Science.gov

Sample records for dechets tres faiblement

  1. Influence des inclusions sur la rupture d'un acier faiblement allié

    NASA Astrophysics Data System (ADS)

    Hausild, P.; Berdin, C.; Bompard, P.; Prioul, C.

    2003-03-01

    L'étude de la rupture d'un acier faiblement allié dans le domaine de la transition ductile fragile a permis de mettre en évidence la présence croissante, avec la température de sollicitation, d'amas d'inclusions de seconde phase sur les surfaces de rupture. On montre, à l'aide de modélisations par éléments finis, que ces amas jouent néanmoins un rôle mineur dans le déclenchement du clivage. En revanche, leur influence sur la propagation de la rupture ductile est importante. On peut alors expliquer l'anisotropie de la résilience en prenant en compte la géométrie des inclusions et leur répartition spatiale.

  2. Study of TrES-3 Exoplanet

    NASA Astrophysics Data System (ADS)

    Vodniza, A. Q.; Rojas, M.; Reyes, K.

    2011-10-01

    The first amateur observation of an exoplanet was made from the Nyrola Observatory in September 16, 2000. (Marko Moilanen, Jalo Ojanperä, Jouni Sorvari, Aki Id and Arto Oksanen). The jovian-type planet orbits a star that is 153 light years far away, and was called HD209458b in Pegasus [1]. The equipment used by this Observatory was a 16 inches MEADE LX200, a ST7E CCD SBIG camera with a V photometric filter and an f/6.3 focal distance reducer. At the University of Nariño Observatory we have a similar equipment. The equipment we employed is: 14"LX200 GPS MEADE telescope and STL-1001 SBIG. The camera we used in our search is much more sensible than the one used by the Nyrola Observatory [2]. From the Astronomical Observatory at the University of Nariño-COLOMBIA, we begun a systematic search for exoplanets. We have already confirmed the transit of the exoplanet TrES-3. This exoplanet was discovered by O'Donovan and other investigators, and turns around the GSC 03089- 00929, with an orbital period of 1.30619 days (31.34856 hours) and inclination of 82.15 deg [3]. The TrES-3 is quite interesting because it has one of the smallest periods found on exoplanets. Jessie L. Christiansen, et.al. observed seven transits and they found that the duration of transit is 81.9+/-1.1 minutes and inclination of 81.99+/-0.30 deg [4], [5]. We have captured a lot of data to elaborate the lightcurves so we can estimate the physical parameters of the exoplanet.

  3. TRES survey of variable diffuse interstellar bands

    NASA Astrophysics Data System (ADS)

    Law, Charles J.; Milisavljevic, Dan; Crabtree, Kyle N.; Johansen, Sommer L.; Patnaude, Daniel J.; Margutti, Raffaella; Parrent, Jerod T.; Drout, Maria R.; Sanders, Nathan E.; Kirshner, Robert P.; Latham, David W.

    2017-09-01

    Diffuse interstellar bands (DIBs) are absorption features commonly observed in optical/near-infrared spectra of stars and thought to be associated with polyatomic molecules that comprise a significant reservoir of organic material in the Universe. However, the central wavelengths of almost all DIBs do not correspond with electronic transitions of known atomic or molecular species and the specific physical nature of their carriers remains inconclusive despite decades of observational, theoretical and experimental research. It is well established that DIB carriers are located in the interstellar medium, but the recent discovery of time-varying DIBs in the spectra of the extragalactic supernova SN 2012ap suggests that some may be created in massive star environments. Here, we report evidence of short time-scale (∼10-60 d) changes in DIB absorption line substructure towards 3 of 17 massive stars observed as part of a pathfinder survey of variable DIBs conducted with the 1.5-m Tillinghast telescope and Tillinghast Reflector Echelle Spectrograph (TRES) at Fred L. Whipple Observatory. The detections are made in high-resolution optical spectra (R ∼ 44 000) having signal-to-noise ratios of 5-15 around the 5797 and 6614 Å features, and are considered significant but requiring further investigation. We find that these changes are potentially consistent with interactions between stellar winds and DIB carriers in close proximity. Our findings motivate a larger survey to further characterize these variations and may establish a powerful new method for probing the poorly understood physical characteristics of DIB carriers.

  4. Detected Timing for Exoplanet TrES-5b. Possible Existence of Exoplanet TrES-5c

    NASA Astrophysics Data System (ADS)

    Sokov, E. N.; Sokova, I. A.; Dyachenko, V. V.; Rastegaev, D. A.; Rusov, S. A.

    2017-06-01

    In this paper, we present timing variations detected for the TrES-5b exoplanet. To obtain necessary photometric data for this exoplanet, we have organized an international campaign for exoplanet searching based on the Transit Timing Variation (TTV) method. We managed to collect N light curves for TrEs-5b. On the basis of the obtained data, we detected timing variations with the period P ≍ 100 days. We carried out the N-body modelling by means of the three-body problem. We detected a perturbation of TrES-5b which can be caused by a second exoplanet in the TrES-5 system. We calculated possible masses and resonances of the objects: M ˜ 0.24 Mjup on the 1:2 Resonance and M ˜ 3.15 Mjup on the 1:3 Resonance.

  5. Ecological protection in the Las Tres Virgenes, Mexico, geothermal field

    SciTech Connect

    Zirahuen Ortega Varela, J.R.

    1996-12-31

    The programs of environmental protection designed by Comision Federal de Electricidad are described in a general way. These programs detect, avoid, soften and compensate the environmental impacts product of the exploration, construction and operation activities of the geothermal field Las Tres Virgenes, this field is in the buffer zone of the biosphere reserve {open_quotes}El Vizcaino{close_quotes} at the north of the State of Baja California Sur, Mexico.

  6. APOSTLE: 11 TRANSIT OBSERVATIONS OF TrES-3b

    SciTech Connect

    Kundurthy, P.; Becker, A. C.; Agol, E.; Barnes, R.; Williams, B.

    2013-02-10

    The Apache Point Survey of Transit Lightcurves of Exoplanets (APOSTLE) observed 11 transits of TrES-3b over two years in order to constrain system parameters and look for transit timing and depth variations. We describe an updated analysis protocol for APOSTLE data, including the reduction pipeline, transit model, and Markov Chain Monte Carlo analyzer. Our estimates of the system parameters for TrES-3b are consistent with previous estimates to within the 2{sigma} confidence level. We improved the errors (by 10%-30%) on system parameters such as the orbital inclination (i {sub orb}), impact parameter (b), and stellar density ({rho}{sub *}) compared to previous measurements. The near-grazing nature of the system, and incomplete sampling of some transits, limited our ability to place reliable uncertainties on individual transit depths and hence we do not report strong evidence for variability. Our analysis of the transit timing data shows no evidence for transit timing variations and our timing measurements are able to rule out super-Earth and gas giant companions in low-order mean motion resonance with TrES-3b.

  7. 75 FR 57747 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-09-22

    ... the certificated capacities of its three in-service natural gas storage caverns to the actual... Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application September 15, 2010. Take notice that on September 3, 2010, Tres Palacios Gas Storage LLC (Tres Palacios), 53...

  8. 78 FR 77445 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-12-23

    ... Palacios to abandon up to 22.9 Bcf of working gas storage capacity in its salt cavern natural gas storage... Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on December 6, 2013, Tres Palacios Gas Storage LLC (Tres Palacios) 700 Louisiana Street, Suite 2060,...

  9. 77 FR 789 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-01-06

    ... Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on December 20, 2011, Tres Palacios Gas Storage LLC (Tres Palacios), Two Brush Creek Boulevard, Kansas City... gas processing plant as a receipt point on its storage facility header pipeline system by:...

  10. Seismic Activity at tres Virgenes Volcanic and Geothermal Field

    NASA Astrophysics Data System (ADS)

    Antayhua, Y. T.; Lermo, J.; Quintanar, L.; Campos-Enriquez, J. O.

    2013-05-01

    The volcanic and geothermal field Tres Virgenes is in the NE portion of Baja California Sur State, Mexico, between -112°20'and -112°40' longitudes, and 27°25' to 27°36' latitudes. Since 2003 Power Federal Commission and the Engineering Institute of the National Autonomous University of Mexico (UNAM) initiated a seismic monitoring program. The seismograph network installed inside and around the geothermal field consisted, at the beginning, of Kinemetrics K2 accelerometers; since 2009 the network is composed by Guralp CMG-6TD broadband seismometers. The seismic data used in this study covered the period from September 2003 - November 2011. We relocated 118 earthquakes with epicenter in the zone of study recorded in most of the seismic stations. The events analysed have shallow depths (≤10 km), coda Magnitude Mc≤2.4, with epicentral and hypocentral location errors <2 km. These events concentrated mainly below Tres Virgenes volcanoes, and the geothermal explotation zone where there is a system NW-SE, N-S and W-E of extensional faults. Also we obtained focal mechanisms for 38 events using the Focmec, Hash, and FPFIT methods. The results show normal mechanisms which correlate with La Virgen, El Azufre, El Cimarron and Bonfil fault systems, whereas inverse and strike-slip solutions correlate with Las Viboras fault. Additionally, the Qc value was obtained for 118 events. This value was calculated using the Single Back Scattering model, taking the coda-waves train with window lengths of 5 sec. Seismograms were filtered at 4 frequency bands centered at 2, 4, 8 and 16 Hz respectively. The estimates of Qc vary from 62 at 2 Hz, up to 220 at 16 Hz. The frequency-Qc relationship obtained is Qc=40±2f(0.62±0.02), representing the average attenuation characteristics of seismic waves at Tres Virgenes volcanic and geothermal field. This value correlated with those observed at other geothermal and volcanic fields.

  11. The Prograde Orbit of Exoplanet TrES-2b

    NASA Astrophysics Data System (ADS)

    Winn, Joshua N.; Johnson, John Asher; Narita, Norio; Suto, Yasushi; Turner, Edwin L.; Fischer, Debra A.; Butler, R. Paul; Vogt, Steven S.; O'Donovan, Francis T.; Gaudi, B. Scott

    2008-08-01

    We monitored the Doppler shift of the G0 V star TrES-2 throughout a transit of its giant planet. The anomalous Doppler shift due to stellar rotation (the Rossiter-McLaughlin effect) is discernible in the data, with a signal-to-noise ratio of 2.9, even though the star is a slow rotator. By modeling this effect we find that the planet's trajectory across the face of the star is tilted by -9° ± 12° relative to the projected stellar equator. With 98% confidence, the orbit is prograde. Data presented herein were obtained at the W. M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and was made possible by the generous financial support of the W. M. Keck Foundation.

  12. Near-UV and optical observations of the transiting exoplanet TrES-3b

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Smart, Brianna M.; Hardegree-Ullman, Kevin K.; Carleton, Timothy M.; Walker-LaFollette, Amanda M.; Crawford, Benjamin E.; Smith, Carter-Thaxton W.; McGraw, Allison M.; Small, Lindsay C.; Rocchetto, Marco; Cunningham, Kathryn I.; Towner, Allison P. M.; Zellem, Robert; Robertson, Amy N.; Guvenen, Blythe C.; Schwarz, Kamber R.; Hardegree-Ullman, Emily E.; Collura, Daniel; Henz, Triana N.; Lejoly, Cassandra; Richardson, Logan L.; Weinand, Michael A.; Taylor, Joanna M.; Daugherty, Michael J.; Wilson, Ashley A.; Austin, Carmen L.

    2013-01-01

    We observed nine primary transits of the hot Jpiter TrES-3b in several optical and near-UV photometric bands from 2009 June to 2012 April in an attempt to detect its magnetic field. Vidotto, Jardine and Helling suggest that the magnetic field of TrES-3b can be constrained if its near-UV light curve shows an early ingress compared to its optical light curve, while its egress remains unaffected. Predicted magnetic field strengths of Jpiter-like planets should range between 8 G and 30 G. Using these magnetic field values and an assumed B* of 100 G, the Vidotto et al. method predicts a timing difference of 5-11 min. We did not detect an early ingress in our three nights of near-UV observations, despite an average cadence of 68 s and an average photometric precision of 3.7 mmag. However, we determined an upper limit of TrES-3b's magnetic field strength to range between 0.013 and 1.3 G (for a 1-100 G magnetic field strength range for the host star, TrES-3) using a timing difference of 138 s derived from the Nyquist-Shannon sampling theorem. To verify our results of an abnormally small magnetic field strength for TrES-3b and to further constrain the techniques of Vidotto et al., we propose future observations of TrES-3b with other platforms capable of achieving a shorter near-UV cadence. We also present a refinement of the physical parameters of TrES-3b, an updated ephemeris and its first published near-UV light curve. We find that the near-UV planetary radius of Rp = 1.386+ 0.248- 0.144 RJup is consistent with the planet's optical radius.

  13. The University of Arizona Astronomy Club Follow-Up Observations of Transiting Extrasolar Planets TrES-3b and TrES-4b

    NASA Astrophysics Data System (ADS)

    Walker-LaFollette, Amanda; Turner, J. D.; Hardegree-Ullman, K. K.; Smart, B. M.; Crawford, B. E.; Carleton, T. M.; Guvenen, B. C.; Towner, A. P. M.; Smith, C. W.; Small, L. C.; McGraw, A. M.; Wilson, A. A.

    2012-01-01

    It has been suggested by Vidotto et. al. (2011) that it is possible to detect the magnetic field of a transiting exoplanet by comparing near-UV and optical light curve asymmetries. The University of Arizona Astronomy Club has observed the primary transits of extrasolar planets TrES-3b and TrES-4b using near-UV and optical filters in order to detect this phenomenon. One of the goals of this project is to involve undergraduates in observational astronomy research and give them practical experience using IRAF and a research-class telescope. In addition to magnetic field observations, we have refined previously published values for the characteristic parameters of these planets.

  14. The University of Arizona Astronomy Club Observations of Transiting Extrasolar Planets TrES-3b and TrES-4b

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Hardegree-Ullman, K.; Smart, B.; Walker-LaFollette, A.; Cunningham, K.; Hardegree-Ullman, E. E.; Crawford, B.; Mueting, J.; Carleton, T.; Schwarz, K.; Robertson, A.; Guvenen, B.; Towner, A.; Austin, C.; Henz, T.; Keys, D.; Johnson, K.

    2011-05-01

    Using the Steward Observatory 61" Kuiper Telescope, The University of Arizona Astronomy Club observed extrasolar planets TrES-3b and TrES-4b. We observed the planets with the Harris-B, V, and R filters as they transited their parent stars during the months of May-July 2009. The main goal of this project was to get undergraduates involved with a research astronomy project and allow them to gain experience beyond what they would receive in the classroom. Many of the team members were introduced to astronomical observing techniques and data reduction using IRAF. Part of the project involved determining the optimum number of flat-field and bias frames required for image calibrations. With our results, we have been able to confirm and refine previously published values for the planets' orbital inclination, mass, radius, and density.

  15. Photometric investigation of hot exoplanets: TrES-3b and Qatar-1b

    NASA Astrophysics Data System (ADS)

    Püsküllü, Ç.; Soydugan, F.; Erdem, A.; Budding, E.

    2017-08-01

    New photometric follow-up observations of transitting 'hot Jupiters' TrES-3b and Qatar-1b are presented. Weighted mean values of the solutions of light curves in R-filter for both planetary systems are reported and compared with the previous results. The transit light curves were analysed using the WINFITTER code. The physical properties of the planets were estimated. The planet radii are found to be Rp = 1.381 ± 0.033RJ for TrES-3b and Rp = 1.142 ± 0.025RJ for Qatar-1b. Transit times and their uncertainties were also determined and a new linear ephemeris was computed for both systems. Analysis of transit times showed that a significant signal could not be determined for TrES-3b, while weak evidence was found for Qatar-1b, which might be tested using more precise future transit times.

  16. Chemical Composition of the Planet-harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, Alessandro; Yong, David; Carney, Bruce W.; Laird, John B.; Latham, David W.; Torres, Guillermo

    2006-04-01

    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck HIRES and Hobby-Eberly Telescope HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]>=-0.02+/-0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way. TrES-1 is found to be very likely a member of the thin-disk population. By comparing α-element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]>~0.0) stars with planets appear to be systematically underabundant in [α/Fe] by ~0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  17. Chemical Composition of the Planet-Harboring Star TrES-1

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Yong, D.; Carney, B. W.; Laird, J. B.; Latham, D. W.; Torres, G.

    2005-12-01

    We present a detailed chemical abundance analysis of the parent star of the transiting extrasolar planet TrES-1. Based on high-resolution Keck/HIRES and HET/HRS spectra, we have determined abundances relative to the Sun for 16 elements (Na, Mg, Al, Si, Ca, Sc, Ti, V, Cr, Mn, Co, Ni, Cu, Zn, Y, and Ba). The resulting average abundance of <[X/H]> = -0.02± 0.06 is in good agreement with initial estimates of solar metallicity based on iron. We compare the elemental abundances of TrES-1 with those of the sample of stars with planets, searching for possible chemical abundance anomalies. TrES-1 appears not to be chemically peculiar in any measurable way. We investigate possible signs of selective accretion of refractory elements in TrES-1 and other stars with planets, and find no statistically significant trends of metallicity [X/H] with condensation temperature Tc. We use published abundances and kinematic information for the sample of planet-hosting stars (including TrES-1) and several statistical indicators to provide an updated classification in terms of their likelihood to belong to either the thin disk or the thick disk of the Milky Way Galaxy. TrES-1 is found to be a very likely member of the thin disk population. By comparing α -element abundances of planet hosts and a large control sample of field stars, we also find that metal-rich ([Fe/H]> 0.0) stars with planets appear to be systematically underabundant in [α /Fe] by ˜ 0.1 dex with respect to comparison field stars. The reason for this signature is unclear, but systematic differences in the analysis procedures adopted by different groups cannot be ruled out.

  18. Application of transit timing variation method (TTV) to exoplanet system TrES-3

    NASA Astrophysics Data System (ADS)

    Kuznyetsova, Yu.; Shliakhetskaya, Y.; Matsiaka, O.; Krushevska, V.; Romanyuk, Ya.

    2015-10-01

    On the basis of the original photometric data, the light curves of several transits in the exoplanet system TrES-3 were simulated by Monte Carlo method. Using these curves, the estimates of precise values of mid-transit time were calculated to assess the possibility of finding new planets by timing method in already known exoplanet systems using ground-based observations at small telescopes. More accurate values of the some orbital and physical parameters of TrES-3 system were also obtained including following the planet-star radius ratio (RP/R*), the angle of the planet orbital plane inclination (i).

  19. 76 FR 41235 - Tres Palacios Gas Storage LLC; Notice of Application

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-13

    ... proposes the substitution of a 15,300 hp single electric- driven centrifugal compressor for five not-yet-installed certificated 4,800hp gas-fired compressors and to construct associated appurtenances and... Energy Regulatory Commission Tres Palacios Gas Storage LLC; Notice of Application Take notice that on...

  20. 77 FR 40628 - Draft Safe Harbor Agreement and Application for an Enhancement of Survival Permit for the Tres...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-07-10

    ... Permit for the Tres Rios Project AGENCY: Fish and Wildlife Service, Interior. ACTION: Notice of... Rios Project, and a potential return to baseline conditions. We invite the public to review and comment...: Mike_Martinez@fws.gov . Include ``Arizona Ecological Services Field Office draft Tres Rios SHA'' in the...

  1. Optical and Near-UV Observations of the Transiting Extrasolar Planet TrES-4b

    NASA Astrophysics Data System (ADS)

    Smith, Carter-Thaxton; Turner, J.; Carleton, T.; Crawford, B.; Guvenen, B.; Hardegree-Ullman, K.; Small, L.; Towner, A. P.; Walker-LaFollette, A.; Henz, T.

    2013-01-01

    Using the Steward Observatory 61” Kuiper Telescope, The University of Arizona Astronomy Club conducted photometric observations of the transiting extrasolar planet TrES-4b as part of the Exoplanet Observation Project. Observations were made in the Bessell U, Harris B, and Harris R filters. Initial observations were made in 2009, with follow up observations in 2011. Basic data reduction and photometry was done using IRAF and determination of transit parameters was done using Transit Analysis Package (TAP) and JKTEBOP transit modeling code. We present an updated planetary mass, radius, density, surface gravity, Safronov number, equilibrium temperature, orbital distance, and orbital inclination for TrES-4b. In addition, we also searched for asymmetries between the near-UV and optical light curves. This project, started in spring 2009, has introduced many undergraduate students to research and given them valuable experience with data reduction and observation techniques.

  2. Detection of Planetary Emission from the Exoplanet TrES-2 Using Spitzer/IRAC

    NASA Technical Reports Server (NTRS)

    Donovan, Francis T.; Charbonneau, David; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake; Knutson, Heather A.

    2010-01-01

    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +/- 0.021%, 0.230% +/- 0.024%, 0.199% +/- 0.054%, and 0.359% +/- 0.060% at 3.6 microns, 4.5 microns, 5.8 microns, and 8.0 microns, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T(sub eff) = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four lRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet. Key words: eclipses - infrared: stars - planetary systems - stars: individual (OSC 03549-02811) - techniques: photometric

  3. DETECTION OF PLANETARY EMISSION FROM THE EXOPLANET TrES-2 USING SPITZER/IRAC

    SciTech Connect

    O'Donovan, Francis T.; Charbonneau, David; Knutson, Heather A.; Harrington, Joseph; Madhusudhan, N.; Seager, Sara; Deming, Drake

    2010-02-20

    We present here the results of our observations of TrES-2 using the Infrared Array Camera on Spitzer. We monitored this transiting system during two secondary eclipses, when the planetary emission is blocked by the star. The resulting decrease in flux is 0.127% +- 0.021%, 0.230% +- 0.024%, 0.199% +- 0.054%, and 0.359% +- 0.060% at 3.6 {mu}m, 4.5 {mu}m, 5.8 {mu}m, and 8.0 {mu}m, respectively. We show that three of these flux contrasts are well fit by a blackbody spectrum with T{sub eff} = 1500 K, as well as by a more detailed model spectrum of a planetary atmosphere. The observed planet-to-star flux ratios in all four IRAC channels can be explained by models with and without a thermal inversion in the atmosphere of TrES-2, although with different atmospheric chemistry. Based on the assumption of thermochemical equilibrium, the chemical composition of the inversion model seems more plausible, making it a more favorable scenario. TrES-2 also falls in the category of highly irradiated planets which have been theoretically predicted to exhibit thermal inversions. However, more observations at infrared and visible wavelengths would be needed to confirm a thermal inversion in this system. Furthermore, we find that the times of the secondary eclipses are consistent with previously published times of transit and the expectation from a circular orbit. This implies that TrES-2 most likely has a circular orbit, and thus does not obtain additional thermal energy from tidal dissipation of a non-zero orbital eccentricity, a proposed explanation for the large radius of this planet.

  4. Photometric measurements of a Transit of Exoplanet TrES 3b

    NASA Astrophysics Data System (ADS)

    Russell, Dwight; Shannon, Lydia; Campbell, Richard; Strickland, Willie

    2012-10-01

    Using the 0.6 m Ritchey-Chretien telescope at the Paul and Jane Meyer Observatory (PJMO), light curves from a transit of exoplanet TReS 3b were produced from images made with a Roper 1300B camera. Light curves from both V and R bands will be presented. Analysis using AstroImageJ software will be discussed. Planet properties determined using the Czech Astronomical Society's transit fitting routines will be presented.

  5. Planetary transit observations at the University Observatory Jena: TrES-2

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Mugrauer, M.; Schmidt, T. O. B.; Roell, T.; Eisenbeiss, T.; Hohle, M. M.; Koeltzsch, A.; Vaňko, M.; Ginski, Ch.; Marka, C.; Moualla, M.; Tetzlaff, N.; Seifahrt, A.; Broeg, Ch.; Koppenhoefer, J.; Raetz, M.; Neuhäuser, R.

    2009-05-01

    We report on observations of several transit events of the transiting planet TrES-2 obtained with the Cassegrain-Teleskop-Kamera at the University Observatory Jena. Between March 2007 and November 2008 ten different transits and almost a complete orbital period were observed. Overall, in 40 nights of observation 4291 exposures (in total 71.52 h of observation) of the TrES-2 parent star were taken. With the transit timings for TrES-2 from the 34 events published by the TrES-network, the Transit Light Curve project and the Exoplanet Transit Database plus our own ten transits, we find that the orbital period is P=(2.470614± 0.000001) d, a slight change by ˜ 0.6 s compared to the previously published period. We present new ephemeris for this transiting planet. Furthermore, we found a second dip after the transit which could either be due to a blended variable star or occultation of a second star or even an additional object in the system. Our observations will be useful for future investigations of timing variations caused by additional perturbing planets and/or stellar spots and/or moons. Based on observations obtained with telescopes of the University Observatory Jena, which is operated by the Astrophysical Institute of the Friedrich-Schiller-University Jena and the 80cm telescope of the Wendelstein Observatory of the Ludwig-Maximilians-University Munich.

  6. Design Considerations for the Installation of an Iodine (I2) Cell onto TRES

    NASA Astrophysics Data System (ADS)

    Garcia-Mejia, Juliana

    2017-01-01

    The radial velocity (RV) method utilizes the reflex motion of a target star to predict the presence of one or multiple exoplanets. However, the disparity in mass between planet and host star often results in RV oscillations below the precision of most modern spectrographs. Such is the case of TRES, the Tillinghast Reflector Echelle Spectrograph located in the Fred Lawrence Whipple Observatory in Mt. Hopkins, Arizona, with a radial velocity (RV) precision of ~ 20 m s-1, dominated by instrumental effects. Since 1992, the iodine cell technique, presented in Butler et al.(1992) has become widely used for the reduction of RV measurement errors. Here, we describe the beginning stages in the installation of one such cell onto TRES. After traveling to the telescope site to perform the first fitting of the iodine stage, I designed, built and fitted the first prototype of an improved thermal insulation system for the front end of the spectrograph, where the cell will be mounted. Here I present such a design, as well as a detailed description of the current state of the project. We expect the iodine cell to be fully functional in approximately 1 year. Once the cell is installed, we expect errors in radial velocity measurements to decrease by an order of magnitude from the aforementioned 20 m s-1. This increase in precision will come with an increase in stability of radial velocity measurements, allowing TRES to perform in-house spectroscopy of more nearby bright targets and high-cadence exoplanet follow-up.

  7. Detection of orbital parameter changes in the TrES-2 exoplanet?

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Schmitt, J. H. M. M.

    2009-06-01

    We report a possible change in the orbit parameters of the TrES-2 exoplanet. With a period of 2.470621 days, the TrES-2 exoplanet exhibits almost “grazing” transits 110.4 min duration as measured in 2006 by Holman and collaborators. We observed two transits of TrES-2 in 2008 using the 1.2 m Oskar-Lühning telescope (OLT) of Hamburg observatory employing CCD photometry in an i-band and a near to R-band filter. A careful lightcurve analysis including a re-analysis of the 2006 observations shows that the current transit duration has shortened since 2006 by ≈3.16 min. Although the new observations were taken in a different filter we argue that the observed change in transit duration time cannot be attributed to the treatment of limb darkening. If we assume the stellar and planetary radii to be constant, a change in orbit inclination is the most likely cause of this change in transit duration. Full Table 1 is only available in electronic form at the CDS via anonymous ftp to cdsarc.u-strasbg.fr (130.79.128.5) or via http://cdsweb.u-strasbg.fr/cgi-bin/qcat?J/A+A/500/L45

  8. A Spitzer five-band analysis of the Jupiter-sized planet TrES-1

    SciTech Connect

    Cubillos, Patricio; Harrington, Joseph; Foster, Andrew S. D.; Lust, Nate B.; Hardy, Ryan A.; Bowman, M. Oliver; Madhusudhan, Nikku

    2014-12-10

    With an equilibrium temperature of 1200 K, TrES-1 is one of the coolest hot Jupiters observed by Spitzer. It was also the first planet discovered by any transit survey and one of the first exoplanets from which thermal emission was directly observed. We analyzed all Spitzer eclipse and transit data for TrES-1 and obtained its eclipse depths and brightness temperatures in the 3.6 μm (0.083% ± 0.024%, 1270 ± 110 K), 4.5 μm (0.094% ± 0.024%, 1126 ± 90 K), 5.8 μm (0.162% ± 0.042%, 1205 ± 130 K), 8.0 μm (0.213% ± 0.042%, 1190 ± 130 K), and 16 μm (0.33% ± 0.12%, 1270 ± 310 K) bands. The eclipse depths can be explained, within 1σ errors, by a standard atmospheric model with solar abundance composition in chemical equilibrium, with or without a thermal inversion. The combined analysis of the transit, eclipse, and radial-velocity ephemerides gives an eccentricity of e=0.033{sub −0.031}{sup +0.015}, consistent with a circular orbit. Since TrES-1's eclipses have low signal-to-noise ratios, we implemented optimal photometry and differential-evolution Markov Chain Monte Carlo (MCMC) algorithms in our Photometry for Orbits, Eclipses, and Transits pipeline. Benefits include higher photometric precision and ∼10 times faster MCMC convergence, with better exploration of the phase space and no manual parameter tuning.

  9. ON THE APPARENT ORBITAL INCLINATION CHANGE OF THE EXTRASOLAR TRANSITING PLANET TrES-2b

    SciTech Connect

    Scuderi, Louis J.; Dittmann, Jason A.; Males, Jared R.; Green, Elizabeth M.; Close, Laird M.

    2010-05-01

    On 2009 June 15 UT the transit of TrES-2b was detected using the University of Arizona's 1.55 m Kuiper Telescope with 2.0-2.5 millimag rms accuracy in the I band. We find a central transit time of T{sub c} = 2454997.76286 {+-} 0.00035 HJD, an orbital period of P = 2.4706127 {+-} 0.0000009 days, and an inclination angle of i = 83.{sup 0}92 {+-} 0{sup 0}.05, which is consistent with our re-fit of the original I-band light curve of O'Donovan et al. where we find i = 83.{sup 0}84 {+-} 0{sup 0}.05. We calculate an insignificant inclination change of {Delta}i = -0.{sup 0}08 {+-} 0{sup 0}.07 over the last three years, and as such, our observations rule out, at the {approx}11{sigma} level, the apparent change of orbital inclination to i{sub predicted} = 83.{sup 0}35 {+-} 0{sup 0}.1 as predicted by Mislis and Schmitt and Mislis et al. for our epoch. Moreover, our analysis of a recently published Kepler Space Telescope light curve for TrES-2b finds an inclination of i = 83.{sup 0}91 {+-} 0.{sup 0}03 for a similar epoch. These Kepler results definitively rule out change in i as a function of time. Indeed, we detect no significant changes in any of the orbital parameters of TrES-2b.

