aunque es necesario realizar espectroscopía infrarroja de las mismas para confirmar su naturaleza.

  2. Nuevos fenómenos en erupciones cometarias

    NASA Astrophysics Data System (ADS)

    Silva, A.

    Se discuten aquí tres procesos físicos novedosos encontrados en la actividad de cometas: 1) El rol de una distribución de granos de hielo como fuente extendida de H2O en la coma, 2) El efecto de una discontinuidad en el plasma cometario, llamada Cometopausa, sobre la excitación del radical OH , y 3) La actividad por erupciones a grandes distancias heliocéntricas (r > 5 AU). Con respecto a 1) y 2), se presentan modelos que ajustan bien con las observaciones. En cuanto a 3), se presentan explicaciones posibles al fenómeno, y se trata el interesante caso de Chirón 2060, basándose en observaciones propias tomadas desde el CASLEO y datos anteriores.


    SciTech Connect

    Batygin, Konstantin; Stevenson, David J.


    We present a new, magnetohydrodynamic mechanism for inflation of close-in giant extrasolar planets. The idea behind the mechanism is that current, which is induced through interaction of atmospheric winds and the planetary magnetic field, results in significant Ohmic dissipation of energy in the interior. We develop an analytical model for computation of interior Ohmic dissipation, with a simplified treatment of the atmosphere. We apply our model to HD209458b, Tres-4b, and HD189733b. With conservative assumptions for wind speed and field strength, our model predicts a generated power that appears to be large enough to maintain the transit radii, opening an unexplored avenue toward solving a decade-old puzzle of extrasolar gas giant radius anomalies.

  4. Evaluation of aminohydantoins as a novel class of antimalarial agents.


    Meyers, Marvin J; Tortorella, Micky D; Xu, Jing; Qin, Limei; He, Zhengxiang; Lang, Xingfen; Zeng, Wentian; Xu, Wanwan; Qin, Li; Prinsen, Michael J; Sverdrup, Francis M; Eickhoff, Christopher S; Griggs, David W; Oliva, Jonathan; Ruminski, Peter G; Jacobsen, E Jon; Campbell, Mary A; Wood, David C; Goldberg, Daniel E; Liu, Xiaorong; Lu, Yongzhi; Lu, Xin; Tu, Zhengchao; Lu, Xiaoyun; Ding, Ke; Chen, Xiaoping


    Given the threat of drug resistance, there is an acute need for new classes of antimalarial agents that act via a unique mechanism of action relative to currently used drugs. We have identified a set of druglike compounds within the Tres Cantos Anti-Malarial Set (TCAMS) which likely act via inhibition of a Plasmodium aspartic protease. Structure-activity relationship analysis and optimization of these aminohydantoins demonstrate that these compounds are potent nanomolar inhibitors of the Plasmodium aspartic proteases PM-II and PM-IV and likely one or more other Plasmodium aspartic proteases. Incorporation of a bulky group, such as a cyclohexyl group, on the aminohydantion N-3 position gives enhanced antimalarial potency while reducing inhibition of human aspartic proteases such as BACE. We have identified compound 8p (CWHM-117) as a promising lead for optimization as an antimalarial drug with a low molecular weight, modest lipophilicity, oral bioavailability, and in vivo antimalarial activity in mice. PMID:24900778

  5. Sistema Planeta-Satélite. Simulación orbital y potenciales gravitatorios

    NASA Astrophysics Data System (ADS)

    Medina, C.; Carrillo, M.

    Se presenta un programa (desarrollado en Quick Basic 4.5) que simula, en tres dimensiones, el movimiento orbital de un satélite (o luna) alrededor de un planeta, al tiempo que calcula y grafica, en un plano, el potencial gravitatorio del sistema en función de la distancia al planeta. Para la simulación orbital, se emplea la matriz de transformación entre el sistema del planeta y el plano orbital. Para el cálculo y graficación del potencial se aplica un desarrollo en serie hasta el segundo orden, que da cuenta del efecto de achatamiento de los polos, en caso de que éste exista. Las longitudes de los ejes del planeta, la masa de éste y del satélite, sus tamaños aparentes, y los parámetros orbitales son introducidos por el usuario.

  6. Tiempo para un cambio

    NASA Astrophysics Data System (ADS)

    Woltjer, L.


    En la reunion celebrada en diciembre dei ano pasado informe al Consejo de mi deseo de terminar mi contrato como Director General de la ESO una vez que fuera aprobado el proyecto dei VLT, que se espera sucedera hacia fines de este aAo. Cuando fue renovada mi designacion hace tres aAos, el Consejo conocia mi intencion de no completar los cinco aAos dei contrato debido a mi deseo de disponer de mas tiempo para otras actividades. Ahora, una vez terminada la fase preparatoria para el VLT, Y habiendose presentado el proyecto formalmente al Consejo el dia 31 de marzo, y esperando su muy probable aprobacion antes dei termino de este ano, me parece que el 10 de enero de 1988 presenta una excelente fecha para que se produzca un cambio en la administracion de la ESO.

  7. Differential Roles of C-terminal Eps15 Homology Domain Proteins as Vesiculators and Tubulators of Recycling Endosomes*

    PubMed Central

    Cai, Bishuang; Giridharan, Sai Srinivas Panapakkam; Zhang, Jing; Saxena, Sugandha; Bahl, Kriti; Schmidt, John A.; Sorgen, Paul L.; Guo, Wei; Naslavsky, Naava; Caplan, Steve


    Endocytic recycling involves the return of membranes and receptors to the plasma membrane following their internalization into the cell. Recycling generally occurs from a series of vesicular and tubular membranes localized to the perinuclear region, collectively known as the endocytic recycling compartment. Within this compartment, receptors are sorted into tubular extensions that later undergo vesiculation, allowing transport vesicles to move along microtubules and return to the cell surface where they ultimately undergo fusion with the plasma membrane. Recent studies have led to the hypothesis that the C-terminal Eps15 homology domain (EHD) ATPase proteins are involved in the vesiculation process. Here, we address the functional roles of the four EHD proteins. We developed a novel semipermeabilized cell system in which addition of purified EHD proteins to reconstitute vesiculation allows us to assess the ability of each protein to vesiculate MICAL-L1-decorated tubular recycling endosomes (TREs). Using this assay, we show that EHD1 vesiculates membranes, consistent with enhanced TRE generation observed upon EHD1 depletion. EHD4 serves a role similar to that of EHD1 in TRE vesiculation, whereas EHD2, despite being capable of vesiculating TREs in the semipermeabilized cells, fails to do so in vivo. Surprisingly, the addition of EHD3 causes tubulation of endocytic membranes in our semipermeabilized cell system, consistent with the lack of tubulation observed upon EHD3 depletion. Our novel vesiculation assay and in vitro electron microscopy analysis, combined with in vivo data, provide evidence that the functions of both EHD1 and EHD4 are primarily in TRE membrane vesiculation, whereas EHD3 is a membrane-tubulating protein. PMID:24019528


    SciTech Connect

    Esteves, Lisa J.; De Mooij, Ernst J. W.; Jayawardhana, Ray E-mail:


    We conducted a comprehensive search for optical phase variations of all close-in (a/R{sub *} < 10) planet candidates in 15 quarters of Kepler space telescope data. After correcting for systematics, we found eight systems that show secondary eclipses as well as phase variations. Of these, five (Kepler-5, Kepler-6, Kepler-8, KOI-64, and KOI-2133) are new and three (TrES-2, HAT-P-7, and KOI-13) have published phase curves, albeit with many fewer observations. We model the full phase curve of each planet candidate, including the primary and secondary transits, and derive their albedos, dayside and nightside temperatures, ellipsoidal variations, and Doppler beaming. We find that KOI-64 and KOI-2133 have nightside temperatures well above their equilibrium values (while KOI-2133 also has an albedo, >1), so we conclude that they are likely to be self-luminous objects rather than planets. The other six candidates have characteristics consistent with their being planets with low geometric albedos (<0.3). For TrES-2 and KOI-13, the Kepler bandpass appears to probe atmospheric layers hotter than the planet's equilibrium temperature. For KOI-13, we detect a never-before-seen third cosine harmonic with an amplitude of 6.7 {+-} 0.3 ppm and a phase shift of -1.1 {+-} 0.1 rad in the phase curve residual, possibly due to its spin-orbit misalignment. We report derived planetary parameters for all six planets, including masses from ellipsoidal variations and Doppler beaming, and compare our results to published values when available. Our results nearly double the number of Kepler exoplanets with measured phase curve variations, thus providing valuable constraints on the properties of hot Jupiters.

  9. Inferring heat recirculation and albedo for exoplanetary atmospheres: Comparing optical phase curves and secondary eclipse data

    NASA Astrophysics Data System (ADS)

    von Paris, P.; Gratier, P.; Bordé, P.; Selsis, F.


    Context. Basic atmospheric properties, such as albedo and heat redistribution between day- and nightsides, have been inferred for a number of planets using observations of secondary eclipses and thermal phase curves. Optical phase curves have not yet been used to constrain these atmospheric properties consistently. Aims: We model previously published phase curves of CoRoT-1b, TrES-2b, and HAT-P-7b, and infer albedos and recirculation efficiencies. These are then compared to previous estimates based on secondary eclipse data. Methods: We use a physically consistent model to construct optical phase curves. This model takes Lambertian reflection, thermal emission, ellipsoidal variations, and Doppler boosting, into account. Results: CoRoT-1b shows a non-negligible scattering albedo (0.11 < AS < 0.3 at 95% confidence) as well as small day-night temperature contrasts, which are indicative of moderate to high re-distribution of energy between dayside and nightside. These values are contrary to previous secondary eclipse and phase curve analyses. In the case of HAT-P-7b, model results suggest a relatively high scattering albedo (AS ≈ 0.3). This confirms previous phase curve analysis; however, it is in slight contradiction to values inferred from secondary eclipse data. For TrES-2b, both approaches yield very similar estimates of albedo and heat recirculation. Discrepancies between recirculation and albedo values as inferred from secondary eclipse and optical phase curve analyses might be interpreted as a hint that optical and IR observations probe different atmospheric layers, hence temperatures.

  10. Optimized time-resolved imaging of contrast kinetics (TRICKS) in dynamic contrast-enhanced MRI after peptide receptor radionuclide therapy in small animal tumor models.


    Haeck, Joost; Bol, Karin; Bison, Sander; van Tiel, Sandra; Koelewijn, Stuart; de Jong, Marion; Veenland, Jifke; Bernsen, Monique


    Anti-tumor efficacy of targeted peptide-receptor radionuclide therapy (PRRT) relies on several factors, including functional tumor vasculature. Little is known about the effect of PRRT on tumor vasculature. With dynamic contrast-enhanced (DCE-) MRI, functional vasculature is imaged and quantified using contrast agents. In small animals DCE-MRI is a challenging application. We optimized a clinical sequence for fast hemodynamic acquisitions, time-resolved imaging of contrast kinetics (TRICKS), to obtain DCE-MRI images at both high spatial and high temporal resolution in mice and rats. Using TRICKS, functional vasculature was measured prior to PRRT and longitudinally to investigate the effect of treatment on tumor vascular characteristics. Nude mice bearing H69 tumor xenografts and rats bearing syngeneic CA20948 tumors were used to study perfusion following PRRT administration with (177) lutetium octreotate. Both semi-quantitative and quantitative parameters were calculated. Treatment efficacy was measured by tumor-size reduction. Optimized TRICKS enabled MRI at 0.032 mm(3) voxel size with a temporal resolution of less than 5 s and large volume coverage, a substantial improvement over routine pre-clinical DCE-MRI studies. Tumor response to therapy was reflected in changes in tumor perfusion/permeability parameters. The H69 tumor model showed pronounced changes in DCE-derived parameters following PRRT. The rat CA20948 tumor model showed more heterogeneity in both treatment outcome and perfusion parameters. TRICKS enabled the acquisition of DCE-MRI at both high temporal resolution (Tres ) and spatial resolutions relevant for small animal tumor models. With the high Tres enabled by TRICKS, accurate pharmacokinetic data modeling was feasible. DCE-MRI parameters revealed changes over time and showed a clear relationship between tumor size and Ktrans . PMID:25995102

  11. A Systematic Retrieval Analysis of Secondary Eclipse Spectra. II. A Uniform Analysis of Nine Planets and their C to O Ratios

    NASA Astrophysics Data System (ADS)

    Line, Michael R.; Knutson, Heather; Wolf, Aaron S.; Yung, Yuk L.


    Secondary eclipse spectroscopy provides invaluable insights into the temperatures and compositions of exoplanetary atmospheres. We carry out a systematic temperature and abundance retrieval analysis of nine exoplanets (HD 189733b, HD 209458b, HD 149026b, GJ436b, WASP-12b, WASP-19b, WASP-43b, TrES-2b, and TrES-3b) observed in secondary eclipse using a combination of space- and ground-based facilities. Our goal with this analysis is to provide a consistent set of temperatures and compositions from which self-consistent models can be compared and to probe the underlying processes that shape these atmospheres. This paper is the second in a three part series of papers exploring the retrievability of temperatures and abundances from secondary eclipse spectra and the implications of these results for the chemistry of exoplanet atmospheres. In this investigation we present a catalogue of temperatures and abundances for H2O, CH4, CO, and CO2. We find that our temperatures and abundances are generally consistent with those of previous studies, although we do not find any statistically convincing evidence for super-solar C to O ratios (e.g., solar C/O falls in the 1σ confidence intervals in eight of the nine planets in our sample). Furthermore, within our sample we find little evidence for thermal inversions over a wide range of effective temperatures (with the exception of HD 209458b), consistent with previous investigations. The lack of evidence for inversions for most planets in our sample over such a wide range of effective temperatures provides additional support for the hypothesis that TiO is unlikely to be the absorber responsible for the formation of these inversions.

  12. A systematic retrieval analysis of secondary eclipse spectra. II. A uniform analysis of nine planets and their C to O ratios

    SciTech Connect

    Line, Michael R.; Knutson, Heather; Wolf, Aaron S.; Yung, Yuk L.


    Secondary eclipse spectroscopy provides invaluable insights into the temperatures and compositions of exoplanetary atmospheres. We carry out a systematic temperature and abundance retrieval analysis of nine exoplanets (HD 189733b, HD 209458b, HD 149026b, GJ436b, WASP-12b, WASP-19b, WASP-43b, TrES-2b, and TrES-3b) observed in secondary eclipse using a combination of space- and ground-based facilities. Our goal with this analysis is to provide a consistent set of temperatures and compositions from which self-consistent models can be compared and to probe the underlying processes that shape these atmospheres. This paper is the second in a three part series of papers exploring the retrievability of temperatures and abundances from secondary eclipse spectra and the implications of these results for the chemistry of exoplanet atmospheres. In this investigation we present a catalogue of temperatures and abundances for H{sub 2}O, CH{sub 4}, CO, and CO{sub 2}. We find that our temperatures and abundances are generally consistent with those of previous studies, although we do not find any statistically convincing evidence for super-solar C to O ratios (e.g., solar C/O falls in the 1σ confidence intervals in eight of the nine planets in our sample). Furthermore, within our sample we find little evidence for thermal inversions over a wide range of effective temperatures (with the exception of HD 209458b), consistent with previous investigations. The lack of evidence for inversions for most planets in our sample over such a wide range of effective temperatures provides additional support for the hypothesis that TiO is unlikely to be the absorber responsible for the formation of these inversions.

  13. Improved Glycemic Control and Vascular Function in Overweight and Obese Subjects by Glyoxalase 1 Inducer Formulation.


    Xue, Mingzhan; Weickert, Martin O; Qureshi, Sheharyar; Kandala, Ngianga-Bakwin; Anwar, Attia; Waldron, Molly; Shafie, Alaa; Messenger, David; Fowler, Mark; Jenkins, Gail; Rabbani, Naila; Thornalley, Paul J


    Risk of insulin resistance, impaired glycemic control, and cardiovascular disease is excessive in overweight and obese populations. We hypothesized that increasing expression of glyoxalase 1 (Glo1)-an enzyme that catalyzes the metabolism of reactive metabolite and glycating agent methylglyoxal-may improve metabolic and vascular health. Dietary bioactive compounds were screened for Glo1 inducer activity in a functional reporter assay, hits were confirmed in cell culture, and an optimized Glo1 inducer formulation was evaluated in a randomized, placebo-controlled crossover clinical trial in 29 overweight and obese subjects. We found trans-resveratrol (tRES) and hesperetin (HESP), at concentrations achieved clinically, synergized to increase Glo1 expression. In highly overweight subjects (BMI >27.5 kg/m(2)), tRES-HESP coformulation increased expression and activity of Glo1 (27%, P < 0.05) and decreased plasma methylglyoxal (-37%, P < 0.05) and total body methylglyoxal-protein glycation (-14%, P < 0.01). It decreased fasting and postprandial plasma glucose (-5%, P < 0.01, and -8%, P < 0.03, respectively), increased oral glucose insulin sensitivity index (42 mL ⋅ min(-1) ⋅ m(-2), P < 0.02), and improved arterial dilatation Δbrachial artery flow-mediated dilatation/Δdilation response to glyceryl nitrate (95% CI 0.13-2.11). In all subjects, it decreased vascular inflammation marker soluble intercellular adhesion molecule-1 (-10%, P < 0.01). In previous clinical evaluations, tRES and HESP individually were ineffective. tRES-HESP coformulation could be a suitable treatment for improved metabolic and vascular health in overweight and obese populations. PMID:27207552

  14. Thyroid Hormone Response Element Half-Site Organization and Its Effect on Thyroid Hormone Mediated Transcription

    PubMed Central

    Paquette, Martin A.; Atlas, Ella; Wade, Mike G.; Yauk, Carole L.


    Thyroid hormone (TH) exerts its effects by binding to the thyroid hormone receptor (TR), which binds to TH response elements (TREs) to regulate target gene expression. We investigated the relative ability of liganded homodimers TR and retinoid X receptor (RXR), and the heterodimer TR/RXR, to regulate gene expression for the TRE half-site organizations: direct repeat 4 (DR4), inverted repeat 0 (IR0) and everted repeat 6 (ER6). Luciferase reporter assays using a DR4 TRE suggest that both the TR homodimer and TR/RXR heterodimer regulate luciferase expression in the presence of their respective ligands. However, in the presence of the IR0 TRE, transfection with TR/RXR and RXR alone increased luciferase activity and there was no effect of TR alone. The presence of 9-cis-retinoic acid was necessary for luciferase expression, whereas TH treatment alone was insufficient. For the ER6 TRE, transfection with TR/RXR, TR alone and RXR alone (in the presence of their respective ligands) all caused a significant increase in luciferase activity. When both ligands were present, transfection with both TR/RXR caused more activation. Finally, we investigated the efficacy of the TR-antagonist 1–850 in inhibiting transcription by TR or TR/RXR at DR4 and ER6 TREs. We found that 1–850 did not suppress luciferase activation in the presence of TR/RXR for the ER6 TRE, suggesting conformational changes of the ligand binding domain of the TR when bound to different TRE half-site organizations. Collectively, the findings indicate that there are fundamental differences between TRE configurations that affect nuclear receptor interactions with the response element and ability to bind ligands and antagonists. PMID:24971931

  15. Young Nearby Suns and Stellar Jitter Dependence on Age

    NASA Astrophysics Data System (ADS)

    Cabrera, Nicole; White, Russel; Delfosse, Xavier; Noah Quinn, Samuel; Latham, David W.


    Finding the nearest young planets offers the most direct way to improve our understanding of how planets form, how they migrate, and how they evolve. However, most radial velocity (RV) surveys have avoided young stars because of their problematic characteristics, including high levels of stellar activity. Recent advancements in infrared (IR) detectors as well as wavelength calibration methods have provided new ways of pursuing high-precision RV measurements of young stars. While this work has been successfully applied to many young late-K and M dwarfs, much less RV work has been done on young Sun-like stars, with the very recent exception of adolescent stars (~600 Myr) in open clusters. In order to better understand the dynamical and structural forces that shaped our own Solar system, we must begin to explore the more massive realm of Sun-like stars.We present precision optical radial velocity data of 5 young, nearby, Sun-like stars in AB Dor and assess our ability to detect young planets with current spectroscopic methods. The data were obtained with the TRES spectrograph on the 1.5-m Tillinghast Reflector at the Fred L. Whipple Observatory and with SOPHIE on the 1.95 m Telescope at the Observatoire de Haute Provence. We obtained a RV precision of ~8 m/s with TRES and ~7 m/s precision with SOPHIE; average observed dispersions are 38 m/s and 33 m/s, respectively. We combine our results with spectroscopic data of Sun-like stars spanning a broad range of youthful ages (< 1 Gyr) from the literature to investigate the relationship between stellar jitter and stellar age. The results suggest that the jitter of Sun-like stars decreases below 100 m/s for stars older than ~30 Myr, which would enable the discovery of hot Jupiters orbiting these adolescent age stars.

  16. Molecular detection of Rangelia vitalii in domestic dogs from Uruguay.


    Soares, João Fabio; Carvalho, Luis; Maya, Leticia; Dutra, Fernando; Venzal, José Manuel; Labruna, Marcelo B


    The piroplasm Rangelia vitalii is the etiological agent of canine rangeliosis, a severe disease affecting domestic dogs in South America. Two domestic dogs from two different Departments (Salto and Treinta y Tres) of Uruguay presented with clinical signs such as apathy, anorexia, pale mucous membranes, jaundice, and hemorrhagic manifestations, suggestive of a canine vector-borne disease. Molecular analysis, based on PCR and DNA sequencing of portions of the 18S rRNA gene, revealed that both dogs were infected by R. vitalii. Two consensus sequences, one from Salto and one from Treinta y Tres, differed from each other by only 1 nucleotide (99.8% similarity) and were 99.8-100% identical to corresponding sequences of R. vitalii from Brazil and Argentina available in GenBank. Through phylogenetic analysis inferred by the 18S rRNA gene, the two Uruguayan sequences of R. vitalii were aligned with the corresponding sequences from 7 other R. vitalii sequences available in GenBank (5 from Brazil and, 2 from Argentina) under high bootstrap support. The two dogs of the present study were negative for Ehrlichia canis according to the E. canis-specific real-time PCR assay. Our findings not only confirm the occurrence of R. vitalii in Uruguay but also provide the southernmost record of this re-emerging agent. The only previous report of R. vitalii in Uruguay dated from 1976, a period when molecular analyses were not available. We provide the first molecular detection of R. vitalii in Uruguay. Currently, canine rangeliosis is confirmed to occur in Brazil, Argentina, and Uruguay. PMID:25843009

  17. The GAPS programme with HARPS-N at TNG. IX. The multi-planet system KELT-6: Detection of the planet KELT-6 c and measurement of the Rossiter-McLaughlin effect for KELT-6 b

    NASA Astrophysics Data System (ADS)

    Damasso, M.; Esposito, M.; Nascimbeni, V.; Desidera, S.; Bonomo, A. S.; Bieryla, A.; Malavolta, L.; Biazzo, K.; Sozzetti, A.; Covino, E.; Latham, D. W.; Gandolfi, D.; Rainer, M.; Petrovich, C.; Collins, K. A.; Boccato, C.; Claudi, R. U.; Cosentino, R.; Gratton, R.; Lanza, A. F.; Maggio, A.; Micela, G.; Molinari, E.; Pagano, I.; Piotto, G.; Poretti, E.; Smareglia, R.; Di Fabrizio, L.; Giacobbe, P.; Gomez-Jimenez, M.; Murabito, S.; Molinaro, M.; Affer, L.; Barbieri, M.; Bedin, L. R.; Benatti, S.; Borsa, F.; Maldonado, J.; Mancini, L.; Scandariato, G.; Southworth, J.; Zanmar Sanchez, R.


    Aims: For more than 1.5 years we spectroscopically monitored the star KELT-6 (BD+31 2447), which is known to host the transiting hot-Saturn KELT-6 b, because a previously observed long-term trend in radial velocity time series suggested that there is an outer companion. Methods: We collected a total of 93 new spectra with the HARPS-N and TRES spectrographs. A spectroscopic transit of KELT-6 b was observed with HARPS-N, and simultaneous photometry was obtained with the IAC-80 telescope. Results: We proved the existence of an outer planet with a mininum mass Mpsin i = 3.71 ± 0.21 MJup and a moderately eccentric orbit (e = 0.21-0.036+0.039) of period P ~ 3.5 years. We improved the orbital solution of KELT-6 b and obtained the first measurement of the Rossiter-McLaughlin effect, showing that the planet has a likely circular, prograde, and slightly misaligned orbit with a projected spin-orbit angle of λ = -36 ± 11 degrees. We improved the KELT-6 b transit ephemeris from photometry and provide new measurements of the stellar parameters. KELT-6 appears as an interesting case for studying the formation and evolution of multi-planet systems. Based on observations made with (i) the HARPS-N spectrograph on the Italian Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the INAF - Fundacion Galileo Galilei (Spanish Observatory of Roque de los Muchachos of the IAC); (ii) the Tillinghast Reflector Echelle Spectrograph (TRES) on the 1.5-m Tillinghast telescope, located at the Smithsonian Astrophysical Observatory's Fred L. Whipple Observatory on Mt. Hopkins in Arizona; (iii) the IAC-80 telescope at the Teide Observatory (Instituto de Astrofísica de Canarias, IAC).Figure 4 and Tables 2 and 3 are available in electronic form at

  18. Are MWC349 A and B a Physical Binary?

    NASA Astrophysics Data System (ADS)

    Drew, Patrick; Strelnitski, Vladimir; Smith, Howard Alan; Dave Latham Jessica Mink and the TRES instrument Team, Maria Mitchell Association


    The age and evolutionary status of the only known hydrogen recombination line maser and laser star MWC349A, "A", is unknown because its spectrum has no absorption features for classification. Star A has an optical B0III companion 2.4 arcsec away, MWC349B. Previous studies suggest A & B are either gravitationally bound, and therefore both a few Myr old, or not bound and A is possibly an observable 30 Msolar star in its pre-main sequence stage. We attempt to solve the controversy by measuring the difference of radial velocities between A and B using observations from the 1.5m Tillinghast telescope and the TRES spectrometer at the Whipple Observatory. With an assumed distance of 1.2 kpc and masses of ~30 Msolar, the radial velocities cannot differ by >3 km/s for the stars to be gravitationally bound. We find a radial velocity with respect to the local standard of rest of 42 ± 18 km/s for B, and compare it with the known radial velocity of 8 ± 2 km/s for A giving a difference of 34 ± 20 km/s - much greater than 3 km/s. We conclude that A and B are not gravitationally bound, although light contamination from star A in B's spectrum makes this result somewhat inconclusive. If confirmed, however, the known spectral type of B will not determine the age of star A and star A may be an observable 30 Msolar star in its pre-main sequence stage. We gratefully acknowledge support from Dave Latham, Jessica Mink and the TRES instrument team. This project was supported in part by the NSF REU grant AST-1358980 and by the Maria Mitchell Association.


    SciTech Connect

    Faigler, S.; Mazeh, T.


    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  20. The Language of Planetary Light

    NASA Technical Reports Server (NTRS)


    This graph of data from NASA's Spitzer Space telescope shows changes in the infrared light output of two star-planet systems (one above, one below) located hundreds of light-years away. The data were taken while the planets, called HD 209458b and TrES-1, disappeared behind their stars in what is called a 'secondary eclipse.' The dip seen in the center of each graph represents the time when the planets were eclipsed, and tells astronomers exactly how much light they emit.

    Why a secondary eclipse? When a planet transits, or passes in front of, its star, it partially blocks the light of the star. When the planet swings around behind the star, the star completely blocks its light. This drop in total light can be measured to determine the amount of light coming from just the planet.

    Why infrared? In visible light, the glare of a star overwhelms its planetary companion and the little light the planet reflects. In infrared, a star shines less brightly, and its planet gives off its own internal light, or heat radiation, making the planet easier to detect.

    By observing these secondary eclipses at different infrared wavelengths, astronomers can obtain the planet's temperature, and, in the future, they may be able to pick out chemicals sprinkled throughout a planet's atmosphere. The technique also reveals whether a planet's orbit is elongated or circular.

    This strategy will not work for all known extrasolar planets. It is ideally suited to study those Jupiter-sized planets previously discovered to cross, or transit, between us and the Sun-like stars they orbit, out to distances of 500 light-years. NASA's Spitzer Space Telescope was the first to successfully employ this technique.

    The data of HD 209458b were taken by Spitzer's multiband imaging photometer using the 24-micron array. The data of TrES-1 were taken by Spitzer's infrared array camera using the 8-micron array.

  1. Initial Results from the 2002 Gulf of California Conjugate Margin Seismic Experiment

    NASA Astrophysics Data System (ADS)

    Holbrook, S.; Lizarralde, D.; Kent, G.; Harding, A.; Fletcher, J.; Gonzalez-Fernandez, A.; Umhoefer, P.; Axen, G.


    The Gulf of California, which marks the ongoing separation of Baja California from mainland Mexico, is one of the few locales where active continental breakup can be studied along unambiguous flow lines that join clear conjugate margin pairs. In Fall 2002, we conducted an onshore-offshore seismic experiment across the conjugate rifted margins of the Gulf of California in several rift segments. The joint U.S.-Mexico project, sponsored principally by the MARGINS program of the U.S. National Science Foundation, aimed to image crustal structure across conjugate margins of four major basins to determine the modes of extension and the influence of sedimentation and magmatism on breakup. Here we present an overview of the experiment, which was substantially altered at sea due to concerns for marine-mammal safety, and present some preliminary findings. Three flow-line transects were acquired, in the Alarcon Basin, the Guaymas Basin, and between Cabo and Tres Marias Islands. In addition, a fourth transect across the Baja Peninsula was acquired. Data acquired included (1) multichannel seismic reflection data using the R/V Ewing’s 20-gun array and 480-channel, 6-km-long streamer, (2) wide-angle reflection/refraction data recorded on ocean-bottom seismometers, from 206 deployments conducted by the R/V New Horizon, and (3) onshore-offshore data recorded on portable seismometers deployed up to 100 km inland on all transects. Initial results from the experiment include (1) clear evidence for asymmetric basement structure on the conjugate rifted margins and across the active mid-ocean spreading center, of the Guaymas Basin, (2) the suggestion of substantial magmatism in an early failed rift of the Alarcon Basin, and (3) active subduction beneath the margin at the Tres Marias islands. In addition, we will discuss new procedures for mitigating effects on marine mammals that may have a significant impact on future U.S.-sponsored seismic reflection activities.

  2. Search of Exoplanets - Phase I

    NASA Astrophysics Data System (ADS)

    Vodniza, Alberto Q.; Pereira, M. R.; Lopez, J. P.; Reyes, K.; Chaves, L.


    From the Astronomical Observatory at the University of Nariño-COLOMBIA, we have begun a systematic search for exoplanets. Initially we made differential photometry on variable stars weaker than the tenth magnitude to get enough experience on the establishment of stellar transits, so then we could undertake the work with exoplanets. We have already confirmed the transits of two exoplanets with good photometry data: At the exoplanet HAT-P-5b, discovered by Bakos and other investigators and which turns around the GSC 02634-01087, with an orbital period of 2.788491 days according to measurements of the discoverers, and also at the exoplanet TrES-3, discovered by O'Donovan and other investigators and which turns around the GSC 03089-00929, with an orbital period of 1.30619 days, established by its discoverers. Both exoplanets are quite interesting because they have one of the smallest periods found on exoplanets. The TrES-3 also provides a big opportunity for studying the orbital decay and mass loss due to evaporation, caused by the great closeness to its star. We have captured a lot of data to elaborate the lightcurves so we can estimate physical parameters of the bodies. We are getting data on various dates. Actually we are preparing the equipment to develop observations of radial velocities through spectrometry. In a later phase, we expect to verify the presence of other exoplanets which cause less deep transits, and then we can investigate stars with possible exoplanets around them. Besides we hope to design a mathematical model of the studied systems. The equipment we employed is: 14"LX200 GPS MEADE telescope, ST-7XME SBIG camera, STL-1001 SBIG camera, LHIRES III Spectrograph, and SGS-SBIG Spectrograph. On the poster it is explained at length the methodology followed over the search, the data we obtained and the physical- mathematical analysis that was carried out.


    PubMed Central

    Mondragón, Liliana; Monroy, Zuraya; Ito, Ma. Emily; Medina-Mora, Dra. Ma. Elena


    El objetivo del trabajo es conocer las disyuntivas entre los principios de beneficencia y autonomía, que se presentan en la relación médico-paciente, durante la terapéutica del intento de suicidio. La investigación se realizó en dos hospitales psiquiátricos de la Ciudad de México. La muestra incluyó a tres sujetos con intento de suicidio, mayores de 18 años, que eran atendidos en consulta externa a causa de una lesión autoinfligida en el último año, y a tres psiquiatras que trataban a estos pacientes. La información se obtuvo previo consentimiento informado en entrevistas individuales. Se llevó a cabo un análisis de discurso argumentado para encontrar los significados que los participantes otorgaron a los principios bioéticos y las posibles disyuntivas entre éstos. Las discordancias entre la beneficencia y la autonomía estuvieron relacionadas con el beneficio del tratamiento, el respeto por los valores y las creencias de los pacientes, entre otros. Este trabajo presenta consideraciones éticas relevantes en el escenario clínico, al ofrecer al psiquiatra un análisis bioético que le permita actuar de acuerdo con la beneficencia y respetando la autonomía del paciente frente a casos de intento de suicidio y, de esta forma procurar una mejor atención para ellos. PMID:20830214

  4. BEER Analysis of Kepler and CoRoT Light Curves. II. Evidence for Superrotation in the Phase Curves of Three Kepler Hot Jupiters

    NASA Astrophysics Data System (ADS)

    Faigler, S.; Mazeh, T.


    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  5. Comparative age and growth of common snook Centropomus undecimalis (Pisces: Centropomidae) from coastal and riverine areas in Southern Mexico.


    Perera-Garcia, Martha A; Mendoza-Carranza, Manuel; Contreras-Sánchez, Wilfrido; Ferrara, Allyse; Huerta-Ortiz, Maricela; Hernández-Gómez, Raúl E


    Common snook Centropomus unidecimalis is an important commercial and fishery species in Southern Mexico, however the high exploitation rates have resulted in a strong reduction of its abundances. Since, the information about its population structure is scarce, the objective of the present research was to determine and compare the age structure in four important fishery sites. For this, age and growth of common snook were determined from specimens collected monthly, from July 2006 to March 2008, from two coastal (Barra Bosque and Barra San Pedro) and two riverine (San Pedro and Tres Brazos) commercial fishery sites in Tabasco, Mexico. Age was determined using sectioned saggitae otoliths and data analyzed by von Bertalanffy and Levenberg-Marquardt among others. Estimated ages ranged from 2 to 17 years. Monthly patterns of marginal increment formation and the percentage of otoliths with opaque rings on the outer edge demonstrated that a single annulus was formed each year. The von Bertalanffy parameters were calculated for males and females using linear adjustment and the non-linear method of Levenberg-Marquardt. The von Bertalanffy growth equations were FLt = 109.21(1-e-0.2(t+0.57)) for Barra Bosque, FLt = 94.56(1-e-027(t+0.485)) for Barra San Pedro, FLt = 97.15(1-e 0.17(t + 1.32)) for San Pedro and FLt = 83.77(1-e-026(t + 0.49)) for Tres Brazos. According to (Hotelling's T2, p < 0.05) test growth was significantly greater for females than for males. Based on the Chen test, von Bertalanffy growth curves were different among the study sites (RSS, p < 0.05). Based on the observed differences in growth parameters among sampling sites (coastal and riverine environments) future research need to be conducted on migration and population genetics, in order to delineate the stock structure of this population and support management programs. PMID:23885591

  6. Nouvelles approches en theorie du champ moyen dynamique: le cas du pouvoir thermoelectrique et celui de l'effet orbital d'un champ magnetique

    NASA Astrophysics Data System (ADS)

    Arsenault, Louis-Francois

    Les applications reliees a la generation d'energie motivent la recherche de materiaux ayant un fort pouvoir thermoelectrique (S). De plus, S nous renseigne sur certaines proprietes fondamentales des materiaux, comme, par exemple, la transition entre l'etat coherent et incoherent des quasi-particules lorsque la temperature augmente. Empiriquement, la presence de fortes interactions electron-electron peut mener a un pouvoir thermoelectrique geant. Nous avons donc etudie le modele le plus simple qui tient compte de ces fortes interactions, le modele de Hubbard. La theorie du champ moyen dynamique (DMFT) est tout indiquee dans ce cas. Nous nous sommes concentres sur un systeme tridimensionnel (3d) cubique a face centree (fcc), et ce, pour plusieurs raisons. A) Ce type de cristal est tres commun dans la nature. B) La DMFT donne de tres bons resultats en 3d et donc ce choix sert aussi de preuve de principe de la methode. C) Finalement, a cause de la frustration electronique intrinseque au fcc, celui-ci ne presente pas de symetrie particule-trou, ce qui est tres favorable a l'apparition d'une grande valeur de S. Ce travail demontre que lorsque le materiau est un isolant a demi-remplissage a cause des fortes interactions (isolant de Mott), il est possible d'obtenir de grands pouvoirs thermoelectriques en le dopant legerement. C'est un resultat pratique important. Du point de vue methodologique, nous avons montre comment la limite de frequence infinie de S et l'approche dite de Kelvin, qui considere la limite de frequence nulle avant la limite thermodynamique pour S, donnent des estimations fiables de la vraie limite continue (DC) dans les domaines de temperature appropriee. Ces deux approches facilitent grandement les calculs en court-circuit ant la necessite de recourir a de problematiques prolongements analytiques. Nous avons trouve que la methode de calcul a frequence infinie fonctionne bien lorsque les echelles d'energie sont relativement faibles. En d'autres termes

  7. Scheme for development of monitoring networks for springs in Bavaria, Germany

    NASA Astrophysics Data System (ADS)

    Bender, Steffen; Einsiedl, Florian; Wohnlich, Stefan


    The present groundwater monitoring network in Bavaria consists mostly of wells and only a small number of natural groundwater springs, all of which are analyzed for mainly the common physical and chemical constituents in groundwater. In order to develop a long-term groundwater management plan for all the groundwater resources of Bavaria, the Bavarian State Office for Water Management intends to establish a separate spring-monitoring network throughout the 11 groundwater provinces of the state. As a first step, significant physicochemical parameters that show considerable annual fluctuation (after monitoring 1-3 years) were determined at 21 springs or spring systems to create a basic data set to guide future monitoring. A selection procedure was developed around four parameters: (1) geological units, which includes the principal aquifers; (2) rate of spring discharge; (3) land utilization within a catchment; and (4) approximate size of the subterranean catchment. However, in the initial phase of the study, only the first three parameters were investigated. These parameters established a matrix for evaluating each groundwater region of Bavaria to aid in the selection of additional springs for the proposed monitoring network. Résumé. Le réseau actuel de surveillance des eaux souterraines en Bavière consiste surtout en des puits avec seulement un petit nombre de sources, tous analysés pour l'essentiel pour les composants courants physiques et chimiques des eaux souterraines. Afin de développer un plan de gestion à long terme des eaux souterraines de la Bavière, l'Office bavarois pour la gestion de l'eau cherche à mettre en place un réseau séparé de surveillance des sources dans les onze provinces hydrogéologiques du lander. Dans un premier temps, les paramètres physico-chimiques significatifs qui présentent des variations annuelles considérables, après 1 à 3 ans de surveillance, ont été déterminés à 21 sources ou groupes de sources pour

  8. [In Process Citation].


    González-Montesinos, José Luis; Ponce-González, Jesús Gustavo; Vicente-Campos, Davinia; López-Chicharro, José; Fernández-Santos, Jorge Del Rosario; Vaz-Pardal, Carmen; Costa-Sepúlveda, José Luis; Conde-Caveda, Julio; Castro-Piñero, José


    Introducción y objetivos: un dispositivo llamado FeelBreathe ® (FB) se ha diseñado, desarrollado y patentado para el entrenamiento de la musculatura inspiratoria (IMT). Para examinar los efectos de FB en la ventilación pulmonar y el intercambio gaseoso durante el ejercicio, se tomaron medidas de 27 voluntarios varones sanos entrenados (edad: 32,5 ± 7,2 años). Métodos: al inicio del estudio se midieron tanto la presión inspiratoria máxima estática (PIM) y la capacidad pulmonar mediante espirometría. Seguidamente, se realizó un test incremental en cicloergómetro para determinar el VO 2 pico. Cada sujeto, tres días más tarde, realizó aleatoriamente tres pruebas idénticas submáximas en cicloergómetro a una intensidad comprendida al 50% entre los umbrales ventilatorios bajo tres condiciones de respiración diferentes: a) respiración oronasal (ONB), b) respiración nasal (NB) y c) la respiración nasal a través del FB. Resultados: la prueba con FB mostró una ventilación minuto (VE) y una frecuencia respiratoria (BF) inferior que en las pruebas de NB, la cual a su vez tenía menor BF, pero similar VE que ONB (p < 0,001). A pesar de esto, FB obtuvo valores similares de VO 2 , cociente respiratorio (RER), frecuencia cardiaca (HR) y saturación de oxígeno capilar periférica (SpO2) en comparación con NB y ONB. Esto último puede ocurrir debido en parte al aumento del volumen tidal (VT) y el tiempo de expiración (Tex) en FB hasta el mismo nivel que en la prueba de NB, los cuales fueron un 15% y 14% en ambas pruebas, respectivamente, superiores a ONB (p < 0,001). El porcentaje de tiempo de inspiración (Ti/Tot) fue 7% mayor en la prueba de FB en comparación con NB y ONB (p < 0,001). Solamente en la prueba de FB se encontró un aumento de la presión final de la espiración de CO 2 (P ET CO 2 ) y la reducción de la presión final de la espiración de O 2 (P ET O 2 ) y la fracción de expiración de O 2 (FEO 2 ). Conclusiones: FeelBreathe es un

  9. Abundance and Morphological Effects of Large Woody Debris in Forested Basins of Southern Andes

    NASA Astrophysics Data System (ADS)

    Andreoli, A.; Comiti, F.; Lenzi, M. A.


    The Southern Andes mountain range represents an ideal location for studying large woody debris (LWD) in streams draining forested basins thanks to the presence of both pristine and managed woodland, and to the general low level of human alteration of stream corridors. However, no published investigations have been performed so far in such a large region. The investigated sites of this research are three basins (9-13 km2 drainage area, third-order channels) covered by Nothofagus forests: two of them are located in the Southern Chilean Andes (the Tres Arroyos in the Malalcahuello National Reserve and the Rio Toro within the Malleco Natural Reserve) and one basin lies in the Argentinean Tierra del Fuego (the Buena Esperanza basin, near the city of Ushuaia). Measured LWD were all wood pieces larger than 10 cm in diameter and 1 m in length, both in the active channel and in the adjacent active floodplain. Pieces forming log jams were all measured and the geometrical dimensions of jams were taken. Jam type was defined based on Abbe and Montgomery (2003) classification. Sediment stored behind log-steps and valley jams was evaluated approximating the sediment accumulated to a solid wedge whose geometrical dimensions were measured. Additional information relative to each LWD piece were recorded during the field survey: type (log, rootwad, log with rootwads attached), orientation to flow, origin (floated, bank erosion, landslide, natural mortality, harvest residuals) and position (log-step, in-channel, channel-bridging, channel margins, bankfull edge). In the Tres Arroyos, the average LWD volume stored within the bankfull channel is 710 m3 ha-1. The average number of pieces is 1,004 per hectare of bankfull channel area. Log-steps represent about 22% of all steps, whereas the elevation loss due to LWD (log-steps and valley jams) results in 27% loss of the total stream potential energy. About 1,600 m3 of sediment (assuming a porosity of 20%) is stored in the main channel

  10. [In Process Citation].


    Santos, E; Rodríguez, A; Prieto de Frías, C; Gil, M J; Fruhbeck, G; Quiroga, J; Herrero, J I; Salvador, J


    RESUMEN            Fundamento. Las alteraciones del estado nutricional son frecuentes en la cirrosis hepática. El presente estudio se ha llevado a cabo para establecer las relaciones existentes entre la función hepática, los niveles de IGF I/IGFBP-3, el estado nutricional y las concentraciones de leptina, ghrelina y glucagón en 21 pacientes en lista de espera de trasplante hepático (TH).            Material y métodos. Se han estudiado 21 varones de 56+2,1 años de edad en lista de TH clasificados por estadio Child-Pugh (CP)  de menor a mayor disfunción hepática en CPA (n=4), CPB (n=11) y CPC (n=6). Se determinó  el índice de masa corporal (IMC),  porcentaje de grasa corporal (%) mediante pletismografía de desplazamiento de aire, gasto energético mediante calorimetría indirecta, calculando su desviación respecto al valor calculado por Harris-Benedict (GER%), y determinaciones analíticas en ayunas de albúmina, glucosa, insulina, HbA1c, leptina, ghrelina total, glucagón, IGF-I e IGFBP3.            Resultados. No hubo diferencias significativas entre % grasa corporal y leptinemia en los tres grupos clasificados por CP. El grupo CPC mostró valores de ghrelina superiores a los CPA y CPB (p<0,05). Los tres grupos mostraron un valor de GER% superior al 100%  e hiperglucagonemia, sin mostrar diferencias entre ellos. La concentración  de glucagón se correlacionó positivamente con el valor de GER%  (r=0,56; p<0,01), y con la concentración de ghrelina (r=0,66; p<0,01). El valor de albúmina se correlacionó positivamente con IGF-I (r=0,52; p<0,05) e IGFBP3 (r=0,45;  p<0,05), encontrándose ambos disminuidos por igual en los tres grupos.            Conclusiones. Estos resultados muestran un aumento de ghrelina en pacientes con mayor afectación funcional hepática, así como un patrón hipermetabólico asociado a hiperglucagonemia, lo que sugiere a este factor como desequilibrador del balance energético y

  11. Large wood storage, longitudinal distribution and mobility in channel segments of four mountain rivers, Chile

    NASA Astrophysics Data System (ADS)

    Iroume, A.; Mao, L.; Andreoli, A.; Ulloa, H.


    In Chile, besides an anecdotal reference to in-stream wood by Vidal Gormaz (1875), the first report on LW is the one by Andreoli et al. (2007). Since then, more abundant research has developed, focusing mainly on morphologic and hydraulic functions (Comiti et al., 2008; Mao et al., 2008, 2010; Iroumé at al., 2010, 2011; Ulloa et al., 2011), and also on the ecology of low order channels (Vera et al., 2012). Large wood storage, longitudinal distribution and mobility have been studied for several periods in channel segments of four mountain catchments (Pichún, El Toro, Tres Arroyos and Vuelta de Zorra) in southern Chile. The surveyed segments were divided into individual reaches, and the length of each reach was calculated using a laser distance meter and mean individual reach bankfull width and depth were obtained by averaging measurements in cross-sections. All wood pieces found within the bankfull channel more than 10 cm in diameter and 1 m in length were measured and their position was referenced to natural elements and to numbered wooden stakes indicating every reach limit. Several of these wood elements were tagged to study LW mobilization. A 1.54 km-long segment divided into 17 individual reaches was first surveyed in the Tres Arroyos during March-April 2005, and then re-surveyed in November 2008 when the study segment was extended to a total length of 2.07 km with the addition of 5 new individual reaches. Pichún, El Toro and Vuelta de Zorra were first surveyed from November 2008 to February 2009. The length of the channel segments is 1.0 (12 reaches), 2.2 (17 reaches) and 1.56 km (16 reaches) for Pichún, El Toro and Vuelta de Zorra, respectively. These segments have been re-surveyed after every winter rainy season to study LW recruitment and mobility. Using the area of the bankfull channel as reference, total LW volume was 54 m3/ha in Pichún, 202 m3/ha in El Toro, 1449 m3/ha for Tres Arroyos and 109 m3/ha for Vuelta de Zorra. The LW travel distance and

  12. Bladder inflammatory transcriptome in response to tachykinins: Neurokinin 1 receptor-dependent genes and transcription regulatory elements

    PubMed Central

    Saban, Ricardo; Simpson, Cindy; Vadigepalli, Rajanikanth; Memet, Sylvie; Dozmorov, Igor; Saban, Marcia R


    Background Tachykinins (TK), such as substance P, and their neurokinin receptors which are ubiquitously expressed in the human urinary tract, represent an endogenous system regulating bladder inflammatory, immune responses, and visceral hypersensitivity. Increasing evidence correlates alterations in the TK system with urinary tract diseases such as neurogenic bladders, outflow obstruction, idiopathic detrusor instability, and interstitial cystitis. However, despite promising effects in animal models, there seems to be no published clinical study showing that NK-receptor antagonists are an effective treatment of pain in general or urinary tract disorders, such as detrusor overactivity. In order to search for therapeutic targets that could block the tachykinin system, we set forth to determine the regulatory network downstream of NK1 receptor activation. First, NK1R-dependent transcripts were determined and used to query known databases for their respective transcription regulatory elements (TREs). Methods An expression analysis was performed using urinary bladders isolated from sensitized wild type (WT) and NK1R-/- mice that were stimulated with saline, LPS, or antigen to provoke inflammation. Based on cDNA array results, NK1R-dependent genes were selected. PAINT software was used to query TRANSFAC database and to retrieve upstream TREs that were confirmed by electrophoretic mobility shift assays. Results The regulatory network of TREs driving NK1R-dependent genes presented cRel in a central position driving 22% of all genes, followed by AP-1, NF-kappaB, v-Myb, CRE-BP1/c-Jun, USF, Pax-6, Efr-1, Egr-3, and AREB6. A comparison between NK1R-dependent and NK1R-independent genes revealed Nkx-2.5 as a unique discriminator. In the presence of NK1R, Nkx2-5 _01 was significantly correlated with 36 transcripts which included several candidates for mediating bladder development (FGF) and inflammation (PAR-3, IL-1R, IL-6, α-NGF, TSP2). In the absence of NK1R, the matrix Nkx2

  13. A Comparison of Observationally Determined Radii with Theoretical Radius Predictions for Short-Period Transiting Extrasolar Planets

    NASA Astrophysics Data System (ADS)

    Laughlin, Gregory; Wolf, Aaron; Vanmunster, Tonny; Bodenheimer, Peter; Fischer, Debra; Marcy, Geoff; Butler, Paul; Vogt, Steve


    Two extrasolar planets, HD 209458b and TrES-1, are currently known to transit bright parent stars for which physical properties can be accurately determined. The two transiting planets have very similar masses and periods and hence invite detailed comparisons between their observed and theoretically predicted properties. In this paper, we carry out these comparisons. We first report photometric and spectroscopic follow-up observations of TrES-1, and we use these observations to obtain improved estimates for the planetary radius, Rpl=(1.08+/-0.05)RJ, and the planetary mass, Mpl=(0.729+/-0.036)MJ. We also confirm that the inclination estimate of the planetary orbit as i=88.2d. These values agree with those obtained by Alonso et al. in their discovery paper, but the uncertainty in the planet radius has been improved as a result of both high-cadence photometry of two full transits and from independent radius determinations for the V=11.8 K0 V parent star. We derive estimates for the TrES-1 stellar parameters of R*/Rsolar=0.83+/-0.03 (by combining independent estimates from stellar models, high-resolution spectra, and transit light curve fitting) M*/Msolar=0.87+/-0.05 (via fitting to evolutionary tracks), Teff=5214+/-23K, [Me/H]=0.001+/-0.04, rotational velocity Vsin(i)=1.08+/-0.3kms-1, logg=4.52+/-0.05dex, logL*/Lsolar=-0.32, d=157+/-6pc, and an age of τ=4+/-2Gyr. These estimates of the physical properties of the system allow us to compute evolutionary models for the planet that result in a predicted radius of Rpl=1.05RJ for a model that contains an incompressible 20 M⊕ core and a radius Rpl=1.09RJ for a model without a core. We use our grids of planetary evolution models to show that, with standard assumptions, our code also obtains good agreement with the observed radii of the other recently discovered transiting planets, including OGLE-TR-56b, OGLE-TR-111b, OGLE-TR-113b, and OGLE-TR-132b. We report an updated radius for HD 209458b of Rpl=(1.32+/-0.05)RJ, based on

  14. Interactive initialization of 2D/3D rigid registration

    SciTech Connect

    Gong, Ren Hui; Güler, Özgür; Kürklüoglu, Mustafa; Lovejoy, John; Yaniv, Ziv


    Purpose: Registration is one of the key technical components in an image-guided navigation system. A large number of 2D/3D registration algorithms have been previously proposed, but have not been able to transition into clinical practice. The authors identify the primary reason for the lack of adoption with the prerequisite for a sufficiently accurate initial transformation, mean target registration error of about 10 mm or less. In this paper, the authors present two interactive initialization approaches that provide the desired accuracy for x-ray/MR and x-ray/CT registration in the operating room setting. Methods: The authors have developed two interactive registration methods based on visual alignment of a preoperative image, MR, or CT to intraoperative x-rays. In the first approach, the operator uses a gesture based interface to align a volume rendering of the preoperative image to multiple x-rays. The second approach uses a tracked tool available as part of a navigation system. Preoperatively, a virtual replica of the tool is positioned next to the anatomical structures visible in the volumetric data. Intraoperatively, the physical tool is positioned in a similar manner and subsequently used to align a volume rendering to the x-ray images using an augmented reality (AR) approach. Both methods were assessed using three publicly available reference data sets for 2D/3D registration evaluation. Results: In the authors' experiments, the authors show that for x-ray/MR registration, the gesture based method resulted in a mean target registration error (mTRE) of 9.3 ± 5.0 mm with an average interaction time of 146.3 ± 73.0 s, and the AR-based method had mTREs of 7.2 ± 3.2 mm with interaction times of 44 ± 32 s. For x-ray/CT registration, the gesture based method resulted in a mTRE of 7.4 ± 5.0 mm with an average interaction time of 132.1 ± 66.4 s, and the AR-based method had mTREs of 8.3 ± 5.0 mm with interaction times of 58 ± 52 s. Conclusions: Based on the

  15. Preliminary results from comparisons of redundant tiltmeters at three sites in central california

    USGS Publications Warehouse

    Mortensen, C.E.; Johnston, M.J.S.


    The U.S. Geological Survey has been operating a network of shallow-borehole tiltmeters in central California since June 1973. At six sites redundant instruments have been installed as a check on data coherency. These include the Sage Ranch, Tres Pinos, New Idria, Aromas, Bear Valley and San Juan Bautista tiltmeter sites. Preliminary results from the comparison of redundant data from the Aromas, Bear Valley and San Juan Bautista sites for periods of eight, three and seven months respectively, suggest that short period tilt signals in the range 5 min < T < 3-5 h and ranging in amplitude from 5 ?? 10-8 to 10-6 rad, but not including step offsets, show excellent agreement on closely spaced instruments. Agreement is not as good in this period range for instruments at San Juan Bautista with a separation of 200 m. Signals of interest observed in this period range include coseismic tilts, teleseisms and tilts associated with creep events. Tilt signals in the period range 3-5 h < T < 2- 5 weeks are not always coherent at all three of the redundant tilt sites studied. Tilt signals in this period range have amplitudes up to 5 ?? 10-6 rad and wavelengths down to at least the instrument separation at the closely spaced sites (~several meters). Regarding longerterm coherency, the instruments at San Juan Bautista with 200-m spacing, agree within 0.5 ??rad for the N-S component and 0.7 jurad for the E-W component for a period of two months. The closely spaced redundant instruments at Aromas agree within 2 ??rad for the N-S component and 1 ??rad for the E-W component for the eight-month period of operation. Data from the three sites have been checked for effects of temperature, atmospheric pressure and rainfall. The latter appears to be critically site dependent. The worst case tilts for 1 inch of rainfall can be more than 1 jurad with a duration of a few days to a week. Typical rain-induced tilts are less than 0.3 ??rad for 1 inch of rain. The two instruments at the Sage Ranch

  16. Parameters controlling the milling process applied to the production of AI-Cu-Mg-Si alloys (2214) by mechanical alloying

    NASA Astrophysics Data System (ADS)

    Yan, X. X.; Bois, N.; Cizeron, G.


    In this study are analysed the respective influence of various parameters (processing time t_p, speed of rotation ω of the attritor axis and ratio R : the ball to powder masses) on the mechanical alloying process applied to mixed powders in order to obtain Al-Cu-Mg-Si alloys (2214 type). It was deduced that the most effective parameter is ω. Furthermore the optimum processing conditions were determined as well as the main characteristics of the powder resulting from the milling process using microscopy and X-ray diffraction. The sintering ability of samples pressed from " MA " powders was also studied thanks to dilatometric tests and compared with that of initial powder mixtures. A relationship between the size reduction of Al particles and the milling parameters is established. Dans cette étude ont été analysées les influences respectives de divers paramètres (temps de broyage t_p vitesse de rotation de l'axe de l'attriteur ω et rapport R : masse des billes/masse des poudres) sur le processus de mécanosynthèse appliqué à des poudres mélangées en vue d'obtenir des alliages Al-Cu-Mg-Si (type 2214). Il en a été déduit que le paramètre essentiel était ω. En outre, par microscopie et par diffraction X, les conditions optimales de broyage ont été déterminées, ainsi que les caractéristiques essentielles de la poudre résultant du processus d'attrition. L'aptitude au frittage des comprimés réalisés à partir de poudres traitées par voie mécanique a également été étudiée par dilatométrie et comparée à celle de la poudre initiale. Une relation permettant de relier la diminution de la taille des particules d'aluminium aux paramètres d'attrition a été établie.

  17. QIN. A Feasible High Spatiotemporal Resolution Breast DCE-MRI Protocol for Clinical Settings

    PubMed Central

    Tudorica, Luminita A.; Oh, Karen Y.; Roy, Nicole; Kettler, Mark D.; Chen, Yiyi; Hemmingson, Stephanie L.; Afzal, Aneela; Grinstead, John W.; Laub, Gerhard; Li, Xin; Huang, Wei


    Three dimensional bilateral imaging is the standard for most clinical breast dynamic contrast-enhanced (DCE) MRI protocols. Because of high spatial resolution (sRes) requirement, the typical 1–2 min temporal resolution (tRes) afforded by a conventional full-k-space-sampling gradient echo (GRE) sequence precludes meaningful and accurate pharmacokinetic analysis of DCE time-course data. The commercially available, GRE-based, k-space undersampling and data sharing TWIST (time-resolved angiography with stochastic trajectories) sequence was used in this study to perform DCE-MRI exams on thirty one patients (with 36 suspicious breast lesions) before their biopsies. The TWIST DCE-MRI was immediately followed by a single-frame conventional GRE acquisition. Blinded from each other, three radiologist readers assessed agreements in multiple lesion morphology categories between the last set of TWIST DCE images and the conventional GRE images. Fleiss’ κ test was used to evaluate inter-reader agreement. The TWIST DCE time-course data were subjected to quantitative pharmacokinetic analyses. With a four-channel phased-array breast coil, the TWIST sequence produced DCE images with 20 s or less tRes and ~ 1.0×1.0×1.4 mm3 sRes. There were no significant differences in signal-to-noise (P = 0.45) and contrast-to-noise (P = 0.51) ratios between the TWIST and conventional GRE images. The agreements in morphology evaluations between the two image sets were excellent with the intra-reader agreement ranging from 79% for mass margin to 100% for mammographic density and the inter-reader κ value ranging from 0.54 (P < 0.0001) for lesion size to 1.00 (P < 0.0001) for background parenchymal enhancement. Quantitative analyses of the DCE time-course data provided higher breast cancer diagnostic accuracy (91% specificity at 100% sensitivity) than the current clinical practice of morphology and qualitative kinetics assessments. The TWIST sequence may be used in clinical settings to acquire

  18. Homogeneous studies of transiting extrasolar planets - IV. Thirty systems with space-based light curves

    NASA Astrophysics Data System (ADS)

    Southworth, John


    I calculate the physical properties of 32 transiting extrasolar planet and brown-dwarf systems from existing photometric observations and measured spectroscopic parameters. The systems studied include 15 observed by the CoRoT satellite, 10 by Kepler and five by the Deep Impact spacecraft. Inclusion of the objects studied in previous papers leads to a sample of 58 transiting systems with homogeneously measured properties. The Kepler data include observations from Quarter 2, and my analyses of several of the systems are the first to be based on short-cadence data from this satellite. The light curves are modelled using the JKTEBOP code, with attention paid to the treatment of limb darkening, contaminating light, orbital eccentricity, correlated noise and numerical integration over long exposure times. The physical properties are derived from the light-curve parameters, spectroscopic characteristics of the host star and constraints from five sets of theoretical stellar model predictions. An alternative approach using a calibration from eclipsing binary star systems is explored and found to give comparable results whilst imposing a much smaller computational burden. My results are in good agreement with published properties for most of the transiting systems, but discrepancies are identified for CoRoT-5, CoRoT-8, CoRoT-13, Kepler-5 and Kepler-7. Many of the error bars quoted in the literature are underestimated. Refined orbital ephemerides are given for CoRoT-8 and for the Kepler planets. Asteroseismic constraints on the density of the host stars are in good agreement with the photometric equivalents for HD 17156 and TrES-2, but not for HAT-P-7 and HAT-P-11. Complete error budgets are generated for each transiting system, allowing identification of the observations best-suited to improve measurements of their physical properties. Whilst most systems would benefit from further photometry and spectroscopy, HD 17156, HD 80606, HAT-P-7 and TrES-2 are now extremely well

  19. Devenir néonatal immédiat de la grande et l'extrême prématurité: données rétrospectives d'une unité de néonatalogie à Yaoundé, Cameroun de 2009 à 2013

    PubMed Central

    Nlend, Anne Esther Njom; Zeudja, Cécile; Motaze, Annie Nga; Suzie, Moyo; Lydie, Nsoa


    L'objectif est de notre étude de décrire la typologie de la prématurité et mesurer la survie hospitalière à court terme des grands et extrêmes prématurés dans un pays à ressources limitées (PRL). C'est une étude descriptive rétrospective. Données extraites du registre des admissions du service. Inclusions de tous les nouveau-nés admis dans le service durant la période, ayant un âge gestationnel annoncé ≤ 36 semaines et 6 jours et plus de 26SA, avec au moins deux paramètres présents: âge gestationnel et poids de naissance. Principaux paramètres mesurés: pourcentage de nouveau-nés sortants vivants selon le type de prématurité: tardive, grande ou extrême. Nous avons recensé 1015 prématurés dont 314 grands prématurés (GP) et 61 extrêmes prématurés (EP). Le taux de nouveau-nés sortant vivants était de 95% chez les prématurés tardifs, de 71% chez les grands prématurés et de moins de 23% chez les extrêmes prématurés. Avant 28 semaines, le taux de mortalité était de prés de 100% chez les grands ou extrêmes prématurés de moins de 1000g contre 64% chez les plus de 1000g. Chez les GP le taux de décès était de 13% chez les nés par césarienne vs 21% chez ceux nés par voie basse (p ≤ 0,01). Le taux de prématurité médicalement induite était faible dans l'ensemble et de 3% chez les prématurés extrêmes. En conclusion le taux de mortalité hospitalière des EP est préoccupant, le faible taux de prématurité médicalement induite urge au renforcement de la prévention et à la mise en place de collaboration obstétrico-pédiatrique. PMID:26175812

  20. [In Process Citation].