  10. Ground-based Detection of the Secondary Eclipse of TrES-3b

    NASA Astrophysics Data System (ADS)

    de Mooij, E.; Snellen, I.

    2011-12-01

    Secondary eclipse measurements provide information on the thermal properties of exoplanet atmospheres. Here we summarise the results of ground-based K-band observations of the secondary eclipse of the planet TrES-3b (see de Mooij & Snellen 2009). The observations were made using the LIRIS instrument on the William Herschell Telescope. The secondary eclipse was detected at a level of -0.241±0.043% (˜6σ), corresponding to a brightness temperature of 2040±125 K.

  11. ANALYSIS OF KEPLER'S SHORT-CADENCE PHOTOMETRY FOR TrES-2b

    SciTech Connect

    Kipping, David; Bakos, Gaspar

    2011-05-20

    We present an analysis of 18 short-cadence (SC) transit light curves of TrES-2b using quarter 0 (Q0) and quarter 1 (Q1) from the Kepler Mission. The photometry is of unprecedented precision, 237 ppm minute{sup -1}, allowing for the most accurate determination of the transit parameters yet obtained for this system. Global fits of the transit photometry, radial velocities, and known transit times are used to obtain a self-consistent set of refined parameters for this system, including updated stellar and planetary parameters. Special attention is paid to fitting for limb darkening and eccentricity. We place an upper limit on the occultation depth to be <72.9 ppm to 3{sigma} confidence, indicating TrES-2b has the lowest determined geometric albedo for an exoplanet, of A{sub g} < 0.146. We also produce a transit timing analysis using Kepler's SC data and demonstrate exceptional timing precision at the level of a few seconds for each transit event. With 18 fully sampled transits at such high precision, we are able to produce stringent constraints on the presence of perturbing planets, Trojans, and extrasolar moons. We introduce the novel use of control data to identify phasing effects. We also exclude the previously proposed hypotheses of short-period transit time variation and additional transits but find that the hypothesis of long-term inclination change is neither supported nor refuted by our analysis.

  12. TrES-5: A MASSIVE JUPITER-SIZED PLANET TRANSITING A COOL G DWARF

    SciTech Connect

    Mandushev, Georgi; Dunham, Edward W.; Quinn, Samuel N.; Latham, David W.; Charbonneau, David; Buchhave, Lars A.; Rabus, Markus; Oetiker, Brian; Brown, Timothy M.; Belmonte, Juan A.

    2011-11-10

    We report the discovery of TrES-5, a massive hot Jupiter that transits the star GSC 03949-00967 every 1.48 days. From spectroscopy of the star we estimate a stellar effective temperature of T{sub eff} = 5171 {+-} 36 K, and from high-precision B, R, and I photometry of the transit we constrain the ratio of the semimajor axis a and the stellar radius R{sub *} to be a/R{sub *} = 6.07 {+-} 0.14. We compare these values to model stellar isochrones to obtain a stellar mass of M{sub *} = 0.893 {+-} 0.024 M{sub Sun }. Based on this estimate and the photometric time series, we constrain the stellar radius to be R{sub *} = 0.866 {+-} 0.013 R{sub Sun} and the planet radius to be R{sub p} = 1.209 {+-} 0.021 R{sub J}. We model our radial-velocity data assuming a circular orbit and find a planetary mass of 1.778 {+-} 0.063 M{sub J}. Our radial-velocity observations rule out line-bisector variations that would indicate a specious detection resulting from a blend of an eclipsing binary system. TrES-5 orbits one of the faintest stars with transiting planets found to date from the ground and demonstrates that precise photometry and followup spectroscopy are possible, albeit challenging, even for such faint stars.

  13. The Age of the Tres Piedras Granite, New Mexico, USA: A Case of Large Scale Isotopic Homogenization.

    NASA Astrophysics Data System (ADS)

    Das, R.; Holm, C.; Odom, L.

    2004-12-01

    The Tres Piedras Granite, exposed in the Tusas Mountain within the crystalline province of Eastern Rio Arriba Country, New Mexico, USA, is a granitic gneiss, which exhibits relict igneous textural features. The present study has obtained U-Pb zircon ages and Rb-Sr whole rock ages for the Tres Piedras Granite. The zircons removed from the Tres Piedras Granite delineate a chord that represents concordia at 1654 Ma and 98 Ma with a concordant point at 1654 Ma. Although there is no dated activity for this region at approximately 98 Ma, the episodic Pb loss is preferred because 1650 Ma diffusion analysis will not fit the data points. Rb - Sr whole rock data points obtained from the Tres Piedras Granite yields a distinct isochron for each outcrop sampled. The age and apparent initial Sr 87/ Sr86 ratios of the Tres Piedras Granite outcrops (approximately 50 square meters of collecting area at each exposure) are as follows: Tres Piedras Granite Type Locality: 1493 +/- 21 Ma and 0.7183 +/- 0.0006; Tres Piedras Granite - Tusas River Canyon: 1501 +/- 44Ma and 0.7145 +/- 0.0013; and Tres Piedras Granite - Tusas Mountain: 1661 +/- 17 Ma and 0.7102 +/- 0.0071. If the concordant zircon point at 1654 Ma indicated the time of crystallization, then some type of disturbance must have occurred in the Rb-Sr isotopic system of the Tres Piedras Granite to cause the Type locality and Tusas River Canyon isochron ages to differ from the zircon discordia intercept age. This difference is explained by large-scale isotope homogenization (during metamorphism) of Sr on the scale of kilometers. The metamorphic effect is also evident in thin section of the granites from the Type Locality and Tusas River Canyon. The feldspars are altered to mica and some of the quartz have been recrystallized to finer grains where as those from the Tusas Mountain are unaltered and have large grains of quartz and feldspars. Finally Lanzirotti and Hanson (1997) have dated the age of regional metamorphism from the

  14. The Age of the Tres Piedras Granite, New Mexico, USA: A Case of Large Scale Isotopic Homogenization

    NASA Astrophysics Data System (ADS)

    Das, R.; Holm, C.; Odom, L.

    2003-04-01

    The Tres Piedras Granite, exposed in the Tusas Mountain within the crystalline province of Eastern Rio Arriba Country, New Mexico, USA, is a granitic gneiss, which exhibits relict igneous textural features. The present study has obtained U-Pb zircon ages and Rb-Sr whole rock ages for the Tres Piedras Granite. The zircons removed from the Tres Piedras Granite delineate a chord that represents concordia at 1654 Ma and 98 Ma with a concordant point at 1654 Ma. Although there is no dated activity for this region at approximately 98 Ma, the episodic Pb loss is preferred because 1650 Ma diffusion analysis will not fit the data points. Rb-Sr whole rock data points obtained from the Tres Piedras Granite yields a distinct isochron for each outcrop sampled. The age and apparent initial Sr87/Sr86 ratios of the Tres Piedras Granite outcrops (approximately 50 square meters of collecting area at each exposure) are as follows: Tres Piedras Granite Type Locality: 1493 +/- 21 Ma and 0.7183 +/- 0.0006; Tres Piedras Granite -- Tusas River Canyon: 1501 +/- 44 Ma and 0.7145 +/- 0.0013; and Tres Piedras Granite -- Tusas Mountain: 1661 +/- 17 Ma and 0.7102 +/- 0.0071. If the concordant zircon point at 1654 Ma indicated the time of crystallization, then some type of disturbance must have occurred in the Rb-Sr isotopic system of the Tres Piedras Granite to cause the Type locality and Tusas River Canyon isochron ages to differ from the zircon discordia intercept age. This difference is explained by large-scale isotope homogenization (during metamorphism) of Sr on the scale of kilometers. The metamorphic effect is also evident in thin section of the granites from the Type Locality and Tusas River Canyon. The feldspars are altered to mica and some of the quartz have been recrystallized to finer grains where as those from the Tusas Mountain are unaltered and have large grains of quartz and feldspars. Finally Lanzirotti and Hanson (1997) have dated the age of regional metamorphism from the

  15. Multi-band transit observations of the TrES-2b exoplanet

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Schröter, S.; Schmitt, J. H. M. M.; Cordes, O.; Reif, K.

    2010-02-01

    We present a new data set of transit observations of the TrES-2b exoplanet taken in spring 2009, using the 1.2 m Oskar-Lühning telescope (OLT) of Hamburg Observatory and the 2.2 m telescope at Calar Alto Observatory using BUSCA (Bonn University Simultaneous CAmera). Both the new OLT data, taken with the same instrumental setup as our data taken in 2008, as well as the simultaneously recorded multicolor BUSCA data confirm the low inclination values reported previously, and in fact suggest that the TrES-2b exoplanet has already passed the first inclination threshold (imin,1 = 83.417°) and is not eclipsing the full stellar surface any longer. Using the multi-band BUSCA data we demonstrate that the multicolor light curves can be consistently fitted with a given set of limb darkening coefficients without the need to adjust these coefficients, and further, we can demonstrate that wavelength dependent stellar radius changes must be small as expected from theory. Our new observations provide further evidence for a change of the orbit inclination of the transiting extrasolar planet TrES-2b reported previously. We examine in detail possible causes for this inclination change and argue that the observed change should be interpreted as nodal regression. While the assumption of an oblate host star requires an unreasonably large second harmonic coefficient, the existence of a third body in the form of an additional planet would provide a very natural explanation for the observed secular orbit change. Given the lack of clearly observed short-term variations of transit timing and our observed secular nodal regression rate, we predict a period between approximately 50 and 100 days for a putative perturbing planet of Jovian mass. Such an object should be detectable with present-day radial velocity (RV) techniques, but would escape detection through transit timing variations. Photometric transit data are only available in electronic form at the CDS via anonymous ftp to cdsarc

  16. SYSTEM PARAMETERS, TRANSIT TIMES, AND SECONDARY ECLIPSE CONSTRAINTS OF THE EXOPLANET SYSTEMS HAT-P-4, TrES-2, TrES-3, and WASP-3 FROM THE NASA EPOXI MISSION OF OPPORTUNITY

    SciTech Connect

    Christiansen, Jessie L.; Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Deming, Drake; Barry, Richard K.; Livengood, Timothy A.; Hewagama, Tilak; Madhusudhan, Nikku; Seager, Sara; Wellnitz, Dennis D.; A'Hearn, Michael F.; Hampton, Don L.; Lisse, Carey M.

    2011-01-10

    As part of the NASA EPOXI Mission of Opportunity, we observed seven known transiting extrasolar planet systems in order to construct time series photometry of extremely high phase coverage and precision. Here we present the results for four 'hot-Jupiter systems' with near-solar stars-HAT-P-4, TrES-3, TrES-2, and WASP-3. We observe 10 transits of HAT-P-4, estimating the planet radius R{sub p} = 1.332 {+-} 0.052 R{sub Jup}, the stellar radius R{sub *} = 1.602 {+-} 0.061 R{sub sun}, the inclination i = 89.67 {+-} 0.30 deg, and the transit duration from first to fourth contact {tau} = 255.6 {+-} 1.9 minutes. For TrES-3, we observe seven transits and find R{sub p} = 1.320 {+-} 0.057 R{sub Jup}, R{sub *} = 0.817 {+-} 0.022 R{sub sun}, i = 81.99 {+-} 0.30 deg, and {tau} = 81.9 {+-} 1.1 minutes. We also note a long-term variability in the TrES-3 light curve, which may be due to star spots. We observe nine transits of TrES-2 and find R{sub p} = 1.169 {+-} 0.034 R{sub Jup}, R{sub *} = 0.940 {+-} 0.026 R{sub sun}, i = 84.15 {+-} 0.16 deg, and {tau} = 107.3 {+-} 1.1 minutes. Finally, we observe eight transits of WASP-3, finding R{sub p} = 1.385 {+-} 0.060 R{sub Jup}, R{sub *} = 1.354 {+-} 0.056 R{sub sun}, i = 84.22 {+-} 0.81 deg, and {tau} = 167.3 {+-} 1.3 minutes. We present refined orbital periods and times of transit for each target. We state 95% confidence upper limits on the secondary eclipse depths in our broadband visible bandpass centered on 650 nm. These limits are 0.073% for HAT-P-4, 0.062% for TrES-3, 0.16% for TrES-2, and 0.11% for WASP-3. We combine the TrES-3 secondary eclipse information with the existing published data and confirm that the atmosphere likely does not have a temperature inversion.

  17. Possible Transit Timing Variations of the TrES-3 Planetary System

    NASA Astrophysics Data System (ADS)

    Jiang, Ing-Guey; Yeh, Li-Chin; Thakur, Parijat; Wu, Yu-Ting; Chien, Ping; Lin, Yi-Ling; Chen, Hong-Yu; Hu, Juei-Hwa; Sun, Zhao; Ji, Jianghui

    2013-03-01

    Five newly observed transit light curves of the TrES-3 planetary system are presented. Together with other light-curve data from the literature, 23 transit light curves in total, which cover an overall timescale of 911 epochs, have been analyzed through a standard procedure. From these observational data, the system's orbital parameters are determined and possible transit timing variations (TTVs) are investigated. Given that a null TTV produces a fit with reduced χ2 = 1.52, our results agree with previous work, that TTVs might not exist in these data. However, a one-frequency oscillating TTV model, giving a fit with a reduced χ2 = 0.93, does possess a statistically higher probability. It is thus concluded that future observations and dynamical simulations for this planetary system will be very important.

  18. POSSIBLE TRANSIT TIMING VARIATIONS OF THE TrES-3 PLANETARY SYSTEM

    SciTech Connect

    Jiang, Ing-Guey; Wu, Yu-Ting; Chien, Ping; Lin, Yi-Ling; Chen, Hong-Yu; Hu, Juei-Hwa; Yeh, Li-Chin; Thakur, Parijat; Sun Zhao; Ji Jianghui

    2013-03-15

    Five newly observed transit light curves of the TrES-3 planetary system are presented. Together with other light-curve data from the literature, 23 transit light curves in total, which cover an overall timescale of 911 epochs, have been analyzed through a standard procedure. From these observational data, the system's orbital parameters are determined and possible transit timing variations (TTVs) are investigated. Given that a null TTV produces a fit with reduced {chi}{sup 2} = 1.52, our results agree with previous work, that TTVs might not exist in these data. However, a one-frequency oscillating TTV model, giving a fit with a reduced {chi}{sup 2} = 0.93, does possess a statistically higher probability. It is thus concluded that future observations and dynamical simulations for this planetary system will be very important.

  19. Near-UV and Optical Observations of the Transiting Extrasolar Planet Tres-3b

    NASA Astrophysics Data System (ADS)

    Smith, Carter-Thaxton W.; Smart, B.; Turner, J. D.; Walker-LaFollette, A.; Hardegree-Ullman, K. K.; Small, L. C.; McGraw, A. M.; Crawford, B. E.; Carleton, T. M.; Robertson, A. N.; Towner, A. P. M.; Daugherty, M. J.; Guvenen, B.

    2012-05-01

    Recent observations of transiting extrasolar planets in near-UV and optical bands, by Vidotto et al. 2011, suggest that asymmetries in light curve ingress times indicate the presence of a magnetic field. The University of Arizona Astronomy Club observed primary transits of extrasolar planet TrES-3b using the 1.55m Kuiper Telescope in the U, B, V, and R photometric bands in order to detect this phenomenon. We have reanalyzed transit data collected between 2009 and 2012 in order to have a consistent reduction methodology and eliminate any systematic errors. Using the Transit Analysis Package (TAP) and the JKTEBOP transit modeling code, we have modeled all of our transits to detect any light curve asymmetries between near-UV and optical bands.

  20. Metazoan parasite community of blue sea catfish, Sciades guatemalensis (Ariidae), from Tres Palos Lagoon, Guerrero, Mexico.

    PubMed

    Violante-González, Juan; Aguirre-Macedo, Ma Leopoldina; Rojas-Herrera, Agustín; Guerrero, Salvador Gil

    2009-10-01

    The seasonal dynamic of the metazoan parasite community of the blue sea catfish (Sciades guatemalensis) from Tres Palos Lagoon, Guerrero, Mexico, was studied at the component community and infracommunity levels. A total of 382 fish were collected during the regional dry and rainy seasons (a total of seven seasons) between April 2000 and September 2007. Nine helminths were collected: Neotetraonchus sp., Pseudoacanthostomum panamense, Austrodiplostomum compactum, Clinostomum complanatum, Metadena sp., Pseudoleptorhynchoides lamothei, Neoechinorhynchus cf. golvani, Hysterothylacium perezi, and Contracaecum sp. The infection dynamics of some dominant helminths was influenced by environmental changes generated by the dry/rainy season cycle. Nested (non-random) species composition was observed in the infracommunities during almost all of the sample period. Variation in the intensity of nestedness was attributed to a sequential colonization process over time by the dominant helminths.

  1. Zinc-germanium ores of the Tres Marias Mine, Chihuahua, Mexico

    NASA Astrophysics Data System (ADS)

    Saini-Eidukat, Bernhardt; Melcher, Frank; Lodziak, Jerzy

    2009-04-01

    The Tres Marias carbonate-hosted Zn-Ge deposit in Chihuahua, Mexico contains sphalerite with the highest average Ge (960 ppm) and willemite with the highest reported Ge contents of Mississippi-Valley-type (MVT) deposits worldwide. This has prompted current exploration efforts to focus on the deposit as a high-grade source of germanium. The sulfide-rich ore type (>125,000 t at 20% Zn and 250 g/t Ge) contains Fe-rich botryoidal sphalerite (type I) associated with solid hydrocarbons. This type exhibits distinctive intimately intergrown lamellar texture of high-Fe sphalerite (average 9.9 wt.% Fe and 800 ppm Ge) and a somewhat less Fe-rich sphalerite phase (average 5.5 wt.% Fe and 470 ppm Ge). Reddish-brown banded sphalerite (type II, average 5.7 wt.% Fe and 1,320 ppm Ge) is subordinately followed by galena and pyrite. The sulfide-poor “oxidized” zinc ore (up to 50 wt.% Zn; 250 to 300 ppm Ge) is a fine-grained, often friable, alteration product of the sulfide ore and associated limestone and breccia host. While some areas are dominated by carbonates and sulfates, others are enriched in silicates such as hemimorphite and willemite. The gangue assemblage includes goethite, hematite, and amorphous silica or quartz. Minor wulfenite, greenockite, cinnabar, and descloizite also occur. Willemite occurs as interstitial replacement of sphalerite and fracture fillings in the oxidized ore and can be unusually rich in Pb (up to 2.0 wt.%) and Ge (up to 4,000 ppm). Oscillatory zonation reflects trace element incorporation into willemite from the oxidation of primary Ge-bearing sphalerite and galena by siliceous aqueous fluids. The Tres Marias deposit has hybrid characteristics consisting of a primary low-temperature MVT Ge-rich Zn-Pb sulfide ore body, overprinted by Ge-rich hemimorphite, willemite, and Fe oxide mineralization.

  2. Improving Stellar and Planetary Parameters of Transiting Planet Systems: The Case of TrES-2

    NASA Astrophysics Data System (ADS)

    Sozzetti, Alessandro; Torres, Guillermo; Charbonneau, David; Latham, David W.; Holman, Matthew J.; Winn, Joshua N.; Laird, John B.; O'Donovan, Francis T.

    2007-08-01

    We report on a spectroscopic determination of the atmospheric parameters and chemical abundance of the parent star of the recently discovered transiting planet TrES-2. A detailed LTE analysis of a set of Fe I and Fe II lines from our Keck spectra yields Teff=5850+/-50 K, logg=4.4+/-0.1, and [Fe/H]=-0.15+/-0.10. Several independent checks (e.g., additional spectroscopy, line-depth ratios) confirm the reliability of our spectroscopic Teff estimate. The mass and radius of the star, needed to determine the properties of the planet, are traditionally inferred by comparison with stellar evolution models using Teff and some measure of the stellar luminosity, such as the spectroscopic surface gravity. We apply here a new method in which we use instead of logg the normalized separation a/R* (related to the stellar density), directly measurabele from the light curves of transiting planets with much greater precision. With the a/R* value from the light-curve analysis of Holman and coworkers and our Teff estimate, we obtain M*=0.980+/-0.062 Msolar and R*=1.000+0.036-0.033 Rsolar, and an evolutionary age of 5.1+2.7-2.3 Gyr, in good agreement with other constraints (Ca II H and K line cores, lithium abundance, and rotation). The new stellar parameters yield improved values for the planetary mass and radius of Mp=1.198+/-0.053 MJ and Rp=1.220+0.045-0.042 RJ, confirming that TrES-2 is the most massive among the currently known nearby (d<~300 pc) transiting hot Jupiters. The surface gravity of the planet, loggp=3.299+/-0.016, can be derived independently of the knowledge of the stellar parameters (i.e., directly from observations), and with a very high precision rivaling that of the best known double-lined eclipsing binaries.

  3. The GAPS programme with HARPS-N at TNG. VI. The curious case of TrES-4b

    NASA Astrophysics Data System (ADS)

    Sozzetti, A.; Bonomo, A. S.; Biazzo, K.; Mancini, L.; Damasso, M.; Desidera, S.; Gratton, R.; Lanza, A. F.; Poretti, E.; Rainer, M.; Malavolta, L.; Affer, L.; Barbieri, M.; Bedin, L. R.; Boccato, C.; Bonavita, M.; Borsa, F.; Ciceri, S.; Claudi, R. U.; Gandolfi, D.; Giacobbe, P.; Henning, T.; Knapic, C.; Latham, D. W.; Lodato, G.; Maggio, A.; Maldonado, J.; Marzari, F.; Martinez Fiorenzano, A. F.; Micela, G.; Molinari, E.; Mordasini, C.; Nascimbeni, V.; Pagano, I.; Pedani, M.; Pepe, F.; Piotto, G.; Santos, N.; Scandariato, G.; Shkolnik, E.; Southworth, J.

    2015-03-01

    We update the TrES-4 system parameters using high-precision HARPS-N radial-velocity measurements and new photometric light curves. A combined spectroscopic and photometric analysis allows us to determine a spectroscopic orbit with a semi-amplitude K = 51 ± 3 m s-1. The derived mass of TrES-4b is found to be Mp = 0.49 ± 0.04 MJup, significantly lower than previously reported. Combined with the large radius () inferred from our analysis, TrES-4b becomes the transiting hot Jupiter with the second-lowest density known. We discuss several scenarios to explain the puzzling discrepancy in the mass of TrES-4b in the context of the exotic class of highly inflated transiting giant planets. Based on observations made with the Italian Telescopio Nazionale Galileo (TNG) operated on the island of La Palma by the Fundacion Galileo Galilei of the INAF at the Spanish Observatorio del Roque de los Muchachos of the IAC in the frame of the program Global Architecture of Planetary Systems (GAPS), and with the Zeiss 1.23-m telescope at the German-Spanish Astronomical Center at Calar Alto, Spain. Tables 1 and 3 are available in electronic form at http://www.aanda.org

  4. Transit Timing Variations of TrES-2: a combined analysis of ground- and space-based photometry

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Ginski, Ch.; Mugrauer, M.; Berndt, A.; Eisenbeiss, T.; Adam, Ch.; Raetz, M.; Roell, T.; Seeliger, M.; Maciejewski, G.; Marka, C.; Vanko, M.; Bukowiecki, L.; Errmann, R.; Kitze, M.; Ohlert, J.; Pribulla, T.; Schmidt, J. G.; Sebastian, D.; Tetzlaff, N.; Hohle, M. M.; Schmidt, T. O. B.; Neuhäuser, R.

    2013-07-01

    TrES-2 is one of the few exoplanets, which offer the matchless possibility to combine long-term ground-based observations with continuous satellite data. TrES-2 is a target of our "Transit Timing Variations @ YETI" (TTV@YETI) project which is dedicated to detect and characterize signals of transit timing variations. We observed 43 ground-based light curves of 30 individual transit events of TrES-2. We used seven 0.2 - 2.2m telescopes located at five observatories in Germany and Spain. In addition, we analyzed 16 quarters (Q0-Q15) of observational data from NASA's space telescope Kepler including 424 individual transit events. The continuous monitoring of Kepler allows to determine the system parameters of each of the 424 transits and search for possible changes of these quantities. Here we present a first indication of an increasing stellar activity of the TrES-2 host star and provide new limits on possible transit timing variations.

  5. ATMOSPHERE AND SPECTRAL MODELS OF THE KEPLER-FIELD PLANETS HAT-P-7b AND TrES-2

    SciTech Connect

    Spiegel, David S.; Burrows, Adam E-mail: burrows@astro.princeton.ed

    2010-10-10

    We develop atmosphere models of two of the three Kepler-field planets that were known prior to the start of the Kepler mission (HAT-P-7b and TrES-2). We find that published Kepler and Spitzer data for HAT-P-7b appear to require an extremely hot upper atmosphere on the dayside, with a strong thermal inversion and little day-night redistribution. The Spitzer data for TrES-2 suggest a mild thermal inversion with moderate day-night redistribution. We examine the effect of nonequilibrium chemistry on TrES-2 model atmospheres and find that methane levels must be adjusted by extreme amounts in order to cause even mild changes in atmospheric structure and emergent spectra. Our best-fit models to the Spitzer data for TrES-2 lead us to predict a low secondary eclipse planet-star flux ratio ({approx}<2 x 10{sup -5}) in the Kepler bandpass, which is consistent with what very recent observations have found. Finally, we consider how the Kepler-band optical flux from a hot exoplanet depends on the strength of a possible extra optical absorber in the upper atmosphere. We find that the optical flux is not monotonic in optical opacity, and the non-monotonicity is greater for brighter, hotter stars.

  6. THE BROADBAND INFRARED EMISSION SPECTRUM OF THE EXOPLANET TrES-3

    SciTech Connect

    Fressin, Francois; Knutson, Heather A.; Charbonneau, David; O'Donovan, Francis T.; Burrows, Adam; Spiegel, David; Deming, Drake; Mandushev, Georgi

    2010-03-01

    We use the Spitzer Space Telescope to estimate the dayside thermal emission of the exoplanet TrES-3 integrated in the 3.6, 4.5, 5.8, and 8.0 {mu}m bandpasses of the Infrared Array Camera (IRAC) instrument. We observe two secondary eclipses and find relative eclipse depths of 0.00346 +- 0.00035, 0.00372 +- 0.00054, 0.00449 +- 0.00097, and 0.00475 +- 0.00046, respectively, in the four IRAC bandpasses. We combine our results with the earlier K-band measurement of De Mooij et al., and compare them with models of the planetary emission. We find that the planet does not require the presence of an inversion layer in the high atmosphere. This is the first very strongly irradiated planet that does not have a temperature inversion, which indicates that stellar or planetary characteristics other than temperature have an important impact on temperature inversion. De Mooij and Snellen also detected a possible slight offset in the timing of the secondary eclipse in the K band. However, based on our four Spitzer channels, we place a 3sigma upper limit of |ecos(omega)| < 0.0056, where e is the planet's orbital eccentricity and omega is the longitude of the periastron. This result strongly indicates that the orbit is circular, as expected from tidal circularization theory.

  7. The Broadband Infrared Emission Spectrum of the Exoplanet TrES-3

    NASA Astrophysics Data System (ADS)

    Fressin, Francois; Knutson, Heather A.; Charbonneau, David; O'Donovan, Francis T.; Burrows, Adam; Deming, Drake; Mandushev, Georgi; Spiegel, David

    2010-03-01

    We use the Spitzer Space Telescope to estimate the dayside thermal emission of the exoplanet TrES-3 integrated in the 3.6, 4.5, 5.8, and 8.0 μm bandpasses of the Infrared Array Camera (IRAC) instrument. We observe two secondary eclipses and find relative eclipse depths of 0.00346 ± 0.00035, 0.00372 ± 0.00054, 0.00449 ± 0.00097, and 0.00475 ± 0.00046, respectively, in the four IRAC bandpasses. We combine our results with the earlier K-band measurement of De Mooij et al., and compare them with models of the planetary emission. We find that the planet does not require the presence of an inversion layer in the high atmosphere. This is the first very strongly irradiated planet that does not have a temperature inversion, which indicates that stellar or planetary characteristics other than temperature have an important impact on temperature inversion. De Mooij & Snellen also detected a possible slight offset in the timing of the secondary eclipse in the K band. However, based on our four Spitzer channels, we place a 3σ upper limit of |ecos(ω)| < 0.0056, where e is the planet's orbital eccentricity and ω is the longitude of the periastron. This result strongly indicates that the orbit is circular, as expected from tidal circularization theory.

  8. Diurnal Evolution of Aerosol Optical Properties and Morphology at Pico Tres Padres: A Phenomenological Analysis

    NASA Astrophysics Data System (ADS)

    Mazzoleni, C.; Chakrabarty, R.; Dubey, M. K.; Moosmuller, H.; Chylek, P.; Onasch, T. B.; Herndon, S.; Zavala, M.; Kolb, C.

    2007-05-01

    Aerosol optical properties affect planetary radiative balance and therefore climate. The optical properties are related to chemical composition, size distribution, and morphology, which also have implications for human health and environmental degradation. During the MILAGRO field campaign, we measured ensemble aerosol absorption and angle-integrated scattering in Mexico City. These measurements were performed using the Los Alamos aerosol photoacoustic instrument with an integrated nephelometer (LAPA) operating at 781 nm. The LAPA was mounted on-board the Aerodyne Inc. mobile laboratory, which hosted a wide variety of gaseous and aerosol instruments. During the campaign, the Aerodyne mobile laboratory was moved to different sites, capturing the influence of spatial and temporal parameters including location, aging, elevation, and sources on ambient air pollution. The LAPA operated almost continuously between the 3rd and the 28th of March 2006. During the same period we collected ambient aerosols on more than 100 Nuclepore filters for scanning electron microscopy (SEM) analysis. Filter samples were collected during specific pollution events and different times of the day. Subsequently, SEM images of selected filters were taken to study particle morphology. The elemental composition of a few individual particles was also qualitatively assessed by energy dispersive X-ray spectroscopy. Between March 7th and 19th the laboratory was sampling air close to the top of the Pico Tres Padres, a ~3000 m high mountain on the north side of the Mexico City. Daily changes of aerosol loading and pollutant concentrations followed the expected diurnal variations of the boundary layer height. Here we report a preliminary analysis of aerosol absorption, scattering, and morphology at Pico Tres Padres for three specific days (9th, 11th and 12th of March 2006). The single scattering albedo (ratio of scattering to total extinction) during these three days showed a characteristic drop in the

  9. Influence of deposit architecture on intrastratal deformation, slope deposits of the Tres Pasos Formation, Chile

    NASA Astrophysics Data System (ADS)

    Auchter, Neal C.; Romans, Brian W.; Hubbard, Stephen M.

    2016-07-01

    Slope sediments on passive and active margins deform and fail across a broad range of scales ranging from loading and sediment remobilization near the sediment-water interface to submarine landslides and mass movements that incorporate significant volumes of slope deposits. Deformational styles are characterized by updip extension and downdip compressional features that occur above a detachment surface. Conditions for failure and deformation include the presence of weak layer(s) that serve as a detachment surface, competency contrasts that allow for detachment and downslope movement, deformation above a detachment surface, and a triggering mechanism(s) that initiates failure. Slope failure processes and products are well documented at scales resolvable by seismic-reflection surveys and in instances of extensive downslope failure, but the processes and products associated with intermediate-scale slope deformation are poorly understood. Intrastratal deformation is defined as stratigraphically isolated zones of deformation bounded above and below by concordant and undeformed strata. In this study, outcrop examples of intrastratal deformation from the Upper Cretaceous Tres Pasos Formation are used to elucidate the influence of depositional architecture on slope deformation. The facies distribution associated with compensational stacking of lobe deposits is shown to have a first-order control on the location and style of deformation. Detachment planes that form in mudstone deposits associated with lobe fringe and interlobe deposits are spatially limited and deformation is restricted to interbedded sandstone and mudstone associated with off-axial lobe positions. Downslope translation was arrested by stratigraphic buttresses associated with more sandstone-prone axial deposits. Emplacement of a regionally extensive mass transport deposit is interpreted as the triggering mechanism for contemporaneous intrastratal deformation of > 60 m of underlying stratigraphy. A vertical

  10. Transit timing of TrES-2: a combined analysis of ground- and space-based photometry

    NASA Astrophysics Data System (ADS)

    Raetz, St.; Maciejewski, G.; Ginski, Ch.; Mugrauer, M.; Berndt, A.; Eisenbeiss, T.; Adam, Ch.; Raetz, M.; Roell, T.; Seeliger, M.; Marka, C.; Vaňko, M.; Bukowiecki, Ł.; Errmann, R.; Kitze, M.; Ohlert, J.; Pribulla, T.; Schmidt, J. G.; Sebastian, D.; Puchalski, D.; Tetzlaff, N.; Hohle, M. M.; Schmidt, T. O. B.; Neuhäuser, R.

    2014-10-01

    Homogeneous observations and careful analysis of transit light curves can lead to the identification of transit timing variations (TTVs). TrES-2 is one of few exoplanets, which offer the matchless possibility to combine long-term ground-based observations with continuous satellite data. Our research aimed at the search for TTVs that would be indicative of perturbations from additional bodies in the system. We also wanted to refine the system parameters and the orbital elements. We obtained 44 ground-based light curves of 31 individual transit events of TrES-2. Eight 0.2-2.2-m telescopes located at six observatories in Germany, Poland and Spain were used. In addition, we analysed 18 quarters (Q0-Q17) of observational data from NASA's space telescope Kepler including 435 individual transit events and 11 publicly available ground-based light curves. Assuming different limb darkening (LD) laws we performed an analysis for all light curves and redetermined the parameters of the system. We also carried out a joint analysis of the ground- and space-based data. The long observation period of seven years (2007-2013) allowed a very precise redetermination of the transit ephemeris. For a total of 490 transit light curves of TrES-2, the time of transit mid-point was determined. The transit times support neither variations on long time-scale nor on short time-scales. The nearly continuous observations of Kepler show no statistically significant increase or decrease in the orbital inclination i and the transit duration D. Only the transit depth shows a slight increase which could be an indication of an increasing stellar activity. In general, system parameters obtained by us were found to be in agreement with previous studies but are the most precise values to date.

  11. A new species of Myotis from the Islas Tres Marias, Nayarit, Mexico, with comments on variation in Myotis nigricans

    USGS Publications Warehouse

    Bogan, Michael A.

    1978-01-01

    A new Myotis is described from the Islas Tres Marias, Nayarit, Mexico. the new species is distinct from related taxa n the adjacent Mexican mainland (M. californicus, M. leibii, and M. carteri), although most closely related to M. carteri as shown by univariate and canonical variates analyses. An analysis of six groups of M. nigricans from Middle and South America supports the elevation of M. nigricans carteri to specific status, confirms the distinctness of M. nigricus extremus, but fails to substantiate subspecific status for bats from Columbia and Ecuador, recent recognized as M. n. punensis.

  12. PHOTOMETRICALLY DERIVED MASSES AND RADII OF THE PLANET AND STAR IN THE TrES-2 SYSTEM

    SciTech Connect

    Barclay, Thomas; Huber, Daniel; Rowe, Jason F.; Quintana, Elisa V.; Christiansen, Jessie L.; Jenkins, Jon M.; Mullally, Fergal; Seader, Shaun E.; Tenenbaum, Peter; Thompson, Susan E.; Barentsen, Geert; Bloemen, Steven; Demory, Brice-Olivier; Fulton, Benjamin J.; Shporer, Avi; Ragozzine, Darin

    2012-12-10

    We measure the mass and radius of the star and planet in the TrES-2 system using 2.7 years of observations by the Kepler spacecraft. The light curve shows evidence for ellipsoidal variations and Doppler beaming on a period consistent with the orbital period of the planet with amplitudes of 2.79{sup +0.44}{sub -0.62} and 3.44{sup +0.32}{sub -0.37} parts per million (ppm), respectively, and a difference between the dayside and the nightside planetary flux of 3.41{sup +0.55}{sub -0.82} ppm. We present an asteroseismic analysis of solar-like oscillations on TrES-2A which we use to calculate the stellar mass of 0.94 {+-} 0.05 M{sub Sun} and radius of 0.95 {+-} 0.02 R{sub Sun }. Using these stellar parameters, a transit model fit and the phase-curve variations, we determine the planetary radius of 1.162{sup +0.020}{sub -0.024} R{sub Jup} and derive a mass for TrES-2b from the photometry of 1.44 {+-} 0.21 M{sub Jup}. The ratio of the ellipsoidal variation to the Doppler beaming amplitudes agrees to better than 2{sigma} with theoretical predications, while our measured planet mass and radius agree within 2{sigma} of previously published values based on spectroscopic radial velocity measurements. We measure a geometric albedo of 0.0136{sup +0.0022}{sub -0.0033} and an occultation (secondary eclipse) depth of 6.5{sup +1.7}{sub -1.8} ppm which we combined with the day/night planetary flux ratio to model the atmosphere of TrES-2b. We find that an atmosphere model that contains a temperature inversion is strongly preferred. We hypothesize that the Kepler bandpass probes a significantly greater atmospheric depth on the night side relative to the day side.

  13. Paramètres fondamentaux complémentaires pour les étoiles AGB/post-AGB.

    NASA Astrophysics Data System (ADS)

    Barthès, D.; Alvarez, R.; Mennessier, M. O.

    Les parallaxes et paramètres cinématiques HIPPARCOS, exploités conjointement avec les courbes de lumière, d'autres données et des modèles théoriques, contribueront à l'affinement de nos connaissances sur la luminosité, la masse et la métallicité des étoiles variables à longue période ainsi que sur l'histoire de la Galaxie, dont elles sont un traceur privilégié.

  14. Spin-orbit alignment for KELT-7b and HAT-P-56b via Doppler tomography with TRES

    NASA Astrophysics Data System (ADS)

    Zhou, George; Latham, David W.; Bieryla, Allyson; Beatty, Thomas G.; Buchhave, Lars A.; Esquerdo, Gilbert A.; Berlind, Perry; Calkins, Michael L.

    2016-08-01

    We present Doppler tomographic analyses for the spectroscopic transits of KELT-7b and HAT-P-56b, two hot-Jupiters orbiting rapidly rotating F-dwarf host stars. These include analyses of archival Tillinghast Reflector Echelle Spectrograph (TRES) observations for KELT-7b, and a new TRES transit observation of HAT-P-56b. We report spin-orbit aligned geometries for KELT-7b (2.7° ± 0.6°) and HAT-P-56b (8° ± 2°). The host stars KELT-7 and HAT-P-56 are among some of the most rapidly rotating planet-hosting stars known. We examine the tidal re-alignment model for the evolution of the spin-orbit angle in the context of the spin rates of these stars. We find no evidence that the rotation rates of KELT-7 and HAT-P-56 have been modified by star-planet tidal interactions, suggesting that the spin-orbit angle of systems around these hot stars may represent their primordial configuration. In fact, KELT-7 and HAT-P-56 are two of three systems in supersynchronous, spin-orbit aligned states, where the rotation periods of the host stars are faster than the orbital periods of the planets.

  15. Helminth infracommunity structure of Leptodactylus melanonotus (Anura) in Tres Palos, Guerrero, and other records for this host species in Mexico.

    PubMed

    Mata-López, Rosario; León-Règagnon, Virginia; García-Prieto, Luis

    2013-06-01

    The amphibian genus Leptodactylus includes around 50 species, of which only 2 are distributed in Mexico; the helminth fauna of these 2 species is poorly known. As part of a research program on amphibian parasites in Mexico from 1997 to 2005, 281 sabinal frogs Leptodactylus melanonotus from 42 localities in 11 Mexican states were examined from a helminthological perspective. A total of 20 taxa of helminths-7 digeneans (5 adults, 2 larvae) and 13 nematodes (8 adults, 5 larvae)-was found to infect this amphibian host species. These data represent 105 new locality records, and 11 taxa are recorded in L. melanonotus for the first time. Infracommunity analyses of the sabinal frogs from Tres Palos indicated that these hosts are depauperate. The helminth community is dominated by specialist species, with Cosmocerca podicipinus the most common in almost 50% of the infracommunities. Percutaneous infection and predator-prey interactions were the 2 most common infection routes by helminths in frogs from Tres Palos, with 79% of the parasites recruited via skin penetration. Finally, our results show that the helminth fauna parasitizing L. melanonotus throughout Mexico has low similarity with the helminth fauna of leptodactylids studied comprehensively in South America, with only 2 digeneans and 3 nematodes being shared by hosts from both regions. As a result of our survey, the number of helminth species parasitizing L. melanonotus increased to 34. Considering its native distribution range, this number is now 36 with the inclusion of the nematodes Oswaldocruzia costaricensis and Cruzia empera in Costa Rica.

  16. THE TRANSIT LIGHT-CURVE PROJECT. XIV. CONFIRMATION OF ANOMALOUS RADII FOR THE EXOPLANETS TrES-4b, HAT-P-3b, AND WASP-12b

    SciTech Connect

    Chan, Tucker; Ingemyr, Mikael; Winn, Joshua N.; Sanchis-Ojeda, Roberto; Holman, Matthew J.; Esquerdo, Gil; Everett, Mark

    2011-06-15

    We present transit photometry of three exoplanets, TrES-4b, HAT-P-3b, and WASP-12b, allowing for refined estimates of the systems' parameters. TrES-4b and WASP-12b were confirmed to be 'bloated' planets, with radii of 1.706 {+-} 0.056R{sub Jup} and 1.736 {+-} 0.092R{sub Jup}, respectively. These planets are too large to be explained with standard models of gas giant planets. In contrast, HAT-P-3b has a radius of 0.827 {+-} 0.055R{sub Jup}, smaller than a pure hydrogen-helium planet and indicative of a highly metal-enriched composition. Analyses of the transit timings revealed no significant departures from strict periodicity. For TrES-4, our relatively recent observations allow for improvement in the orbital ephemerides, which is useful for planning future observations.

  17. Dynamic study of the upper Sao Francisco River and the Tres Marias reservoir using MSS/LANDSAT images. [Brazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The use of LANDSAT multispectral ban scanner imagery to verify the relationship between the behavior of the Tres Marias reservoir and the dynamics of the Sao Francisco River supply basin is described. The dispersion of suspended sediments and their concentration in the surface layers of the water are considered. A five year survey of the region during both dry and rainy seasons was performed. The drainage network was analyzed based on the patterns of dessication, water rises and soil use in the supply basin. Surface layers of the reservoir were tabulated as a function of the levels of gray in the imagery. In situ observations of water depth and reflectance were performed. Ground truth and LANDSAT data were correlated to determine the factors affecting the dynamics of the supply basin.

  18. High-precision multiband time series photometry of exoplanets Qatar-1b and TrES-5b

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Mancini, L.; Tregloan-Reed, J.; Ciceri, S.; Southworth, J.; D'Ago, G.; Bruni, I.; Baştürk, Ö.; Alsubai, K. A.; Bachelet, E.; Bramich, D. M.; Henning, Th.; Hinse, T. C.; Iannella, A. L.; Parley, N.; Schroeder, T.

    2015-04-01

    We present an analysis of the Qatar-1 and TrES-5 transiting exoplanetary systems, which contain Jupiter-like planets on short-period orbits around K-dwarf stars. Our data comprise a total of 20 transit light curves obtained using five medium-class telescopes, operated using the defocusing technique. The average precision we reach in all our data is RMSQ = 1.1 mmag for Qatar-1 (V = 12.8) and RMST = 1.0 mmag for TrES-5 (V = 13.7). We use these data to refine the orbital ephemeris, photometric parameters, and measured physical properties of the two systems. One transit event for each object was observed simultaneously in three passbands (gri) using the BUSCA imager. The QES survey light curve of Qatar-1 has a clear sinusoidal variation on a period of P⋆ = 23.697 ± 0.123 d, implying significant star-spot activity. We searched for star-spot crossing events in our light curves, but did not find clear evidence in any of the new data sets. The planet in the Qatar-1 system did not transit the active latitudes on the surfaces of its host star. Under the assumption that P⋆ corresponds to the rotation period of Qatar-1A, the rotational velocity of this star is very close to the vsin i⋆ value found from observations of the Rossiter-McLaughlin effect. The low projected orbital obliquity found in this system thus implies a low absolute orbital obliquity, which is also a necessary condition for the transit chord of the planet to avoid active latitudes on the stellar surface.

  19. A TRANSIT TIMING ANALYSIS OF NINE RISE LIGHT CURVES OF THE EXOPLANET SYSTEM TrES-3

    SciTech Connect

    Gibson, N. P.; Pollacco, D.; Simpson, E. K.; Barros, S.; Joshi, Y. C.; Todd, I.; Keenan, F. P.; Skillen, I.; Benn, C.; Christian, D.; Hrudkova, M.; Steele, I. A.

    2009-08-01

    We present nine newly observed transits of TrES-3, taken as part of a transit timing program using the RISE instrument on the Liverpool Telescope. A Markov-Chain Monte Carlo analysis was used to determine the planet-star radius ratio and inclination of the system, which were found to be R{sub p} /R {sub *} = 0.1664{sup +0.0011} {sub -0.0018} and i = 81.73{sup +0.13} {sub -0.04}, respectively, consistent with previous results. The central transit times and uncertainties were also calculated, using a residual-permutation algorithm as an independent check on the errors. A re-analysis of eight previously published TrES-3 light curves was conducted to determine the transit times and uncertainties using consistent techniques. Whilst the transit times were not found to be in agreement with a linear ephemeris, giving {chi}{sup 2} = 35.07 for 15 degrees of freedom, we interpret this to be the result of systematics in the light curves rather than a real transit timing variation. This is because the light curves that show the largest deviation from a constant period either have relatively little out-of-transit coverage or have clear systematics. A new ephemeris was calculated using the transit times and was found to be T{sub c} (0) = 2454632.62610 {+-} 0.00006 HJD and P = 1.3061864 {+-} 0.0000005 days. The transit times were then used to place upper mass limits as a function of the period ratio of a potential perturbing planet, showing that our data are sufficiently sensitive to have probed sub-Earth mass planets in both interior and exterior 2:1 resonances, assuming that the additional planet is in an initially circular orbit.

  20. Seismic activity and stress tensor inversion at Las Tres Vírgenes Volcanic and Geothermal Field (México)

    NASA Astrophysics Data System (ADS)

    Antayhua-Vera, Yanet; Lermo-Samaniego, Javier; Quintanar-Robles, Luis; Campos-Enríquez, Oscar

    2015-10-01

    We analyze local earthquakes occurring between 2003 and 2012 at the Las Tres Vírgenes Volcanic and Geothermal Field (TVVGF) to establish their temporal and spatial distribution, and relationships with local and regional fault systems, water injection, acid stimulation and steam production tests. We obtained focal mechanisms and inverted data for the stress tensor to understand the local and regional stress fields. We analyzed 423 local earthquakes with magnitudes between 0.1 and 2.9 Mc and hypocentral depths from 0.2 to 7.4 km b.s.l. The cutoff depth at ~ 7.4 km possibly delineates the brittle-ductile transition zone. We identified seven swarms (from 1 to 7). Swarms 1 (December 2009), 2 (May 2010), 3 (June-July 2010) and 7 (December 2012) are strongly correlated with injection processes; whereas swarms 5 (April 2012) and 6 (September 2012) are correlated with local tectonic faults. Stress inversion showed NW-SE, E-W and NE-SW extensional orientations (Shmin), in agreement with the local tectonic stress field; while NE-SW compressional orientations (SHmax) are correlated with the regional tectonic stress field.

  1. Birth and death of the Late Cretaceous ``La Luna Sea'', and origin of the Tres Esquinas phosphorites

    NASA Astrophysics Data System (ADS)

    Erlich, R. N.; Macsotay I., O.; Nederbragt, A. J.; Lorente, M. Antonieta

    2000-05-01

    Deposition of organic carbon-rich intervals of the La Luna and Navay formations of northwestern Venezuela was governed by the development of key paleobathymetric barriers (Santa Marta and Santander massifs, Paraguana Block, and ancestral Mérida Andes). These enhanced the development of anoxia in the "La Luna Sea" by causing poor circulation and limited ventilation. Anoxia was also promoted by high evaporation and low precipitation rates (high salinity bottom water), and high levels of marine algal productivity (high organic matter flux). Nutrient supply was augmented by infrequent fluvial sources. Bottom water oxygen levels increased from the Late Santonian through the end of the Cretaceous. Ventilation of anoxic bottom waters may have been enhanced by more frequent or intense seasonal upwelling (caused by higher wind stress) and catastrophic overturn, as well as the removal of a key paleobathymetric barrier. Common byproducts of overturn events were massive phytoplankton blooms, which produced red tides. Fish and marine reptile bone beds within the Tres Esquinas Member (La Luna Formation) are attributed to massive mortality during these events, and are correlative with similar Campanian units in eastern Colombia. During the Maastrichtian, increasing ventilation, combined with siliciclastic dilution, ultimately produced sediments with lower total organic carbon (TOC) content.

  2. Collapse of the northern Jalisco continental slope:Subduction erosion, forearc slivering, or subduction beneath the Tres Marias escarpment?

    NASA Astrophysics Data System (ADS)

    Bandy, W. L.; Mortera-Gutierrez, C. A.; Ortiz-Zamora, G.; Ortega-Ramirez, J.; Galindo Dominguez, R. E.; Ponce-Núñez, F.; Pérez-Calderón, D.; Rufino-Contreras, I.; Valle-Hernández, S.; Pérez-González, E.

    2010-12-01

    Rivera Plate beneath the Tres Marias Escarpment.

  3. Multiple approaches to understanding the taxonomic status of an enigmatic new scorpion species of the genus Tityus (Buthidae) from the biogeographic island of Paraje Tres Cerros (Argentina).

    PubMed

    Ojanguren-Affilastro, Andrés A; Adilardi, Renzo S; Cajade, Rodrigo; Ramírez, Martín J; Ceccarelli, F Sara; Mola, Liliana M

    2017-01-01

    Tityus curupi n. sp., belonging to the bolivianus complex, is described from the biogeographically distinct area of Paraje Tres Cerros in north-eastern Argentina. We also present a molecular species delimitation analysis between Tityus curupi n. sp. and its sister species Tityus uruguayensis Borelli 1901 to confirm species integrity. Furthermore, a cytogenetic analysis is presented for these two species which contain different multivalent associations in meiosis, as a consequence of chromosome rearrangements, and the highest chromosome numbers in the genus.

  4. Multiple approaches to understanding the taxonomic status of an enigmatic new scorpion species of the genus Tityus (Buthidae) from the biogeographic island of Paraje Tres Cerros (Argentina)

    PubMed Central

    Adilardi, Renzo S.; Cajade, Rodrigo; Ramírez, Martín J.; Ceccarelli, F. Sara; Mola, Liliana M.

    2017-01-01

    Tityus curupi n. sp., belonging to the bolivianus complex, is described from the biogeographically distinct area of Paraje Tres Cerros in north-eastern Argentina. We also present a molecular species delimitation analysis between Tityus curupi n. sp. and its sister species Tityus uruguayensis Borelli 1901 to confirm species integrity. Furthermore, a cytogenetic analysis is presented for these two species which contain different multivalent associations in meiosis, as a consequence of chromosome rearrangements, and the highest chromosome numbers in the genus. PMID:28746406

  5. Multi-filter Transit Observations of HAT-P-3b and TrES-3b with Multiple Northern Hemisphere Telescopes

    NASA Astrophysics Data System (ADS)

    Ricci, D.; Sada, P. V.; Navarro-Meza, S.; López-Valdivia, R.; Michel, R.; Fox Machado, L.; Ramón-Fox, F. G.; Ayala-Loera, C.; Brown Sevilla, S.; Reyes-Ruiz, M.; La Camera, A.; Righi, C.; Cabona, L.; Tosi, S.; Truant, N.; Peterson, S. W.; Prieto-Arranz, J.; Velasco, S.; Pallé, E.; Deeg, H.

    2017-06-01

    We present a photometric follow-up of transiting exoplanets HAT-P-3b and TrES-3b, observed by using several optical and near-infrared filters, with four small-class telescopes (D = 36-152 cm) in the Northern Hemisphere. Two of the facilities present their first scientific results. New 10 HAT-P-3b light curves and new 26 TrES-3b light curves are reduced and combined by filter to improve the quality of the photometry. Combined light curves fitting is carried out independently by using two different analysis packages, allowing the corroboration of the orbital and physical parameters in the literature. Results find no differences in the relative radius with the observing filter. In particular, we report for HAT-P-3b a first estimation of the planet-to-star radius {R}p/{R}* ={0.1112}-0.0026+0.0025 in the B band which is coherent with values found in the VRIz‧JH filters. Concerning TrES-3b, we derive a value for the orbital period of P = 1.3061862 ± 0.0000001 days which shows no linear variations over nine years of photometric observations.

  6. NEAR-INFRARED THERMAL EMISSION FROM THE HOT JUPITER TrES-2b: GROUND-BASED DETECTION OF THE SECONDARY ECLIPSE

    SciTech Connect

    Croll, Bryce; Jayawardhana, Ray; Albert, Loic; Lafreniere, David; Fortney, Jonathan J.

    2010-07-10

    We present near-infrared Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-2b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect its thermal emission with an eclipse depth of 0.062{sup +0.013}{sub -0.011}% (5{sigma}). Our best-fit secondary eclipse is consistent with a circular orbit (a 3{sigma} upper limit on the eccentricity, e, and argument or periastron, {omega}, of |e cos {omega}| < 0.0090), in agreement with mid-infrared detections of the secondary eclipse of this planet. A secondary eclipse of this depth corresponds to a dayside Ks-band brightness temperature of T{sub B} = 1636{sup +79}{sub -88} K. Our thermal emission measurement, when combined with the thermal emission measurements using Spitzer/IRAC from O'Donovan and collaborators, suggests that this planet exhibits relatively efficient dayside to nightside redistribution of heat and a near isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. It is unclear if the atmosphere of TrES-2b requires a temperature inversion; if it does it is likely due to chemical species other than TiO/VO as the atmosphere of TrES-2b is too cool to allow TiO/VO to remain in gaseous form. Our secondary eclipse has the smallest depth of any detected from the ground, at around 2 {mu}m, to date.

  7. A user`s manual for the program TRES4: Random vibration analysis of vertical-axis wind turbines in turbulent winds

    SciTech Connect

    1994-03-01

    TRES4 is a software package that works with the MSC/NASTRAN finite element analysis code to conduct random vibration analysis of vertical-axis wind turbines. The loads on the turbine are calculated in the time domain to retain the nonlinearities of stalled aerodynamic loadings. The loads are transformed into modal coordinates to reduce the number of degrees of freedom. Power spectra and cross spectra of the loads are calculated in the modal coordinate system. These loads are written in NASTRAN Bulk Data format to be read and applied in a random vibration analysis by NASTRAN. The resulting response is then transformed back to physical coordinates to facilitate user interpretation.

  8. Transiting Primary Eclipse Photometric Follow-up Observations and Transit Timing Variations Studies of WASP-43 b and TrES-3 b

    NASA Astrophysics Data System (ADS)

    Sun, Z.; Ji, J. H.; Dong, Y.

    2016-11-01

    Two photometric follow-up observations for transiting primary eclipse of WASP-43 b and four for TrES-3 b are performed using the Xuyi Near-Earth Object Survey Telescope. After differential photometry and light curve analysis, physical parameters of the two systems are obtained and are in good match with the literatures. Combining with transit data from many literatures, the residuals (O-C) of observations of both systems transits are fitted with the linear and quadratic terms. With the linear fitting, the periods and transit timing variations (TTVs) of the planets are obtained, and no obvious periodic TTV signal is found in either system after analysis. The maximum mass of perturbing planet located at 1:2 mean motion resonance (MMR) of WASP-43 b and TrES-3 b are estimated to be 1.826 and 1.504 Earth mass, respectively. By quadratic fitting, it is confirmed that WASP-43 b may have long-term TTV which means an orbital decay. The decay rate is shown to be dot{P} =(-0.005248 ± 0.001714) s\\cdotyr^{-1}, and is compared with the previous results. Based on this, the lower limit of the stellar tidal quality parameter of WASP-43 is calculated to be Q'_{*} ≥ 1.5×10^5, and the remaining lifetime of the planets of both systems is presented for different Q'_{*} values accordingly.

  9. Eruption and magma crystallization ages of Las Tres Vírgenes (Baja California) constrained by combined 230Th/ 238U and (U-Th)/He dating of zircon

    NASA Astrophysics Data System (ADS)

    Schmitt, Axel K.; Stockli, Daniel F.; Hausback, Brian P.

    2006-11-01

    Las Tres Vírgenes volcano is a calc-alkaline composite cone located near the main Gulf of California escarpment on the E coast of the Baja California peninsula. High-sensitivity ion microprobe U-series ( 230Th/ 238U) ages for zircon from La Vírgen tephra average 121 - 10 + 12 ka (1σ; MSWD = 2.7), with discrete age peaks at ˜ 100 and 160 ka. The noble gas mass spectrometric (U-Th)/He zircon age, corrected for disequilibrium and pre-eruptive storage, is 36 ± 3 ka. This result for the eruption age of La Vírgen tephra is significantly older than previously postulated historic or Holocene ages that were based on an 18th century map reference and 14C dating of accidental charcoal, respectively. The new (U-Th)/He zircon age is consistent with a > 26 ± 4 ka age derived from cosmogenic He exposure dating of an overlying basaltic lava flow [Hausback, B.P. and Abrams, M.J., 1996. Plinian eruption of La Virgen Tephra, Volcán Las Tres Virgenes, Baja California Sur, Mexico. Eos, Transactions, American Geophysical Union, 77(46, Suppl.): 813-814.]. U-Pb zircon analysis of ignimbrites erupted from the adjacent Early Pleistocene La Reforma and El Aguajito calderas yielded ages of 1.38 ± 0.03 Ma ( n = 12; MSWD = 1.0) and 1.17 ± 0.07 Ma ( n = 23; MSWD = 1.3), respectively. No evidence for these ages is found among La Vírgen zircons, whereas pre-Quaternary zircon xenocrysts are common. The La Vírgen magma, therefore, evolved unrelated to Early Pleistocene magmatism in adjacent calderas, but assimilated local basement rocks. A gap between average Th-U and (U-Th)/He zircon ages suggests that zircon crystallization was discontinuous in the La Vírgen magma chamber. In addition, partial resorption of zircon suggests episodic thermal rejuvenation, most likely by basaltic recharge. Based on the zircon record, the > 100 ka lifetime of the thermal anomaly that sustained repeated intrusive pulses significantly exceeds the age of the last eruption. This strengthens the view that Tres

  10. Dynamic study of the upper Sao Francisco river and Tres Marias reservoir using MSS/LANDSAT images. M.S. Thesis; [BRazil

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The relationship between the dispersion and concentration of sediment in the superficial layers of the Tres Marias reservoir and the dynamics of the drainage basins of its tributaries was verified using LANDSAT MSS imagery. The drainage network, dissection patterns, and land use of each watershed were considered in an analysis of multispectral images, corresponding to bands 4,5, and 7, of dry and rainy seasons in 1973, 1975, 1977, and 1978. The superficial layer water layers of the reservoir were also divided according to the grey level pattern of each image. Two field trips were made to collect Secchi depths and in situ water reflectance. It is concluded that it is possible to determine the main factors that act in the dynamics of the drainage basins of a reservoir by simultaneous control of the physical variables and the antropic action of each basin.

  11. Hydrochemical-isotopic and hydrogeological conceptual model of the Las Tres Vı´rgenes geothermal field, Baja California Sur, México

    NASA Astrophysics Data System (ADS)

    Portugal, E.; Birkle, P.; Barragán R, R. M.; Arellano G, V. M.; Tello, E.; Tello, M.