    Zourdos, Michael C; Dolan, Chad; Quiles, Justin M; Klemp, Alex; Jo, Edward; Loenneke, Jeremy P; Blanco, Rocky; Whitehurst, Michael


    Introducción: el propósito de este estudio fue investigar la eficacia del entrenamiento diario de una repetición máxima (1RM) de la sentadilla en fuerza máxima. Material y método: tres levantadores de peso de competición realizaron la sentadilla durante 37 días consecutivos y se reportan como casos individuales. Participante 1 (P1) (masa corporal = 80,5 kg; edad = 28 años) y participante 3 (P3) (masa corporal = 108,8 kg; edad = 34 años) eran levantadores de fuerza; participante 2 (P2) (masa corporal = 64,1 kg; edad = 19 años) fue un levantador de pesas. Cada participante tenía por lo menos 5 años de experiencia con la posición en sentadilla de formación. Durante los días 1-35, los participantes realizaron una sentadilla de 1RM seguida por 5 conjuntos de volumen de 3 repeticiones al 85% o 2 repeticiones al 90% de la 1RM diario. En el día 36, los participantes realizan solo una serie de 1 repetición al 85% de 1RM del día 1; y el día 37 realizaron un 1RM. Resultados: cambios absolutos y porcentaje para P1 del 1 día al 37: + 5 kg/2,3% y desde el primer día al máximo (1RM era el mayor) + 12,5 kg/5,8%. P2 experimentó un aumento de 13,5 kg/10,8% en 1RM del día 1 al 37 y del día 1 al máximo. P3 demostró un aumento de 21 kg/9,5% del día 1 al 37 y del día 1 al máximo. Los tres participantes exhibieron significativa (p < 0,05) las correlaciones entre el tiempo (días) y 1RM (P1: r = 0,65, P2: r = 0,78, P3: r = 0,48). Conclusión: nuestros resultados sugieren que el entrenamiento diario de 1RM había producido efectivamente cambios significativos en la máxima fuerza en los atletas de fuerza competitiva en un periodo relativamente corto de entrenamiento. PMID:27238810

  1. Profil de l'hémogramme chez les enfants paludéens de 0 à 5 ans sous quinine, cas de la République Démocratique du Congo

    PubMed Central

    Kabamba, Arsène Tshikongo; Lukumwena, Zet Kalala; Longanga, Albert Otshudi


    Le paludisme constitue un des problèmes de santé publique majeur en République Démocratique du Congo (RDC) à cause d'une part des risques d’épidémies dans certaines zones du pays et d'autre part à cause du nombre des malades et des décès qu'il provoque. Cette étude expose les aspects hématologiques liés à la prise de la quinine au cours du paludisme grave chez l'enfant. Pour ce faire, les prises de sang ont été effectuées à deux groupes d'enfants, dans différents centres hospitaliers de Lubumbashi: le premier groupe est constitué d'enfants gravement impaludés et sous traitement à la quinine; tandis que le second groupe, composé d'enfants impaludés aussi mais sans traitement à la quinine et sert de groupe témoin. Ces prélèvements ont été analysés pour une exploration de l'hémogramme par un dosage sérique des paramètres hématologiques ci-après: les globules rouges, l'hémoglobine, l'hématocrite et le volume globulaire moyen. Les résultats obtenus montrent une différence statistiquement significative entre les deux groupes d'enfants examinés. En effet, dans la majorité des cas, une augmentation des taux plasmatiques des paramètres hématologiques analysés a été observée dans le groupe d'enfants impaludés sous traitement à la quinine, traduisant ainsi l'apport de la quinine sur la stabilisation de l'hémogramme au cours d'un paludisme grave chez l'enfant de moins de cinq ans. PMID:25722768

  2. Propriétés électroniques et schémas de bandes dans les semi-conducteurs amorphes. II. Etude des phénomènes de transport

    NASA Astrophysics Data System (ADS)

    Moliton, André; Ratier, Bernard

    We present the particular study of three important electric parameters which characterize an amorphous semiconductor. The band scheme is the Mott - Davis model and the three parameters : dark conductivity, thermoelectric power and alternative conductivity are determined versus temperature : calculations are presented on the more general manner for the successive energy levels (extended states, localized states in band tails, localized states near Fermi level). The schematic representations are finally proposed : at the classical curves obtained for the conductivities, we add a peculiar scheme for the thermoelectric power : its study is of importance for determining (with its sign) the type of amorphous semiconductor. Nous présentons de façon détaillée l'étude théorique de trois importants paramètres électriques susceptibles de caractériser un semi-conducteur amorphe. Le schéma de bande retenu est celui de Mott - Davis et les trois paramètres : conductivité continue, pouvoir thermoélectrique et conductivité alternative sont déterminés en particulier en fonction de la température : nous nous sommes attachés à présenter les calculs sous leur forme la plus générale possible en faisant intervenir successivement les différents mécanismes relatifs aux différents niveaux d'énergie (énergie relative aux états délocalisés, localisés dans les queues de bande, localisés au voisinage du niveau de Fermi). Les représentations schématiques, classiques pour la conductivité continue et à un degré moindre pour la conductivité alternative, sont proposées : nous détaillons en particulier celle du pouvoir thermoélectrique S dont l'étude est en fait essentielle car le signe de S (cf. Mott) est une des seules caractérisations fiables du type de semi-conducteur amorphe étudié.

  3. Formation et Evolution des Structures dans le Milieu interstellaire. Une Approche théorique, numérique et observationnelle

    NASA Astrophysics Data System (ADS)

    Hennebelle, Patrick


    Le milieu interstellaire, au sein duquel se forme les étoiles,présente d'importants contrastes de densités. Ces structures se forment sous l'action couplée de processus magnétohydrodynamiques, thermiques et chimiques. La première partie de cette thèse est un travail théorique et numérique sur la condensation induite dynamiquement de gaz chaud et diffus en une phase froide et condensée. Nous montrons, tout d'aborddans le cas hydrodynamique, puis MHD, comment, dans un milieu thermiquement bistable, une fluctuation de vitesse typiquement transonique conduit, si elle est d'amplitude suffisante et dure un temps assez long, à la formationd'une structure stable. L'influence de divers paramètres -amplitude et échelle spatiale caractéristique de la perturbation, pression initiale, configuration du champ magnétique- sur la condensationest étudiée numériquement et analytiquement. Des spectres synthétiques sont calculés et qualitativement comparés aux spectres observationnels. La seconde partie de la thèse porte sur l'étudeobservationnelle des phases les plus condensées du milieu interstellaire détectées en absorption sur le fond infrarouge galactique par le satellite ISO. Nous effectuons tout d'abordune extraction systématique de ces objets à partir d'une analyse multi-échelle des données ISOGAL.L'étude du rapport des contrastes à 7 et 15 um permet de mesurer le rapport de l'extinction interstellaire, peu connue dans cette région du spectre, à ces deux longueurs d'onde. Des estimations d'opacité de quelques objets sont égalementdéduites des données en infrarouge. Des observations complémentaires spectroscopiques et bolométriques dans le domaineradio ont été effectuées et permettent une analyse plus détaillée des paramètres physico-chimiques de ces nuages.

  4. Simulation du comportement thermique en régime permanent d'un moteur asynchrone à refroidissement extérieur. Etude par éléments finis

    NASA Astrophysics Data System (ADS)

    Glises, R.; Hostache, G.; Kauffmann, J. M.


    The steady state thermal modelling of an 4kW asynchronous motor is realized. A design has been made thanks to the Flux2D finite element magnetic calculus software converted into a resolution tool of the heat equation. This last is used to simulate the heat flux in fluid and solid areas. A 3D study is effected thanks to two 2D studies. The first concerns a radial view (perpendicular to the mechanical axis) whereas the second is effected for an axial view (parallel to the mechanical axis). Thermal conductivities of the materials and thermal contact resistances of the motor are determined through two different tests creating different overheatings. The first is made with a sinewave supply and pre-determine the thermophysical parameters. The second effected with direct current supplies at the rotor and the stator is used to validate these last parameters. On réalise l'étude du comportement thermique en régime permanent d'un moteur asynchrone de 4kW. Le logiciel de calculs magnétiques par éléments finis flux2D est converti en un outil de résolution de l'équation de la chaleur. Cette dernière équation sert à simuler les transferts thermiques tant dans les domaines fluides que solides. Une pseudo-étude tridimensionnelle est réalisée par le biais de deux études bidimensionnelles : la première effectuée suivant un plan radial (plan perpendiculaire à l'axe du moteur) et la seconde suivant un plan axial (plan parallèle à l'axe). Les conductivités des matériaux et des résistances thermiques de contact composant le moteur sont déterminées à l'aide de deux types d'essais qui induisent des échauffements différents. Le premier est réalisé avec une alimentation sinusoïdale et sert à prédéterminer les paramètres thermophysiques. Le second est effectué avec des alimentations à courant continu tant au stator qu'au rotor et a pour rôle la validation de ces paramètres.

  5. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R


    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  6. Diapycnal diffusivity in the core and oxycline of the tropical North Atlantic oxygen minimum zone

    NASA Astrophysics Data System (ADS)

    Köllner, Manuela; Visbeck, Martin; Tanhua, Toste; Fischer, Tim


    Diapycnal diffusivity estimates from two Tracer Release Experiments (TREs) and microstructure measurements in the oxycline and core of the oxygen minimum zone (OMZ) in the Eastern Tropical North Atlantic (ETNA) are compared. For the first time, two TREs within the same area at different depths were realized: the Guinea Upwelling Tracer Release Experiment (GUTRE) initiated in 2008 in the oxycline at approximately 320 m depth, and the Oxygen Supply Tracer Release Experiment (OSTRE) initiated in 2012 in the core of the OMZ at approximately 410 m depth. The mean diapycnal diffusivity Dz was found to be insignificantly smaller in the OMZ core with (1.06 ± 0.24) × 10- 5 m2 s- 1 compared to (1.11 ± 0.22) × 10- 5 m2 s- 1 90 m shallower in the oxycline. Unexpectedly, GUTRE tracer was detected during two of the OSTRE surveys which showed that the estimated diapycnal diffusivity from GUTRE over a time period of seven years was within the uncertainty of the previous estimates over a time period of three years. The results are consistent with the Dz estimates from microstructure measurements and demonstrate that Dz does not vary significantly vertically in the OMZ within the depth range of 200-600 m and does not change with time. The presence of a seamount chain in the vicinity of the GUTRE injection region did not cause enhanced Dz compared to the smoother bottom topography of the OSTRE injection region, although the analysis of vertical shear spectra from ship ADCP data showed elevated internal wave energy level in the seamount vicinity. However, the two tracer patches covered increasingly overlapping areas with time and thus spatially integrated increasingly similar fields of local diffusivity, as well as the difference in local stratification counteracted the influence of roughness on Dz. For both experiments no significant vertical displacements of the tracer were observed, thus diapycnal upwelling within the ETNA OMZ is below the uncertainty level of 5 m yr- 1.

  7. Migration and spawning of radio-tagged zulega Prochilodus argenteus in a dammed Brazilian river

    USGS Publications Warehouse

    Godinho, Alexandre L.; Kynard, B.


    It is difficult for agencies to evaluate the impacts of the many planned dams on Sa??o Francisco River, Brazil, migratory fishes because fish migrations are poorly known. We conducted a study on zulega Prochilodus argenteus, an important commercial and recreational fish in the Sa??o Francisco River, to identify migrations and spawning areas and to determine linear home range. During two spawning seasons (2001-2003), we radio-tagged fish in three main-stem reaches downstream of Tre??s Marias Dam (TMD), located at river kilometer (rkm) 2,109. We tagged 10 fish at Tre??s Marias (TM), which is 5 km downstream of TMD; 12 fish at Pontal, which is 28 km downstream of TMD and which includes the mouth of the Abaete?? River, and 10 fish at Cilga, which is 45 km downstream of TMD. Late-stage (ripe) adults tagged in each area during the spawning season remained at or near the tagging site, except for four Cilga fish that went to Pontal and probably spawned. The Pontal area at the Abaete?? River mouth was the most important spawning site we found. Prespawning fish moved back and forth between main-stem staging areas upstream of the Abaete?? River mouth and Pontal for short visits. These multiple visits were probably needed as ripe fish waited for spawning cues from a flooding Abaete?? River. Some fish homed to prespaw ning staging areas, spawning areas, and nonspawning areas. The migratory style of zulega was dualistic, with resident and migratory fish. Total linear home range was also dualistic, with small (<26-km) and large (53-127-km) ranges. The locations of spawning areas and home ranges suggest that the Pontal group (which includes Cilga fish) is one population that occupies about 110 km. The Pontal population overlaps a short distance with a population located downstream of Cilga. Movements of late-stage TM adults suggest that the TM group is a separate population, possibly with connections to populations upstream of TMD. ?? Copyright by the American Fisheries Society

  8. Utilisation de traceurs radioactifs pour l'évaluation du recrutement des leucocytes et des échanges vasculaires au niveau d'organes in~vivo. Description d'une méthode et discussion des problèmes d'interprétation sur quelques exemples

    NASA Astrophysics Data System (ADS)

    Bureau, M. F.


    An experimental method using simultaneously different γ emiter tracers was developed to evaluate inflammation in vivo. Experiments were performed on the anaesthetized guinea-pig to test pulmonary effects of inflammatory agents. Red blood cells, albumin and inflammatory cells (platelets or leucocytes) radiolabelled with 99m technetium, 131 iodine and 111 indium respectively were injected i.v. Their radioactivities were measured on a pulmonary region by external detection and on blood samples in a well type counter. From these measurements variations of the lung contents in red blood cells, extravascular albumin and non circulating leucocytes during inflammatory stimulation were evaluated. These parameters axe indexes of blood perfusion, vascular exchanges and leucocyte sequestration respectively. Fiability of the method and meaning of the parameters evaluated are discussed. Une méthode expérimentale utilisant simultanément différents traceurs γ a été développée pour évaluer l'inflammation in vivo. Des expériences ont été réalisées chez le cobaye anesthésié pour tester l'effet pulmonaire d'agents inflammatoires. Des globules rouges, de l'albumine et des cellules inflammatoires (plaquettes ou leucocytes) radiomarqués respectivement au technetium 99m, à l'iode 131 et à l'indium 111 sont injectés i.v. Leurs radioactivités sont mesurées sur une région pulmonaire par détection externe et sur des échantillons sanguins au compteur puit. À partir de ces mesures sont évaluées les variations des contenus pulmonaires en globules rouges, en albumine extravasculaire et en leucocytes non circulants lors d'une stimulation inflammatoire. Ces paramètres sont corrélés aux modifications de la perfusion, des échanges vasculaires et de la séquestration leucocytaire. La fiabilité de la méthode et la signification des paramètres évalués sont discutées.

  9. La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

    NASA Astrophysics Data System (ADS)

    Arroyo Betancourt, Luz I.

    Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las

  10. VizieR Online Data Catalog: Photometry and spectroscopy of V501 Mon (Torres+, 2015)

    NASA Astrophysics Data System (ADS)

    Torres, G.; Lacy, C. H. S.; Pavlovski, K.; Fekel, F. C.; Muterspaugh, M. W.


    Spectroscopic observations of V501 Mon were carried out with three different instruments. They began at the Harvard-Smithsonian Center for Astrophysics (CfA) in 2005 November, using the now decommissioned Digital Speedometer (DS) mounted on the 1.5m Tillinghast reflector at the Fred L. Whipple Observatory on Mount Hopkins (AZ). Seven spectra were recorded through 2009 March with an intensified photon-counting Reticon detector, and cover a narrow span of 45Å centered at 5190Å (MgIb triplet). The resolving power of this instrument was R~35000, and the signal-to-noise ratios of the spectra range from 13 to 22 per resolution element of 8.5km/s. Thirty seven additional spectra were gathered from 2009 November to 2015 February with the Tillinghast Reflector Echelle Spectrograph (TRES) on the same telescope. This bench-mounted, fiber-fed instrument provides a resolving power of R~44000 in 51 orders over the wavelength span 3900-9100Å. The signal-to-noise ratios of the 37 spectra range from 8 to 56 per resolution element of 6.8km/s. The heliocentric velocities we obtained from the DS and TRES spectra are listed in Table2. Between 2011 October and 2015 February we also obtained 57 usable spectra of V501 Mon with the Tennessee State University 2m Automatic Spectroscopic Telescope (AST) and a fiber-fed echelle spectrograph at Fairborn Observatory in southeast Arizona. The detector for these observations was a Fairchild 486 CCD, with 15μm pixels in a 4096*4096 format. The spectrograms have 48 orders ranging from 3800 to 8260Å. Because of the faintness of V501 Mon (V=12.32), we used a fiber that produced a spectral resolution of 0.4Å, corresponding to a resolving power of 15000 at 6000Å. Our spectra have typical signal-to-noise ratios per resolution element of 40 at 6000Å. We list the final values in Table3. An extensive program of CCD photometry was carried out using the NFO WebScope ear Silver City, New Mexico, for the purpose of gathering an accurate V-band light

  11. [In Process Citation].


    Reyna, Nadia; Moreno-Rojas, Rafael; Mendoza, Laura; Parra, Karla; Linares, Sergia; Reyna, Eduardo; Cámara-Martos, Fernando


    Se estudió el consumo de tres tipos de suplementos, proteínas del lactosuero, caseínas y maltodextrinas (control) en la disminución de la ingesta energética y prolongación del efecto de saciedad de 60 mujeres obesas. Después de 10 semanas, la reducción del peso corporal, IMC, % de grasa corporal y circunferencia de la cintura fue significativamente mayor (p < 0,001) en el grupo que consumió las proteínas lactoséricas frente a los otros dos grupos (control y caseínas). También se observa un descenso en la ingesta energética de -383 kcal/día en las mujeres que consumieron las proteínas de lactosuero frente a un descenso de -144 kcal/día en el grupo de caseínas y de tan solo -70 kcal/día en el grupo control. Finalmente la regulación del efecto de saciedad mediante escala visual analógica fue también más efectiva en el caso de las proteínasséricas, que en el caso de las caseínas y maltodextrinas. PMID:27019242

  12. VizieR Online Data Catalog: Planetary candidates from 1st yr K2 mission (Vanderburg+, 2016)

    NASA Astrophysics Data System (ADS)

    Vanderburg, A.; Latham, D. W.; Buchhave, L. A.; Bieryla, A.; Berlind, P.; Calkins, M. L.; Esquerdo, G. A.; Welsh, S.; Johnson, J. A.


    During Campaign 0, K2 observed a field centered at RAJ2000=06:33:11.14,DEJ2000=+21:35:16.40, for a period of 80 days between March and May of 2014. During Campaign 1, K2 observed a field centered at RAJ2000=11:35:45.51,DEJ2000=+01:25:02.28 for 83 days between June and August of 2014. Field 2 of the K2 mission is centered at RAJ2000=16:24:30.34,DEJ2000=-22:26:50.28, and was observed for 79 days between 2014 August and November. Field 3 of the K2 mission is centered at RAJ2000=22:26:39.68,DEJ2000=-11:05:47.99, and was observed for 69 days between 2014 November and 2015 February. We observed 68 stars with the high-resolution Tillinghast Reflector Echelle Spectrograph (TRES; on the 1.5m telescope at Fred L. Whipple Observatory (FLWO) on Mt. Hopkins, Arizona; R=44000) at least once, collecting a total of 101 spectra, and extracted the spectra using the procedure described in Buchhave et al. (2010, J/ApJ/720/1118). See tables 3 and 4. (4 data files).


    SciTech Connect

    Gilliland, Ronald L.; Jenkins, Jon M.; Caldwell, Douglas A.; Clarke, Bruce D.; Quintana, Elisa V.; Twicken, Joseph D.; Van Cleve, Jeffrey E.; Hall, Jennifer; Klaus, Todd; McCauliff, Sean


    The Kepler Mission offers two options for observations-either long cadence (LC) used for the bulk of core mission science, or short cadence (SC) which is used for applications such as asteroseismology of solar-like stars and transit timing measurements of exoplanets where the 1 minute sampling is critical. We discuss the characteristics of SC data obtained in the 33.5 day long Quarter 1 observations with Kepler which completed on 2009 June 15. The truly excellent time series precisions are nearly Poisson limited at 11th magnitude providing per-point measurement errors of 200 parts-per-million per minute. For extremely saturated stars near seventh magnitude precisions of 40 ppm are reached, while for background limited measurements at 17th magnitude precisions of 7 mmag are maintained. We note the presence of two additive artifacts, one that generates regularly spaced peaks in frequency, and one that involves additive offsets in the time domain inversely proportional to stellar brightness. The difference between LC and SC sampling is illustrated for transit observations of TrES-2.

  14. La opacidad atmosférica del CASLEO a ondas milimétricas

    NASA Astrophysics Data System (ADS)

    Bareilles, F.; Olalde, J.; Picardo, C.; Guarrera, L.; Arnal, E. M.; Morras, R.; Perilli, D.; Salazar, P.

    Mediante el uso de un radiómetro que trabaja en la frecuencia de 210 GHz, se han realizado mediciones de la transparencia de la atmósfera a esa frecuencia. Los sitios en los que se han realizado las medidas, corresponden al Cerro Negro de la Tina (Cerro Burek), ubicado a unos 2650 m de altura, y a un sitio ubicado a unos 3400 m de altura, localizado en la Pampa del Jarillal. Las mediciones forman parte de una campaña que cubrirá un lapso de tres años, durante la cual se caracterizan distintas zonas ubicadas en la cordillera. Los resultados que se comunican fueron obtenidos durante el período diciembre de 2002 a septiembre de 2003. Se realiza una comparación preliminar entre la opacidad atmosférica de los lugares mencionados y aquélla de otros sitios en los que se encuentran instaladas facilidades observacionales que operan en la banda milimétrica y submilimétrica del espectro.

  15. Production de faisceaux EPR à l'aide d'un oscillateur paramétrique optique à auto-verrouillage de phase

    NASA Astrophysics Data System (ADS)

    Longchambon, L.; Laurat, J.; Treps, N.; Ducci, S.; Maître, A.; Coudreau, T.; Fabre, C.


    Nous étudions théoriquement les propriétés quantiques des faisceaux lumineux continus orthogonalement polarisés émis par un Oscillateur Paramétrique Optique (OPO) de type II contenant une lame biréfringente. Quand les axes optiques de la lame sont tournés par rapport à ceux du cristal paramétrique, un couplage apparaît entre les faisceaux signal et complémentaire qui entraîne un verrouillage de phase entre les deux modes et un fonctionnement à dégénérescence de fréquence à l'intérieur d'une zone d'accrochage. Les corrélations quantiques entre les deux faisceaux permettent de définir les zones dans l'espace des paramètres expérimentaux où les différents critères associés à l'intrication EPR utilisés en information quantique sont vérifiés.

  16. Algorithmes et architectures pour ordinateurs quantiques supraconducteurs

    NASA Astrophysics Data System (ADS)

    Blais, Alexandre

    Depuis sa formulation, la theorie de l'information a ete basee, implicitement, sur les lois de la physique classique. Une telle formulation est toutefois incomplete puisqu'elle ne tient pas compte de la realite quantique. Au cours des vingt dernieres annees, l'expansion de la theorie de l'information englobant les effets purement quantiques a connu un interet grandissant. La realisation d'un systeme de traitement de l'information quantique, un ordinateur quantique, presente toutefois de nombreux defis. Dans ce document, on s'interesse a differents aspects concernant ces defis. On commence par presenter des concepts algorithmiques comme l'optimisation de calculs quantiques et le calcul quantique geometrique. Par la suite, on s'interesse au design et a differents aspects de l'utilisation de qubits bases sur les jonctions Josephson. En particulier, un nouveau design de qubit supraconducteur est suggere. On presente aussi une approche originale pour l'interaction entre qubits. Cette approche est tres generale puisqu'elle peut etre appliquee a differents designs de qubits. Finalement, on s'interesse a la lecture des qubits supraconducteurs de flux. Le detecteur suggere ici a l'avantage de pouvoir etre decouple du qubit lorsqu'il n'y a pas de mesure en cours.

  17. Vers des boites quantiques a base de graphene

    NASA Astrophysics Data System (ADS)

    Branchaud, Simon

    Le graphene est un materiau a base de carbone qui est etudie largement depuis 2004. De tres nombreux articles ont ete publies tant sur les proprietes electroniques, qu'optiques ou mecaniques de ce materiel. Cet ouvrage porte sur l'etude des fluctuations de conductance dans le graphene, et sur la fabrication et la caracterisation de nanostructures gravees dans des feuilles de ce cristal 2D. Des mesures de magnetoresistance a basse temperature ont ete faites pres du point de neutralite de charge (PNC) ainsi qu'a haute densite electronique. On trouve deux origines aux fluctuations de conductance pres du PNC, soit des oscillations mesoscopiques provenant de l'interference quantique, et des fluctuations dites Hall quantique apparaissant a plus haut champ (>0.5T), semblant suivre les facteurs de remplissage associes aux monocouches de graphene. Ces dernieres fluctuations sont attribuees a la charge d'etats localises, et revelent un precurseur a l'effet Hall quantique, qui lui, ne se manifeste pas avant 2T. On arrive a extraire les parametres caracterisant l'echantillon a partir de ces donnees. A la fin de cet ouvrage, on effectue des mesures de transport dans des constrictions et ilots de graphene, ou des boites quantiques sont formees. A partir de ces mesures, on extrait les parametres importants de ces boites quantiques, comme leur taille et leur energie de charge.

  18. Biochemical Screening of Five Protein Kinases from Plasmodium falciparum against 14,000 Cell-Active Compounds

    PubMed Central

    Crowther, Gregory J.; Hillesland, Heidi K.; Keyloun, Katelyn R.; Reid, Molly C.; Lafuente-Monasterio, Maria Jose; Ghidelli-Disse, Sonja; Leonard, Stephen E.; He, Panqing; Jones, Jackson C.; Krahn, Mallory M.; Mo, Jack S.; Dasari, Kartheek S.; Fox, Anna M. W.; Boesche, Markus; El Bakkouri, Majida; Rivas, Kasey L.; Leroy, Didier; Hui, Raymond; Drewes, Gerard; Maly, Dustin J.; Van Voorhis, Wesley C.; Ojo, Kayode K.


    In 2010 the identities of thousands of anti-Plasmodium compounds were released publicly to facilitate malaria drug development. Understanding these compounds’ mechanisms of action—i.e., the specific molecular targets by which they kill the parasite—would further facilitate the drug development process. Given that kinases are promising anti-malaria targets, we screened ~14,000 cell-active compounds for activity against five different protein kinases. Collections of cell-active compounds from GlaxoSmithKline (the ~13,000-compound Tres Cantos Antimalarial Set, or TCAMS), St. Jude Children’s Research Hospital (260 compounds), and the Medicines for Malaria Venture (the 400-compound Malaria Box) were screened in biochemical assays of Plasmodium falciparum calcium-dependent protein kinases 1 and 4 (CDPK1 and CDPK4), mitogen-associated protein kinase 2 (MAPK2/MAP2), protein kinase 6 (PK6), and protein kinase 7 (PK7). Novel potent inhibitors (IC50 < 1 μM) were discovered for three of the kinases: CDPK1, CDPK4, and PK6. The PK6 inhibitors are the most potent yet discovered for this enzyme and deserve further scrutiny. Additionally, kinome-wide competition assays revealed a compound that inhibits CDPK4 with few effects on ~150 human kinases, and several related compounds that inhibit CDPK1 and CDPK4 yet have limited cytotoxicity to human (HepG2) cells. Our data suggest that inhibiting multiple Plasmodium kinase targets without harming human cells is challenging but feasible. PMID:26934697

  19. Étude comparative de l’innocuité de deux vaccins commerciaux contre la babésiose canine provoquée par Babesia canis

    PubMed Central

    Freyburger, L.; Lemaitre, L.; Médaille, C.; Oberli, F.; Fanchon, L.; Bergamo, P.


    L’innocuité de deux vaccins commercialisés en France contre la babésiose canine – Nobivac Piro® (NP) et Pirodog® (P) – a été étudiée. Leur impact local, général et biochimique a été comparé, en conditions expérimentales maîtrisées, sur un groupe témoin (T) et deux groupes vaccinés deux fois à 21 jours d’intervalle. Tous les chiens ont présenté une réaction locale modérée. Cependant, le groupe NP a présenté une réaction locale significativement plus intense que le groupe P. Ceci est objectivé par les paramètres cliniques et biologiques. Aucune différence statistiquement significative n’est mise en évidence entre les évolutions des groupes P et T. PMID:22091461

  20. Earthquake source mechanisms and transform fault tectonics in the Gulf of California

    NASA Technical Reports Server (NTRS)

    Goff, John A.; Bergman, Eric A.; Solomon, Sean C.


    The source parameters of 19 large earthquakes in the Gulf of California were determined from inversions of long-period P and SH waveforms. The goal was to understand the recent slip history of this dominantly transform boundary between the Pacific and North American plates as well as the effect on earthquake characteristics of the transition from young oceanic to continental lithosphere. For the better recorded transform events, the fault strike is resolved to + or - 4 deg at 90 percent confidence. The slip vectors thus provide important constraints on the direction of relative plate motion. Most centroid depths are poorly resolved because of tradeoffs between depth and source time function. On the basis of waveform modeling, historical seismicity, and other factors, it is appropriate to divide the Gulf into three distinct zones. The difference in seismic character among the three zones is likely the result of differing levels of maturity of the processes of rifting, generation of oceanic crust, and formation of stable oceanic transform faults. The mechanism of an earthquake on the Tres Marias Escarpment is characterized by thrust faulting and likely indicates the direction of relative motion between the Rivera and North American plates. This mechanism requires revision in plate velocity models which predict strike slip motion at this location.

  1. T@lemed: Ehealth applications applied to underserved areas in Latin America

    NASA Astrophysics Data System (ADS)

    Sachpazidis, Ilias; Ohl, Roland; Binotto, Alécio Pedro Delazari; Torres, Márcio Soares; Messina, Luiz Ary; Sales, Alexandre; Gomes, Ricardo; Sakas, Georgios


    Access to medical care is sometimes very difficult to be reached from people living in rural and underserved areas. This problem is very well known in rural areas in Brazil. Citizens have no access to health care. They have to travel hundreds of kilometres to receive medical care. In this paper, we will propose a medical network based on state-of-the-art medical imaging application that addresses the problems of providing health care from a distance. Additionally, we are going to show preliminarily results of the first year of the system deployment and utilization in undeserved regions in Brazil. The total number of patients submitted to ultrasound examinations, during the 10 months of projects' medical trials, is 321. The exams have begun with the elderly people (hypertension and diabetes cases) with 90% above 50-years-old. Fifty-four percent were male and 46% were female. From those exams, 67 exams (21%) needed a second medical opinion and were transmitted to Santa Casa hospital in Porto Alegre, Brazil, one of the referral medical centres. From those second opinions of Santa Casa, 12 exams had to be repeated since the acquired images were not sufficient to give a correct diagnosis. The Lagoa Tres Cantos medical doctor performed also preventive exams with patients who had not presented any symptoms (70%).

  2. Engineered crumpled graphene oxide nanocomposite membrane assemblies for advanced water treatment processes.


    Jiang, Yi; Wang, Wei-Ning; Liu, Di; Nie, Yao; Li, Wenlu; Wu, Jiewei; Zhang, Fuzhong; Biswas, Pratim; Fortner, John D


    In this work, we describe multifunctional, crumpled graphene oxide (CGO) porous nanocomposites that are assembled as advanced, reactive water treatment membranes. Crumpled 3D graphene oxide based materials fundamentally differ from 2D flat graphene oxide analogues in that they are highly aggregation and compression-resistant (i.e., π-π stacking resistant) and allow for the incorporation (wrapping) of other, multifunctional particles inside the 3D, composite structure. Here, assemblies of nanoscale, monomeric CGO with encapsulated (as a quasi core-shell structure) TiO2 (GOTI) and Ag (GOAg) nanoparticles, not only allow high water flux via vertically tortuous nanochannels (achieving water flux of 246 ± 11 L/(m(2)·h·bar) with 5.4 μm thick assembly, 7.4 g/m(2)), outperforming comparable commercial ultrafiltration membranes, but also demonstrate excellent separation efficiencies for model organic and biological foulants. Further, multifunctionality is demonstrated through the in situ photocatalytic degradation of methyl orange (MO), as a model organic, under fast flow conditions (tres < 0.1 s); while superior antimicrobial properties, evaluated with GOAg, are observed for both biofilm (contact) and suspended growth scenarios (>3 log effective removal, Escherichia coli). This is the first demonstration of 3D, crumpled graphene oxide based nanocomposite structures applied specifically as (re)active membrane assemblies and highlights the material's platform potential for a truly tailored approach for next generation water treatment and separation technologies. PMID:25942505

  3. Cellulose Degradation by Sulfolobus solfataricus Requires a Cell-Anchored Endo-β-1-4-Glucanase

    PubMed Central

    Girfoglio, Michele; Rossi, Mosé


    A sequence encoding a putative extracellular endoglucanase (sso1354) was identified in the complete genome sequence of Sulfolobus solfataricus. The encoded protein shares signature motifs with members of glycoside hydrolases family 12. After an unsuccessful first attempt at cloning the full-length coding sequences in Escherichia coli, an active but unstable recombinant enzyme lacking a 27-residue N-terminal sequence was generated. This 27-amino-acid sequence shows significant similarity with corresponding regions in the sugar binding proteins AraS, GlcS, and TreS of S. solfataricus that are responsible for anchoring them to the plasma membrane. A strategy based on an effective vector/host genetic system for Sulfolobus and on expression control by the promoter of the S. solfataricus gene which encodes the glucose binding protein allowed production of the enzyme in sufficient quantities for study. In fact, the enzyme expressed in S. solfataricus was stable and highly thermoresistant and showed optimal activity at low pH and high temperature. The protein was detected mainly in the plasma membrane fraction, confirming the structural similarity to the sugar binding proteins. The results of the protein expression in the two different hosts showed that the SSO1354 enzyme is endowed with an endo-β-1-4-glucanase activity and specifically hydrolyzes cellulose. Moreover, it also shows significant but distinguishable specificity toward several other sugar polymers, such as lichenan, xylan, debranched arabinan, pachyman, and curdlan. PMID:22821975

  4. CAG repeat expansions in bipolar and unipolar disorders

    SciTech Connect

    Oruc, L.; Verheyen, G.R.; Raeymaekers, P.; Van Broeckhoven, C.


    Family, twin, and adoption studies consistently have indicated that the familial aggregation of bipolar (BP) disorder and unipolar recurrent major depression (UPR) is accounted for largely by genetic factors. However, the mode of inheritance is complex. One of the possible explanations could be that a gene with variable penetrance and variable expression is involved. Recently there have been reports on a new class of genetic diseases caused by an abnormal trinucleotide-repeat expansion (TRE). In a number of genetic disorders, these dynamic mutations were proved to be the biological basis for the clinically observed phenomenon of anticipation. DNA consisting of repeated triplets of nucleotides becomes unstable and increases in size over generations within families, giving rise to an increased severity and/or an earlier onset of the disorder. It has been recognized for a long time that anticipation occurs in multiplex families transmitting mental illness. More recent studies also suggest that both BP disorder and UPR show features that are compatible with anticipation. Although the findings of anticipation in BP disorders and in UPR must be interpreted with caution because of the possible presence of numerous ascertainment biases, they support the hypothesis that pathological TREs are implicated in the transmission of these disorders. TRE combined with variable penetrance of expression could explain the complex transmission pattern observed in BP disorder. In view of this, the recent reports of an association between CAG-repeat length and BP disorder in a Belgian, Swedish, and British population are promising. 14 refs., 1 fig., 1 tab.

  5. Probing Planetary Magnetic Fields During Transits

    NASA Astrophysics Data System (ADS)

    Vidotto, A. A.; Jardine, M.; Helling, C.


    Recently, Fossati et al. observed that the near-UV transit light curve of the close-in giant planet WASP-12b shows an early ingress as compared to its optical transit. Such observations were interpreted as due to the presence of asymmetries in the exosphere of the planet. In particular, we suggest that this asymmetry could be explained by the presence of a shock formed around the planet's magnetosphere. Bow shocks are formed as a result of the interaction of the planet with the coronal material of the host star, similar to the one formed around the Earth's magnetosphere. According to our model, shock detection through transit observations can be a useful tool to probe and constrain exoplanetary magnetic field. In the case of WASP- 12b, we derive an upper limit for the magnetic field of ∼ 24 G. In addition, we predict that observable shocks should be a common feature in other transiting systems. Promising candidates are: WASP- 19b, WASP-4b, WASP-18b, CoRoT-7b, HAT-P-7b, CoRoT-1b, TrES-3 and WASP-5b.

  6. Characterization of Fluorescence of ANS–Tear Lipocalin Complex: Evidence for Multiple-Binding Modes

    PubMed Central

    Gasymov, Oktay K.; Abduragimov, Adil R.; Glasgow, Ben J.


    ANS is widely used as a probe for locating binding sites of proteins and studying structural changes under various external conditions. However, the nature of ANS-binding sites in proteins and the accompanying changes in fluorescence properties are controversial. We examined the steady-state and time-resolved fluorescence of the ANS–protein complexes for tear lipocalin (TL) and its mutants in order to discern the origin of lifetime components via analysis that included the multiexponential decay and the model-free maximum entropy methods. Fluorescence lifetimes of ANS–TL complexes can be grouped into two species, 14.01–17.42 ns and 2.72–4.37 ns. The log-normal analyses of fluorescence spectral shapes reveal the heterogeneous nature of both long- and short-lifetime species. The constructed time-resolved emission, amplitude (TRES) and area normalized (TRANES), and decay-associated spectra are consistent with a model that includes heterogeneous modes of ANS binding with two separate lifetime components. The two lifetime components are not derived from solvent relaxation, but rather may represent different binding modes. PMID:18028215

  7. Characterization of fluorescence of ANS-tear lipocalin complex: evidence for multiple-binding modes.


    Gasymov, Oktay K; Abduragimov, Adil R; Glasgow, Ben J


    ANS is widely used as a probe for locating binding sites of proteins and studying structural changes under various external conditions. However, the nature of ANS-binding sites in proteins and the accompanying changes in fluorescence properties are controversial. We examined the steady-state and time-resolved fluorescence of the ANS-protein complexes for tear lipocalin (TL) and its mutants in order to discern the origin of lifetime components via analysis that included the multiexponential decay and the model-free maximum entropy methods. Fluorescence lifetimes of ANS-TL complexes can be grouped into two species, 14.01-17.42 ns and 2.72-4.37 ns. The log-normal analyses of fluorescence spectral shapes reveal the heterogeneous nature of both long- and short-lifetime species. The constructed time-resolved emission, amplitude (TRES) and area normalized (TRANES), and decay-associated spectra are consistent with a model that includes heterogeneous modes of ANS binding with two separate lifetime components. The two lifetime components are not derived from solvent relaxation, but rather may represent different binding modes. PMID:18028215

  8. Implantation des sites de soins communautaires en République Démocratique du Congo: consécration d'un double standard dans l'accès aux soins

    PubMed Central

    Dunia, Gisèle Mawazo Binti


    Depuis 2005, la République Démocratique du Congo a amorcé l'implantation des sites de soins communautaires. Cette stratégie a pour objectif de rapprocher les services de santé des populations éloignées. Bien que cela parte d'une bonne intention, elle résulte, à notre sens, en une consécration d'un système de santé à deux vitesses. En effet, les populations vivant en ville ont accès à des soins prestés par des agents de santé formés alors que celles vivant en milieu rural reculé ont pour prestataires de soins des relais communautaires. Cette situation marginalise encore plus des populations dont la situation géographique est déjà préoccupante. Pourtant, la population est prête à parcourir des kilomètres en échange d'un service qu'elle estime de qualité. PMID:23785563

  9. Plasma activated dissociation of CO2 studied in a dielectric barrier discharge

    NASA Astrophysics Data System (ADS)

    Engeln, Richard; Brehmer, Florian; Welzel, Stefan; Klarenaar, Bart; van de Sanden, Richard; Tu/E Collaboration; Afs Gmbh Collaboration; Differ Collaboration


    The ever-increasing emission of carbon dioxide into the atmosphere as well as the intermittency problem of electricity produced by renewable energy sources are challenges that urgently need to be addressed. An approach addressing both issues at the same time is converting CO2 to a fuel using plasma driven by electricity from renewable sources. We will present in this contribution the results of a study on the conversion of CO2 to CO in a dielectric barrier discharge in pure CO2 at pressures up to 1000 mbar: FTIR absorption and Raman spectroscopy were applied to measure CO number densities and gas temperatures as function of the specific injected energy. CO densities with a maximum at 1018 cm-3 (mixing ratio of 4.4%) at 46 kJ/sl, energy efficiencies in the range of a few percent and gas temperatures up to 550 K were detected. The CO production is directly linked with the total number of transferred charges q during the residence time tres of CO2 molecules. Also ozone has been detected with a maximum mixing ratio of 0.075%.

  10. Natural Enemies of the Frankliniella Complex Species (Thysanoptera: Thripidae) in Ataulfo Mango Agroecosystems

    PubMed Central

    Rocha, Franklin H.; Infante, Francisco; Castillo, Alfredo; Ibarra-Nuñez, Guillermo; Goldarazena, Arturo; Funderburk, Joe E.


    A field survey was conducted in Ataulfo mango (Mangifera indica L.) orchards in Chiapas, Mexico, with the objective of determining the natural enemies of the Frankliniella complex species (Thysanoptera: Thripidae). Seven species of this genus feed and reproduce in large numbers during the mango flowering. Two representative orchards were selected: the orchard “Tres A” characterized by an intensive use of agrochemicals directed against thrips, and the orchard “La Escondida” that did not spray insecticides. During mango flowering, five inflorescences were randomly collected every 5 d in both orchards, for a total of 18 sampling dates. Results revealed the presence of 18 species of arthropods that were found predating on Frankliniella. There were 11 species in the families Aeolothripidae, Phlaeothripidae, Formicidae, Anthocoridae and Chrysopidae; and seven species of spiders in the families Araneidae, Tetragnathidae, and Uloboridae. Over 88% of predators were anthocorids, including, Paratriphleps sp. (Champion), Orius insidiosus (Say), Orius tristicolor (White), and O. perpunctatus (Reuter). The orchard that did not spray insecticides had a significantly higher number of predators suggesting a negative effect of the insecticides on the abundance of these organisms. PMID:26246440

  11. Nouvelle structure de capteur à courants de Foucault et algorithme associé pour la mesure des propriétés électrique et magnétique d'un métal

    NASA Astrophysics Data System (ADS)

    Lê, Minh-Quang; Placko, Dominique


    This paper describes a new structure for eddy-current transducers which improves sensitivity while maintaining high lateral resolution. We have developed an analytical model to allow a model-based inversion from transducers signals to estimate thick and homogeneous plates electrical conductivity, magnetic permeability and/or lift-off. The inversion procedure is described and shows the possibility of a precise simultaneous estimation of the three parameters. Experiments were conducted with magnetic and non magnetic metals. Cet article décrit une nouvelle structure de capteur à courants de Foucault qui permet d'améliorer la sensibilité du capteur tout en conservant sa résolution latérale. Nous avons développé un modèle analytique de ce capteur qui peut être inversé pour estimer la conductivité électrique, la perméabilité magnétique d'une cible homogène et/ou la distance capteur-cible. La procédure d'inversion a été décrite et montre une possibilité d'estimer ces trois paramètres avec précision. L'expérience a été effectuée sur des métaux magnétiques et amagnétiques.

  12. Commande vectorielle d'un moteur asynchrone sans capteur

    NASA Astrophysics Data System (ADS)

    Ourth, T.


    A field-oriented control strategy for induction machines which does not use mechanical sensors is presented. The rotor flux is observed by a reduced-order Luenberger-type observer based on a model using a stator-fixed reference frame. An estimate of the rotation speed is derived from the flux vector, the measured stator currents and the field orientation angle. Simulations demonstrate that this control strategy performs well even in the presence of parameter variations up to ± 50% (resistances). Ce papier présente la commande par flux orienté d'une machine asynchrone sans capteur de vitesse ou de position. Le flux rotorique est évalué grâce à un observateur d'ordre réduit d'un type voisin de Luenberger travaillant dans un repère fixe statorique. L'estimation de la vitesse est obtenue à partir du module du flux rotorique, des courants statoriques mesurés et de l'angle d'orientation du flux rotorique. Cette étude basée sur des simulations démontre un comportement acceptable de la commande malgré la variation des paramètres comme les résistances de la machine.

  13. Water flow and energy balance for a tropical dry semideciduous forest

    NASA Astrophysics Data System (ADS)

    Andrade, J. L.; Garruña-Hernandez, R.; Leon-Palomo, M.; Us-Santamaria, R.; Sima, J. L.


    Tropical forests cool down locally because increase water evaporation from the soil to the atmosphere, reduce albedo and help forming clouds that reflect solar radiation back to the atmosphere; this, aligned to the carbon catchment, increase forests value. We will present an estimation of the sap flow and energy balance for the tropical dry semideciduous forest at Kiuic, Yucatan, Mexico during a year. We use a meteorological tower equipped with a rain gauge, temperature and relative humidity, heat flow plates, thermocouples and volumetric soil water content. We recorded net radiation and soil heat flux and estimated sensible heat and latent heat. Besides, we estimated latent heat by measuring sap flow directly in tres using disispation constant heat probes during the rainy season. Results show the influence of the seasonality on net radiation, air temperatura and vapor pressure deficit, because during the dry season his variables were higher and with more duation than during the rainy and early dry season. Sap flow was different for trees belonging to the family Fabaceae compared to trees from other families.

  14. A New Set of Chemical Starting Points with Plasmodium falciparum Transmission-Blocking Potential for Antimalarial Drug Discovery

    PubMed Central

    Almela, Maria Jesus; Lozano, Sonia; Lelièvre, Joël; Colmenarejo, Gonzalo; Coterón, José Miguel; Rodrigues, Janneth; Gonzalez, Carolina; Herreros, Esperanza


    The discovery of new antimalarials with transmission blocking activity remains a key issue in efforts to control malaria and eventually eradicate the disease. Recently, high-throughput screening (HTS) assays have been successfully applied to Plasmodium falciparum asexual stages to screen millions of compounds, with the identification of thousands of new active molecules, some of which are already in clinical phases. The same approach has now been applied to identify compounds that are active against P. falciparum gametocytes, the parasite stage responsible for transmission. This study reports screening results for the Tres Cantos Antimalarial Set (TCAMS), of approximately 13,533 molecules, against P. falciparum stage V gametocytes. Secondary confirmation and cytotoxicity assays led to the identification of 98 selective molecules with dual activity against gametocytes and asexual stages. Hit compounds were chemically clustered and analyzed for appropriate physicochemical properties. The TCAMS chemical space around the prioritized hits was also studied. A selection of hit compounds was assessed ex vivo in the standard membrane feeding assay and demonstrated complete block in transmission. As a result of this effort, new chemical structures not connected to previously described antimalarials have been identified. This new set of compounds may serve as starting points for future drug discovery programs as well as tool compounds for identifying new modes of action involved in malaria transmission. PMID:26317851

  15. Biological Functions of Thyroid Hormone in Placenta

    PubMed Central

    Chen, Cheng-Yi; Chen, Chie-Pein; Lin, Kwang-Huei


    The thyroid hormone, 3,3,5-triiodo-l-thyronine (T3), modulates several physiological processes, including cellular growth, differentiation, metabolism, inflammation and proliferation, via interactions with thyroid hormone response elements (TREs) in the regulatory regions of target genes. Infection and inflammation are critical processes in placental development and pregnancy-related diseases. In particular, infection is the leading cause of neonatal mortality and morbidity worldwide. However, to date, no successful approach has been developed for the effective diagnosis of infection in preterm infants. Pre-eclampsia (PE) is a serious disorder that adversely affects ~5% of human pregnancies. Recent studies identified a multiprotein complex, the inflammasome, including the Nod-like receptor (NLR) family of cytosolic pattern recognition receptors, the adaptor protein apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and caspase-1, which plays a vital role in the placenta. The thyroid hormone modulates inflammation processes and is additionally implicated in placental development and disease. Therefore, elucidation of thyroid hormone receptor-regulated inflammation-related molecules, and their underlying mechanisms in placenta, should facilitate the identification of novel predictive and therapeutic targets for placental disorders. This review provides a detailed summary of current knowledge with respect to identification of useful biomarkers and their physiological significance in placenta. PMID:25690032

  16. Structure cristalline de la 4-méthyl-1,2,4-triazole-thione

    NASA Astrophysics Data System (ADS)

    El Hajji, A.; El Ammari, L.; Mattern, G.; Benarafa, L.; Saidi Idrissi, M.


    The 4-methyl-1,2,4-triazole-thione crystalizes in the monoclinic system with the space group P21/n. The unit cell parameters are: a = 7.946 Å; b = 6.295 Å; c = 20.901 Å; β=100.47circ and Z = 8. The structure refinement lead to R = 0.047 and Rw = 0.035 factors. The molecules are planar and are joined together through hydrogen bonds N-H...N. Among the two possible tautomeric forms, only the thione form is present in the crystal structure. La 4-méthyl-1,2,4-triazole-thione cristallise dans un système monoclinique avec un groupe d'espace P21/n. Les paramètres cristallins sont : a = 7,946 Å ; b = 6,295 Å ; c = 20,901 Å ; β=100,47circ et Z = 8. L'affinement de la structure a conduit aux facteurs R = 0,047 et Rw = 0,035. Les molécules sont planes et sont liées entre elles par des liaisons hydrogène N- - -H....N. Parmi les deux formes tautomères possibles pour cette molécule, seule existe dans le cristal, la forme thione.

  17. Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual.


    Barrios, Liliana Mondragón


    El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar. PMID:22754085

  18. Liquid metal thermoelectric converter (LMTEC) for solar applications

    SciTech Connect

    Martinez, J.I.


    An overview is given of the research and development plan for the Liquid Metal Thermoelectric Converter (LMTEC) being undertaken by Sandia Laboratories under the Solar Thermal Technologies program of DOE. Sandia initiated work in this area less than a year ago and has pursued the work as a specific subtask starting in FY 1985. As with any new project, a significant part of the initial effort has been spent on reviewing the current technology in thermo-electric converters including Thermally Regenerative Electrochemical Systems (TRES), fuel cells, thermionic devices, magnetohydrodynamics, and other modes of direct thermal-to-electric conversion. Consequently, no formal research results are included in this paper and the presentation is intended more to indicate those areas in which further research and development efforts could be expended to prove of positive impact on the solar application of LMTEC. The principal objective of this task is to design, engineer, and develop a LMTEC suitable for use in solar distributed receiver applications. Since the thermal requirements for the LMTEC are in the temperature range of parabolic dishes, the engineering development effort will concentrate on a device that can be mounted at the focal point of a dish and preferably incorporated into the receiver. Due to a technology review, the LMTEC most likely will be based on the current Sodium Heat Engine (SHE) concept. Our main effort will consist of optimizing the concept for solar applications and conducting the necessary engineering development to produce a 20 to 50 kWe device.

  19. Advective Mechanisms in Tree Island Formation

    NASA Astrophysics Data System (ADS)

    Stothoff, S.


    Tree islands are important landscape features in the Florida Everglades. Tres islands are formed of peat deposited on the shallow limestone bedrock, and have been stressed as the system has changed in response to anthropogenic activities due to the sensitivity of organic soils to hydrologic cycles. The plume shape aligned with flow direction for typical tree islands is characteristic of advective transport, despite the rather low flow velocities in the system. Hypothesized mechanisms for the plume shape include sediment transport downstream from the head of the island (often anchored by a bedrock rise), or nutrient transport downstream allowing plants to produce more sediments in situ. Understanding mechanisms controlling tree island shape will aid in understanding the response of tree islands to hydrologic management. An integrated system of field, laboratory, and modeling studies is underway, with the first effort aimed at bounding the importance of the simpler sediment transport processes before tackling more-complex nutrient transport processes. The numerical model integrating the field and laboratory efforts is a 3D finite volume model considering water flow in the shallow groundwater/surface-water system together with sediment transport. The model can account for variable vegetative resistance through the flow column, including the important case where a dense mat forms at the surface. Model components specific for this system and associated data requirements are presented.

  20. New avenues for regulation of lipid metabolism by thyroid hormones and analogs.


    Senese, Rosalba; Lasala, Pasquale; Leanza, Cristina; de Lange, Pieter


    Weight loss due to negative energy balance is a goal in counteracting obesity and type 2 diabetes mellitus. The thyroid is known to be an important regulator of energy metabolism through the action of thyroid hormones (THs). The classic, active TH, 3,5,3'-triiodo-L-thyronine (T3) acts predominantly by binding to nuclear receptors termed TH receptors (TRs), that recognize TH response elements (TREs) on the DNA, and so regulate transcription. T3 also acts through "non-genomic" pathways that do not necessarily involve TRs. Lipid-lowering therapies have been suggested to have potential benefits, however, the establishment of comprehensive therapeutic strategies is still awaited. One drawback of using T3 in counteracting obesity has been the occurrence of heart rhythm disturbances. These are mediated through one TR, termed TRα. The end of the previous century saw the exploration of TH mimetics that specifically bind to TR beta in order to prevent cardiac disturbances, and TH derivatives such as 3,5-diiodo-L-thyronine (T2), that possess interesting biological activities. Several TH derivatives and functional analogs have low affinity for the TRs, and are suggested to act predominantly through non-genomic pathways. All this has opened new perspectives in thyroid physiology and TH derivative usage as anti-obesity therapies. This review addresses the pros and cons of these compounds, in light of their effects on energy balance regulation and on lipid/cholesterol metabolism. PMID:25538628

  1. Des proprietes de l'etat normal du modele de Hubbard bidimensionnel

    NASA Astrophysics Data System (ADS)

    Lemay, Francois

    Depuis leur decouverte, les etudes experimentales ont demontre que les supra-conducteurs a haute temperature ont une phase normale tres etrange. Les proprietes de ces materiaux ne sont pas bien decrites par la theorie du liquide de Fermi. Le modele de Hubbard bidimensionnel, bien qu'il ne soit pas encore resolu, est toujours considere comme un candidat pour expliquer la physique de ces composes. Dans cet ouvrage, nous mettons en evidence plusieurs proprietes electroniques du modele qui sont incompatibles avec l'existence de quasi-particules. Nous montrons notamment que la susceptibilite des electrons libres sur reseau contient des singularites logarithmiques qui influencent de facon determinante les proprietes de la self-energie a basse frequence. Ces singularites sont responsables de la destruction des quasi-particules. En l'absence de fluctuations antiferromagnetiques, elles sont aussi responsables de l'existence d'un petit pseudogap dans le poids spectral au niveau de Fermi. Les proprietes du modele sont egalement etudiees pour une surface de Fermi similaire a celle des supraconducteurs a haute temperature. Un parallele est etabli entre certaines caracteristiques du modele et celles de ces materiaux.

  2. En la búsqueda de características en eyecciones coronales de masa que discriminen entre dos paradigmas físicos en modelos de ECMs

    NASA Astrophysics Data System (ADS)

    Paissan, G.; Stenborg, G.; Rovira, M.

    Se conocen tres diferentes fenómenos de gran escala que ocurren en la atmósfera solar, denominados eyecciones coronales de masa (ECMs), protuberancias eruptivas y grandes fulguraciones de dos bandas. Estos fenómenos están estrechamente relacionados y podrían ser distintas manifestaciones de un único proceso físico. Las ECMs son definidas como eyecciones de gran escala de masa y flujo magnético desde la baja corona al espacio interplanetario. Desde su descubrimiento en los '70, muchos modelos han sido propuestos para explicar su origen y evolución. La explicación física de las ECMs es un tema de debate intenso. No obstante, los modelos pueden sintetizarse en dos grandes grupos: 1) los modelos de inyección de flujo y 2) los modelos de almacenamiento y liberación. En este trabajo, se presentan los estudios realizados con una serie de eventos observados con el coronógrafo MICA (Mirror Coronograph for Argentina), el telescopio en H-alfa HASTA (H-alpha Solar Telescope for Argentina) y los coronógrafos C2 y C3 de la sonda SOHO (Solar and Heliospheric Observatory). Los eventos que pudieron ser identificados como ECMs son contrastados dentro del esquema de los dos paradigmas teóricos propuestos.

  3. Biocatalytic Production of Trehalose from Maltose by Using Whole Cells of Permeabilized Recombinant Escherichia coli.


    Zheng, Zhaojuan; Xu, Ying; Sun, Ye; Mei, Wending; Ouyang, Jia


    Trehalose is a non-reducing disaccharide, which can protect proteins, lipid membranes, and cells from desiccation, refrigeration, dehydration, and other harsh environments. Trehalose can be produced by different pathways and trehalose synthase pathway is a convenient, practical, and low-cost pathway for the industrial production of trehalose. In this study, 3 candidate treS genes were screened from genomic databases of Pseudomonas and expressed in Escherichia coli. One of them from P. stutzeri A1501 exhibited the best transformation ability from maltose into trehalose and the least byproduct. Thus, whole cells of this recombinant E. coli were used as biocatalyst for trehalose production. In order to improve the conversion rate of maltose to trehalose, optimization of the permeabilization and biotransformation were carried out. Under optimal conditions, 92.2 g/l trehalose was produced with a high productivity of 23.1 g/(l h). No increase of glucose was detected during the whole course. The biocatalytic process developed in this study might serve as a candidate for the large scale production of trehalose. PMID:26462117

  4. Digitalización de diapositivas del Sol en H α

    NASA Astrophysics Data System (ADS)

    Missio, H.; Montenegro, C.; Montenegro, R.