    2000-09-01

    Based on geological, structural, hydrochemical and isotopic data, a hydrogeological conceptual model for the geothermal reservoir, shallow wells and springs at the Las Tres Vı´rgenes geothermal field and its surroundings is proposed. The model explains the genesis of different types of thermal and cold groundwater in the NW (El Azufre Valley, Las Tres Vı´rgenes and Aguajito complex), NE (Reforma complex) and S (Sierra Mezquital) areas. Shallow groundwater of sulfate type in the NW zone is explained by the rise of CO 2-H 2S vapor from a shallow magma chamber and the subsequent heating up of a shallow aquifer. Vertical communication between the reservoir and the surface is facilitated by a series of extensional, NW-SE-trending normal faults, forming the graben structures of the Santa Rosalı´a Basin. Low-permeability characteristics of the geological formations of the study area support the hypothesis of a fracture and fault-dominated, subterranean-flow circulation system. The Na- (Cl-HCO 3) composition of springs in the NE and SE zones indicates influence of ascending geothermal fluids, facilitated by radial fault systems of the Reforma caldera and probably the existence of a shallow magma chamber. Close to the surface, the rising geothermal fluids are mixed up with meteoric water from a shallow aquifer. The Las Tres Vı´rgenes and the Reforma complex are separated by younger, N-S-trending lateral shearing faults, such as the Cimarrón fault; such disposition explains the genesis of different hydrogeological flow regimes on both sides. HCO 3-type surface water from the southern zone between San Ignacio and Mezquital is of typical meteoric origin, with no influence of geothermal fluids. Due to arid climatic conditions in the study zone, recent recharge in the geothermal area seems improbable; thus, recent interaction between the surface and the geothermal reservoir can be excluded. Furthermore, isotopic and hydrochemical data exclude the presence of marine

  12. The GTC exoplanet transit spectroscopy survey. II. An overly large Rayleigh-like feature for exoplanet TrES-3b

    NASA Astrophysics Data System (ADS)

    Parviainen, H.; Pallé, E.; Nortmann, L.; Nowak, G.; Iro, N.; Murgas, F.; Aigrain, S.

    2016-01-01

    Aims: We search for Rayleigh scattering and K and Na absorption signatures from the atmosphere of TrES-3b using ground-based transmission spectroscopy covering the wavelength range from 530 to 950 nm as observed with the OSIRIS instrument at the Gran Telescopio CANARIAS. Methods: Our analysis is based on a Bayesian approach where the light curves covering a set of given passbands are fitted jointly with PHOENIX-calculated stellar limb darkening profiles. The analysis is carried out assuming both white and red noise that is temporally correlated, with two approaches (Gaussian processes and divide-by-white) to account for the red noise. Results: An initial analysis reveals a transmission spectrum that shows a strong Rayleigh-like increase in extinction towards the blue end of the spectrum, and enhanced extinction around the K I resonance doublet near 767 nm. However, the signal amplitudes are significantly larger than expected from theoretical considerations. A detailed analysis reveals that the K I-like feature is entirely due to variability in the telluric O2 absorption, but the Rayleigh-like feature remains unexplained. The light curves are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/585/A114

  13. A possible widespread Upper Miocene to Lower Pliocene rift-related sequence under the marine shelf from Mazatlan to the Tres Marias islands, southeastern Gulf of California, Gulf of California MARGINS project

    NASA Astrophysics Data System (ADS)

    Umhoefer, P. J.; Paramo, P.; Brown, H. E.; Holbrook, W. S.; Sutherland, F.; Kent, G. M.; Harding, A. J.; Fletcher, J. M.; Lizarralde, D.; González-Fernández, A.; Axen, G.

    2003-12-01

    The margins of the plate boundary on either side of the southern Gulf of California differ substantially. The western margin along Baja California is narrower and has mush less sediment than the eastern margin. The eastern margin is dominated by a 30 - 60-km wide coastal plain and a 40 - 100-km wide marine shelf, both of which cover faults and basins. The Tres Marias islands are the only chance for a detailed geologic window into the shelf. Therefore, seismic reflection lines and the Tres Marias islands are critical to understanding the geology of the southeastern margin of the plate boundary. Previous workers described 1100 - 1600 m of strata on Maria Madre Island that is Late Miocene (~8 Ma) to Pleistocene in age. The section changes abruptly from basal marginal(?) marine sandstone into thick mudstone and diatomite formed in a Late Miocene to Early Pliocene slope to deep marine setting. Within the Lower Pliocene section is an angular unconformity. The Pliocene section shallows up to outer shelf to upper slope conditions, possibly across a second major unconformity that separates the lower and upper Pliocene. The Pliocene marine strata are overlain abruptly across a third unconformity by Pleistocene nonmarine to shallow marine sandstone and conglomerate. Two of our seismic reflection lines run onto the modern shelf between the Tres Marias islands and Puerta Vallarta. The lines show an undeformed upper sequence that lies on a major unconformity above a lower sequence. The upper sequence is ~100 m to ~1 km thick and onlaps and fills previous topography. The lower sequence is consistently broken by normal faults and shows common growth sedimentation related to faulting. The lower sequence is most commonly from 0.5 to 1.0 seconds (two-way travel time). The upper and lower sequences are also well defined on a seismic line offshore of Mazatlan; the lower sequence is under the shelf and slope out to ~80 km offshore; the upper sequence is unfaulted, while the lower

  14. Extreme fractionation in a granite-pegmatite system documented by quartz chemistry: The case study of Tres Arroyos (Central Iberian Zone, Spain)

    NASA Astrophysics Data System (ADS)

    Garate-Olave, I.; Müller, A.; Roda-Robles, E.; Gil-Crespo, P. P.; Pesquera, A.

    2017-08-01

    The Tres Arroyos granite-pegmatite system is located in the SW margin of the Nisa-Alburquerque Variscan batholith. Two granitic facies (monzogranite and marginal leucogranite) and three types of aplite-pegmatite dykes (barren, intermediate and highly evolved Li-rich), have been distinguished in the area, with a zoned distribution from the granite southwards. Trace elements in quartz from the five facies have been analysed by LA-ICP-MS in order to obtain information about the petrogenetic links among the different lithologies of this system, as well as to better understand the regional and individual fractionation processes that led to the distinct rocks. Aluminium, Ti, Li and Ge show continuous trends from the monzogranite, through the marginal granitic facies, the barren and intermediate aplite-pegmatites, up to the most evolved Li-rich dykes. Titanium and Ge contents, respectively, decrease and increase gradually with fractionation. In contrast, Al and Li show a more complex trend, with an initial descending trend to the marginal granitic facies, and then showing the highest Al and Li contents in the quartz from the most fractionated Li-rich aplite-pegmatites. This suggests the influence of different competing factors controlling the incorporation of these trace elements in quartz, such as the chemical composition of the melt, the P and T conditions and the rate of crystallization. Based on the good correlation between Al and Li, the substitution Si4 + ↔ Al3 + + Li+ seems to be the dominant mechanism of Li incorporation into quartz. The negligible amount of other trace elements suggests that the remaining Al was mainly compensated with H+ ions, via the Si4 + ↔ Al3 + + H+ substitution. A continuous fractionation trend from the monzogranite up to the most fractionated aplite-pegmatites is inferred from geochemical modelling by applying the Rayleigh equation for fractional crystallization. Fractionation rates over 50% are needed to obtain the marginal granite

  15. Polymorphisme de l'apolipoprotéine E dans la population du nord du Maroc: fréquence et influence sur les paramètres lipidiques

    PubMed Central

    Benyahya, Fatiha; Barakat, Amina; Ghailani, Naima; Bennani, Mohcine

    2013-01-01

    Introduction L'objectif de ce travail est de déterminer les fréquences alléliques et génotypiques des sites polymorphes situés dans le gène de l'apolipoprotéine E (apo E) ainsi que leur impact sur les paramètres cliniques et lipidiques dans un échantillon de la population du nord du Maroc cliniquement diagnostiqué ADH. Méthodes Le génotype de l'apo E a été analysé par séquençage direct chez 46 patients cliniquement diagnostiqués ADH selon les critères standards. Résultats Les fréquences des allèles epsilon 3, epsilon 2 et epsilon 4 ont été respectivement 78.3%, 2.2% et 19.6%. La fréquence de l'allèle epsilon 4 est très élevée chez la population du nord du Maroc en comparaison avec les populations des autres régions marocaines. Elle est similaire à celle rapportée dans les pays de l'Europe du nord. Les taux du cholestérol total, du cholestérol LDL ainsi que la présence des xanthomes et les maladies cardiovasculaires ne différent pas entre les génotypes de l'apoE. En revanche, les résultats ont montré une influence de l'allèle epsilon4 sur le taux des triglycérides chez les sujets obèses. Conclusion Le génotype de l'apoE ne peut expliquer le phénotype clinique et biochimique présenté par des patients du Nord du Maroc cliniquement diagnostiqués ADH. PMID:24396563

  16. Diurnal Cycles of Aerosol Optical Properties at Pico Tres Padres, Mexico City: Evidences for Changes in Particle Morphology and Secondary Aerosol Formation

    NASA Astrophysics Data System (ADS)

    Mazzoleni, C.; Dubey, M.; Chakrabarty, R.; Moosmuller, H.; Onasch, T.; Zavala, M.; Herndon, S.; Kolb, C.

    2007-12-01

    Aerosol optical properties affect planetary radiative balance and depend on chemical composition, size distribution, and morphology. During the MILAGRO field campaign, we measured aerosol absorption and scattering in Mexico City using the Los Alamos aerosol photoacoustic (LAPA) instrument operating at 781 nm. The LAPA was mounted on-board the Aerodyne Research Inc. mobile laboratory, which hosted a variety of gaseous and aerosol instruments. During the campaign, the laboratory was moved to different sites, capturing spatial and temporal variability. Additionally, we collected ambient aerosols on Nuclepore filters for scanning electron microscopy (SEM) analysis. SEM images of selected filters were taken to study particle morphology. Between March 7th and 19th air was sampled at the top of Pico Tres Padres, a mountain on the north side of Mexico City. Aerosol absorption and scattering followed diurnal patterns related to boundary layer height and solar insulation. We report an analysis of aerosol absorption, scattering, and morphology for three days (9th, 11th and 12th of March 2006). The single scattering albedo (SSA, ratio of scattering to total extinction) showed a drop in the tens-of-minutes-to-hour time frame after the boundary layer grew above the sampling site. Later in the day the SSA rose steadily reaching a maximum in the afternoon. The SEM images showed a variety of aerosol shapes including fractal-like aggregates, spherical particles, and other shapes. The absorption correlated with the CO2 signal and qualitatively with the fraction of fractal-like particles to the total particle count. In the afternoon the SSA qualitatively correlated with a relative increase in spherical particles and total particle count. These observed changes in optical properties and morphology can be explained by the dominant contribution of freshly emitted particles in the morning and by secondary particle formation in the afternoon. SSA hourly averaged values ranged from ~0.63 in

  17. Etude théorique des paramètres principaux réglant la sensibilité des capteurs d'accélération à cristal de quartz

    NASA Astrophysics Data System (ADS)

    Delaite, R.; Aïch, Y.

    1994-10-01

    A theoretical analysis of quartz accelerometers is performed to determine their optimal mechanical and sensitivity performances. A general analytical model is used to investigate the parameters and their effects on the sensitivity of these sensors. The analysis of physical characteristics shows that feasibility and performances depend on three factors such as dimensions of the quartz plate, quantity of holders located at the crystal edge and location of these holders with respect to the crystal's crystallographic reference. This study is applied to various design sensors with different supporting quartz crystal. The conditions on parameters are given to achieve optimum performances. Une étude théorique de la sensibilité des capteurs d'accélération à cristal de quartz est présentée. Son but est d'optimiser les performances mécaniques et métrologiques de ces capteurs. Les paramètres sensibles sont mis en évidence. L'analyse des caractéristiques physiques démontre que la faisabilité et les performances des accéléromètres à quartz dépendent, pour une coupe donnée du cristal, de trois facteurs : les dimensions de la lame de quartz, le nombre de liaisons à la périphérie du cristal et la position de ces liaisons par rapport à la référence cristallographique. L'étude est appliquée aux cas des capteurs bipodes, multipodes et monopodes. Pour chaque type de capteur, les valeurs des paramètres sensibles correspondant aux performances optimales sont précisées.

  18. Study of the relation between soil use, vegetation coverage, and the discharge of sediments from artificial reservoirs using MSS/LANDSAT images. Example: The Tres Marias reservoir and its supply basin

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1981-01-01

    The land use and types of vegetation in the region of the upper Sao Francisco River, Brazil, are identified. This region comprises the supply basin of the Tres Marias reservoir. Imagery from channels 5 and 7 of the LANDSAT multispectral band scanner during wet and rainy seasons and ground truth data were employed to characterize and map the vegetation, land use, and sedimentary discharges from the reservoir. Agricultural and reforested lands, meadows, and forests are identified. Changes in land use due to human activity are demonstrated.

  19. Caractérisation de matériaux a basse température. Dilatation conductivité, essais mécaniques; étalonnage de thermomètres industriels

    NASA Astrophysics Data System (ADS)

    Chabert, J. N.

    1991-02-01

    The Low Temperatures Department is equiped with the following testing benchs/stands: thermal dilatation from 4 K to 300 K; thermal conductivity from 2 K to 300 K; mechanical testing at 4 K, 77 K and 300 K; industrial thermometers calibration (Allen-Bradley carbon resistors) from 1.7 K to 80 K; platine resistors thermometers calibration (DEGUSSA) from 20 K to 300 K. These measurements can be carried out in the Laboratory for internal studies or for external demands. Le Service des Basses Températures est équipé des bancs de mesure suivants : dilatation thermique de 4 K à 300 K ; conductivité thermique de 2 K à 300 K ; essais mécaniques à 4 K, 77 K et 300 K ; étalonnage de thermomètres industriels (résistance de carbone AllenBradley) de 1,7 K à 80 K; étalonnage de thermomètres à résistance de platine (DEGUSSA) de 20 K à 300 K. Le laboratoire peut effectuer ces mesures pour ses besoins propres ou pour des clients extérieurs.

  20. Source X par agrégats : contrôle et optimisation des paramètres gouvernant l'interaction laser de puissance agrégats de gaz rare

    NASA Astrophysics Data System (ADS)

    Lamour, E.; Prigent, C.; Rozet, J. P.; Vernhet, D.; Gobert, O.; Meynadier, P.; Normand, D.; Perdrix, M.

    2005-06-01

    Les expériences que nous avons réalisées sur le Laser Ultra Court Accordable du CEA Saclay permettent d'observer l'émission de photons X dans la gamme 1-5 keV lors de l'irradiation d'agrégats de gaz rare (Ar, Kr et Xe comprenant entre 103 et 106 atomes par agrégat) avec un laser femtoseconde de puissance (Ipic jusqu'à 1017 W/cm2). En plus de la distribution des états de charge des ions responsables de l'émission X, la technique de spectroscopie X que nous utilisons permet de mesurer les taux absolus de photons émis dans 4π par impulsion laser en fonction des paramètres gouvernant l'interaction dans des conditions contrôlées. Nous avons déterminé la sensibilité des paramètres physiques régissant la production du rayonnement X pendant l'interaction, ce qui permet d'accéder à l'optimisation de cette source. Cet article est plus particulièrement dédié aux résultas relatifs à l'évolution du taux d'X avec l'éclairement laser, d'une part, et avec la durée de l'impulsion laser, d'autre part.

  1. Near-infrared Thermal Emission from TrES-3b: A Ks-band Detection and an H-band Upper Limit on the Depth of the Secondary Eclipse

    NASA Astrophysics Data System (ADS)

    Croll, Bryce; Jayawardhana, Ray; Fortney, Jonathan J.; Lafrenière, David; Albert, Loic

    2010-08-01

    We present H- and Ks-band photometry bracketing the secondary eclipse of the hot Jupiter TrES-3b using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope. We detect the secondary eclipse of TrES-3b with a depth of 0.133+0.018 -0.016% in the Ks band (8σ)—a result that is in sharp contrast to the eclipse depth reported by de Mooij & Snellen. We do not detect its thermal emission in the H band, but place a 3σ limit of 0.051% on the depth of the secondary eclipse in this band. A secondary eclipse of this depth in Ks requires very efficient day-to-nightside redistribution of heat and nearly isotropic reradiation, a conclusion that is in agreement with longer wavelength, mid-infrared Spitzer observations. Our 3σ upper limit on the depth of our H-band secondary eclipse also argues for very efficient redistribution of heat and suggests that the atmospheric layer probed by these observations may be well homogenized. However, our H-band upper limit is so constraining that it suggests the possibility of a temperature inversion at depth, or an absorbing molecule, such as methane, that further depresses the emitted flux at this wavelength. The combination of our near-infrared measurements and those obtained with Spitzer suggests that TrES-3b displays a near-isothermal dayside atmospheric temperature structure, whose spectrum is well approximated by a blackbody. We emphasize that our strict H-band limit is in stark disagreement with the best-fit atmospheric model that results from longer wavelength observations only, thus highlighting the importance of near-infrared observations at multiple wavelengths, in addition to those returned by Spitzer in the mid-infrared, to facilitate a comprehensive understanding of the energy budgets of transiting exoplanets. Based on observations obtained with WIRCam, a joint project of CFHT, Taiwan, Korea, Canada, France, at the Canada-France-Hawaii Telescope (CFHT) which is operated by the National Research Council (NRC) of

  2. Evaluation of SIR-A (Shuttle Imaging Radar) images from the Tres Marias region (Minas Gerais State, Brazil) using derived spatial features and registration with MSS-LANDSAT images

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Kux, H. J. H.; Dutra, L. V.

    1984-01-01

    Two image processing experiments are described using a MSS-LANDSAT scene from the Tres Marias region and a shuttle Imaging Radar SIR-A image digitized by a vidicon scanner. In the first experiment the study area is analyzed using the original and preprocessed SIR-A image data. The following thematic classes are obtained: (1) water, (2) dense savanna vegetation, (3) sparse savanna vegetation, (4) reforestation areas and (5) bare soil areas. In the second experiment, the SIR-A image was registered together with MSS-LANDSAT bands five, six, and seven. The same five classes mentioned above are obtained. These results are compared with those obtained using solely MSS-LANDSAT data. The spatial information as well as coregistered SIR-A and MSS-LANDSAT data can increase the separability between classes, as compared to the use of raw SIR-A data solely.

  3. Photopolymérisation des monomères multifonctionnels dans une matrice polymère Effet de différents paramètres sur la réactivité des monomères

    NASA Astrophysics Data System (ADS)

    Bendaikha, T.; Boussaad, S.; Boutamdja, M.

    2005-05-01

    Un matériau polymère semi-interpénétré a été obtenu par polymérisation d'un monomère diacrylate, le tripropylène glycol diacrylate (TPGDA) ou le 1,6-hexanediol diacrylate (HDDA) dispersé dans une matrice organique qui est le polystyrène ou le copolymère élastomérique SBS. L'amorçage de la réaction se fait par voie photochimique en utilisant des photoamorceurs qui se décomposent rapidement sous l'action des radiations UV émises par une lampe à vapeur de mercure. La cinétique de la réaction a été suivie quantitativement par spectroscopie IR. Les effets de plusieurs paramètres sur la vitesse de la polymérisation ont été étudiés.

  4. TRES Survey of Variable Diffuse Interstellar Bands

    NASA Astrophysics Data System (ADS)

    Law, Charles; Milisavljevic, Dan; Crabtree, Kyle; Johansen, Sommer; Patnaude, Daniel

    2017-01-01

    Diffuse interstellar bands (DIBs) are absorption features commonly observed in optical/near-infrared spectra of stars and thought to be associated with polyatomic molecules that comprise a significant reservoir of organic material in the universe. However, because the central wavelengths of DIBs do not correspond with electronic transitions of known atomic or molecular species, the specific physical nature of their carriers remains inconclusive despite decades of observational, theoretical, and experimental research. It is well established that DIB carriers must be located in the interstellar medium, but the recent discovery of time-varying DIBs in the spectra of the extragalactic supernova SN 2012ap suggests that some may be created in massive star environments. We report evidence of short time-scale (˜1-60 days) variations in DIB absorption line substructure toward 3 of 17 massive stars observed as part of a pathfinder survey of variable DIBs. The detections are made in high-resolution optical spectra (R ˜ 44000) from the Tillinghast Reflection Echelle Spectrograph on the 1.5m Tillinghast telescope at the Smithsonian Astrophysical Observatory's Fred L. Whipple Observatory on Mt. Hopkins in Arizona. Our detections have signal-to-noise ratios of 5-15 around the features of interest, and are thus considered significant but requiring further investigation. We find that these changes are potentially consistent with interactions between stellar winds and DIB carriers in close proximity. Our findings motivate a larger survey to further characterize these variations and may establish a powerful new method for probing the poorly understood physical characteristics of DIB carriers.

  5. Mapping variations in weight percent silica measured from multispectral thermal infrared imagery - Examples from the Hiller Mountains, Nevada, USA and Tres Virgenes-La Reforma, Baja California Sur, Mexico

    USGS Publications Warehouse

    Hook, S.J.; Dmochowski, J.E.; Howard, K.A.; Rowan, L.C.; Karlstrom, K.E.; Stock, J.M.

    2005-01-01

    Remotely sensed multispectral thermal infrared (8-13 ??m) images are increasingly being used to map variations in surface silicate mineralogy. These studies utilize the shift to longer wavelengths in the main spectral feature in minerals in this wavelength region (reststrahlen band) as the mineralogy changes from felsic to mafic. An approach is described for determining the amount of this shift and then using the shift with a reference curve, derived from laboratory data, to remotely determine the weight percent SiO2 of the surface. The approach has broad applicability to many study areas and can also be fine-tuned to give greater accuracy in a particular study area if field samples are available. The approach was assessed using airborne multispectral thermal infrared images from the Hiller Mountains, Nevada, USA and the Tres Virgenes-La Reforma, Baja California Sur, Mexico. Results indicate the general approach slightly overestimates the weight percent SiO2 of low silica rocks (e.g. basalt) and underestimates the weight percent SiO2 of high silica rocks (e.g. granite). Fine tuning the general approach with measurements from field samples provided good results for both areas with errors in the recovered weight percent SiO2 of a few percent. The map units identified by these techniques and traditional mapping at the Hiller Mountains demonstrate the continuity of the crystalline rocks from the Hiller Mountains southward to the White Hills supporting the idea that these ranges represent an essentially continuous footwall block below a regional detachment. Results from the Baja California data verify the most recent volcanism to be basaltic-andesite. ?? 2005 Elsevier Inc. All rights reserved.

  6. Détermination des paramètres bioécologiques et entomologiques d’Anopheles gambiae sl dans la transmission du paludisme à Bandundu-ville, République Démocratique de Congo

    PubMed Central

    Matubi, Emery Metelo; Bukaka, Eric; Luemba, Trésor Bakambana; Situakibanza, Hyppolite; Sangaré, Ibrahim; Mesia, Gauthier; Ngoyi, Dieudonné Mumba; Maniania, Nguya Kalemba; Akikwa, Charles Ngandote; Kanza, Jean Pierre Basilua; Tamfum, Jean-Jacques Muyembe; sudi, Jonas Nagahuedi Bongo

    2015-01-01

    Introduction La présente étude a été menée à Bandundu-ville (RDC) en vue d'identifier les paramètres écologiques et entomologiques modulant la transmission du paludisme ainsi que leur tendance saisonnière dans cette agglomération. Méthodes Cette étude a été réalisée dans la période du 1er juin au 31 décembre 2011. Des prospections des gîtes larvaires d'anophèles avec récolte ont été réalisées, les paramètres physiques, physico-chimiques et environnementaux déterminés. La densité larvaire a été estimée selon une échelle de classes de densité, inspirée de la méthode de Carron pour chaque type de gîtes. Quarante-huit maisons ont été sélectionnées et prospectées pour la récolte des moustiques par pulvérisation intradomicilaire. L'identification des moustiques a été faite sur base des critères morphologiques de Gilles et Demeillon. L'Indice sporozoïtique (Is) a été déterminé par le test ELISA CSP de Plasmodium falciparum à l'Institut National de Recherche Biomédicale selon le protocole de Robert Wirtz. Les autres paramètres entomologiques comme la densité, le taux d'agressivité, le taux d'inoculation entomologique (TIE) ainsi que l'indice de stabilité ont été déterminés selon le protocole de l'OMS. La régression linéaire a été réalisée au seuil de signification de 0,05 pour identifier les déterminants de la densité larvaire. Résultats Cent-sept gîtes larvaires ont été identifiés et caractérisés en 5 types (digues et puits d'eau, collections d'eau maraîchère et concasseurs moellons, marais Régie de distribution d'eau, marais le long des rivières et ruisseaux et flaques d'eau de pluies). La densité larvaire moyenne a été de 117,4±64,1. Quatre mille cinq cents quatre-vingt-huit moustiques ont été capturés et identifiés, parmi lesquels 1.258 Anopheles gambiae sl avec une densité de 8,86, un taux d'agressivité de 1,55 piqûre par homme par nuit, l'Is de 5,6%, un TIE de 0,085 piq

  7. Variabilité inter et intra-opérateur de l’analyse des paramètres spermatiques: résultat d’un programme de contrôle de qualité

    PubMed Central

    Daoud, Salima; Chakroun-Feki, Nozha; Sellami, Afifa; Ammar-Keskes, Leila; Rebai, Tarek

    2016-01-01

    Introduction L’analyse du sperme est d’une importance majeure dans l’exploration de l'infertilité masculine. Afin de s’assurer de la fiabilité des résultats rendus, l’implantation du management de qualité en spermiologie est devenue une nécessité.Le but de ce travail a été d’évaluer la variabilité intra- et inter-opérateurau cours de l’analyse des paramètres spermatiques au sein de notre laboratoire de spermiologie, à travers la mise en place d’un programme de contrôle de qualité. Méthodes Quatre opérateurs ayant des niveaux d’expérience différents ont participé à l’étude. La variabilité inter-individuelle des résultats des lectures de la mobilité, la concentration et la morphologie spermatique a été évaluée sur plusieurs échantillons de sperme de qualités différentes. Pour chaque paramètre spermatique, la variabilité intra-individuelle a été évaluée en analysant les résultats des lectures de plusieurs aliquotes issus de chacun des échantillons utilisés. Résultats Les coefficients de variation moyens inter-opérateurs ont été de12.8%, 19.8% et 48.9% pour la mobilité, la concentration et la morphologie spermatique, respectivement. Les coefficients de variation moyens intra-opérateurs ont été de6.9%, 12.3%et 42.7% pour la mobilité, la concentration, et la morphologie spermatique, respectivement. Mis à part quelques écarts (erreurs aléatoires), la plupart des mesures réalisées ont été dans les limites d’acceptabilité pour l’ensemble des opérateurs.La variabilité de l’évaluation morphologique des spermatozoïdes a été particulièrement influencée par le niveau d’expérience de l’opérateur. Conclusion Les résultats de cette étude mettent l’accent sur la nécessité d’une formation adéquate du personnel de laboratoire, et de la participation régulière aux contrôles de qualité internes afin de minimiser les divergences et d’améliorer la fiabilité des r

  8. Calcul des paramètres électromagnétiques d'un moteur à réluctance à commutations par une méthode hybride: éléments finis. Equations intégrales de frontière

    NASA Astrophysics Data System (ADS)

    Omekanda, Avoki; Broche, Christian; Baland, René

    1992-11-01

    The switched reluctance motor (SRM) is a doubly salient electrical machine carrying simple windings in which flow unidirectional currents over appropriate rotor positions[1]. Because of its simplicity, robustness, and high efficiency[2, 3], SRM is evaluated for variable speed- and traction drives. In this paper, a quadratic two-dimensional technique founded upon Lagrange curvilinear elements and coupling finite element method (FEM)- and boundary integral equation method (BIEM) is used to calculate electromagnetic parameters in a SRM. The application of this method to two SRM prototypes provides an accurate analysis of the magnetostatic field and gives good values of the electromagnetic parameters of a SRM. Le moteur à réluctance à commutations est une machine électrique à structures saillantes au stator et au rotor et qui comporte des bobinages simples dans lesquels circulent des courants unidirectionnels pour des positions appropriées du rotor[1]. Grâce à sa simplicité, sa robustesse et son rendement élevé[2, 3], ce moteur à réluctance est apprécié dans les entraînements à vitesse variable et de traction. Dans cet article, nous présentons l'application d'une méthode quadratique bidimensionnelle qui couple des éléments finis (MEF) et la méthode des équations intégrales de frontière (MEIF) en vue du calcul des paramètres électromagnétiques d'un moteur à réluctance à commutations. L'application de cette méthode à deux prototypes fournit une analyse précise de la répartition du champ magnétique ainsi qu'une bonne prédiction des paramètres électromagnétiques de ces moteurs.