    El objetivo de este trabajo ha sido el de obtener imágenes digitalizadas de las diapositivas tomadas del Sol en luz de hidrógeno de la línea correspondiente a Hα, y de esta manera llegar a convertir las mismas a un archivo digital para poder ser tratadas luego por computadora y poder contabilizar con exactitud, mediante un programa adecuado para tal fin, las zonas activas del Sol en la imagen digitalizada. En principio, para llegar a esto se pensó en la utilización de medios accesibles, y como detector se utilizó un fototransistor ubicado dentro de un soporte rectangular sobre dos ejes de desplazamiento X e Y. Se han obtenido con este procedimiento imágenes de buena calidad, construídas a partir de tres datos digitalizados en cada barrido que aportan la posición X e Y y la intensidad del pixel en ese punto indicada en 255 tonos de grises.

  5. Natural Enemies of the Frankliniella Complex Species (Thysanoptera: Thripidae) in Ataulfo Mango Agroecosystems.


    Rocha, Franklin H; Infante, Francisco; Castillo, Alfredo; Ibarra-Nuñez, Guillermo; Goldarazena, Arturo; Funderburk, Joe E


    A field survey was conducted in Ataulfo mango (Mangifera indica L.) orchards in Chiapas, Mexico, with the objective of determining the natural enemies of the Frankliniella complex species (Thysanoptera: Thripidae). Seven species of this genus feed and reproduce in large numbers during the mango flowering. Two representative orchards were selected: the orchard "Tres A" characterized by an intensive use of agrochemicals directed against thrips, and the orchard "La Escondida" that did not spray insecticides. During mango flowering, five inflorescences were randomly collected every 5 d in both orchards, for a total of 18 sampling dates. Results revealed the presence of 18 species of arthropods that were found predating on Frankliniella. There were 11 species in the families Aeolothripidae, Phlaeothripidae, Formicidae, Anthocoridae and Chrysopidae; and seven species of spiders in the families Araneidae, Tetragnathidae, and Uloboridae. Over 88% of predators were anthocorids, including, Paratriphleps sp. (Champion), Orius insidiosus (Say), Orius tristicolor (White), and O. perpunctatus (Reuter). The orchard that did not spray insecticides had a significantly higher number of predators suggesting a negative effect of the insecticides on the abundance of these organisms. PMID:26246440

  6. Profil anthropometrique des enfants scolarises tananariviens

    PubMed Central

    Razafimanantsoa, Fetralinjiva; Razafindramaro, Notahiana; Raherimandimby, Hasina; Robinson, Annick; RakotoAlson, Olivat; Rasamindrakotroka, Andry


    Les enfants tananariviens sont en état de malnutrition chronique. Notre objectif est d’évaluer l'indice de masse corporelle (IMC) pour estimer les enfants apparemment "sains". Une enquête et une mesure de la taille et du poids des enfants scolarisés tananariviens de 6 à 11 ans ont été réalisées. Après leur accord, la taille et l'indice de masse corporelle des 442 enfants tirés au hasard ont été ainsi obtenus. L'analyse de la moyenne de la taille a révélé une différence significative à 8 ans, une différence non évidente sur l'indice de masse corporelle. La comparaison avec les valeurs de référence (OMS 2006) a montré un retard statural de 34% avec une tendance globale à la hausse et un déficit pondéral égal à 5,5% selon le z score. Ainsi, au sein d'une population malnutrie, l'indice de masse corporelle pourrait être utilisé comme un des paramètres à considérer dans l’évaluation de l’état de santé pour classer ces enfants en bonne santé apparente. PMID:24711862

  7. Benchmarking the power of amateur observatories for TTV exoplanets detection

    NASA Astrophysics Data System (ADS)

    Baluev, Roman V.; Sokov, Evgenii N.; Shaidulin, Vakhit Sh.; Sokova, Iraida A.; Jones, Hugh R. A.; Tuomi, Mikko; Anglada-Escudé, Guillem; Benni, Paul; Colazo, Carlos A.; Schneiter, Matias E.; D'Angelo, Carolina S. Villarreal; Burdanov, Artem Yu.; Fernández-Lajús, Eduardo; Baştürk, Özgür; Hentunen, Veli-Pekka; Shadick, Stan


    We perform an analysis of ˜80 000 photometric measurements for the following 10 stars hosting transiting planets: WASP-2, -4, -5, -52, Kelt-1, CoRoT-2, XO-2, TrES-1, HD 189733, GJ 436. Our analysis includes mainly transit light curves from the Exoplanet Transit Database, public photometry from the literature, and some proprietary photometry privately supplied by other authors. Half of these light curves were obtained by amateurs. From this photometry we derive 306 transit timing measurements, as well as improved planetary transit parameters. Additionally, for 6 of these 10 stars we present a set of radial velocity measurements obtained from the spectra stored in the HARPS, HARPS-N and SOPHIE archives using the HARPS-TERRA pipeline. Our analysis of these transit timing and radial velocity data did not reveal significant hints of additional orbiting bodies in almost all of the cases. In the WASP-4 case, we found hints of marginally significant TTV signals having amplitude 10-20 s, although their parameters are model dependent and uncertain, while radial velocities did not reveal statistically significant Doppler signals.

  8. Mapping of sites in forest stands.


    Netto, Sylvio Péllico; Stefanello, Flavio R; Pelissari, Allan L; David, Hassan C


    Generally, the forest companies use the total one year planting area as a minimum stratum of the total population and, consequently, the forest inventory processing has been conducted by applying the stratified random sampling to it. This study was carried out in the National Forest of Tres Barras, Brazil, and it aimed to classify and map the sites of Pinus elliottii stands. A systematic sampling was structured into clusters and applied independently by compartments. The clusters, in maltese cross, were composed of four sampling subunits, using Prodan sampling method with a fixed number of six trees. By analysis of the methodology it was possible to confirm the hypothesis: a) the selective thinning cause expressive increase of volumetric variability within compartments; b) the variation of sites within the compartments causes volumetric expansion of variance and this grows proportionally to the quality of the sites; c) the stratification in sites results in minimum variance within them; d) the stratification in sites resulted in until to 91% reduction of variances within them. PMID:25590737

  9. Comparaison de lois de commande. Régulation numérique de courant dans l'association convertisseur-machine

    NASA Astrophysics Data System (ADS)

    Kalinowski, D.; Bergmann, C.


    This article deals with a comparison of different numerical command laws, as regards dynamical characteristics and robustness, for direct current motor control. The power converter, which uses bi-directional switches, connect directly the three-phase source to the servo-motor. Simulations, compared with experimental results, show the variations of the dynamical characteristics regarding perturbations, that is to say: model parameters are not constant, the converter is not linear, and there are numerical saturations. Cet article présente différentes stratégies de commande, sur un critère de rapidité/robustesse, pour une régulation numérique du courant dans un servo-moteur à courant continu. Le convertisseur de puissance, à la base de la structure, est constitué d'interrupteurs bidirectionnels et réalise l'alimentation directe de la charge à travers un réseau triphasé. Les simulations, confrontées aux résultats expérimentaux, montrent la très nette dépendance des caractéristiques dynamiques finales vis-à-vis des éléments perturbateurs à savoir : la variation des paramètres constituants le modèle, les non-linéarités des convertisseurs et les saturations numériques.

  10. Experiencias sobre el impacto del Programa de Formación en Ética de la Investigación Biomédica y Psicosocial en el ámbito de la salud mental y la investigación conductual

    PubMed Central

    Barrios, Liliana Mondragón


    El propósito de este trabajo es presentar el impacto y la integración que los conocimientos adquiridos en el Programa Internacional de Formación en Ética de la Investigación Biomédica y Psicosocial de la Universidad de Chile han tenido en mi experiencia profesional, en el ámbito de la investigación psicosocial en un Instituto de Salud de México. Para este objetivo, expondré tres áreas en las cuales se ha podido evidenciar tal impacto: trabajo en los comités de ética, desarrollo de programas de académicos en bioética e investigación y publicación sobre ética y bioética. El motivo que me llevó a incursionar en el Programa fue que su enseñanza vincula la investigación psicosocial con la ética y la bioética, lo cual me permitió dirigir este tipo de reflexión hacia problemas como violencia, suicidio, adicciones, depresión y salud mental, y a nuevos campos como los estudios comunitarios, con poblaciones en riesgo o vulnerables, en los cuales las diversas implicaciones son difíciles de indagar. PMID:22754085

  11. GRAF1 forms a complex with MICAL-L1 and EHD1 to cooperate in tubular recycling endosome vesiculation

    PubMed Central

    Cai, Bishuang; Xie, Shuwei; Caplan, Steve; Naslavsky, Naava


    The biogenesis of tubular recycling endosomes (TREs) and their subsequent vesiculation after cargo-sorting has occurred, is essential for receptor and lipid recycling to the plasma membrane. Although recent studies have implicated the C-terminal Eps15 Homology Domain (EHD) protein, EHD1, as a key regulator of TRE vesiculation, additional proteins involved in this process have been largely uncharacterized. In the present study, we identify the GTPase Regulator Associated with Focal adhesion kinase-1 (GRAF1) protein in a complex with EHD1 and the TRE hub protein, Molecules Interacting with CasL-Like1 (MICAL-L1). Over-expression of GRAF1 caused vesiculation of MICAL-L1-containing TRE, whereas GRAF1-depletion led to impaired TRE vesiculation and delayed receptor recycling. Moreover, co-addition of purified EHD1 and GRAF1 in a semi-permeabilized cell vesiculation assay produced synergistic TRE vesiculation. Overall, based on our data, we suggest that in addition to its roles in clathrin-independent endocytosis, GRAF1 synergizes with EHD1 to support TRE vesiculation. PMID:25364729

  12. An integrated error parameter estimation and lag-aware data assimilation scheme for real-time flood forecasting

    NASA Astrophysics Data System (ADS)

    Li, Yuan; Ryu, Dongryeol; Western, Andrew W.; Wang, Q. J.; Robertson, David E.; Crow, Wade T.


    For operational flood forecasting, discharge observations may be assimilated into a hydrologic model to improve forecasts. However, the performance of conventional filtering schemes can be degraded by ignoring the time lag between soil moisture and discharge responses. This has led to ongoing development of more appropriate ways to implement sequential data assimilation. In this paper, an ensemble Kalman smoother (EnKS) with fixed time window is implemented for the GR4H hydrologic model (modèle du Génie Rural à 4 paramètres Horaire) to update current and antecedent model states. Model and observation error parameters are estimated through the maximum a posteriori method constrained by prior information drawn from flow gauging data. When evaluated in a hypothetical forecasting mode using observed rainfall, the EnKS is found to be more stable and produce more accurate discharge forecasts than a standard ensemble Kalman filter (EnKF) by reducing the mean of the ensemble root mean squared error (MRMSE) by 13-17%. The latter tends to over-correct current model states and leads to spurious peaks and oscillations in discharge forecasts. When evaluated in a real-time forecasting mode using rainfall forecasts from a numerical weather prediction model, the benefit of the EnKS is reduced as uncertainty in rainfall forecasts becomes dominant, especially at large forecast lead time.

  13. Biocatalytic Production of Trehalose from Maltose by Using Whole Cells of Permeabilized Recombinant Escherichia coli

    PubMed Central

    Sun, Ye; Mei, Wending; Ouyang, Jia


    Trehalose is a non-reducing disaccharide, which can protect proteins, lipid membranes, and cells from desiccation, refrigeration, dehydration, and other harsh environments. Trehalose can be produced by different pathways and trehalose synthase pathway is a convenient, practical, and low-cost pathway for the industrial production of trehalose. In this study, 3 candidate treS genes were screened from genomic databases of Pseudomonas and expressed in Escherichia coli. One of them from P. stutzeri A1501 exhibited the best transformation ability from maltose into trehalose and the least byproduct. Thus, whole cells of this recombinant E. coli were used as biocatalyst for trehalose production. In order to improve the conversion rate of maltose to trehalose, optimization of the permeabilization and biotransformation were carried out. Under optimal conditions, 92.2 g/l trehalose was produced with a high productivity of 23.1 g/(l h). No increase of glucose was detected during the whole course. The biocatalytic process developed in this study might serve as a candidate for the large scale production of trehalose. PMID:26462117

  14. Availability of ground water near Carmel, Hamilton County, Indiana

    USGS Publications Warehouse

    Gillies, D.C.


    Flow in the unconsolidated glacial deposits near the city of Carmel in central Indiana was simulated by a digital-computer model in a study of hydraulic characteristics of the deposits. The study shows that 21.3 million gallons per day (933 litres per second) of additional water could be withdrawn from the aquifer for an indefinite period of time. This pumpage is approximately 5 million gallons per day (219 1itres per second) above the projected water needs of Carmel for 1990. Saturated thickness, transmissivity, and storage coefficient of the outwash aquifer along the White River east of Carmel were determined, using available data supplemented by test drilling . The saturated thickness of the aquifer ranges f r om 10 to 110 feet 0 to 34 me tres); transmissivity ranges from 1,000 feet squared per day (93 metres squared per day) to 24 ,000 feet squared per day (2 ,230 metres squared per day); and the average storage coefficient is 0.11.

  15. New avenues for regulation of lipid metabolism by thyroid hormones and analogs

    PubMed Central

    Senese, Rosalba; Lasala, Pasquale; Leanza, Cristina; de Lange, Pieter


    Weight loss due to negative energy balance is a goal in counteracting obesity and type 2 diabetes mellitus. The thyroid is known to be an important regulator of energy metabolism through the action of thyroid hormones (THs). The classic, active TH, 3,5,3′-triiodo-L-thyronine (T3) acts predominantly by binding to nuclear receptors termed TH receptors (TRs), that recognize TH response elements (TREs) on the DNA, and so regulate transcription. T3 also acts through “non-genomic” pathways that do not necessarily involve TRs. Lipid-lowering therapies have been suggested to have potential benefits, however, the establishment of comprehensive therapeutic strategies is still awaited. One drawback of using T3 in counteracting obesity has been the occurrence of heart rhythm disturbances. These are mediated through one TR, termed TRα. The end of the previous century saw the exploration of TH mimetics that specifically bind to TR beta in order to prevent cardiac disturbances, and TH derivatives such as 3,5-diiodo-L-thyronine (T2), that possess interesting biological activities. Several TH derivatives and functional analogs have low affinity for the TRs, and are suggested to act predominantly through non-genomic pathways. All this has opened new perspectives in thyroid physiology and TH derivative usage as anti-obesity therapies. This review addresses the pros and cons of these compounds, in light of their effects on energy balance regulation and on lipid/cholesterol metabolism. PMID:25538628

  16. Accumulation of contaminants in fish from wastewater treatment wetlands

    USGS Publications Warehouse

    Barber, L.B.; Keefe, S.H.; Antweiler, R.C.; Taylor, H.E.; Wass, R.D.


    Increasing demands on water resources in arid environments make reclamation and reuse of municipal wastewater an important component of the water budget. Treatment wetlands can be an integral part of the water-reuse cycle providing both water-quality enhancement and habitat functions. When used for habitat, the bioaccumulation potential of contaminants in the wastewater is a critical consideration. Water and fish samples collected from the Tres Rios Demonstration Constructed Wetlands near Phoenix, Arizona, which uses secondary-treated wastewater to maintain an aquatic ecosystem in a desert environment, were analyzed for hydrophobic organic compounds (HOC) and trace elements. Semipermeable membrane devices (SPMD) were deployed to investigate uptake of HOC. The wetlands effectively removed HOC, and concentrations of herbicides, pesticides, and organic wastewater contaminants decreased 40-99% between inlet and outlet. Analysis of Tilapia mossambica and Gambusia affinis indicated accumulation of HOC, including p,p???-DDE and trans-nonachlor. The SPMD accumulated the HOC detected in the fish tissue as well as additional compounds. Trace-element concentrations in whole-fish tissue were highly variable, but were similar between the two species. Concentrations of HOC and trace elements varied in different fish tissue compartments, and concentrations in Tilapia liver tissue were greater than those in the whole organism or filet tissue. Bioconcentration factors for the trace elements ranged from 5 to 58 000 and for the HOC ranged from 530 to 150 000. ?? 2006 American Chemical Society.

  17. Live 107Pd in Some Group II and III Irons and the Time-Scales of Fe-Ni Segregations in the Early Solar System

    NASA Astrophysics Data System (ADS)

    Chen, J. H.; Wasserburg, G. J.


    In a recent report, we presented evidence for excesses (*) of ^107Ag* due to ^107Pd decay (tau bar = 6.5 Ma) in a wide variety of iron meteorites, some pallasites and mesosiderites. They provide unambiguous evidence of the in situ decay of ^107Pd in planetary differentiates. A key problem of early solar system chronologies has been the ability to interrelate different short-lived and long-lived chronometers. Evidence for the presence of both live ^107Pd and ^53Mn (tau bar = 5.3 Ma) in the early solar system has been found in several meteorites. However, there appear to be major discrepancies between the ^107Pd and ^53Mn chronometers. New Re-Os data on iron meteorites seem to support the small time differences for formation of iron meteorites as inferred by the Pd-Ag system. In this study, we selected samples on which Re-Os data were available. These include Coahuila (IIA) metal and Tres Castillos (IIIA) metal and sulfide.

  18. Le carcinome neuro-endocrine cutané primitif: à propos d'un nouveau cas et revue de la littérature

    PubMed Central

    Boukind, Samira; Elatiqi, Oumkeltoum; Dlimi, Meriem; Elamrani, Driss; Benchamkha, Yassine; Ettalbi, Saloua


    Le carcinome neuro- endocrine cutané primitif (CNEC) est une tumeur cutanée rare et agressive du sujet âgé, favorisée par le soleil et l'immunodépression. Elle est caractérisée par une évolution agressive avec un fort taux de récidive, une évolution ganglionnaire régionale et un risque de métastases à distance. Nous rapportons un cas de cette tumeur chez un patient âgé de 67 ans sous forme d'un placard nodulaire hémorragique mesurant 16 /14 cm. Le patient a bénéficié d'une exérèse chirurgicale large avec couverture de la perte de substance par un lambeau musculo-cutané du muscle grand dorsal, un curage ganglionnaire axillaire et une radiothérapie adjuvante. Après un recul de 2 ans et 2 mois, le patient est toujours vivant sans métastase ni récidive. La littérature étant pauvre, la prise en charge diagnostique et thérapeutique est controversée et donc hétérogène. Globalement le pronostic est mauvais, et certains paramètres corrélés au pronostic sont précisés. PMID:26185585

  19. Characterizing exoplanet atmospheres with the 10.4m GTC telescope: New results from the world’s largest optical telescope

    NASA Astrophysics Data System (ADS)

    Wilson, Paul Anthony; Evans, Tom; Sing, David Kent; Nikolov, Nikolay; Lecavelier des Etangs, Alain; Colón, Knicole


    Exoplanet transit spectroscopy of hot Jupiters has given us the first detailed glimpses of the complex physical characteristics that govern these objects. These highly irradiated planets with their extended atmospheres lend themselves as excellent targets for probing their compositions, temperature-pressure profiles and the vertical abundance distributions.We have explored the atmospheres of several hot Jupiters using the 10.4m GTC telescope together with unique tunable filters capable of precision narrowband photometry at specific wavelengths. Using the worlds largest optical telescope we have been able to detect and characterise specific atmospheric features at higher resolutions than can be obtained with the Hubble Space Telescope. This is important as atmospheric signatures could be missed if the resolution is not sufficiently high.In this talk I will present a summary of the exoplanet atmospheres characterised with the GTC telescope. I will also present new results obtained by combining Kepler and GTC data to study the low-albedo atmosphere of TrES-2b.

  20. Preserved extensional structures in an inverted Cretaceous rift basin, northwestern Argentina: Outcrop examples and implications for fault reactivation

    NASA Astrophysics Data System (ADS)

    Monaldi, CéSar R.; Salfity, José A.; Kley, Jonas


    During the Cretaceous-Eocene interval a system of intracontinental rift basins, the Salta group rift, evolved in northwestern Argentina. Individual segments of the rift later suffered different degrees of inversion during Cenozoic shortening. The Tres Cruces subbasin, on the west side of the Eastern Cordillera, was strongly deformed, being now part of a thick-skinned thrust belt with a predominantly N-S structural trend. On its eastern border, tilting due to folding and thrusting and subsequent erosion have produced exceptional outcrops of preserved east-trending extensional structures including half grabens, rollover anticlines, and extensional fault-propagation folds. Farther west, the synrift succession is only intermittently exposed, although the interference of north- and east-trending structures as well as peculiar, dome-shaped anticlines with spur-like extensions suggest that north- and east-trending Cretaceous faults were reactivated, particularly near their intersections. Compilation of published data and analysis of our new data focused on the Salta rift indicates three main factors favoring the contractional reactivation of normal faults: dip angles lower than approximately 60°, especially for faults striking roughly normal to contraction; strikes no closer to the contraction direction than approximately 30°; and low downdip fault curvatures. Occasional dip-slip reactivation of east-trending faults does not match the present and long-term Andean stress regimes and presents an unresolved problem.

  1. A Novel Ultrasound-Based Registration for Image-Guided Laparoscopic Liver Ablation.


    Fusaglia, Matteo; Tinguely, Pascale; Banz, Vanessa; Weber, Stefan; Lu, Huanxiang


    Background Patient-to-image registration is a core process of image-guided surgery (IGS) systems. We present a novel registration approach for application in laparoscopic liver surgery, which reconstructs in real time an intraoperative volume of the underlying intrahepatic vessels through an ultrasound (US) sweep process. Methods An existing IGS system for an open liver procedure was adapted, with suitable instrument tracking for laparoscopic equipment. Registration accuracy was evaluated on a realistic phantom by computing the target registration error (TRE) for 5 intrahepatic tumors. The registration work flow was evaluated by computing the time required for performing the registration. Additionally, a scheme for intraoperative accuracy assessment by visual overlay of the US image with preoperative image data was evaluated. Results The proposed registration method achieved an average TRE of 7.2 mm in the left lobe and 9.7 mm in the right lobe. The average time required for performing the registration was 12 minutes. A positive correlation was found between the intraoperative accuracy assessment and the obtained TREs. Conclusions The registration accuracy of the proposed method is adequate for laparoscopic intrahepatic tumor targeting. The presented approach is feasible and fast and may, therefore, not be disruptive to the current surgical work flow. PMID:26969718

  2. Del sujeto que ha intentado suicidarse y el Otro: la Institución Psiquiátrica

    PubMed Central

    Liliana, Mondragón B.; Miguel Ángel, Caballero G.


    El hospital psiquiátrico se ha constituido como un lugar donde se posibilita legitimar la exclusión y la radicalidad de ese otro “que no es igual”, como es el caso del sujeto que atenta contra su propia vida. En consecuencia, el intento de suicidio desde el pensamiento foucaultiano, es una resistencia que desmantela la estructura de dominación a través de un acto de poder, el cual se ejerce sobre el propio cuerpo. Así, la intención de este texto es mostrar que la relación Otro-otro es un lugar en la estructura subjetiva, que se deposita en la institución psiquiátrica, la cual representa el poder, la ley, y es aquello a lo que se le quiere agredir, resistir, abatir con un intento de suicidio. Para demostrar como se materializan estos hechos, se exponen los testimonios de tres adolescentes atendidas en un hospital psiquiátrico por intentos suicidas, en los cuales se señalan los diferentes significados que le atribuyen a la institución psiquiátrica en tanto que representa un Otro en sus actos autoinfligidos. PMID:25400324

  3. Collection of relevant results obtained with the ERTS-1 satellite images by the Institute for Space Research (INPE), volume 2. [Brazil

    NASA Technical Reports Server (NTRS)

    Demendonca, F.; Amaral, G.; Gamadealmeida, E. (Principal Investigator)


    The author has identified the following significant results. Soil resource studies in Brazil have concluded that: areas with agricultural activities appear surrounding urban centers; some areas are suffering a strong erosion action; there exist two drainage systems near Paraguai River and Parana River; and this region possesses great variety of soil types. It is possible to count the number of lakes and sluices as well as their superficial area using a channel 7 photographic enlargement. The great concentration of water bodies along the Jacui River determines the large rice crops. Data concerning regions around Teresina City, Presidente Prudente, Piracicaba City, Dourados, and Tres Marias Dam revealed several characteristics concerning the soil and water resources. Two basic maps were made of the natural vegetation distribution over central eastern Brazil from data ERTS-1 data. One map shows the drainage system, the road system, and cities; while the second shows the natural vegetation. It was possible to identify old reforestation, new reforestation, natural forest in flat lands, and natural forest in rolling lands from the ERTS images. Different pasture plant species could be identified by multispectral remote sensing. Data obtained along different wavelength bands provide essential data for the range manager to evaluate his range and to establish a suitable policy. Hydrographic mapping was done using the ERTS images.

  4. Optical Properties of the Defect State Luminescence of Zn2 SnO4 Nanowires

    NASA Astrophysics Data System (ADS)

    Yakami, Baichhabi; Paudyal, Uma; Nandyala, Shashank; Rimal, Gaurab; Cooper, Jason K.; Chen, Jiajun; Chien, Teyu; Wang, Wenyong; Pikal, Jon M.; Department of Electrical; Computer Engineering Team; Department of Physics; Astronomy Team

    Nanowires (NWs) are a promising option for sensitized solar cells, sensors & display technology. Most of the work thus far has focused on binary oxides for these NWs, but ternary oxides have advantages in additional control of optical and electronic properties. Here we report on the diffuse reflectance, Low Temperature (LT) and Room Temperature (RT) photoluminescence (PL), PL excitation and Time Resolved PL (TRPL) of Zinc Tin Oxide (ZTO) NWs grown by Chemical Vapor Deposition. Our results show two broad peaks centered at 640 nm & 450 nm. The complex emission spectra was studied by Time Resolved Emission Spectroscopy (TRES) and Intensity dependent PL. The intensity dependent TRPL shows that 640 nm states decay much slower than the 450 nm states. We propose an energy band model for the NWs containing donor and acceptor states in the band gap with the associated transitions between these states that are consistent with our results. The effect of annealing in air and vacuum is carried out to study the origin of defect states in these NWs. . Department of Energy.

  5. Phase transition in ABi4Ti4O15 (A=Ca,Sr,Ba) Aurivillius oxides prepared through a soft chemical route

    NASA Astrophysics Data System (ADS)

    Rout, S. K.; Sinha, E.; Hussian, A.; Lee, J. S.; Ahn, C. W.; Kim, I. W.; Woo, S. I.


    A series of compounds, CaBi4Ti4O15 (CBT), SrBi4Ti4O15 (SBT), and BaBi4Ti4O15 (BBT), belonging to the Aurivillus-type structure (four layers) has been prepared by a modified chemical route. Different oxalates were precipitated from their respective nitrate solution onto the surface of TiO2 powders. The room temperature x-ray diffraction study reveled that the compounds were having orthorhombic symmetry. Considering the tolerance factor, a significant deformation of the perovskite block is observed and that decreases with increase in ionic radius of A site atom. Temperature dependent dielectric study showed normal ferroelectric to paraelectric transition well above the room temperature except for BBT. The BBT ceramic showed a relaxorlike behavior near phase transition. The quantitative characterization and comparison of relaxor behavior were based on empirical parameters γ and ΔTres. The dielectric relaxation rate follows the Vogel-Fulcher relation with activation energy=0.02 eV and freezing temperature=362 °C. All these measurements confirmed its relaxorlike phase transition.

  6. Exposure to 3,3',5-triiodothyronine affects histone and RNA polymerase II modifications, but not DNA methylation status, in the regulatory region of the Xenopus laevis thyroid hormone receptor βΑ gene.


    Kasai, Kentaro; Nishiyama, Norihito; Izumi, Yushi; Otsuka, Shunsuke; Ishihara, Akinori; Yamauchi, Kiyoshi


    Thyroid hormones (THs) play a critical role in amphibian metamorphosis, during which the TH receptor (TR) gene, thrb, is upregulated in a tissue-specific manner. The Xenopus laevis thrb gene has 3 TH response elements (TREs) in the 5' flanking regulatory region and 1 TRE in the exon b region, around which CpG sites are highly distributed. To clarify whether exposure to 3,3',5-triiodothyronine (T3) affects histone and RNA polymerase II (RNAPII) modifications and the level of DNA methylation in the 5' regulatory region, we conducted reverse transcription-quantitative polymerase chain reaction, bisulfite sequencing and chromatin immunoprecipitation assay using X. laevis cultured cells and premetamorphic tadpoles treated with or without 2 nM T3. Exposure to T3 increased the amount of the thrb transcript, in parallel with enhanced histone H4 acetylation and RNAPII recruitment, and probably phosphorylation of RNAPII at serine 5, in the 5' regulatory and exon b regions. However, the 5' regulatory region remained hypermethylated even with exposure to T3, and there was no significant difference in the methylation status between DNAs from T3-untreated and -treated cultured cells or tadpole tissues. Our results demonstrate that exposure to T3 induced euchromatin-associated epigenetic marks by enhancing histone acetylation and RNAPII recruitment, but not by decreasing the level of DNA methylation, in the 5' regulatory region of the X. laevis thrb gene. PMID:26417689

  7. Biomechanically Constrained Surface Registration: Application to MR-TRUS Fusion for Prostate Interventions.


    Khallaghi, Siavash; Sánchez, C Antonio; Rasoulian, Abtin; Sun, Yue; Imani, Farhad; Khojaste, Amir; Goksel, Orcun; Romagnoli, Cesare; Abdi, Hamidreza; Chang, Silvia; Mousavi, Parvin; Fenster, Aaron; Ward, Aaron; Fels, Sidney; Abolmaesumi, Purang


    In surface-based registration for image-guided interventions, the presence of missing data can be a significant issue. This often arises with real-time imaging modalities such as ultrasound, where poor contrast can make tissue boundaries difficult to distinguish from surrounding tissue. Missing data poses two challenges: ambiguity in establishing correspondences; and extrapolation of the deformation field to those missing regions. To address these, we present a novel non-rigid registration method. For establishing correspondences, we use a probabilistic framework based on a Gaussian mixture model (GMM) that treats one surface as a potentially partial observation. To extrapolate and constrain the deformation field, we incorporate biomechanical prior knowledge in the form of a finite element model (FEM). We validate the algorithm, referred to as GMM-FEM, in the context of prostate interventions. Our method leads to a significant reduction in target registration error (TRE) compared to similar state-of-the-art registration algorithms in the case of missing data up to 30%, with a mean TRE of 2.6 mm. The method also performs well when full segmentations are available, leading to TREs that are comparable to or better than other surface-based techniques. We also analyze robustness of our approach, showing that GMM-FEM is a practical and reliable solution for surface-based registration. PMID:26054062

  8. Telescopio Solar en Hα (HASTA)

    NASA Astrophysics Data System (ADS)

    Fernández Borda, R.; Francile, C.; Bagala, G.; Bauer, O.; Haerendel, G.; Rieger, E.; Rovira, M.

    El Telescopio Solar en Hα (Hα Solar Telescope for Argentina (-HASTA-) fue recientemente instalado en la Estación Astronómica de Altura Carlos Ulrrico Cesco (OAFA) en El Leoncito. Este instrumento estudiará la evolución de las fulguraciones solares desde tierra con alta resolución temporal y espacial. HASTA es un telescopio refractor de 110 mm con una distancia focal de 165 cm, un filtro Lyot sintonizable (±1Å) con un ancho de banda de 0.3 Å y una cámara CCD de alta resolución (1280×1024 pixels). Todo el conjunto es controlado en forma remota por una PC, la cual además adquiere datos del Sistema de Posicionamiento Global (GPS) y de la estación meteorológica. Diseñado para detectar fulguraciones, el instrumento trabaja en dos modos (patrullaje y fulguración) con una resolución espacial de 1.5 arcseg por pixel y una resolución temporal de 2 seg. HASTA comenzó a operar en Mayo de 1998 y, junto con otros tres instrumentos solares, que se están instalando o se instalaron, harán de El Leoncito un polo de observación solar importante en el Hemisferio Sur.

  9. Intrication de deux atomes en utilisant le blocage de Rydberg

    NASA Astrophysics Data System (ADS)

    Gaëtan, A.


    Considérons un système quantique constitué de deux sous-systèmes : on dit qu'il est dans un état intriqué s'il existe des corrélations quantiques entre les états de ces derniers. La compréhension et la mise en œuvre d'états intriqués ont de nombreuses applications (métrologie quantique, étude des systèmes fortement corrélés, traitement quantique de l'information, etc.) et constituent le contexte général de ce travail de thèse. Plus en détail, nous démontrons la réalisation d'un état intriqué de deux atomes neutres piégés indépendamment. Pour cela, nous exploitons le phénomène de blocage de Rydberg : lorsqu'on essaie d'exciter simultanément deux atomes séparés de quelques micromètres vers un état de Rydberg donné, la forte interaction entre atomes de Rydberg peut empêcher cette excitation simultanée. Dans ce cas, seul un des deux atomes est excité et l'on génère ainsi des corrélations quantiques entre les états des deux atomes, c'est-à-dire de l'intrication. Dans notre expérience, deux atomes de 87Rb dans l'état fondamental 5S1/2 sont piégés chacun dans une pince optique microscopique, à une distance relative de 4 micromètres. En réalisant des transitions entre l'état 5S1/2 et l'état de Rydberg 58D3/2 par des transitions à deux photons, nous obtenons un état intriqué des deux atomes dans les sous-niveaux |5S1/2, f = 1, mf = 1> et |5S1/2, f = 2, mf = 2>. Afin de quantifier l'intrication, nous mesurons la fidélité par rapport à l'état-cible en réalisant des transitions Raman entre ces deux sous-niveaux. La fidélité des paires d'atomes présentes à la fin de l'expérience est supérieure à la valeur seuil de 0,5, ce qui prouve la création d'un état intriqué.

  10. Taille et régularité de la structure du front de la détonation dans les gaz. Corrélation avec le diamètre critique de transmission de la détonation

    NASA Astrophysics Data System (ADS)

    Desbordes, D.; Brisot, D.; Guerraud, C.

    Size and regularity of the cellular structure of detonations in C 2H2-O2-Ar systems were considered. Experiments were conducted over a wide range of dilutions by argon and of degrees of overdrive of detonations. The increase of dilution by argon or of the degree of overdrive of the detonation reduces the value of the effective activation energy EA/RT of the system and promotes the regularity of the cellular structure. Conditions of critical transmission of a detonation from a pipe of diameter d (= 52 mm) into a large volume were investigated in the same systems. It appears that the classical correlation between the critical diameter of transmission and the cell size, i.e. dc = 13 λ, remains no longer valid when the dilution by argon or the degree overdrive increase significantly. dc ≅ 26 λ is observed when the cell becomes very regular. All the results obtained emphasize the importance of cell regularity on correlation factors between the dynamics parameters of a detonation and its cell size. On discute du problème de l'évolution de la taille et de la régularité de la structure tridimensionnelle cellulaire du front de la détonation dans le système réactif C2H2-O2-Ar. Les résultats expérimentaux ont été obtenus en faisant varier : 1) la dilution en argon du mélange, 2) le degré de force de la détonation (M ? M CJ : CJ correspondant à l'onde de Chapman et Jouguet), deux paramètres dont l'augmentation permet de diminuer l'énergie d'activation apparente réduite, EA/RT, du mélange réactif derrière onde de choc et d'accroître la régularité de la structure cellulaire. On établit ensuite dans quelles mesures la loi empirique liant le diamètre critique de transmission dc d'une détonation à la taille caractéristique de sa structure (en particulier sa dimension transversale λ), i.e. dc = 13 λ, reste valable lorsque chaque paramètre de l'étude varie. Compte tenu des écarts importants à la règle classique de la relation dc (λ) mis en

  11. Modeles de Calogero et Sutherland, fonctions speciales et symetries

    NASA Astrophysics Data System (ADS)

    Lapointe, Luc

    La thèse comporte trois volets distincts, bien que l'utilisation de méthodes algébriques soit commune aux trois parties. Le premier volet (articles 1, 2 et 3) explore la relation entre les algèbres quantiques et les q-fonctions hypergéométriques. La connexion est d'abord faite, dans ce contexte, entre une extension à deux paramètres de l'algèbre de l'oscillateur harmonique, la (p, q)- algèbre de l'oscillateur, et les fonctions hypergéométriques bibasiques. Une formule génératrice pour des déformations à deux paramètres des polynômes de Laguerre peut ainsi être obtenue. Ensuite, la connexion entre l'algèbre sl q(n + 3) et les q-fonctions de Lauricella est étudiée et, de cette façon, plusieurs identités et relations de contiguité impliquant ces fonctions sont dérivées. Ce premier volet se termine par un court article où il est montré que certaines équations de Schrödinger en deux dimensions peuvent être résolues en termes de fonctions d'Appell, le cas à deux variables des fonctions de Lauricella. Le second volet (articles 4, 5, 6, 7 et 8) porte sur le modèle de Calogero-Sutherland et les fonctions symétriques. Le modèle de Calogero- Sutherland est un modèle intégrable décrivant N particules identiques sur un cercle dont les solutions sont esssentiellement données par des fonctions symétriques à N variables, les polynômes de Jack. Une formule permettant de construire ces polynômes à l'aide d'opérateurs de création est présentée. Cette formule permet de prouver une propriété importante des polynômes de Jack. Ces opérateurs de création sont ensuite généralisés au cas des polynômes de Macdonald. Les opérateurs obtenus dans ce cas possèdent des propriétés remarquables qui permettent notamment de prouver une forme faible d'une conjecture sur les polynômes de Macdonald. Finalement, le dernier volet (articles 9, 10 et 11) traite des algèbres dynamiques et de symétrie des modèles intégrables à plusieurs

  12. Achieving Conservation Science that Bridges the Knowledge–Action Boundary

    PubMed Central

    Cook, Carly N; Mascia, Michael B; Schwartz, Mark W; Possingham, Hugh P; Fuller, Richard A


    both advances scientific understanding and contributes to decision making. Logrando que la Ciencia de la Conservación Trasponga la Frontera Conocimiento-Acción Resumen Hay muchas barreras para utilizar ciencia para informar a la política y práctica de la conservación. Los científicos de la conservación que desean producir ciencia relevante para el manejo deben equilibrar esta meta con el imperativo de demostrar novedad y rigor en su ciencia. Los tomadores de decisiones que buscan que sus decisiones se basen en evidencias deben equilibrar el deseo de conocimientos con la necesidad de actuar a pesar de la incertidumbre. La generación de ciencia que informe efectivamente a las decisiones de manejo requiere que la producción de información (los componentes del conocimiento) sea sobresaliente (relevante y oportuna), creíble (autoritativa, verosímil y confiable) y legítima (desarrollada mediante un proceso que considera los valores y perspectivas de todos los actores relevantes) a la vista tanto de investigadores como de tomadores de decisiones. Percibimos tres retos clave para quienes desean generar ciencia de la conservación que logre estas tres características de la información. Primero, las audiencias científicas y de manejo pueden tener percepciones contrastantes sobre la relevancia de la investigación. Segundo, la credibilidad se puede lograr a costa de la relevancia y legitimidad a la vista de los tomadores de decisiones y tercero, los diferentes actores pueden tener percepciones conflictivas sobre los que constituye información legítima. Resaltamos cuatro marcos institucionales que pueden facilitar que la ciencia informe al manejo: organizaciones de frontera (organizaciones ambientales que trasponen la frontera entre la ciencia y el manejo), investigadores científicos insertados en agencias de manejo de recursos, vínculos formales entre tomadores de decisiones y científicos en instituciones enfocadas a la investigación, y programas de

  13. Révision systématique des effets de la fréquence des repas en famille sur les résultats psychosociaux chez les jeunes

    PubMed Central

    Harrison, Megan E.; Norris, Mark L.; Obeid, Nicole; Fu, Maeghan; Weinstangel, Hannah; Sampson, Margaret


    Résumé Objectif Effectuer une révision systématique des effets de repas en famille fréquents sur les résultats psychosociaux chez les enfants et les adolescents et examiner s’il existe des différences dans les résultats selon le sexe. Sources des données Des études ont été cernées à la suite d’une recherche dans MEDLINE (de 1948 à la dernière semaine de juin 2011) et dans PsycINFO (de 1806 à la première semaine de juillet 2011) à l’aide de l’interface Ovide. Les expressions et mots clés MeSH utilisés seuls ou en combinaisons étaient les suivants : family, meal, food intake, nutrition, diets, body weight, adolescent attitudes, eating behaviour, feeding behaviour et eating disorders. Les bibliographies des articles jugés pertinents ont aussi été passées en revus. Sélection des études La recherche initiale a produit 1783 articles. Pour être incluses dans l’analyse, les études devaient répondre aux critères suivants : être publiées en anglais dans une revue révisée par des pairs; porter sur des enfants ou des adolescents; traiter de l’influence des repas en famille sur les paramètres psychosociaux (p. ex. consommation de drogues et autres substances, troubles de l’alimentation, dépression) chez les enfants ou les adolescents; avoir une conception d’étude appropriée, notamment des méthodes statistiques acceptables pour l’analyse des paramètres. Quatorze articles satisfaisaient aux critères d’inclusion. Deux examinateurs indépendants ont étudié et analysé les articles. Synthèse Dans l’ensemble, les résultats font valoir que la fréquence des repas en famille est inversement proportionnelle aux troubles de l’alimentation, à la consommation d’alcool et de drogues, aux comportements violents, aux sentiments de dépression ou aux pensées suicidaires chez les adolescents. Il existe une relation positive entre de fréquents repas en famille, une bonne estime de soi et la réussite scolaire. Les

  14. Étude de la répartition des courants de Foucault pulsés dans une configuration de contrôle non destructif

    NASA Astrophysics Data System (ADS)

    Bour, J.-C.; Zubiri, E.; Vasseur, P.; Billat, A.


    Adjusting an experimental device of control by eddy-currents in sinusoidal or pulse mode requires the optimization of a certain number of parameters. Generally, the implementation of the latter operations is long and delicate, since it is issued of many compromises. The simulation study presented in this paper can be considered as a qualitative help because it specifies the the behaviour of the different parameters implied in the adjustment of the experimental defect reserach. First, we prove the influence of the lift-off on the defect detention's sensitivity of the flat sensor we used. Next we give prominence to the fact, in practice, we cannot disregard the geometry of the sensor, as we could do in theory. This result will lead us to define a family of curves showing the evolution of the depth of penetration as a function of the pulse's duration for different coil radii. We also determine the maximal sensor's sensitivity area, with the aim of locating the defect detected in the plate with precision. Finally, we prove the dependency between the true value of the depth of penetration and the thickness of the considered metallic plate. This very important result should equally be taken under consideration in the case of a real control. La mise au point d'un dispositif expérimental de contrôle par courants de Foucault, en mode sinusoïdal ou impulsionnel, nécessite l'optimisation d'un certain nombre de paramètres. Cette optimisation est généralement longue et délicate à exécuter en pratique puisqu'elle résulte de plusieurs compromis. L'étude en simulation présentée ici peut être considéré comme une aide plutôt qualitative, puisqu'elle précise le comportement des différents paramètres impliqués dans la mise en point de la recherche expérimentale de défauts. Nous montrons dans un premier temps l'influence de la distance capteur-cible sur la sensibilité du capteur à détecter un défaut. Nous mettons ensuite en évidence le fait de la g

  15. The response of creeping parts of the San Andreas fault to earthquakes on nearby faults: Two examples

    USGS Publications Warehouse

    Simpson, R.W.; Schulz, S.S.; Dietz, L.D.; Burford, R.O.


    Rates of shallow slip on creeping sections of the San Andreas fault have been perturbed on a number of occasions by earthquakes occurring on nearby faults. One example of such perturbations occurred during the 26 January 1986 magnitude 5.3 Tres Pinos earthquake located about 10 km southeast of Hollister, California. Seven creepmeters on the San Andreas fault showed creep steps either during or soon after the shock. Both left-lateral (LL) and right-lateral (RL) steps were observed. A rectangular dislocation in an elastic half-space was used to model the coseismic fault offset at the hypocenter. For a model based on the preliminary focal mechanism, the predicted changes in static shear stress on the plane of the San Andreas fault agreed in sense (LL or RL) with the observed slip directions at all seven meters; for a model based on a refined focal mechanism, six of the seven meters showed the correct sense of motion. Two possible explanations for such coseismic and postseismic steps are (1) that slip was triggered by the earthquake shaking or (2) that slip occurred in response to the changes in static stress fields accompanying the earthquake. In the Tres Pinos example, the observed steps may have been of both the triggered and responsive kinds. A second example is provided by the 2 May 1983 magnitude 6.7 Coalinga earthquake, which profoundly altered slip rates at five creepmeters on the San Andreas fault for a period of months to years. The XMM1 meter 9 km northwest of Parkfield, California recorded LL creep for more than a year after the event. To simulate the temporal behavior of the XMM1 meter and to view the stress perturbation provided by the Coalinga earthquake in the context of steady-state deformation on the San Andreas fault, a simple time-evolving dislocation model was constructed. The model was driven by a single long vertical dislocation below 15 km in depth, that was forced to slip at 35 mm/yr in a RL sense. A dislocation element placed in the

  16. Etude theorique des fluctuations structurales dans les composes organiques a dimensionnalite reduite

    NASA Astrophysics Data System (ADS)

    Dumoulin, Benoit

    Les systemes a dimensionnalite reduite constituent maintenant une branche entiere de la physique de la matiere condensee. Cette derniere s'est developpee rapidement au cours des dernieres annees, avec la decouverte des materiaux organiques qui presentent, justement, des proprietes physiques fortement anisotropes. Cette these presente une etude en trois parties de plusieurs composes organiques qui, bien que tres differents du point de vue de leurs compositions chimiques et de leurs proprietes physiques a haute temperature, subissent tous une instabilite structurale a tres basse temperature. De plus, dans chacun des cas, l'instabilite structurale est precedee d'un important regime fluctuatif a partir duquel les proprietes physiques changent de maniere significative. Notre etude suit un ordre chronologique inverse puisque nous nous attardons en premier lieu au cas de composes recemment decouverts: les composes de la famille des (BCPTTF)2X (X = PF6 , AsF6). Ces derniers sont des isolants magnetiques a la temperature ambiante et subissent une instabilite structurale de type spin-Peierls a une temperature appelee TSP. En particulier, nous nous interessons a l'etude des proprietes physiques de ces systemes dans le regime fluctuatif, qui precede cette instabilite. Notre etude theorique nous permet de comprendre en detail comment ces systemes s'approchent de l'instabilite struturale. Dans la seconde partie de cette these, nous etudions le regime fluctuatif (pre-transitionnel) observe experimentalement dans le compose de (TMTTF)2PF6. Ce compose organique, dont la structure s'apparente aux sels de Bechgaard, subit une instabilite de type spin-Peierls a une temperature T SP = 19K. Bien que ce compose possede la particularite d'etre un bon conducteur a la temperature ambiante, il subit une transition de type Mott-Hubbard a une temperature Trho ≈ 220K et devient alors un isolant magnetique, analogue aux composes de la famille des (BCPTTF)2X. Le regime fluctuatif precedant l

  17. The GAPS programme with HARPS-N at TNG. XI. Pr 0211 in M 44: the first multi-planet system in an open cluster

    NASA Astrophysics Data System (ADS)

    Malavolta, L.; Nascimbeni, V.; Piotto, G.; Quinn, S. N.; Borsato, L.; Granata, V.; Bonomo, A. S.; Marzari, F.; Bedin, L. R.; Rainer, M.; Desidera, S.; Lanza, A. F.; Poretti, E.; Sozzetti, A.; White, R. J.; Latham, D. W.; Cunial, A.; Libralato, M.; Nardiello, D.; Boccato, C.; Claudi, R. U.; Cosentino, R.; Covino, E.; Gratton, R.; Maggio, A.; Micela, G.; Molinari, E.; Pagano, I.; Smareglia, R.; Affer, L.; Andreuzzi, G.; Aparicio, A.; Benatti, S.; Bignamini, A.; Borsa, F.; Damasso, M.; Di Fabrizio, L.; Harutyunyan, A.; Esposito, M.; Fiorenzano, A. F. M.; Gandolfi, D.; Giacobbe, P.; González Hernández, J. I.; Maldonado, J.; Masiero, S.; Molinaro, M.; Pedani, M.; Scandariato, G.


    Context. Open cluster (OC) stars share the same age and metallicity, and, in general, their age and mass can be estimated with higher precision than for field stars. For this reason, OCs are considered an importantlaboratory to study the relation between the physical properties of the planets and those of their host stars, and the evolution of planetary systems. However, only a handful of planets have been discovered around OC main-sequence stars so far, all of them in single-planet systems. For this reason we started an observational campaign within the GAPS collaboration to search for and characterize planets in OCs Aims: We monitored the Praesepe member Pr 0211 to improve our knowledge of the eccentricity of the hot Jupiter (HJ) that is already known to orbit this star and search for additional intermediate-mass planets. An eccentric orbit for the HJ would support a planet-planet scattering process rather than a disk-driven migration after its formation. Methods: From 2012 to 2015, we collected 70 radial velocity (RV) measurements with HARPS-N and 36 with TRES of Pr 0211. Simultaneous photometric observations were carried out with the robotic STELLA telescope to characterize the stellar activity. We discovered a long-term trend in the RV residuals that we show as being due to the presence of a second, massive, outer planet. Orbital parameters for the two planets are derived by simultaneously fitting RVs and photometric light curves, with the activity signal modelled as a series of sinusoids at the rotational period of the star and its harmonics. Results: We confirm that Pr 0211b has a nearly circular orbit (e = 0.02 ± 0.01), with an improvement of a factor two with respect to the previous determination of its eccentricity, and estimate that Pr 0211c has a mass Mp sin i = 7.9 ± 0.2 MJ, a period P> 3500 days and a very eccentric orbit (e> 0.60). This kind of peculiar system may be typical of open clusters if the planet-planet scattering phase, which lead to the

  18. Déterminants de la calcémie néonatale dans une maternité périphérique à Abidjan

    PubMed Central

    Konan, Diby Jean-Paul; Amon-Tanoh-Dick, Flore; Aka, Joseph; Daniel, Sess Essiagne


    Introduction Le transfert du calcium de la mère au nouveau-né est nécessaire pour la constitution de la charpente osseuse. L'hypocalcémie néonatale reste peu documentée en Afrique. En 1993, il a été observé au service de néonatologie du Centre hospitalo-universitaire de Yopougon à Abidjan une proportion d'hypocalcémie asymptomatique de 26.9%. L'objectif de ce travail était de préciser la prévalence de l'hypocalcémie néonatale dans une maternité périphérique de Yopougon et en déterminer les facteurs de risque. Méthodes Une étude transversale a été menée à la formation sanitaire de de Yopougon de février à mai 2012 auprès de 145 parturientes et leurs nouveau-nés. Les caractéristiques des mères et des nouveau-nés ont été recueillies. Les prélèvements de sang maternel et du cordon ont permis le dosage des paramètres du métabolisme phosphocalcique. Une régression linéaire multiple a été faite pour apprécier les éléments de prédilection de la calcémie néonatale. Résultats Les valeurs moyennes étaient de 2,271 mmol/l pour la calcémie, 1,169 mmol/l pour le phosphore, 0,735 mmol/l pour le magnésium et 69 g/l pour les protides totaux chez les mères. La durée moyenne du travail était de 499 minutes. L’âge gestationnel moyen était de 39 semaines. Les constantes anthropométriques et cliniques des nouveau-nés étaient normales. Les paramètres phosphocalciques étaient en moyenne normaux (calcémie = 2,52 mmol/l, phosphorémie = 1,668 mmol/l, magnesémie = 0,777 mmol/l, protidémie = 63 g/l). Six gestantes (4,1%) étaient hypocalcémiques contre 12 nouveau-nés (8,1%). La durée du travail influençait la calcémie néonatale (p = 0,02). En analyse multivariée, 34% de la variabilité de la calcémie néonatale était expliqué par la calcémie maternelle et la durée du travail. Conclusion L'hypocalcémie néonatale est rare en zone tropicale. Dans cette étude, la proportion était de 8,1%. La durée du travail

  19. Modèle mathématique pour l'étude des équilibres physico-chimiques de permanentes.


    Chiodi, F


    Résumé La plupart des permanentes du commerce sont constituées d'acide thioglycolique (éventuellement associéà l'acide thiolactique), neutralisé par l'ammoniac, elles sont additionnées de carbonate d'ammonium comme tampon. Le système peut etre traité comme la neutralisation d'un mélange d'acides thioglycolique et carbonique par l'ammoniac, et il est complètement défini par trois paramètres, trois concentrations, ou deux concentrations et le pH, ou trois paramètres analytiques indépendants. Les calculs théoriques de l'équilibre sont compliqués du fait qu'il s'agit de l'équilibre de deux diacides faibles neutralisés par une base faible. Un modèle mathématique développé exclusivement par des équations théoriques permet l'interprétation des équilibres et la réalisation des calculs fiable pour la préparation des formules remplissant certaines caractéristiques. Le modèle permet de réaliser facilement des simulations en faisant varier les concentrations, les acides (par la voie des constantes de dissociation) ou d'associer différents acids et/ou bases organiques ou minérales. Une application complémentaire du modèle est de tracer la courbe dérivée à la courbe de neutralisation et de cette façon mesurer l'effet tampon en différents points par la mesure de sa pente. Synopsis Mathematical model for the study of physico-chemical equilibria in permanent wave solutions Most waving lotions on the market are prepared with thioglycolic acid (eventually associated with thiolactic acid) neutralized with ammonium hydroxide and buffered with ammonium bicarbonate. The system can be treated as the neutralization of a mix of carbonic acid and thioglycolic acid by ammonia and it is completely defined by three parameters: three concentrations; or two concentrations and pH; or three independent analytical parameters. Theoretical calculations of the equilibrium are difficult because the equilibrium involves at least two weak acids with a weak base

  20. Effet Hall et Magnetisme des Alliages Amorphes Nickel-Zirconium Fabriques Par Pulverisation

    NASA Astrophysics Data System (ADS)

    Morel, Robert

    Cette these se situe dans le cadre d'une etude des proprietes electroniques et structurales des alliages metalliques amorphes, en cours depuis quelques annees a l'Universite de Montreal. Ce programme nous a entre autres amene a caracteriser la magnetoresistivite et l'effet Hall d'alliages FeZr, CoZr et NiZr, ce qui a permis de mettre en evidence deux caracteristiques de l'effet Hall: Dans les alliages amorphes ferromagnetiques, la resistivite elevee engendre un effet Hall extraordinaire beaucoup plus important que celui enregistre dans les metaux cristallins. La polarisation des spins entrai ne une asymetrie de la diffusion qui, tant dans les phases cristalline et amorphe, est tenue responsable de cette contribution. L'autre particularite du comportement de Hall de ces systemes est le renversement de signe du coefficient de Hall ordinaire, qui passe du negatif au positif dans les echantillons plus riches en zirconium. Dans les metaux cristallins, un modele d'electrons libres predit un signe negatif a moins que la conduction ne soit dominee par les trous. Or, dans un milieu desordonne les memes concepts sont difficilement applicables et de nouvelles theories ont du etre elaborees pour expliquer ce phenomene. Jusqu'a maintenant, l'etude des alliages amorphes nickel-zirconium s'est faite surtout a partir d'echantillons fabriques par trempe sur roue. Malheureusement cette technique ne permet pas la fabrication d'alliages contenant plus de 70% de nickel, a l'exception du seul compose Ni _{90}Zr_{10 }. Pour pallier a cette lacune et etendre nos connaissance a l'ensemble de la gamme de compositions, nous avons fabrique par pulverisation cathodique des echantillons NiZr amorphes--et quelques alliages cristallins tres riches en nickel--couvrant une bonne partie de la gamme interdite par la technique de trempe sur roue. Dans un premier temps, par comparaison avec les resultats connus nous avons mis en evidence les similitudes et les differences entre les alliages obtenus par

  1. Diapycnal diffusivity in the core and oxycline of the tropical North Atlantic oxygen minimum zone

    NASA Astrophysics Data System (ADS)

    Köllner, Manuela; Visbeck, Martin; Tanhua, Toste; Fischer, Tim


    Diapycnal diffusivity plays an important role in the ventilation of the Eastern Tropical North Atlantic (ETNA) Oxygen Minimum Zone (OMZ). Studies by Fischer et al. (2013), Banyte et al. (2012) and the synthesis by Brandt et al. (2015) found that diapycnal mixing contributes up to 20{%}, locally up to 30{%}, to the oxygen supply in the OMZ. This comparatively high contribution to the oxygen supply for the ETNA OMZ is the consequence of the weak horizontal circulation within the so-called shadow zone of the subtropical gyre (Luyten et al., 1983) and possibly enhanced mixing over rough topography in the seamount area south of the Guinea Dome (Brandt et al., 2015). Diapycnal diffusivity estimates from two Tracer Release Experiments (TREs) and microstructure measurements in the oxycline and core of the oxygen minimum zone (OMZ) in the eastern tropical North Atlantic are compared. For the first time, two TREs within the same area at different depths were realized: the Guinea Upwelling Tracer Release Experiment (GUTRE) initiated in 2008 in the oxycline at approximately 320 m depth, and the Oxygen Supply Tracer Release Experiment (OSTRE) initiated in 2012 in the core of the OMZ at approximately 410 m depth. The mean diapycnal diffusivity Dz was found to be insignificantly smaller in the OMZ core with (1.06 ± 0.24) × 10-5 m2 s-1 compared to (1.11 ± 0.22)) × 10-5 m2 s-1 90 m shallower in the oxycline. Unexpectedly, GUTRE tracer was detected during two of the OSTRE surveys which allowed to estimate diapycnal diffusivity from GUTRE over a time period of seven years. The results are consistent with the Dz estimates from microstructure measurements and demonstrate that Dz does not vary significantly in the OMZ within the depth range of 200-600 m. For both experiments no significant vertical displacements of the tracer larger than 5 m per year were observed over the entire time period of both experiments. REFERENCES Banyte, D., Tanhua, T., Visbeck, M., Wallace, D., Karstensen

  2. Modelizacion, control e implementacion de un procesador energetico paralelo para aplicacion en sistemas multisalida

    NASA Astrophysics Data System (ADS)

    Ferreres Sabater, Agustin

    modelizacion, y aplicacion en convertidores PWM, esta aun por estudiar y valorar. El primer Capitulo consiste en una breve introduccion al problema de la regulacion cruzada y la impedancia cruzada para posteriormente describir las tecnicas de post-regulacion actualmente mas empleadas, con especial atencion al post-regulador con transformador controlado. El Capitulo segundo trata del estudio de las caracteristicas estaticas del postregulador con transformador controlado. Partiendo de los estudios disponibles sobre el postregulador se plantean mejoras en su modo de actuacion y se discuten tres alternativas diferentes para controlar el transformador. Las dos primeras consisten en emplear un convertidor auxiliar Boost en sus dos modos de funcionamiento, continuo y discontinuo. La tercera consiste en controlar el transformador con una tension PWM directamente, sin filtrado. Finalmente se comprueba experimentalmente, para el estado estacionario, el funcionamiento del post-regulador para cada uno de los tres metodos de control. El Capitulo tercero trata de la dinamica de la salida controlada con el post-regulador cuando este emplea un convertidor auxiliar tipo Boost. Mediante la tecnica de promediado de variables de estado se propone el modelo de pequena senal, tanto para el modo continuo como para el modo discontinuo de funcionamiento del convertidor auxiliar. Los resultados mas significativos de esta seccion son las expresiones analiticas de las impedancias cruzadas y de la impedancia de la salida post-regulada. Como complemento al modelo de pequena senal se plantea un modelo de gran senal implementado sobre el simulador Pspice. Con este nuevo modelo se reproducen los resultados obtenidos con el modelo de pequena senal y ademas es posible simular los transitorios en las tensiones de salida ante cambios de carga. La modelizacion del convertidor cuando el transformador se controla con una tension PWM sin filtrar es el objetivo del Capitulo 4. En las secciones siguientes del Capitulo

  3. Tuberculose chez le personnel de santé du secteur public au Burundi: fréquence et facteurs de risque

    PubMed Central

    Mukuku, Olivier; Ruhindiza, Bienvenu Mukuku; Mupepe, Alexis Kumba; Sawadogo, Michel


    Introduction Le but de cette étude était de déterminer la fréquence de la tuberculose (TB) chez le personnel de santé du secteur public en charge des patients tuberculeux et d’évaluer les facteurs de risque de contracter la tuberculose chez ce personnel au Burundi. Méthodes Il s’agit d’une étude transversale à visée analytique réalisée auprès de 300 travailleurs prestant dans 30 centres de dépistage et de traitement de la TB (CDT) au Burundi du 16 octobre au 15 novembre 2012. Les paramètres sociodémographiques et professionnels ainsi que l’antécédent de vaccination BCG de travailleurs ayant été touché par la TB ont été analysé et comparé à ceux de travailleurs qui ne l’ont pas été. Le seuil de signification a été fixé à p < 0,05. Résultats La fréquence de la TB chez le personnel de santé est de 15%. Le risque de souffrir de la TB est de près de 4 fois chez les travailleurs âgés d’au moins 50 ans (OR=3,73; 1,53-9,08), chez ceux qui n’ont jamais reçu de vaccin de BCG (OR=3,73; 1,24-11,03), chez ceux qui n’ont pas de cicatrice vaccinale de BCG (OR=3,80; 1,67-8,62) et chez ceux qui travaillent depuis au moins 6 ans dans un CDT (OR=3,79; 1,44-9,96); ce risque est de 9 fois chez ceux qui sont mariés (OR=9,42; 1,26-70,23), de 8 fois chez ceux qui n’aèrent pas leurs salles de travail (OR=8,20; 1,48-48,23) et de 6 fois chez ceux qui ont comme profession nettoyeur ou aide-soignant (OR=6,12; 2,92-12,82). Par contre, aucune corrélation statistiquement significative n’a été observée entre le fait de souffrir de la TB et le sexe mais aussi le nombre d’heures de contact d’un travailleur avec un patient tuberculeux (p>0,05). Conclusion L’âge, l’antécédent de vaccination de BCG ainsi que la majorité de paramètres professionnels sont en association avec la maladie TB des travailleurs de CDT. D’où, la maîtrise de certains facteurs de risque s’avère important pour faire face au fardeau de la TB parmi

  4. [In Process Citation].


    Aguilar Cordero, María José; Rodríguez Blanquet, Raquel; Sánchez García, Juan Carlos; Sánchez López, Antonio Manuel; Baena García, Laura; López Contreras, Gracia


    Introducción: el entrenamiento mediante ejercicio físico moderado durante el periodo de gestación aporta beneficios tanto a la mujer embarazada como al feto. Los trabajos de investigación consultados vinculan la actividad física con una reducción del número de cesáreas, de partos instrumentados y con un parto más fisiológico. Previene igualmente la ganancia excesiva de peso de la mujer, disminuye el riesgo de diabetes gestacional y de hipertensión arterial.Objetivo: el objetivo de esta investigación es conocer si un programa de ejercicio físico de carácter moderado con el método Study Water Exercise Pregnant (SWEP), realizado en un medio acuático, contribuye a obtener unos resultados más favorables en la etapa perinatal, tanto para la mujer como para el bebé.Material y métodos: el diseño que se llevará a cabo es un ensayo clínico aleatorizado. La muestra estará constituida por 364 gestantes, obtenida de un universo total de 6.579 partos acontecidos en Granada (España) durante el año 2014. Dicha muestra se ha dividido en dos grupos, uno de intervención y otro de control. La actividad se realizará en las instalaciones deportivas acuáticas de la Facultad de Ciencias del Deporte de la Universidad de Granada, que cuentan con dos vasos adecuados a nuestros objetivos, uno polivalente de 25 metros y otro de enseñanza de 12,5 metros.  Resultados: el programa de ejercicios diseñado específicamente para el proyecto denominado SWEP, abarca desde la 20 hasta la 37 semana de gestación (SG) y consta de tres sesiones semanales, con una duración de 60 minutos cada una. Las sesiones incluirán tres fases: fase de calentamiento, fase principal en la que el ejercicio se divide en una parte aeróbica y otra de ejercicios de fuerza y resistencia y una final con estiramientos y relajación. Las variables que se van a estudiar son las siguientes: a) maternas: peso, IMC, tensión arterial, test de O´Sullivan, aparición de depresión postparto

  5. Quantification du champ electromagnetique et description quantique de la generation du second harmonique a l'interieur d'une microcavite

    NASA Astrophysics Data System (ADS)

    Collette, Marc

    L'existence de particules virtuelles qui surgissent spontanement du vide pour disparaitre tres peu de temps apres leur apparition (les fluctuations du vide) trouve son origine dans le principe d'incertitude de Heisenberg. Par ailleurs, on sait que le phenomene de resonance par confinement explique l'amplification de l'intensite lumineuse a l'interieur d'une cavite ouverte aux frequences de resonances de celle-ci. C'est pourquoi le taux d'apparition des photons virtuels au sein des modes propres d'une cavite est lui aussi amplifie par le resonateur. Mathematiquement, cet effet quantique est decrit par l'existence d'un commutateur " anomal " entre les operateurs d'annihilation et de creation des photons. Nous decrivons les consequences de ce commutateur sur la generation du second harmonique optique (GSH), un processus photonique ou, dans un materiau optiquement non lineaire, deux photons de meme energie fusionnent pour n'en former qu'un seul. On commence ce travail avec un traitement complet et original sur la quantification du champ electromagnetique. On montre ensuite que les fluctuations du vide stimulent le signal de la GSH a l'interieur du milieu confine. Cependant, on constate aussi que les fluctuations du vide jouent le role d'un inhibiteur au declenchement du processus, c'est-a-dire que le seuil de la GSH augmente (il est superieur au seuil minimal de deux photons seulement). En conclusion, les mecanismes intimes de certains processus optiques non lineaires doivent etre reconsideres lorsqu'ils surviennent en presence d'un confinement electromagnetique.

  6. Ultrafast Torsional Relaxation of Thioflavin-T in Tris(pentafluoroethyl)trifluorophosphate (FAP) Anion-Based Ionic Liquids.


    Singh, Prabhat K; Mora, Aruna K; Nath, Sukhendu


    Ultrafast spectroscopy on solutes, whose dynamics is very sensitive to the friction in its local environment, has strong potential to report on the microenvironment existing in complex fluids such as ionic liquids. In this work, the torsional relaxation dynamics of Thioflavin-T (ThT), an ultrafast molecular rotor, is investigated in two fluoroalkylphosphate ([FAP])-based ionic liquids, namely, 1-ethyl-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([EMIM][FAP]) and 1-(2-hydroxyethyl)-3-methylimidazolium tris(pentafluoroethyl)trifluorophosphate ([OHEMIM][FAP]), using ultrafast fluorescence up-conversion spectroscopy. The emission quantum yield and the excited-state fluorescence lifetime measurement suggest that the torsional relaxation of Thioflavin-T, in this class of ionic liquids, is guided by the viscosity of the medium. The temporal profile of the dynamic Stokes' shift of ThT, measured from time-resolved emission spectrum (TRES), displays a multiexponential behavior in both ionic liquids. The long time dynamics of the Stokes' shift is reasonably slower for the hydroxyethyl derivative as compared to the ethyl derivative, which is in accordance with their measured shear viscosity. However, the short time dynamics of Stokes' shift is very similar in both the ionic liquids, and seems to be independent of the measured shear viscosity of the ionic liquid. We rationalize these observations in terms of different locations of ThT in these ionic liquids. These results suggest that despite having a higher bulk viscosity in the ionic liquid, they can provide unique microenvironment in their complex structure, where the reaction can be faster than expected from their measured shear viscosity. PMID:26457972

  7. Regiones de formación de estrellas masivas en las Nubes de Magallanes

    NASA Astrophysics Data System (ADS)

    Barbá, R.; Maíz Apellániz, J.; Rubio, M.; Walborn, N.

    Las Nubes de Magallanes son un laboratorio formidable para el estudio de regiones de formación estelar. A diferencia de lo que sucede en el plano galáctico, ambas galaxias contienen poco polvo que nos afecte la visión directa de dichas regiones. Por otra parte, la menor metalicidad de las Nubes, nos permiten hacer un estudio comparativo de la formación estelar en ambientes de baja metalicidad. El presente trabajo da una revisión de los progresos notables que hemos alcanzado en el conocimiento del contenido estelar de algunas regiones de formación de estrellas masivas en ambas Nubes, en base a la utilización de imágenes del Telescopio Espacial Hubble, Gemini Sur, y Very Large Telescope, entre otros. En especial, nos concentramos en 30 Doradus y N11 en la Nube Mayor, y en NGC 346 en la Nube Menor. Nuevas imágenes de N11 obtenidas en los últimos meses con la Advanced Camera for Surveys del Hubble (óptico), y con Flamingos en Gemini Sur (infrarrojo), nos han permitido descubrir un nuevo `jet' con origen en una fuente infrarroja sumergida en un pilar polvoriento similar al objeto Herbig-Haro de M20 en nuestra galaxia. Este `jet' (junto a otros tres que hemos descubierto en 30 Doradus), es el cuarto ejemplo confirmado de `jet' asociado a una protoestrella fuera de nuestra galaxia. Además, presentamos el descubrimiento del primer objeto estelar joven masivo de la Nube Menor confirmado espectroscópicamente.

  8. Discovery of Dual-Stage Malaria Inhibitors with New Targets.


    Raphemot, Rene; Lafuente-Monasterio, Maria J; Gamo-Benito, Francisco Javier; Clardy, Jon; Derbyshire, Emily R


    Malaria remains a major global health problem, with more than half of the world population at risk of contracting the disease and nearly a million deaths each year. Here, we report the discovery of inhibitors that target multiple stages of malaria parasite growth. To identify these inhibitors, we took advantage of the Tres Cantos Antimalarial Compound Set (TCAMS) small-molecule library, which is comprised of diverse and potent chemical scaffolds with activities against the blood stage of the malaria parasite, and investigated their effects against the elusive liver stage of the malaria parasite using a forward chemical screen. From a screen of nearly 14,000 compounds, we identified and confirmed 103 compounds as dual-stage malaria inhibitors. Interestingly, these compounds show preferential inhibition of parasite growth in liver- versus blood-stage malaria parasite assays, highlighting the drug susceptibility of this parasite form. Mode-of-action studies were completed using genetically modified and drug-resistant Plasmodium parasite strains. While we identified some compound targets as classical antimalarial pathways, such as the mitochondrial electron transport chain through cytochrome bc1 complex inhibition or the folate biosynthesis pathway, most compounds induced parasite death through as yet unknown mechanisms of action. Importantly, the identification of new chemotypes with different modes of action in killing Plasmodium parasites represents a promising opportunity for probing essential and novel molecular processes that remain to be discovered. The chemical scaffolds identified with activity against drug-resistant Plasmodium parasites represent starting points for dual-stage antimalarial development to surmount the threat of malaria parasite drug resistance. PMID:26666931

  9. Profil hématologique et nutritionnel du drépanocytaire homozygote SS âgé de 6 à 59 mois à Lubumbashi, République Démocratique du Congo

    PubMed Central

    Shongo, Mick Ya Pongombo; Mukuku, Olivier; Mutombo, Augustin Mulangu; Lubala, Toni Kasole; Ilunga, Paul Makinko; Sombodi, Winnie Umumbu; Wembonyama, Stanislas Okitotsho; Luboya, OscarNumbi


    Introduction La drépanocytose est une maladie génétique très polymorphe et la moitié des drépanocytaires homozygotes SS en Afrique meurt avant l’âge de 5 ans. Le but de cette étude est de déterminer les paramètres nutritionnels et hématologiques des jeunes drépanocytaires homozygotes (SS) congolais au cours de la phase stationnaire. Méthodes Nous avons fait à une étude descriptive comparative de deux groupes de patients dont l'un avec 41 sujets drépanocytaires (SS) d’âge moyen de 39,1mois et l'autre, groupe contrôle, avec 82 patients avec hémoglobine AA et d’âge moyen de 35,0 mois. Nous avons eu recours à un automate ABX Micros 60 pour l’évaluation hématologique. Pour l’évaluation nutritionnel nous avons étudiés le poids, la taille, l’âge ainsi que le sexe. Résultats Nous n'avons pas observé de différence significative entre les deux groupes par rapport à l’état nutritionnel (p > 0,05). L'hémogramme des homozygotes SS révèle une anémie chronique avec un taux moyen d'Hémoglobine à 8,33 ± 1,35g/dL. Cette anémie est normocytaire (VGM = 83,86 µm3), et régénérative (réticulocytes = 4,23±4,26%). Conclusion Nos résultats rencontrent ce qui est souvent décrit dans le syndrome drépanocytaire majeur sur les homozygotes SS avec haplotype bantu. PMID:26587126

  10. Prospects for detection of exoplanet magnetic fields through bow-shock observations during transits

    NASA Astrophysics Data System (ADS)

    Vidotto, A. A.; Jardine, M.; Helling, Ch.


    An asymmetry between the ingress and egress times was observed in the near-UV light curve of the transit planet WASP-12b. Such asymmetry led us to suggest that the early ingress in the UV light curve of WASP-12b, compared to the optical observations, is caused by a shock around the planet, and that shocks should be a common feature in transiting systems. Here, we classify all the transiting systems known to date according to their potential for producing shocks that could cause observable light curve asymmetries. We found that 36/92 of known transiting systems would lie above a reasonable detection threshold and that the most promising candidates to present shocks are: WASP-19b, WASP-4b, WASP-18b, CoRoT-7b, HAT-P-7b, CoRoT-1b, TrES-3 and WASP-5b. For prograde planets orbiting outside the corotation radius of fast rotating stars, the shock position, instead of being ahead of the planetary motion as in WASP-12b, trails the planet. In this case, we predict that the light curve of the planet should present a late-egress asymmetry. We show that CoRoT-11b is a potential candidate to host such a behind shock and show a late egress. If observed, these asymmetries can provide constraints on planetary magnetic fields. For instance, for a planet that has a magnetic field intensity similar to Jupiter's field (˜14 G) orbiting a star whose magnetic field is between 1 and 100 G, the stand-off distance between the shock and the planet, which we take to be the size of the planet's magnetosphere, ranges from 1 to 40 planetary radii.

  11. Phénomènes d'électrisation des matériaux isolants pour transformateurs de puissance

    NASA Astrophysics Data System (ADS)

    Peyraque, L.; Béroual, A.; Boisdon, C.; Buret, F.


    In power transformers, the oil flowed through the cooling ducts in coil assembly induces a static charge separation. The study of this static electrification phenomena is presented through a device allowing to investigate the charge separation generated by the rotating motion of a transformer pressboard in oil. This permits to show the influence of various parameters such as velocity, temperature, moisture and processing of oils and pressboards as well as their nature on this electrical charge. We also present another device allowing to classify oils according to their level of charge production. It appears from our results that a correlation exists between the density of these charges and the characteristics of oil such as conductivity, electric strength and water content. Dans les transformateurs de puissance, la circulation d'huile à travers les canaux de refroidissement en fibre cellulosique (carton isolant) est à l'origine d'une séparation de charges. L'étude de ce phénomène d'électrisation statique est présentée, tout d'abord à travers un dispositif permettant d'étudier la séparation de charges créées par le mouvement du carton dans l'huile. Celui-ci a permis de mettre en évidence l'influence de plusieurs paramètres comme la vitesse, la température, l'humidité et le traitement des huiles et cartons ainsi que la nature du carton sur cette charge. Le second dispositif présenté permet de classer les huiles selon leur niveau de création de charges. Une corrélation semble s'établir entre la densité de ces charges et les grandeurs caractéristiques de l'huile telles que la conductivité, la rigidité diélectrique et la teneur en eau.

  12. Unusual H-type aggregation of coumarin-481 dye in polar organic solvents.


    Verma, Poonam; Pal, Haridas


    Coumarin-481 (C481) dye shows intriguing time-resolved (TR) fluorescence behavior in polar organic solvents of both protic and aprotic nature, namely, ethanol (EtOH) and acetonitrile (ACN), demonstrating the presence of multiple emitting species in the solution. Following concentration-dependent and wavelength-dependent TR fluorescence measurements and the time-resolved emission spectra (TRES) and time-resolved area-normalized emission spectra (TRANES) subsequently constructed using wavelength dependent decay parameters, we convincingly conclude that in the studied solvents a part of the dissolved dye undergoes H-type of aggregation, even at a very low dye concentration. This is quite an unusual finding because the dye C481 apparently shows reasonably good solubility in these organic solvents. As the TR measurements indicate, major contribution in the fluorescence decays is due to monomeric dye, having reasonably short lifetime (∼0.64-0.68 ns), which is in accordance with the conversion of fluorescent intramolecular charge transfer (ICT) state to nonfluorescent twisted intramolecular charge transfer (TICT) state suggested for the dye in high polarity solvents, causing an efficient nonradiative deexcitation. The minor contributions arising from the aggregated dyes show its clear presence in the decays at the blue edge of the emission spectra and have relatively longer lifetimes (∼1.2-5.2 ns) because the steric hindrance caused by the stacked dyes resists the ICT to TICT conversion. Aggregation of C481 dye as observed in the present study in polar organic solvents is an intriguing finding, as the dye is a widely used fluorescent probe for various photochemical studies, where overlooking such aggregation can mislead the observed results. PMID:24168239

  13. Supplemental water releases for fisheries restoration in a Brazilian floodplain River: A conceptual model

    USGS Publications Warehouse

    Godinho, Alexandre L.; Kynard, B.; Martinez, C.B.


    Highly productive floodplain rivers in Brazil and elsewhere provide livelihood and recreational fishing for millions of people around the world, but damming and controlled water discharge are a threat to these valuable ecosystems. Supplemental water releases (SWRs) at a dam are increasingly used for restoring fisheries productivity in many floodplain rivers. We proposed a conceptual model for a hypothetical water release to enhance fisheries using Tre??s Marias Reservoir (TMR) on the Sa??o Francisco River (SFR), Brazil. The information needed by the model follows: (i) Biologically, what is the best release date? (ii) How much water will be released? (iii) What is the pattern of impoundment and how much impounded water will be released? (iv) What is the lost revenue to the power plant associated with SWR? (v) What is the relationship between river discharge and the area of floodplain that is flooded? (vi) What is the relationship between SWR and fisheries value? Ichthyoplankton studies in the SFR showed a clear positive relationship between fish density and water level (WL). While the relationship between WL and floodplain area flooded and recruitment is not known, we concluded the best date for release is when there is a natural flood, which naturally triggers fish spawning and the SWR will add to the natural flood and cover a greater floodplain area. The released volume will range from 0.302km3 to 2.192 km3, depending on SWR duration. In most years from 1976 to 2003, TMR impounded enough water for SWR only in the second half of the fish-spawning season (January-March). Lost revenue at TMR depended on release volume and ranged from US$ 0.493 million to US$ 3.452 million for the actual power rate. However, SWR could increase commercial fisheries income an estimated US$ 4.468 million. We forecast that SWR can bring fisheries benefits that surpass the lost revenue.

  14. Managing Carbon on Federal Public Lands: Opportunities and Challenges in Southwestern Colorado

    NASA Astrophysics Data System (ADS)

    Dilling, Lisa; Kelsey, Katharine C.; Fernandez, Daniel P.; Huang, Yin D.; Milford, Jana B.; Neff, Jason C.


    Federal lands in the United States have been identified as important areas where forests could be managed to enhance carbon storage and help mitigate climate change. However, there has been little work examining the context for decision making for carbon in a multiple-use public land environment, and how science can support decision making. This case study of the San Juan National Forest and the Bureau of Land Management Tres Rios Field Office in southwestern Colorado examines whether land managers in these offices have adequate tools, information, and management flexibility to practice effective carbon stewardship. To understand how carbon was distributed on the management landscape we added a newly developed carbon map for the SJNF-TRFO area based on Landsat TM texture information (Kelsey and Neff in Remote Sens 6:6407-6422. doi: 10.3390/rs6076407, 2014). We estimate that only about 22 % of the aboveground carbon in the SJNF-TRFO is in areas designated for active management, whereas about 38 % is in areas with limited management opportunities, and 29 % is in areas where natural processes should dominate. To project the effects of forest management actions on carbon storage, staff of the SJNF are expected to use the Forest Vegetation Simulator (FVS) and extensions. While identifying FVS as the best tool generally available for this purpose, the users and developers we interviewed highlighted the limitations of applying an empirically based model over long time horizons. Future research to improve information on carbon storage should focus on locations and types of vegetation where carbon management is feasible and aligns with other management priorities.

  15. Managing Carbon on Federal Public Lands: Opportunities and Challenges in Southwestern Colorado.


    Dilling, Lisa; Kelsey, Katharine C; Fernandez, Daniel P; Huang, Yin D; Milford, Jana B; Neff, Jason C


    Federal lands in the United States have been identified as important areas where forests could be managed to enhance carbon storage and help mitigate climate change. However, there has been little work examining the context for decision making for carbon in a multiple-use public land environment, and how science can support decision making. This case study of the San Juan National Forest and the Bureau of Land Management Tres Rios Field Office in southwestern Colorado examines whether land managers in these offices have adequate tools, information, and management flexibility to practice effective carbon stewardship. To understand how carbon was distributed on the management landscape we added a newly developed carbon map for the SJNF-TRFO area based on Landsat TM texture information (Kelsey and Neff in Remote Sens 6:6407-6422. doi: 10.3390/rs6076407 , 2014). We estimate that only about 22 % of the aboveground carbon in the SJNF-TRFO is in areas designated for active management, whereas about 38 % is in areas with limited management opportunities, and 29 % is in areas where natural processes should dominate. To project the effects of forest management actions on carbon storage, staff of the SJNF are expected to use the Forest Vegetation Simulator (FVS) and extensions. While identifying FVS as the best tool generally available for this purpose, the users and developers we interviewed highlighted the limitations of applying an empirically based model over long time horizons. Future research to improve information on carbon storage should focus on locations and types of vegetation where carbon management is feasible and aligns with other management priorities. PMID:27272016

  16. Effect of Protein Kinase C delta (PKC-δ) Inhibition on the Transcriptome of Normal and Systemic Sclerosis Human Dermal Fibroblasts In Vitro

    PubMed Central

    Wermuth, Peter J.; Addya, Sankar; Jimenez, Sergio A.


    Previous studies demonstrated that protein kinase C- δ (PKC-δ) inhibition with the selective inhibitor, rottlerin, resulted in potent downregulation of type I collagen expression and production in normal human dermal fibroblasts and abrogated the exaggerated type I collagen production and expression in fibroblasts cultured from affected skin from patients with the fibrosing disorder systemic sclerosis (SSc). To elucidate the mechanisms involved in the ability of PKC-δ to regulate collagen production in fibroblasts, we examined the effects of PKC-δ inhibition on the transcriptome of normal and SSc human dermal fibroblasts. Normal and SSc human dermal fibroblasts were incubated with rottlerin (5 µM), and their gene expression was analyzed by microarrays. Pathway analysis and gene ontology analysis of differentially expressed genes in each comparison were performed. Identification of significantly overrepresented transcriptional regulatory elements (TREs) was performed using the Promoter Analysis and Interaction Network Toolset (PAINT) program. PKC-δ activity was also inhibited using RNA interference (siRNA) and by treating fibroblasts with a specific PKC-δ inhibitory cell permeable peptide. Differential gene expression of 20 genes was confirmed using real time PCR. PKC-δ inhibition caused a profound change in the transcriptome of normal and SSc human dermal fibroblasts in vitro. Pathway and gene ontology analysis identified multiple cellular and organismal pathways affected by PKC-δ inhibition. Furthermore, both pathway and PAINT analyses indicated that the transcription factor NFκB played an important role in the transcriptome changes induced by PKC-δ inhibition. Multiple genes involved in the degradation of the extracellular matrix components were significantly reduced in SSc fibroblasts and their expression was increased by PKC-δ inhibition. These results indicate that isoform-specific inhibition of PKC-δ profibrotic effects may represent a novel


    SciTech Connect

    Beerer, Ingrid M.; Knutson, Heather A.; Burrows, Adam; Fortney, Jonathan J.; Laughlin, Gregory; Agol, Eric; Cowan, Nicolas B.; Charbonneau, David; Desert, Jean-Michel; Deming, Drake; Langton, Jonathan; Lewis, Nikole K.; Showman, Adam P.


    We present photometry of the giant extrasolar planet WASP-4b at 3.6 and 4.5 {mu}m taken with the Infrared Array Camera on board the Spitzer Space Telescope as part of Spitzer's extended warm mission. We find secondary eclipse depths of 0.319% {+-} 0.031% and 0.343% {+-} 0.027% for the 3.6 and 4.5 {mu}m bands, respectively, and show model emission spectra and pressure-temperature profiles for the planetary atmosphere. These eclipse depths are well fit by model emission spectra with water and other molecules in absorption, similar to those used for TrES-3 and HD 189733b. Depending on our choice of model, these results indicate that this planet has either a weak dayside temperature inversion or no inversion at all. The absence of a strong thermal inversion on this highly irradiated planet is contrary to the idea that highly irradiated planets are expected to have inversions, perhaps due the presence of an unknown absorber in the upper atmosphere. This result might be explained by the modestly enhanced activity level of WASP-4b's G7V host star, which could increase the amount of UV flux received by the planet, therefore reducing the abundance of the unknown stratospheric absorber in the planetary atmosphere as suggested in Knutson et al. We also find no evidence for an offset in the timing of the secondary eclipse and place a 2{sigma} upper limit on |ecos {omega}| of 0.0024, which constrains the range of tidal heating models that could explain this planet's inflated radius.

  18. Thyroid hormone-dependent epigenetic suppression of herpes simplex virus-1 gene expression and viral replication in differentiated neuroendocrine cells.


    Figliozzi, Robert W; Chen, Feng; Balish, Matthew; Ajavon, Amakoe; Hsia, S Victor


    A global HSV-1 gene repression occurs during latency in sensory neurons where most viral gene transcriptions are suppressed. The molecular mechanisms of gene silencing and how stress factors trigger the reactivation are not well understood. Thyroid hormones are known to be altered due to stress, and with its nuclear receptor impart transcriptional repression or activation depending upon the hormone level. Therefore we hypothesized that triiodothyronine (T3) treatment of infected differentiated neuron like cells would reduce the ability of HSV-1 to produce viral progeny compared to untreated infected cells. Previously we identified putative thyroid hormone receptor elements (TREs) within the promoter regions of HSV-1 thymidine kinase (TK) and other key genes. Searching for a human cell line that can model neuronal HSV-1 infection, we performed HSV-1 infection experiments on differentiated human neuroendocrine cells, LNCaP. Upon androgen deprivation these cells undergo complete differentiation and exhibit neuronal-like morphology and physiology. These cells were readily infected by our HSV-1 recombinant virus, expressing GFP and maintaining many processes iconic of dendritic morphology. Our results demonstrated that differentiated LNCaP cells produced suppressive effects on HSV-1 gene expression and replication compared to its undifferentiated counterpart and T3 treatment has further decreased the viral plaque counts compared to untreated cells. Upon washout of the T3 viral plaque counts were restored, indicating an increase of viral replication. The qRT-PCR experiments using primers for TK showed reduced expression under T3 treatment. ChIP assays using a panel of antibodies for H3 lysine 9 epigenetic marks showed increased repressive marks on the promoter regions of TK. In conclusion we have demonstrated a T3 mediated quiescent infection in differentiated LNCaP cells that has potential to mimic latent infection. In this HSV-1 infection model thyroid hormone

  19. Identification of Thyroid Hormone Receptor Binding Sites and Target Genes Using ChIP-on-Chip in Developing Mouse Cerebellum

    PubMed Central

    Dong, Hongyan; Yauk, Carole L.; Rowan-Carroll, Andrea; You, Seo-Hee; Zoeller, R. Thomas; Lambert, Iain; Wade, Michael G.


    Thyroid hormone (TH) is critical to normal brain development, but the mechanisms operating in this process are poorly understood. We used chromatin immunoprecipitation to enrich regions of DNA bound to thyroid receptor beta (TRβ) of mouse cerebellum sampled on post natal day 15. Enriched target was hybridized to promoter microarrays (ChIP-on-chip) spanning −8 kb to +2 kb of the transcription start site (TSS) of 5000 genes. We identified 91 genes with TR binding sites. Roughly half of the sites were located in introns, while 30% were located within 1 kb upstream (5′) of the TSS. Of these genes, 83 with known function included genes involved in apoptosis, neurodevelopment, metabolism and signal transduction. Two genes, MBP and CD44, are known to contain TREs, providing validation of the system. This is the first report of TR binding for 81 of these genes. ChIP-on-chip results were confirmed for 10 of the 13 binding fragments using ChIP-PCR. The expression of 4 novel TH target genes was found to be correlated with TH levels in hyper/hypothyroid animals providing further support for TR binding. A TRβ binding site upstream of the coding region of myelin associated glycoprotein was demonstrated to be TH-responsive using a luciferase expression system. Motif searches did not identify any classic binding elements, indicating that not all TR binding sites conform to variations of the classic form. These findings provide mechanistic insight into impaired neurodevelopment resulting from TH deficiency and a rich bioinformatics resource for developing a better understanding of TR binding. PMID:19240802

  20. Dynamique sub-picoseconde de l'interaction laser de puissance agrégats de gaz rare: emission intense de rayons X et production d'ions multichargés

    NASA Astrophysics Data System (ADS)

    Prigent, C.; Adoui, L.; Dreuil, S.; Gauthier, J. C.; Gobert, O.; Lamour, E.; Meynadier, P.; Normand, D.; Perdrix, M.; Rozet, J.-P.; Vernhet, D.


    Lors de campagnes d'expériences réalisées sur le Laser Ultra Court Accordable du CEA/Saclay, nous avons étudié le rayonnement X, tant qualitativement (spectroscopie et énergie moyenne des photons) que quantitativement (taux absolus et lois d'évolution), émis lors de l'interaction d'un jet effusif d'agrégats de gaz rare (Ar, Kr, Xe comprenant entre 10^4 et 10^6 atome/agrégat) avec un laser femtoseconde de puissance (éclairement jusqu'à quelques 10^{17} W/cm^2). Les résultats présentés dans ce manuscrit sont uniquement dédiés aux agrégats d'Ar pour lesquels nous avons observé un rayonnement X issu d'ions fortement multichargés (jusqu'à l'Ar^{16+}) présentant des lacunes en couches K. La technique de spectroscopie X utilisée a permis de déterminer pour la première fois des taux absolus ainsi que les lois d'évolution de l'émission X en fonction de l'ensemble des paramètres gouvernant l'interaction (intensité, polarisation, longueur d'onde et durée du pulse laser aussi bien que taille, densité et numéro atomique des agrégats).

  1. Testing a Method of Detecting a Magnetic Field of Transiting Hot-Jupiter CoRot-1b

    NASA Astrophysics Data System (ADS)

    Biddle, Lauren; Turner, J.; Pearson, K.; Teske, J.


    In October of 2011 and December of 2012, exoplanet CoRot-1b was observed on the Steward Observatory 1.55m Kuiper Telescope using the Bessel-U filter to detect a possible magnetic field. It is suggested by Vidotto et. al. (2011), that it is possible to detect a magnetic field of a transiting exoplanet in the near-UV photometric band by comparing asymmetry between the ingress and egress of the light curve. This effect is believed to be caused by a bow shock being formed in front of a closely orbiting planet as it transverses through the coronal plasma of its host star. CoRot-1b is a candidate for demonstrating this effect. We do not observe an early ingress in our near-UV broad-band light curves from the 61" Kuiper Telescope. We find an unexpected upper limit of 0.087-1.4 Gauss for the magnetic field strength of CoRoT-1b. This result is consistent with the near-UV observations by Turner et al. (2013) of another exoplanet predicted to show this effect, TrES-3b. It was suggested by Vidotto et al. (2011) and the finding of Turner et al. (2013) that an early ingress observed in the near-UV might only happen at certain spectral resonance lines. To find the best fit to the light curves we used a modeling package called EXOMOP that uses the analytic equations of Mandel & Agol (2002) to generate a model transit, the Levenberg-Marquardt non-linear least squares minimization algorithm to find the best fit, the bootstrap Monte Carlo technique to calculate robust errors of the fitted parameters, and the residual permutation “rosary bead” method to access the importance of red noise. Several other parameters to confirm and amend can be derived from the light curve including the planet’s mass, radius, density, surface gravity, distance, and orbital inclination.

  2. Procesamiento Digital de Imagenes del Cometa Halley

    NASA Astrophysics Data System (ADS)

    Ferrin, L.; Fuenmayor, F.; Naranjo, O.; Bulka, P.; Mendoza, C.


    Se reportan observaciones fotográficas del cometa Halley, obtenidas con los telescopios Schmidt de 1-m del CIDA, y de 35 cms de la ULA. Se hicieron exposiciones desde 2 segundos a 30 minutos y se utilizaron emulsiones IIa-O, 103a-F, y 103a-D, guladas manualmente 0 automaticámente. Las imágenes fueron digitalizadas con el microdensitómetro PDS, y procesadas con el sistema HACIENDA del CCIBM. Se experimentó con la Transformada de Fourier en dos dimensiones, y con la aplicación de filtros de paso alto y bajo. Se encontró que el metodo de "autocorrelación" es el mejor para separar "la vegetación" de "la montaña". Se aplicaron diversas técnicas a fin de cubrir ambos extremos: a) enfatizar detalles débiles en la cola, y b) penetrar en las regiones más intensas de la coma. Se lograron ambos objetivos. Detalles en la cola permitieron determinar velocidades de propagación de unos 50 a 90 kms/ seg. Se pudieron detectar no menos de tres perturbaciones en "Y", y una en 5? Co de Cisne). Se cree que las primeras están asociadas a eventos de desconexión. Se puede separar la cola de gas de la de polvo. Las fotos de color permiten enfatizar diferentes regiones espectrales con mayor claridad aún. El "balance" del color puede ser hecho con la computadora.


    SciTech Connect

    Adams, E. R.; Dupree, A. K.; Kulesa, C.; McCarthy, D.


    All transiting planet observations are at risk of contamination from nearby, unresolved stars. Blends dilute the transit signal, causing the planet to appear smaller than it really is, or producing a false positive detection when the target star is blended with an eclipsing binary. High spatial resolution adaptive optics images are an effective way of resolving most blends. Here we present visual companions and detection limits for 12 Kepler planet candidate host stars, of which 4 have companions within 4''. One system (KOI 1537) consists of two similar-magnitude stars separated by 0.''1, while KOI 174 has a companion at 0.''5. In addition, observations were made of 15 transiting planets that were previously discovered by other surveys. The only companion found within 1'' of a known planet is the previously identified companion to WASP-2b. An additional four systems have companions between 1'' and 4'': HAT-P-30b (3.''7, {Delta}Ks = 2.9), HAT-P-32b (2.''9, {Delta}Ks = 3.4), TrES-1b (2.''3, {Delta}Ks = 7.7), and WASP-P-33b (1.''9, {Delta}Ks = 5.5), some of which have not been reported previously. Depending on the spatial resolution of the transit photometry for these systems, these companion stars may require a reassessment of the planetary parameters derived from transit light curves. For all systems observed, we report the limiting magnitudes beyond which additional fainter objects located 0.''1-4'' from the target may still exist.

  4. Poisoning of sheep by Vernonia plantaginoides (Less.) Hieron in Uruguay.


    Dutra, Fernando; Romero, Agustin; Quinteros, Carina; Araújo, Ruben; García Y Santos, Carmen


    Vernonia plantaginoides (Less.) Hieron, previously known as Vernonia squarrosa, is a rhizomatous subshrub with purple flowers that is prevalent in the natural grassland of Uruguay, Argentina, and southern Brazil. We report an outbreak of V. plantaginoides (yuyo moro) intoxication in sheep in Treinta y Tres Department, northeastern Uruguay. A total of 54 of 463 (12%) recently weaned lambs died 2-7 days after entering a natural pasture that had been invaded by sprouting V. plantaginoides The first cases were found dead. Affected lambs showed marked jaundice, edema of the face, ears, and eyelids, and severe photodermatitis. At the autopsies of 3 lambs, the carcass was yellow, the liver was enlarged with a marked acinar pattern ("nutmeg liver"), and hemorrhages were observed on serous membranes. Microscopic lesions were characterized by diffuse periacinar hepatocellular necrosis and cholemic nephrosis. Three female lambs were experimentally dosed with the aerial parts of V. plantaginoides collected immediately after the outbreak. The lamb that was dosed once with 40 g/kg body weight died after 36 h with severe hepatic necrosis. The lamb dosed with 20 g/kg daily for 4 days showed clinical signs and microscopic lesions in the liver with multiple apoptotic hepatocytes in the periacinar zone. The third lamb, dosed with 30, 17, and 15 g/kg daily over 3 days, respectively, showed transient clinical signs and a rise in liver enzymes, but recovered, and no lesions were found postmortem. These results demonstrate that V. plantaginoides was responsible for severe field outbreaks of poisoning in sheep in Uruguay. PMID:27240570

  5. Thyroid Hormone-dependent Epigenetic Suppression of Herpes Simplex Virus-1 Gene Expression and Viral Replication in Differentiated Neuroendocrine Cells

    PubMed Central

    Figliozzi, Robert W.; Chen, Feng; Balish, Matthew; Ajavon, Amakoe; Hsia, S. Victor


    A global HSV-1 gene repression occurs during latency in sensory neurons where most viral gene transcriptions are suppressed. The molecular mechanisms of gene silencing and how stress factors trigger the reactivation are not well understood. Thyroid hormones are known to be altered due to stress, and with its nuclear receptor impart transcriptional repression or activation depending upon the hormone level. Therefore we hypothesized that triiodothyronine (T3) treatment of infected differentiated neuron like cells would reduce the ability of HSV-1 to produce viral progeny compared to untreated infected cells. Previously we identified putative thyroid hormone receptor elements (TREs) within the promoter regions of HSV-1 thymidine kinase (TK) and other key genes. Searching for a human cell line that can model neuronal HSV-1 infection, we performed HSV-1 infection experiments on differentiated human neuroendocrine cells, LNCaP. Upon androgen deprivation these cells undergo complete differentiation and exhibit neuronal-like morphology and physiology. These cells were readily infected by our HSV-1 recombinant virus, expressing GFP and maintaining many processes iconic of dendritic morphology. Our results demonstrated that differentiated LNCaP cells produced suppressive effects on HSV-1 gene expression and replication compared to its undifferentiated counterpart and T3 treatment have further decreased the viral plaque counts compared to untreated cells. Upon washout of the T3 viral plaque counts were restored, indicating an increase of viral replication. The qRT-PCR experiments using primers for TK showed reduced expression under T3 treatment. ChIP assays using a panel of antibodies for H3 lysine 9 epigenetic marks showed increased repressive marks on the promoter regions of TK. In conclusion we have demonstrated a T3 mediated quiescent infection in differentiated LNCaP cells that has potential to mimic latent infection. In this HSV-1 infection model thyroid hormone

  6. Other Worlds, Other Earths

    NASA Astrophysics Data System (ADS)

    Sunbury, Susan; Gould, R. R.


    The Harvard-Smithsonian Center for Astrophysics is developing a two-to-three week NSF-funded program for middle and high school students using telescope-based investigations of real world cutting edge scientific questions. The goal is to reveal and enhance students' understanding of core concepts in the physical sciences as well as to develop their proficiency in the practice of scientific inquiry. Specifically, students and teachers are joining scientists in the search for habitable worlds by exploring transiting exoplanets. Using robotic telescopes, image processing software and simulations, students take images and then measure the brightness of their target star to create a portrait of a transiting planet including how large it is; the tilt of its orbit; how far it is from its star and what its environment might be like. Once classes collect and analyze their own data, they can begin to compare, combine, and communicate their findings with others in the community. Interactive models help students predict what they might expect to find and interpret what they do find. During the past two years, the Center for Astrophysics has tested the concept in fifty middle-and high-school classrooms, enrichment classes and after school science clubs in 13 states across the United States. To date, astronomy, earth science, and physics students have successfully detected Jupiter-sized planets transiting stars such as TRES-3, HATP-10, and HATP-12. Preliminary results indicate that learning of core concept did occur. Gains in content were most significant in middle school students as this project delivered new information to them while it served primarily as a review of concepts and application of skills for advanced placement classes. A significant change also occurred in students’ self reported knowledge of exoplanets. There was also an increase in students’ awareness of exoplanets and attitudes about science after participating in this project.

  7. Surpoids et obésité dans la population au-dessus de 20 ans en milieu urbain bamakois (Mali)

    PubMed Central

    Oumar Bâ, Hamidou; Menta, Ichaka; Camara, Youssouf; Sangaré, Ibrahima; Sidibé, Noumou; Doumbia, Seydou; Diarra, Mamadou Bocary


    Introduction Il est question dans notre travail d’étudier le SP et l'OB et les facteurs associés dans la population âgée de 20 ans ou plus. Méthodes Notre échantillon a été obtenu à partir d'une enquête sur les pathologies cardiovasculaires dans le District de Bamako et impliquant 2199 sujets de 5-104 ans, en sélectionnant tous les sujets âgés d'au moins 20 ans (1162). Pour chaque sujet, l'IMC, rapport taille / hanche et le tour de taille ont été déterminées. Les données ont été analysées avec SPSS 12. Résultats L’âge moyen était de 36,86 années, 61,4% étaient des femmes, 49,7% dans le secteur informel et 38,0% avaient réalisé l'enseignement primaire. Facteurs de risque cardiovasculaires étaient l'inactivité physique (72,4%), le tabagisme (12,2%) et hypertension (26,7%). La prévalence de l'obésité était de 8,8 et 14,7% respectivement sur la base de l'indice de masse et le tour de taille. Conclusion Le SP et l'OB sont à prendre en compte dans les mesures de politique sanitaire que dans la pratique quotidienne des professionnels de santé, il est peut-être plus utile d'utiliser plusieurs paramètres pour être à même de bien stratifier nos patients par rapport à leur risque. PMID:25932065

  8. Renewed Volcano-Stratigraphc Studies of Calderas with Geothermal Potential in Mexico

    NASA Astrophysics Data System (ADS)

    Macias, J. L.; Arce, J. L.; García-Tenorio, F.; Layer, P. W.; Saucedo, R.; Castro, R.; Garduño, V. H.; Jimenez, A.; Pérez, H.; Valdez, G.; Meriggi, L.


    During the past six years we have carried out volcanologic fieldwork either in active geothermal fields in Mexico (Los Azufres, Tres Vírgenes, and Cerro Prieto) or in potential sites in which some geothermal exploration studied had been done by the National Power Company (CFE). These studies have been very successful in reassessing the location of the geothermal reservoirs within the volcanic successions through detailed mapping of the volcanic units using high resolution topography and satellite imagery to produce 3-D imagery in conjunction with field work to produce preliminary geologic maps. Detailed stratigraphy of volcanic units, assisted with 40Ar/39Ar and radiocarbon geochronology have redefined the evolution of some of these complexes. For example, our studies at Los Azufres geothermal field located in the State of Michoacán indicate that the volcanic complex of the same name sits upon a structural high transected by E-W faults related to the youngest structures of the Trans-Mexican Volcanic Belt. The volcanic complex has been emplaced during the past ~1.5 Ma. During this time, magmas evolved from basaltic to rhyolitic in composition with the emplacement of circa 100 vents. Several landforms have undergone intense hydrothermal alteration and, in some cases, generated debris avalanches. The revised stratigraphy based on drill holes and new dates of cores suggested that the geothermal reservoir is hosted in Miocene rocks bracketed between the Miocene Sierra de Mil Cumbres volcanics (17-22 Ma) and the products of the volcanic field itself. Similar studies will be carried out at four other Pleistocene calderas (Acoculco, La Primavera, Aguajito and Reforma) attempting to refine their volcanic stratigraphy, evolution, and the location of the geothermal system, and those results will help in the design of exploration strategies for geothermal sources.

  9. Stratigraphy of Pyroclastic Deposits of EL Aguajito Caldera, Baja California Sur, MÉXICO

    NASA Astrophysics Data System (ADS)

    Osorio Ocampo, L. S.; Macias, J. L.; García Sánchez, L.; Pola, A.; Saucedo, R.; Sánchez, J. M.; Avellán, D. R.; Cardona, S.; Reyes-Agustín, G.; Arce, J. L.


    El Aguajito caldera is located in the State of Baja California Sur, it comprises an area of 450 km2 and sits within the Santa Rosalía Basin which is controlled by NE-SW extensional structures and the NW-SE Cimarron Fault that transects the caldera structure. The oldest rocks are ~90 Ma granodiorites covered by an Oligocene-Miocene volcano-sedimentary sequence, the Miocene Santa Lucia Formation and La Esperanza basalt. Pliocene volcanism is represented by La Reforma caldera, El Aguajito caldera, and the Tres Vírgenes Volcanic complex. This study focuses on the cartography and stratigraphy of area in order to understand the evolution of the volcanic system. The stratigraphy from base to top consists of a series of shallow marine sediments (fossiliferous sandstones) covered by a thick sequence of ignimbrites and pyroclastic flows interbedded with volcaniclastic deposits (Gloria and El Infierno Formations). On top of these deposits is El Aguajito caldera, it consists of a 2 m thick pumice fallout followed by an ignimbrite with three transitional lithofacies: a ≤30-m thick light-pink pyroclastic flow enriched in pumice at the base that gradually becomes enrich in lithics towards the top with the occurrence of degasing pipes. On top rests a 15 m-thick light-purple ignimbrite slightly welded with fiammes and a sequence of pumiceous pyroclastic flows and fallouts. These deposits have been associate to the caldera formation with a collapse diameter of ~8 km marked by rhyolitic domes exposed along a ring collapse crowned the sequence as well as NW-SE aligned rhyolitic domes parallel to the seashore. This cartography allowed to present a preliminary new geological map with four stratigraphic units recognized so far, that were emplaced under subaerial conditions beginning with a Plinian column followed by the emplacement of El Aguajito ignimbrite with its subsequent caldera collapse and finally the extrusion of resurgent domes.

  10. Pesticides and inner-city children: exposures, risks, and prevention.


    Landrigan, P J; Claudio, L; Markowitz, S B; Berkowitz, G S; Brenner, B L; Romero, H; Wetmur, J G; Matte, T D; Gore, A C; Godbold, J H; Wolff, M S


    Six million children live in poverty in America's inner cities. These children are at high risk of exposure to pesticides that are used extensively in urban schools, homes, and day-care centers for control of roaches, rats, and other vermin. The organophosphate insecticide chlorpyrifos and certain pyrethroids are the registered pesticides most heavily applied in cities. Illegal street pesticides are also in use, including tres pasitos (a carbamate), tiza china, and methyl parathion. In New York State in 1997, the heaviest use of pesticides in all counties statewide was in the urban boroughs of Manhattan and Brooklyn. Children are highly vulnerable to pesticides. Because of their play close to the ground, their hand-to-mouth behavior, and their unique dietary patterns, children absorb more pesticides from their environment than adults. The long persistence of semivolatile pesticides such as chlorpyrifos on rugs, furniture, stuffed toys, and other absorbent surfaces within closed apartments further enhances urban children's exposures. Compounding these risks of heavy exposures are children's decreased ability to detoxify and excrete pesticides and the rapid growth, development, and differentiation of their vital organ systems. These developmental immaturities create early windows of great vulnerability. Recent experimental data suggest, for example, that chlorpyrifos may be a developmental neurotoxicant and that exposure in utero may cause biochemical and functional aberrations in fetal neurons as well as deficits in the number of neurons. Certain pyrethroids exert hormonal activity that may alter early neurologic and reproductive development. Assays currently used for assessment of the toxicity of pesticides are insensitive and cannot accurately predict effects to children exposed in utero or in early postnatal life. Protection of American children, and particularly of inner-city children, against the developmental hazards of pesticides requires a comprehensive

  11. Pesticides and inner-city children: exposures, risks, and prevention.

    PubMed Central

    Landrigan, P J; Claudio, L; Markowitz, S B; Berkowitz, G S; Brenner, B L; Romero, H; Wetmur, J G; Matte, T D; Gore, A C; Godbold, J H; Wolff, M S


    Six million children live in poverty in America's inner cities. These children are at high risk of exposure to pesticides that are used extensively in urban schools, homes, and day-care centers for control of roaches, rats, and other vermin. The organophosphate insecticide chlorpyrifos and certain pyrethroids are the registered pesticides most heavily applied in cities. Illegal street pesticides are also in use, including tres pasitos (a carbamate), tiza china, and methyl parathion. In New York State in 1997, the heaviest use of pesticides in all counties statewide was in the urban boroughs of Manhattan and Brooklyn. Children are highly vulnerable to pesticides. Because of their play close to the ground, their hand-to-mouth behavior, and their unique dietary patterns, children absorb more pesticides from their environment than adults. The long persistence of semivolatile pesticides such as chlorpyrifos on rugs, furniture, stuffed toys, and other absorbent surfaces within closed apartments further enhances urban children's exposures. Compounding these risks of heavy exposures are children's decreased ability to detoxify and excrete pesticides and the rapid growth, development, and differentiation of their vital organ systems. These developmental immaturities create early windows of great vulnerability. Recent experimental data suggest, for example, that chlorpyrifos may be a developmental neurotoxicant and that exposure in utero may cause biochemical and functional aberrations in fetal neurons as well as deficits in the number of neurons. Certain pyrethroids exert hormonal activity that may alter early neurologic and reproductive development. Assays currently used for assessment of the toxicity of pesticides are insensitive and cannot accurately predict effects to children exposed in utero or in early postnatal life. Protection of American children, and particularly of inner-city children, against the developmental hazards of pesticides requires a comprehensive

  12. Análisis del futuro marco de referencia internacional

    NASA Astrophysics Data System (ADS)

    Cionco, G. R.; Arias, E. F.

    La técnica de interferometría de muy larga línea de base (VLBI) se aplica hoy a la astrometría para el cálculo de posiciones precisas de radiofuentes extragalácticas. Por tratarse de objetos lejanos, sus movimientos propios aparentes pueden considerarse nulos; esta propiedad hace que los catálogos de radiofuentes extragalácticas VLBI constituyan la mejor materialización de un sistema de referencia celeste inercial definido cinemáticamente. La Unión Astronómica Internacional (IAU) recomendó la adopción de un nuevo sistema de referencia celeste internacional materializado por las coordenadas ecuatoriales de objetos extragalácticos observados con le técnica VLBI. Para superar la precisión astrométrica actual es necesaria una mejora en la modelización de aquellos fenómenos que pueden introducir desviaciones sistemáticas en el marco de referencia celeste. El objetivo de este trabajo es poner de manifiesto las sistematicidades presentes en los distintos marcos de referencia elaborados con el próposito de materializar el nuevo sistema de referencia celeste de la IAU. Para la comparación de los distintos marcos de referencia se propone un modelo de tres rotaciones diferenciales más un término lineal que procura absorber los efectos sistemáticos presentes en las coordenadas. Se analiza igualmente la estabilidad de la solución cuando se utilizan distintos conjuntos de objetos de definición.


    NASA Astrophysics Data System (ADS)

    Gonzalez, T.; Ortiz, I.


    Analysis and interpretation of gravimetric anomalies over the Occidental-Central Mexican Volcanic Belt, sheds new light on the subsurface structure of the Ixtlan de los Hervores, geothermal area. In Mexico, there are several geothermal areas that have been exploited commercially (Cerro Prieto, Los Azufres, Los Humeros, Tres Virgenes fields). However, there are many other known fields that have not been exploited. This is the case in the area of "Ixtlan de los Hervores" in the state of Michoacan. The analyzed region covers a rectangular area, aproximality from 20o N to 20.5° N and 102° W to 102.2°W. In the region there are thick basalt flows. The area is characterized by low and elongated hills formed by volcanic flows and on a smaller scale lacustrian sediments and major normal faults with a NW-SE direction particularly, the Ixtlan-Encinal fault which controls the trace of the Duero River and the Pajacuarán fault. The anomaly map was compared with the surface geology and the anomalies were correlated with major volcanic features, since our main interest was in mapping the subsurface faults and volcanic bodies. Two profiles were selected that cross major anomalies and the geothermal zone of Ixtlan. The Talwani algorithm for 2-D polygonal bodies has been used for calculating the theoretical anomalies. The proposed models adequately explain the main observed geological features. The models are made up of two lithostratigraphic units of volcanic rocks, represented by the Tertiary basalts, which adequately reflect the area's volcanic environment. These basaltic units, corresponding to different volcanic events were cut by the Ixtlan well. Both models reflect the existence of the Ixtlan-Encinal fault, the most important feature in the area which is also responsible for the existence of the geothermal area.

  14. Cretaceous stratigraphy and biostratigraphy, Sierra Blanca basin, southeastern New Mexico

    SciTech Connect

    Lucas, S.G. ); Anderson, O.R. )


    The Sierra Blanca basin of Otero and Lincoln counties, New Mexico contains a Lower (upper Albian)-Upper (Santonian) Cretaceous section of marine and nonmarine strata as much as 700 m thick which represent the upper part of a regressive cycle followed by two transgressive-regressive deposition cycles. The lower 55 m of the Cretaceous section are the same tripartite Dakota Group units recognized in Guadalupe and San Miguel counties: basal Mesa Rica Sandstone (late Albian), medial Pajarito formation (late Albian) and upper Romeroville sandstone (earliest Cenomanian). The Mesa Rica and Pajarito represent a regression and are overlain disconformably by the transgressive Romeroville sandstone. Overlying transgressive marine clastics and minor carbonates of the Mancos Shale are as much as 73 m thick and include the early Turonian Greenhorn Limestone. The overlying Tres Hermanos formation (up to 91 m thick) consists of the (ascending order) Atarque sandstone and the Carthage and Fite Ranch sandstone members. These strata represent a mid-Turonian regression in response to regional tectonism (Atarque and Carthage), followed by a transgression (Fite Ranch sandstone) that ended in the deposition of the D-Cross Tongue of the Mancos Shale and Fort Hays Member of the Niobrara Formation during the late Turonian. The subsequent regression began with the Coniacian Gallup Sandstone (55 m) followed by coal-bearing Crevasse Canyon Formation (up to 244 m thick). The Coniacian-Santonian Crevasse Canyon Formation, the youngest Cretaceous unit in the basin, is disconformably overlain by middle Eocene conglomerates and red-bed siliciclastics of the Cub Mountain formation. Dakota Group age determinations in the Sierra Blanca basin are those of well-dated sections to the north, but ammonites and inoceramid bivalves from the Sierra Blanca basin provide precise age control for Cenomanian-Santonian marine and marginal marine strata and palynology and megafossil plants for nonmarine strata.

  15. Matrix deformation in a basement-involved fold-and-thrust-belt: A case study in the central Andes, Malargüe (Argentina)

    NASA Astrophysics Data System (ADS)

    Branellec, M.; Callot, J.-P.; Aubourg, C.; Nivière, B.; Ringenbach, J.-C.


    An analysis of the anisotropy of magnetic susceptibility (AMS) is used to investigate the matrix strain record of weakly deformed clastic rocks, including sandstones and shales, along a cross-section of the Malargüe fold-and-thrust belt (MFTB, Argentina). We collected 339 oriented cores from the Tres Esquinas Sandstones, the red beds of the Tordillo and Neuquén formations, as well as from Shales/Silts of the Mendoza Group. Overall, ~ 90% of the magnetic fabrics are well defined and are related to the strain imprint of the layer parallel shortening. Among the tectonic-related fabrics, 40% show the development of a magnetic lineation at right angle of the shortening (type II), 38% display an apparent loss of magnetic foliation (type III) and 21% develops a magnetic foliation at right angle of the shortening (type IV). There is no lithological control on magnetic fabric typology despite contrasting ferromagnetic mineralogy between the red sandstones and dark shales. Thin-section observations highlight the good match between the orientation of both the susceptibility ellipsoid and microstructure orientation, which enables us to infer the preferred orientations of the petrofabric (i.e. finite strain directions). In this way, two trends can be recognized in the study area: shortening directions trending N110 in the north and trending N80 in the south. In addition, the spatial distribution of magnetic fabric typology and burial data suggests an atypical pattern of deformation from the foreland to hinterland. Such a pattern contrasts with previous studies in fold thrust belt settings, suggesting that, at the matrix-scale, the deformation (even in a pre-folding setting) is compartmentalized and controlled by the occurrence of deep-seated thrusts localized along inherited structures. From the analysis of cross-sections, we can distinguish several domains, each of them reflecting distinct states of matrix deformation.

  16. Population-based prediction of subject-specific prostate deformation for MR-to-ultrasound image registration

    PubMed Central

    Hu, Yipeng; Gibson, Eli; Ahmed, Hashim Uddin; Moore, Caroline M.; Emberton, Mark; Barratt, Dean C.


    Statistical shape models of soft-tissue organ motion provide a useful means of imposing physical constraints on the displacements allowed during non-rigid image registration, and can be especially useful when registering sparse and/or noisy image data. In this paper, we describe a method for generating a subject-specific statistical shape model that captures prostate deformation for a new subject given independent population data on organ shape and deformation obtained from magnetic resonance (MR) images and biomechanical modelling of tissue deformation due to transrectal ultrasound (TRUS) probe pressure. The characteristics of the models generated using this method are compared with corresponding models based on training data generated directly from subject-specific biomechanical simulations using a leave-one-out cross validation. The accuracy of registering MR and TRUS images of the prostate using the new prostate models was then estimated and compared with published results obtained in our earlier research. No statistically significant difference was found between the specificity and generalisation ability of prostate shape models generated using the two approaches. Furthermore, no statistically significant difference was found between the landmark-based target registration errors (TREs) following registration using different models, with a median (95th percentile) TRE of 2.40 (6.19) mm versus 2.42 (7.15) mm using models generated with the new method versus a model built directly from patient-specific biomechanical simulation data, respectively (N = 800; 8 patient datasets; 100 registrations per patient). We conclude that the proposed method provides a computationally efficient and clinically practical alternative to existing complex methods for modelling and predicting subject-specific prostate deformation, such as biomechanical simulations, for new subjects. The method may also prove useful for generating shape models for other organs, for example, where

  17. Validation of the use of photogrammetry to register pre-procedure MR images to intra-procedure patient position for image-guided cardiac catheterization procedures

    NASA Astrophysics Data System (ADS)

    Gao, Gang; Tarte, Segolene; King, Andy; Ma, Yingliang; Chinchapatnam, Phani; Schaeffter, Tobias; Razavi, Reza; Hawkes, Dave; Hill, Derek; Rhode, Kawal


    A hybrid X-ray and magnetic resonance imaging system (XMR) has been proposed as an interventional guidance for cardiovascular catheterisation procedure. However, very few hospitals can benefit from the XMR system because of its limited availability. In this paper we describe a new guidance strategy for cardiovascular catheterisation procedure. In our technique, intra-operative patient position is estimated by using a chest surface reconstructed from a photogrammetry system. The chest surface is then registered with the same surface derived from pre-procedure magnetic resonance (MR) images. The catheterisation procedure can therefore be guided by a roadmap derived from the MR images. Patients were required to hold the breath at end expiration during MRI acquisition. The surface matching accuracy is improved by using a robust trimmed iterative closest point (ICP) matching algorithm, which is especially designed for incomplete surface matching. Compared to the XMR system, the proposed guidance strategy is low cost and easy to set up. Experimental data were acquired from 6 volunteers and 1 patient. The patient data were collected during an electrophysiology procedure. In 6 out of 7 subjects, the experimental results show our method is accurate in term of reciprocal residual error (range from 1.66m to 3.75mm) and constant (closed-loop TREs range from 1.49mm to 3.55mm). For one subject, trimmed ICP failed to find the optimal transform matrix (residual = 4.89, TRE = 9.32) due to the poor quality of the photogrammetry-reconstructed surface. More studies are being carried on in clinical trials.

  18. Origin of sulfide and phosphate deposits in Upper Proterozoic carbonate strata, Irece basin, Bahia, Brazil

    SciTech Connect

    Kyle, J.R. ); Misi, A. )


    Carbonate strata of the Una Group represent late Proterozoic platform sedimentation in the Irece basin of north-central Brazil. Stratabound sulfide- and phosphate-rich units occur within a 50-m thick tidal flat sequence of dolomitic limestone and cherty dolomite. Three types of primary phosphate concentrations are present: columnar stromatolitic, laminar stromatolitic, and intraclastic. Resedimented phosphate clasts and phosphatic units interbedded with non phosphatic dolomites suggest early diagenetic replacement of algal carbonate units. Local stratabound Zn-Pb-Ag sulfide concentrations at the Tres Irmas prospect occur within silty dolomite with shallow water sedimentary structures and local disturbed laminae, synsedimentary faults, and breccias. Sulfide minerals include pyrite, sphalerite, galena, marcasite, jordanite, tetrahedrite, and covellite. Pyrite crystal aggregates commonly show bladed forms. Nodular aggregates of length-slow quartz are locally associated with sulfides. Sulfur isotope analyses indicate relatively uniform heavy {delta}{sup 34}S values. Barite shows a {delta}{sup 34}S range from +25.2 to +29.6{per thousand}, CDT. Pyrite and sphalerite representative of a variety of textural types have a {delta}{sup 34}S range of +20.2 to +22.6{per thousand}. Late Proterozoic evaporite sulfates show a wide range of {delta}{sup 34} S values from about +10 to +28{per thousand}. Thus, the {delta}{sup 34}S values for Irece barite could reflect original seawater sulfate values. However, the relatively heavy {delta}{sup 34}S values of the associated sulfides suggests that the original seawater sulfate was modified by bacterial sulfate reduction processes in shallow sea floor sediments. Textural and {delta}{sup 34}S evidence suggests that a later stage of metallic mineralization scavenged sulfur from preexisting sulfides or from direct reduction of evaporitic sulfate minerals.