  9. Ameliorer les performances environnementales des centrales a charbon pulverise via la co-combustion de combustible derive de dechets

    NASA Astrophysics Data System (ADS)

    Vekemans, Odile Geraldine

    Coal supplies around 28% of the world's energy needs and produces some 40% of the world's electricity. In the United States, close to 650 coal power plants currently produce electricity from coal, the majority of witch are equipped with pulverized coal boilers build in the 80's. Due to coal's intrinsic content in nitrogen and sulfur, its combustion is associated with high levels of NOx and SO2 emissions, that are responsible, among other thing, for acid rains. In order to help reduce SO2 emissions of coal power plant, this thesis focuses on the behaviour of a novel feedstock called ReEF(TM) or ReEngineered Feedstock(TM), developed by the company Accordant Energy LLCRTM, that combines non recyclable waste and alkaline sorbent. Since waste have a high calorific value and do not contain sulfur, and since alkaline sorbents (such as limestone) are able to react with SO2 and capture it in solid state, co-combustion of ReEF(TM) and coal could reduce SO2 emissions inside the furnace chamber itself. This technology easy to implement, as it requires a limited initial investment and limited additional space, could help avoid the construction of costly flue gas treatment unit downstream from the furnace. However, careless combustion of this engineered fuel could have disastrous consequences for the coal power plant owners. This thesis, then, deliver one among the first experimental study of co-combustion of coal and ReEF(TM) in conditions characteristic of pulverized coal boilers. As a first step, in order to get familiarize with the feedstock under study, the thermal degradation of a ReEF(TM) without sorbent and of its components is analyzed by thermogravimetry. With the analysis of more than 70 samples at heating rates ranging from 5°C/min to 400°C/min we are able to conclude that ReEF(TM) thermal degradation can be seen as the independent thermal degradation of its components, as long as heat transfer limitations are taken into account. Thus, no substantial chemical interactions between ReEF(TM) components take place during its devolatilization. During the second step of this study, performances of the co-firing of coal and sorbent are compared to that of co-combustion of coal and ReEF(TM) without sorbent. This is carried out in a reactor specially build for this study, capable of reproducing the contact mode between gas and particles, the concentrations, the temperature gradient and the pressure typical of pulverized coal boiler. SO2 emissions reduction around 20% are observed in presence of CaCO3 and of Ca(OH)2 compared to the coal baseline, reduction that generally increased with the increase of sorbent molar ratio compared to sulfur (also called stoic). As for the co-combustion of 20%th of ReEF(TM) and coal, a SO2 emission reduction around 20% is also measured, with no clear effect of ReEF(TM) composition (fiber to plastic ratio). On the other hand, the HCl level that is negligible during coal combustion with and without sorbent, reaches around 20ppm in presence of ReEF(TM), and increases proportionally with the ReEF(TM) plastic content. The first step of this work consists in the study of the co-combustion of coal and ReEF(TM) containing limestone (CaCO3), a mix of sodium bicarbonate (NaHCO3) and limestone, as well as a mix of trona (Na2CO3.NaHCO3.H2O) and limestone. The amount of sorbent in the ReEF(TM) as well as the feeding parameters are adjusted to reach a 20%th feeding of ReEF(TM) compared to coal, to inject sorbents at a stoic of 1, 2 and 2.5 and to obtain Na/Ca molar ratios of 0, 0.1 with trona and NaHCO3, and 0.5 with NaHCO 3 only. Globally, as in the case of sorbent alone, the increase of the total stoic of the feed leads to increased SO2 capture. For a given stoic, to combine waste and limestone in the ReEF(TM), compared to using limestone alone, allows to reach higher levels of SO2 emissions reduction. The combination of sodium-based and calcium-based sorbent even leads to record SO2 emissions reduction of more than 50% with trona, and more than 40% with NaHCO3, at gas residence time in the reactor four time smaller than typical residence time of PCB. Furthermore, the lower fuel-N content of the ReEF(TM), compared to coal, also leads to lower NOx emissions. Combustion of ReEF(TM) with trona is even associated with NOx emissions reduction of more than 50%, possibly due to sodium induced NO reduction. Finally, regarding HCl emissions, chlorine capture by the sorbents leads to HCl levels comparable to that of coal alone. Even if, from the point of view of pollutant emissions, the results are promising, co-feeding ReEF(TM) with sorbent was nonetheless associated with heavy formation of melted ash deposits in the reactor. Deposition probes are used to compare the magnitude of the deposition in function of the ReEF(TM) sorbent composition. With those probes, we are able to figure out that slag formation is quite severe in presence of NaHCO3, and all the more that the Na/Ca ratio is high, but is less severe in presence of limestone alone, and isn't at all problematic in presence of trona. Those results all seem to indicate that co-combustion of coal and 20%th ReEF(TM) containing limestone and trona at a Na/Ca ratio of 0.1 and at a total stoic of 2 is the most adequate composition for application in existing PCB. In all those experiments a single measure of the emissions at the exit of the reactor is conducted, the emissions being associated with a federate of gas and solid and a temperature profile along the reactor. In order to gain insight regarding the behaviour of the gas and the particles inside the reactor, a phenomenological model combining more than 30 reaction kinetics is developed. This model allows us, without any fitting parameter, to predict the CO2, SO2 and NOx emissions measured at the outlet of the reactor. This model is easily adapted to the different ReEF(TM) compositions and was able to take into account the various particle sizes. The model is then used to evaluate potential SO2 emissions reduction that could be obtain with ReEF(TM) co-combustion for a residence time and a temperature profile measured in an existing pulverized coal boiler. Those simulations indicate that SO2 emissions reduction up to 85% could be obtain at the exit of the furnace chamber with a 20%th coal feed substitution by ReEF(TM) containing limestone and trona. Co-combustion of ReEF(TM) in pulverized coal boiler is therefore sensible from the point of view of pulverized coal boiler environmental performances, as long as the ReEF(TM) composition is chosen wisely and is tested beforehand in conditions similar to that of PCB. Furthermore, since ReEF(TM) co-combustion allows electricity production at high efficiency from waste, it is also sensible in terms of waste energetic valorization.

  10. Where are the Black Walnut Tres in Iowa? 1996

    Treesearch

    J. Michael Vasievich; Neal P. Kingsley

    1996-01-01

    The third measurement of Iowa?s forests was completed in 1990 by the North Central Forest Experiment Station and the Iowa Department of Natural Resources (Brand and Walkowiak 1991). The inventory found that black walnut trees are common in the forests of Iowa. Two out of every hundred trees in the State are black walnuts. To accomplish the inventory, more than 12,769...

  11. The Three Roots of Cuban Heritage. (Los Tres Raices de la Herencia Cubana.)

    ERIC Educational Resources Information Center

    Alzaga, Florinda

    1980-01-01

    Discusses legacies of traits left by Cuba's three ethnic streams--the Spanish, Black, and Taino--that together explain Cuban personality and way of life. Asserts that by understanding what each group has contributed, Cubans can better know themselves and better project for their future, both individually and collectively. (DS)

  12. Tres mitos de la fonetica espanola (Three Myths of Spanish Phonetics).

    ERIC Educational Resources Information Center

    Dalbor, John B.

    1980-01-01

    Contrasts current pronunciation of some Spanish consonants with the teachings and theory of pronunciation manuals, advocating more realistic standards of instruction. Gives a detailed phonetic description of common variants of the sounds discussed, covering both Spanish and Latin American dialects. (MES)

  13. Análisis detallado de tres complejos estelares en NGC 300

    NASA Astrophysics Data System (ADS)

    Rodríguez, M. J.; Baume, G. L.; Feinstein, C.

    2015-08-01

    From images obtained with the Advance Camera for Surveys (ACS) of the Hubble Space Telescope (HST) and available in the MAST/STScI database, we have conducted a detailed study of three complexes of stellar associations located in particular regions of the NGC 300 galaxy. We built their respective radial density profiles, their photometric diagrams corrected by field contamination, and their initial mass functions. All these elements together with a comparison with theoretical evolutionary models yielded preliminary results about the characteristics of the studied associations.

  14. Las Tres Comidas del Dia (The Three Meals of the Day).

    ERIC Educational Resources Information Center

    Olais, Niltza M.

    A sixteen line poem in Spanish provides the text of this short booklet on the three meals of the day. Designed for use as supplementary reading materials for the elementary grade Spanish speaking child, the booklet was developed by students in the Bilingual Teacher Aide Program at Mesa Community College. Content and language have been controlled…

  15. Las Tres Comidas del Dia (The Three Meals of the Day).

    ERIC Educational Resources Information Center

    Olais, Niltza M.

    A sixteen line poem in Spanish provides the text of this short booklet on the three meals of the day. Designed for use as supplementary reading materials for the elementary grade Spanish speaking child, the booklet was developed by students in the Bilingual Teacher Aide Program at Mesa Community College. Content and language have been controlled…

  16. Human Consequences of Agile Aircraft (Facteurs humains lies au pilotage des avions de combat tres manoeuvrants)

    DTIC Science & Technology

    2001-05-01

    Service de Santé des Armées B.P.73, Bretigny-sur-Orge Cedex F-91223 France **Asian Office of Aerospace Research and Development 7-23-17 Roppongi Minato-ku...less than quantitative or spatial abilities. The French Air Force use aptitude tests, group tests, sports tests, pilot-officer interview and also a...Automation basics, Analog/Symbol info Team sports , No Drugs, No Smoking, Stress management, Active life, Aerobics

  17. Home before You Know It = De regres en casa en un dos por tres.

    ERIC Educational Resources Information Center

    Vida Health Communications, Inc., Cambridge, MA.

    The arrival of a newborn requires a great deal of adjustment. Intended for new and expectant parents, this booklet and companion video provide practical advice and hands-on demonstrations of the essentials of mother and baby care, from birth to the first visit to the pediatrician. The first part of the booklet, which comes in both English- and…

  18. Caracterización de tres cúmulos estelares de la Nube Menor de Magallanes

    NASA Astrophysics Data System (ADS)

    Palma, T.; Clariá, J. J.; Geisler, D.; Ahumada, A. V.

    2015-08-01

    This work represents the continuation of a systematic study of star clusters belonging to the Magellanic Clouds observed with the Cerro Tololo Interamerican Observatory (Chile) 4 m telescope, using the Washington photometric system. We present preliminary results for 3 faint and compact clusters of the Small Magellanic Cloud, one of which (BS126) has not been previously studied. We characterize the sample by determining mainly angular radii, reddenings, ages and metallicities of the clusters. The determination of these parameters is performed in a homogeneous way by applying standard procedures.

  19. Home before You Know It = De regres en casa en un dos por tres.

    ERIC Educational Resources Information Center

    Vida Health Communications, Inc., Cambridge, MA.

    The arrival of a newborn requires a great deal of adjustment. Intended for new and expectant parents, this booklet and companion video provide practical advice and hands-on demonstrations of the essentials of mother and baby care, from birth to the first visit to the pediatrician. The first part of the booklet, which comes in both English- and…

  20. Tres mitos de la fonetica espanola (Three Myths of Spanish Phonetics).

    ERIC Educational Resources Information Center

    Dalbor, John B.

    1980-01-01

    Contrasts current pronunciation of some Spanish consonants with the teachings and theory of pronunciation manuals, advocating more realistic standards of instruction. Gives a detailed phonetic description of common variants of the sounds discussed, covering both Spanish and Latin American dialects. (MES)

  1. Segmentation d'images a tres haute resolution spatiale basee sur l'analyse multifractale

    NASA Astrophysics Data System (ADS)

    Voorons, Matthieu

    The recent availability, in remote sensing, of very high spatial resolution images brings the texture classification of images to a higher level of complexity. The singularity content of very high spatial resolution images, such as those from IKONOS, is very important due to the high local variability of their gray level. Such images have so many details that classical classification algorithms fail to achieve good results. In the case of IKONOS images of forest areas, a texture can be so different within a same class, that it becomes very difficult, even for a human, to classify or interpret them. The study of the high frequency content of the data seems to be a good way to study those images. The multifractal analysis provides us with global and local information on the singularities which represent the high frequency content of the image. We propose a new approach which uses the singularities of the image to achieve the classification of very high spatial resolution optical forestry images. It is based on the computation of the Holder regularity exponent at each point in the image. From this parameter we can compute the local Lacunarity spectrum or the large deviation multifractal spectrum which give information about the geometric distribution of the singularities in the image. So we use global and local descriptors of the regularity of the signal as input parameters to a k-means algorithm. The two algorithms are described and applied to an IKONOS image of forestry as well as to two artificial images, one made of Brodatz textures and the other of fractional brownian motions. The classification results are compared to those obtained with the gabor filters, the laws filters, the fractal dimension, the gaussian Markov random fields and the Haralick co-occurrence parameters. The proposed methods give good results and are even able to segment the image in tree density classes. We also devised tests to see the resistance of the discrimination power of the proposed parameters with regards to intensity fields transformations like contrast stretching, luminosity changes and noise addition. Both methods seem not too, sensitive to such alterations. A study of the sensitivity of the proposed algorithms te, the parameters which govern them was carried out to determine the influence of each parameter on the classification result. A rough estimation of the interval of values which they can take was also achieved. The obtained results show that the multifractal theory is a suitable tool for texture classification and analysis.

  2. The Three Roots of Cuban Heritage. (Los Tres Raices de la Herencia Cubana.)

    ERIC Educational Resources Information Center

    Alzaga, Florinda

    1980-01-01

    Discusses legacies of traits left by Cuba's three ethnic streams--the Spanish, Black, and Taino--that together explain Cuban personality and way of life. Asserts that by understanding what each group has contributed, Cubans can better know themselves and better project for their future, both individually and collectively. (DS)

  3. Open Source Drug Discovery: Highly Potent Antimalarial Compounds Derived from the Tres Cantos Arylpyrroles

    PubMed Central

    2016-01-01

    The development of new antimalarial compounds remains a pivotal part of the strategy for malaria elimination. Recent large-scale phenotypic screens have provided a wealth of potential starting points for hit-to-lead campaigns. One such public set is explored, employing an open source research mechanism in which all data and ideas were shared in real time, anyone was able to participate, and patents were not sought. One chemical subseries was found to exhibit oral activity but contained a labile ester that could not be replaced without loss of activity, and the original hit exhibited remarkable sensitivity to minor structural change. A second subseries displayed high potency, including activity within gametocyte and liver stage assays, but at the cost of low solubility. As an open source research project, unexplored avenues are clearly identified and may be explored further by the community; new findings may be cumulatively added to the present work. PMID:27800551

  4. The conversion of community-derived wastes to methane in a high-rate digester. La conversion des dechets solides municipaux en methane dans un digesteur a rendement eleve

    SciTech Connect

    Biljetina, R.; Srivastava, V.J.; Punwani, D.V.

    1988-01-01

    The Institute of Gas Technology (IGT) has been operating a 4.5-m/sup 3/, anaerobic solids-concentrating digester at the Walt Disney World Resort Complex in Lake Buena Vista, Florida, since January 1984. This digester development work is part of a larger effort that provides effective community waste treatment and disposal options while recovering a valuable methane resources from these wastes. Excellent conversions to methane have been obtained in the digester during 4 years of uninterrupted operation. Data were collected on wastes from experimental municipal wastewater treatment applications, that is, water hyacinths were harvested from secondary wastewater treatment channels and combined with sludge from primary clarifiers to maximize potential methane recoveries in the digester; wastes from agricultural operations, that is, sorghum was selected as a candidate because it represents both a potential energy crop, as well as a waste resource if only portions of the plant are converted after grain production; and wastes from municipal waste collection. Municipal solids waste (MSW) from a commercial resource recovery center was selected. 3 refs., 4 figs., 5 tabs.

  5. Utilisation de la Fibre a Deux Coeurs Non-Lineaire dans les Lasers EN Fibre et Lignes de Transmission

    NASA Astrophysics Data System (ADS)

    Essiambre, Rene-Jean

    L'utilisation des proprietes non-lineaires de la fibre optique a deux coeurs identiques constitue l'objet de cette etude numerique. Les effets non-lineaires dans les fibres optiques ainsi que la theorie des modes couples sont abordes pour decrire le comportement de la fibre a deux coeurs non-lineaire. On a d'abord analyse les proprietes de transmission d'une telle fibre autour de la puissance critique lorsqu'elle est recouplee a elle-meme dans une configuration Sagnac pour differentes valeurs de dispersion. Nous avons observe des effets simultanes de compression et de filtrage non-lineaire des impulsions injectees. On a ensuite considere configuration de laser en fibre incluant une fibre a deux coeurs comme element passif de synchronisation modale adjoint a un mileu amplificateur externe ayant une largeur de gain finie. On a demontre qu'il etait possible de generer ainsi des solitons fondamentaux de puissance variable et ce, avec tres peu d'ondes dispersives. Ces solitons possedent un spectre qui est de l'ordre de grandeur de la largeur du milieu de gain du laser et ils ne sont amplifies que faiblement a chaque passage. La combinaison d'une fibre a deux coeurs et d'un milieu de gain de largeur de bande finie peut egalement etre utilisee pour controler certains effets non-lineaires d'ordre superieur comme l'auto -glissement en frequence du soliton (diffusion Raman intra -impulsion) qui deplace le spectre d'un soliton vers les basses frequences. Pour une certaine plage de parametres on obtient une stabilisation periodique du deplacement en frequence du soliton. La zone de stabilite correspondant a une longueur de fibre de l'ordre de quelques kilometres et a une duree de soliton d'environ deux a cinq picosecondes. Un tel dispositif semble bien adapte pour la transmission d'information par solitons sur de longues distances dans un nouveau regime d'operation. Enfin, tout au long de l'ouvrage, on retrouve des analyses reliees a des systemes deja existants et on situe les

  6. I. Rheology of Weakly Flocculated Suspensions of Rigid Particles

    NASA Astrophysics Data System (ADS)

    Snabre, P.; Mills, P.

    1996-12-01

    A rheological law for hard spheres in purely hydrodynamic interaction is used to describe the steady state viscosity of weakly aggregated suspensions of rigid particles. The shear viscosity only involves the volume fraction and the maximum packing concentration of particles. Particle aggregation influences the parameters of the reference viscosity law. Within the framework of fractal aggregation, we introduce the volume fraction of aggregates and we derive the equilibrium mean radius of clusters from an effective medium approximation. The proposed rheological equation is close to the phenomenological Casson equation for soft clusters of fractal dimensionality D=2. In a second part, we present rheo-optical experiments for studying the break-up of red cell aggregates in a shear flow and for determining the critical disaggregation shear stress of the flowing suspension mainly representative of the surface adhesive energy between particles. The proposed microrheological model well describes viscometric data in the low shear regime and allows information about the shear induced restructuration and the lifetime of clusters. Nous utilisons une loi de viscosité pour des suspensions concentrées de sphères dures en interaction purement hydrodynamique pour décrire le comportement rhéologique des suspensions faiblement agrégées de particules rigides. La viscosité de cisaillement fait intervenir la fraction volumique et la concentration d'empilement des particules. La floculation des particules modifie les paramètres de la loi rhéologique. Dans le cadre de structures fractales, nous introduisons la fraction volumique effective des agrégats et nous déterminons la taille de d'équilibre des amas à partir d'une hypothèse de milieu effectif. La loi de viscosité se rapproche de la loi phénoménologique de Casson pour des aggrégats mous de dimension fractale D=2. Dans une seconde partie, nous présentons des expériences de réflectométrie sous cisaillement pour

  7. Restauration fonctionnelle du rachis : effet du niveau initial de douleur sur les performances des sujets lombalgiques chroniques

    PubMed Central

    Caby, Isabelle; Olivier, N; Mendelek, F; Kheir, R Bou; Vanvelcenaher, J; Pelayo, P

    2014-01-01

    HISTORIQUE : La lombalgie chronique est une douleur lombaire persistante d’origine multifactorielle. Le niveau de douleur initial reste faiblement utilisé pour analyser et comparer les réponses des patients lombalgiques au programme de reconditionnement. OBJECTIFS : Apprécier et évaluer les réponses des sujets lombalgiques chroniques très douloureux à une prise en charge dynamique et intensive. MÉTHODOLOGIE : 144 sujets atteints de lombalgie chronique ont été inclus dans un programme de restauration fonctionnelle du rachis de 5 semaines. Les sujets ont été classés en deux groupes de niveau de douleur: un groupe atteint de douleur sévère (n = 28) et un groupe atteint de douleur légère à modérée (n = 106). L’ensemble des sujets ont bénéficié d’une prise en charge identique comprenant principalement de la kinésithérapie, de l’ergothérapie, du reconditionnement musculaire et cardio-vasculaire ainsi qu’un suivi psychologique. Les paramètres physiques (flexibilité, force musculaire) et psychologiques (qualité de vie) ont été mesurés avant (T0) et après le programme (T5sem). RÉSULTATS : L’ensemble des performances physiques et fonctionnelles des sujets très douloureux sont moins bonnes et le retentissement de la lombalgie sur la qualité de vie, pour ces mêmes sujets, est majoré à T0. Toutes les différences significatives constatées à T0 entre les deux groupes s’effacent à T5sem. CONCLUSIONS : Les sujets lombalgiques chroniques très douloureux répondent favorablement au programme dynamique et intensif. L’intensité douloureuse de la lombalgie n’aurait pas d’effet sur les réponses au programme. La restauration fonctionnelle du rachis apporterait aux sujets la possibilité de mieux gérer leur douleur quel que soit son niveau. PMID:25299476

  8. 77 FR 5504 - Tres Palacios Gas Storage, L.L.C.; Notice of Intent To Prepare an Environmental Assessment for...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-03

    ... United States and Mexico. The general location of the Project facilities is shown in Appendix 1.\\1\\ \\1.../pipe storage yards, compressor stations, and access roads). Our EA for this Project will document...

  9. El curriculo creativo para ninos de cero a tres anos (The Creative Curriculum for Infants and Toddlers).

    ERIC Educational Resources Information Center

    Dombro, Amy Laura; Colker, Laura J.; Dodge, Diane Trister

    Stemming from the core idea that infant and toddler care should be based on building relationships, this curriculum in Spanish-language version provides a foundation for staff development. Section 1, "Why a Curriculum for Infants and Toddlers?" examines key quality indicators, discusses curriculum components, describes how to use the…

  10. A new species of Homonota (Reptilia: Squamata: Gekkota: Phyllodactylidae) endemic to the hills of Paraje Tres Cerros, Corrientes Province, Argentina.

    PubMed

    Cajade, Rodrigo; Etchepare, Eduardo Gabriel; Falcione, Camila; Barrasso, Diego Andrés; Alvarez, Blanca Beatriz

    2013-01-01

    The genus Homonota comprises nine South American species of terrestrial and nocturnal lizards. Homonota lizards lack the femoral pores typical of other South American Phyllodactylidae, and their infradigital lamellas are not expanded. We here describe a new species, Homonota taragui sp. nov., exclusively found on a small group of three hills up to 179 meters above sea level in central eastern Corrientes Province, Argentina. The new species differs from other Homonota species by a combination of characters, including: a well-marked dorsal, reticulate, dark pattern contrasting with a lighter colored background; small, star-shaped chromatophores on the abdomen; the post-orbital region of the head covered by granular scales; the dorsal and anterior regions of the thighs covered by keeled scales interspersed with cycloid scales; and the internasal scale in contact with rostral scales. The conservation status of Homonota taragui sp. nov. may be vulnerable, due to its localized endemism with populations on three small hills surrounded by intense agricultural and livestock activity. Two endemic plant species are known from these hills, and this new lizard represents the first endemic animal species.

  11. Buen Comienzo, Buen Futuro: El Bebe de Tres Meses (Healthy Start, Grow Smart: Your Three-Month-Old).

    ERIC Educational Resources Information Center

    Department of Agriculture, Washington, DC.

    Distributed by the U.S. Departments of Agriculture, Education, and Health and Human Services, this Spanish-language pamphlet provides parents with information and advice about their infants in the third month of life. The pamphlet provides information on communicating with the infant through body language, preparing for the 4-month checkup,…

  12. El curriculo creativo para ninos de cero a tres anos (The Creative Curriculum for Infants and Toddlers).

    ERIC Educational Resources Information Center

    Dombro, Amy Laura; Colker, Laura J.; Dodge, Diane Trister

    Stemming from the core idea that infant and toddler care should be based on building relationships, this curriculum in Spanish-language version provides a foundation for staff development. Section 1, "Why a Curriculum for Infants and Toddlers?" examines key quality indicators, discusses curriculum components, describes how to use the…

  13. VizieR Online Data Catalog: TrES-2b multi-band transit observations (Mislis+, 2010)

    NASA Astrophysics Data System (ADS)

    Mislis, D.; Schroeter, S.; Schmitt, J. H. M. M.; Cordes, O.; Reif, K.

    2010-02-01

    The OLT data were taken on 11 April 2009 using a 3Kx3K CCD with a 1x1 FOV and an I-band filter as in our previous observing run (Paper I, Mislis & Schmitt, 2009, Cat. ). The Calar Alto data were taken on 28 May 2009 using BUSCA and the 2.2m telescope. (1 data file).

  14. Paramètres statistiques de la houle au large de la côte sud-aquitaine

    NASA Astrophysics Data System (ADS)

    Abadie, Stéphane; Butel, Rémi; Dupuis, Hélène; Brière, Christophe

    2005-06-01

    Statistical parameters of waves on the south Aquitaine coast have been determined by comparison of two datasets: in situ local measurements on a short duration and numerical simulation outputs from the WAVEWATCH III model over a period of 6 years and 9 months. Data and simulation results are well correlated in the case of the significant wave height, whereas in the case of the peak periods (T) and directions (D), this correlation is lower. This is due respectively to the intrinsic unstable nature of T and the narrow distribution of D. An adjustment of simulation data on measurement is then used to give an evaluation of the wave statistics for the southern fraction of the French Atlantic coast. Eventually, the relationships between the three statistical variables (H,T,D) are analysed in order to determine representative sea states. The classification obtained shows the predominance of swell regimes, distributed on a very narrow angular sector over wind sea regimes. To cite this article: S. Abadie et al., C. R. Geoscience 337 (2005).

  15. 78 FR 57878 - Notice of Availability of the Proposed Bureau of Land Management Tres Rios Field Office and San...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-20

    ... 81401; email gmjones@blm.gov . Persons who use a telecommunications device for the deaf (TDD) may call... (Alternative B) would establish two Areas of Environmental Concern (ACEC), Gypsum Valley and Anasazi...

  16. Inversor Resonante de Tres Elementos L-LC con Caracteristica Cortocircuitable para Aplicaciones de Calentamiento por Induccion

    NASA Astrophysics Data System (ADS)

    Espi Huerta, Jose Miguel

    Los generadores de calentamiento por induccion son puentes inversores con carga resonante, cuya mision es basicamente crear una corriente sinusoidal de gran amplitud sobre la "bobina de caldeo", que forma parte del tanque resonante. En el interior de esta bobina se introduce la pieza que se desea calentar. EI campo magnetico creado induce corrientes superficiales (corrientes de Foucault) sobre la pieza, que producen su calentamiento. Los tanques resonantes (tambien llamados osciladores) utilizados en la actualidad son el resonante serie y el resonante paralelo. Aunque ya desde hace algun tiempo se vienen construyendo generadores de alta potencia basados en estos dos osciladores, el exito nunca ha. sido completo en ninguno de los dos casos. Tal y como se explica en la introduccion de esta memoria, los puentes inversores utilizados deben operar sobre una carga inductiva (corriente retrasada) para evitar el fenomeno de la recuperacion inversa de sus diodos y la consiguiente ruptura de los transistores. De la restriccion topologica anterior se deduce que el generador paralelo debe conmutar a frecuencias inferiores a la resonancia, y el serie a frecuencias superiores. A esta restriccion topologica hay que unir otra que es exclusiva del calentamiento por induccion: La corriente por la bobina de caldeo debe ser sinusoidal. De no ser asi, resultaria imposible disponer toda la potencia de calentamiento sobre la pieza en el espesor requerido por la aplicacion. Como consecuencia, los inversores no pueden operar por debajo de la frecuencia de resonancia del oscilador, pues en ese caso se amplifican los armonicos de orden superior de la tension/corriente de entrada situados sobre la resonancia, con la consiguiente distorsion de la corriente de salida. La conjuncion de las dos restricciones anteriores obligan al inversor paralelo a funcionar a la frecuencia de resonancia del oscilador. Esto imposibilita un control por variacion de frecuencia, regulandose la potencia desde la seccion de entrada mediante un mayor o menor aporte de corriente al puente. Como consecuencia, la seccion de entrada del paralelo, ya de por si mas voluminosa que lao del serie por el uso de grandes componentes magneticos (bobinas de filtro o de "alisamiento"), result a tambien mas complicada y costosa debido a la necesidad de ser implementada mediante rectificador controlado. Ademas, la regulacion que ofrece el rectificador es pobre, dada su baja frecuencia de conmutacion. En cambio, el circuito serie puede funcionar por encima de la resonancia manteniendo una secuencia de conmutacion sin riesgos de recuperacion inversa y con una corriente de salida practicamente sinusoidal, lo que permite un control de la potencia por variacion de frecuencia. Puesto que la tarea de regulacion se realiza desde el puente inversor, la regulacion resulta mucho mas eficaz y la seccion de entrada se puede implementar mediante un simple rectificador no controlado y un condensador de filtro. (Abstract shortened by UMI.).

  17. Tres Marias Reservoir, Minas Gerais State: Study of the dispersion of suspended sediments in surface waters using orbital images

    NASA Technical Reports Server (NTRS)

    Dejesusparada, N. (Principal Investigator); Sausen, T. M.

    1980-01-01

    Computer compatible tapes from LANDSAT were used to compartmentalize the Ires Marias reservoir according to respective grey level spectral response. Interactive and automatic, supervised classification, was executed from the IMAGE-100 system. From the simple correlation analysis and graphic representation, it is shown that grey tone levels are inversely proportional to Secchi Depth values. It is further shown that the most favorable period to conduct an analysis of this type is during the rainy season.

  18. (Low-level radioactive waste management techniques)

    SciTech Connect

    Van Hoesen, S.D.; Kennerly, J.M.; Williams, L.C.; Lingle, W.N.; Peters, M.S.; Darnell, G.R.; USDOE Oak Ridge Operations Office, TN; Du Pont de Nemours and Co., Aiken, SC . Savannah River Plant; Idaho National Engineering Lab., Idaho Falls, ID )

    1988-08-08

    The US team consisting of representatives of Oak Ridge National Laboratory (ORNL), Savannah River plant (SRP), Idaho National Engineering Laboratory (INEL), and the Department of Energy, Oak Ridge Operations participated in a training program on French low-level radioactive waste (LLW) management techniques. Training in the rigorous waste characterization, acceptance and certification procedures required in France was provided at Agence Nationale pour les Gestion des Dechets Radioactif (ANDRA) offices in Paris.

  19. Sustainability Gaps in Municipal Solid Waste Management: The Case of Landfills

    DTIC Science & Technology

    2006-02-01

    Stockage des d ~ chets et sant6 publique. Institut National de Veille Sanitaire, Saint Maurice (http://www.invs.sante.fr/publications/2005/dechets/pdf...une gestion durable du risque environnemental du stockage des d ~ chets m6nagers et assimil6s: l𔄀valuation des cofits externes des fuites de lixiviat...Department of Social Sciences D -22585 Hamburg, Germany e-mail: stefanbayer@bundeswehr.orig Dr. Jacques MWry Hydrosystems and bioprocesses research unit

  20. Mapas dinamicos de trayectorias rapidas para un valor dado de la constante de Jacobi en el problema de tres cuerpos restringido Tierra-Luna

    NASA Astrophysics Data System (ADS)

    Leiva, A. M.; Briozzo, C. M.