  19. Identification of a Putative Mexican Strain of Serratia entomophila Pathogenic against Root-Damaging Larvae of Scarabaeidae (Coleoptera)▿ †

    PubMed Central

    Nuñez-Valdez, M. Eugenia; Calderón, Marco A.; Aranda, Eduardo; Hernández, Luciano; Ramírez-Gama, Rosa M.; Lina, Laura; Rodríguez-Segura, Zitlhally; Gutiérrez, María del C.; Villalobos, Francisco J.


    The larvae of scarab beetles, known as “white grubs” and belonging to the genera Phyllophaga and Anomala (Coleoptera: Scarabaeidae), are regarded as soil-dwelling pests in Mexico. During a survey conducted to find pathogenic bacteria with the potential to control scarab larvae, a native Serratia sp. (strain Mor4.1) was isolated from a dead third-instar Phyllophaga blanchardi larva collected from a cornfield in Tres Marías, Morelos, Mexico. Oral bioassays using healthy P. blanchardi larvae fed with the Mor4.1 isolate showed that this strain was able to cause an antifeeding effect and a significant loss of weight. Mortality was observed for P. blanchardi, P. trichodes, and P. obsoleta in a multidose experiment. The Mor4.1 isolate also caused 100% mortality 24 h after intracoelomic inoculation of the larvae of P. blanchardi, P. ravida, Anomala donovani and the lepidopteran insect Manduca sexta. Oral and injection bioassays were performed with concentrated culture broths of the Mor4.1 isolate to search for disease symptoms and mortality caused by extracellular proteins. The results have shown that Mor4.1 broths produce significant antifeeding effects and mortality. Mor4.1 broths treated with proteinase K lost the ability to cause disease symptoms and mortality, in both the oral and the injection bioassays, suggesting the involvement of toxic proteins in the disease. The Mor4.1 isolate was identified as a putative Serratia entomophila Mor4.1 strain based on numerical taxonomy and phylogenetic analyses done with the 16S rRNA gene sequence. The potential of S. entomophila Mor4.1 and its toxins to be used in an integrated pest management program is discussed. PMID:18083879

  20. Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice.


    Dong, Hongyan; Yauk, Carole L; Wade, Michael G


    Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined with chromatin immunoprecipitation (ChIP-chip), we identified a TRβ binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TRβ revealed that one of these fragments bound TRβ. This complex was shifted with the addition of anti-TRβ antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1 compared to control animals. Similarly, the expression of Barhl1 in cultured GH3 decreased with the addition of T3. Given the important role of Barhl1 in brain development, we propose that perturbations of TH-mediated transcriptional control of Barhl1 may play a role in the impaired neurodevelopment induced by hypothyroidism. PMID:22027146

  1. Characteristics of a thyroid hormone responsive reporter gene transduced into a Xenopus laevis cell line using lentivirus vector.


    Sugiyama, Shin-Ichiro; Miyoshi, Hiroyuki; Yamauchi, Kiyoshi


    We introduced a self-inactivation (SIN) lentivirus vector (LV) into Xenopus laevis cell lines and established a permanent cell line expressing a reporter gene in a 3,5,3'-l-triiodothyronine (T(3)) dependent manner. The SIN LV contained the luciferase gene downstream from the X. laevis T(3)-response elements (TREs) and the SV40 promoter, and the enhanced green fluorescent protein (EGFP) gene downstream from the cytomegalovirus (CMV) promoter. It was integrated into the genome of X. laevis XL58, XTC2, and KR cells. The SIN LV transduced the X. laevis cells as efficiently as mammalian cells; however, the expression of EGFP in the transgene decreased with increasing culture time. A cell clone exhibiting the highest TH-dependent luciferase gene expression (XL58-TRE-Luc clone) was isolated from the EGFP-positive XL58 cell pool and characterized. The minimum effective concentration of T(3) that significantly induced the luciferase gene expression was 10(-11)M in the XL58-TRE-Luc clone. The application of the luciferase gene assay using the permanent XL58-TRE-Luc clone for the screening of thyroid-disrupting chemicals revealed that tetrachlorobisphenol A, at 10(-6)M, had a weak T(3)-agonist activity, whereas trichlorobisphenol A, at 10(-8) - 10(-6)M had a weak T(3)-antagonist activity. Our results indicated that the permanent X. laevis cell line containing a T(3)-response transgene could be used as a bioassay, with small intra-assay variation, for the rapid screening, identification, and characterization of the thyroid-disrupting chemicals. PMID:16102758

  2. Imaging the Seismic Crustal Structure of the Western Mexican Margin between 19°N and 21°N

    NASA Astrophysics Data System (ADS)

    Bartolomé, Rafael; Dañobeitia, Juanjo; Michaud, François; Córdoba, Diego; Delgado-Argote, Luis A.


    Three thousand kilometres of multichannel (MCS) and wide-angle seismic profiles, gravity and magnetic, multibeam bathymetry and backscatter data were recorded in the offshore area of the west coast of Mexico and the Gulf of California during the spring 1996 (CORTES survey). The seismic images obtained off Puerto Vallarta, Mexico, in the Jalisco subduction zone extend from the oceanic domain up to the continental shelf, and significantly improve the knowledge of the internal crustal structure of the subduction zone between the Rivera and North American (NA) Plates. Analyzing the crustal images, we differentiate: (1) An oceanic domain with an important variation in sediment thickness ranging from 2.5 to 1 km southwards; (2) an accretionary prism comprised of highly deformed sediments, extending for a maximum width of 15 km; (3) a deformed forearc basin domain which is 25 km wide in the northern section, and is not seen towards the south where the continental slope connects directly with the accretionary prism and trench, thus suggesting a different deformational process; and (4) a continental domain consisting of a continental slope and a mid slope terrace, with a bottom simulating reflector (BSR) identified in the first second of the MCS profiles. The existence of a developed accretionary prism suggests a subduction-accretion type tectonic regime. Detailed analysis of the seismic reflection data in the oceanic domain reveals high amplitude reflections at around 6 s [two way travel time (twtt)] that clearly define the subduction plane. At 2 s (twtt) depth we identify a strong reflection which we interpret as the Moho discontinuity. We have measured a mean dip angle of 7° ± 1° at the subduction zone where the Rivera Plate begins to subduct, with the dip angle gently increasing towards the south. The oceanic crust has a mean crustal thickness of 6.0-6.5 km. We also find evidence indicating that the Rivera Plate possibly subducts at very low angles beneath the Tres

  3. Effects of redecoration of a hospital isolation room with natural materials on stress levels of denizens in cold season

    NASA Astrophysics Data System (ADS)

    Ohta, Hiromi; Maruyama, Megumi; Tanabe, Yoko; Hara, Toshiko; Nishino, Yoshihiko; Tsujino, Yoshio; Morita, Eishin; Kobayashi, Shotai; Shido, Osamu


    We investigated the effects of redecoration of a hospital isolation room with natural materials on thermoregulatory, cardiovascular and hormonal parameters of healthy subjects staying in the room. Two isolation rooms with almost bilaterally-symmetrical arrangements were used. One room (RD) was redecorated with wood paneling and Japanese paper, while the other (CN) was unchanged (with concrete walls). Seven healthy male subjects stayed in each room for over 24 h in the cold season. Their rectal temperature (Tre) and heart rate, and the room temperature (Ta) and relative humidity were continuously measured. Arterial blood pressures, arterial vascular compliance, thermal sensation and thermal comfort were measured every 4 h except during sleeping. Blood was sampled after the stay in the rooms. In RD, Ta was significantly higher by about 0.4°C and relative humidity was lower by about 5% than in CN. Diurnal Tre levels of subjects in RD significantly differed from those in CN, i.e., Tres were significantly higher in RD than in CN especially in the evening. In RD, the subjects felt more thermally-comfortable than in CN. Redecoration had minimal effects on cardiovascular parameters. Plasma levels of catecholamines and antidiuretic hormone did not differ, while plasma cortisol level was significantly lower after staying in RD than in CN by nearly 20%. The results indicate that, in the cold season, redecoration with natural materials improves the thermal environment of the room and contributes to maintaining core temperature of denizens at preferable levels. It also seems that redecoration of room could attenuate stress levels of isolated subjects.

  4. Pulsation, Mass Loss and the Upper Mass Limit

    NASA Astrophysics Data System (ADS)

    Klapp, J.; Corona-Galindo, M. G.


    RESUMEN. La existencia de estrellas con masas en exceso de 100 M0 ha sido cuestionada por mucho tiempo. Lfmites superiores para la masa de 100 M0 han sido obtenidos de teorfas de pulsaci6n y formaci6n estelar. En este trabajo nosotros primero investigamos la estabilidad radial de estrellas masivas utilizando la aproximaci6n clasica cuasiadiabatica de Ledoux, la aproximaci6n cuasiadiabatica de Castor y un calculo completamente no-adiabatico. Hemos encontrado que los tres metodos de calculo dan resultados similares siempre y cuando una pequefia regi6n de las capas externas de la estrella sea despreciada para la aproximaci6n clasica. La masa crftica para estabilidad de estrellas masivas ha sido encontrada en acuerdo a trabajos anteriores. Explicamos Ia discrepancia entre este y trabajos anteriores por uno de los autores. Discunmos calculos no-lineales y perdida de masa con respecto a) lfmite superior de masa. The existence of stars with masses in excess of 100 M0 has been questioned for a very long time. Upper mass limits of 100 Me have been obtained from pulsation and star formation theories. In this work we first investigate the radial stability of massive stars using the classical Ledoux's quasiadiabatic approximation. the Castor quasiadiabatic approximation and a fully nonadiabatic calculation. We have found that the three methods of calculation give similar results provided that a small region in outer layers of the star be neglected for the classical approximation. The critical mass for stability of massive stars is found to be in agreement with previous work. We explain the reason for the discrepancy between this and previous work by one of the authors. We discuss non-linear calculations and mass loss with regard to the upper mass limit. Key words: STARS-MASS FUNCTION - STARS-MASS LOSS - STARS-PULSATION

  5. Structure of covalently bonded materials: From the Peierls distortion to Phase-Change Materials

    NASA Astrophysics Data System (ADS)

    Gaspard, Jean-Pierre


    The relation between electronic structure and cohesion of materials has been a permanent quest of Jacques Friedel and his school. He developed simple models that are of great value as guidelines in conjunction with ab initio calculations. His local approach of bonding has both the advantages of a large field of applications including non-crystalline materials and a common language with chemists. Along this line, we review some fascinating behaviors of covalent materials, most of them showing a Peierls (symmetry breaking) instability mechanism, even in liquid and amorphous materials. We analyze the effect of external parameters such as pressure and temperature. In some temperature ranges, the Peierls distortion disappears and a negative thermal expansion is observed. In addition, the Peierls distortion plays a central role in Phase-Change Materials, which are very promising non-volatile memories. xml:lang="fr" Son approche locale de la liaison chimique s'applique à un vaste champ de systèmes, incluant les matériaux non cristallins et permis un langage commun avec les chimistes. Dans cet axe nous passons en revue quelques comportements fascinants des matériaux covalents, la plupart d'entre eux présentant un mécanisme d'instabilité de Peierls (brisure de symétrie), même les liquides et les amorphes, étonnamment. Nous analysons aussi l'effet de parame'tres externes tels que la pression et la température. Dans un certain domaine de température, la distorsion de Peierls disparaît et une dilatation thermique négative est observée. Enfin, la distorsion de Peierls joue un rôle central dans les matériaux à changement de phase (PC materials), qui sont très prometteurs pour la réalisation de mémoires non volatiles.

  6. Adipose tissues and thyroid hormones

    PubMed Central

    Obregon, Maria-Jesus


    The maintenance of energy balance is regulated by complex homeostatic mechanisms, including those emanating from adipose tissue. The main function of the adipose tissue is to store the excess of metabolic energy in the form of fat. The energy stored as fat can be mobilized during periods of energy deprivation (hunger, fasting, diseases). The adipose tissue has also a homeostatic role regulating energy balance and functioning as endocrine organ that secretes substances that control body homeostasis. Two adipose tissues have been identified: white and brown adipose tissues (WAT and BAT) with different phenotype, function and regulation. WAT stores energy, while BAT dissipates energy as heat. Brown and white adipocytes have different ontogenetic origin and lineage and specific markers of WAT and BAT have been identified. “Brite” or beige adipose tissue has been identified in WAT with some properties of BAT. Thyroid hormones exert pleiotropic actions, regulating the differentiation process in many tissues including the adipose tissue. Adipogenesis gives raise to mature adipocytes and is regulated by several transcription factors (c/EBPs, PPARs) that coordinately activate specific genes, resulting in the adipocyte phenotype. T3 regulates several genes involved in lipid mobilization and storage and in thermogenesis. Both WAT and BAT are targets of thyroid hormones, which regulate genes crucial for their proper function: lipogenesis, lipolysis, thermogenesis, mitochondrial function, transcription factors, the availability of nutrients. T3 acts directly through specific TREs in the gene promoters, regulating transcription factors. The deiodinases D3, D2, and D1 regulate the availability of T3. D3 is activated during proliferation, while D2 is linked to the adipocyte differentiation program, providing T3 needed for lipogenesis and thermogenesis. We examine the differences between BAT, WAT and brite/beige adipocytes and the process that lead to activation of UCP1 in WAT

  7. Metal to Insulator Quantum-Phase Transition in Few-Layered ReS₂.


    Pradhan, Nihar R; McCreary, Amber; Rhodes, Daniel; Lu, Zhengguang; Feng, Simin; Manousakis, Efstratios; Smirnov, Dmitry; Namburu, Raju; Dubey, Madan; Walker, Angela R Hight; Terrones, Humberto; Terrones, Mauricio; Dobrosavljevic, Vladimir; Balicas, Luis


    In ReS2, a layer-independent direct band gap of 1.5 eV implies a potential for its use in optoelectronic applications. ReS2 crystallizes in the 1T'-structure, which leads to anisotropic physical properties and whose concomitant electronic structure might host a nontrivial topology. Here, we report an overall evaluation of the anisotropic Raman response and the transport properties of few-layered ReS2 field-effect transistors. We find that ReS2 exfoliated on SiO2 behaves as an n-type semiconductor with an intrinsic carrier mobility surpassing μ(i) ∼ 30 cm(2)/(V s) at T = 300 K, which increases up to ∼350 cm(2)/(V s) at 2 K. Semiconducting behavior is observed at low electron densities n, but at high values of n the resistivity decreases by a factor of >7 upon cooling to 2 K and displays a metallic T(2)-dependence. This suggests that the band structure of 1T'-ReS2 is quite susceptible to an electric field applied perpendicularly to the layers. The electric-field induced metallic state observed in transition metal dichalcogenides was recently claimed to result from a percolation type of transition. Instead, through a scaling analysis of the conductivity as a function of T and n, we find that the metallic state of ReS2 results from a second-order metal-to-insulator transition driven by electronic correlations. This gate-induced metallic state offers an alternative to phase engineering for producing ohmic contacts and metallic interconnects in devices based on transition metal dichalcogenides. PMID:26599563

  8. Methodes non perturbatives en mecanique quantique et en theorie des champs quantiques

    NASA Astrophysics Data System (ADS)

    Jirari, Hamza


    Nous construisons un hamiltonien effectif à partir de l'intégrale de chemin via la méthode Monte-Carlo. Cet hamiltonien décrit les phénomènes physiques dans le domaine de basse énergie. Nous déterminons le spectre d'énergie et les fonctions d'ondes de plusieurs systèmes quantiques. Les résultats obtenus montrent que cette nouvelle approche Monte-Carlo hamiltonienne fonctionne. En mécanique quantique, nous suggérons une expression analytique de l'intégrale de chemin en introduisant une action quantique avec des paramètres renormalisés. Nous présentons des résultats numériques pour quelques potentiels locaux. Cette action quantique offre la possibilité de comparer l'évolution classique et quantique et permet de quantifier les instantons classiques et éventuellement le chaos classique. Nous investiguons la QCD sur un réseau bidimensionnel en utilisant une version améliorée des fermions de Wilson. Nous montrons que la théorie améliorée conduit à une réduction significative des erreurs dues à la valeur finie du pas du réseau. Nous calculons le condensat chiral et la masse de l'état lié quark-antiquark. Nous aboutissons à une bonne concordance entre nos résultats numériques et les résultats analytiques du modèle dans le continu.

  9. Imaging-Based High-Throughput Screening Assay To Identify New Molecules with Transmission-Blocking Potential against Plasmodium falciparum Female Gamete Formation

    PubMed Central

    Miguel-Blanco, Celia; Lelièvre, Joël; Delves, Michael J.; Bardera, Ana I.; Presa, Jesús L.; López-Barragán, María José; Ruecker, Andrea; Marques, Sara; Sinden, Robert E.


    In response to a call for the global eradication of malaria, drug discovery has recently been extended to identify compounds that prevent the onward transmission of the parasite, which is mediated by Plasmodium falciparum stage V gametocytes. Lately, metabolic activity has been used in vitro as a surrogate for gametocyte viability; however, as gametocytes remain relatively quiescent at this stage, their ability to undergo onward development (gamete formation) may be a better measure of their functional viability. During gamete formation, female gametocytes undergo profound morphological changes and express translationally repressed mRNA. By assessing female gamete cell surface expression of one such repressed protein, Pfs25, as the readout for female gametocyte functional viability, we developed an imaging-based high-throughput screening (HTS) assay to identify transmission-blocking compounds. This assay, designated the P. falciparum female gametocyte activation assay (FGAA), was scaled up to a high-throughput format (Z′ factor, 0.7 ± 0.1) and subsequently validated using a selection of 50 known antimalarials from diverse chemical families. Only a few of these agents showed submicromolar 50% inhibitory concentrations in the assay: thiostrepton, methylene blue, and some endoperoxides. To determine the best conditions for HTS, a robustness test was performed with a selection of the GlaxoSmithKline Tres Cantos Antimalarial Set (TCAMS) and the final screening conditions for this library were determined to be a 2 μM concentration and 48 h of incubation with gametocytes. The P. falciparum FGAA has been proven to be a robust HTS assay faithful to Plasmodium transmission-stage cell biology, and it is an innovative useful tool for antimalarial drug discovery which aims to identify new molecules with transmission-blocking potential. PMID:25801574

  10. Mapping Stripe Rust Resistance in a BrundageXCoda Winter Wheat Recombinant Inbred Line Population

    PubMed Central

    Case, Austin J.; Naruoka, Yukiko; Chen, Xianming; Garland-Campbell, Kimberly A.; Zemetra, Robert S.; Carter, Arron H.


    A recombinant inbred line (RIL) mapping population developed from a cross between winter wheat (Triticum aestivum L.) cultivars Coda and Brundage was evaluated for reaction to stripe rust (caused by Puccinia striiformis f. sp. tritici). Two hundred and sixty eight RIL from the population were evaluated in replicated field trials in a total of nine site-year locations in the U.S. Pacific Northwest. Seedling reaction to stripe rust races PST-100, PST-114 and PST-127 was also examined. A linkage map consisting of 2,391 polymorphic DNA markers was developed covering all chromosomes of wheat with the exception of 1D. Two QTL on chromosome 1B were associated with adult plant and seedling reaction and were the most significant QTL detected. Together these QTL reduced adult plant infection type from a score of seven to a score of two reduced disease severity by an average of 25% and provided protection against race PST-100, PST-114 and PST-127 in the seedling stage. The location of these QTL and the race specificity provided by them suggest that observed effects at this locus are due to a complementation of the previously known but defeated resistances of the cultivar Tres combining with that of Madsen (the two parent cultivars of Coda). Two additional QTL on chromosome 3B and one on 5B were associated with adult plant reaction only, and a single QTL on chromosome 5D was associated with seedling reaction to PST-114. Coda has been resistant to stripe rust since its release in 2000, indicating that combining multiple resistance genes for stripe rust provides durable resistance, especially when all-stage resistance genes are combined in a fashion to maximize the number of races they protect against. Identified molecular markers will allow for an efficient transfer of these genes into other cultivars, thereby continuing to provide excellent resistance to stripe rust. PMID:24642574

  11. Identification d'une loi thermo-élasto-viscoplastique en vue de la modélisation du laminage à chaud du cuivre

    NASA Astrophysics Data System (ADS)

    Moureaux, P.; Moto Mpong, S.; Remy, M.; Bouffioux, C.; Lecomte-Beckers, J.; Habraken, A. M.


    la mise au point d'un modèle de simulation de la dernière passe du laminage à chaud du cuivre ne présente à priori pas de problème du point de vue numérique pour un code d'éléments finis non linéaire. La collecte d'informations précises tant sur le procédé industriel que sur le comportement du matériau est par contre une opération non triviale. Cet article présente les diverses méthodes expérimentales mises en œuvre pour caractériser le matériau : essais de compression à chaud, mesures d'analyse thermique différentielle, essais de dilatométrie et de diffusivité. Les méthodes permettant d'identifier les paramètres de la loi élasto-visco-plastique de type Norton-Hoff à partir des essais sont présentées et une analyse bibliographique investigue le problème de la détermination du module de Young à haute température. Tant les hypothèses supplémentaires relatives au procédé et nécessaires au modèle que les résultats finaux sont résumés.

  12. Auditory dominance in motor-sensory temporal recalibration.


    Sugano, Yoshimori; Keetels, Mirjam; Vroomen, Jean


    Perception of synchrony between one's own action (e.g. a finger tap) and the sensory feedback thereof (e.g. a flash or click) can be shifted after exposure to an induced delay (temporal recalibration effect, TRE). It remains elusive, however, whether the same mechanism underlies motor-visual (MV) and motor-auditory (MA) TRE. We examined this by measuring crosstalk between MV- and MA-delayed feedbacks. During an exposure phase, participants pressed a mouse at a constant pace while receiving visual or auditory feedback that was either delayed (+150 ms) or subjectively synchronous (+50 ms). During a post-test, participants then tried to tap in sync with visual or auditory pacers. TRE manifested itself as a compensatory shift in the tap-pacer asynchrony (a larger anticipation error after exposure to delayed feedback). In experiment 1, MA and MV feedback were either both synchronous (MV-sync and MA-sync) or both delayed (MV-delay and MA-delay), whereas in experiment 2, different delays were mixed across alternating trials (MV-sync and MA-delay or MV-delay and MA-sync). Exposure to consistent delays induced equally large TREs for auditory and visual pacers with similar build-up courses. However, with mixed delays, we found that synchronized sounds erased MV-TRE, but synchronized flashes did not erase MA-TRE. These results suggest that similar mechanisms underlie MA- and MV-TRE, but that auditory feedback is more potent than visual feedback to induce a rearrangement of motor-sensory timing. PMID:26610349

  13. The evolving male: spinner dolphin (Stenella longirostris) ecotypes are divergent at Y chromosome but not mtDNA or autosomal markers.


    Andrews, Kimberly R; Perrin, William F; Oremus, Marc; Karczmarski, Leszek; Bowen, Brian W; Puritz, Jonathan B; Toonen, Robert J


    The susceptibility of the Y chromosome to sexual selection may make this chromosome an important player in the formation of reproductive isolating barriers, and ultimately speciation. Here, we investigate the role of the Y chromosome in phenotypic divergence and reproductive isolation of spinner dolphin (Stenella longirostris) ecotypes. This species contains six known ecotypes (grouped into four subspecies) that exhibit striking differences in morphology, habitat and mating system, despite having adjacent or overlapping ranges and little genetic divergence at previously studied mtDNA and autosomal markers. We examined the phylogeographic structure for all six ecotypes across the species range (n = 261, 17 geographic locations) using DNA sequences from three Y chromosome markers, two maternally inherited mitochondrial (mtDNA) markers, and a biparentally inherited autosomal intron. mtDNA and autosomal analyses revealed low divergence (most Φ(ST) values <0.1) between ecotypes and geographic regions, concordant with previous studies. In contrast, Y intron analyses revealed fixed differences amongst the three most phenotypically divergent groups: S. l. longirostris vs. S. l. roseiventris vs. combined S. l. orientalis/S. l. centroamericana/Tres Marias ecotypes). Another ecotype (whitebelly), previously postulated to be a hybrid between the two phenotypically most divergent ecotypes, had Y haplotypes from both putative parent ecotypes, supporting a hybrid designation. Reduced introgression of the Y chromosome has previously been observed in other organisms ranging from insects to terrestrial mammals, and here we demonstrate this phenomenon in a marine mammal with high dispersal capabilities. These results indicate that reduced introgression of the Y chromosome occurs in a wide taxonomic range of organisms and support the growing body of evidence that rapid evolution of the Y chromosome is important in evolutionary diversification. PMID:23551274

  14. Unique effects of aerosol OT lamellar structures on the dynamics of guest molecules.


    De, Dipanwita; Datta, Anindya


    The behavior of lamellar structures of Aerosol OT (AOT) as hosts, vis-à-vis the flexible normal micelles and rigid nanochannels of Nafion membranes, has been investigated with two different fluorophores, [2,2'-bipyridyl]-3,3'-diol (BP(OH)2) and coumarin 102 (C102). Surprisingly, for BP(OH)2, a rise time is observed at intermediate emission wavelengths and not in the red edge of the fluorescence spectrum. A shoulder at 525 nm is observed in time resolved emission spectra (TRES) at initial times of BP(OH)2 in AOT lamellar structures. This feature is the signature of the monoketo (MK) tautomer, observed for the first time in a microheterogeneous medium. Also, the usually ultrafast single proton transfer in BP(OH)2 is retarded to an considerable extent in lamellar structures. The potential of this medium in promoting unusual intermediates is thus highlighted. This property may be ascribed to the rigidity of lamellar structures, compared to hosts such as regular micelles. However, studies using another fluorophore, coumarin 102 (C102), brings out the fact that these structures are significantly different from the rigid host, Nafion, as well. The absence of excited state proton transfer (ESPT) in this molecule in AOT lamellar structures indicates that it is not protonated, unlike in Nafion. Thus, the interfacial pH of lamellar structures is found to be significantly greater than that of Nafion nanochannels. From the time dependent Stokes shift (TDSS) of the emission spectra of C102, the relaxation time (0.85 ns) of interfacial water in lamellar structures is found to be an order of magnitude faster than that observed in Nafion nanochannels, in which H3O(+) ions have been substituted by different cations. Hence, this study demonstrates that AOT lamellar structures are rather unique hosts and that they behave very differently from conventional rigid and flexible hosts such as normal micelles and Nafion, respectively. PMID:23713719

  15. How amateur observations can be used in the exoplanetary science?

    NASA Astrophysics Data System (ADS)

    Baluev, Roman V.; Nikolaevich Sokov, Eugene; Shaidulin, Vakhit Sh; Sokova, Iraida A.; Jones, Hugh R. A.; Anglada-Escudé, Guillem; Tuomi, Mikko; Benni, Paul; Colazo, Carlos A.; Schneiter, Matias E.; Villarreal D'Angelo, Carolina S.; Burdanov, Artem Yu.; Fernández-Lajús, Eduardo; Bastürk, Özgür; Hentunen, Veli-Pekka; Shadick, Stan


    We perform an analysis of ~80000 photometric measurements for the following 10 stars hosting transiting planets: WASP-2, -4, -5, -52, Kelt-1, CoRoT-2, XO-2, TrES-1, HD 189733, GJ 436. Our analysis includes mainly transit lightcurves from the Exoplanet Transit Database, public photometry from the literature, and some proprietary photometry privately supplied by other authors. Half of these lightcurves were obtained by amateurs. From this photometry we derive 306 transit timing measurements, as well as improved planetary transit parameters. For 5 of these 10 stars we also use radial velocity measurements obtained from the spectra stored in the HARPS, HARPS-N, and SOPHIE archives using the HARPS-TERRA pipeline.Our analysis of these TTV and RV data did not reveal significant hints of additional orbiting bodies in almost all of the cases. In the WASP-4 case, we found hints of marginally significant TTV signals having amplitude 10-20 sec, although their parameters are model-dependent and uncertain, while radial velocities did not reveal statistically significant Doppler signals.This work was supported by the Russian Foundation for Basic Research (project No. 14-02-92615 KO_a), the UK Royal Society International Exchange grant IE140055, by the President of Russia grant for young scientists (No. MK-733.2014.2), by the programmes of the Presidium of Russian Academy of Sciences P21 and P22, by the Saint Petersburg State University research grant 6.37.341.2015, and by the Russian Ministry of Education and Science (contract No. 01201465056). OB acknowledges the support by the research fund of Ankara University (BAP) through the project 13B4240006.

  16. [Not Available].


    Hernando-Requejo, Virgilio


    La demencia, estrechamente ligada a factores predisponentes ambientales como la dieta, supone un problema de salud pública de magnitud creciente: actualmente más de 35 millones de pacientes con demencia tipo alzhéimer, y se espera que superen los 135 millones en 2050. Si conseguimos retrasar el desarrollo de la demencia 5 años, reduciremos su prevalencia en un 50%. Los pacientes con demencia alteran su dieta y se han reportado déficits, entre otros, de ácido fólico, vitaminas B12, B6, C, E, A, D, K, betacarotenos y omega tres, que deben ser resueltos con una dieta adecuada y, en según qué casos, con aportes extra. Pero para reducir o al menos retrasar la prevalencia debemos preconizar la prevención mediante una dieta adecuada desde el inicio de la vida, idea reforzada por el hecho de que los factores de riesgo cardiovascular se relacionen de forma directa con el desarrollo de demencia. Disponemos de abundante bibliografía que, aunque con límites, nos permite hacer recomendaciones nutricionales para prevenir el deterioro cognitivo. Se han conseguido mejores resultados cuando se han estudiado dietas completas que cuando se han considerado nutrientes específicos. De especial interés es la dieta mediterránea, que garantiza un aporte elevado de vegetales, frutas, frutos secos, legumbres, cereales, pescado y aceite de oliva, y moderado de carne, productos lácteos y alcohol, y en la que nos centraremos en este artículo. PMID:27571865

  17. Étude comparative des techniques d'analyse par fluorescence X à dispersion d'énergie (ED-XRF) et à dispersion de longueur d'onde (WD-XRF), et par spectrométrie d'émission atomique à source plasma couplée par induction (ICP-AES)

    NASA Astrophysics Data System (ADS)

    Rahmani, A.; Benyaïch, F.; Bounakhla, M.; Bilal, E.; Moutte, J.; Gruffat, J. J.; Zahry, F.


    Dans ce travail, nous présentons une étude comparative des techniques d'analyse par fluorescence X à dispersion d'énergie (ED-XRF) et à dispersion de longueur d'onde (WD-XRF), et par spectrométrie d'émission atomique à source plasma couplée par induction (ICP-AES). Les résultats de la calibration des spectromètres à dispersion d'énergie, à excitation par sources radioactives (55Fe, 109Cd et 241Am) et à excitation secondaire (cible secondaire Mo et Cu) du Centre National pour l'Energie, les Sciences et les Techniques Nucléaires (CNESTEN, Rabat, Maroc) sur des échantillons étalons de références de l'Agence International de l'Energie Atomique (AIEA) et du Community Bureau of Référence (BCR) ont été comparés aux résultats d'analyse des mêmes échantillons étalons par la spectrométrie X à dispersion de longueur d'onde (WD-XRF) et par spectrométrie d'émission atomique à source plasma couplé par induction (ICP-AES) au département GENERIC du centre SPIN à l'Ecole des Mines de Saint-Etienne (France). Les trois techniques d'analyse utilisées donnent des résultats comparables pour le dosage des éléments majeurs, alors que pour les traces on note des déviations importantes à cause des effets de matrice qui sont difficiles à corriger dans le cas de la fluorescence X.

  18. Groundwater components in the alluvial aquifer of the alpine Rhone River valley, Bois de Finges area, Wallis Canton, Switzerland

    NASA Astrophysics Data System (ADS)

    Schürch, Marc; Vuataz, François-D.


    Source, type, and quantity of various components of groundwater, as well as their spatial and temporal variations were determined by different hydrochemical methods in the alluvial aquifer of the upper Rhone River valley, Bois de Finges, Wallis Canton, Switzerland. The methods used are hydrochemical modeling, stable-isotope analysis, and chemical analysis of surface water and groundwater. Sampling during high- and low-water periods determined the spatial distribution of the water chemistry, whereas monthly sampling over three years provided a basis for understanding seasonal variability. The physico-chemical parameters of the groundwater have spatial and seasonal variations. The groundwater chemical composition of the Rhone alluvial aquifer indicates a mixing of weakly mineralized Rhone River water and SO4-rich water entering from the south side of the valley. Temporal changes in groundwater chemistry and in groundwater levels reflect the seasonal variations of the different contributors to groundwater recharge. The Rhone River recharges the alluvial aquifer only during the summer high-water period. Résumé. Origine, type et quantité de nombreux composants d'eau de l'aquifère alluvial dans la vallée supérieure du Rhône, Bois de Finges, Valais, Suisse, ainsi que leurs variations spatiales et temporelles ont été déterminés par différentes méthodes hydrochimiques. Les méthodes utilisées sont la modélisation hydrochimique, les isotopes stables, ainsi que l'échantillonnage en période de hautes eaux et de basses eaux pour étudier la distribution spatiale de la composition chimique, alors qu'un échantillonnage mensuel pendant trois ans sert à comprendre les processus de la variabilité saisonnière. Les paramètres physico-chimiques des eaux souterraines montrent des variations spatiales et saisonnières. La composition chimique de l'aquifère alluvial du Rhône indique un mélange entre une eau peu minéralisée venant du Rhône et une eau sulfatée s

  19. Availability of ground water in parts of the Acoma and Laguna Indian Reservations, New Mexico

    USGS Publications Warehouse

    Dinwiddie, George A.; Motts, Ward Sundt


    The need for additional water has increased in recent years on the Acoma and Laguna Indian Reservations in west-central New Mexico because the population and per capita use of water have increased; the tribes also desire water for light industry, for more modern schools, and to increase their irrigation program. Many wells have been drilled in the area, but most have been disappointing because of small yields and poor chemical quality of the water. The topography in the Acoma and Laguna Indian Reservations is controlled primarily by the regional and local dip of alternating beds of sandstone and shale and by the igneous complex of Mount Taylor. The entrenched alluvial valley along the Rio San Jose, which traverses the area, ranges in width from about 0.4 mile to about 2 miles. The climate is characterized by scant rainfall, which occurs mainly in summer, low relative humidity, and large daily fluctuations of temperature. Most of the surface water enters the area through the Rio San Jose. The average annual streamflow past the gaging station Rio San Jose near Grants, N. Mex. is about 4,000 acre-feet. Tributaries to the Rio San Jose within the area probably contribute about 1,000 acre-feet per year. At the present time, most of the surface water is used for irrigation. Ground water is obtained from consolidated sedimentary rocks that range in age from Triassic to Cretaceous, and from unconsolidated alluvium of Quaternary age. The principal aquifers are the Dakota Sandstone, the Tres Hermanos Sandstone Member of the Mancos Shale, and the alluvium. The Dakota Sandstone yields 5 to 50 gpm (gallons per minute) of water to domestic and stock wells. The Tres Hermanos sandstone Member generally yields 5 to 20 gpm of water to domestic and stock wells. Locally, beds of sandstone in the Chinle and Morrison Formations, the Entrada Sandstone, and the Bluff Sandstone also yield small supplies of water to domestic and stock wells. The alluvium yields from 2 gpm to as much as 150

  20. Etudes optiques de nouveaux materiaux laser: Des orthosilicates dopes a l'ytterbium: Le yttrium (lutetium,scandium) pentoxide de silicium

    NASA Astrophysics Data System (ADS)

    Denoyer, Aurelie

    La decouverte et l'elaboration de nouveaux materiaux laser solides suscitent beaucoup d'interet parmi la communaute scientifique. En particulier les lasers dans la gamme de frequence du micron debouchent sur beaucoup d'applications, en telecommunication, en medecine, dans le domaine militaire, pour la, decoupe des metaux (lasers de puissance), en optique non lineaire (doublage de frequence, bistabilite optique). Le plus couramment utilise actuellement est le Nd:YAG dans cette famille de laser, mais des remplacants plus performants sont toujours recherches. Les lasers a base d'Yb3+ possedent beaucoup d'avantages compares aux lasers Nd3+ du fait de leur structure electronique simple et de leur deterioration moins rapide. Parmi les matrices cristallines pouvant accueillir l'ytterbium, les orthosilicates Yb:Y 2SiO5, Yb:Lu2SiO5 et Yb:Sc2SiO 5 se positionnent tres bien, du fait de leur bonne conductivite thermique et du fort eclatement de leur champ cristallin necessaire a l'elaboration de lasers quasi-3 niveaux. De plus l'etude fine et systematique des proprietes microscopiques de nouveaux materiaux s'avere toujours tres interessante du point de vue de la recherche fondamentale, c'est ainsi que de nouveaux modeles sont concus (par exemple pour le champ cristallin) ou que de nouvelles proprietes inhabituelles sont decouvertes, menant a de nouvelles applications. Ainsi d'autres materiaux dopes a l'ytterbium sont connus pour leurs proprietes de couplage electron-phonon, de couplage magnetique, d'emission cooperative ou encore de bistabilite optique, mais ces proprietes n'ont encore jamais ete mises en evidence dans Yb:Y 2SiO5, Yb:Lu2SiO5 et Yb:Sc2SiO 5. Ainsi, cette these a pour but l'etude des proprietes optiques et des interactions microscopiques dans Yb:Y2SiO 5, Yb:Lu2SiO5 et Yb:Sc2SiO5. Nous utilisons principalement les techniques d'absorption IR et de spectroscopie Raman pour determiner les excitations du champ cristallin et les modes de vibration dans le materiau

  1. Determination of aquifer roof extending under the sea from variable-density flow modelling of groundwater response to tidal loading: case study of the Jahe River Basin, Shandong Province, China

    NASA Astrophysics Data System (ADS)

    Cheng, Jianmei; Chen, Chongxi; Ji, Menrui

    The main task of studies on salt-water intrusion into coastal confined aquifers is to predict the position of the fresh- salt-water interface, which can be determined from the length of the aquifer roof extending under the sea. Records of groundwater level affected by tides can be used to infer hydrological conditions and determine hydraulic parameters of an aquifer extending under the sea. In this paper, a three-dimensional, variable-density groundwater flow model has been developed to determine the equivalent roof length of an aquifer extending under the sea from the tidal-effected data of groundwater level in the Jahe River Basin, Shandong Province, China. The seaward boundary is obtained by converging hydraulic head fluctuations observed in drill holes with calculated values, and the aquifer parameters in the extending zone are estimated. The impacts of aquifer roof length and aquifer parameters on the fluctuation of tidal groundwater are studied. It is concluded that the length of the aquifer roof extending under the sea should correspond with certain aquifer parameters in the extrapolation zone. Therefore, the seaward boundary determined from tidal-effect information is the equivalent boundary in hydrodynamic characteristics rather than the true boundary of the confined aquifer Les sujets principaux des études d'instrusion saline dans les aquifères confinés en zone côtière sont la prédiction de la position de l'interface entre l'eau salée et l'eau fraîche, qui peut être déterminée à partir de l'extention du toit de l'aquifère sous la mer. Les enregistrements des niveaux des eaux souterraines influencés par les marées peuvent être utilisés pour préciser les conditions hydrologiques et déterminer les paramètres hydrauliques d'un aquifère possédant une extension sous la mer. Dans cet article, un modèle tridimensionnel comprenant des eaux souterraines de densité variable a été développé pour déterminer la longueur équivalente du toit

  2. Caracterisation pratique des systemes quantiques et memoires quantiques auto-correctrices 2D

    NASA Astrophysics Data System (ADS)

    Landon-Cardinal, Olivier

    Cette these s'attaque a deux problemes majeurs de l'information quantique: - Comment caracteriser efficacement un systeme quantique? - Comment stocker de l'information quantique? Elle se divise done en deux parties distinctes reliees par des elements techniques communs. Chacune est toutefois d'un interet propre et se suffit a elle-meme. Caracterisation pratique des systemes quantiques. Le calcul quantique exige un tres grand controle des systemes quantiques composes de plusieurs particules, par exemple des atomes confines dans un piege electromagnetique ou des electrons dans un dispositif semi-conducteur. Caracteriser un tel systeme quantique consiste a obtenir de l'information sur l'etat grace a des mesures experimentales. Or, chaque mesure sur le systeme quantique le perturbe et doit done etre effectuee apres avoir reprepare le systeme de facon identique. L'information recherchee est ensuite reconstruite numeriquement a partir de l'ensemble des donnees experimentales. Les experiences effectuees jusqu'a present visaient a reconstruire l'etat quantique complet du systeme, en particulier pour demontrer la capacite de preparer des etats intriques, dans lesquels les particules presentent des correlations non-locales. Or, la procedure de tomographie utilisee actuellement n'est envisageable que pour des systemes composes d'un petit nombre de particules. Il est donc urgent de trouver des methodes de caracterisation pour les systemes de grande taille. Dans cette these, nous proposons deux approches theoriques plus ciblees afin de caracteriser un systeme quantique en n'utilisant qu'un effort experimental et numerique raisonnable. - La premiere consiste a estimer la distance entre l'etat realise en laboratoire et l'etat cible que l'experimentateur voulait preparer. Nous presentons un protocole, dit de certification, demandant moins de ressources que la tomographie et tres efficace pour plusieurs classes d'etats importantes pour l'informatique quantique. - La seconde

  3. Constraining performance assessment models with tracer test results: a comparison between two conceptual models

    NASA Astrophysics Data System (ADS)

    McKenna, Sean A.; Selroos, Jan-Olof

    the amount of diffusive capacity that can be accessed along the transport pathway. Contraindre le bilan des performances des modèles avec les résultats de traçages: une comparaison entre deux modèles conceptuels. Des tests de traçage sont mis en oeuvre pour étudier les paramètres de transport de soluté d'une roche sur une longueur de 5 m. Deux différents modèles de transport de soluté dans un milieu à double porosité fournissent des estimation des courbes de restitution. L'une des conceptualisations (unique taux de restitution) emploie un seul coefficient effectif de diffusion dans une matrice possédant une pénétration infinie en profondeur. Par ailleurs, la rétention du traceur entre les différentes lignes d'écoulement peut varier comme le rapport des débits aux surfaces mouillées et comme le rapport de la différence de débits entres les lignes d'écoulement. L'autre conceptualisation (taux multiple) emploie une distribution continue de coefficients de diffusion dans une matrice à capacité variable et finit. L'application de ces deux modèles avec les pa! ramètres estimés grâce aux courbes de restitution produit des résultats de transport qui différent de plusieurs ordres de grandeur dans la magnitude du pic, le temps du pic de concentration, au bilan des performances (PA) et aux échelles de distance (100,000 ans et 1,000 m). Ces différences sont éxaminées par l'intermédiaire des temps limites pour que la capacité diffusive équivaille à un milieu infini. Ces limites sont comparées à travers les modèles conceptuels ainsi que les temps caractéristiques de diffusion à l'échelle du test de traçage et à l'échelle du PA. Par ailleurs, les différences entre les modèles sont éxaminées en réestimant les paramètres pour le modèle à taux multiple à partir des résultats du modèle à double porosité à l'échelle du PA. Les résultats indiquent que pour chaque modèle la valeur de la capacité diffusive dans un milieu

  4. Accuracy of CFC groundwater dating in a crystalline bedrock aquifer: Data from a site in southern Sweden

    NASA Astrophysics Data System (ADS)

    Bockgård, Niclas; Rodhe, Allan; Olsson, K. A.

    The concentrations of chlorofluorocarbons (CFC-11, CFC-12, and CFC-113) and tritium were determined in groundwater in fractured crystalline bedrock at Finnsjön, Sweden. The specific goal was to investigate the accuracy of CFC dating in such an environment, taking potential degradation and mixing of water into consideration. The water was sampled to a depth of 42 m in three boreholes along an 800-m transect, from a recharge area to a local discharge area. The CFC-113 concentration was at the detection limit in most samples. The apparent recharge date obtained from CFC-11 was earlier than from CFC-12 for all samples, with a difference of over 20 years for some samples. The difference was probably caused by degradation of CFC-11. The CFC-12 dating of the samples ranged from before 1945 to 1975, with the exception of a sample from the water table, which had a present-day concentration. Conclusions about flow paths or groundwater velocity could not be drawn from the CFCs. The comparison between CFC-12 and tritium concentrations showed that most samples could be unmixed or mixtures of waters with different ages, and the binary mixtures that matched the measured concentrations were determined. The mixing model approach can be extended with additional tracers. Précision de la datation au CFC dans un aquifère rocheux-fracturé: données d'un site du sud de la Suède. Les concentrations en chlorofluorocarbones (CFC-11, CFC-12, CFC-113) et entritium ont été déterminées dans l'eau souterraine d'un massif fracturé à Finnsjön en Suède. Le but de cette étude est de mieux cerner la précision de la méthode de datation au CFC dans ce type d'environnement hydrogéologique, tout en considérant d'éventuels phénomènes de dégradation et de mélange d'eaux. L'eau a été échantillonnée à une profondeur de 42 mètres dans trois forages alignés sur 800 mètres entre une zone de recharge et une zone de déversement. Les concentrations en CFC-113 sont dans la plupart

  5. Accuracy of CFC groundwater dating in a crystalline bedrock aquifer: Data from a site in southern Sweden

    NASA Astrophysics Data System (ADS)

    Bockgård, Niclas; Rodhe, Allan; Olsson, K. A.

    The concentrations of chlorofluorocarbons (CFC-11, CFC-12, and CFC-113) and tritium were determined in groundwater in fractured crystalline bedrock at Finnsjön, Sweden. The specific goal was to investigate the accuracy of CFC dating in such an environment, taking potential degradation and mixing of water into consideration. The water was sampled to a depth of 42 m in three boreholes along an 800-m transect, from a recharge area to a local discharge area. The CFC-113 concentration was at the detection limit in most samples. The apparent recharge date obtained from CFC-11 was earlier than from CFC-12 for all samples, with a difference of over 20 years for some samples. The difference was probably caused by degradation of CFC-11. The CFC-12 dating of the samples ranged from before 1945 to 1975, with the exception of a sample from the water table, which had a present-day concentration. Conclusions about flow paths or groundwater velocity could not be drawn from the CFCs. The comparison between CFC-12 and tritium concentrations showed that most samples could be unmixed or mixtures of waters with different ages, and the binary mixtures that matched the measured concentrations were determined. The mixing model approach can be extended with additional tracers. Précision de la datation au CFC dans un aquifère rocheux-fracturé: données d'un site du sud de la Suède. Les concentrations en chlorofluorocarbones (CFC-11, CFC-12, CFC-113) et entritium ont été déterminées dans l'eau souterraine d'un massif fracturé à Finnsjön en Suède. Le but de cette étude est de mieux cerner la précision de la méthode de datation au CFC dans ce type d'environnement hydrogéologique, tout en considérant d'éventuels phénomènes de dégradation et de mélange d'eaux. L'eau a été échantillonnée à une profondeur de 42 mètres dans trois forages alignés sur 800 mètres entre une zone de recharge et une zone de déversement. Les concentrations en CFC-113 sont dans la plupart

  6. Formation et Evolution des Quasars et Contraintes cosmologiques

    NASA Astrophysics Data System (ADS)

    Hatziminaoglou, Evanthia


    Cette thèse porte sur l'étude de l'évolution des quasars. Elle en aborde certains aspects théoriques et observationnels, ainsi que la construction des grands échantillons de quasars dans le but à long terme de combiner le tout dans un test cosmologique géométrique pour déterminer les valeurs des paramètres cosmologiques Omega et Lambda. Les paramètres cosmologiques Omegaspan>et Lambdaspan>décrivent la géométrie globale de l'Univers. En faisant des hypothèses raisonnables sur la distribution spatiale et l'évolution des objets astrophysiques (galaxies, amas des galaxies, quasars), on peut déterminer les valeurs de ces paramètres qui sont cohérentes avec ces hypothèses. Les tests cosmologiques traditionnels ont besoin de ''chandelles standards'', objets dont les propriétés intrinsèques sont indépendantes des distances. De tels objets sont probablement fictifs. Néanmoins, certains de ces tests cosmologiques peuvent être adaptés si l'évolution individuelle, ou au moins l'évolution statistique d'une population d'objets est connue. La question de la nature de l'évolution des quasars a très vite été posée et des réponses ''phénoménologiques'' ont d'abord été données. Ces réponses ne faisaient que donner une forme mathématique à l'évolution mais n'expliquaient rien de la physique duphénomène. Les premières tentatives de construction d'un modèle physique, liées au processus d'accrétion sur un trou noir et à la théorie de la formation de l'Univers ont commencé à la fin des années 80. Depuis, des dizaines de modèles tentent d'expliquer les observations, qui sont les résultats de l'étude d'objets de plus en plus nombreux. Au cours de cette thèse, le test V/Vmax a été appliqué sur l'échantillon du Large Bright Quasar Survey en montrant 1) que l'échantillon était biaisé à cause des critères de sélection et 2) que la (simple) loi de Pure Evolution en Luminosité n'était pas une bonne approximation à tout

  7. Etude du mecanisme de predissociation de l'ion moleculaire de protoxyde d'azote par la mesure de l'energie cinetique des fragments de l'oxyde nitrique et de l'oxygene

    NASA Astrophysics Data System (ADS)

    Delisle, Claude

    La reaction N2 + O+ ↔ NO + + N, laquelle joue un role important dans la physique de la haute atmosphere, a ete le sujet de plusieurs etudes. Bien que cette reaction ait ete l'objet d'une quantite importante de travaux, ces derniers ne permettent toutefois pas de comprendre entierement le mecanisme d'un point de vue quantique, particulierement les niveaux d'energie excites des fragments qui permettent cette reaction. Puisque cette reaction n'est pas tres facile a reproduire en laboratoire, nous avons utilise la spectroscopie laser sur faisceaux d'ions rapides afin d'explorer les limites de dissociation de l'ion moleculaire intermediaire de cette reaction, a savoir l'ion N2O+. Le faisceau d'ions N2O+ rapides, apres excitation de l'ion moleculaire vers un niveau predissocie de l'etat A2Sigma+, se dissocie pour produire les fragments ioniques O+ et NO+. Par la mesure de la variation du nombre de fragments ioniques en fonction de l'energie cinetique des ions N2O+, nous avons enregistre les spectres de predissociation de l'ion N2O+. Lorsque c'etait possible, nous avons procede a l'analyse de ces spectres de dissociation afin d'en tirer les constantes moleculaires. Pour certaines des transitions rotationnelles intenses, nous avons mesure l'energie cinetique acquise par les fragments lors de la predissociation de l'ion N 2O+. Afin d'analyser les distributions en energie cinetique, nous avons developpe une simulation de l'experience en considerant, entre autres choses, la position des niveaux de vibration et de rotation des fragments diatomiques de chacune des limites de dissociation de N2O+. Les resultats de l'analyse sont exprimes en termes de population des niveaux de vibration des fragments diatomiques pour une distribution donnee de la population des niveaux de rotation des fragments. Les resultats ainsi obtenus, montrent que les fragments diatomiques sont produits dans des niveaux de vibration fortement excites. De tels niveaux d'excitation ne correspondent pas aux

  8. Analyse des facteurs histo-pronostiques du cancer du rectum non métastatique dans une série ouest Algérienne de 58 cas au CHU-Tlemcen

    PubMed Central

    Mesli, Smain Nabil; Regagba, Derbali; Tidjane, Anisse; Benkalfat, Mokhtar; Abi-Ayad, Chakib


    Introduction L'objectif de notre travail est d'analyser les facteurs histo-pronostiques des cancers du rectum non métastatique opérés au service de chirurgie «A» de Tlemcen à ouest Algérien durant une période de six ans. Méthodes Etude rétrospective de 58 patients qui avait un adénocarcinome rectal. Le critère de jugement était la survie. Les paramètres étudiés, le sexe, l’âge, stade tumoral, et les récidives tumorales. Résultats L’âge moyen était de 58 ans. Avec 52% d'hommes contre 48% femmes avec sex-ratio (1,08). Le siège tumoral était: moyen rectum avec 41,37%, 34,48% au bas rectum et dans 24,13% au haut rectum. La classification TNM avec 17,65% au stade I, 18,61% au stade II, 53, 44% au stade III et 7,84% au stade IV. La survie médiane globale était de 40 mois ±2,937 mois. La survie en fonction du stade tumoral, le stade III et IV avait un faible taux de survie (19%) a 3 ans contre le stade I, II avait un taux de survie de (75%) (P = 0,000) (IC 95%). Les patients avec récidives tumorales avaient un taux de survie faible à 3 ans par rapport à ceux n'ayant pas eu de récidive (30,85% Vs 64,30% P = 0,043). Conclusion Dans cette série, l’étude uni varié des différents facteurs pronostiques conditionnant la survie n'a permis de retenir que trois facteurs influençant la survie, à savoir la taille tumorale, le stade, et les récidives tumorales. En analyse multi variée en utilisant le modèle Cox un seul facteur été retenu la récidive tumorale.

  9. A homogeneous spectroscopic analysis of host stars of transiting planets

    NASA Astrophysics Data System (ADS)

    Ammler-von Eiff, M.; Santos, N. C.; Sousa, S. G.; Fernandes, J.; Guillot, T.; Israelian, G.; Mayor, M.; Melo, C.


    Context: The analysis of transiting extra-solar planets provides an enormous amount of information about the formation and evolution of planetary systems. A precise knowledge of the host stars is necessary to derive the planetary properties accurately. The properties of the host stars, especially their chemical composition, are also of interest in their own right. Aims: Information about planet formation is inferred by, among others, correlations between different parameters such as the orbital period and the metallicity of the host stars. The stellar properties studied should be derived as homogeneously as possible. The present work provides new, uniformly derived parameters for 13 host stars of transiting planets. Methods: Effective temperature, surface gravity, microturbulence parameter, and iron abundance were derived from spectra of both high signal-to-noise ratio and high resolution by assuming iron excitation and ionization equilibria. Results: For some stars, the new parameters differ from previous determinations, which is indicative of changes in the planetary radii. A systematic offset in the abundance scale with respect to previous assessments is found for the TrES and HAT objects. Our abundance measurements are remarkably robust in terms of the uncertainties in surface gravities. The iron abundances measured in the present work are supplemented by all previous determinations using the same analysis technique. The distribution of iron abundance then agrees well with the known metal-rich distribution of planet host stars. To facilitate future studies, the spectroscopic results of the current work are supplemented by the findings for other host stars of transiting planets, for a total dataset of 50 objects. Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundación Galileo Galilei of the INAF (Istituto Nazionale di Astrofisica) at the Spanish Observatorio del Roque de los Muchachos of

  10. Demographic and quality control parameters of Anastrepha Fraterculus (Diptera: Tephritidae) maintained under artificial rearing

    SciTech Connect

    Vera, T.; Abraham, S.; Oviedo, A.; Willink, E.


    que la fecundidad es optima durante las tres primeras semanas de iniciada la oviposicion y que la fertilidad se mantiene constante durante ese periodo. Durante 2003-2004 se implementaron mejoras en el protocolo de cria existente lo que resulto en un incremento de la viabilidad larvaria, del peso de pupas y del porcentaje de emergencia de adultos. La produccion actual semanal es de un millon de huevos. Los mismos son utilizados para mantener la colonia y realizar distintos estudios de calidad de esta cepa. Por ultimo, se sugieren necesidades de investigacion para alcanzar mejores rendimientos. (author)

  11. Déclenchement du travail à terme par le misoprostol: expérience d'une maternité tunisienne

    PubMed Central

    Ouerdiane, Nadia; Tlili, Nihel; Othmani, Kaouther; Daaloul, Walid; Masmoudi, Abdelwaheb; Hamouda, Sonia Ben; Bouguerra, Badreddine


    Evaluer l'efficacité et l'innocuité de l'utilisation du misoprostol par voie vaginale pour le déclenchement du travail à terme. Etude prospective réalisée au service de gynécologie obstétrique B de l'hôpital Charles Nicolle de Tunis sur une durée de 4 mois. La population sélectionnée concernait les patientes à terme devant bénéficier d'une maturation cervicale. Le misoprostol à la dose de 50 µg par voie vaginale toutes les 12 h était utilisé. Les paramètres étudiés étaient les anomalies contractiles, les anomalies du RCF, le mode d'accouchement, le délai d'accouchement et l’état néonatal. 44 patientes ont bénéficié d'une maturation cervicale par misoprostol. Le terme moyen était de 40 SA. Le taux de nullipare était de 23/44 (52%). Le taux d'accouchement par voie basse était de 31/44 (70.4%). 84% des patientes ont reçu une seule dose de misoprostol. Les anomalies du RCF ont été notées dans 14/44 (32%). Le taux de liquides méconiaux était de 12/44 (27%). Un score d'Apgar à 5 mn inférieur à 7 était noté chez 7/44 (16%). Un cas de rupture utérine était survenue chez une primipare et ce après une seule prise de misoprostol. Nos résultats sont décevants en raison de la survenue d'une rupture utérine et d'une morbidité néonatale importante. D'autres études prospectives multicentriques restent utiles pour mieux s'assurer de l'efficacité mais surtout de l'innocuité du misoprostol à dose faible pour le déclenchement du travail à terme. PMID:27583092

  12. Education relative a l'environnement (ERE): Une etude des representations sociales et des pratiques educatives d'enseignants de science et technologie du secondaire en contexte de formation continue

    NASA Astrophysics Data System (ADS)

    Collard-Fortin, Ugo

    Le developpement des sciences/technologie a tres clairement contribue a ce que ce dernier domaine de savoirs jouisse d'une place de choix au sein de notre societe. Au-dela des progres de notre civilisation inherents a ce dernier developpement, cette croissance amena avec elle un lot d'ineluctables dommages collateraux, contribuant en corollaire a l'emergence de diverses problematiques environnementales inquietantes pour lesquelles les valeurs ainsi que le mode de fonctionnement de la societe occidentale contemporaine sont largement tributaires. C'est entre autres en reponse a cet etat de fait que la recente vague de reforme de l'Education conduisit a l'integration, dans les curricula de sciences/technologie, de contenus relavant d'education relative a l'environnement (ERE). Face au changement, les enseignants de sciences ont du s'approprier ce nouveau programme afm de l'enseigner a leurs eleves. Toutefois, l'analyse de la situation montre que les prescriptions du programme en matiere d'ERE ne se sont pas toujours traduites en de reelles actions dans la pratique. Le contexte de notre etude s'est interesse aux pratiques educatives de l'ERE ainsi qu'a la representation sociale qui en decoule. Notre recherche aborde plus specifiquement la problematique de la modification de ces derniers objets chez les enseignants de sciences et technologie du deuxieme cycle du secondaire. Pour y arriver, nous avons propose a un groupe de trois praticiens de participer a une activite, en communaute de pratique, de formation continue orientee autour de thematiques ERE. Cette recherche developpement, s'inscrivant dans un paradigme qualitatif/interpretatif, s'est appuyee sur une cueillette de donnees effectuee a partir d'entrevues semi-dirigees, d'observations en situation et d'un groupe de discussion, au debut et a la fm de la formation continue. Les donnees brutes ont ete soumises a une demarche d'analyse inductive et ont genere diverses categories etayant nos objets de recherche

  13. Cristallisation, syncristallisation, et alliages moléculaires entre le lorazépam et l'oxazépam

    NASA Astrophysics Data System (ADS)

    Mascherpa-Corral, D.; Mascherpa, G.; Chauvet, A.