    Starting from the numerical integration of 1736649 trajectories we study the behaviour of 783209 trajectories in the Earth-Moon Circular Restricted Three Body Problem, for a value h=-1.5887 of the Jacobi constant. Many of these trajectories are of great interest because they take place between the primary masses for times shorter than 217 days and show close approaches to the Moon. On a surface of section we show dynamical maps which provide a global description of the main features of these trajectories, and show the optimal regions to search for periodic orbits and for orbits colliding with the Moon. FULL TEXT IN SPANISH

  1. Calcul par simulation des paramètres dosimétriques pour le noyau cellulaire après irradiation α in vitro

    NASA Astrophysics Data System (ADS)

    Le Foll, L.; Bailly, I.; Fritsch, P.

    1998-04-01

    Determination of absorbed dose in biological targets after high LET α particules irradiation needs heavy calculations. A softwave has been developed in order to allow everyone to calculate hit probability and absorbed dose. It is particularly adapted to the study of cell cultures irradiated with electrodeposited source or α-beam accelerator. It is based first, on a random generator of α-track homogeneously distributed in 4π, second, on the evaluation of energy loss in the different media along the track and then on a statistical analysis of the results. This method is accurate and low time consuming. The target is either modelised by an ellipsoid or represented by its 3D shape recorded using confocal microscopy. Des calculs dosimétriques complexes sont nécessaires pour l'évaluation des doses délivrées dans des cibles biologiques après irradiation par des particules α de haut TEL. Un logiciel a été développé pour rendre facilement accessible le calcul de la probabilité pour atteindre la cible et de la dose absorbée. il est particulièrement adapté à l'étude des cultures cellulaires irradiées par des sources électrodéposées de radionucléides ou des accélérateurs de particules. Il repose sur un générateur de traces aléatoires, sur une approximation de la perte d'énergie dans les différents milieux traversés et sur une exploitation statistique des résultats obtenus. Cette méthode s'avère précise et rapide. La cible est modélisée par un ellipsoïde ou représentée par son image 3D obtenue en microscopie confocale.

  2. Very high temperature measurements: Applications to nuclear reactor safety tests; Mesures des tres hautes temperatures: Applications a des essais de surete des reacteurs nucleaires

    SciTech Connect

    Parga, Clemente-Jose

    2013-09-27

    This PhD dissertation focuses on the improvement of very high temperature thermometry (1100 deg. C to 2480 deg. C), with special emphasis on the application to the field of nuclear reactor safety and severe accident research. Two main projects were undertaken to achieve this objective: - The development, testing and transposition of high-temperature fixed point (HTFP) metal-carbon eutectic cells, from metrology laboratory precision (±0.001 deg. C) to applied research with a reasonable degradation of uncertainties (±3-5 deg. C). - The corrosion study and metallurgical characterization of Type-C thermocouple (service temp. 2300 deg. C) prospective sheath material was undertaken to extend the survivability of TCs used for molten metallic/oxide corium thermometry (below 2000 deg. C)

  3. Experiencias, Sentido y Significado de la Consejeria en Justicia Social a Nivel Universitario: Estudio de Caso Cualitativo Mediante Tres Narrativas De Consejeros Profesionales en Educacion Superior

    ERIC Educational Resources Information Center

    Santiago Tosado, Virginia

    2012-01-01

    The purpose of the study was to understand and profoundly describe the nature of social justice practice, as is comes up from the experience of three professional counselors whose working settings are the academic arena. Detailed descriptions are presented concerning the meanings and sense of counseling for social justice, as the interviews…

  4. Catalysts for Change: Three Case Studies of Quality Education Worldwide = Catalizadores del Cambio: Tres Casos de Estudio sobre la Educacion de Calidad en el Mundo

    ERIC Educational Resources Information Center

    Puriefoy, Wendy D.

    2007-01-01

    Public education is the cornerstone of democracy and is absolutely fundamental to a democratic, civil and prosperous society. Beyond the boundaries of the United States, other countries are working to provide quality education to their children through civil society institutions. In particular, there are three extraordinary organizations in Peru,…

  5. Modelado de las Distribuciones Espectrales de Energía de tres nuevas estrellas jóvenes de tipo FU Orionis

    NASA Astrophysics Data System (ADS)

    Gramajo, L. V.; Rodón, J.; Gómez, M.; Whitney, B.

    In this work we present the modeling of the spectral energy distributions (SEDs) of three protostellar objects of the FU Orionis type, for which an outburst was observed in the last two years. We applied the code developed by Whitney et al. (ApJ 591, 1049, 2003) to model the SEDs. We derived physical and geometric parameters for each object, which agree with those previously obtained for other FU Orionis type stars. Furthermore, the three objects were studied in their stages of high and low activity. Our results suggest that the disk plays a key role in the outburst event, which is reflected in an increase of at least one order of magnitude of the mass accretion rate from the disk to the central object, with respect to the low activity period. FULL TEXT IN SPANISH

  6. Mesure des stades de developpement du sapin baumier (Abies balsamea [L.] Mill.) par teledetection des maxima locaux sur images a tres haute resolution

    NASA Astrophysics Data System (ADS)

    Demers, Alain

    L'objectif principal de cette these est d'identifier les parametres cles pour lier le developpement morphologique de la cime du sapin baumier (Abies balsamea [L.] Mill.) aux patrons de reflectance qu'elle genere sur une image aerienne a haute resolution. La quantite et la distribution spatiale des aiguilles dans le sapin dependent de la structure des branches. Un mecanisme de ramification particulier (la reiteration) ressort comme le parametre cle pour lier l'augmentation de la biomasse foliaire et la forme de la branche. Les reiterats forment des agglomerats de feuillage qui engendrent des inegalites dans les patrons de reflectance de la cime. La reflectance est plus elevee ou il y a une forte concentration de reiterats (maximum local). On demontre que le developpement du sapin baumier se mesure au moyen de l'analyse des maxima locaux de la cime sur une image. La biomasse de l'arbre se mesure par la teledetection et l'analyse des patrons de reflectance de la cime, c'est-a-dire la mesure du niveau de reiteration par le decompte des maxima locaux de la cime. Cette etude demontre qu'il est possible de proceder a l'inventaire du volume de bois d'un peuplement par la teledetection de l'architecture des arbres.

  7. Detection automatique des changements du bati en milieu urbain sur des images a tres haute resolution spatiale (Ikonos et QuickBird) en utilisant des donnees cartographiques numeriques

    NASA Astrophysics Data System (ADS)

    Bouziani, Mourad

    The updating of cartographic databases in urban environments is a difficult and expensive task. It can be facilitated by an automatic change detection method. Several methods have been developed for medium and low spatial resolution images. These methods are not adapted for the very high spatial resolution images (VHSR) and are not applicable in urban environment. This study proposes a new method for change detection of buildings in urban environments from VHSR images and using existing digital cartographic data. The proposed methodology is composed of several stages. The existing knowledge on the buildings and the other urban objects are first modelled and saved in a knowledge base. All change detection rules are defined at this stage. Then, the image is segmented. The parameters of segmentation are computed thanks to the integration between the image and the geographical database (GDB). Thereafter, the segmented image is analyzed using the knowledge base to localize the segments where the change of building is likely to occur. The change detection rules are then applied on these segments to identify the segments that represent the changes of buildings. These changes represent the updates of buildings to add to the geographical database. Finally, the map representing changes is assessed before being integrated in the geographical database. The data used in this research concern the city of Sherbrooke (Quebec, Canada) and the city of Rabat (Morocco). For Sherbrooke, we used an Ikonos image acquired in October 2004, an Ikonos image acquired in July 2006 and a GDB at the scale of 1:20,000. For Rabat, a QuickBird image acquired in August 2004 has been used with a GDB at the scale of 1:10,000. The results of tests on several zones are encouraging. Indeed, the rate of good detection is of 90%. Concerning the geometric precision of detection, the mean error is 3 m for Ikonos and 2 m for QuickBird. The proposed method presents some limitations on the detection of the exact contours of the buildings. It could be improved by including a shape post-analysis of detected buildings. The proposed method can be integrated in a cartographic update process or as a method for the quality assessment of a topographic database.

  8. Relantionships between gold mineralization and granite - Discussion with the support of a pluridisciplinary study of the Passa Tres gold deposit (South Brazil)

    NASA Astrophysics Data System (ADS)

    Dressel, Bárbara; Chauvet, Alain; Trzaskos, Barbara; Biondi, Joao Carlos; Bruguier, Olivier; Monie, Patrick; Villanova, Sandro; Bazille, Jose

    2016-04-01

    The Passa Três Granite, located at East of the Paraná State is elongated following a NNE-SSW direction. This sienogranite is emplaced within metapelites of the meso to neoproterozoic Açungui Group, between the Morro Agudo and Lancinha transcurrent faults, comprising the N040°E trending Lancinha Transcurrent Fault System. Gold mineralization within the Passa Três Granite is constituted by huge quartz veins with sulfides, variable quantities of fluorite and carbonates, forming orebodies with different internal textures, including massive, banded, sheared and brecciated. Structural data indicate the existence of two major fault systems, one N-S and the other E-W, with dips of 15-45°W and 20-75°S, respectively. Both NS and EW systems are interpreted to be contemporaneous and conjugate. Normal motions are everywhere suspected and main mineralized veins are located at opening sites at these fault systems, such as pull-aparts. The structural model suggests that the normal motion can be initiated by shearing along a "guide" level, in which sulfides and clay minerals are concentrated. This configuration can be observed at several scales, such as field, hand samples and thin section. Mineralized veins mainly contain, in addition to the quartz of the gangue, sulphides (pyrite, chalcopyrite, galena, molybdenite), fluorite, chlorite, muscovite, sericite, and carbonate. The presence of sericite, kaolinite and chlorite indicate the occurrence of, at least, propylitic and phyllic-type alterations, both in core of the granite and best-expressed at the rim of quartz-rich orebodies. Gold occurs as native grains in core of the quartz veins, within fractures that affect pyrite and frequently exhibiting normal motions consistent with the one observed at larger scale and systematically associated with chalcopyrite and galena. Quartz veins are sometimes bordered by aplitic dike. Additionally, some of the veins can exhibit a very thin margin of adularia minerals that seems to represent the early stage of vein formation. These observations favor the link between late-magmatic fluids and veins formation. In order to constrain this assumption, a campaign of absolute dating has been undertaken. Zircons from granite and aplite for the magmatic feature and adularia, muscovite, sericite and molybdenite grains for the hydrothermal ones were selected and will be dated by, respectively U-Pb, Ar-Ar and Re-Os methods. Preliminary field results may suggest that gold-quartz veins may formed during the magmatic-hydrothermal transition and that mineralizing fluids possibly represent the late stages of magmatic fluid. Their mode of formation looks to be consistent with an extensional setting. With the help of all these new data, a discussion will be initiated about the genetic model of granite-hosted gold deposits and particularly on this specific case represented by the Passa Três deposit in which huge quartz veins, and no stockwork, are only formed inside the granite and not in surrounding rocks.

  9. Conversacion sobre "Tres tristes tigres". Una entrevista de Rita Guibert (A Conversation about "Three Sad Tigers". An Interview with Rita Guibert)

    ERIC Educational Resources Information Center

    Cabrera Infante, Guillermo

    1971-01-01

    Interview took place in London, England, on October 5, 1970 between Cuban writer Guillermo Cabrera Infante and journalist Rita Guibert. Special issue dedicated to contemporary Spanish American literature. (DS)

  10. Yo Ciudadano: Un Curriculo de Experiencias Para Educacion Civica. Nivel: Tres (Citizen Me: An Experiential Curriculum for Citizenship Education. Level: Three).

    ERIC Educational Resources Information Center

    Javora, Angela

    Integrating concepts of basic citizenship education with community involvement, this experiential curriculum provides a means for developing decision making and critical thinking skills within the existing third grade social studies curriculum. The 10 lessons, translated into Spanish, cover school rules as personal safety measures, consequences of…

  11. Using synthetic forward seismic models of channelized deep-water slope deposits to inform stratigraphic interpretation, Tres Pasos Formation, Magallanes Basin, Chile

    NASA Astrophysics Data System (ADS)

    Nielson, A.; Stright, L.; Hubbard, S. M.; Romans, B.

    2016-12-01

    Subsurface interpretation of deep-water channels from seismic-reflection profiles is inherently challenging due to the sub-seismic scale of key stratigraphic surfaces and facies transitions. Synthetic seismic modeling can provide valuable insight into multi-scale (bed to composite channel complexes) stratigraphic architecture and is ideal for understanding uncertainties inherent to seismic interpretation through seismic attributes and assessing the interpretation error from seismic reflectivity profiles at different frequencies. Cretaceous slope channel-fill deposits in the Magallanes Basin of southern Chile were used as the basis for a bed-scale model (0.25 m vertical resolution) of a single 14 m thick by 300 m wide channel element. This channel element was used to generate synthetic seismic models using rock properties from analogous deep-water Gulf of Mexico deposits. The results were analyzed to quantify the error in predicting channel thickness at different frequencies and how the error scales with true channel thickness, internal channel architecture, and wavelet frequency. Two channel elements were then stacked to elucidate the stacking patterns and seperability of multiple channel elements and finally expanded to a composite channel complex ( 100 m thick). Single channel elements are tuned at 60 Hz and below, upon which a predictive error model was generated relating true channel thickness to interpreted thickness as a function of frequency. Furthermore, RMS amplitude analysis of a single symmetrical channel element shows a linear relationship between decreasing frequency and increasing RMS amplitude as well as a positive correlation between increasing channel thickness and increasing amplitude. Tuning effects are dampened by the natural heterogeneity of the channels towards the margins. These seismic attributes aid in the recognition of channel stacking patterns and enhance channel seperability within a composite channel complex.

  12. Guia para Padres Intervencion Temprana en Pennsylvania para Bebes desde el Nacimiento a los Tres Anos (A Parent Guide to Early Intervention in Pennsylvania for Infants and Toddlers).

    ERIC Educational Resources Information Center

    Parent Education Network, York, PA.

    This guide, in Spanish, is intended to help Pennsylvania parents of infants and toddlers with disabilities to understand their rights and assist in the design of an appropriate early intervention preschool educational program. An overview of special education laws focus on the Individuals with Disabilities Education Act, Parts B and C. The main…

  13. Estimation de parametres structuraux des arbres dans une savane a partir de mesures LiDAR terrestre et d'imagerie a tres haute resolution spatiale

    NASA Astrophysics Data System (ADS)

    Beland, Martin

    This thesis takes its place in a context where information on the biophysical state of forest ecosystems at spatial scales only remote sensing can retrieve is in demand more than ever. In order to provide reliable information using validated approaches, the remote sensing research community recognises the need for new and innovative methods, especially in heterogeneous environments like savannas. The recent emergence of terrestrial LiDAR scanners (TLS) and the increase in the computational capability of computers which allow running ray tracing model simulations with a high level of realism hold great potential to improve our understanding of the processes influencing the radiance measured by satellite sensors. This thesis makes use of these two cutting edge technologies for estimating the spatial distribution of tree leaf area, a key element of modeling radiative transfer processes. The first part of the thesis concerns the development of methods for estimating tridimensional leaf area distribution in a savanna environment from TLS measurements. The methods presented address certain issues related to TLs measures affecting the application of classical theories (the probability of light transmission and the contact frequency) to the estimation of leaf area through indirect means. These issues pertain to the cross-section of laser pulses emitted by a TLS and the occlusion effects caused by the interception of laser pulses by material inside the crown. The developed methods also exploit additional information provided by the active nature of the TLS sensor that is not available to passive sensors like hemispherical photography, i.e. the intensity of a pulse return offers the possibility to distinguish between energy interception by wood and foliage. A simplified approach of this method is presented to promote its use by other research groups. This approach consists of a series of parameterisations and represents a significant gain in terms of the required resources to produce the leaf area, estimates. The second part of the thesis explores the combination of the tree representations generated in the first part with a ray tracing model to simulate the interactions of light with tree crowns. This approach is highly innovative and our study showed its potential to improve our understanding of the factors influencing the radiative environment in a savanna. The methods presented offer a solution to map leaf area at the individual tree scale over large areas from very high spatial resolution imagery. Mots-cles: Scanneur LiDAR terrestre, voxel, distribution 3D de surface foliaire, savanes, densite de surface foliaire (LAD), indice de surface foliaire (LAI), effets d'occlusion, parametrage, cartographie de la surface foliaire, lancer de rayons, modelisation du transfert radiatif.

  14. Conversacion sobre "Tres tristes tigres". Una entrevista de Rita Guibert (A Conversation about "Three Sad Tigers". An Interview with Rita Guibert)

    ERIC Educational Resources Information Center

    Cabrera Infante, Guillermo

    1971-01-01

    Interview took place in London, England, on October 5, 1970 between Cuban writer Guillermo Cabrera Infante and journalist Rita Guibert. Special issue dedicated to contemporary Spanish American literature. (DS)

  15. Experiencias, Sentido y Significado de la Consejeria en Justicia Social a Nivel Universitario: Estudio de Caso Cualitativo Mediante Tres Narrativas De Consejeros Profesionales en Educacion Superior

    ERIC Educational Resources Information Center

    Santiago Tosado, Virginia

    2012-01-01

    The purpose of the study was to understand and profoundly describe the nature of social justice practice, as is comes up from the experience of three professional counselors whose working settings are the academic arena. Detailed descriptions are presented concerning the meanings and sense of counseling for social justice, as the interviews…

  16. Integrated Approach To Producing High-Purity Trehalose from Maltose by the Yeast Yarrowia lipolytica Displaying Trehalose Synthase (TreS) on the Cell Surface.

    PubMed

    Li, Ning; Wang, Hengwei; Li, Lijuan; Cheng, Huiling; Liu, Dawen; Cheng, Hairong; Deng, Zixin

    2016-08-10

    An alternative strategy that integrated enzyme production, trehalose biotransformation, and bioremoval in one bioreactor was developed in this study, thus simplifying the traditional procedures used for trehalose production. The trehalose synthase gene from a thermophilic archaea, Picrophilus torridus, was first fused to the YlPir1 anchor gene and then inserted into the genome of Yarrowia lipolytica, thus yielding an engineered yeast strain. The trehalose yield reached 73% under optimal conditions. The thermal and pH stabilities of the displayed enzyme were improved compared to those of its free form purified from recombinant Escherichia coli. After biotransformation, the glucose byproduct and residual maltose were directly fermented to ethanol by a Saccharomyces cerevisiae strain. Ethanol can be separated by distillation, and high-purity trehalose can easily be obtained from the fermentation broth. The results show that this one-pot procedure is an efficient approach to the economical production of trehalose from maltose.

  17. Final closure of a low level waste disposal facility

    SciTech Connect

    Potier, J.M.

    1995-12-31

    The low-level radioactive waste disposal facility operated by the Agence Nationale pour la Gestion des Dechets Radioactifs near La Hague, France was opened in 1969 and is scheduled for final closure in 1996. The last waste package was received in June 1994. The total volume of disposed waste is approximately 525,000 m{sup 3}. The site closure consists of covering the disposal structures with a multi-layer impervious cap system to prevent rainwater from infiltrating the waste isolation system. A monitoring system has been set up to verify the compliance of infiltration rates with hydraulic performance objectives (less than 10 liters per square meter and per year).

  18. La influencia de "los de abajo" en tres procesos de cambio linguistico en el espanol de Morelia, Michoacan (The Influence of "the Underclass" on Three Processes of Linguistic Change in the Spanish of Morelia, Michoacan).

    ERIC Educational Resources Information Center

    Gutierrez, Manuel J.

    1994-01-01

    Examines the role of the educational and socioeconomic levels of the speakers in advancing linguistic change. The study reviews three grammatical phenomena found at distinct stages of change. Individuals at the lower socioeconomic and educational strata of society embrace innovations in language more readily than their affluent and educated…

  19. Etude de la migration des interstitiels dans des austenites Fe, Cr (18), Ni (14) pures et industrielles par irradiation dans un microscope a tres haute tension: Role du carbone et du titane

    NASA Astrophysics Data System (ADS)

    Housseau, N.; Pelissier, J.

    1983-12-01

    Nous avons étudié le rôle des impurtés (C ou Ti) dans la condensation et la migration des défauts interstitiels. Les échantillons étudiés sont des aciers austénitiques: (a) acier de synthèse de haute pureté (Cr 18, Ni 14, Fe) avec ou sans carbone; (b) acier industriel avec C (800 ppm) ou Ti (0,45%). Les échantillons ont été irradiés dans un microscope à très haute tension aux doses allant de 10 -4 jusqu'à 10 -1 dpa aux températures de 300°C à 400°C. Dans de telles conditions les défauts observés sont des boucles interstitielles. L'étude de la variation de l'épaisseur de la zone dénudée près du bord de la lame mince en fonction de la température nous a permis d'évaluer l'énergie de migration effective de l'interstitiel dans ces alliages. Dans l'austénite de synthèse carburée ou non sa valeur est de 0.8 eV. Dans l'acier industriel au titane carburé ou non on obtient 2.0 eV. Nous n'avons pas observé d'effet lié au carbone. L'examen de la densité de boucles à saturation dans les divers aciers suggère une forte énergie de liaison interstitiel-titane. Cette énergie de liaison, si l'ont admet que le titane est la seule impureté agissante du système, peut être estimée à 1.2 eV.

  20. La influencia de "los de abajo" en tres procesos de cambio linguistico en el espanol de Morelia, Michoacan (The Influence of "the Underclass" on Three Processes of Linguistic Change in the Spanish of Morelia, Michoacan).

    ERIC Educational Resources Information Center

    Gutierrez, Manuel J.

    1994-01-01

    Examines the role of the educational and socioeconomic levels of the speakers in advancing linguistic change. The study reviews three grammatical phenomena found at distinct stages of change. Individuals at the lower socioeconomic and educational strata of society embrace innovations in language more readily than their affluent and educated…

  1. New Transit Observations for HAT-P-30 b, HAT-P-37 b, TrES-5 b, WASP-28 b, WASP-36 b and WASP-39 b

    NASA Astrophysics Data System (ADS)

    Maciejewski, G.; Dimitrov, D.; Mancini, L.; Southworth, J.; Ciceri, S.; D'Ago, G.; Bruni, I.; Raetz, St.; Nowak, G.; Ohlert, J.; Puchalski, D.; Saral, G.; Derman, E.; Petrucci, R.; Jofre, E.; Seeliger, M.; Henning, T.

    2016-01-01

    We present new transit light curves for planets in six extrasolar planetary systems. They were acquired with 0.4-2.2 m telescopes located in west Asia, Europe, and South America. When combined with literature data, they allowed us to redetermine system parameters in a homogeneous way. Our results for individual systems are in agreement with values reported in previous studies. We refined transit ephemerides and reduced uncertainties of orbital periods by a factor between 2 and 7. No sign of any variations in transit times was detected for the planets studied.

  2. Influence des conditions climatiques saisonnières sur quelques paramètres physiologiques dès boucs Créoles alimentés avec de l'ensilage de banane

    NASA Astrophysics Data System (ADS)

    Fauconneau, B.; Xande, A.

    1986-06-01

    Response of three groups of 12 male creole goats (weighing about 10 kg) to environmental variations was tested in Guadeloupe (French West Indies) respectively at three times in the year: end of humid season (October November), dry season (February March) and beginning of humid season (July August). Voluntary free intake of banana silage (silage of mixed green banana, bagassa, wheat bran and urea complemented with molasse) was not significantly affected by climatic variations. Three physiological parameters: rectal temperature, respiratory frequency and cardiac frequency were measured. These parameters were correlated with heat production dependent factors such as metabolic body weight, body weight gain and voluntary free intake. Rectal temperature increased all through the day until sunset and then decreased during the night. Both minimal rectal temperature and daily increase of rectal temperature were correlated with ambient temperature. Cardiac frequency increased during feeding. Generally cardiac frequency seemed to be correlated with activity of animals and so with behavioural response to environmental variations. Respiratory frequency was the most sensitive index of goat response to climate. The daily increase of respiratory frequency was important at the end of the humid season but was not observed in dry season. This increase was dependent on ambient temperature increase but also on air humidity characteristics and air velocity. These points are discussed according to integration of those physiological parameters in thermoregulation.

  3. Report of foreign travel to Paris, France, June 1, 1990--June 12, 1990

    SciTech Connect

    Van Hoesen, S.D.; Jones, L.S.

    1990-07-01

    The Martin Marietta Energy Systems, Inc., Team, consisting of representatives of the Engineering Division and Central Waste Management Division, participated in a technology exchange program on French --- US low-level radioactive waste (LLW) management facility design, construction, and operation. Visits were made to the new French LLW disposal facility currently under construction, the Centre de Stockage de l'Aube (CSA), to the La Hague reprocessing facility to visit LLW conditioning and storage facilities, and to the operating LLW disposal facility, the Centre de Stockage de la Manche (CSM). A meeting was also held with representatives of the Agence National pour la Gestion des Dechets Radioactifs (ANDRA) to discuss overall French and Oak Ridge LLW disposal facility development programs and to review the status of the efforts being conducted under the current subcontract with NUMATEC/Societe General pour les Techniques Nouvelles (SGN)/ANDRA.

  4. (Low-level waste disposal facility siting and site characterization)

    SciTech Connect

    Mezga, L.J.; Ketelle, R.H.; Pin, F.G.; Van Hoesen, S.D.

    1985-10-25

    A US team consisting of representatives of Oak Ridge National Laboratory (ORNL), Savannah River Plant (SRP), Savannah river Laboratory (SRL), and the Department of Energy Office of Defense Waste and Byproducts Management participated in the fourth meeting held under the US/French Radioactive Waste Management Agreement between the US Department of Energy and the Commissariat a l'Energie Atomique. This meeting, held at Agence Nationale pour les Gestion des Dechets Radioactifs' (ANDRA's) Headquarters in Paris, was a detailed, technical topical workshop focusing on Low-Level Waste Disposal Facility Siting and Site Characterization.'' The meeting also included a visit to the Centre de la Manche waste management facility operated by ANDRA to discuss and observe the French approach to low-level waste management. The final day of the meeting was spent at the offices of Societe Generale pour les Techniques Nouvelles (SGN) discussing potential areas of future cooperation and exchange. 20 figs.

  5. GEDEON: A joint venture between research (CEA and CNRS) and industry (EDF and FRAMATOME)

    NASA Astrophysics Data System (ADS)

    Schapira, J. P.

    1999-07-01

    Nuclear waste partitionning and transmutation (P & T) are considered in France as an official line of research, in accordance with the Law of December 30, 1991 concerning research in the field of long lived and highly active nuclear waste. A research group called GEDEON ( GEstion des DEchets par des Options Nouvelles) has been set up between CEA, CNRS, EDF and FRAMATOME with the aim to carry out basic research related to the use of accelerator driven subcritical systems (ADS) and of thorium as an option to reduce the waste long term impacts. In the partners agreement of GEDEON, the following subjects have been identified: spallation physics, nuclear data, subcritical neutronic studies, materials, thorium, system and scenario studies. The organization as well as the scientific program and activities of GEDEON are presented.

  6. Standardized UXO Technology Demonstration Site Moguls Scoring Record Number 170 (Tetra Tech Foster Wheeler, Inc.)

    DTIC Science & Technology

    2005-08-01

    background removal operation. 9 "* Corner stake locations for the survey grid were compared to known survey data and verified. "* Sample density along...quantities can therefore be written as pds(tres), Pfpes (tres), PbareS(tres) and BARre(tres). DISCRIMINATION STAGE DEFINITIONS Discrimination: The application

  7. Lo que Piensan los Estudiantes y Profesores Sobre la Calidad de la Educacion Superior. Estudio Comparativo en 5 Instituciones de Educacion Superior--dos publicas y tres privadas--en Guadalajara, Jalisco, Mexico (What Students and Faculties Think about the Quality of Higher Education. Comparative Study of 5 Higher Education Institutions--Two Public and Three Private--in Guadalajara, Jalisco, Mexico).

    ERIC Educational Resources Information Center

    Yanez, Maria Lorena Hernandez

    This study, written in Spanish, compared attitudes of students (N=302) and faculty (N=28) at five institutions of higher education (two public and three private) in Guadalajara, Jalisco, Mexico. The study explored first, whether respondents believed there are significant quality differences between private and public universities and, second, what…

  8. Exploring EFL Pre-Service Teachers' Experience with Cultural Content and Intercultural Communicative Competence at Three Colombian Universities (Indagación sobre la experiencia con el contenido cultural y la competencia comunicativa intercultural de docentes de inglés en formación, en tres universidades colombianas)

    ERIC Educational Resources Information Center

    Olaya, Alba; Gómez Rodríguez, Luis Fernando

    2013-01-01

    This article reports the findings of a qualitative research project that explored pre-service English teachers' perceptions of and attitudes toward the aspects of culture and intercultural competence addressed in their English classes in the undergraduate programs at three Colombian universities. Findings reveal that pre-service teachers are…

  9. Etude du profil d'echelle des formes et de mesures d'energie de texture pour l'evaluation semi-automatique des degâts sur les bâtiments dans les images satellitaires de tres haute resolution

    NASA Astrophysics Data System (ADS)

    Dubois, David

    Dozens of natural disasters occur each year throughout the world. They cause the death of thousands of people and cost billions of dollars in losses and reconstruction. Considerable resources are invested in the various phases of the emergency cycle like response and reconstruction. To avoid mismanagement of human and material resources during the response to a disaster, decisions must be made very quickly. To make appropriate choices, decision makers need up to date information on conditions on the ground. The images acquired by satellite are a possible source for this information. The new satellites equipped with optical sensors having spatial resolution finer than a meter per pixel provide details useful for determining the status of roads and damage to buildings. Unfortunately, visual analysis of these very large images is time consuming and fatigue may increase the rate of human error. In this thesis, we propose a semi-automatic method for the extraction of buildings and damage assessment using geometric, radiometric and texture features. The work includes a review of the literature in order to identify gaps in current approaches and possible solutions, the development of a methodology to solve this difficult problem, the testing of the proposed method on a portion of images of the city of Port-au-Prince, Haiti captured before and after the earthquake of January 12, 2010, assessment of results and their comparison with the literature. The proposed method requires processing of the image in a hierarchical tree shapes through the fast level set transform. Once the image is represented in this way, an algorithm for extracting meaningful forms is used to assign a representative form for each pixel. Geometrical descriptors such as area, perimeter and others from central moments are extracted from these forms. In addition, for damage assessment, energy measurements of texture are calculated on the forms before and after the event. Buildings are extracted using a supervised classifier based on a support vector machine (SVM). The damage is classified according to three degrees: little or no damage, damaged and destroyed. After experiment, the proposed method for the evaluation of damage exceeds those proposed in the recent literature both in rapidity and accuracy. The use of the scale profile and Laws textures are considerable innovations in the field of remote sensing brought by this thesis.