    Le polymorphisme et pseudopolymorphisme du lorazépam et oxazépam ont été étudiés par analyse thermique, calorimétrie différentielle à balayage et diffraction de rayons X. Deux formes polymorphes du lorazépam et plusieurs mono et hemisolvates ont été isolés à partir de recristallisation dans divers soivants. Aucun polymorphisme ni solvate n'a été mis en évidence avec l'oxazépam. Les paramètres cristallographiques des phases isolées ont été déterminées. A 160 et 203°C, le lorazépam et l'oxazépam perdent respectivement une molécule d'eau pour donner après réarrangement la quinazolinecarboxaldéhyde correspondante. La syncristallisation des deux benzodiazépines dans le benzène conduit à des alliages moléculaires à miscibilité totale à l'état solide dans tout le domaine de concentration entre l'exazépam el la forme α du lorazépam, elle n'est que partielle avec la forme β. Thermal analysis, differential scanning calorimetry, and X-ray diffraction were carried out to study the polymorphism and pseudopolymorphism of lorazepam and oxazepam. Two polymorphic forms of lorazepam and several mono- or hemisolvates were obtained after recrystallization from various solvents. No polymorphic form or solvate has been found for oxazepam. The crystallographic parameters of these new phases were determined. Lorazepam and oxazepam can lose a molecule of water at 160 and 203°C, respectively, and rearrange to quinazolinecarboxaldehyde. Mixed crystals of the two benzodiazepines, after recrystallization from benzene, lead to molecular alloys with complete solid solubility between oxazepam and the α-form of lorazepam over the whole range of composition but only to partial solubility with the β-form of lorazepam.

  14. Evaluation du niveau d'activité physique dans un service Marocain d'hémodialyse chronique

    PubMed Central

    Karimi, Ilham; Benabdellah, Nawal; Bentata, Yassamine; Yacoubi, Hicham; Haddiya, Intissar


    Introduction L'activité physique est souvent réduite chez le patient hémodialysé chronique. Plusieurs études ont montré l'intérêt du maintien ou de la reprise d'une activité physique sur l’état de santé des patients. Le but de notre travail est d'analyser le niveau d'activité physique chez nos patients hémodialysé chronique. Méthodes Nous avons réalisé une étude transversale au centre d'hémodialyse de l'hôpital Al Farabi d'Oujda. Nous avons évalué l'activité physique de nos patients à l'aide du Questionnaire de Baecke traduit en dialectal Marocain et adapté au contexte socioculturel Marocain. Nous avons relevé les paramètres démographiques et clinico-biologiques ainsi que le niveau d'activité physique. L'analyse statistique est réalisée par le logiciel SPSS 11.5. Résultats Notre étude a inclus 83 patients. L’âge moyen était de 47,3±13,2 ans, avec une prédominance masculine. 15,6% déclarent n'avoir aucune activité physique. 68% des patients rapportent des difficultés à effectuer des efforts physiques importants (courir, soulever un objet lourd). 16,4% des patients déclarent avoir une activité physique et sportive régulière (marche, foot-ball etc..). La diminution de l'activité physique est corrélée de façon significative à l’âge avancée, l'indice de masse corporelle bas, l'ancienneté en hémodialyse et les affections cardio-vasculaires. Conclusion Un programme d'activité physique adapté à notre population d'hémodialysés et élaboré en concertation pluridisciplinaire (cardiologues, orthopédistes, rhumatologues, kinésithérapeutes) paraît intéressant dans le cadre d'une prise en charge globale du patient hémodialysé chronique. PMID:24198881

  15. A large eruption convulsed in prehistoric times an extensive area of Catamarca, Southern Central Andes, NW Argentina

    NASA Astrophysics Data System (ADS)

    Fernandez-Turiel, Jose-Luis; Ratto, Norma; Perez-Torrado, Francisco-Jose; Rodriguez-Gonzalez, Alejandro; Rejas, Marta; Lobo, Agustin


    Geomorphological, stratigraphical, mineralogical and chemical characteristics of many recent 30-160 cm ash deposits occurring at the Bolsón de Fiambalá in Catamarca, NW Argentina, allow their correlation. This lithostratigraphic unit is named Fiambalá Ash and it is uncovered or covered by colluvial deposits and present-day aeolian deposits, reworked products of the primary fall deposits. The grain size of these ash deposits is gritty rather than silty. They are nearly unique among regional ashes in containing hornblende phenocrysts. In addition, they are made up of glass (subangular blocky shards), feldspars, biotite, and quartz; magnetite, ilmenite, apatite and titanite are scarce. The glass is rhyolitic (˜75 to 79 % m/m SiO2; ˜3 to 4 % m/m Na2O; ˜3 to 5 % m/m K2O; 1 to 2 % m/m CaO; normalized to 100 %). On the other hand, in northern margins of Fiambalá basin, extensive remnants of fines-poor pumiceous debris flows and hyperconcentrated sandflow deposits as thick as 10 m are exposed on the walls of the river gorges, where the base is usually covered, e.g., Chuquisaca River. There is no significant unconformity or intercalation of other materials, thus suggesting rapid emplacement after a single eruptive event. A preliminary age of Fiambalá Ash based on archaeological studies bracket it between 1400-1270 and 1270-980 cal a BP (OxCal 4.2.4, SHCal13, 2 sigma). The geographical distribution, the geomorphological features observed in satellite images and the information on the main trends of the stratigraphy, the abundance of hornblende and biotite in the younger proximal ash fall deposits, ignimbrites and lava-domes of the Nevado Tres Cruces complex, favours this edifice as the strongest candidate to be the source of the Upper Holocene pyroclastic deposits found in the Fiambalá basin. The archaeological records seem to evidence the abrupt environmental and societal changes associated with this major eruption. Significant areas of Catamarca were likely

  16. A Comprehensive Stellar Astrophysical Study of the Old Open Cluster M67 with Kepler

    NASA Astrophysics Data System (ADS)

    Mathieu, Robert D.; Vanderburg, Andrew; K2 M67 Team


    M67 is among the best studied of all star clusters. Being at an age and metallicity very near solar, at an accessible distance of 850 pc with low reddening, and rich in content (over 1000 members including main-sequence dwarfs, a well populated subgiant branch and red giant branch, white dwarfs, blue stragglers, sub-subgiants, X-ray sources and CVs), M67 is a cornerstone of stellar astrophysics.The K2 mission (Campaign 5) has obtained long-cadence observations for 2373 stars, both within an optimized central superaperture and as specified targets outside the superaperture. 1,432 of these stars are likely cluster members based on kinematic and photometric criteria.We have extracted light curves and corrected for K2 roll systematics, producing light curves with noise characteristics qualitatively similar to Kepler light curves of stars of similar magnitudes. The data quality is slightly poorer than for field stars observed by K2 due to crowding near the cluster core, but the data are of sufficient quality to detect seismic oscillations, binary star eclipses, flares, and candidate transit events. We are in the process of uploading light curves and various diagnostic files to MAST; light curves and supporting data will also be made available on ExoFOP.Importantly, several investigators within the M67 K2 team are independently doing light curve extractions and analyses for confirmation of science results. We also are adding extensive ground-based supporting data, including APOGEE near-infrared spectra, TRES and WIYN optical spectra, LCOGT photometry, and more.Our science goals encompass asteroseismology and stellar evolution, alternative stellar evolution pathways in binary stars, stellar rotation and angular momentum evolution, stellar activity, eclipsing binaries and beaming, and exoplanets. We will present early science results as available by the time of the meeting, and certainly including asteroseismology, blue stragglers and sub-subgiants, and newly discovered

  17. Détermination quotidienne, en tous les points d'une région, de l'évolution de l'éclairement solaire utilisable à partir d'images de meteosat

    NASA Astrophysics Data System (ADS)

    Ben Jemaa, A.; Delorme, C.


    Our methodology Gistel gives, for each pixel of each numerical image of the visible channel from meteosat, the global irradiance on the ground. It is described here. It has been applied in Tunisia to archived B2 images and in France to Wefax images regularly received at Carpentras. Results are compared with measured daily and hourly irradiations from several stations. The ability to reproduce the evolution of the available solar radiation during several days is analysed. The accuracy about irradiances of our methodology is, indeed, lower than of this one of pyranometers. But if 6 or 8 Wefax images are daily processed, it is possible to get useful data about the distribution of radiation versus time and space. These data disseminated with a short delay allow users to check the daily performances of their solar energy systems. The stored data will be useful to systems designers. La méthodologie Gistel fournit pour chaque pixel de chaque image numérique du canal visible du satellite géostationnaire meteosat l'éclairement global au sol. Elle est brièvement décrite ici. Elle a été appliquée, d'une part en Tunisie à des images archivées B2 et d'autre part en France à des images Wefax reçues régulièrement à Carpentras. Les résultats obtenus sont comparés aux mesures d'irradiations journalières et horaires des stations actinométriques. La reproductibilité de l'évolution du rayonnement disponible au cours de quelques journées est analysée et discutée. La précision des éclairements fournis est, certes, inférieure à celle d'un pyranomètre mais appliquée quotidiennement à 6 ou 8 images Wefax par jour Gistel peut donner des informations utiles sur l'évolution du flux solaire dans l'espace et le temps. Ces informations, transmises en temps peu différé, permettent aux utilisateurs de vérifier les performances de leurs systèmes énergétiques solaires, non équipés de pyranomètres. Les informations stockées pourront servir aux concepteurs de

  18. Developpement d'un vibrateur acoustique pour precipiter les defauts latents de circuits electroniques

    NASA Astrophysics Data System (ADS)

    Lafleur, Francois


    Le procede de deverminage, ou Environmental Stress Screening (ESS), est employe principalement dans le domaine de l'electronique pour reduire les mortalites infantiles des produits avant leur livraison. Il utilise usuellement des stimulations environnementales telles que les vibrations ou la temperature produites a l'aide d'equipements conventionnels d'essais qui sont tres couteux et difficiles a implanter. Le but de cette recherche est le developpement d'une nouvelle methode d'excitation vibratoire des plaques de circuits electroniques a moindre cout par l'emploi de l'excitation acoustique. Le projet a mene au developpement d'un vibrateur acoustique pouvant etre utilise lors d'implantations du procede ESS en milieu industriel. L'utilisation de cette nouvelle technologie et des methodes novatrices de personnalisation des spectres ESS proposees dans cette these permettent la precipitation de defaillances latentes presentes dans les produits electroniques de facon efficace et securitaire et ce, a moindre cout par rapport aux technologies concurrentes. La methodologie des travaux presentes dans cette these inclus: (1) La generation acoustique des vibrations sur les circuits; (2) L'analyse modale acoustique des circuits par des methodes a reference unique et a references multiples; (3) La precipitation de defauts latents typiques des circuits electroniques; (4) Une methode d'individualisation des spectres vibratoires tenant compte des caracteristiques structurelles des circuits; (5) La presentation de la configuration de l'equipement acoustique et les resultats d'implantation du procede. Nonobstant la fabrication, l'installation et la mise en service d'un equipement en milieu industriel (depuis le mois de mai 2002), ces travaux ont permis l'obtention de trois familles de brevets et la publication de six articles de conference: trois portant sur l'analyse modale a reference unique, un portant sur l'analyse modale a references multiples, un autre portant sur la

  19. Barhl1 is directly regulated by thyroid hormone in the developing cerebellum of mice

    SciTech Connect

    Dong, Hongyan; Yauk, Carole L.; Wade, Michael G.


    Highlights: Black-Right-Pointing-Pointer Thyroid hormone receptor binds to the promoter region of Barhl1. Black-Right-Pointing-Pointer Barhl1 expression in cerebellum is negatively regulated by thyroid hormone. Black-Right-Pointing-Pointer Negative regulation of Barhl1 by thyroid hormone was confirmed in vitro. Black-Right-Pointing-Pointer Thyroid hormone may play a role in normal brain development through transcriptional control of Barhl1. -- Abstract: Thyroid hormones (THs) are essential for the brain development. Despite considerable effort, few genes directly regulated by THs have been identified. In this study, we investigate the effects of THs on the regulation of Barhl1, a transcription factor that regulates sensorineural development. Using DNA microarray combined with chromatin immunoprecipitation (ChIP-chip), we identified a TR{beta} binding site in the promoter of Barhl1. The binding was further confirmed by ChIP-PCR. The site is located approximately 755 bp upstream of the transcription start site. Reporter vectors containing the binding site or mutated fragments were transfected into GH3 cells. T3 treatment decreased the transcriptional activity of the wild fragment but not the mutant. Two 28 bp oligonucleotides containing sequences that resemble known TH response elements (TREs) were derived from this binding site and DNA-protein interaction was performed using electrophoretic mobility shift assays (EMSA). Binding analysis in a nuclear extract containing TR{beta} revealed that one of these fragments bound TR{beta}. This complex was shifted with the addition of anti-TR{beta} antibody. We investigated Barhl1 expression in animal models and TH-treated cultured cells. Both long term treatment with 6-propyl-2-thiouracil and short-term treatment with 0.05% methimazole/1% sodium perchlorate (both treatments render mice hypothyroid) resulted in up-regulation of Barhl1. TH supplementation of hypothyroid mice caused a decrease in the expression of Barhl1

  20. Trace and minor elements in sphalerite: A LA-ICPMS study

    NASA Astrophysics Data System (ADS)

    Cook, Nigel J.; Ciobanu, Cristiana L.; Pring, Allan; Skinner, William; Shimizu, Masaaki; Danyushevsky, Leonid; Saini-Eidukat, Bernhardt; Melcher, Frank


    Sphalerite is an important host mineral for a wide range of minor and trace elements. We have used laser-ablation inductively coupled mass spectroscopy (LA-ICPMS) techniques to investigate the distribution of Ag, As, Bi, Cd, Co, Cu, Fe, Ga, Ge, In, Mn, Mo, Ni, Pb, Sb, Se, Sn and Tl in samples from 26 ore deposits, including specimens with wt.% levels of Mn, Cd, In, Sn and Hg. This technique provides accurate trace element data, confirming that Cd, Co, Ga, Ge, In, Mn, Sn, As and Tl are present in solid solution. The concentrations of most elements vary over several orders of magnitude between deposits and in some cases between single samples from a given deposit. Sphalerite is characterized by a specific range of Cd (typically 0.2-1.0 wt.%) in each deposit. Higher Cd concentrations are rare; spot analyses on samples from skarn at Baisoara (Romania) show up to 13.2 wt.% (Cd 2+ ↔ Zn 2+ substitution). The LA-ICPMS technique also allows for identification of other elements, notably Pb, Sb and Bi, mostly as micro-inclusions of minerals carrying those elements, and not as solid solution. Silver may occur both as solid solution and as micro-inclusions. Sphalerite can also incorporate minor amounts of As and Se, and possibly Au (e.g., Magura epithermal Au, Romania). Manganese enrichment (up to ˜4 wt.%) does not appear to enhance incorporation of other elements. Sphalerite from Toyoha (Japan) features superimposed zoning. Indium-sphalerite (up to 6.7 wt.% In) coexists with Sn-sphalerite (up to 2.3 wt.%). Indium concentration correlates with Cu, corroborating coupled (Cu +In 3+) ↔ 2Zn 2+ substitution. Tin, however, correlates with Ag, suggesting (2Ag +Sn 4+) ↔ 3Zn 2+ coupled substitution. Germanium-bearing sphalerite from Tres Marias (Mexico) contains several hundred ppm Ge, correlating with Fe. We see no evidence of coupled substitution for incorporation of Ge. Accordingly, we postulate that Ge may be present as Ge 2+ rather than Ge 4+. Trace element concentrations in

  1. Influence of the atmospheric humidity on the behaviour of silicon AFM probes in photon scanning tunneling microscopy

    NASA Astrophysics Data System (ADS)

    Benfedda, M.; Lahimer, S.; Bonnafe, J.


    The photon scanning tunneling microscopy (PSTM) allows to characterize the surface topography with high resolution. This microscopy exploits the exponential decay of the evanescent field achieved by the total internal reflection under the surface sample. When the distance between the sensor and the surface becomes small (sim 100 nm), the non propagating photons of the evanescent field can be converted into guided propagating mode of polaritons. A bulk Silicon probe is used in the AFM experiment as a sensor of van der Waals forces. The aim of this paper is to discuss the influence of the atmospheric humidity on the PSTM measurements. We have showed that the theoretical predictions of the dielectrical capture model (DCM) are very different from the experimental results when the humidity level is higher than a threshold value (30%). We present the results obtained with TE polarization, but the same behaviour is found with TM polarization. Although, in this paper we do not propose a theoretical model explaining the deviations between DCM values and experimental, however we found a validity threshold for our experimental results and we have emited the assumption that under high humidity level the pollution film presents on the sample surface slide during the displacement of the probe. La microscopie optique à effet tunnel (PSTM) est un outil de caractérisation de surface à haute résolution. Ce microscope exploite la décroissance du champ évanescent créé sur la surface de l'échantillon. Quand la distance entre le capteur et la surface est de quelques dizaines de nanomètres, les ondes évanescentes créées sur la surface sont converties en ondes propagatives et détectées en champ lointain. Le capteur est une sonde en silicium utilisée en microscopie à force atomique. Cet article montre l'influence des conditions atmosphériques sur les mesures PSTM. Il montre qu'au-delà d'un certain taux d'humidité (30%), les mesures ne sont plus valables et ne suivent

  2. L'Infection Nosocomiale en Reanimation des Brules

    PubMed Central

    Siah, S.; Belefqih, R.; Elouennass, M.; Fouadi, F.E.; Ihrai, I.


    Summary L'infection nosocomiale bactérienne étant l'une des principales causes de morbidité et de mortalité chez le brûlé, nous avons réalisé une étude rétrospective portant sur 84 patients hospitalisés au sein du service de réanimation des brûlés de l'Hôpital Militaire d'Instruction Mohammed V de Rabat, sur une période de 3 ans, du premier janvier 2001 au 31 décembre 2003. Les critères d'infection nosocomiale étaient ceux du Center for Disease Control d'Atlanta de 1988. Les taux d'incidence ont été calculés. La population infectée a été comparée à celle non infectée. L'écologie bactérienne du service a été décrite comme aussi l'antibiotype. Il ressort de cette étude la survenue de 87 infections nosocomiales chez 27 patients. L'incidence cumulative était de 103 infections pour 1000 jours de traitement. Pour ce qui est des caractéristiques des infections bactériennes, les sites infectés étaient la peau (77%), le sang (13,8%), les voies urinaires (8%) et les poumons (1,1%). Les principaux germes étaient: Staphylococcus sp. (33,3%), Pseudomonas aeruginosa (23%), Enterococcus faecalis et Acinetobacter (8%). Les staphylocoques étaient méticillo-résistants dans 22,2% des cas. Le Pseudomonas et l'Acinetobacter étaient multirésistants (60%). Dans notre étude les facteurs prédictifs de survenue des infections nosocomiales que nous avons retenus après l'étude comparative des populations infectées et non infectées ont été l'âge, le body mass index, l'abbreviated burn severity index et le remplissage initial. En isolant ces paramètres, nous avons pu établir une équation à valeur prédictive de survenue d'infection nosocomiale chez le patient brûlé. PMID:21991158


    SciTech Connect

    Ibgui, Laurent; Spiegel, David S.; Burrows, Adam E-mail:


    The radii of some transiting extrasolar giant planets are larger than would be expected by the standard theory. We address this puzzle with the model of coupled radius-orbit tidal evolution developed by Ibgui and Burrows. The planetary radius is evolved self-consistently with orbital parameters, under the influence of tidal torques and tidal dissipation in the interior of the planet. A general feature of this model, which we have previously demonstrated in the generic case, is that a possible transient inflation of the planetary radius can temporarily interrupt its standard monotonic shrinking and can lead to the inflated radii that we observe. Importantly, we demonstrate that the use of a constant time lag model for the orbital evolution does not improve the accuracy of the evolutionary calculations. First, though formulated in a closed form by the equations of Hut, it is not valid at large eccentricities, as for the constant phase lag model truncated at the second order in eccentricity that we adopt; ambiguities in tidal theories are perhaps the most significant source of uncertainty in evolutionary calculations. Second, we find evolutionary tracks that fit within the 1{sigma} error bars, the radius, the eccentricity, and the semimajor axis of HD 209458b in its current estimated age range, using the constant time lag model, as we find fitting tracks with the constant phase lag model. Both models show that a bloated planet with a circular orbit may still be inflated, due to thermal inertia. We have modified our constant phase lag model to include an orbital period dependence of the tidal dissipation factor in the star, Q'{sub *} {proportional_to} P{sup {gamma}}, -1 {<=} {gamma} {<=} 1. For some inflated planets (WASP-6b and WASP-15b), we find fitting tracks; for another (TrES-4), we do not; and for others (WASP-4b and WASP-12b), we find fitting tracks, but our model might imply that we are observing the planets at a special time. Finally, we stress a 2-3 order

  4. Anomalous dielectric relaxation in lithium-potassium tantalate crystals

    NASA Astrophysics Data System (ADS)

    Doussineau, P.; Farssi, Y.; Frénois, C.; Levelut, A.; Toulouse, J.; Ziolkiewicz, S.


    In order to describe the unusual dielectric properties observed in Ki{1-χ}Li{χ}TaO3. crystals a new approchh is proposed. The dynamical Glauber theory, previously applied to spinglasses, is modifiéd by the introduction of the spectral distribution of the random interactions between the dipoles associated with the Li+ ions. Moreover, the dipole corrélations are taken into account by the Onsager réaction field. As a result, the calculated dielectric constant reproduces well the unusual features of the Argand diagrams and, in particular, their finite slope at low frequencies and infinite slope at high frequencies (strophoidal shape). The temperature dépendance of some parameters shows, however, the limits of a spin-glass type model in describing the collective behaviour of randomly distributed dipoles in a highly polarizable medium. Une nouvelle approche est présentée qui permet de décrire les propriétés diélectriques particulières de cristaux mixtes de Ki{1-χ}Li{χ}TaO3. Elle s'appuie sur la théorie dynamique de Glauber, déjà utilisée pour les verres de spins, et modifiée par l'introduction d'une distribution spectrale spécifique aux interactions aléatoires des dipôles électriques associés aux ions Li+. En outre, les corrélations entre dipôles sont prises en compte par le champ de réaction d'Onsager. II s'ensuit que la constante diélectrique complexe ainsi calculée reproduit fidèlement les particularités des diagrammes d'Argand, telles que la pente finie aux basses fréquences et la pente infinie aux hautes fréquences (forme strophoïdale). La dépendance en température de certains paramètres déterminés par le calcul montre les limites de l'analogie avec les verres de spins et met en évidence le rôle d'un réseau très polarisable dans le comportement collectif d'une assemblée de dipôles électriques.

  5. Impact du traitement antirétroviral sur le profil biologique des enfants VIH positifs suivis au Centre Hospitalier et Universitaire de Yaoundé au Cameroun

    PubMed Central

    Kalla, Ginette Claude Mireille; Assoumou, Marie-Claire Okomo; Kamgaing, Nelly; Monebenimp, Francisca; Mbopi-Keou, Francois-Xavier


    Introduction L'objectif de ce travail était d’évaluer l'impact du traitement antirétroviral sur le profil biologique des enfants VIH positifs suivis au Centre Hospitalier et Universitaire de Yaoundé au Cameroun. Méthodes Il s'agissait d'une étude rétrospective réalisée de Mai 2003 à Décembre 2012 au CHU de Yaoundé au Cameroun. Pour cette étude, nous avons obtenu une clairance éthique. Résultats L’âge moyen était de 54.02±46.34 mois. The sexe ratio était de 0.96 en faveur des garçons. Le diagnostic s’était fait tardivement (74.2%) ainsi que la mise sous traitement (83.3%). Seuls 36 des 116 enfants (31%) avait pu avoir un bilan biologique à l'initiation du traitement antirétroviral et six mois après l'initiation du traitement antirétroviral. Après six mois de traitement, nous avons enregistrés une augmentation significative des paramètres biologiques suivants: taux de glycémie de 0.09g/L (0.75-0.84; p= 0.007), pourcentage de CD4 chez les enfants de moins de 5 ans de 4.62% (20.12-24.75; p = 0.022), valeur absolue de CD4 chez les enfants de plus de 5 ans de 294 cellules/mm3 (151.18-445.18; p = 0.011), le rapport CD4/CD8 de 0.35 (0.55-0.90; p = 0.000). Enfin, après six mois de traitement, on enregistrait une baisse significative de la charge virale du VIH de 3.90 log (5.85-1.95; p = 0.006). Conclusion Il ressort de cette étude que la restauration immunitaire et la suppression virologique peuvent être obtenus après six mois de traitement antirétroviral. Cependant, des efforts doivent encore être faits en ce qui concerne la prise en charge du suivi biologique, gage d'un bon suivi thérapeutique au Cameroun. PMID:26113902

  6. [In Process Citation].


    González-Castell, Dinorah; González de Cosío, Teresita; Rodríguez-Ramírez, Sonia; Escobar-Zaragoza, Leticia


    Introducción: los estudios en consumo dietético infantil no se enfocan generalmente al tipo de líquidos consumidos.Objetivo: documentar los líquidos presentes en la dieta de infantes mexicanos < 1 año, participantes en la Encuesta Nacional de Salud y Nutrición 2012 (ENSANUT-2012) de acuerdo a su edad y lactancia.Métodos: se analizaron las prácticas de alimentación de infantes < 1 año de la ENSANUT-2012 en niños no amamantados (no-A) y amamantados (A) determinado por status quo para el consumo de líquidos agrupados en: agua, fórmula, leche fortificada LICONSA, líquidos nutritivos (LN; atole con agua o leche y café con leche) y líquidos no-nutritivos (Lno-N): agua endulzada, bebidas a base de agua, tes, caldos de frijol o pollo, aguamiel y café con agua. A partir del recuerdo de la madre en los tres primeros días de nacidos (recién nacidos) de los infantes < 1 año, analizamos el consumo de líquidos sin agrupar. Calculamos porcentajes e intervalos de confianza (IC 95%) ajustados por diseño de encuesta. Las diferencias estadísticas se analizaron a través de la prueba Z con un valor p < 0,05.Resultados: en infantes < 6 meses se observó un alto consumo de leche materna seguido por fórmula (56,7%) y agua (51,1%). Fue más alta la proporción del consumo Lno-N en infantes no-A que en amamantados (p < 0,05). Más del 60% de infantes entre 6 meses y 1 año consumieron fórmula y no eran amamantados. En recién nacidos predominó el consumo de fórmula seguido por té o infusión.Conclusiones: los líquidos diferentes a la leche materna se encuentran indeseablemente en la alimentación de infantes mexicanos y los líquidos no nutritivos son consumidos antes que los nutritivos, resaltando negativas prácticas dietéticas tempranamente. PMID:27019236

  7. Aspects épidémiologiques, diagnostiques et thérapeutiques des ostéosarcomes de l'enfant au CHU Aristide le Dantec de Dakar: à propos de 16 cas

    PubMed Central

    Ndour, Oumar; Alumeti, Desire Munyali; Fall, Mbaye; Fall, Aimée Faye; Diouf, Cheikh; Ndoye, Ndeye Aby; Ngom, Gabriel; Ndoye, Mamadou


    Le but de cette étude était de décrire les aspects épidémiologiques, diagnostiques et thérapeutiques des ostéosarcomes de l'enfant. Il s'agissait d'une étude rétrospective sur dix ans qui a colligé 16 dossiers d'ostéosarcome pris en charge au service de Chirurgie Pédiatrique de l'hôpital Aristide Le Dantec de Dakar. Les paramètres étudiés étaient le niveau d'instruction et le niveau socioprofessionnel des parents, l'origine géographique, l’âge, le sexe, les antécédents particuliers, le délai de consultation, les motifs de consultation, les signes physiques, les signes radiologiques, la biologie, les modalités thérapeutiques et l’évolution. Tous les patients avaient bénéficié d'un examen anatomopathologique qui a confirmé le diagnostic d'ostéosarcome. Pour la majeure partie de nos patients (58% des cas) les parents avaient un niveau d'instruction bas. L’âge moyen était de 11ans. Une prédominance masculine était retrouvée avec un sex-ratio de 3,25:1. Le délai de consultation moyen était de 16 mois. Le principal motif de consultation était la tuméfaction (10 cas). Huit patients avaient bénéficié d'un traitement traditionnel. La taille de la tumeur était supérieure à 10cm dans 14 cas. La localisation la plus fréquente était le genou (14 cas). La radiographie standard retrouvait dans 15 cas des images d'ostéolyse. Le bilan d'extension n'avait pas retrouvé de métastases. Les options thérapeutiques étaient dominées par l'amputation seule (43,75% des cas). La survie à 2 ans était de 17%. L'ostéosarcome atteint le plus souvent le garçon après l’âge de 10 ans. Sa prise en charge au Sénégal se heurte à d’énormes difficultés liées au retard diagnostique. La solution repose essentiellement sur une collaboration pluridisciplinaire. PMID:23720705

  8. Micellisation et activité de surface des bromures de n-alkyltriméthylammonium en milieu eau-acide orthophosphorique

    NASA Astrophysics Data System (ADS)

    Ouni, S.; Hafiane, A.; Dhahbi, M.


    Measurements of superficial tension of n-alkyltrimethylammonium bromides in air/water-orthophosphoric acid interface have been made by “stripping method". Data were evaluated by approximation to the Von Szyszkowski equation. Thermodynamic parameters as (Γmax, F, A, B, Δ G^circ_A, Δ GM and CMC) at different concentrations of orhophosphoric acid (0 at 3 M) are calculted. The CMC values of the homologous series in relation to the chain length were determined. They showed a good correlation with the Klevens equation. A minimum of CMC and (-ΔGM) was observed for the n-octadecyltrimethylammonium bromide, which has been attributed to the cosolvant effect and the change of medium properties. L'adsorption, de bromure de n-alkyltriméthylammonium à l'interface air/eau-acide orthophosphorique, a été étudiée par la mesure de tension superficielle en fonction du nombre d'atomes de carbone du groupement alkyle et de la concentration en acide orthophosphorique (0 à 3 M). L'analyse des résultats a été effectuée à l'aide de l'équation de Von Szyszkowski. Les grandeurs et paramètres thermodynamiques (Γmax, F, A, B, Δ G^circ_A, Δ GM and CMC) ont été déterminés et discutés selon l'équilibre de forces de répulsion électrostatique entre les têtes polaires et d'attraction hydrophobe des chaînes aliphatiques. Les valeurs des CMC obéissent à l'équation de Klevens. Dans le cas du bromure de n-octadécyltriméthylammonium les valeurs de la CMC et de (-ΔGM) présentent un minimum, attribué au changement des propriétés du binaire eau-acide orthophosphorique.

  9. Mechanisms of arsenic enrichment in geothermal and petroleum reservoirs fluids in Mexico.


    Birkle, Peter; Bundschuh, Jochen; Sracek, Ondra


    The lack of chemical similarity between thermal fluids in geothermal and petroleum reservoirs in Mexico indicates a distinct origin for arsenic in both types of reservoirs. Deep fluids from geothermal reservoirs along the Transmexican Volcanic Belt (TMVB) are characterized by elevated arsenic concentrations, within a range between 1 and 100 mg L(-1) at a depth from 600 to 3000 m b.s.l. Based on hierarchical cluster analysis (HCA), arsenic is linked to typical geothermal species like lithium, silica, and boron. The lack of correlation between arsenic and salinity reflects the importance of secondary water-rock interaction processes. The predominance of arsenic compared to Fe- and Cu-concentrations, and the occurrence of secondary minerals (sulfides and clay minerals) in temperature-dependent hydrothermal zones, supports this hypothesis. Neither magmatic fluids input, nor As mineralization is a prerequisite for As enrichment in Mexican geothermal fluids. In contrast, petroleum reservoir waters from sedimentary basins in SE-Mexico show maximum As concentrations of 2 mg L(-1), at depths from 2900 to 6100 m b.s.l. The linear chloride-arsenic correlation indicates that evaporated seawater represents the major source for aqueous arsenic in oil reservoirs, and only minor arsenic proportions are derived from interaction with carbonate host rock. Speciation modeling suggests the lack of arsenic solubility control in both geothermal and petroleum reservoirs, but precipitation/co-precipitation of As with secondary sulfides could occur in petroleum reservoirs with high iron concentrations. Geothermal fluids from magmatic-type reservoirs (Los Azufres and Los Humeros at the TMVB and Las Tres Vírgenes with a granodioritic basement) show relative constant arsenic concentrations through varying temperature conditions, which indicates that temperatures above 230-250 °C provide optimal and stable conditions for arsenic mobility. In contrast, temperature conditions for sedimentary

  10. Constraining performance assessment models with tracer test results: a comparison between two conceptual models

    NASA Astrophysics Data System (ADS)

    McKenna, Sean A.; Selroos, Jan-Olof

    the amount of diffusive capacity that can be accessed along the transport pathway. Contraindre le bilan des performances des modèles avec les résultats de traçages: une comparaison entre deux modèles conceptuels. Des tests de traçage sont mis en oeuvre pour étudier les paramètres de transport de soluté d'une roche sur une longueur de 5 m. Deux différents modèles de transport de soluté dans un milieu à double porosité fournissent des estimation des courbes de restitution. L'une des conceptualisations (unique taux de restitution) emploie un seul coefficient effectif de diffusion dans une matrice possédant une pénétration infinie en profondeur. Par ailleurs, la rétention du traceur entre les différentes lignes d'écoulement peut varier comme le rapport des débits aux surfaces mouillées et comme le rapport de la différence de débits entres les lignes d'écoulement. L'autre conceptualisation (taux multiple) emploie une distribution continue de coefficients de diffusion dans une matrice à capacité variable et finit. L'application de ces deux modèles avec les pa! ramètres estimés grâce aux courbes de restitution produit des résultats de transport qui différent de plusieurs ordres de grandeur dans la magnitude du pic, le temps du pic de concentration, au bilan des performances (PA) et aux échelles de distance (100,000 ans et 1,000 m). Ces différences sont éxaminées par l'intermédiaire des temps limites pour que la capacité diffusive équivaille à un milieu infini. Ces limites sont comparées à travers les modèles conceptuels ainsi que les temps caractéristiques de diffusion à l'échelle du test de traçage et à l'échelle du PA. Par ailleurs, les différences entre les modèles sont éxaminées en réestimant les paramètres pour le modèle à taux multiple à partir des résultats du modèle à double porosité à l'échelle du PA. Les résultats indiquent que pour chaque modèle la valeur de la capacité diffusive dans un milieu

  11. [Not Available].


    Vizuet Vega, Norma Isela; Shamah Levy, Teresa; Gaona Pineda, Elsa Berenice; Cuevas Nasu, Lucía; Méndez Gómez-Humarán, Ignacio


    Introducción: la anemia es un factor de riesgo en la población infantil con consecuencias graves para su crecimiento y desarrollo. Los programas de ayuda alimentaria pueden contribuir a su prevención y control. Objetivo: estudiar la adherencia al consumo de suplementos y su relación con la prevalencia de anemia en niños menores de tres años de edad en San Luis Potosí, México beneficiarios del programa PROSPERA.Métodos: se realizó un análisis comparativo en niños de 12 a 36 meses que consumen diferentes suplementos alimenticios: 414 pertenecientes al grupo de intervención y 334 al de comparación. Se midió la hemoglobina (Hb) por Hemocue clasificando como anémicos a quienes tuvieron valores <110 g/l. Se aplicaron pruebas de t de Student y X2. Se estimaron efectos de intervención mediante el método de diferencias en diferencias y un puntaje de adherencia al consumo de suplementos.Resultados: al final del estudio la prevalencia de anemia disminuyó 11.2 pp en el grupo de intervención y 8.7 pp en el de comparación; la interacción del puntaje de adherencia por suplemento y etapa de observación mostró que la adherencia al consumo de Bebida láctea + Vitaniño reduce el riesgo de presentar anemia (p = 0,14). El consumo de Nutrisano + Vitaniño se asoció con menor riesgo (0,2), ambos con respecto al consumo de Nutrisano.Conclusiones: el programa PROSPERA tuvo efectos importantes en la disminución de las prevalencias de anemia. Se recomienda llevar a cabo acciones para mejorar la adherencia al consumo de suplementos alimenticios, a fIn de mejorar la efectividad de los programas. PMID:27571648

  12. Hernie inguinale de la vessie: à propos de 8 cas

    PubMed Central

    Sarr, Alioune; Ondo, Cyrille Ze; Sow, Yaya; Fall, Boubacar; Thiam, Amath; sine, Babacar; Djoufang, Rodrigue; Diao, Babacar; Fall, Papa Ameth; Ndoye, Alain Khassim; Ba, Mamadou


    Décrire notre expérience de la prise en charge des hernies inguinales de la vessie (HIV). Il s'agit d'une étude rétrospective descriptive colligeant les dossiers des patients opérés pour une HIV entre janvier 2005 et décembre 2012. Les paramètres suivants ont été étudiés: l’âge des patients, les aspects anatomo-cliniques de la hernie, les circonstances de découverte, l'attitude thérapeutique et les résultats de la cure. Huit HIV ont été diagnostiquées sur une période de 7 ans. Tous les patients étaient de sexe masculin. La moyenne d’âge était de 57,6 ans. La HIV siégeait à droite chez 5 patients et était associée à une HBP chez 3 patients, deux patients avaient des antécédents de herniorraphie. La découverte était per opératoire chez 6 patients, postopératoire (fistule vesicocutanée) chez un patient et préopératoire chez un patient. Ce dernier a présenté une HIV géante diagnostiquée à l'Uroscanner. L'attitude thérapeutique était fonction des circonstances de découverte de la HIV et de la pathologie associée. Six patients ont été opérés selon la technique de Bassini et deux selon la technique de Mac Way. La durée moyenne de l'hospitalisation était de 7 jours. Après un suivi régulier de 2 ans nous n'avons pas noté de récidive herniaire. La HIV est une affection rare dont la découverte est le plus souvent per-opératoire après une taille vésicale. Il faut l’évoquer chez tout patient aux antécédents d'herniorraphie et chez les sujets âgés de plus de 50 ans qui présentent une hernie inguinale associée à des TUBA. PMID:26600907

  13. Homogeneous studies of transiting extrasolar planets - V. New results for 38 planets

    NASA Astrophysics Data System (ADS)

    Southworth, John


    I measure the physical properties of 38 transiting extrasolar planetary systems, bringing the total number studied within the Homogeneous Studies project to 82. Transit light curves are modelled using the JKTEBOP code, with careful attention paid to limb darkening, orbital eccentricity and contaminating light. The physical properties of each system are obtained from the photometric parameters, published spectroscopic measurements and five sets of theoretical stellar model predictions. Statistical errors are assessed using Monte Carlo and residual permutation algorithms and propagated via a perturbation algorithm. Systematic errors are estimated from the interagreement between results calculated using five theoretical stellar models. The headline result is a major upward revision of the radius of the planet in the OGLE-TR-56 system, from 1.23-1.38 to 1.734 ± 0.051 ± 0.029 RJup (statistical and systematic errors, respectively). Its density is three times lower than previously thought. This change comes from the first complete analysis of published high-quality photometry. Significantly larger planetary radii are also found for Kepler-15, KOI-428, WASP-13, WASP-14 and WASP-21 compared to previous work. I present the first results based on Kepler short-cadence data for Kepler-14, Kepler-15 and KOI-135. More extensive long-cadence data from the Kepler satellite are used to improve the measured properties of KOI-196, KOI-204, KOI-254, KOI-423 and KOI-428. The stellar component in the KOI-428 system is the largest known to host a transiting planet, at 2.48 ± 0.17 ± 0.20 R⊙. Detailed analyses are given for HAT-P-3, HAT-P-6, HAT-P-9, HAT-P-14 and WASP-12, based on more extensive data sets than considered in previous studies. Detailed analyses are also presented for the CoRoT systems 17, 18, 19, 20 and 23; Kepler-7, -12 and -17; KOI-254; OGLE-TR-111, -113, -132 and L9 and TrES-4. I revisit the correlations between orbital period and surface gravity, and orbital period

  14. Séroprévalence du virus de l'herpès humain-8 chez des patients VIH positif à l'hôpital général de Yaoundé – Cameroun

    PubMed Central

    Jacky, Njiki Bikoï; Paul, Ndom; Lilian, Mupang; Sylvie, Agokeng Demanou


    L'épidémiologie de l'infection par le virus herpès humain de type 8 (HHV8) associée à celle à VIH, reste encore méconnue au Cameroun, bien que le pays soit considéré comme une zone endémique pour ces deux virus. L'objectif de ce travail était de ressortir le profil de la séroprévalence du HHV8 au sein de notre population d'étude. 57 personnes ont été recrutées à l'Hôpital Général de Yaoundé et suivies sur une durée 12 mois. Des anticorps IgG anti-HHV8 ont été déterminés par ELISA. Des paramètres autres, tels que l'âge, le sexe, le stade des maladies (SK et VIH/SIDA), le protocole ARV, ainsi que les taux de CD4 ont été utilisés pour déterminer les variables associées à la séropositivité au HHV8. Cette association a été évaluée par le test khi carré. La séroprévalence du HHV8 était de 90% dans notre population en début d'étude et de 74% douze mois plus tard, une séroprévalence qui restait élevée quelque soit le profil clinique, la tranche d'âge, le sexe ou le taux de CD4+ de l'individu. Aucune variable de l'étude n'était significativement associée à la séropositivité du HHV8. Le virus HHV8 semblait circuler au sein de notre population d'étude. Cependant l'on constate, douze mois plus tard, l'absence de manifestations cliniques du SK chez les patients VIH+ positifs, malgré des titres très élevés en IgG anti-HHV8. PMID:26090027

  15. Mourir chez soi

    PubMed Central

    Kiyanda, Brigitte Gagnon; Dechêne, Geneviève; Marchand, Robert


    Résumé Objectif Démontrer que des infirmières dédiées en soins palliatifs d’un centre local de services communautaires (CLSC) urbain peuvent garder à domicile jusqu’au décès plus de 50 % de leurs patients en fin de vie et que le suivi médical à domicile est un facteur déterminant du décès à domicile. Type d’étude Analyse du lieu de décès des patients décédés en 2012 et 2013 suivis par les infirmières dédiées (N = 212), en fonction du suivi médical. Contexte Soins palliatifs du CLSC de Verdun, un territoire urbain situé dans le sud-ouest de Montréal. Participants Un total de 212 patients en fin de vie décédés en 2012 et 2013, suivis par 3 infirmières dédiées en soins palliatifs. Principaux paramètres à l’étude Le pourcentage de décès à domicile. Résultats Des 212 patients suivis à domicile par les infirmières en soins palliatifs, 56,6 % sont décédés à domicile, 62,6 % lorsque suivis par des médecins à domicile du CLSC, contre 5,0 % lorsque sans médecin à domicile. Conclusion Le développement des services médicaux à domicile au Québec, couplé à une simple restructuration des services de soins infirmiers des CLSC, permettrait à plus de 50 % des patients en fin de vie à domicile suivis par ces CLSC d’y demeurer jusqu’au décès, le souhait d’une majorité.

  16. On the Electrification of Pyrocumulus Clouds

    NASA Technical Reports Server (NTRS)

    Lang, Timothy J.; Rutledge, Steven A.; Dolan, Brenda; Krehbiel, Paul; Rison, William; Lindsey, Daniel T.


    , Tres Lagunas, etc.) will be compared against the 2012 cases, with special emphasis on polarimetric NEXRAD and available lightning measurements, in order to better understand the physical processes responsible for pyrocumulus electrification.

  17. Profil épidémiologique des femmes enceintes cardiaques dans le centre de maternité de Tunis: expérience du service A

    PubMed Central

    Khemiri, Khaled; Jenayah, Amel Achour; Boudaya, Fethia; Hamdi, Asma; Meskhi, Souad; Sfar, Ezzeddine; Chelli, Dalenda


    Nous rapportons dans ce travail, le profil épidémiologique des femmes enceintes porteuses d'une cardiopathie ayant accouché dans le service «A» du centre de maternité de Tunis. Il s'agit d'une étude rétrospective descriptive sur 3 ans, de janvier 2010 à décembre 2012, portant sur les dossiers des parturientes cardiaques suivies et ayant accouché dans notre service, à l'exclusion des cardiopathies hypertensives. Les paramètres analysés étaient la gestité et parité des parturientes, le type de la cardiopathie, le mode d'accouchement et le pronostic foetal. Cinquante six cas sur 19655 accouchements avaient été recrutés, soit une incidence de 1 pour 351 accouchements (0,285%). L’âge moyen de nos parturientes était de 30,89±5,3 ans avec des extrêmes allant de 21 à 42 ans. 23 (41,07%) avaient une cardiopathie congénitale, 35 (62,5%) une valvulopathie, 6 (10,71%) un trouble du rythme, 3 (5,35%) un trouble de la conduction à type de bloc auriculo-ventriculaire et 3 (5,35%) une cardiopathie ischémique. Cinquante deux parturientes (92,85%) avaient accouché à un terme dépassant les 37 semaines d'aménorrhée (SA). L'accouchement s'est déroulé par les voies naturelles chez 22 (39,28%) patientes et par césarienne chez 34 (60,71%). Le poids moyen des nouveaux nés à la naissance était de 3341,25 grammes. 3 transferts néonataux en unité de réanimation étaient réalisés avec un seul cas de décès néonatal. La grossesse et l'accouchement chez la femme cardiaque constituent un haut risque materno-foetal dépendant du type, mais surtout du stade de la cardiopathie, nécessitant une prise en charge précoce et multidisciplinaire de la parturiente. PMID:26327977

  18. Towards integrated error estimation and lag-aware data assimilation for operational streamflow forecasting

    NASA Astrophysics Data System (ADS)

    Li, Y.; Ryu, D.; Western, A. W.; Wang, Q.; Robertson, D.; Crow, W. T.


    Timely and reliable streamflow forecasting with acceptable accuracy is fundamental for flood response and risk management. However, streamflow forecasting models are subject to uncertainties from inputs, state variables, model parameters and structures. This has led to an ongoing development of methods for uncertainty quantification (e.g. generalized likelihood and Bayesian approaches) and methods for uncertainty reduction (e.g. sequential and variational data assimilation approaches). These two classes of methods are distinct yet related, e.g., the validity of data assimilation is essentially determined by the reliability of error specification. Error specification has been one of the most challenging areas in hydrologic data assimilation and there is a major opportunity for implementing uncertainty quantification approaches to inform both model and observation uncertainties. In this study, ensemble data assimilation methods are combined with the maximum a posteriori (MAP) error estimation approach to construct an integrated error estimation and data assimilation scheme for operational streamflow forecasting. We contrast the performance of two different data assimilation schemes: a lag-aware ensemble Kalman smoother (EnKS) and the conventional ensemble Kalman filter (EnKF). The schemes are implemented for a catchment upstream of Myrtleford in the Ovens river basin, Australia to assimilate real-time discharge observations into a conceptual catchment model, modèle du Génie Rural à 4 paramètres Horaire (GR4H). The performance of the integrated system is evaluated in both a synthetic forecasting scenario with observed precipitation and an operational forecasting scenario with Numerical Weather Prediction (NWP) forecast rainfall. The results show that the error parameters estimated by the MAP approach generates a reliable spread of streamflow prediction. Continuous state updating reduces uncertainty in initial states and thereby improves the forecasting accuracy

  19. Astronomía Gamma desde El Leoncito

    NASA Astrophysics Data System (ADS)

    Rovero, A. C.; Colombo, E.; Sahade, J.; Weekes, T. C.

    La astronomía gamma, en el extremo de energías detectadas hasta el presente, se encuentra en desarrollo en muchas partes del mundo y proporciona resultados sorprendentes a medida que la tecnología avanza en el desarrollo de nuevos detectores. La técnica Cherenkov Atmosférica es la utilizada para la detección, mediante telescopios en tierra, del efecto secundario causado por la radiación gamma de muy altas energías (E ≈ TeV). Por medio de telescopios o arreglos de detectores y utilizando la técnica mencionada, se han podido detectar algunas fuentes puntuales de mucha importancia astrofísica como la Nebulosa del Cangrejo y la galaxia de núcleo activo Markarian 421. El sistema instalado en San Juan, en cooperación con el grupo de Radiación Gamma del Observatorio Whipple, está constituído por tres colectores de 1.5m que registran pulsos de luz generados por las cascadas de partículas producidas por rayos cósmicos de todo tipo al entrar en la atmósfera terrestre. El sistema opera por barrido en ascención recta de la fuente observada que, para esta etapa del experimento, es el Centro Galáctico. Esta fuente extensa es conocida como emisor gamma de energías inferiores al TeV y ha sido observada anteriormente en este rango de energía desde el hemisferio norte pero con elevaciones bajas, situación no óptima para este tipo de técnica. Se presentan los primeros resultados del análisis de los datos obtenidos observando la región del Centro Galáctico, luego de dos años de observaciones, así como una descripción de la técnica Cherenkov Atmosférica y del equipo utilizado en la experiencia.

  20. Testing a Method of Detecting a Magnetic Field of Transiting Hot-Jupiter CoRot-1b

    NASA Astrophysics Data System (ADS)

    Biddle, Lauren I.; Turner, J.; Pearson, K.; Teske, J.


    In October of 2011 and December of 2012, exoplanet CoRot-1b was observed on the Steward Observatory 61” Kuiper Telescope using the Bessel-U filter to detect a possible magnetic field. In addition, the primary transit of CoRoT-1b was observed January 29, 2012 and February 2, 2012 using the medium resolution spectrograph on the 6.5 meter MMT Observatory. It is suggested by Vidotto et. al. (2011), that it is possible to detect a magnetic field of a transiting exoplanet in the near-UV photometric band by comparing asymmetry between the ingress and egress of the light curve. This effect is believed to be caused by a bow shock being formed in front of the planet as it transverses through the coronal plasma of its host star. CoRot-1b is a candidate for demonstrating this effect. We do not observe an early ingress in our near-UV broad-band light curves from the 61" Kuiper Telescope. We find an unexpected upper limit of 0.087-1.4 Gauss for the magnetic field strength of CoRoT-1b. This result is consistent with the near-UV observations by Turner et al. 2013 of another exoplanet predicted to show this effect, TrES-3b. It was suggested Vidotto et al 2011 and the finding of Turner et al. 2013 that an early near-UV might only happen at certain spectral resonance lines. Our observations from the MMT observatory hope to shed light on this possibly. Our spectral observations can constrain the composition of a possible bowshock and also investigate potential molecular features in the atmosphere of CoRoT-1b. To find the best fit to the light curves we used a modeling package called EXOMOP that uses the analytic equations of Mandel & Agol (2002) to generate a model transit, the Levenberg-Marquardt non-linear least squares minimization algorithm to find the best fit, the bootstrap Monte Carlo technique to calculate robust errors of the fitted parameters, and the residual permutation “rosary bead” method to access the importance of red noise. Several other parameters to confirm

  1. Evolution of Soot Particle Morphology and Mixing State in the Atmosphere

    NASA Astrophysics Data System (ADS)

    Mazzoleni, C.; China, S.; Sharma, N.; Gorkowski, K.; Dubey, M.; Aiken, A. C.; Zaveri, R. A.; Salvadori, N.; Chakrabarty, R. K.; Moosmuller, H.; Onasch, T. B.; Herndon, S.; Williams, L. R.; Liu, S.; Dzepina, K.; Helmig, D.; Hueber, J.; Fialho, P. J.; Mazzoleni, L. R.; kumar, S.; Dziobak, M.; Wright, K.


    Soot particles (aka black carbon) impact the environment and climate by affecting Earth's radiation balance, cloud microphysics, and atmospheric chemistry. The complex morphology and mixing state of soot particles influence their optical properties and therefore their radiative forcing, the particles' transport, lifecycle, and heterogeneous chemistry. How soot morphology and mixing state alter during transport from the source to remote areas is still not well understood. While aging, soot particles can change shape, oxidize and mix, and become coated by organic and inorganic materials. In this study, we investigate the morphological and mixing state evolution of single soot particles in different stages of their 'life' in the atmosphere. This analysis will include an overview of several samples collected in various locations and atmospheric conditions: 1) particles freshly emitted near freeway on-ramps in Southern Michigan (USA); 2) particles emitted in two biomass burning events in New Mexico (USA), one close to the sampling location and another hundreds of miles away; 3) particles in the urban atmosphere of Mexico City and in the uplifted boundary layer captured on the top of the Pico de Tres Padres Mountain (on the north edge of Mexico City); 4) particles collected in the Sacramento urban area and the Sierra Nevada foothills (CA, USA); 5) particles collected in Detling (UK), and mostly transported from London, and 6) long-range transported particles in the free troposphere and collected at the Pico Mountain Observatory, located near the top of the Pico Volcano in the Azores (Portugal). We analyzed a large number of individual particles using electron microscopy and X-ray spectroscopy followed by image analysis. The projected structural properties of soot particles were characterized using size (maximum length, maximum width, and area equivalent diameter) and shape descriptors (e.g., aspect ratio, roundness, and convexity). The particle mass-fractal dimensions

  2. Developpement de mesures non destructives, par ondes ultrasonores, d'epaisseurs de fronts de solidification dans les reacteurs metallurgiques

    NASA Astrophysics Data System (ADS)

    Floquet, Jimmy

    Dans les cuves d'electrolyse d'aluminium, le milieu de reaction tres corrosif attaque les parois de la cuve, ce qui diminue leur duree de vie et augmente les couts de production. Le talus, qui se forme sous l'effet des pertes de chaleur qui maintiennent un equilibre thermique dans la cuve, sert de protection naturelle a la cuve. Son epaisseur doit etre controlee pour maximiser cet effet. Advenant la resorption non voulue de ce talus, les degats generes peuvent s'evaluer a plusieurs centaines de milliers de dollars par cuve. Aussi, l'objectif est de developper une mesure ultrasonore de l'epaisseur du talus, car elle serait non intrusive et non destructive. La precision attendue est de l'ordre du centimetre pour des mesures d'epaisseurs comprenant 2 materiaux, allant de 5 a 20 cm. Cette precision est le facteur cle permettant aux industriels de controler l'epaisseur du talus de maniere efficace (maximiser la protection des parois tout en maximisant l'efficacite energetique du procede), par l'ajout d'un flux thermique. Cependant, l'efficacite d'une mesure ultrasonore dans cet environnement hostile reste a demontrer. Les travaux preliminaires ont permis de selectionner un transducteur ultrasonore a contact ayant la capacite a resister aux conditions de mesure (hautes temperatures, materiaux non caracterises...). Differentes mesures a froid (traite par analyse temps-frequence) ont permis d'evaluer la vitesse de propagation des ondes dans le materiau de la cuve en graphite et de la cryolite, demontrant la possibilite d'extraire l'information pertinente d'epaisseur du talus in fine. Fort de cette phase de caracterisation des materiaux sur la reponse acoustique des materiaux, les travaux a venir ont ete realises sur un modele reduit de la cuve. Le montage experimental, un four evoluant a 1050 °C, instrumente d'une multitude de capteurs thermique, permettra une comparaison de la mesure intrusive LVDT a celle du transducteur, dans des conditions proches de la mesure

  3. Écologie des soins de santé au Canada

    PubMed Central

    Stewart, Moira; Ryan, Bridget


    Résumé Objectif Présenter un profil populationnel pancanadien des besoins en soins de santé et de leur utilisation, facile d’accès et permettant des comparaisons entre les provinces et avec d’autres instances internationales. Conception Une comparaison des taux d’utilisation des soins de santé entre les provinces en utilisant des données d’enquêtes et des renseignements administratifs sur la santé. Contexte Les provinces du Canada. Principaux paramètres à l’étude Les taux canadiens et provinciaux de personnes en mauvaise santé (présence de problèmes chroniques) et d’utilisation des soins de santé (contacts avec des médecins de famille, avec d’autres médecins spécialistes, avec des infirmières et hospitalisations) sous forme de proportions mensuelles par 1000 habitants normalisées en fonction de l’âge et du genre. Résultats La proportion mensuelle par 1000 habitants de personnes souffrant d’au moins 1 problème chronique variait de 524 au Québec à 638 en Nouvelle-Écosse; les contacts avec un médecin de famille se situaient entre 158 au Québec et 295 en Colombie-Britannique; les contacts avec d’autres médecins spécialistes variaient entre 53 en Saskatchewan et 79 en Ontario; et le nombre de contacts avec des infirmières se situait entre 23 en Colombie-Britannique et 41 au Québec. Le nombre de séjours à l’hôpital variait entre 8 et 11 par 1000 habitants et les proportions étaient semblables d’une province à l’autre. Conclusion Il est essentiel de reconnaître les distinctions entre les provinces pour éclairer les politiques sur la santé dans l’ensemble du pays. Les différences persistaient lorsque les taux étaient normalisés en fonction de la composition démographique variable selon l’âge et le genre dans les provinces. Cet article présente une méthodologie simple à l’aide de données publiquement accessibles qui peut servir dans chaque province à examiner, à l’avenir, l

  4. 40Ar/39Ar constraints on the activity of the Temsamane extensional detachment (eastern Rif, Morocco)

    NASA Astrophysics Data System (ADS)

    Jabaloy Sánchez, A.; Booth-Rea, G.; Azdimousa, A.; Asebriy, L.; Vázquez-Vílchez, M.; Martínez-Martínez, J. M.; Gabites, J.


    The subducted North Maghrebian passive margin was exhumed by an upper crustal brittle-ductile extensional detachment and brittle low-angle normal faults in a continental subduction transform setting. The Temsamane detachment in the eastern Rif is defined by a ductile shear zone approximately 100 m thick with a low-angle ramp geometry that cuts down into the Temsamane fold-nappe stack. The shear zone shows southwestward kinematics and separates epizone metapelites of the Temsamane units below from the epizone to diagenetic rocks of the Tanger-Ketama-Aknoul units above. To the east, the detachment becomes brittle, branching into a listric-fan that cuts through 10-6 Ma sediments and volcanoclastics in the Tres Forcas cape. New 40Ar/39Ar radiometric ages on amphiboles and micas from the footwall of the Temsamane detachment indicate that the metamorphic peak was reached in the footwall (Temsamane units) at ca. 21 Ma, producing the amphibolite epidote facies in the Ras Afrou Unit. The cooling of the footwall rocks below the 325 °C occurred between the 16 and 13 Ma, while apatite fission track ages indicate that the cooling below the 120 °C occurred at ca. 11 Ma. The 40Ar/39Ar radiometric ages on amphiboles and micas of the metamorphic klippes over the Temsamene units (Ait-Amrâne massif) indicates that the Jurassic marbles of the Tanger-Ketama Unit reached their metamorphic peak at ca. 80 Ma, in agreement with previously published K/Ar ages in micas. The rocks of the Tanger-Ketama Unit cooled below the 120 °C between 17.0 ± 2.4 Ma and 13.9 ± 1.8 Ma. We interpret the increase of cooling rates of the footwall rocks between 15-13 Ma and 11 Ma as due to the activity of the Temsamane detachment fault. Thus, both the North Maghrebian and the South Iberian subducted passive margins were exhumed in the Betic and Rif branches of the Gibraltar arc by SW-directed brittle-ductile detachments during the Late Miocene in an oblique collisional setting.