  10. Étude de la variation spatio-temporelle des paramètres physico-chimiques caractérisant la qualité des eaux d'une lagune côtière et ses zonations écologiques : cas de Moulay Bousselham, Maroc

    NASA Astrophysics Data System (ADS)

    Labbardi, Hanane; Ettahiri, Omar; Lazar, Said; Massik, Zakia; El Antri, Said

    2005-04-01

    Our interest is related to the hydrological characteristics of the Moulay Bousselham lagoon. Water samples were taken monthly from July 2001 to June 2002 in 15 stations distributed along the lagoon. The various measured hydrological parameters (temperature, salinity, suspended matter, chlorophyll a) showed significant monthly variations ( p<0.001), whereas spatially among all sampled stations, only the salinity showed significant variations. The variability analysis approached by the analysis of the normalized principal components combined with discriminate analysis showed very small inter-stations variability. Its percentage is 11% and 9% of the total variance during high and low tide, respectively. To cite this article: H. Labbardi et al., C. R. Geoscience 337 (2005).

  11. Radioactive waste management in France and international cooperation

    SciTech Connect

    Marque, Y. )

    1991-01-01

    Long-term industrial management of radioactive waste in France is carried out by the Agence Nationale pour la gestion des Dechets Radioactifs. (ANDRA), which is a public body responsible mainly for siting, design, construction, and operation of the disposal facilities for every kind of radioactive waste produced in the country. Furthermore, ANDRA has to define and control the required quality of waste packages delivered for disposal. As far as disposal is concerned, it is customary in France to classify waste in two main categories. The first category includes all the so-called short-lived low-level waste (LLW) containing mainly radioactive substances have < 30-yr half-lives (beta-gamma emitters) and, in a few cases, a very small amount of long-half-life substances. The second category includes waste that contains a significant amount of long-lived substances such as transuranic nuclides. Throughout the world, public acceptance is at present the main issue in the siting of a disposal facility. Development of international cooperation is desirable in order to present a consistent international policy, whatever technical options may be chosen according to local considerations and possibilities. It can also be very fruitful to have bilateral collaboration where approaches in the two countries seem to be similar. International cooperation is already a matter of fact within the framework of international organizations such as the International Atomic Energy Agency, the Organization for Economic Cooperation and Development, and the Commission of European Communities.

  12. (US low-level radioactive waste management facility design, construction, and operation): Foreign trip report, July 22--30, 1989

    SciTech Connect

    Van Hoesen, S.D.; Bolinsky, J.

    1989-08-02

    The Martin Marietta Energy Systems, Inc., Team, consisting of representatives of the Engineering Division and Oak Ridge National Laboratory (ORNL), participated in a technology exchange program on French and US low-level radioactive waste (LLW) management facility design, construction, and operation. Meetings were held at the Agence National pour la Gestion des Dechets Radioactif (ANDRA) offices in Paris to review the designs for the new French LLW disposal facility, the Cente de Stockage de l'Aube (CSA), and the new ORNL LLW disposal project, the Interim Waste Management Facility (IWMF), and the results of the French LLW disposal facility cover experiment at St. Sauveur. Visits were made to the operating LLW disposal facility, the Centre de Stockage de la Manche (CSM), the LLW conditioning facilities at the La Hague Reprocessing Facility, and the St. Saueveur Disposal Cap Experiment to discuss design, construction, and operating experience. A visit was also made to the CSA site to view the progress made in construction of the new facility.

  13. Technical and design update in the AUBE French low-level radioactive waste disposal facility

    SciTech Connect

    Marque, Y.

    1989-01-01

    Long-term industrial management of radioactive waste in France is carried out by the Agence Nationale pour la Gestion des Dechets Radioactifs (ANDRA). ANDRA is in charge of design, siting, construction, and operation of disposal centers. The solution selected in France for the disposal of low- and medium-level, short-lived radioactive waste is near-surface disposal in the earth using the principle of multiple barriers, in accordance with national safety rules and regulations, and based on operating experience from the Centre de Stockage de la Manche. Since the center's start-up in 1969, 400,000 m{sup 3} of waste have been disposed of. The French national program for waste management is proceeding with the construction of a second near-surface disposal, which is expected to be operational in 1991. It is located in the department of AUBE (from which its name derives), 100 miles southeast of Paris. The paper describes the criteria for siting and design of the AUBE disposal facility, design of the AUBE facility disposal module, and comparison with North Carolina and Pennsylvania disposal facility designs.

  14. La teneur en iode du sel de cuisine consommé à Lubumbashi et le statut iode des personnes vulnérables: cas de femmes enceintes de milieux défavorisés

    PubMed Central

    Banza, Bienvenue Ilunga; Lumbu, Jean Baptiste Simbi; Donnen, Philippe; Twite, Eugène Kabange; Kwete, Daniel Mikobi; Kazadi, Costa Mwadianvita; Ozoza, Jean Okolonken; Habimana, Laurence; Kalenga, Prosper Muenze Kayamba; Robert, Annie

    2016-01-01

    Introduction La consommation du sel faiblement iodé peut engendrer des troubles divers liés à la carence iodée Ce travail a pour objectif d’évaluer la teneur en iode du sel consommé à Lubumbashi et de déterminer le statut iodé des femmes enceintes, cible privilégiée de la carence iodée. Méthodes Une étude transversale descriptive a été consacrée à une analyse iodométrique d'iode dans 739 échantillons de sel collectés dans les ménages et marchés de Lubumbashi en 2014. Précédemment, l'iode urinaire a été déterminé par la technique de minéralisation au persulfate d'ammonium chez 225 femmes enceintes reçues en consultation du 15 mars 2009 au 25 avril 2011. Résultats Notre enquête a révélé 47,5% des échantillons de sels de cuisine adéquatement iodés (15 à 40 ppm), 36,9% d’échantillons faiblement iodés, 7,4% d’échantillons trop riches en iode et 8,1% des échantillons non iodés. La disponibilité en iode du sel de cuisine analysé était globalement de 54,9%, se trouvant nettement en dessous des normes OMS (90%). En mesurant l'iode urinaire chez la femme enceinte, la carence iodée (iode urinaire <150 µg/l) a été observée dans une proportion de 52%. Conclusion La faible disponibilité en iode du sel consommé à Lubumbashi pourrait être responsable d'une grande proportion de la carence iodée observée chez la femme enceinte, ce qui expose celle-ci aux risques majeurs des troubles dus à la carence en iode. PMID:27279956

  15. Adsorption of star polymers

    NASA Astrophysics Data System (ADS)

    Halperin, A.; Joanny, J. F.

    1991-06-01

    The adsorption of star polymers on a flat solid surface is analyzed by means of scalling arguments based on the Daoud-Cotton blob model. For the adsorption of a single star, consisting of f arms comprising each N monomers, we distinguish three regimes determined by the adsorption energy of a monomer at the surface, δ kT. 1) Strong adsorption characterized by the full adsorption of all arms occurs for δ > (f/N)^{3/5}. 2) A “Sombrero” like structure comprising f_ads fully adsorbed arms and f{-}f_ads free arms is obtained for (f/N)^{3/5}> δ > f^{9/20}/N^{3/5}. 3) Weakly adsorbed stars retain, essentially, the structure of a free star. This regime occurs for δ < f^{9/20}/N^{3/5}. The weakly adsorbed structure may also exist as a metastable state if δ > f^{9/5}/N^{3/5}. Nous étudions l'adsorption de polymères en étoile sur une surface solide en utilisant une approche de lois d'échelles basée sur le modèle de blobs de Daoud et Cotton. Pour une étoile formée de f bras contenant chacun N monomères, nous distinguons trois régimes suivant la valeur de l'énergie d'adsorption d'un monomère sur la surface δ kT. 1) L'adsorption forte caractérisée par une adsorption complète de tous les bras se produit lorsque δ > (f/N)^{3/5}. 2) Une structure en “sombrero” avec f_ads bras adsorbés et f{-}f_ads bras libres est obtenue si f^{9/20}/N^{3/5}δ < (f/N)^{3/5}. 3) Les étoiles faiblement adsorbées gardent une structure très similaire à celle des étoiles libres en solution. Ce régime existe si δ < f^{9/20}/N^{3/5}. La structure correspondant aux étoiles faiblement adsorbées peut aussi exister comme un état métastable si δ > f^{9/5}/N^{3/5}.

  16. Noncoding RNAs of trithorax response elements recruit Drosophila Ash1 to Ultrabithorax.

    PubMed

    Sanchez-Elsner, Tilman; Gou, Dawei; Kremmer, Elisabeth; Sauer, Frank

    2006-02-24

    Homeotic genes contain cis-regulatory trithorax response elements (TREs) that are targeted by epigenetic activators and transcribed in a tissue-specific manner. We show that the transcripts of three TREs located in the Drosophila homeotic gene Ultrabithorax (Ubx) mediate transcription activation by recruiting the epigenetic regulator Ash1 to the template TREs. TRE transcription coincides with Ubx transcription and recruitment of Ash1 to TREs in Drosophila. The SET domain of Ash1 binds all three TRE transcripts, with each TRE transcript hybridizing with and recruiting Ash1 only to the corresponding TRE in chromatin. Transgenic transcription of TRE transcripts restores recruitment of Ash1 to Ubx TREs and restores Ubx expression in Drosophila cells and tissues that lack endogenous TRE transcripts. Small interfering RNA-induced degradation of TRE transcripts attenuates Ash1 recruitment to TREs and Ubx expression, which suggests that noncoding TRE transcripts play an important role in epigenetic activation of gene expression.

  17. Open Field Scoring Record No. 298

    DTIC Science & Technology

    2005-10-01

    platform are the axles, the hub, and a small number of aluminum pop rivets. The wheels are composite. Even the tires have had the metal beads removed ...then applied to that set of data to background-level the sensors and remove streaks in the image. A site-wide offset may also be applied if the reference...quantities can therefore be written as Pdres(tres), Pfpes (tres), Pb(trges), and BARres(tres). DISCRIMINATION STAGE DEFINITIONS Discrimination: The application

  18. Prototype pushing robot for emplacing vitrified waste canisters into horizontal disposal drifts

    SciTech Connect

    Londe, L.; Seidler, W.K.; Bosgiraud, J.M.; Guenin, J.J.; Devaux, P.

    2007-07-01

    Within the French Underground Disposal concept, as described in ANDRA's (Agence Nationale pour la Gestion des Dechets Radioactifs) Dossier 2005, the Pushing Robot is an application envisaged for the emplacement (and the potential retrieval) of 'Vitrified waste packages', also called 'C type packages'. ANDRA has developed a Prototype Pushing Robot within the framework of the ESDRED Project (Engineering Studies and Demonstration of Repository Design) which is co-funded by the European Commission as part of the sixth EURATOM Research and Training Framework Programme (FP6) on nuclear energy (2002 - 2006). The Rationale of the Pushing Robot technology comes from various considerations, including the need for (1) a simple and robust system, capable of moving (and potentially retrieving) on up to 40 metres (m), a 2 tonne C type package (mounted on ceramic sliding runners) inside the carbon steel sleeve constituting the liner (and rock support) of a horizontal disposal cell, (2) small annular clearances between the package and the liner, (3) compactness of the device to be transferred from surface to underground, jointly with the package, inside a shielding cask, and (4) remote controlled operations for the sake of radioprotection. The initial design, based on gripping supports, has been replaced by a 'technical variant' based on inflatable toric jacks. It was then possible, using a test bench, to check that the Pushing Robot worked properly. Steps as high as 7 mm were successfully cleared by a dummy package pushed by the Prototype.. Based on the lessons learned by ANDRA's regarding the Prototype Pushing Robot, a new Scope of Work is being written for the Contract concerning an Industrial Scale Demonstrator. The Industrial Scale Demonstration should be completed by the end of the second Quarter of 2008. (authors)

  19. Facility design, construction, and operation

    SciTech Connect

    1995-04-01

    France has been disposing of low-level radioactive waste (LLW) at the Centre de Stockage de la Manche (CSM) since 1969 and now at the Centre de Stockage de l`Aube (CSA) since 1992. In France, several agencies and companies are involved in the development and implementation of LLW technology. The Commissariat a l`Energie Atomic (CEA), is responsible for research and development of new technologies. The Agence National pour la Gestion des Dechets Radioactifs is the agency responsible for the construction and operation of disposal facilities and for wastes acceptance for these facilities. Compagnie Generale des Matieres Nucleaires provides fuel services, including uranium enrichment, fuel fabrication, and fuel reprocessing, and is thus one generator of LLW. Societe pour les Techniques Nouvelles is an engineering company responsible for commercializing CEA waste management technology and for engineering and design support for the facilities. Numatec, Inc. is a US company representing these French companies and agencies in the US. In Task 1.1 of Numatec`s contract with Martin Marietta Energy Systems, Numatec provides details on the design, construction and operation of the LLW disposal facilities at CSM and CSA. Lessons learned from operation of CSM and incorporated into the design, construction and operating procedures at CSA are identified and discussed. The process used by the French for identification, selection, and evaluation of disposal technologies is provided. Specifically, the decisionmaking process resulting in the change in disposal facility design for the CSA versus the CSM is discussed. This report provides` all of the basic information in these areas and reflects actual experience to date.

  20. Person-Oriented Approaches to Profiling Learners in Technology-Rich Learning Environments for Ecological Learner Modeling

    ERIC Educational Resources Information Center

    Jang, Eunice Eunhee; Lajoie, Susanne P.; Wagner, Maryam; Xu, Zhenhua; Poitras, Eric; Naismith, Laura

    2017-01-01

    Technology-rich learning environments (TREs) provide opportunities for learners to engage in complex interactions involving a multitude of cognitive, metacognitive, and affective states. Understanding learners' distinct learning progressions in TREs demand inquiry approaches that employ well-conceived theoretical accounts of these multiple facets.…

  1. 75 FR 32932 - Combined Notice of Filings No. 2

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-06-10

    ... Commission has received the following Natural Gas Pipeline Rate and Refund Report filings: Docket Numbers: RP09-260-005. Applicants: Tres Palacios Gas Storage LLC. Description: Tres Palacios Gas Storage LLC submits Second Substitute First Revised Sheet 138 to FERC Gas Tariff, Original Volume 1. Filed Date:...

  2. In harmony with nature: A pioneer conservationist's bungalow home

    Treesearch

    Robert G. Bailey

    2014-01-01

    On February 2, 1912, Aldo Leopold (1887-1948) wrote to his fiancee, Estella Bergere, in Santa Fe that the Forest Service had appropriated $650 to build a new supervisor's quarters he had designed at Tres Piedras, New Mexico, northwest of Taos. At the time, Leopold was about to become the new Forest Supervisor of the Carson National Forest in Tres Piedras. Later...

  3. In situ and glancing angle X-ray diffraction of the structure change during and after the high temperature oxidation at 1000 ^{circ}C in air of an yttrium-implanted 304 steel

    NASA Astrophysics Data System (ADS)

    Riffard, F.; Buscail, H.; Caudron, E.; Cueff, R.; Rabaste, F.; Issartel, C.

    2002-07-01

    A study has been made of the initial stages of oxidation of yttrium ion implanted 304 steel in an attempt to shed some light on the so-called `reactive element effect' observed on chromia forming alloys. In situ XRD was used in order to observe the initial local structural changes during the high temperature oxidation process, while glancing angle XRD was used to monitor the longer range structural transformations taking place near the surface after cooling of oxidised samples. The treatment by ion implantation promotes the intensive establishment of the chromic layer, which leads to the inhibition of the formation of iron rich oxides, by preventing the diffusion of iron through the more compact and more uniform layer initially formed than it would be in the absence of yttrium. However, the identification of yttried phases could not be established. L'effet bénéfique d'un traitement par implantation ionique d'yttrium sur un acier 304 a été mis en évidence par le suivi d'analyses in situ développées par diffraction des rayons X au cours de son oxydation isotherme à 1000^{circ}C sous air. Malgré l'altération superficielle du substrat, le traitement par implantation ionique favorise l'établissement accéléré de la couche de chromine et inhibe la formation au cours du processus d'oxydation des oxydes contenant du fer, réputés peu protecteurs, car faiblement adhérents. Des analyses conduites après refroidissement des échantillons oxydés par diffraction des rayons X sous incidence rasante révèlent la localisation de la structure spinelle au manganèse à l'interface le plus externe. L'identification de phases yttriées n'a cependant pu être établie.

  4. Cinetique de precipitation de la phase γ' et son influence sur la limite d'elasticite d'un alliage Fe-Ni-Cr

    NASA Astrophysics Data System (ADS)

    Tavassoli, A. A.; Pozarnik, F.

    1984-04-01

    La cinétique de précipitation et coalescence de la phase γ' dans l'alliage 800 — acier austénique contenant 33% de nickel, 20% de chrome et des faibles quantités de titane et d'aluminium — a été étudiée. Les résultats obtenus permettent d'établir une loi globale donnant la variation de la taille des particules de γ' en fonction de la température, de la durée de vieillissement et de la composition chimique de l'alliage. Cette loi est utilisée pour calculer la variation de la limite d'élasticité de l'alliage provoquée par la formation de la phase γ'. Les calculs sont basés sur les théories d'interaction de paires de dislocations (faiblement ou fortement couplées) avec des particules cohérentes, ordonnées dépourvues de contrainte: l'anisotropie de tension de ligne des dislocations est prise en compte ainsi que l'influence de la déformation induite par le 'défaut de compatibilité' (misfit). La variation de la limite d'élasticité ainsi calculée est comparée à celle obtenue expérimentalement et il est démontré que le survieillissement n'interviendra pas avant 2×10 5 h aux températures de service inférieures à 550°C.

  5. The electrohydrodynamic instability in homeotropic nematic layers

    NASA Astrophysics Data System (ADS)

    Hertrich, A.; Decker, W.; Pesch, W.; Kramer, L.

    1992-11-01

    We calculate the threshold for electrohydrodynamic convection in homeotropically oriented nematic layers with negative dielectric anistropy that sets in after the bend-Fréedericksz transition to a quasi-planar alignment has taken place. Oblique rolls are found in a larger range than in the case of planar anchoring. The most interesting prediction is that in the weakly nonlinear analysis all roll solution are in fact unstable so that a direct transition to spatio-temporal chaos becomes possible. In the oblique-roll case this may be accompanied by a permanent local rotation of the director bend axis. Application of a planar magnetic field should stabilize the rolls. Nous calculons le seuil d'apparition de convection électrohydrodynamique dans des couches nématiques orientées homéotropiquement possédant une anisotropie diélectrique négative après que la transition de Fréedericksz de type courbure (bend) vers un alignement quasihorizontal ait eu lieu. Des rouleaux obliques sont observés dans un domaine plus grand que dans le cas de conditions aux limites planes. La prédiction la plus intéressante est que dans le cadre d'une analyse faiblement nonlinéaire toutes les solutions de rouleaux sont en fait instables et un passage direct vers un chaos spatio-temporel a lieu. Dans le cas de rouleaux obliques ceci peut être accompagné d'une rotation permanente locale de l'axe directeur de courbure. L'application d'un champ magnétique plan devrait stabiliser les rouleaux.

  6. Nanocarriers for topical administration of resveratrol: a comparative study.

    PubMed

    Scognamiglio, Immacolata; De Stefano, Daniela; Campani, Virginia; Mayol, Laura; Carnuccio, Rosa; Fabbrocini, Gabriella; Ayala, Fabio; La Rotonda, Maria Immacolata; De Rosa, Giuseppe

    2013-01-20

    The trans-resveratrol (t-res), a non-flavonoid polyphenol extracted from different plants, has recently earned interest for application on the skin for different applications. In this work, the potential of nanocarriers, namely transfersomes and ethanol-containing vesicles, to deliver t-res into/through the skin was investigated. Thus, transfersomes with different surfactants, namely polysorbate 80 (Tw80), sodium cholate (SC) and sodium deossicholate (SDC) and ethanol-containing vesicles with different lipid composition, namely soy phosphatidylcholine (SPC) and cholesterol (chol), encapsulating t-res were prepared and characterized. The nanocarriers had a mean diameter ranging between 83 and 116 nm with a high t-res encapsulation efficiency (≥ 70%). Moreover, cytotoxicity as well as the inhibition of production of reactive oxygen species (ROS) and lipid peroxidation, following incubation of H(2)O(2)-stimulated human keratinocyte (HaCaT) with t-res, as free or encapsulated into the nanocarriers, were investigated. Only blank nanocarriers containing Tw80 or ethanol were cytotoxic and led to increase of ROS, but this effect was not observed when using nanocarriers encapsulating t-res. Finally, permeation studies on porcine skin carried out on Franz diffusion cells, showed that only ethanol-containing vesicles based SPC were able to promote t-res permeation through the skin. Copyright © 2012 Elsevier B.V. All rights reserved.

  7. Identification and characterization of a novel trehalose synthase gene derived from saline-alkali soil metagenomes.

    PubMed

    Jiang, Ling; Lin, Ming; Zhang, Yang; Li, Yanping; Xu, Xian; Li, Shuang; He Huang

    2013-01-01

    A novel trehalose synthase (TreS) gene was identified from a metagenomic library of saline-alkali soil by a simple activity-based screening system. Sequence analysis revealed that TreS encodes a protein of 552 amino acids, with a deduced molecular weight of 63.3 kDa. After being overexpressed in Escherichia coli and purified, the enzymatic properties of TreS were investigated. The recombinant TreS displayed its optimal activity at pH 9.0 and 45 °C, and the addition of most common metal ions (1 or 30 mM) had no inhibition effect on the enzymatic activity evidently, except for the divalent metal ions Zn(2+) and Hg(2+). Kinetic analysis showed that the recombinant TreS had a 4.1-fold higher catalytic efficiency (Kcat/K m ) for maltose than for trehalose. The maximum conversion rate of maltose into trehalose by the TreS was reached more than 78% at a relatively high maltose concentration (30%), making it a good candidate in the large-scale production of trehalsoe after further study. In addition, five amino acid residues, His172, Asp201, Glu251, His318 and Asp319, were shown to be conserved in the TreS, which were also important for glycosyl hydrolase family 13 enzyme catalysis.

  8. Identification of active transcriptional regulatory elements with GRO-seq

    PubMed Central

    Danko, Charles G.; Hyland, Stephanie L.; Core, Leighton J.; Martins, Andre L.; Waters, Colin T; Lee, Hyung Won; Cheung, Vivian G.; Kraus, W. Lee; Lis, John T.; Siepel, Adam

    2015-01-01

    Transcriptional regulatory elements (TREs), including enhancers and promoters, determine the transcription levels of associated genes. We have recently shown that global run-on and sequencing (GRO-seq) with enrichment for 5'-capped RNAs reveals active TREs with high accuracy. Here, we demonstrate that active TREs can be identified by applying sensitive machine-learning methods to standard GRO-seq data. This approach allows TREs to be assayed together with gene expression levels and other transcriptional features in a single experiment. Our prediction method, called discriminative Regulatory Element detection from GRO-seq (dREG), summarizes GRO-seq read counts at multiple scales and uses support vector regression to identify active TREs. The predicted TREs are more strongly enriched for several marks of transcriptional activation, including eQTL, GWAS-associated SNPs, H3K27ac, and transcription factor binding than those identified by alternative functional assays. Using dREG, we survey TREs in eight human cell types and provide new insights into global patterns of TRE function. PMID:25799441

  9. Cloning and expression of a trehalose synthase from Pseudomonas putida KT2440 for the scale-up production of trehalose from maltose.

    PubMed

    Wang, Tengfei; Jia, Shiru; Dai, Kun; Liu, Hongjuan; Wang, Ruiming

    2014-09-01

    Trehalose synthase (TreS) is considered to be a potential biocatalyst for trehalose production. We aimed to scale-up produce the TreS protein in Escherichia coli and further investigate the bioconversion capacity of TreS. The treS gene from Pseudomonas putida KT2440 was amplified and expressed in E. coli BL21 (DE3). The recombinant TreS showed a molecular mass of 67 kDa. Activity analysis suggested that TreS had optimal activity at a temperature of 55 °C, a pH of 7.4, with a substrate concentration of 30%. High-pressure liquid chromatography results indicated that this enzyme had the ability to catalyze 59% maltose into trehalose, with about 5.1% glucose as by-product. Purification analysis showed that trehalose crystals with a purity of 98% were obtained by cooling trehalose solution. The TreS from P. putida KT2440 might be a candidate for trehalose production. Further study is needed to improve the trehalose conversion rate.

  10. The detection and exploration of planets from the Trans-atlantic Exoplanet Survey

    NASA Astrophysics Data System (ADS)

    O'Donovan, Francis Thomas

    I present the discovery of three transiting planets (TrES-2, TrES-3, and TrES-4) of nearby bright stars made with the ten-centimeter telescope Sleuth as part of the Trans-atlantic Exoplanet Survey (TrES). TrES-2 is the first transiting exoplanet detected in the field of view of NASA’s Kepler mission. Of the 20 known transiting exoplanets, TrES-3 has the second shortest period, facilitating the study of orbital decay and atmospheric evaporation. Its visible/infrared brightness makes TrES-3 an ideal target for observations to determine the atmospheric composition. TrES-4 has the largest radius and lowest density of the known transiting planets. These three planets have radii larger than that of Jupiter, and the radius of TrES-4 significantly exceeds predictions from models of hot Jupiters, indicating a possible lack of an energy source in these models. I present the results of Spitzer observations of TrES-2. I reject tidal dissipation of eccentricity as an explanation for the inflated radius, and examine the spectrum for evidence of atmospheric absorption.I have monitored 19 fields each containing 6,000-36,000 stars for evidence of transits. I discuss the rejection of six of my candidate transiting systems from an early field that represent examples of the 67 astrophysical false positives that I encountered in Sleuth data. These six false positives highlight the benefit of a multisite survey such as TrES, and also of comprehensive follow-up of transit candidates. As a further example, I present the candidate GSC 03885-00829 from Sleuth data that was revealed to be a blend of a bright F dwarf and a fainter K-dwarf eclipsing binary. This candidate proved nontrivial to reject, requiring multicolor follow-up photometry to produce evidence of the true binary nature of this candidate.The yield of planets from transit surveys is not yet well constrained or understood. There are numerous factors that affect the predictions such as the amount of correlated photometric noise

  11. Information Support for Environmental Management, Legacy Data Capture, and Data Assessment, Volume II

    DTIC Science & Technology

    1994-12-01

    WSMR DATA U CIERM/TEC L- 1 PSL-94/74 ISEM Final Report, Volume II PSL-94174 L-2 WHITE SANDS HISSIL K ANGE Area 1 Area 2 Area 3 Area 4 Area 5 White Sands...Lake Lucero, NE * Foster Lake Area 4: WSMR. South * Bear Peak * Bennett Mountain * Lake Lucero, SE * Tres Hermanos , SW * Tres Hermanos , SE * Organ...Remarks 53 EDAC/UNM NM ESIC August 23, 1994 Tres Hermanos SE Agency Bureau of Land Management, Denver Agency NASA, Ames Latitude 323000N Latitude

  12. TN International and ITS operational feedback regarding the decommissioning of obsolete casks dedicated to the transport and/or storage of nuclear raw materials, fuel and used fuel

    SciTech Connect

    Blachet, L.; Bimet, F.; Rennesson, N.

    2008-07-01

    Within the AREVA group, TN International is a major actor regarding the design of casks and transportation for the nuclear cycle. In the early 2005, TN International has started the project of decommissioning some of its own equipment and was hence the first company ever in the AREVA Group to implement this new approach. In order to do so, TN International has based this project by taking into account the AREVA Sustainable Development Charter, the French regulatory framework, the ANDRA (Agence Nationale pour la Gestion des Dechets Radioactifs - National Agency for the radioactive waste management) requirements and has deployed a step by step methodology such as radiological characterization following a logical route. The aim was to define a standardized process with optimized solutions regarding the diversity of the cask's fleet. As a general matter, decommissioning of nuclear casks is a brand new field as the nuclear field is more familiar with the dismantling of nuclear facilities and/or nuclear power plant. Nevertheless existing workshops, maintenance facilities, measurements equipments and techniques have been exploited and adapted by TN International in order to turn an ambitious project into a permanent and cost-effective activity. The decommissioning of the nuclear casks implemented by TN International regarding its own needs and the French regulatory framework is formalized by several processes and is materialized for instance by the final disposal of casks as they are or in ISO container packed with cut-off casks and big bags filled with crushed internal cask equipments, etc. The first part of this paper aims to describe the history of the project that started with a specific environmental analysis which took into account the values of AREVA as regards the Sustainable Development principles that were at the time and are still a topic of current concern in the world. The second part will deal with the definition, the design and the implementation of the

  13. Epithelium

    MedlinePlus

    The term "epithelium" refers to layers of cells that line hollow organs and glands. It is also those cells that make ... Epithelium. In: Kierszenbaum AL, Tres LL. Histology and Cell Biology - An Introduction to Pathology , 3rd ed. Philadelphia, ...