  5. Cancer du sein au Cameroun, profil histo-épidémiologique: à propos de 3044 cas

    PubMed Central

    Engbang, Jean Paul Ndamba; Essome, Henri; Koh, Valère Mve; Simo, Godefroy; Essam, Jean Daniel Sime; Mouelle, Albert Sone; Essame, Jean Louis Oyono


    Décrire les caractéristiques épidémiologiques et histo-pathologiques des tumeurs malignes du sein au Cameroun. Il s'agissait d'une étude rétrospective descriptive portant sur les tumeurs malignes du sein, colligées, dans les registres des différents laboratoires d'Anatomie Pathologique publiques et privés repartis dans cinq régions (centre, littoral, Ouest, Nord-ouest, Sud-ouest), pendant une période de 10 ans (2004-2013). Les paramètres étudiés étaient la fréquence, l’âge, le sexe, la localisation, le type et le grade histologique, et les récepteurs hormonaux. Un total de 3044 cas de cancers du sein a été recensé, soit une fréquence annuelle de 304,4 cas en moyenne. Le sexe féminin était le plus représenté avec 2971 cas (97,60%) et les hommes avec 73 cas (2,40%), soit un sexe ratio (H/F) de 0,02. L’âge moyen des patients était de 46±15,87 ans, avec des extrêmes de 13 et 95 ans. Selon la localisation, le sein gauche était atteint dans 1244 cas (52%) et le sein droit dans 1115 cas (47%). Au plan histologique, on retrouvait essentiellement des carcinomes avec 96,50% des cas, des sarcomes 1,39%, des lymphomes 1,07% et la maladie de Paget du mamelon, 1,03%. Les tumeurs épithéliales étaient infiltrantes dans 2049 cas (84,46%), avec une prédominance du carcinome canalaire infiltrant (1870 cas) et non infiltrantes dans 377 cas (15,54%). Le grade histo-pronostic de SBR avait révélé une prédominance du grade II dans 66% des cas. Les cancers du sein restent une pathologie fréquente au Cameroun et atteignent principalement la population féminine en âge de procréer. Ils sont caractérisés par la prédominance du carcinome canalaire infiltrant. PMID:26523182

  6. Analyse de la prise en charge du nouveau-né dans le cadre de la stratégie nationale de subvention des accouchements et des soins obstétricaux et néonatals d'urgence au Centre Hospitalier Universitaire Pédiatrique Charles de Gaulle, Ouagadougou (Burkina Faso)

    PubMed Central

    Ouédraogo, Solange Odile Yugbaré; Yougbaré, Nestor; Kouéta, Fla; Dao; Ouédraogo, Moussa; Lougué, Claudine; Ludovic, Kam; Traoré, Ramata Ouédraogo; Yé, Diarra


    Introduction Il s'agit d'analyser la prise en charge du nouveau-né dans le cadre de la stratégie na-tionale de subvention des accouchements et des soins obstétricaux et néonatals d'urgence mis en place par le gouvernement du Burkina Faso en 2006. Méthodes Nous avons menée une étude à visée descriptive et analytique comportant un volet ré-trospectif du 01 janvier 2006 au 31 décembre 2010 portant sur les paramètres épidémiologiques, cliniques des nouveau-nés hospitalisés et un volet prospectif du 3 octobre 2011 au 29 février 2012 par une entrevue des accompagnateurs des nouveau-nés et des prestataires des services de santé. Résultats Les hospitalisations ont augmenté de 43,65% entre 2006 à 2010 Le taux de mortalité néo-natale hospitalière qui était de 11,04% a connu une réduction moyenne annuelle de 3,95%. L'entrevue a porté sur 110 accompagnateurs et 76 prestataires. La majorité des prestataires (97,44%) et des ac-compagnateurs (88,18%) étaient informés de la stratégie mais n'avait pas une connaissance exacte de sa définition. Les prestataires (94,74%) ont signalé des ruptures de médicaments, consommables médicaux et des pannes d’ appareils de laboratoire et d'imagerie. Parmi les accompagnateurs (89%) disaient être satisfaits des services offerts et (72,89%) trouvaient les coûts abordables mais évoquaient les difficultés du transport. Conclusion: La subvention a amélioré la prise en charge du nou-veau-né mais son optimisation nécessiterait une meilleur information et implication de tous les acteurs. Conclusion La subvention a amélioré la prise en charge du nouveau-né mais son optimisation nécessiterait une meilleur information et implication de tous les acteurs. PMID:26161166

  7. Les accidents de scooter chez l'enfant au CHU Aristide Le Dantec de Dakar: à propos de 74 cas

    PubMed Central

    Mohamed, Azhar Salim; Ngom, Gabriel; Sow, Mamadou; Mbaye, Papa Alassane; Camara, Souleymane; Seck, Ndeye Fatou; Ndour, Oumar


    Introduction Les accidents de scooter sont de plus en plus fréquents à Dakar. Le but de ce travail est de rapporter les aspects épidémiologiques et lésionnels des ces accidents chez l'enfant à Dakar. Méthodes Une étude rétrospective et descriptive a été menée dans le Service de Chirurgie Pédiatrique du CHU Aristide Le Dantec de Dakar entre le 1er janvier 2009 et le 31 décembre 2011. Nous avons étudié divers paramètres dont la fréquence, les aspects sociodémographiques et lésionnels. Résultats Les accidents de scooter représentaient 12% des accidents de la voie publique. Ils étaient fréquents entre 12 heures et 14 heures (27%) et entre 18 heures et 20 heures (28,4%). Ils pouvaient survenir tous les jours et étaient fréquents pendant les mois d'avril (17,6%) et de juin (13,5%). Ils survenaient essentiellement dans la périphérie de Dakar (78%). La tranche de 3 à 8 ans (60,8%) était la plus touchée. Le sexe masculin était prédominant (sexe ratio de 1,5). Les piétons étaient les plus vulnérables (93,2%). La chute était le mécanisme dominant (98,7%). Les lésions touchaient surtout le membre inférieur (51,1%) et étaient constituées essentiellement de fracture. Conclusion La fréquence des accidents de scooter chez l'enfant est liée à l'urbanisation galopante et à l'accroissement du parc automobile dans une presqu’île. Les victimes sont essentiellement des piétons et présentent le plus souvent des fractures. PMID:27200137

  8. [In Process Citation].


    Fariña López, E; Estévez-Guerra, G J; Núñez González, E; Calvo Francés, F; Penelo, E


    Fundamento. Adaptar y validar en español el cuestionario Perception of Restraint Use Questionnaire, que mide la importancia que dan los profesionales al uso de restricciones físicas en personas mayores.Método. Estudio multicéntrico, descriptivo y transversal. Tras un proceso de traducción-retrotraducción, se obtuvo una versión en español del cuestionario original. La validación se llevó a cabo entre una muestra de 830 profesionales seleccionados en veinte centros de tres comunidades autónomas españolas. Se analizó la viabilidad, la fiabilidad mediante la consistencia interna y la estabilidad temporal (test-retest), así como la validez de contenido (panel de expertos e índice de validez) y de constructo (análisis factorial).Resultados. De los 17 ítems del cuestionario, 15 pudieron traducirse de manera literal; en dos hubo que realizar modificaciones menores. Un estudio piloto confirmó la adecuada viabilidad del cuestionario. El alfa de Cronbach fue de 0,92 y la fiabilidad test-retest (CCI) de 0,908 (IC del 95%: 0,880-0,933). El índice de validez de contenido fue de 0,89. El análisis factorial exploratorio identificó dos dimensiones que explicaban el 63% de la varianza, presentando una fiabilidad de 0,90 y 0,93 respectivamente. Este fue sometido a un análisis confirmatorio, mostrando los indicadores un adecuado ajuste.Conclusiones. Se ha obtenido un instrumento en español con unas buenas características psicométricas y adaptado al contexto cultural de este país. Una herramienta útil para evaluar en qué situaciones se considera más necesario el uso de las restricciones físicas, lo que podría ayudar a diseñar actividades de formación encaminadas a racionalizar su aplicación.Palabras clave. Cuestionarios. Percepción. Restricción física. Anciano. Estudios de validación. PMID:27125606

  9. L'hemorragie grave du peripartum en milieu de reanimation dans un centre universitaire tunisien de niveau 3: épidémiologie et facteurs de risque de mortalité maternelle

    PubMed Central

    Nasr, Laidi Ben; Marzouk, Sofiene Ben; Kehila, Mehdi; Jabri, Hamed; Thamleoui, Saber; Maghrebi, Hayen


    L'hémorragie grave du péripartum demeure une des causes principales de mortalité maternelle. L'objectif de notre étude était de décrire le profil épidémiologique des patientes qui ont été prises en charge en milieu de réanimation suite à une hémorragie grave du péripartum et de rechercher d’éventuels facteurs de risque de mortalité. Notre étude est rétrospective descriptive et analytique. Nous avons inclus tous les cas d'hémorragie du péripartum ayant séjourné en unité de réanimation obstétricale du centre de maternité et de néonatologie de Tunis (CMNT) au cours de la période allant de janvier 2010 à Décembre 2013. Nous avons recueilli les paramètres démographiques, obstétricaux, ceux relatifs à la prise en charge chirurgicale et réanimatoire, les scores de gravité SAPS obstétrical et APACHEII, ainsi que la morbi-mortalité. Au total nous avons colligé 322 cas sur quatre ans. La répartition annuelle des patientes ainsi que les caractéristiques démographiques et obstétricales étaient comparables dans leur globalité sur les quatre années. Les pratiques thérapeutiques étaient également comparables. Le taux global de mortalité par hémorragie dans notre unité était à 4,7%, avec un taux annuel de mortalité stable. L'analyse des facteurs de risque de mortalité par hémorragie en milieu de réanimation a montré une association statistiquement significative entre la survenue du décès et les facteurs suivants: recours aux catécholamines, survenue de sepsis, œdème pulmonaire aigu, coagulation intravasculaire disséminée, insuffisance rénale aigue avec recours à l'hémodialyse, SDRA ou TRALI, atteinte neurologique grave, défaillance multiviscérale et arrêt cardiaque récupéré. PMID:26587127

  10. The Role of Slope in the Fill and Spill Process of Linked Submarine Minibasins. Model Validation and Numerical Runs at Laboratory Scale.

    NASA Astrophysics Data System (ADS)

    Bastianon, E.; Viparelli, E.; Cantelli, A.; Imran, J.


    Primarily motivated by applications to hydrocarbon exploration, submarine minibasins have been widely studied during recent decades to understand the physical phenomenon that characterizes their fill process. Minibasins were identified in seismic records in the Gulf of Mexico, Angola, Trinidad and Tobago, Ireland, Nigeria and also in outcrops (e.g., Tres Pasos Formation, southern Chile). The filling of minibasis is generally described as the 'fill-and-spill' process, i.e. turbidity currents enter, are reflected on the minibasin flanks, pond and deposit suspended sediment. As the minibasin fills the turbidity current spills on the lowermost zone of the basin flank -spill point - and start filling the next basin downdip. Different versions of this simplified model were used to interpret field and laboratory data but it is still unclear how the minibasin size compared to the magnitude of the turbidity currents, the position of each basin in the system, and the slope of the minibasin system affects the characteristics of the deposit (e.g., geometry, grain size). Here, we conduct a numerical study to investigate how the 'fill-and-spill' model changes with increase in slopes of the minibasin system. First, we validate our numerical results against laboratory experiment performed on two linked minibasins located on a horizontal platform by comparing measured and simulated deposit geometries, suspended sediment concentration profiles and grain sizes. We then perform numerical simulations by increasing the minibasin system slope: deposit and flow characteristics are compared with the case of horizontal platform to identify how the depositional processes change. For the numerical study we used a three-dimensional numerical model of turbidity currents that solves the Reynolds-averaged Navier-Stokes equations for dilute suspensions. Turbulence is modeled by a buoyancy-modified k-ɛ closure. The numerical model has a deforming bottom boundary, to model the changes in the bed

  11. Régimes transitoires des photopiles: durée de vie des porteurs et vitesse de recombinaison

    NASA Astrophysics Data System (ADS)

    Mialhe, P.; Sissoko, G.; Pelanchon, F.; Salagnon, J. M.


    A detailed analysis of a new experimental practice of the open circuit voltage decay method and of the short circuit current decay method for determining the base minority carrier lifetime and the back surface recombination velocity in solar cells has been performed. The measurements have been made by using the monitoring of a single transient of an operating cell at any level of injection; no power supply is required and a constant illumination level imposes the carrier injection level for normal operating conditions. The theory considers the complete continuity equation including generation and recombination rates of carriers. Precision and sensitivity of the method have been compared. The necessity of a precise knowledge of cell structural parameters have been shown to impose a limitation of the practical use of short-circuit current decay method, to low illumination levels. Cette étude développe une nouvelle méthode expérimentale pour mesurer la durée de vie des porteurs minoritaires dans la base d'une photopile ainsi que la vitesse de recombinaison à son interface arrière. Au cours de la mesure, la photopile est maintenue sous un éclairement constant qui impose le niveau d'injection souhaité. Cette méthode permet d'éliminer les effets néfastes à la mesure, provenant des impédances, propres au composant. Un régime transitoire, provoqué par une variation d'impédance, est étudié au cours de fonctionnements dans des conditions de court-circuit ou de circuit ouvert. L'étude théorique souligne la prise en compte de l'ensemble des phénomènes de recombinaison. L'obtention d'une bonne précision des mesures nécessite, avec une expérimentation rigoureuse, une connaissance précise des paramètres de structure de la photopile étudié. Pour la mesure de la durée de vie des porteurs, la plus grande sensibilité de la méthode en régime transitoire de court-circuit, comparée au régime de circuit ouvert, impose des mesures sous faible

  12. Etude theorique du jet de plasma supersonique a courant continu

    NASA Astrophysics Data System (ADS)

    Jodoin, Bertrand

    La déposition par plasma supersonique à courant continu permet d'obtenir une qualité de dépôt supérieure au jet subsonique. Un modèle numérique a été développé dans le but de mieux comprendre les mécanismes de transfert à l'intérieur de la tuyère et d'estimer l'influence des paramètres d'opération de la torche sur le jet à la sortie de la tuyère. Les équations d'Euler, auxquelles sont ajoutées l'effet Joule, la conduction et les pertes par rayonnement sont résolues à l'aide de la méthode de Jameson. Un schéma centré est utilisé pour résoudre les champs électriques. La sous-couche cathodique en déséquilibre thermodynamique est modélisée à l'aide du modèle simple de Morrow et Lowke. Quelques détails sur les aspects numériques facilitant la convergence du système sont donnés. Le modèle est validé pour un écoulement compressible classique et pour un jet de plasma supersonique à l'aide de résultats de la littérature. Les champs à l'intérieur de la tuyère sont analysés afin de déterminer l'influence de l'hydrogène, de l'intensité du courant et de la géométrie de la tuyère sur les caractéristiques de l'écoulement.

  13. Interpretation des donnees de flux de chaleur et de gravite dans le bouclier Canadien

    NASA Astrophysics Data System (ADS)

    Cheng, Li Zhen


    Le champ geothermique du Bouclier Canadien est caracterise par un flux moyen de 41 mW·m-2, qui suggere une production de chaleur moyenne dans la croute comprise entre 0.7 et 0.8 muW·m-3. Le flux de chaleur relativement faible favorise la stabilite du bouclier et lui a permis de resister a la deformation tectonique. Les variations du flux de chaleur a la surface sont dominees par la composition de la croute. Un flux eleve implique generalement une composition felsique et il est d'autant plus faible que la croute devient plus mafique. La production de chaleur en surface n'est pas representative de la production moyenne de la croute. Le flux de chaleur dans le Boucher Canadien ne depend donc pas de la production de chaleur en surface, mais depend de la composition principale de la croute. L'interpretation combinee des donnees geophysiques nous permet de determiner les variations de composition d'echelle crustale a partir desquelles il est possible d'etablir la structure de la croute. L'etude detaillee de l'Orogene de Trans-Hudson et de la Sous-province d'Abitibi a montre que le flux de chaleur, la gravite et la sismique lorsqu'elles sont combinees fournissent des contraintes efficaces pour determiner l'architecture crustale. En general, la croute est trop resistante pour se deformer par fluage, excepte tres localement. Le mode de deformation de la lithosphere continentale depend de la composition et du gradient geothermique. Nous montrons que la lithosphere du Bouclier Canadien demeure principalement fragile jusqu'a une profondeur de plus de 150 km. Une deformation ductile pourrait cependant etre possible localement a la base de la, croute, comme dans la ceinture de Thompson par exemple. Si l'on admet que la lithosphere peut resister a des contraintes allant jusqu'a 20 MPa (taux de deformation 3˙ < 10-15 s-1), l'epaisseur de la lithosphere est de l'ordre de 300 km pour la ceinture de Thompson et est superieure a 300 km pour la sous-province d'Abitibi. La resistance

  14. Modèle simplifié du comportement hygrothermique d'un chai

    NASA Astrophysics Data System (ADS)

    Battaglia, J.-L.; Jomaa, W.; Gounot, J.


    Coupling between heat and moisture is often important for some kind of buildings. It is the case for wine and spirit storehouse for the breeding of wine in cask. Without strong assumptions, the knowledge model is too complex is regard to the formulation and the resolution of the equations. In this work, we develop a simplified model based on a preliminary study of the concerned building. For the resolution, an algorithm, adapted to our configuration, is proposed. Assumptions are proved with respect to experimental measurements of temperature and relative moisture, for two periods of the year. A sensitivity analysis of the model to some parameters is carried out. Finally, an implementation of the model, to estimate the quantity of wine lost by evaporation during one year, is presented. Le couplage entre chaleur et humidité est souvent important dans certains types de bâtiment et ne permet pas de traiter les deux transferts indépendamment l'un de l'autre. C'est le cas des chais où se déroule l'élevage du vin en barriques. Sans hypothèses fortes, la prise en compte du couplage hygrothermique donne alors lieu à une modélisation complexe tant au point de vue de sa formulation que la résolution des équations. Dans ce travail, nous développons un modèle simplifié, basé sur une étude préliminaire du bâtiment considéré. Un algorithme de résolution, adapté à la configuration étudiée, est proposé. Les hypothèses de modélisation sont validées à partir de relevés expérimentaux de température et d'humidité, réalisés sur deux périodes de l'année. Une étude de sensibilité du modèle à certains paramètres est menée. Enfin, une application du modèle, pour l'évaluation de la quantité de vin évaporée sur une année, est présentée.

  15. [In Process Citation].


    Giner, Manel; Culebras, Jesús M; Meguid, Michael M


    En agosto de 1976, un joven llamado LeRoy cayó desde una cornisa fracturándose el fémur. Se sospechó una hemorragia interna importante. Durante una laparotomía se comprobó que todos los órganos internos estaban intactos y los cirujanos ortopédicos arreglaron la fractura. Treintadías después, LeRoy murió. Había comido poco; diariamente, tan solo había recibido tres litros de la glucosa, el equivalente a 510 calorías, por vía intravenosa. La glucosa fue insuficiente para satisfacer sus necesidades nutricionales, perdiendo más del 20% de su peso corporaldurante su estancia en el hospital. La causa de la muerte se debió a "desnutrición médicamente inducida". Mientras tanto, un artículo científico documentó que la prevalencia de desnutrición en los hospitales de Boston era del 44% y que la desnutrición en sí era un predictor de altas tasas de complicaciones y muerte.Como resultado, los médicos sensibilizados formaron una sociedad que creó programas de formación y alentó la formación de equipos de nutrición en los hospitales. La industria comercializó fórmulas de nutrición y catéteres. Las complicaciones en enfermos hospitalizados cayeron en picado, mientras que las tasas de supervivencia aumentaron. California aprobó una legislación para regular el soporte nutricional. Aunque la industria de la atención sanitaria reconoce la importancia de la nutrición en los cuidados al paciente, el Congreso no proporcionó apoyo fiscal para los equipos de nutrición. Como resultado, los hospitales disolvieron sus equipos de nutrición de reciente creación. La educación y las habilidades en nutrición disminuyeron, y las complicaciones hospitalarias y las tasas de mortalidad aumentaron de nuevo. PMID:27238814

  16. Urétéroscopie souple laser dans le traitement des calculs du haut appareil urinaire: résultats a propos de 166 interventions

    PubMed Central

    Padja, Essodina; Ibarra, Venceslas Amboulou; Lmezguidi, Khalid; Janane, Abdellatif; Ghadouane, Mohamed; Ameur, Ahmed; Abbar, Mohamed


    L’évolution de la technique opératoire fait de l'urétéroscopie souple –Laser (URSS-L) une méthode efficace et sure dans le traitement des calculs du haut appareil urinaire (HAU). Elle apparait comme une option salvatrice après échec des autres options thérapeutiques. Son coût limite son accessibilité et restreint ses indications dans certains contextes socio-économiques. Nous rapportons l'expérience du service sur les indications, les résultats et les complications de l'URSS-L dans le traitement des calculs du HAU. C'est une étude rétrospective sur 4ans concernant 130 patients ayant des calculs du HAU. Un scanner permettait de déterminer les caractéristiques des calculs avant l'intervention et de faire un contrôle après afin de juger de l'efficacité du traitement. Une analyse statistique évaluait l'influence des différents paramètres des calculs sur l'efficacité de l'intervention. Un suivi était réalisé afin de détecter les complications. L’âge moyen des patients était de 52 ± 17ans. 166 interventions étaient faites en 3 séries. Les indications étaient de première intention dans 50.32% suivi des échecs de LEC. La durée moyenne de l'intervention était de 73min ± 25min pour une taille moyenne des calculs de 13.78mm ± 5mm. Le taux de succès global était de 78.91% (78.71%; 80%; 100%) respectivement après la 1ère, la 2ème et la 3ème série. Aucun paramètre n'influençait significativement le taux de succès. 14.45% de complications était enregistré. L'URSS-L est une méthode aussi efficace que sure dans le traitement des calculs du HAU nous motivant malgré son coût, à élargir ses indications en première intention lorsque les calculs répondent aux critères de choix. PMID:26600912

  17. Les inconvénients de perdre du poids

    PubMed Central

    Bosomworth, N. John


    Résumé Objectif Explorer les raisons pour lesquelles la perte de poids à long terme échoue la plupart du temps et évaluer les conséquences de diverses trajectoires pondérales, y compris la stabilité, la perte et le gain. Source des données Les études qui évaluent les paramètres pondéraux dans la population sont en majorité observationnelles. Des données probantes de niveau I ont été publiées pour évaluer l’influence des interventions relatives au poids sur la mortalité et la qualité de vie. Message principal Seulement un petit pourcentage des personnes qui désirent perdre du poids réussissent à le faire de manière durable. La mortalité est la plus faible chez les personnes se situant dans la catégorie de poids élevé-normal et surpoids. La trajectoire pondérale la plus sécuritaire est la stabilité du poids avec une optimisation de la condition physique et métabolique. Il est démontré que la mortalité est plus faible chez les personnes ayant des comorbidités reliées à l’obésité si elles perdent du poids. Il est aussi établi que la qualité de vie sur le plan de la santé est meilleure chez les personnes obèses qui perdent du poids. Par contre, la perte de poids chez une personne obèse autrement en santé est associée à une mortalité accrue. Conclusion La perte de poids est recommandable seulement chez les personnes qui ont des comorbidités reliées à l’obésité. Les personnes obèses en santé qui veulent perdre du poids devraient être informées qu’il peut y avoir des risques à le faire. Une stratégie qui se traduit par un indice de masse corporelle stable avec une condition physique et métabolique optimisée, peu importe le poids, est l’option d’intervention la plus sécuritaire en ce qui concerne le poids.

  18. Modelling of the steady state thermal behaviour of a permanent magnet direct current motor with commutator. 3D finite elements study

    NASA Astrophysics Data System (ADS)

    Bernard, R.; Glises, R.; Chamagne, D.; Cuchet, D.; Kauffmann, J. M.


    The aim of this work concerns the development and the validation of a thermal steady state model applied to a permanent magnet direct current motor with commutator. The rated power of the machine is 120 W. Design has been realized thanks to the thermal modulus of the computation software with the finite element method Flux3D. It is shown in this work how it is possible to use only the heat equation to simulate the thermal behaviour of the motor. It implies calculating of new fluid conductivities (considering also all thermal modes) by comparison of calculated and experimental temperatures. To realize these 3D modelizations, it is necessary to know and to locate all the losses of the motor which are considered as thermal sources. The experimental temperatures are given by 40 chromel-alumel thermocouples of 100 μm diameter located in the rotor and the stator of the machine. Numerical computations use Dirichlet boundary layer conditions given by an IR camera. Ce travail concerne le développement et la validation d'un modèle de simulation du comportement thermique tridimensionnel en régime permanent d'un moteur électrique de 120 watt à courant continu, à aimants permanents et à collecteur. Le logiciel est développé à partir du code de calculs par éléments finis Flux3D. L'équation de la chaleur modélise l'ensemble des transferts thermiques du moteur. Cela nécessite de recaler certains paramètres fluides par comparaison des températures simulées et expérimentales. Une séparation détaillée des différentes pertes est nécessaire pour obtenir une bonne précision finale. Un banc d'essais thermiques permet d'obtenir à l'aide de 40 thermocouples (chromel-alumel de 100 μm de diamètre) les températures au stator et au rotor. Une caméra thermographique infrarouge donne les conditions aux limites de Dirichlet nécessaires à la modélisation.

  19. Priming the Solar Neighborhood M dwarfs for Future Planet Searches

    NASA Astrophysics Data System (ADS)

    Dittmann, Jason


    The nearby low-mass stars are the best candidate hosts for searching for transiting exoplanets to enable atmospheric characterization. Unfortunately, our understanding of exoplanets is most often limited by our ability to characterize the host star. My thesis has focused on this stellar characterization problem. MEarth consists of 2 arrays of 8 telescopes each, one located at Mt. Hopkins, Arizona, and the other at Cerro Tololo, Chile. First, I used data from the Northern array to measure the trigonometric parallax of 1500 northern M dwarfs with a precision of 3 mas. With these distances we better characterized the MEarth M dwarfs and selected a volume-limited sample from which to search for planets. Second, I calibrated the MEarth photometric system using observations of Landolt standard fields. We measured the red-optical MEarth magnitude for 1800 M dwarfs with 1.5% precision. Combined with trigonometric parallaxes and spectroscopic metallicity estimates, I created a color-magnitude-metallicity relation for the mid-to-late M dwarfs capable of reproducing spectral metallicities with 0.1 dex precision. With these metallicities, we plan to measure any potential planet-metallicity correlation at the low-mass end of the stellar sequence once future missions uncover the planets orbiting these stars. Third, I present MEarth-South's discovery of a low mass eclipsing binary system. The system has an orbital period of 4.7 days, possesses zero eccentricity but is non-synchronously rotating. We obtained high precision radial velocity measurements from the TRES spectrograph, allowing us to measure the mass of each component with 1% precision. Both components are slightly inflated compared to the most recent stellar models, in keeping with previous precise mass-radius determinations for low mass stars. Fourth, I am currently gathering sloan photometry for M dwarfs to calibrate a color-color metallicity relation in the sloan bandpass. My thesis has focused on characterizing the

  20. [In Process Citation].


    Sánchez-Ramírez, Carmen A; Larrosa-Haro, Alfredo; M Vásquez Garibay, Edgar; Rodríguez-Anguiano, Ana K; Cámara-López, María E


    Introducción: la ingestión de cáusticos (IC) en niños y adolescentes puede ocasionar esofagitis erosiva, estenosis esofágica y disfagia, entidades que pueden alterar el proceso de alimentación y originar desnutrición y retraso en el crecimiento.Objetivos: evaluar el estado nutricio de niños con IC y su asociación con disfagia y estenosis esofágica.Métodos: estudio transversal analítico en el que se incluyó a 62 niños atendidos en un hospital pediátrico de referencia que sufrieron IC. Lasvariables independientes fueron la presencia/ausencia de disfagia y/o estenosis esofágica; las dependientes fueron el crecimiento y el estado nutricio evaluados mediante antropometría. Análisis estadístico: c2, OR, IC 95%, kappa y t de Student.Resultados: la edad promedio fue 39,7 meses, el 39,7% eran niñas. Cuarenta y dos (77,8%) presentaron esofagitis erosiva (II-b, III-a, and III-b) en la endoscopia. En 24 (38,7%) ocurrió disfagia y en 40 (64,5%) estenosis esofágica. El puntaje z de la talla para la edad fue <-2 DE en cinco niños (8,1%) y el puntaje z del IMC < -2 DE en tres (4,8%). En 24.2% la z-IMC fue > +1 DE. El puntaje z de los indicadores del brazo relacionados a reservas grasa y masa muscular tanto en el grupo de estenosis como de disfagia se localizó en el lado negativo de la curva y ambos fueron significativamente menores a los del grupo sin disfagia o estenosis.Conclusiones: la proporción de esofagitis erosiva, estenosis o disfagia fue elevada. En los niños con disfagia o estenosis esofágica se identificaron reservas de grasa y masa muscular menores a las de los niños sin estas complicaciones. PMID:27019238

  1. La dialyse péritonéale chez les patients de moins de vingt ans: expérience d'un centre hospitalier universitaire marocain

    PubMed Central

    Haddiya, Intissar; Rhou, Hakima; Ezaitouni, Fatima; Ouzeddoun, Naima; Bayahia, Rabia; Benamar, Loubna


    Introduction La dialyse péritonéale (DP) est une méthode d'épuration extra-rénale qui offre plusieurs avantages chez l'enfant et l'adolescent. Le but de cette étude est de rapporter notre expérience de DP chez des patients jeunes âgés de moins de vingt ans, et soulever l'intérêt et les avantages de cette technique chez cette catégorie de patients. Méthodes Il s'agit d'une étude rétrospective incluant tous les dialysés péritonéaux âgés de moins de vingt ans au début du traitement par DP. Les paramètres de DP ainsi que les données cliniques et biologiques ont été recueillit et analysés. Résultats Parmi 41 dialysés péritonéaux dans notre centre, huit sont des enfants et adolescents. L'âge moyen de nos patients est 16,1±2,6. Le sexe ratio M/F est égal à 1,6. 37,5% de nos patients ont une activité professionnelle et 62,5% ont une activité scolaire. Ils ont tous gardé leur activité toute la durée du traitement par DP. A l'initiation de la DP, 62,5% étaient hypertendus alors qu'actuellement 25% seulement sont hypertendus et aucun patient ne présente de signes cliniques de surcharge. Le maintien de la fonction rénale et résiduelle (FRR) et une amélioration de l'anémie a été noté chez nos patients. Conclusion Notre expérience de DP chez l'enfant et l'adolescent est globalement satisfaisante. La DP a procuré plusieurs avantages dont le maintien d'une FRR, l'équilibre hydro-électrolytique, ainsi qu'une vie sociale éducative pour l'enfant et un maximum d'indépendance chez l'adolescent. Cette technique doit donc être encouragée surtout chez cette catégorie de patients. PMID:22937185

  2. Fluorescence of nitrobenzoxadiazole (NBD)-labeled lipids in model membranes is connected not to lipid mobility but to probe location.


    Amaro, Mariana; Filipe, Hugo A L; Prates Ramalho, J P; Hof, Martin; Loura, Luís M S


    Nitrobenzoxadiazole (NBD)-labeled lipids are popular fluorescent membrane probes. However, the understanding of important aspects of the photophysics of NBD remains incomplete, including the observed shift in the emission spectrum of NBD-lipids to longer wavelengths following excitation at the red edge of the absorption spectrum (red-edge excitation shift or REES). REES of NBD-lipids in membrane environments has been previously interpreted as reflecting restricted mobility of solvent surrounding the fluorophore. However, this requires a large change in the dipole moment (Δμ) of NBD upon excitation. Previous calculations of the value of Δμ of NBD in the literature have been carried out using outdated semi-empirical methods, leading to conflicting values. Using up-to-date density functional theory methods, we recalculated the value of Δμ and verified that it is rather small (∼2 D). Fluorescence measurements confirmed that the value of REES is ∼16 nm for 1,2-dioleoyl-sn-glycero-3-phospho-l-serine-N-(NBD) (NBD-PS) in dioleoylphosphatidylcholine vesicles. However, the observed shift is independent of both the temperature and the presence of cholesterol and is therefore insensitive to the mobility and hydration of the membrane. Moreover, red-edge excitation leads to an increased contribution of the decay component with a shorter lifetime, whereas time-resolved emission spectra of NBD-PS displayed an atypical blue shift following excitation. This excludes restrictions to solvent relaxation as the cause of the measured REES and TRES of NBD, pointing instead to the heterogeneous transverse location of probes as the origin of these effects. The latter hypothesis was confirmed by molecular dynamics simulations, from which the calculated heterogeneity of the hydration and location of NBD correlated with the measured fluorescence lifetimes/REES. Globally, our combination of theoretical and experiment-based techniques has led to a considerably improved understanding of

  3. [Critical flicker fusion frequency in psychopathology and psychopharmacology. Review of the literature].


    Bobon, D P; Lecoq, A; von Frenckell, R; Mormont, I; Lavergne, G; Lottin, T


    , depression, motivation etc.). The authors summarize the prerequisite for CFF to measure vigilance or aging in psychopharmacological research. The present Monograph is dedicated to the authors' 'Maîtres', who recently became Emeritus Professors, namely the ophthalmologist Roger Weekers, the pioneer of the clinical application of CFF in Belgium, and the psychiatrist Jean Bobon, who pioneered clinical psychopharmacology in Belgium. PMID:6751024

  4. Analyse des transferts de chaleur et de masse transitoires dans un arena a l'aide de la methode zonale

    NASA Astrophysics Data System (ADS)

    Daoud, Ahmed

    Cette these presente les resultats d'une etude sur le mouvement de l'air et les transferts thermiques et massiques dans les arenas en regime transitoire et en 3D. Pour la partie aeraulique, il a ete question de developper un modele base sur la methode zonale qui permet de calculer les debits de l'air (dus a la ventilation et aux gradients de temperature) et de l'humidite entre les differentes zones du batiment et de determiner l'age de l'air dans chacune des zones. Pour la partie thermique, un modele de calcul du rayonnement entre les surfaces interieures du batiment qui a ete couple a TRNSYS afin de calculer sur une base annuelle les charges de chauffage et de refrigeration; ces dernieres tiennent compte des transferts radiatif et convectif, de la chaleur latente due a la condensation de l'humidite sur la glace et du surfacage. Le document presente est constitue de 7 chapitres qui peuvent etre resumes comme suit: Les chapitres 1, 2 et 3 sont consacres respectivement: a l'introduction generale, a la revue bibliographique et a la description du batiment modelise. Le chapitre 4 decrit l'approche developpee et la contribution importante qui y est apportee. Il presente l'utilisation de la methode zonale comme une alternative pratique aux methodes CFD car elle permet de realiser des simulations dynamiques sur une annee avec des temps de simulation tres courts et une precision acceptable. Il s'agit d'une approche intermediaire entre les modeles CFD et les modeles a un noeud d'air (considerant la temperature homogene dans un local). Le chapitre 5 est consacre a la methode de resolution numerique. L'outil de simulation a ete developpe en utilisant l'interface du logiciel TRNSYS: Le type 56 de ce logiciel a ete adopte comme modele energetique tandis que les autres modeles ont ete developpes et programmes en utilisant le logiciel MATLAB. Le chapitre 6 presente les resultats de simulation pour un arena sans faux plafond et avec un faux plafond et les resultats de mesures

  5. Effets des electrons secondaires sur l'ADN

    NASA Astrophysics Data System (ADS)

    Boudaiffa, Badia

    Les interactions des electrons de basse energie (EBE) representent un element important en sciences des radiations, particulierement, les sequences se produisant immediatement apres l'interaction de la radiation ionisante avec le milieu biologique. Il est bien connu que lorsque ces radiations deposent leur energie dans la cellule, elles produisent un grand nombre d'electrons secondaires (4 x 104/MeV), qui sont crees le long de la trace avec des energies cinetiques initiales bien inferieures a 20 eV. Cependant, il n'y a jamais eu de mesures directes demontrant l'interaction de ces electrons de tres basse energie avec l'ADN, du principalement aux difficultes experimentales imposees par la complexite du milieu biologique. Dans notre laboratoire, les dernieres annees ont ete consacrees a l'etude des phenomenes fondamentaux induits par impact des EBE sur differentes molecules simples (e.g., N2, CO, O2, H2O, NO, C2H 4, C6H6, C2H12) et quelques molecules complexes dans leur phase solide. D'autres travaux effectues recemment sur des bases de l'ADN et des oligonucleotides ont montre que les EBE produisent des bris moleculaires sur les biomolecules. Ces travaux nous ont permis d'elaborer des techniques pour mettre en evidence et comprendre les interactions fondamentales des EBE avec des molecules d'interet biologique, afin d'atteindre notre objectif majeur d'etudier l'effet direct de ces particules sur la molecule d'ADN. Les techniques de sciences des surfaces developpees et utilisees dans les etudes precitees peuvent etre etendues et combinees avec des methodes classiques de biologie pour etudier les dommages de l'ADN induits par l'impact des EBE. Nos experiences ont montre l'efficacite des electrons de 3--20 eV a induire des coupures simple et double brins dans l'ADN. Pour des energies inferieures a 15 eV, ces coupures sont induites par la localisation temporaire d'un electron sur une unite moleculaire de l'ADN, ce qui engendre la formation d'un ion negatif transitoire


    SciTech Connect

    Machalek, Pavel; Greene, Tom; McCullough, Peter R.; Burrows, Adam; Burke, Christopher J.; Hora, Joseph L.; Johns-Krull, Christopher M.; Deming, Drake L.


    We determined the flux ratios of the heavy and eccentric planet XO-3b to its parent star in the four Infrared Array Camera bands of the Spitzer Space Telescope: 0.101% +- 0.004% at 3.6 {mu}m; 0.143% +- 0.006% at 4.5 {mu}m; 0.134% +- 0.049% at 5.8 {mu}m; and 0.150% +- 0.036% at 8.0 {mu}m. The flux ratios are within [-2.2, 0.3, -0.8, and -1.7]sigma of the model of XO-3b with a thermally inverted stratosphere in the 3.6 {mu}m, 4.5 {mu}m, 5.8 {mu}m, and 8.0 {mu}m channels, respectively. XO-3b has a high illumination from its parent star (F{sub p} {approx} (1.9-4.2) x 10{sup 9} erg cm{sup -2} s{sup -1}) and is thus expected to have a thermal inversion, which we indeed observe. When combined with existing data for other planets, the correlation between the presence of an atmospheric temperature inversion and the substellar flux is insufficient to explain why some high insolation planets like TrES-3 do not have stratospheric inversions and some low insolation planets like XO-1b do have inversions. Secondary factors such as sulfur chemistry, atmospheric metallicity, amounts of macroscopic mixing in the stratosphere, or even dynamical weather effects likely play a role. Using the secondary eclipse timing centroids, we determined the orbital eccentricity of XO-3b as e = 0.277 +- 0.009. The model radius-age trajectories for XO-3b imply that at least some amount of tidal heating is required to inflate the radius of XO-3b, and the tidal heating parameter of the planet is constrained to Q{sub p} {approx}< 10{sup 6}.

  7. Conception et caracterisation d'un magnetoplasma produit par une onde de surface pour la pulverisation d'echantillons solides

    NASA Astrophysics Data System (ADS)

    Masse, Louis Philippe

    puissance. Une etude des caracteristiques du plasma seul a revele que le champ magnetique confine si bien le plasma que le maximum de densite electronique se trouve hors axe, plus exactement a la position radiale correspondant au rayon du cylindre dielectrique servant a former l'interface dielectrique-plasma dans la zone source du reacteur. Ce phenomene indique une tres nette superiorite du coefficient de diffusion axial par rapport au coefficient de diffusion radial. Notre reacteur a un potentiel interessant pour l'analyse elementaire de materiaux solides puisque le taux de pulverisation y est eleve et que les especes pulverisees sont aisement excitees et ionisees par le plasma.

  8. [In Process Citation].


    Obispo Entrenas, Ana; Martín Carvajal, Francisco; Legupín Tubío, David; Lucena Navarro, Fabiola; García Caballero, Manuel; Gándara Adán, Norberto; Abilés Osinaga, Jimena


    Objetivo: el objetivo de este estudio fue evaluar la prevalencia de hipovitaminosis D en los candidatos a cirugía bariátrica (CB) y su relación con factores de riesgo y los componentes del síndrome metabólico.Material y métodos: los parámetros clínicos, antropométricos y bioquímicos se midieron en 56 pacientes caucásicos incluidos en un protocolo de cirugía bariátrica entre enero y junio de 2014. Los pacientes fueron estratificados en tres grupos de acuerdo al status de vitamina D: suficiencia (≥ 40 ng/ml), insuficiencia (40-20 ng/ml) y deficiencia (< 20 ng/ml).Resultados: se observó deficiencia de vitamina D en el 75% de los pacientes. Estos pacientes tenían mayor índice de masa corporal (p = 0,006) y concentraciones plasmáticas mas bajas de PTH (p = 0,045). Además, hubo más pacientes con diabetes mellitus tipo 2 (DM2) y dislipemia (DLPM) en el grupo con niveles de 25 (OH) D < 20 ng/ml. Asimismo la 25 (OH) D se correlacionó negativamente con la masa grasa (r = -0,504; p = 0,009), el IMC (r = -0,394; p = 0,046) y la hipertensión arterial (r = -0,637; p = 0,001).Conclusión: De nuestros hallazgos concluimos que la deficiencia de vitamina D es muy común entre los candidatos a CB y que la misma está asociada con DM2 y DLPM.Aunque hay pocos datos sobre el mejor tratamiento para el bajo nivel de vitamina D en los pacientes candidatos CB, la detección de la deficiencia de vitamina D debe realizarse de forma rutinaria en estos casos. PMID:27019241

  9. Étude expérimentale de l'interaction laser-matière dans le cas du soudage d'un acier inoxydable austénitique par laser Nd:YAG continu de 2 kW

    NASA Astrophysics Data System (ADS)

    Dumord, E.; Jouvard, J. M.; Grevey, D.; Druetta, M.; Ottavi, P.


    The laser-matter interaction acting during cw 2 kW Nd:YAG laser welding of an austenitic stainless steel is studied and particulary the effects linked to the presence of a keyhole in the liquid bath. This is done in order to define parameters useful to the process modelling. The absorption factor of target has been measured in order to better understand the Nd:YAG laser/stainless steel 304 interaction. Then an experimental approach of the keyhole angle value determination is proposed. Values are presented showing the important keyhole angle at the bottom of the bead. Finally a study relative to the plume above the keyhole shows that it is responsible for the formation of the nail-head part, observed on the experimental melting zone, by laser beam scattering. L'interaction laser-matière se produisant lors du soudage par laser Nd:YAG continu de 2kW d'un acier inoxydable austénitique est étudiée, et notamment les effets liés à la présence du capillaire dans le bain liquide, de façon à définir les paramètres utiles à la modélisation du processus. Le facteur d'absorption des cibles utilisées a été mesuré afin de mieux appréhender l'interaction laser Nd:YAG/acier inoxydable austénitique 304. Puis une approche expérimentale de détermination de l'angle d'inclinaison du capillaire est proposée. Des valeurs sont présentées montrant la forte inclinaison du capillaire en fond de cordon. Finalement une étude relative au panache présent audessus du capillaire met en évidence qu'il est responsable de la formation de la partie en tête de clou observée sur les zones fondues expérimentales par diffusion du faisceau laser

  10. Comprehensive time series analysis of the transiting extrasolar planet WASP-33b

    NASA Astrophysics Data System (ADS)

    Kovács, G.; Kovács, T.; Hartman, J. D.; Bakos, G. Á.; Bieryla, A.; Latham, D.; Noyes, R. W.; Regály, Zs.; Esquerdo, G. A.


    Context. HD 15082 (WASP-33) is the hottest and fastest rotating star known to harbor a transiting extrasolar planet (WASP-33b). The lack of high precision radial velocity (RV) data stresses the need for precise light curve analysis and gathering further RV data. Aims: By using available photometric and RV data, we perform a blend analysis, compute more accurate system parameters, confine the planetary mass, and, attempt to cast light on the observed transit anomalies. Methods: We combined the original HATNet observations and various followup data to jointly analyze the signal content and extract the transit component and used our RV data to aid the global parameter determination. Results: The blend analysis of the combination of multicolor light curves yields the first independent confirmation of the planetary nature of WASP-33b. We clearly identify three frequency components in the 15-21 d-1 regime with amplitudes 7-5 mmag. These frequencies correspond to the δ Scuti-type pulsation of the host star. None of these pulsation frequencies or their low-order linear combinations are in close resonance with the orbital frequency. We show that these pulsation components explain some but not all of the observed transit anomalies. The grand-averaged transit light curve shows that there is a ~1.5 mmag brightening shortly after the planet passes the mid-transit phase. Although the duration and amplitude of this brightening varies, it is visible even through the direct inspections of the individual transit events (some 40-60% of the followup light curves show this phenomenon). We suggest that the most likely explanation of this feature is the presence of a well-populated spot belt which is highly inclined to the orbital plane. This geometry is consistent with the inference from the spectroscopic anomalies. Finally, we constrain the planetary mass to Mp = 3.27 ± 0.73 MJ by using our RV data collected by the TRES spectrograph. Appendix A is available in electronic form at http

  11. High School Student's Alternative Conceptions About the Phenomenon of the Formation of the Moon Phases. (Spanish Title: Concepciones Alternativas de Alumnos de Educación Media Sobre el Fenómeno de Formación de las Fases de La Luna.) Concepções Alternativas de Alunos do Ensino Médio Sobre o Fenômeno de Formação das Fases da Lua

    NASA Astrophysics Data System (ADS)

    Iachel, Gustavo; Langhi, Rodolfo; Fernandes Scalvi, Rosa Maria


    Forty students, at ages between 14 and 18 years old, from three schools in Bauru city, were questioned about their alternative conceptions concerning the phenomenon of formation of the Moon Phases. It was observed that some of the pupils confound the phenomenon of the formation of the Moon Phases with the phenomenon of the formation of the lunar eclipses, others are unaware of the reason of the phenomenon, they present incoherent alternative conceptions of the reality or incomplete conceptions. The results found here are aimed at the teachers of Elementary Education and can be used as a subsidy for future development of new pedagogical methods. Cuarenta estudiantes, con edad entre 14 y 18 años, pertenecientes a tres escuelas de la ciudad de Bauru, fueron cuestionados sobre sus concepciones alternativas acerca del fenómeno de la formación de las fases de la Luna. Fue observado que algunos alumnos confunden el fenómeno de formación de las fases de la Luna con el fenómeno de formación de los eclipses lunares, otros desconocen el motivo delfenómeno, presentan concepciones alternativas incoherentes con la realidad o bien presentan concepciones incompletas. Los resultados aquí encontrados son destinados a los profesores de la Enseñanza Básica y podrán ser usados como ayuda para el futuro desarrollo de nuevos métodos pedagógicos. Quarenta estudantes, com idades entre 14 e 18 anos, pertencentes a três escolas da cidade de Bauru, foram questionados sobre suas concepções alternativas acerca do fenômeno de formação das fases da Lua. Foi observado que alguns dos alunos confundem o fenômeno da formação das fases da Lua com o fenômeno da formação dos eclipses lunares, outros desconhecem o motivo do fenômeno, apresentam concepções alternativas incoerentes com a realidade ou então concepções incompletas. Os resultados aqui encontrados são destinados aos professores do Ensino Básico e poderão ser usados como subsídio parafuturo desenvolvimento de

  12. Crustal Structure at the North Eastern Tip of Rivera Plate, Nayarit- Marias Islands Region: Scenarios and Tectonic Implications. Tsujal Project

    NASA Astrophysics Data System (ADS)

    Danobeitia, J.; Bartolome, R.; Barba, D. C., Sr.; Nunez-Cornu, F. J.; Bandy, W. L.; Prada, M.; Cameselle, A. L.; Nunez, D.; Espindola, J. M.; Estrada, F.; Zamora, A.; Gomez, A.; Ortiz, M.


    A primarily analysis of marine geophysical data acquired aboard the RRS James Cook in the framework of the project "Characterization of seismic hazard and tsunami associated with cortical contact structure Rivera Jalisco Block Plate (TSUJAL)" is presented. This survey was held in the region of Nayarit-Tres Marias Islands between February and March 2014. The examination of data recorded by 16 OBS 's, deployed along 4 wide angle seismic profiles is presented, using an airgun-array seismic source of 6800 c.i., which allows sampling the crustal structure to the Moho. The profiles are located along the margin off the Marias Islands: a profile of over 200 km NNW-SSE direction and parallel to the western flank of the Islas Marias Islands and three orthogonal thereto. These perpendicular sections sample the lithosphere from the north of Maria Madre Island with a profile of 100 km length, across Maria Magdalena and Mari Cleofas Islands, with a profile of 50 km long, till south of Maria Cleofas with a profile of 100 km long. Coincident multichannel seismic profiles with refraction ones are also surveyed, although shooting with a source of 3,540 c. i., and acquired with a digital "streamer" of 6.0 km long. Simultaneously, multibeam, parametric and potential field data were recorded during seismic acquisition A first analysis shows an anomalously thickened crust in the western flank of the Marias Islands, as indicated by relatively short pre-critical distances of 30-35 km. While the moderate dip of 7 ° of the subduction of the Pacific oceanic plate favors somehow this effect, the existence of a remnant crustal fragment is also likely. Moreover, the images provided by the parametric sounding show abundant mass wasting deposits suggesting of recent active tectonics, possibly generated by earthquakes with moderate magnitude as those reported in the Marias Islands. This set of geophysical data, not only provide valuable information for the seismogenic characterization and

  13. Kinematics of an oblique deformation front using paleomagnetic data; the Altomira-Loranca structures (Iberian Chain, Central Spain)

    NASA Astrophysics Data System (ADS)

    Valcarcel, M.


    Manoel Valcárcel1, 5, Ruth Soto2, Elisabet Beamud3, Belén Oliva-Urcia4 and Josep Anton Muñoz5 1 IGME, Departamento de Investigación y Prospección Geocientífica. C/ La Calera, 1, 28760 Tres Cantos; 2 IGME, Unidad de Zaragoza, C/ Manuel Lasala 44, 9 B, 50006 Zaragoza, Spain 3 Lab. Paleomagnetisme (CCiT UB-CSIC). ICT "Jaume Almera", Solé i Sabarís, s/n, 08028 Barcelona, Spain. 4 IPE-CSIC, Avda. Montañana 1005, 50059 Zaragoza, Spain 5 Grup Geodinàmica i Anàlisi de Conques, Universitat de Barcelona, Zona Universitària Pedralbes, 08028 Barcelona, Spain The Altomira and Loranca structures consist of a fold-and-thrust system detached on Triassic evaporites. They are oriented N-S to NNE-SSW and NNW-SSE at its northern and southern end, respectively, forming a subtle arc, oblique with respect to the general NW-SE trend of the Iberian Chain. The aim of this work is to characterize with paleomagnetic data the kinematic evolution of the the Altomira Range, located at the southwestern deformation front of the Iberian Chain, and of the structures within its associated piggy-back basin, the Loranca basin. This approach will also give clues regarding the primary and/or secondary origin of these structures to better characterize them in further studies (3D reconstruction and restoration, fault pattern). A total of 180 samples were obtained from 19 sites in Eocene, Oligocene and Miocene rocks (including clays, fine sandstones and limestones). They were analyzed by means of stepwise thermal demagnetization and subsequent measurement of the natural remanent magnetization (NRM). Although fold tests are not statistically significant, a primary origin of the magnetization is deduced by samples showing either normal or reverse polarity after bedding correction of the calculated characteristic components. Declinations of the site mean directions appear scattered after bedding correction suggesting differential vertical-axis rotations. Sites located at the

  14. Suivi prospectif sur 5 ans des tentatives de suicide en population clinique dans la région de Fès, Maroc

    PubMed Central

    Aarab, Chadya; Elghazouani, Fatima; Aalouane, Rachid; Rammouz, Ismail


    Au Maroc, les tentatives de suicide (TS) demeurent un sujet mal évalué à cause de considérations socioculturelles et l'absence d'approche longitudinale. L'objectif principal était d’évaluer le devenir des suicidants après 5ans au centre universitaire psychiatrique de Fès, les objectifs secondaires étaient l'estimation de la prévalence des TS, préciser les étiologies les plus fréquentes, et établir une corrélation entre les paramètres sociodémographiques, cliniques et évolutifs. Etude prospective à visée transversale et longitudinale, incluant les suicidants vus à l'hôpital psychiatrique de Fès, avec un suivi longitudinal sur 5ans. L’évaluation a été faite par un hétéro-questionnaire et le Mini International Neuropsychiatric Interview (MINI) cherchant le trouble psychiatrique sous jacent. On a recruté 105 patients suicidants, 62% des femmes, l’âge moyen est de 29,23ans. La prévalence des tentatives de suicide est de 3% sur l'ensemble des consultants à l’établissement. Les troubles de l'humeur, psychotiques et de personnalité ont occupé respectivement 37,6%, 27,7%, et 25,7% des cas. La récidive suicidaire a été notée chez 54% des patients, était significativement corrélée à la vie solitaire (P: 0,039) et à la présence d'antécédents familiaux de TS (P: 0,046). L'utilisation de moyens violents était significativement fréquente chez les patients psychotiques. Après 5ans, 32 patients ont répondu à notre appel. Le taux de récidive était de 15%. On a noté trois cas de décès dont deux suicides confirmés. Les résultats confirment les données de la littérature scientifique avec certaines particularités cliniques et évolutives. PMID:25478042

  15. Convertisseur de reequilibrage de la tension d'un reseau

    NASA Astrophysics Data System (ADS)

    Richardeau, Frédéric; Aouda, Noureddine; Meynard, Thierry


    This paper deals with the design, the control and the simulation of a voltage balancing static converter for a three phases utility distribution. Unbalancing sources and compensator structures are studied and compared. The balancing method consists in injecting the load currents negative and zero sequence in opposite phase by means of a PWM voltage source inverter. The identification of the load currents negative sequence is based on the fluctuating active and reactive power computing allowing a transient state compensation. A general formulation is proposed allowing to relate the unbalance parameters to the inverter design. The compensation currents and the DC voltage loops are studied and carried out. Presented simulation results allow to validate control loops and to refine the theoretical study on the basis of a specification. This study has been supported by a research contract between the LEEI and the CENTRALP Automatismes company. Cet article traite du dimensionnement, du pilotage et de la simulation d'un convertisseur statique de rééquilibrage dynamique de la tension d'un réseau de distribution. Les sources de déséquilibre sont identifiées et les structures statiques de rééquilibrage sont décrites. Le principe du rééquilibrage consiste en une compensation des systèmes inverse et homopolaire de courants au moyen d'un onduleur de tension en modulation de largeur d'impulsion. L'identification du système inverse de courants repose sur le calcul des puissances active et réactive fluctuantes mises en jeu par la charge déséquilibrée, permettant une compensatiori en régime transitoire. Une formulation générale du dimensionnement du compensateur est proposée permettant de lier les paramètres caractéristiques du déséquilibre à la valeur des éléments constitutifs. L'asservissement des courants et la régulation de la tension de l'onduleur sont analysés. Les résultats de simulation ont permis de valider et d'affiner l'étude théorique sur

  16. Estudio teórico de la distribución catiónica en la capa octaédrica de silicatos laminares

    NASA Astrophysics Data System (ADS)

    Hernández-Laguna, A.

    Los silicatos laminares son unos minerales de gran extensión en la corteza de nuestro y otros planetas, y se ha detectado su presencia en masas de partículas de polvo interplanatario. Están formados por láminas estructuradas en una capa tetraedros de sílice y una de octaédros de oxihidroxido de aluminio. Según el número de capas y la disposición aparecen distintos minerales. Además, también pueden aparecer distintos minerales como consecuencia de la substitución isomórfica de cationes en la capas, en particular, Al(III) por Si en la capa tetraédrica y Fe(III) y/o Mg(II) por Al(III) en la octaédrica. Cuando el catión substituyente presenta un estado de oxidación más bajo que al que substituye genera carga negativa que tiene que neutralizarse con cationes que se disponen en el espacio interlaminar. En este trabajo vamos a estudiar, mediante distintos métodos computacionales, las distribuciones de dichos cationes de substitución en la capa octaédrica de silicatos laminares 2:1 (dos capas tetraédricas y en medio una octaédrica), en particular, en los minerales esmectitas e ilitas. En primer lugar, estudiaremos la distribución de dichos cationes en la capa octaédrica en un modelo de gas reticular por el método de Monte Carlo, minimizando el número de pares de cationes Al, Fe y Mg de nuestro modelo con respecto a los procedentes de resultados espectroscópicos de muestras de minerales. Posteriormente, y mediante un modelo de potenciales empíricos, estudiamos la energética de las distribuciones binarias en dichos minerales, generando unos potenciales de interacción intercambio a dos y tres cationes (extrapolables a cualquier filosilicato) que son la base para una investigación Monte Carlo-"simulated-annealing" en la que se encuentran las transiciones de fase y las estructuras ordenadas, dependiendo dichas estructuras y la temperatura de cambio de fase de la de la naturaleza y concentración de los cationes de substitución. También se han


    PubMed Central

    Chávez, Natividad; Molina, Helfer; Sánchez, Jorge; Gelaye, Bizu; Sánchez, Sixto E.


    Vaginosis bacteriana (VB) es una infección caracterizada por el cambio en la microflora de la vagina, asociándose a resultados adversos del embarazo y a la adquisición de infecciones de transmisión sexual (ITS), incluyendo el VIH. En este estudio se buscó la asociación entre el uso de duchas vaginales y otros factores de riesgos con VB. Se usó un diseño observacional descriptivo transversal prospectivo, en 1,252 mujeres que asistieron al servicio de planificación familiar de tres hospitales nacionales (Dos de Mayo, Arzobispo Loayza, San Bartolomé) y el Instituto Materno Perinatal, durante el año 1997. Se utilizó un cuestionario estructurado donde se registraron variables socio demográficas y características del estilo de vida de las participantes. VB fue diagnosticada mediante el puntaje de Nugent. Se empleó análisis de regresión logística para calcular odds ratio (OR) e intervalos de confianza al 95%. La edad promedio de las participantes fue 25.1 ± 4,7 años, el 23.4% tenían más de 11 años de educación. La prevalencía de VB fue 20,1%. Las mujeres que practicaban duchas vaginales tuvieron 2.28 veces (OR = 2.28, IC 95% [1.0–5.0]) mayor probabilidad de tener VB comparado con aquellas que no lo practicaban. Tener dos o más parejas sexuales estuvo asociado con 2.0 veces (OR =2.0, IC 95% [1.2–3.5]) mayor probabilidad de adquirir VB comparado con aquellas que habían tenido solo una pareja sexual. Las participantes que iniciaron una relación sexual a una edad temprana tuvieron 1.4 veces (OR=1.4, IC 95% [1.0 –1.9]) mayor probabilidad de adquirir VB. El uso de duchas vaginales es un factor de riesgo de VB. Los programas destinados a la salud de la mujer deben abordar las repercusiones perjudiciales para la salud asociados con las duchas vaginales. PMID:21132048

  18. [In Process Citation].


    Schnettler, Berta; Höger, Yesly; Orellana, Ligia; Sepúlveda, José; Salinas-Oñate, Natalia; Lobos, Germán; Grunert, Klaus G


    Objetivo: caracterizar tipologías de estudiantes universitarios según la percepción de los hábitos alimentarios de sus familias. Material y método: se aplicó un cuestionario a una muestra no probabilística de 372 estudiantes de ambos géneros de la Universidad de La Frontera, Chile. El instrumento incluyó: Cuestionario de Hábitos Alimentarios Familiares (FEHQ), Satisfaction with Life Scale (SWLS), Satisfaction with Food-related Life (SWFL) y la Escala de Recursos Familiares (FRS). Se consultó peso y estatura aproximada, así como variables sociodemográficas. Resultados: mediante análisis factorial exploratorio (AFE) se detectaron tres factores en el FEHQ: importancia de la alimentación para los miembros de la familia, cohesión en las comidas familiares y presión por comer. Mediante AFE se detectaron dos factores en la FRS: apoyo intangible y tangible. Mediante análisis factorial confirmatorio se validó la estructura del FEHQ y de la FRS con aceptables niveles de bondad de ajuste. Mediante análisis clúster se distinguieron cuatro tipologías que difirieron significativamente en las puntuaciones de los componentes del FEHQ y de la FRS, puntajes de la SWLS y SWFL, índice de masa corporal, género y nivel socioeconómico. Las tipologías con mayores puntuaciones en "cohesión en las comidas familiares" reportan mayor apoyo intangible de sus familias y superiores puntuaciones en la SWLS y SWFL. Conclusiones: los resultados muestran que la frecuencia y la importancia asignada a las comidas en familia se asocian positivamente con el apoyo familiar percibido, especialmente en recursos intangibles, así como también con la satisfacción global con la vida y en el dominio de la alimentación. PMID:27238812

  19. More evidence on the control of reverse micelles sizes. Combination of different techniques as a powerful tool to monitor AOT reversed micelles properties.


    Durantini, Andrés M; Falcone, R Darío; Silber, Juana J; Correa, N Mariano


    In this work, we have investigated the behavior of 4-aminophthalimide (4-AP) in solvent mixtures of ethyl lactate (EL)- water and EL-n-heptane and in reversed micelles (RMs) media made of EL-water/sodium 1,4-bis(2-ethylhexyl)sulfosuccinate (AOT)/n-heptane. We have used dynamics light scattering (DLS) and absorption, steady-state and time-resolved emission (TRES) techniques. 4-AP is a very interesting and unique molecule used to study preferential solvation in water mixtures since its emission profile changes dramatically when its sphere shell is solvated by water molecules. Thus, in homogeneous media 4-AP is strongly solvated by water in the EL-water mixture and by EL in the EL-n-heptane mixture, results that show the importance of the hydrogen bonding in the 4-AP solvation. We were motivated by this feature of 4-AP and have used it to monitor properties in AOT RMs. Thus, we use 4-AP spectroscopic behavior in conjunction with DLS technique to reveal the location of each polar solvent of the mixture encapsulated within the RMs media. We found that in the EL-water/AOT/n-heptane RMs the results strongly depend on the amount of water dissolved. Below W0 = [water]/[AOT] = 5, there are no reversed micelles and EL, water, AOT and n-heptane forms a nonstructured mixture. For W0 values between 5 and 10, the droplet sizes are independent of the EL content because of its strong intermolecular interactions forms an EL polar core and only water is found at the interface. For W0 values higher than 10, the droplets size increase with the EL content and EL molecules are detected at the AOT RMs interface. We inferred that the RMs sizes will change only if the polar solvent encapsulated interacts with the interface changing the surfactant packing parameter. Then, we can assume that it is possible to create RMs with solvents that do not interact with the interface but can be encapsulated in the polar core. These results, give evidence that expand the knowledge about which are the


    SciTech Connect

    Spiegel, David S.; Silverio, Katie; Burrows, Adam E-mail:


    Spitzer Space Telescope infrared observations indicate that several transiting extrasolar giant planets have thermal inversions in their upper atmospheres. Above a relative minimum, the temperature appears to increase with altitude. Such an inversion probably requires a species at high altitude that absorbs a significant amount of incident optical/UV radiation. Some authors have suggested that the strong optical absorbers titanium oxide (TiO) and vanadium oxide (VO) could provide the needed additional opacity, but if regions of the atmosphere are cold enough for Ti and V to be sequestered into solids they might rain out and be severely depleted. With a model of the vertical distribution of a refractory species in gaseous and condensed form, we address the question of whether enough TiO (or VO) could survive aloft in an irradiated planet's atmosphere to produce a thermal inversion. We find that it is unlikely that VO could play a critical role in producing thermal inversions. Furthermore, we find that macroscopic mixing is essential to the TiO hypothesis; without macroscopic mixing, such a heavy species cannot persist in a planet's upper atmosphere. The amount of macroscopic mixing that is required depends on the size of condensed titanium-bearing particles that form in regions of an atmosphere that are too cold for gaseous TiO to exist. We parameterize the macroscopic mixing with the eddy diffusion coefficient K{sub zz} and find, as a function of particle size a, the values that K{sub zz} must assume on the highly irradiated planets HD 209458b, HD 149026b, TrES-4, and OGLE-TR-56b to loft enough titanium to the upper atmosphere for the TiO hypothesis to be correct. On these planets, we find that for TiO to be responsible for thermal inversions K{sub zz} must be at least a few times 10{sup 7} cm{sup 2} s{sup -1}, even for a = 0.1 {mu}m, and increases to nearly 10{sup 11} cm{sup 2} s{sup -1} for a = 10 {mu}m. Such large values may be problematic for the TiO hypothesis

  1. Interactions of grass spontaneous cover in olive orchards with site conditions and management: a study case using biodiversity indices

    NASA Astrophysics Data System (ADS)

    Arroyo, Carmen; Taguas, Encarnación; Lora, Ángel; Guzmán, Gema; Vanderlinden, Karl; Gómez, Jose A.


    Spontaneous herbaceous plants are an inexpensive control measure of soil erosion in olive orchards. Grass covers on steep areas are a requirement for compliance by farmers with basic standards concerning the environment, derived from Common Agricultural Policy (cross-compliances). In addition to ground cover, other aspects such as biodiversity and OC storage capacity of these systems are often not considered, despite the fact that the occupation of many ecological niches by different species might provide substantial environmental and landscape benefits. In this study, we evaluated different biodiversity indices on grass cover in two olive orchard catchments with different managements (conventional tillage and non-tillage with natural herbaceous plants) during 3 years (2011-2013). Seasonal samples of vegetal material and pictures in a permanent grid (4 samples/ha) were taken to characterize the temporal variations of the indicators: number of species, frequency, diversity and transformed Shanon's and Pielou's indices. The specific objectives of this work were: i) to describe and to compare the biodiversity indices in two contrasting olive orchard catchments of 6 and 9 ha with different soil types, precipitation, topography and management; ii) to explore possible relationships of these indexes with soil organic carbon content and soil loss. The results will allow improving our knowledge of environmental functions of this type of ground cover as well as factors determining its development. These features can be particularly interesting to enhance the environmental values of marginal olive orchards in steep locations. REFERENCES Aguilera L. 2012.Estudio de cubiertas vegetales para el control de la erosión en olivar Evolución espacio-temporal en dos fincas comerciales, y exploración de nuevas opciones de cubiertas. Master Thesis. University of Cordoba (Spain) Gimeno E. 2011. Análisis de la variabilidad de la cobertura vegetal en tres pequeñas cuencas de olivar

  2. Elaboration d'un composite conducteur a base de polypyrrole et de nanofibres de cellulose

    NASA Astrophysics Data System (ADS)

    Bideau, Benoit

    Le projet de production de nanocellulose à grande échelle par l'équipe de recherche du professeur Claude Daneault, ne pourra se faire sans avoir démontré sa quelconque utilité sur le marché économique. C'est dans cette optique que s'est articulé mon travail afin de mettre en avant une des voix de valorisation de ces nanocelluloses. Nous avons travaillé plus précisément sur le développement d'un nanocomposite conducteur biodégradable. Nous nous sommes proposé dans ce travail de développer une technique simple et écologique permettant la conception d'un matériau composite conducteur. Nous avons étudié l'influence des nanofibres de cellulose, du pyrrole, de la température, de la durée de polymérisation et l'ajout d'additifs dans le matériau composite. L'étude de ces paramètres nous a permis de déterminer les meilleures conditions pour le développement d'un film composite conducteur avec des propriétés mécaniques acceptables. L'ajout de ce renfort (nanofibres), au sein de la matrice de polypyrrole a permis d'obtenir des films intéressants, de part leurs propriétés mécaniques, électriques et de leur caractère biodégradable. Des comparaisons ont été effectuées avec des fibres oxydées, afin d'étudier l'apport des nanofibres de cellulose au composite. Notre étude a ensuite été élargie à l'ajout d'additifs dans les matériaux conducteurs afin d'améliorer certaines propriétés du composite. L'objectif de ce travail visait l'étude de l'incorporation des nanofibres de cellulose dans une matrice de polypyrrole en vue de son utilisation en tant que matériau conducteur biodégradable pour des applications dans le domaine énergétique. Mots Clés: Nanocellulose, polypyrrole, composite, conducteur, biodégradable, propriétés mécaniques, additifs.

  3. Apoyo a Estudios Geodinamicos con GPS en Guatemala

    NASA Astrophysics Data System (ADS)

    Robles, V. R.


    El Instituto Geografico Nacional de Guatemala implemento 17 estaciones GNSS en el año 2009, como un proyecto de credito mixto de donacion de equipamiento del Gobierno de Suiza, el cual, este equipamiento de estaciones CORS GNSS es un sistema de recepción y transmisión de datos crudos GPS RInex que utiliza la tecnologia Spider Web de Leica, asi mismo este sistema esta sirviendo para el espablecimiento de un marco geodesico nacional de coordenadas geodesicas oficiales, el cual se calculan u obtienen las velocidades en tiempos temporales programados de las 17 Estaciones CORS. La infraestructura del marco geodesico de Guatemala esta sirviendo de base para las aplicaciones de estudios geodinamicos como el monitoreo de del desplazamiento de las placas tectonicas por medio de un estudio que se inicio en el año de 1999, llamado medicion con GPS el sistema de Fallas de los rios Polochic Motagua de Guatemala, tambien para un estudio que se implemento para deformación de corteza terrestre local en un Volcan Activo de Guatemala llamado Pacaya. Para el estudio de medicion con GPS en el sistema de falla de los Rios del polochic Motagua se implementaron 16 puntos para medir con GPS de dos frecuencias en el año de 1999, el cual, tres puntos son estaciones geodesicas CORS IGS llamados GUAT, ELEN y HUEH, despues en el año de 2003 se hizo otra medicion en un total de 20 puntos, que permitió calcular las velocidades de desplazamieinto de los puntos en mención, usando como referencia el modelo NUVEL 1A de DeMets de la placa de Norteamerica. Este estudio fue en cooperación internacional por la universidad de Nice de Francia y el IGNde Francia. Para el estudio del monitoreo con GPS del volcan activo de Guatemala, se implementaron cuatro puntos al rededor del volcan, el cual, se realizan cuatro mediciones al año, que permiten determinar axialmente la distancias entre los puntos, y rebisar estadisticamente cual es el comportamiento de las distancias en funcion del tiempo, si

  4. [Not Available].


    Peñailillo Escarate, Luis; Mackay Phillips, Karen; Serrano Duarte, Natalia; Canales Espinoza, Pablo; Miranda Herrera, Pamela; Zbinden-Foncea, Hermann


    Introducción: el entrenamiento de intervalos de alta intensidad (HIIT) y el consumo de ácidos grasos omega-3 (O3) ha demostrado cada uno por separado aumentar la capacidad aeróbica, metabolismo oxidativo y función cardiovascular.Objetivo: examinar el efecto combinado de HIIT más suplementación de O3 en el rendimiento físico, presión arterial y composición corporal en jóvenes sedentarios.Método: 28 jóvenes sedentarios con sobrepeso (Edad=22 ± 4 años; IMC=25.8 ± 2.4 kg·m-2) fueron distribuidos aleatoriamente en cuatro grupos: grupo O3/HIIT (n=7) realizó un protocolo de HIIT, tres veces por semana durante seis semanas y consumió 2 g·día-1 de O3; grupo HIIT (n=7) realizó solo el HIIT; grupo O3 (n=7) solo consumió O3; y grupo CONTROL (n=7) que no realizó ninguna intervención. Consumo de oxígeno peak (VO2peak), velocidad máxima (Vmax), presión arterial sistólica y diastólica (PAS y PAD), y porcentaje de grasa fueron medidos antes y después de la intervención.Resultados: el consumo de oxígeno peak aumentó más en el grupo O3/HIIT (+10.9%) en comparación con HIIT, O3 y CONTROL. Velocidad máxima aumentó en O3/HIIT (+7.1%) y HIIT (+11.9%). La presión arterial sistólica disminuyó más en O3 (-6.8%) en comparación con O3/HIIT, HIIT y CONTROL. Por último, O3/HIIT (-19.2%), HIIT (-20.2%), y O3 (-15.2%) presentaron mayores disminuciones del porcentaje de masa grasa en relación al CONTROL.Conclusión: nuestros resultados sugieren un efecto potenciador de la capacidad aeróbica máxima producto de la combinación de HIIT y suplementación de O3. Además, se observó una disminución de masa grasa en todos los grupos intervenidos. PMID:27571658

  5. Spatial and temporal variability of particulate polycyclic aromatic hydrocarbons in Mexico City

    NASA Astrophysics Data System (ADS)

    Thornhill, D. A.; de Foy, B.; Herndon, S. C.; Onasch, T. B.; Wood, E. C.; Zavala, M.; Molina, L. T.; Gaffney, J. S.; Marley, N. A.; Marr, L. C.


    As part of the Megacities Initiative: Local and Global Research Observations (MILAGRO) study in the Mexico City Metropolitan Area in March 2006, we measured particulate polycyclic aromatic hydrocarbons (PAHs) and other gaseous species and particulate properties, including light absorbing carbon or effective black carbon (BC), at six locations throughout the city. The measurements were intended to support the following objectives: to describe spatial and temporal patterns in PAH concentrations, to gain insight into sources and transformations of PAHs and BC, and to quantify the relationships between PAHs and other pollutants. Total particulate PAHs at the Instituto Mexicano del Petróleo (T0 supersite) located near downtown averaged 50 ng m-3, and aerosol active surface area averaged 80 mm2 m-3. PAHs were also measured on board the Aerodyne Mobile Laboratory, which visited six sites encompassing a mixture of different land uses and a range of ages of air parcels transported from the city core. A combination of analyses of time series, back trajectories, concentration fields, pollutant ratios, and correlation coefficients supports the concept of T0 as an urban source site, T1 as a receptor site with strong local sources, Pedregal and PEMEX as intermediate sites, Pico Tres Padres as a vertical receptor site, and Santa Ana as a downwind receptor site. Weak intersite correlations suggest that local sources are important and variable and that exposure to PAHs and BC cannot be represented by a single regional-scale value. The relationships between PAHs and other pollutants suggest that a variety of sources and ages of particles are present. Among carbon monoxide, nitrogen oxides (NOx), and carbon dioxide, particulate PAHs are most strongly correlated with NOx. Mexico City's PAH/BC mass ratio of 0.01 is similar to that found on a freeway loop in the Los Angeles area and approximately 8 30 times higher than that found in other cities. Evidence also suggests that primary

  6. Enquête sur la contrefaçon de quelques anti-infectieux administrés per os commercialisés dans la ville de Lubumbashi

    PubMed Central

    Tshilumba, Pierrot Mwamba; Amuri, Salvius Bakari; Kaghowa, Elie Rongorongo; Mbikay, Danny Mukeba; Impele, Alex Bokanya; Duez, Pierre; Ndoumba, Jean Baptiste Kalonji


    Introduction La production, la vente et la consommation des médicaments contrefaits sont de sérieux problèmes qui pèsent sur la Santé Publique particulièrement des pays en développement et pour lesquels il existe peu d'informations dans certains pays. Cette étude a été menée en vue de contribuer à la détermination de la prévalence des médicaments contrefaits, particulièrement celle des anti-infectieux consommés dans la ville de Lubumbashi en République Démocratique du Congo. Méthodes L’étude a visé des médicaments anti-infectieux administrés per os commercialisés dans la ville de Lubumbashi. L'inspection visuelle attentive de l'emballage, l'interprétation de l’étiquetage et l'observation attentive du produit ont servi de paramètres d’études. Les échantillons ont été acquis par achat auprès des fournisseurs licites et illicites. Résultats Cinq molécules: ampicilline, amoxycilline, ciprofloxacine, mebendazole et metronidazole ont été colletées. Sur 60 échantillons rassemblés: 31,7% se sont avérés contrefaits. L'ampicilline et le mebendazole sont les produits les plus contrefaits dans cette étude avec 26,3%, suivi de metronidazole avec 21,05%. 78,9% des médicaments contrefaits proviennent du secteur informel. La provenance de 47,4% d'anti-infectieux contrefaits est l'Inde, suivi de la Chine avec 26,3%. Conclusion Cette étude a montré la circulation des médicaments contrefaits dans la ville de Lubumbashi à un taux non négligeable. Une étude des caractéristiques physico-chimiques et de l'activité biologiques permettra d’évaluer l'impact de ces médicaments dans la prise en charge des infections. PMID:26977227

  7. La supraconductivité a 100 ans !




    Il y a 100 ans, le 8 avril 1911, une découverte majeure était réalisée : celle de la supraconductivité. La supraconductivité est la caractéristique qu?ont certains métaux et alliages de perdre toute résistance électrique en dessous d?une température donnée. Cette renversante découverte, réalisée de manière presque fortuite par Kammerlingh Onnes de l?Université de Leyde (Pays-Bas) et son étudiant Gilles Holst, a ouvert un nouveau champ de recherche en physique et de fabuleuses perspectives d?applications technologiques. Du point de vue scientifique, la supraconductivité est en effet l?une des rares manifestations de la physique quantique à l?échelle macroscopique.  Du point de vue des retombées techniques, elle est porteuse d?applications majeures dans le domaine de la santé, des communications et de l?énergie. 100 ans après, les physiciens n?ont toujours pas fini d?explorer ce phénomène et ses applications. Le CERN abrite des applications de la supraconductivité à des échelles inédites. L?accélérateur de particules LHC, avec ses milliers d?aimants supraconducteurs répartis sur 27 kilomètres de circonférence, est en effet la plus grande application mondiale de la supraconductivité. Il ne pourrait exister sans elle.  Le CERN fête donc la découverte de la supraconductivité avec une conférence exceptionnelle donnée par Philippe Lebrun. Au cours de cette conférence, l?expérience historique de Kammerlingh Onnes sera reproduite. Philippe Lebrun racontera l?histoire de cette étonnante découverte, en la replaçant dans le contexte scientifique de l?époque. Il racontera les développements scientifiques et les applications du premier siècle de la supraconductivité. Conférence en français Merci de bien vouloir vous inscrire au : +41 22 767 76 76 ou

  8. X-ray microanalysis in the environmental scanning electron microscope (ESEM): Small size particles analysis limits

    NASA Astrophysics Data System (ADS)

    Khouchaf, L.; Verstraete, J.


    In this work we will present a study of the effects of some parameters such as pressure and data acquisition duration in EDS microanalysis results. The chamber pressure has been increased from 1Torr (133Pa) to 15 Torr (1995 Pa). Measurements with times of measurement varying between 180 seconds and 1800 seconds were carried out. Small size particles of iron and silicon are analyzed. The results show that at 1Torr (133Pa), the primary electron beam can move if the time of measurement is long, which introduces some mistakes in the microananlysis results. Moreover an increase in the chamber pressure induces an amplification of the skirt beam phenomena up to 160 microns. This fact adds some noise coming from the environment around the analyzed particle. We showed that, the displacement of the electron beam during measurement caused a decrease in the iron concentration versus the time of measurment which reachs approximately 15% when the time of measurement is 1800seconds. Dans cette étude nous présenterons les effets de certains paramètres tels que la durée d'acquisition et la pression dans la chambre du microscope électronique à balayage environnemental sur les résultats de la microanalyse X. La pression dans la chambre a été augmentée de 1 Torr (133 Pa) à 15 Torr (1995 Pa). Des mesures avec des durées d'acquisition entre 180 secondes et 1800 secondes ont été effectuées. Des particules de fer et de silicium de petites tailles sont analysées. Les résultats ont montré qu'à 1 Torr (133 Pa), le faisceau d'électrons primaire peut fluctuer si la durée d'acquisition est longue, ce qui induit quelques erreurs dans les résultats obtenus. Une augmentation de la pression dans la chambre induit une amplification des phénomènes de diffusion du faisceau d'électrons jusqu'à 160 microns. Ce fait, ajoute un certain bruit venant de l'environnement autour de la particule analysée. Nous avons ensuite montré que le déplacement du faisceau d'électrons pendant

  9. [In Process Citation].


    Morales-Fernández, M A Teresa; Aranda-Ramírez, Pilar; López-Jurado, María; Llopis-González, Juan; Ruiz-Cabello-Turmo, Pilar; Fernández-Martínez, María Del Mar


    Objetivos: el objetivo de este estudio fue comprobar la eficacia de un programa de educación e intervención nutricional, de salud integral y ejercicio físico en mujeres posmenopáusicas, incidiendo especialmente en el sector de mujeres fumadoras con el fin de reducir el riesgo cardiovascular de este sector de población. Materiales y métodos: la población objeto de estudio estuvo constituida por 96 mujeres (46-79 años) residentes en Granada (sur de España).Al comienzo del estudio se recogieron las características sociodemográficas y se realizó una valoración nutricional; el consumo de alimentos se evaluó mediante una encuesta de 48 preguntas y un estudio de adhesión a la dieta mediterránea. Se determinaron datos antropométricos: índice de masa corporal, porcentaje de masa grasa y magra. Determinamos también el colesterol total, el colesterol LDL, HDL y los triglicéridos.Una vez obtenidos los primeros resultados, se realizó una intervención personalizada, para cada mujer participante en el estudio, de educación nutricional y de hábitos saludables. Transcurridos tres meses, se volvieron a determinar todos los parámetros anteriormente estudiados. Resultados: al comienzo del estudio se observó que la dieta de la población se adecuaba a los patrones de dieta saludable y tras la intervención nutricional se produjo una mejora del perfil calórico y lipídico y un descenso de la obesidad. En el grupo de las mujeres fumadoras además se encontró una mejora de los parámetros lipídicos séricos, alcanzando valores semejantes a los de las no fumadoras. Conclusiones: se observó que las mujeres posmenopáusicas andaluzas participantes en este estudio tenían una adecuada adhesión a la dieta mediterránea. La intervención nutricional mejoró en todo el grupo la calidad de la dieta y el porcentaje de obesidad y, además en las mujeres fumadoras mejoró el perfil lipídico. PMID:27238798

  10. Conocimientos y autoeficacia asociados a la prevención del VIH y SIDA en mujeres chilenas

    PubMed Central

    Villegas Rodríguez, Natalia; Ferrer Lagunas, Lilian Marcela; Cianelli Acosta, Rosina; Miner, Sarah; Lara Campos, Loreto; Peragallo, Nilda


    Resumen Objetivo Evaluar la relación existente entre conocimientos y autoeficacia asociados al VIH/SIDA en mujeres chilenas en desventaja social. Metodología Estudio correlacional, que utiliza la medición basal del estudio “Testeando una intervención en VIH y SIDA en mujeres chilenas”, realizada entre 2006 y 2008, que tiene una muestra de 496 mujeres entre 18 y 49 años residentes en dos comunas de Santiago de Chile. Las participantes respondieron un cuestionario estructurado aplicado por entrevistadoras entrenadas. Este cuestionario incluyó preguntas sobre datos sociodemográficos, escala de conocimientos de conductas de riesgo y autoeficacia, entre otros. Resultados Edad promedio de 32.3±9.1 años, 72.2% vive con su pareja y 42.7% poseen educación media completa. La puntuación media de los conocimientos de la infección por el VIH fue de 8.9±2.5, mientras que para las tres escalas empleadas para medir autoeficacia fueron: “Normas de los pares” =9.8±3.6, “Intención de reducir conductas de riesgo” =12.2±3.6 y “Self Efficacy Form”=20.2±4.7. Los conocimientos tuvieron una correlación positiva débil con la “intención de reducir conductas de riesgo” (r=0.19; p<0.0001) y con la escala “Self Efficacy Form” (r=0.34; p<0.0001), pero no se relacionaron con las “normas de los pares en cuanto a relaciones sexuales seguras” (r=0.13; p=0.78). Conclusión Existe una débil correlación positiva entre el nivel de conocimientos sobre el VIH/SIDA y la autoeficacia en mujeres chilenas en desventaja social. PMID:25284914

  11. Des ballons pour demain

    NASA Astrophysics Data System (ADS)

    Régipa, R.

    A partir d'une théorie sur la détermination des formes et des contraintes globales d'un ballon de révolution, ou s'en rapprochant, une nouvelle famille de ballons a été définie. Les ballons actuels, dits de ``forme naturelle'', sont calculés en général pour une tension circonférencielle nulle. Ainsi, pour une mission donnée, la tension longitudinale et la forme de l'enveloppe sont strictement imposées. Les ballons de la nouvelle génération sont globalement cylindriques et leurs pôles sont réunis par un câble axial, chargé de transmettre une partie des efforts depuis le crochet (pôle inférieur), directement au pôle supérieur. De plus, la zone latérale cylindrique est soumise à un faible champ de tensions circonférencielles. Ainsi, deux paramètres permettent de faire évoluer la distribution des tensions et la forme de l'enveloppe: - la tension du câble de liaison entre pôles (ou la longueur de ce câble) - la tension circonférencielle moyenne désirée (ou le rayon du ballon). On peut donc calculer et réaliser: - soit des ballons de forme adaptée, comme les ballons à fond plat pour le bon fonctionnement des montgolfières infrarouge (projet MIR); - soit des ballons optimisés pour une bonne répartition des contraintes et une meilleure utilisation des matériaux d'enveloppe, pour l'ensemble des programmes stratosphériques. Il s'ensuit une économie sensible des coûts de fabrication, une fiabilité accrue du fonctionnement de ces ballons et une rendement opérationnel bien supérieur, permettant entre autres, d'envisager des vols à très haute altitude en matériaux très légers.

  12. Measurements of the W Boson Mass with the D0 Detector

    NASA Astrophysics Data System (ADS)

    Lopes de Sa, Rafael Coelho

    Thesis est omnis divisa in partes tres. In the first part, we describe what is the W boson mass in the context of the Standard Model. We discuss the prominent role this physical observable plays in the determination of the internal self consistency of the Electroweak Sector. We review measurements and calculation of the W boson mass done in past and argue about the importance and feasibility of improving the experimental determination. We give a description of the Fermilab Tevatron Collider and the D0 detector, highlighting the relevant parts for the measurement described in this Dissertation. In the second part, we give a detailed description of a measurement of the W boson mass using the D0 Central Calorimeter. The measurement uses 1.68 x 106 candidates from W → enu decays, corresponding to 4.3 fb-1 of integrated luminosity collected from 2006 to 2009. We measure the mass using the transverse mass, electron transverse momentum, and missing transverse energy distributions. The transverse mass and electron transverse momentum measurements are the most precise and are combined to give MW = 80.367 +/- 0.013 (stat) +/- 0.023 (syst) GeV = 80.367 +/- 0.026 GeV. This is combined with an earlier D0 result determined using an independent 1 fb-1 data sample, also with central electrons only, to give MW = 80.375 +/- 0.023 GeV. The uncertainty in the measurement is dominated by the determination of the calorimeter electron energy scale, the W sample size, the knowledge of the parton distribution function. In the third part, we discuss methods of reducing the dominant uncertainties in the W boson mass measurements. We show that introducing electrons detected in the End Calorimeters greatly reduce the measurement systematic uncertainty, especially the one related to the parton distribution functions. We describe a precise calibration of the End Calorimeter using Z → ee events corresponding to 4.3 fb -1 of integrated luminosity. The calibration is an important milestone in a

  13. Les fractures distales de la clavicule type II de Neer: plaque à crochet versus brochage transacromiale

    PubMed Central

    Mechchat, Atif; Elidrissi, Mohammed; Shimi, Mohammed; Elibrahimi, Abdelhalim; Elmrini, Abdelmajid


    Cette étude a été menée afin de faire une comparaison entre deux techniques chirurgicales différentes: la plaque à crochet et l'embrochage dans les fractures instables du quart externe de la clavicule. Nous avons mené une étude prospective entre 2009 et 2013, incluant deux groupes de patients: un premier groupe de 14 patients traités par plaque à crochet par voie d'abord antéro-inférieure, un second de 12 patients traités par brochage. Tous les patients ont été hospitalisés 24 h après la chirurgie et ont été suivi pendant 1 an. Nous avons comparé les résultats des deux techniques en étudiant: le temps opératoire, le saignement, délai de consolidation, la douleur et la fonction selon le score de constant. L'analyse statistique des résultats fonctionnels et radiologiques a montré la supériorité d'une technique par rapport à l'autre; ainsi l’âge moyen global était de 32,6 ans (+/- 13,7), le sex-ratio (H/F) était de 1. Le temps opératoire moyen est de 35 min pour la plaque à crochet contre 45 minutes pour le brochage, le délai moyen de consolidation était de 6,1 (+/-0,7) semaines dans le groupe traité par plaque vissée, et de 6 (+/-0,7) semaines dans le groupe traité par embrochage (p = 0,5), le score de Constant absolu moyen était respectivement de 86 (+/-10,4) et de 90,92 (+/-2,5) (p = 0,04). L'analyse uni variée a montré une association statistiquement significative entre les paramètres d’évaluation et les deux techniques chirurgicales étudiées. Par conséquent, l’étude a noté la supériorité de la plaque à crochet contre l'embroche dans les fractures instables du quart externe de la clavicule. PMID:26090053

  14. Faut-il continuer à infiltrer le scalp par un anesthésique local pour une craniotomie?

    PubMed Central

    Doumiri, Mouhssine; Motiaa, Youssef; Razine, Rachid; Amor, Morad; Moussaoui, Abdelmajid; Kabbaj, Saad; Maazouzi, Wajdi


    Introduction Le maintien de la stabilité hémodynamique est un objectif primordial de l'anesthésie pour craniotomie. Peu d’études ont prouvé l'efficacité de l'infiltration du scalp par un anesthésique local pour le maintien de la stabilité hémodynamique après l'incision. L'objectif de notre travail est d’évaluer l'influence de l'infiltration de la ligne d'incision du scalp par la lidocaïne à 0,5% adrénalinée sur les paramètres hémodynamiques après incision pour craniotomie supratentorielle. Méthodes Étude prospective en double aveugle réalisée au bloc opératoire de l'hôpital des spécialités de Rabat sur une période d'une année incluant 80 malades programmés pour craniotomie supratentorielle. Les malades étaient randomisés par tirage au sort en 2 groupes: Le groupe 1 était infiltré par 40 ml du sérum salé adrénaliné (1/200 000) et le groupe 2 était infiltré par 40 ml de la lidocaïne 0,5% adrénalinée (1/200 000). Le critère de jugement principal était la pression artérielle moyenne (PAM) après l'incision. L’étude statistique a fait appel aux tests t de student et l'U- mann-whitney. Une valeur de p <0.05 était considérée significative. Résultats L’étude a inclus 80 patients (40 hommes et 40 femmes). L’âge moyen était 42,33±14,76 ans. Le poids moyen était 71,58 ±10 kg. Le 3/4 des patients était ASA 1, seulement 25% étaient ASA2. La durée moyenne de la chirurgie était de 252,06±38,62 mn. Les deux groupes étaient comparables concernant l’âge, le sexe, le poids, la durée d'intervention, le type d'abord chirurgical, la dose totale du fentanyl reçue jusqu'a l'incision, ainsi que les paramètres hémodynamiques avant l'incision. Après l'incision la FC moyenne a augmenté dans les deux groupes: 80,53±7,72 bpm dans le groupe contrôle et 76,85±8,52 bpm dans le groupe lidocaïne. La différence d'augmentation de la FC entre les deux groupes était statistiquement significative (p = 0,047). L

  15. Étude par analogie électrique de différents types de tubes à gaz pulsé : modélisation et expérience

    NASA Astrophysics Data System (ADS)

    Halouane, A.; Maréchal, J.-C.; David, M.


    The main purpose of this paper is to explain the operation of pulse tubes refrigerators (PTR) by a network theory approach: the voltage and the current represent respectively the hydrodynamic parameters pressure P and mass flow rate m of the system. Each impedance is treated as a circuit of equivalent electrical element: resistance, capacitance or inductance. At the hot end of the PTR, different phase shift systems are modelled in the same way and could be compared, as the orifice pulse tube refrigerator (OPTR), the double inlet pulse tube refrigerator (DIPTR), the modified pulse tube refrigerator (MPTR) whose phasor is a moving piston at the hot end, the hybrid pulse tube refrigerator (HPTR) with a sequential orifice opening and the OPTR with inertance (IOPTR). By combining the network approach with the thermal analysis of the regenerator and the thermodynamic analysis of the tube it is possible to predict the energy balance at the cold end: extracted power, regenerator and tube losses and the influence of dead volumes. Different solutions were pointed out to treat this model. If the parameters are not sinusoidal the system might be treated at an order greater than 1. This modelling was used to design a miniature PTR operating at high frequency (20-50) Hz and pressure higher than 2 MPa, developed in collaboration with “Air Liquide" firm. The rotary or linear compressor used has 1 cm3 swept-volume and is similar to that used on Stirling refrigerator and generate a quasi-sinusoidal pressure wave. Under a mean pressure of 3 MPa and a 27.5 Hz operating frequency, the lower temperature reached is 49 K with an available power of 1 W at 84 K, in a double inlet mode. Le principal objectif de cet article est de présenter le fonctionnement des tubes à gaz pulsé (TGP) par une analogie électrique [CITE] où la tension et le courant représentent les paramètres hydrodynamiques pression P et débit massique m du système. Toute impédance peut être traitée comme un

  16. Improving mating performance of mass-reared sterile Mediterranean fruit flies (Diptera: Tephritidae) through changes in adult holding conditions: demography and mating competitiveness

    SciTech Connect

    Liedo, P.; Salgado, S.; Oropeza, A.; Toledo, J.


    with wild flies. As colonization progressed, life expectancy and fecundity rates increased in the 3 rearing systems. There was no significant difference in standard quality control parameters among the 3 rearing systems. Wild males always achieved more matings than any of the mass reared males. Mating competitiveness of males from the IS, although surprisingly not from the SS, was significantly greater than that of males from the MS. Our results indicate that these slight changes in the adult holding conditions can significantly reduce the harmful effects of mass rearing on the mating performance of sterile flies. (author) [Spanish] Se ha demostrado que las condiciones de cria masiva afectan el comportamiento de apareamiento de la mosca del Mediterraneo Ceratitis capitata (Wiedemann). Nosotros evaluamos el efecto de ligeros cambios en las condiciones en las que los adultos son mantenidos para la produccion de huevos, en el desempeno de apareamiento de las moscas esteriles. La colonizacion se inicio con moscas silvestres colectadas como larvas en cerezas de cafe (Coffea arabica L.) infestadas. Cuando las pupas estuvieron cerca de la emergencia de los adultos, se dividieron en tres grupos al azar y los adultos recien emergidos fueron criados en las siguientes condiciones: (1) Sistema Metapa (MS, testigo), consistente en jaulas con marco de aluminio de 70 x 45 x 15 cm, cubiertas con malla, con una densidad de 2,200 moscas por jaula y una relacion de sexos inicial de 1:1; (2); Sistema Insertos (IS), con el mismo tipo de jaula, densidad de moscas, y relacion de sexos que en el MS, pero conteniendo 12 piezas de plexiglas (23 x 8.5 cm) para proporcionar superficie horizontal al interior de la jaula; y (3) Sistema de Relacion de Sexos (SS), igual que el IS, pero en este caso la relacion inicial macho: hembra fue de 4:1, tres dias despues se introdujeron hembras recien emergidas para tener una relacion de 3:1 y en el 6 dia se anadio otro grupo de hembras para tener una relacion

  17. Plan for a groundwater monitoring network in Taiwan

    NASA Astrophysics Data System (ADS)

    Hsu, Shiang-Kueen

    suivi des eaux souterraines à Taïwan". D'après ce programme, les données de base concernant les eaux souterraines, comprenant les mesures de niveau et les données de qualité, ont été acquises ; une base de données sûre est en cours d'élaboration, dans le but de gérer l'ensemble des ressources en eau. Cet article présente les buts, les stades de développement et une vue d'ensemble de ce plan. Le plan impose la mise en place de 517 stations de mesures hydrogéologiques et de 990 piézomètres en 17 ans. Selon ce programme, les variations du niveau des nappes doivent être suivies en continu, tandis que des échantillons pour la qualité de l'eau seront prélevés pour analyses uniquement au cours de la phase de foration, puis au moment de la mise en service des piézomètres. En 1996, le Département des Ressources en Eau et la Commission de Planification des Ressources en Eau ont été réunis pour former l'actuel Bureau des Ressources en Eau. Resumen En Taiwan, el rápido crecimiento económico, el aumento en el nivel de vida y los cambios sociales en los últimos años han resultado en un aumento en la demanda de agua. Por su estabilidad en términos de cantidad y calidad, las aguas subterráneas han sido durante años la fuente de agua para usos domésticos, agrícolas e industriales. En los últimos años, sin embargo, el establecimiento de un programa de gestión conjunta de aguas superficiales y subterráneas se ha visto comprometido por la falta de datos correspondientes a estas últimas. En 1992, el Departamento de Recursos de Agua (DWR) inició un programa titulado "Plan de Red de Control de Aguas Subterráneas en Taiwan". Bajo este programa, se están recogiendo datos básicos, incluyendo niveles piezométricos y datos de calidad, y se está construyendo una base de datos con el propósito de gestionar los recursos de agua totales. Este artículo presenta el marco, los objetivos y el estado de implantación del plan, que pretende la construcci

  18. Re-Os in FeNi, Sulfide, and Phosphide: The Possible Determination of Internal Isochrons for Iron Meteorites

    NASA Astrophysics Data System (ADS)

    Papanastassiou, D. A.; Shen, J. J.; Wasserburg, G. J.


    nature of Re and the PGE, under the reducing conditions in the solar nebula, we consider that the condensation of Re and the PGE and their subsequent incorporation into the FeNi did not result in significant Re/Os fractionation. We conclude that the data for the non-magmatic IA and IVA groups show a limited Re/Os fractionation and that the major dispersion in Re/Os for FeNi is obtained for members of the magmatic iron groups and is dominated by the melting and fractional crystallization of the metal phase. This Re/Os fractionation process then enables the determination of essentially whole-rock isochrons for iron meteorites, which date the melting and fractional crystallization of the metal phase on the parent planetesimals. The data on the Tres Castillos (IIIA group) FeNi show relatively low Re and Os concentrations, consistent with the Ni concentration. The results on the Tres Castillos FeNi are consistent with the well-defined, whole-rock Re-Os isochron determined by all irons analyzed. The data on the massive schreibersite lamella (3 cm x 5 mm) show low but significant levels of Re and Os, with metal to schreibersite partition coefficients of about 11 and 29 for Re and Os, respectively. The data, furthermore, demonstrate that the schreibersite has Re/Os which is significantly fractionated, by a factor of 2.7, relative to the coexisting FeNi. The schreibersite data yield a model age of 4.30+/-0.09 AE, indicating a disturbance at a time younger than 4.30 AE. The FeNi-schreibersite pair yields a two point line with a slope corresponding to an age of 4.11+/-0.11 AE. We consider this relatively young age as an indication of 1) a relatively late disturbance of the phosphide; 2) an indication of a relatively slow cooling rate at 1-2 degrees C/my; or 3) an indication that even the massive schreibersite may continue to act as an open system at reasonably low temperatures. We also consider that the Re-Os data on the schreibersite permit for the first time the application of

  19. Hydrochemical tracers in the middle Rio Grande Basin, USA: 2. Calibration of a groundwater-flow model

    NASA Astrophysics Data System (ADS)

    Sanford, Ward E.; Plummer, L. Niel; McAda, Douglas P.; Bexfield, Laura M.; Anderholm, Scott K.

    The calibration of a groundwater model with the aid of hydrochemical data has demonstrated that low recharge rates in the Middle Rio Grande Basin may be responsible for a groundwater trough in the center of the basin and for a substantial amount of Rio Grande water in the regional flow system. Earlier models of the basin had difficulty reproducing these features without any hydrochemical data to constrain the rates and distribution of recharge. The objective of this study was to use the large quantity of available hydrochemical data to help calibrate the model parameters, including the recharge rates. The model was constructed using the US Geological Survey's software MODFLOW, MODPATH, and UCODE, and calibrated using 14C activities and the positions of certain flow zones defined by the hydrochemical data. Parameter estimation was performed using a combination of nonlinear regression techniques and a manual search for the minimum difference between field and simulated observations. The calibrated recharge values were substantially smaller than those used in previous models. Results from a 30,000-year transient simulation suggest that recharge was at a maximum about 20,000 years ago and at a minimum about 10,000 years ago. Le calibrage d'un modèle hydrogéologique avec l'aide de données hydrochimiques a démontré que la recharge relativement faible dans le Grand Bassin du Middle Rio est vraisemblablement responsable d'une dépression des eaux souterraines dans le centre du bassin et de la présence d'une quantité substantielle d'eau du Rio Grande dans l'aquifère du Groupe de Santa Fe. Les modèles antérieurs avaient des difficultés à reproduire ses conclusions sans l'aide de données hydrochimiques pour contraindre les taux et la distribution de la recharge. L'objectif de cette étude était d'utiliser une grande quantité de données hydrochimiques permettant de calibrer les paramètres du modèle, et notamment les taux de recharge. Le modèle a

  20. Préface

    NASA Astrophysics Data System (ADS)

    Paulus, Werner; Meinnel, Jean


    'interaction entre le neutron et la matière, mais également une haute spécificité dans la conception et l'utilisation des diffractomètres et spectromètres neutroniques. Pour ces raisons, l'accès aux neutrons est souvent limité, sinon réservé à des spécialistes, ce qui freine tout naturellement l'utilisation par des chercheurs non familiarisés à ce domaine.Pour combattre ce déficit d'information et cet état de fait, en accord avec de nombreux collègues Rennais, nous avons proposé à la Société Française de Neutronique d'organiser une École d'été qui s'adresse plus spécialement à de non-spécialistes de la diffusion neutronique. Le public visé concernait donc à la fois les chercheurs confirmés mais peu familiarisés avec le domaine neutronique, mais aussi les jeunes chercheurs dès le niveau doctorant. En effet pour ces derniers, l'utilisation des “grands instruments" s'avère nécessaire pour qu'ils soient à la hauteur de leur sujet de thèse. Pour cette raison, il était évident d'intégrer cette École d'été dans le programme de l'École Doctorale “Sciences des Matériaux" de l'Université de Rennes 1 qui rassemble chimistes, physiciens et géologues. Dans le même contexte, notre intérêt était de proposer un large spectre de cours couvrant la diversité des applications de la diffusion neutronique dans les différents domaines de recherche en chimie et physique des matériaux, en sciences de la terre ainsi qu'en sciences pour l'ingénieur. Un deuxième but était de montrer de plus la complémentarité des neutrons et des rayons X et plus spécifiquement des X produits par rayonnement synchrotron.Dans l'avenir, nous sommes persuadés que la diffusion neutronique va jouer un rôle clé pour le développement de nouveaux matériaux et de leur caractérisation. Dans cette optique, des efforts considérables ont été déjà engagés aux États-Unis ainsi qu'au Japon où deux nouvelles sources de neutrons sont en cours de construction. Du point

  1. Fracture hydraulic conductivity in the Mexico City clayey aquitard: Field piezometer rising-head tests

    NASA Astrophysics Data System (ADS)

    Vargas, Carlos; Ortega-Guerrero, Adrián

    A regional lacustrine aquitard covers the main aquifer of the metropolitan area of Mexico City. The aquitard's hydraulic conductivity (K') is fundamental for evaluating the natural protection of the aquifer against a variety of contaminants present on the surface and its hydraulic response. This study analyzes the distribution and variation of K' in the plains of Chalco, Texcoco and Mexico City (three of the six former lakes that existed in the Basin of Mexico), on the basis of 225 field-permeability tests, in nests of existing piezometers located at depths of 2-85 m. Tests were interpreted using the Hvorslev method and some by the Bouwer-Rice method. Results indicate that the distribution of K' fits log-Gaussian regression models. Dominant frequencies for K' in the Chalco and Texcoco plains range between 1E-09 and 1E-08 m/s, with similar population means of 1.19E-09 and 1.7E-09 m/s, respectively, which are one to two orders of magnitude higher than the matrix conductivity. In the Mexico City Plain the population mean is near by one order of magnitude lower; K'=2.6E-10 m/s. The contrast between the measured K' and that of the matrix is attributed to the presence of fractures in the upper 25-40 m, which is consistent with the findings of previous studies on solute migration in the aquitard. Un imperméable régional d'origine lacustre recouvre le principal aquifère de la zone urbaine de la ville de Mexico. La conductivité hydraulique K' de cet imperméable est fondamentale pour évaluer la protection naturelle de l'aquifère, contre les différents contaminants présents en surface, et sa réponse hydraulique. Cette étude analyse et les variations de K' dans les plaines de Chalco, Texcoco et Mexico (trois des six anciens lacs qui existaient dans le Bassin de Mexico), sur la base de 225 essais de perméabilité sur le terrain, réalisés en grappes dans des piézomètres existants entre 2 et 85 m de profondeur. Les essais ont été interprétés avec la m

  2. Geomorphic aspects of groundwater flow

    NASA Astrophysics Data System (ADS)

    LaFleur, Robert G.

    The many roles that groundwater plays in landscape evolution are becoming more widely appreciated. In this overview, three major categories of groundwater processes and resulting landforms are considered: (1) Dissolution creates various karst geometries, mainly in carbonate rocks, in response to conditions of recharge, geologic setting, lithology, and groundwater circulation. Denudation and cave formation rates can be estimated from kinetic and hydraulic parameters. (2) Groundwater weathering generates regoliths of residual alteration products at weathering fronts, and subsequent exhumation exposes corestones, flared slopes, balanced rocks, domed inselbergs, and etchplains of regional importance. Groundwater relocation of dissolved salts creates duricrusts of various compositions, which become landforms. (3) Soil and rock erosion by groundwater processes include piping, seepage erosion, and sapping, important agents in slope retreat and headward gully migration. Thresholds and limits are important in many chemical and mechanical groundwater actions. A quantitative, morphometric approach to groundwater landforms and processes is exemplified by selected studies in carbonate and clastic terrains of ancient and recent origins. Résumé Les rôles variés joués par les eaux souterraines dans l'évolution des paysages deviennent nettement mieux connus. La revue faite ici prend en considération trois grandes catégories de processus liés aux eaux souterraines et les formes associées: (1) La dissolution crée des formes karstiques variées, surtout dans les roches carbonatées, en fonction des conditions d'alimentation, du cadre géologique, de la lithologie et de la circulation des eaux souterraines. Les taux d'érosion et de formation des grottes peuvent être estimés à partir de paramètres cinétiques et hydrauliques. (2) L'érosion par les eaux souterraines donne naissance à des régolites, résidus d'altération sur des fronts d'altération, et l'exhumation r

  3. Inverse modeling of groundwater flow in the semiarid evaporitic closed basin of Los Monegros, Spain

    NASA Astrophysics Data System (ADS)

    Samper-Calvete, F. J.; García-Vera, M. A.

    ha a été programmée, en partie dans un bassin évaporitique fermé où existent des lacs de playa. Le projet a fait émergé des préoccupations environnementales. L'évaluation des impacts hydrologiques de l'irrigation implique de quantifier correctement l'hydrogéologie de cette région. A partir des informations disponibles, un modèle hydrogéologique conceptuel a étéétabli il identifie deux aquifères principaux interconnectés par drainance au travers d'un imperméable. Un modèle numérique, établi sur la base de ce modèle conceptuel, a été calibré en conditions de régime permanent, en utilisant la méthode d'estimation automatique du maximum de vraisemblance des paramètres (Carrera and Neuman, 1986a). Le modèle calibré reproduit correctement la piézométrie mesurée et est en accord avec les informations concernant l'écoulement des nappes. La résolution du problème inverse a fourni des estimations acceptables des paramètres. On en a conclu que l'anisotropie joue un rôle essentiel dans certaines parties de l'aquifère inférieur. La moyenne géométrique de la conductivité hydraulique est d'environ deux ordres de grandeur plus élevée que la conductivité hydraulique moyenne obtenue par des essais de terrain à l'échelle locale. Cet effet d'échelle sur la conductivité hydraulique est conforme aux résultats obtenus par Neuman (1994) et Sánchez-Vila et al. (1996). Resumen La hidrogeología de zonas endorreicas en zonas evaporíticas ha recibido muy poca atención en el pasado debido fundamentalmente a que en estas zonas las aguas subterráneas tienen una elevada salinidad debido a la alta solubilidad de sus materiales. El interés por la hidrogeología de la zona de Los Monegros en el noreste de España surgió a raiz de la aprobación en 1986 del proyecto de Los Monegros II en la zona central del valle del Ebro que contempla la puesta en regadío de 60,000 ha, algunas de las cuales se encuentran situadas en la zona endorreica de Los

  4. Evaluation of probabilistic flow in two unsaturated soils

    NASA Astrophysics Data System (ADS)

    Boateng, Samuel


    ées. Les propriétés sont basées sur le modèle de van Genuchten. Le domaine d'écoulement possède une surface de recharge, une limite de fuite à sa base et des limites sans écoulement sur les côtés. Les variables incertaines sont la teneur en eau à saturation, la teneur en eau résiduelle, les paramètres alpha (α) et n du modèle de van Genuchten et la conductivité hydraulique à saturation. L'objectif est d'évaluer la signification de chacune des variables incertaines dans l'écoulement probabiliste. Dans des conditions humides, la teneur en eau à saturation et la teneur en eau résiduelle sont les variables incertaines les plus significatives dans le sable. Toutefois, dans des conditions sèches dans le sable, les paramètres α et n du modèle de van Genuchten sont les plus significatifs. Le paramètre n du modèle et la conductivité hydraulique à saturation sont les plus significatifs pour un sol argileux humide. La teneur en eau à saturation est très significative pour le sol argileux sec. Resumen. Se ha acoplado un modelo de flujo de saturación variable con un algoritmo de fiabilidad de primer orden con el fin de simular el flujo no saturado en dos tipos de suelos. Se ha tratado las propiedades del suelo no saturado como variables inciertas, a las que se asigna las medias, desviaciones estándar y distribuciones de probabilidad marginal correspondientes. Así, cada simulación constituye un evento probabilístico de flujo no saturado y la sensibilidad de las variables inciertas es estimada para cada evento. Se ha utilizado las propiedades de la conductividad hidráulica no saturada de dos suelos con dos tipos de textura - fina y gruesa - mediante el modelo de van Genuchten. El dominio de flujo está delimitado por una superficie de recarga, base de goteo y contornos laterales de flujo nulo. Las variables inciertas son el contenido de agua residual, el de saturación, los parámetros del modelo de van Genuchten (α y n) y la conductividad hidr

  5. Geology and hydrogeology of the Dammam Formation in Kuwait

    NASA Astrophysics Data System (ADS)

    Al-Awadi, E.; Mukhopadhyay, A.; Al-Senafy, M. N.

    différence de niveau piézométrique est observée entre la formation de Damman et le groupe de Koweit qui la recouvre en discordance; cette différence est due à la présence d'un niveau imperméable qui la maintient captive. Resumen La Formación Damman, del Eoceno Medio, es uno de los mayores acuíferos de agua salobre aprovechable en Kuwait. Además de una zona de paleokarst en la parte superior, la Formación Damman en Kuwait consiste en 150-200m de caliza dolomitizada, que se subdivide en tres zonas en función de la litología y la biofacies. La parte superior está formada por dolomicrita yesífera friable y dolomita. La parte central es básicamente biomicrita laminada y biodolomicrita. La inferior es caliza nummulítica, con intercalaciones de pizarra en la base. Los marcadores geofísicos reflejan claramente estas subdivisiones. Los análisis de testigos revelan que la parte superior es la más porosa y permeable de las tres unidades. Esto queda confirmado con la distribución de zonas de circulación perdidas. La calidad del agua en el acuífero se deteriora hacia el norte y el este. Sobre la Formación Damman, y de manera no conforme, suprayace otra formación, que se conoce como Grupo Kuwaití. Existe una diferencia de niveles piezométricos entre ambas formaciones, la cual se mantiene por la presencia de una capa semiconfinante.

  6. The Dammam aquifer in Bahrain - Hydrochemical characterization and alternatives for management of groundwater quality

    NASA Astrophysics Data System (ADS)

    Zubari, Waleed K.

    Over-ion of the Dammam aquifer, the principal aquifer in Bahrain, by the agricultural and domestic sectors, has led to its salinization by adjacent brackish and saline water bodies. A hydrochemical study identified the locations of the sources of aquifer salinization and delineated their areas of influence. The investigation indicates that the aquifer water quality is significantly modified as groundwater flows from the northwestern parts of Bahrain, where the aquifer receives its water by lateral underflow from eastern Saudi Arabia, to the southern and southeastern parts. Four types of salinization of the aquifer are identified: brackish-water up-flow from the underlying brackish-water zones in north-central, western, and eastern regions; seawater intrusion in the eastern region; intrusion of sabkha water in the southwestern region; and irrigation return flow in a local area in the western region. Four alternatives for the management of groundwater quality that are available to the water authorities in Bahrain are discussed and their priority areas are proposed, based on the type and extent of each salinization source, in addition to groundwater use in that area. The effectiveness of the proposed management options in controlling the degradation of water quality in the Dammam aquifer should be evaluated using simulation modeling. Résumé La surexploitation de l'aquifère de Damman, principal aquifère de Bahreïn, du fait des besoins agricoles et domestiques, a conduit à sa salinisation à partir d'eaux voisines saumâtres et salées. Une étude hydrochimique a identifié les origines de la salinisation de l'aquifère et a délimité leurs zones d'influence. Les recherches montrent que la qualité de l'eau souterraine est modifiée de façon significative pour les écoulements souterrains dirigés vers les secteurs sud et sud-est et provenant de la région nord-ouest de Bahreïn, là où l'aquifère est alimenté latéralement à partir de l'Arabie Saoudite

  7. Geomorphic aspects of groundwater flow

    NASA Astrophysics Data System (ADS)

    LaFleur, Robert G.

    The many roles that groundwater plays in landscape evolution are becoming more widely appreciated. In this overview, three major categories of groundwater processes and resulting landforms are considered: (1) Dissolution creates various karst geometries, mainly in carbonate rocks, in response to conditions of recharge, geologic setting, lithology, and groundwater circulation. Denudation and cave formation rates can be estimated from kinetic and hydraulic parameters. (2) Groundwater weathering generates regoliths of residual alteration products at weathering fronts, and subsequent exhumation exposes corestones, flared slopes, balanced rocks, domed inselbergs, and etchplains of regional importance. Groundwater relocation of dissolved salts creates duricrusts of various compositions, which become landforms. (3) Soil and rock erosion by groundwater processes include piping, seepage erosion, and sapping, important agents in slope retreat and headward gully migration. Thresholds and limits are important in many chemical and mechanical groundwater actions. A quantitative, morphometric approach to groundwater landforms and processes is exemplified by selected studies in carbonate and clastic terrains of ancient and recent origins. Résumé Les rôles variés joués par les eaux souterraines dans l'évolution des paysages deviennent nettement mieux connus. La revue faite ici prend en considération trois grandes catégories de processus liés aux eaux souterraines et les formes associées: (1) La dissolution crée des formes karstiques variées, surtout dans les roches carbonatées, en fonction des conditions d'alimentation, du cadre géologique, de la lithologie et de la circulation des eaux souterraines. Les taux d'érosion et de formation des grottes peuvent être estimés à partir de paramètres cinétiques et hydrauliques. (2) L'érosion par les eaux souterraines donne naissance à des régolites, résidus d'altération sur des fronts d'altération, et l'exhumation r

  8. Etude thermo-aeraulique d'une piscine interieure

    NASA Astrophysics Data System (ADS)

    Guerfala, Nasreddine

    Les grands espaces fermés (amphithéâtres, supermarchés, gymnases et piscines) jouent un rôle essentiel dans l'économie et la société canadienne mais n'assurent pas nécessairement le confort thermique et la bonne qualité de l'air intérieur. En outre, leur consommation énergétique demeure très élevée. Plus spécifiquement, les piscines intérieures présentent certaines particularités telles qu'une humidité relative élevée, une température contrôlée de l'eau et une condensation possible sur les parois ce qui rend la tâche d'assurer le confort des baigneurs encore plus difficile. Rares sont les études réalisées pour ce type de bâtiment malgré l'existence de pistes d'optimisation de la consommation énergétique et l'amélioration de la qualité d'air intérieur. Dans cette optique, ce mémoire présente une étude thermo-aéraulique réalisée sur la piscine intérieure de l'Université Bishop's (Sherbrooke, Canada). La simulation numérique a été effectuée en utilisant le logiciel TRNSYS. L'approche adoptée pour la modélisation est la méthode zonale qui découpe l'espace de travail étudié en plusieurs zones fictives tout en calculant les caractéristiques thermo-aérauliques (température, pression, nombre de changement d'air par heure). D'autre part, une validation expérimentale en situations réelles est mise en œuvre au sein de cette piscine moyennant un dispositif expérimental spécifique. Ce dernier a été conçu spécialement pour s'adapter aux caractéristiques du milieu (hauteur du bâtiment, présence de l'eau et forte humidité) afin de mesurer la température, la pression et la vitesse de l'air dans plusieurs endroits significatifs de la piscine. Cette étude développe un outil de calcul capable de prédire les températures de différentes zones thermiques et des surfaces de l'enveloppe du bâtiment d'une part et de calculer le débit massique de l'air entre les zones ainsi que le nombre de changement d'air par

  9. Etude theorique et experimentale des evaporateurs de dioxyde de carbone operant dans des conditions de givrage

    NASA Astrophysics Data System (ADS)

    Bendaoud, Adlane Larbi

    . Dans la partie theorique, un modele traitant les aspects thermique, hydrodynamique et massique a ete elabore. Sur la base de ce modele a ete ecrit un programme informatique en langage FORTRAN 6.6. Il est base sur la discretisation du serpentin en volumes de controle, est entierement automatise et peut traiter des echangeurs de chaleur avec des circuits de refrigerant complexes pouvant avoir des entrees et sorties multiples ainsi que des bifurcations. La presence simultanee des trois phases thermodynamiques du refrigerant (liquide sous refroidi, fluide sature, vapeur surchauffee) dans le serpentin est aussi prise en charge. Le modele a ete valide pour un fonctionnement avec et sans formation de givre en utilisant des donnees experimentales disponibles dans la litterature et celles obtenues sur le banc d'essai de CanmetENERGIE. Celui-ci a ete mis a jour pour les besoins de la presente recherche et pour cela, un systeme de surchauffe et d'injection de la vapeur d'eau dans une enceinte a tres basse temperature a ete dimensionne, fabrique et installe. Un dispositif de visualisation de la formation de givre, ainsi qu'un equipement de mesure de la temperature, de la pression et de l'humidite relative de l'air ont aussi ete ajoutes. Une fois le modele valide, des simulations numeriques sur le serpentin avec et sans formation de givre ont ete effectuees. Un premier cas de base a servi comme reference pour d'autres cas pour lesquels une etude parametrique sur la geometrie et le fonctionnement a ete menee. Il a ete montre par rapport au cas de base que : 1. la diminution de la densite des ailettes sur des rangees specifiques du serpentin donne une surface minimale (Amin) plus grande, retardant ainsi l'obstruction totale du serpentin par le givre et permet donc un temps de fonctionnement plus grand et une frequence de degivrage plus faible. 2. une bonne configuration de circuit de refrigerant augmente le temps de fonctionnement du serpentin de 200 % et delivre une puissance

  10. Inverse problem in hydrogeology

    NASA Astrophysics Data System (ADS)

    Carrera, Jesús; Alcolea, Andrés; Medina, Agustín; Hidalgo, Juan; Slooten, Luit J.


    The state of the groundwater inverse problem is synthesized. Emphasis is placed on aquifer characterization, where modelers have to deal with conceptual model uncertainty (notably spatial and temporal variability), scale dependence, many types of unknown parameters (transmissivity, recharge, boundary conditions, etc.), nonlinearity, and often low sensitivity of state variables (typically heads and concentrations) to aquifer properties. Because of these difficulties, calibration cannot be separated from the modeling process, as it is sometimes done in other fields. Instead, it should be viewed as one step in the process of understanding aquifer behavior. In fact, it is shown that actual parameter estimation methods do not differ from each other in the essence, though they may differ in the computational details. It is argued that there is ample room for improvement in groundwater inversion: development of user-friendly codes, accommodation of variability through geostatistics, incorporation of geological information and different types of data (temperature, occurrence and concentration of isotopes, age, etc.), proper accounting of uncertainty, etc. Despite this, even with existing codes, automatic calibration facilitates enormously the task of modeling. Therefore, it is contended that its use should become standard practice. L'état du problème inverse des eaux souterraines est synthétisé. L'accent est placé sur la caractérisation de l'aquifère, où les modélisateurs doivent jouer avec l'incertitude des modèles conceptuels (notamment la variabilité spatiale et temporelle), les facteurs d'échelle, plusieurs inconnues sur différents paramètres (transmissivité, recharge, conditions aux limites, etc.), la non linéarité, et souvent la sensibilité de plusieurs variables d'état (charges hydrauliques, concentrations) des propriétés de l'aquifère. A cause de ces difficultés, le calibrage ne peut êtreséparé du processus de modélisation, comme c'est le

  11. Approaches to optimal aquifer management and intelligent control in a multiresolutional decision support system

    NASA Astrophysics Data System (ADS)

    Orr, Shlomo; Meystel, Alexander M.


    Despite remarkable new developments in stochastic hydrology and adaptations of advanced methods from operations research, stochastic control, and artificial intelligence, solutions of complex real-world problems in hydrogeology have been quite limited. The main reason is the ultimate reliance on first-principle models that lead to complex, distributed-parameter partial differential equations (PDE) on a given scale. While the addition of uncertainty, and hence, stochasticity or randomness has increased insight and highlighted important relationships between uncertainty, reliability, risk, and their effect on the cost function, it has also (a) introduced additional complexity that results in prohibitive computer power even for just a single uncertain/random parameter; and (b) led to the recognition in our inability to assess the full uncertainty even when including all uncertain parameters. A paradigm shift is introduced: an adaptation of new methods of intelligent control that will relax the dependency on rigid, computer-intensive, stochastic PDE, and will shift the emphasis to a goal-oriented, flexible, adaptive, multiresolutional decision support system (MRDS) with strong unsupervised learning (oriented towards anticipation rather than prediction) and highly efficient optimization capability, which could provide the needed solutions of real-world aquifer management problems. The article highlights the links between past developments and future optimization/planning/control of hydrogeologic systems. Malgré de remarquables nouveaux développements en hydrologie stochastique ainsi que de remarquables adaptations de méthodes avancées pour les opérations de recherche, le contrôle stochastique, et l'intelligence artificielle, solutions pour les problèmes complexes en hydrogéologie sont restées assez limitées. La principale raison est l'ultime confiance en les modèles qui conduisent à des équations partielles complexes aux paramètres distribués (PDE) à une

  12. Approaches to optimal aquifer management and intelligent control in a multiresolutional decision support system

    NASA Astrophysics Data System (ADS)

    Orr, Shlomo; Meystel, Alexander M.


    Despite remarkable new developments in stochastic hydrology and adaptations of advanced methods from operations research, stocha