  14. LAREDO: LAunching, REndezvous and DOcking Simulation Tool

    DTIC Science & Technology

    2006-08-01

    Molina, Jose Prieto GMV – c/ Isaac Newton , 11 PTM Tres Cantos 28760 Madrid SPAIN Tel: +34 918072100; Fax: +34 918072199 mamc@gmv.es, jjpm@gmv.es...TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) GMV c/ Isaac Newton , 11 PTM Tres Cantos 28760 Madrid SPAIN 8...EXOMARS09 DM,” CDF Study Report, 2002. BIOGRAPHY Miguel Angel Molina is a Senior Aeronautical Engineer currently responsible of the Flight Engineering

  15. A SEARCH FOR ADDITIONAL PLANETS IN FIVE OF THE EXOPLANETARY SYSTEMS STUDIED BY THE NASA EPOXI MISSION

    SciTech Connect

    Ballard, Sarah; Charbonneau, David; Holman, Matthew J.; Christiansen, Jessie L.; Deming, Drake; Barry, Richard K.; Kuchner, Marc J.; Livengood, Timothy A.; Hewagama, Tilak; Hampton, Don L.; Lisse, Carey M.; Seager, Sara; Veverka, Joseph F.

    2011-05-01

    We present time series photometry and constraints on additional planets in five of the exoplanetary systems studied by the EPOCh (Extrasolar Planet Observation and Characterization) component of the NASA EPOXI mission: HAT-P-4, TrES-3, TrES-2, WASP-3, and HAT-P-7. We conduct a search of the high-precision time series for photometric transits of additional planets. We find no candidate transits with significance higher than our detection limit. From Monte Carlo tests of the time series using putative periods from 0.5 days to 7 days, we demonstrate the sensitivity to detect Neptune-sized companions around TrES-2, sub-Saturn-sized companions in the HAT-P-4, TrES-3, and WASP-3 systems, and Saturn-sized companions around HAT-P-7. We investigate in particular our sensitivity to additional transits in the dynamically favorable 3:2 and 2:1 exterior resonances with the known exoplanets: if we assume coplanar orbits with the known planets, then companions in these resonances with HAT-P-4b, WASP-3b, and HAT-P-7b would be expected to transit, and we can set lower limits on the radii of companions in these systems. In the nearly grazing exoplanetary systems TrES-3 and TrES-2, additional coplanar planets in these resonances are not expected to transit. However, we place lower limits on the radii of companions that would transit if the orbits were misaligned by 2.{sup 0}0 and 1.{sup 0}4 for TrES-3 and TrES-2, respectively.

  16. Detection and Exploration of Planets from the Trans-atlantic Exoplanet Survey

    NASA Astrophysics Data System (ADS)

    O'Donovan, Francis T.; Charbonneau, D.; Hillenbrand, L.

    2006-12-01

    The Trans-atlantic Exoplanet Survey (TrES) is a network of three small-aperture telescopes dedicated to searching the skies for new transiting extrasolar gas giants. The TrES team have discovered two of the 14 known transiting exoplanets. We discuss the detection and exploration of these nearby planets and present the latest observations of TrES-2. TrES-2 is the most massive of the nearby transiting planets, and the first transiting planet found within the field of view of the NASA Kepler transit-search mission. TrES was motivated by our incomplete understanding of the structure and composition of highly-insolated gas giants, and is one of several wide-field photometric campaigns to find new transiting planets. Astrophysical false positives, such as grazing eclipsing binaries, are the dominant source of transit-like periodic signals from these campaigns. Hence follow-up observations are required for all planet candidates. In particular, recent experience has highlighted the need for careful analysis to eliminate astronomical systems where light from a faint eclipsing binary is blended with that from a bright star. We present here examples of the procedure followed by the TrES network to identify false positive candidates. This material is based upon work supported by the National Aeronautics and Space Administration under grant NNG05GJ29G, issued through the Origins of Solar Systems Program.

  17. Mechanistic Analysis of Trehalose Synthase from Mycobacterium smegmatis*

    PubMed Central

    Zhang, Ran; Pan, Yuan T.; He, Shouming; Lam, Michael; Brayer, Gary D.; Elbein, Alan D.; Withers, Stephen G.

    2011-01-01

    Trehalose synthase (TreS) catalyzes the reversible interconversion of maltose and trehalose and has been shown recently to function primarily in the mobilization of trehalose as a glycogen precursor. Consequently, the mechanism of this intriguing isomerase is of both academic and potential pharmacological interest. TreS catalyzes the hydrolytic cleavage of α-aryl glucosides as well as α-glucosyl fluoride, thereby allowing facile, continuous assays. Reaction of TreS with 5-fluoroglycosyl fluorides results in the trapping of a covalent glycosyl-enzyme intermediate consistent with TreS being a member of the retaining glycoside hydrolase family 13 enzyme family, thus likely following a two-step, double displacement mechanism. This trapped intermediate was subjected to protease digestion followed by LC-MS/MS analysis, and Asp230 was thereby identified as the catalytic nucleophile. The isomerization reaction was shown to be an intramolecular process by demonstration of the inability of TreS to incorporate isotope-labeled exogenous glucose into maltose or trehalose consistent with previous studies on other TreS enzymes. The absence of a secondary deuterium kinetic isotope effect and the general independence of kcat upon leaving group ability both point to a rate-determining conformational change, likely the opening and closing of the enzyme active site. PMID:21840994

  18. Mechanical effects induced by shock waves generated by high energy laser pulses

    NASA Astrophysics Data System (ADS)

    Fournier, J.; Ballard, P.; Merrien, P.; Barralis, J.; Castex, L.; Fabbro, R.

    1991-09-01

    Specimens made of low alloy and non alloyed medium carbon steels were subjected to high energy laser pulses. Direct ablation and confined plasma procedures were both investigated. An optimum impulse momentum transfer to the material is attained with a pulse duration of 30 ns and a power density of 10 GW .cm^2. Fatigue testing shows that the fatigue strengths of the selected materials are significantly increased. This can be related to the fact that laser shock processing generates an appropriate residual compressive stress field in a sufficiently thick layer and does not alter the initial surface roughness. In addition, the use of cumulative laser impacts and of dual treatment combining thermal and mechanical effects of the laser beam have been investigated and shown to result in an enhanced fatigue strength. Des échantillons d'acier éventuellement faiblement allié sont irradiés par un ou plusieurs pulses laser ayant une intensité comprise entre 1 et 100 GW/cm^2 et une durée d'émission laser de 3 ou 30 ns, les deux configurations d'ablation directe ou de plasma confiné étant utilisées. Les contraintes résiduelles résultant du passage de l'onde de choc sont analysées à l'aide de la technique de diffraction de rayons X. D'après cette étude, il apparaît clairement que les valeurs d'intensité et de durée d'émission laser les plus appropriées sont respectivement 10 GW/cm^2 et 30 ns. Ces valeurs correspondent à l'optimum de transfert d'impulsion. De plus, l'influence du nombre d'impacts laser utilisés est discuté et un essai de fatigue montre que ce traitement mécanique de surface augmente de manière significative la limite d'endurance du matériau étudié.

  19. Random hydrophilic-hydrophobic copolymers

    NASA Astrophysics Data System (ADS)

    Garel, T.; Leibler, L.; Orland, H.

    1994-12-01

    We study a single statistical amphiphilic copolymer chain AB in a selective solvent (e.g. water). Two situations are considered. In the annealed case, hydrophilic (A) and hydrophobic (B) monomers are at local chemical equilibrium and both the fraction of A monomers and their location along the chain can vary, whereas in the quenched case (which is relevant to proteins), the chemical sequence along the chain is fixed by synthesis. In both cases, the physical behaviour depends on the average hydrophobicity of the polymer chain. For a strongly hydrophobic chain (large fraction of B), we find an ordinary continuous θ collapse, with a large conformational entropy in the collapsed phase. For a weakly hydrophobic, or a hydrophilic chain, there is an unusual first-order collapse transition. In particular, for the case of Gaussian disorder, this discontinuous transition is driven by a change of sign of the third virial coefficient. The entropy of this collapsed phase is strongly reduced with respect to the θ collapsed phase. Nous étudions un copolymère aléatoire amphiphile AB dans un solvant sélectif (par exemple, de l'eau). Nous considérons deux cas. Dans le cas du désordre mobile, les monomères hydrophiles (A) et hydrophobes (B) sont à l'équilibre chimique local, et la fraction de monomères A ainsi que leur position dans l'espace peuvent varier, alors que dans le cas du désordre gelé (qui est relié au problème des protéines), la séquence chimique est fixée par synthèse. Dans les deux cas, le comportement de la chaîne depend de son hydrophobicité moyenne. Pour une chaîne fortement hydrophobe (grande fraction de B), on trouve un point d'effondrement θ continu ordinaire, avec une grande entropie conformationnelle. Pour une chaîne faiblement hydrophobe ou hydrophile, on trouve une transition inhabituelle du premier ordre. En particulier, dans le cas du désordre gaussien, cette transition discontinue est pilotée par un changement de signe du troisi

  20. Evaluation des Connaissances-Attitudes-Pratiques des populations des districts sanitaires de Benoye, Laoukassy, Moundou et N’Djaména Sud sur la rage canine au Tchad

    PubMed Central

    Mindekem, Rolande; Lechenne, Monique; Alfaroukh, Idriss Oumar; Moto, Daugla Doumagoum; Zinsstag, Jakob; Ouedraogo, Laurent Tinoaga; Salifou, Sahidou

    2017-01-01

    Introduction La rage canine demeure une préoccupation en Afrique comme au Tchad. La présente étude vise à évaluer les Connaissances-Attitudes-Pratiques des populations pour la prise en charge appropriée des personnes exposées et une lutte efficace. Méthodes C’était une étude transversale descriptive réalisée en juillet et septembre dans quatre districts sanitaires au Tchad en 2015. Les données ont été collectées à l’aide d’un questionnaire auprès des ménages recrutés suivant un sondage aléatoire à 3 degrés. Résultats C’était 2428 personnes enquêtées avec un niveau maximum primaire (54,12%). L’âge moyen était de 36 ± 13,50 ans. Ils étaient cultivateurs (35,17%), commerçants (18,04%), ménagères (12,81%). La rage était définie comme une maladie transmise du chien à l’homme (41,43%), une altération du cerveau (41,27%), une sous-alimentation (10,26%). Le chat était faiblement connu réservoir (13,84%) et vecteur (19,77%) ainsi que la griffure comme moyen de transmission (4,61%) et la vaccination du chat comme mesure préventive (0,49%). Les premiers soins en cas de morsure à domicile étaient les pratiques traditionnelles (47,69%), le lavage des plaies (19,48%) ou aucune action entreprise (20,43%). Les ménages consultaient la santé humaine (78,50%), la santé animale (5,35%) et les guérisseurs traditionnels (27%). Conclusion La communication en rapport avec des premiers soins à la maison en cas de morsure, la connaissance du chat comme réservoir et vecteur, celle de la griffure comme moyen de transmission et la promotion de la consultation des services vétérinaires en cas de morsure sont nécessaires. PMID:28761600

  1. Molecular characterization of soluble and membrane-bound trehalases of the whitefly, Bemisia tabaci.

    PubMed

    Wang, Jia; He, Wen-Bo; Su, Yun-Lin; Bing, Xiao-Li; Liu, Shu-Sheng

    2014-04-01

    Trehalases (Tres) have been demonstrated to be the key enzymes that are involved in various trehalose-associated physiological processes in insects. However, little attention has been devoted to the Tres in the whitefly, Bemisia tabaci. In this study, a soluble Tre (BtTre-1) and a membrane-bound Tre (BtTre-2) were cloned in the invasive cryptic species Middle East-Asia Minor 1 (MEAM1) of the whitefly B. tabaci complex. Alignment of deduced amino acids sequences of both BtTres revealed that they share common consensus regions and residues with Tres of other insect species. Levels of BtTres expression in various stages and tissues of the whitefly suggested that BtTre-2 may play a key role in trehalose catabolism during development of the whitefly, especially for oocyte development, while BtTre-1 may prevent trehalose in salivary gland from leaking and entering into plants along with saliva. Potential roles of trehalose catabolism in response to direct and/or plant-mediated indirect effects of Tomato Yellow Leaf Curl China Virus (TYLCCNV) were also detected. Whiteflies feeding on virus-infected tobacco plants showed higher BtTres expressions and accordingly higher BtTres activity but lower trehalose content than those feeding on uninfected plants. The enhanced trehalose catabolism may be beneficial to oocyte development in ovary and attenuate plant defensive responses induced by trehalose in saliva. Viruliferous and nonviruliferous whiteflies feeding on cotton, a nonhost plant for TYLCCNV, differed significantly only in trehalose content. The higher trehalose content in viruliferous whiteflies may be conducive to resisting the stress inflicted by TYLCCNV. © 2014 Wiley Periodicals, Inc.

  2. Cloning, expression and functional characterization of a novel trehalose synthase from marine Pseudomonas sp. P8005.

    PubMed

    Gao, Yun; Xi, Yue; Lu, Xiao-Ling; Zheng, Heng; Hu, Bo; Liu, Xiao-Yu; Jiao, Bing-Hua

    2013-11-01

    Trehalose synthase (TreS) catalyzes the reversible interconversion of maltose and trehalose. A novel treS gene with a length of 3,369 bp, encoding a protein of 1,122 amino acid residues with a predicted molecular mass of 126 kDa, was cloned from a marine Pseudomonas sp. P8005 (CCTCC: M2010298) and expressed in Escherichia coli. The amino acid sequence identities between this novel TreS and other reported TreS is relatively low. The purified recombinant TreS showed an optimum pH and temperature of 7.2 and 37 °C, respectively. The enzyme displayed a high conversion rate (70 %) of maltose to trehalose during equilibrium and had a higher catalytic efficiency (k cat/K m) for maltose than for trehalose, suggesting its application in the production of trehalose. In addition to maltose and trehalose, this enzyme can also act on sucrose, although this activity is relatively low. Mutagenesis studies demonstrated that enzymatic activity was reduced dramatically by individually substitution with alanine for D78, Y81, H121, D219, E261, H331 or D332, which implied that these residues might be important in P8005-TreS. Experiments using isotope-labeled substrates showed that [(2)H2]trehalose combined with unlabeled trehalose was converted to [(2)H2]maltose and maltose, but without any production of [(2)H]maltose or [(2)H]trehalose and with no incorporation of exogenous [(2)H7]glucose into the disaccharides during the conversion catalyzed by this enzyme. This finding indicated the involvement of an intramolecular mechanism in P8005-TreS catalyzing the reversible interconversion of maltose and trehalose.

  3. Preparation and in-vitro/in-vivo characterization of trans-resveratrol nanocrystals for oral administration.

    PubMed

    Singh, Sandeep K; Makadia, Vishal; Sharma, Shweta; Rashid, Mamunur; Shahi, Sudhir; Mishra, Prabhat R; Wahajuddin, Mohammed; Gayen, Jiaur R

    2017-02-13

    Trans -resveratrol (t-RES) is a natural polyphenolic compound with extensive therapeutic activities; however, its clinical application is circumscribed due to its poor solubility and low bioavailability. The purpose of this study was to prepare stable t-RES nanocrystals (t-RES-NCs) with different stabilizers to improve its oral bioavailability. t-RES-NCs were fabricated by the probe sonication method and optimized by particles size, poly dispersive index and zeta potential. The pharmaceutical characterization of t-RES-NCs was further performed systematically. The in vitro cellular efficacy and in vivo pharmacokinetics of t-RES-NCs were also evaluated. The optimized NCs were successfully accomplished in a sub-micron particle size (110.28 ± 12.55 nm) with high ζ-potential (-32.96 ± 3.85 mV) value. Scanning electron microscopy (SEM) image indicated that morphology of t-RES-NCs was regular and rod like in shape. Meanwhile, the result of in vitro cellular efficacy against MDA-MB-231 cells revealed that developed t-RES-NCs were more efficacious and potent (p < 0.05) than plain t-RES. Compared to plain t-RES, t-RES-NCs exhibited significant increase (p < 0.05) in AUC0-t (3.5-folds) and C max (2.2-folds), demonstrating improved oral bioavailability of t-RES after grafting as NCs. The significant increase in oral bioavailability of developed t-RES-NCs represents an ideal vehicle for oral delivery of t-RES which ultimately reflected the clinical efficacy of t-RES.

  4. Flux through trehalose synthase flows from trehalose to the alpha anomer of maltose in mycobacteria.

    PubMed

    Miah, Farzana; Koliwer-Brandl, Hendrik; Rejzek, Martin; Field, Robert A; Kalscheuer, Rainer; Bornemann, Stephen

    2013-04-18

    Trehalose synthase (TreS) was thought to catalyze flux from maltose to trehalose, a precursor of essential trehalose mycolates in mycobacterial cell walls. However, we now show, using a genetic approach, that TreS is not required for trehalose biosynthesis in Mycobacterium smegmatis, whereas two alternative trehalose-biosynthetic pathways (OtsAB and TreYZ) are crucial. Consistent with this direction of flux, trehalose levels in Mycobacterium tuberculosis decreased when TreS was overexpressed. In addition, TreS was shown to interconvert the α anomer of maltose and trehalose using (1)H and (19)F-nuclear magnetic resonance spectroscopies using its normal substrates and deoxyfluoromaltose analogs, with the nonenzymatic mutarotation of α/β-maltose being slow. Therefore, flux through TreS in mycobacteria flows from trehalose to α-maltose, which is the appropriate anomer for maltose kinase of the GlgE α-glucan pathway, which in turn contributes to intracellular and/or capsular polysaccharide biosynthesis.

  5. Atmospheric Characterization of Five Hot Jupiters with the Wide Field Camera 3 on the Hubble Space Telescope

    NASA Technical Reports Server (NTRS)

    Ranjan, Sukrit; Charbonneau, David; Desert, Jean-Michel; Madhusudhan, Nikku; Deming, Drake; Wilkins, Ashlee; Mandell, Avi M.

    2014-01-01

    We probe the structure and composition of the atmospheres of five hot Jupiter exoplanets using the Hubble Space Telescope Wide Field Camera 3 (WFC3) instrument. We use the G141 grism (1.1-1.7 micrometers) to study TrES-2b, TrES-4b, and CoRoT-1b in transit; TrES-3b in secondary eclipse; and WASP-4b in both. This wavelength region includes a predicted absorption feature from water at 1.4 micrometers, which we expect to be nondegenerate with the other molecules that are likely to be abundant for hydrocarbon-poor (e.g., solar composition) hot Jupiter atmospheres. We divide our wavelength regions into 10 bins. For each bin we produce a spectrophotometric light curve spanning the time of transit or eclipse. We correct these light curves for instrumental systematics without reference to an instrument model. For our transmission spectra, our mean 1s precision per bin corresponds to variations of 2.1, 2.8, and 3.0 atmospheric scale heights for TrES-2b, TrES-4b, and CoRoT-1b, respectively. We find featureless spectra for these three planets. We are unable to extract a robust transmission spectrum for WASP-4b. For our dayside emission spectra, our mean 1 sigma precision per bin corresponds to a planet-to-star flux ratio of 1.5 x 10(exp -4) and 2.1 x 10(exp -4) for WASP-4b and TrES-3b, respectively. We combine these estimates with previous broadband measurements and conclude that for both planets isothermal atmospheres are disfavored. We find no signs of features due to water. We confirm that WFC3 is suitable for studies of transiting exoplanets, but in staring mode multivisit campaigns are necessary to place strong constraints on water abundance.

  6. Atmospheric characterization of five hot Jupiters with the wide field Camera 3 on the Hubble space telescope

    SciTech Connect

    Ranjan, Sukrit; Charbonneau, David; Désert, Jean-Michel; Madhusudhan, Nikku; Deming, Drake; Wilkins, Ashlee; Mandell, Avi M.

    2014-04-20

    We probe the structure and composition of the atmospheres of five hot Jupiter exoplanets using the Hubble Space Telescope Wide Field Camera 3 (WFC3) instrument. We use the G141 grism (1.1-1.7 μm) to study TrES-2b, TrES-4b, and CoRoT-1b in transit; TrES-3b in secondary eclipse; and WASP-4b in both. This wavelength region includes a predicted absorption feature from water at 1.4 μm, which we expect to be nondegenerate with the other molecules that are likely to be abundant for hydrocarbon-poor (e.g., solar composition) hot Jupiter atmospheres. We divide our wavelength regions into 10 bins. For each bin we produce a spectrophotometric light curve spanning the time of transit or eclipse. We correct these light curves for instrumental systematics without reference to an instrument model. For our transmission spectra, our mean 1σ precision per bin corresponds to variations of 2.1, 2.8, and 3.0 atmospheric scale heights for TrES-2b, TrES-4b, and CoRoT-1b, respectively. We find featureless spectra for these three planets. We are unable to extract a robust transmission spectrum for WASP-4b. For our dayside emission spectra, our mean 1σ precision per bin corresponds to a planet-to-star flux ratio of 1.5 × 10{sup –4} and 2.1 × 10{sup –4} for WASP-4b and TrES-3b, respectively. We combine these estimates with previous broadband measurements and conclude that for both planets isothermal atmospheres are disfavored. We find no signs of features due to water. We confirm that WFC3 is suitable for studies of transiting exoplanets, but in staring mode multivisit campaigns are necessary to place strong constraints on water abundance.

  7. To boldly gulp: standard metabolic rate and boldness have context-dependent influences on risk-taking to breathe air in a catfish.

    PubMed

    McKenzie, David J; Belão, Thiago C; Killen, Shaun S; Rantin, F Tadeu

    2015-12-01

    The African sharptooth catfish Clarias gariepinus has bimodal respiration, it has a suprabranchial air-breathing organ alongside substantial gills. We used automated bimodal respirometry to reveal that undisturbed juvenile catfish (N=29) breathed air continuously in normoxia, with a marked diurnal cycle. Air breathing and routine metabolic rate (RMR) increased in darkness when, in the wild, this nocturnal predator forages. Aquatic hypoxia (20% air saturation) greatly increased overall reliance on air breathing. We investigated whether two measures of risk taking to breathe air, namely absolute rates of aerial O2 uptake (ṀO2,air) and the percentage of RMR obtained from air (%ṀO2,air), were influenced by individual standard metabolic rate (SMR) and boldness. In particular, whether any influence varied with resource availability (normoxia versus hypoxia) or relative fear of predation (day versus night). Individual SMR, derived from respirometry, had an overall positive influence on ṀO2,air across all contexts but a positive influence on %ṀO2,air only in hypoxia. Thus, a pervasive effect of SMR on air breathing became most acute in hypoxia, when individuals with higher O2 demand took proportionally more risks. Boldness was estimated as time required to resume air breathing after a fearful stimulus in daylight normoxia (Tres). Although Tres had no overall influence on ṀO2,air or %ṀO2,air, there was a negative relationship between Tres and %ṀO2,air in daylight, in normoxia and hypoxia. There were two Tres response groups, 'bold' phenotypes with Tres below 75 min (N=13) which, in daylight, breathed proportionally more air than 'shy' phenotypes with Tres above 115 min (N=16). Therefore, individual boldness influenced air breathing when fear of predation was high. Thus, individual energy demand and personality did not have parallel influences on the emergent tendency to take risks to obtain a resource; their influences varied in strength with context. © 2015

  8. Atmospheric Characterization of Five Hot Jupiters with the Wide Field Camera 3 on the Hubble Space Telescope

    NASA Technical Reports Server (NTRS)

    Ranjan, Sukrit; Charbonneau, David; Desert, Jean-Michel; Madhusudhan, Nikku; Deming, Drake; Wilkins, Ashlee; Mandell, Avi M.

    2014-01-01

    We probe the structure and composition of the atmospheres of five hot Jupiter exoplanets using the Hubble Space Telescope Wide Field Camera 3 (WFC3) instrument. We use the G141 grism (1.1-1.7 micrometers) to study TrES-2b, TrES-4b, and CoRoT-1b in transit; TrES-3b in secondary eclipse; and WASP-4b in both. This wavelength region includes a predicted absorption feature from water at 1.4 micrometers, which we expect to be nondegenerate with the other molecules that are likely to be abundant for hydrocarbon-poor (e.g., solar composition) hot Jupiter atmospheres. We divide our wavelength regions into 10 bins. For each bin we produce a spectrophotometric light curve spanning the time of transit or eclipse. We correct these light curves for instrumental systematics without reference to an instrument model. For our transmission spectra, our mean 1s precision per bin corresponds to variations of 2.1, 2.8, and 3.0 atmospheric scale heights for TrES-2b, TrES-4b, and CoRoT-1b, respectively. We find featureless spectra for these three planets. We are unable to extract a robust transmission spectrum for WASP-4b. For our dayside emission spectra, our mean 1 sigma precision per bin corresponds to a planet-to-star flux ratio of 1.5 x 10(exp -4) and 2.1 x 10(exp -4) for WASP-4b and TrES-3b, respectively. We combine these estimates with previous broadband measurements and conclude that for both planets isothermal atmospheres are disfavored. We find no signs of features due to water. We confirm that WFC3 is suitable for studies of transiting exoplanets, but in staring mode multivisit campaigns are necessary to place strong constraints on water abundance.

  9. [Intragenic deletions of NRXN1: three new case reports and a review of the phenotype].

    PubMed

    Galán-Sánchez, Francisco; Esteban-Cantó, Vanessa; Blaya-Fernández, Pedro; Jadraque-Rodríguez, Rocío; Manchón-Trives, Irene; Alcaraz-Más, Luis

    2015-03-01

    Objetivo. Aportar datos sobre el fenotipo determinado por las microdeleciones de los exones alfa del gen NRXN1. Casos clinicos. Se estudian tres casos neuropediatricos con microdeleciones intragenicas NRXN1 alfa. El fenotipo en estos tres casos es inespecifico, con retraso mental leve-moderado, trastornos de comportamiento y escasos rasgos dismorficos o malformaciones. Conclusion. El fenotipo encontrado en las microdeleciones de los exones alfa del gen NRXN1 es claramente distinguible del fenotipo encontrado en las microdeleciones de los exones beta, con macrocefalia, epilepsia y retraso mental.

  10. In vitro transcriptional studies of the roles of the thyroid hormone (T3) response elements and minimal promoters in T3-stimulated gene transcription.

    PubMed

    Suen, C S; Yen, P M; Chin, W W

    1994-01-14

    Thyroid hormone receptors (TRs) are ligand-dependent nuclear transcription factors that are encoded by two different genes, TR alpha and TR beta, and bind to thyroid hormone response elements (TREs) in the promoters of thyroid hormone (T3)-regulated genes. Retinoid X receptors (RXRs), major members of the thyroid hormone receptor auxiliary proteins, have recently been shown to enhance the binding of TRs to TREs. We previously showed that TRs extracted from rat pituitary GH3 cells retain ligand (T3) and DNA binding specificity and stimulate rat growth hormone (rGH) promoter activity in a cell-free in vitro transcription system. In this report, we have studied further how T3 activates endogenous TRs and stimulates transcription from different TRE-containing promoters. We found that T3 (10(-8) M) selectively stimulates transcription from rGH-TRE- and TREpal-, but not ME-TRE- and F2-TRE-, containing templates in which these TREs are linked in front of the rGH minimal promoter containing only the TATA box binding protein, but not any other proximal binding protein, sequence. In contrast, only the TREpal/AdML template, in which TREpal oligonucleotide was linked in front of the adenovirus major late gene (AdML) minimal promoter, was stimulated by T3. Electrophoretic mobility shift assay (EMSA) demonstrates that endogenous TR complexes specifically bind to either natural or idealized TRE (rGH-TRE, TREpal, ME-TRE, and F2-TRE) oligonucleotides. To further understand these receptor-DNA complexes formed on various TREs, isoform-specific anti-receptor antisera (TR alpha, TR beta 1, TR beta 2, and RXR beta) were added in the EMSA. These antisera differentially supershifted TR.DNA complexes formed on the TREs. These data suggest either that endogenous TR isoforms and RXR beta may form different complexes on the various TREs or that TR.RXR complexes have distinct conformations when bound to the various TREs. Taken together, these data suggest that particular TREs in which specific

  11. Cryptographie quantique avec des états cohérents à longueur d'onde télécom

    NASA Astrophysics Data System (ADS)

    Lodewyck, J.; Tualle-Brouri, R.; Debuisschert, T.; Grangier, P.

    2006-10-01

    Nous proposons un système de distribution quantique de clé avec des variables continues, implémenté avec des technologies télécom à 1550 nm. Le dispositif actuel nous a permis de transmettre une clé secrète brute au taux de 1 Mb/s sur une distance de quelques mètres. Une extension en cours de réalisation nous permettra de transmettre des clés sur des distances allant jusqu'à plusieurs dizaines dekilomètres.

  12. Expression and localization of aromatase during fetal mouse testis development.

    PubMed

    Borday, Caroline; Merlet, Jorge; Racine, Chrystèle; Habert, René

    2013-01-01

    Les androgènes et les oestrogènes sont indispensables au développement et aux fonctions du testicule. Le testicule est particulièrement sensible aux perturbateurs endocriniens pendant le développement fœtal et beaucoup de perturbateurs endocriniens agissent en modifiant la balance oestrogènes/androgènes. Physiologiquement, cette balance est régulée par une cascade enzymatique qui convertit irréversiblement les androgènes en oestrogènes. Le composant principal de cette cascade est le cytochrome p450 19A1 (appelé couramment aromatase). Le but de ce travail a été d’étudier l’expression de l’aromatase testiculaire au cours du développement fœtal chez la souris.En utilisant une approche par RT-PCR et par western blot, nous avons montré que l’aromatase est exprimée dès 12,5 jours post-conception (jpc) et que l’expression est maximum à 17,5 jpc. Deux transcripts tronqués ont également été détectés par RT-PCR. La localisation cellulaire de l’aromatase a été étudiée par immunohistologie et par immunomarquage après séparation des cellules testiculaires. Cette enzyme est très fortement exprimée dans les cellules de Leydig fœtales. Elle est également exprimée dans les gonocytes mais plus faiblement et à un niveau variable selon les cellules. En revanche, elle est indétectable dans les cellules de Sertoli.En conclusion, cette étude montre pour la première fois chez la souris que 1) l’aromatase est exprimée dès le début de l’ontogenèse testiculaire, 2) elle est exprimée dans les gonocytes suggérant que ces cellules interviennent dans l’endocrinologie testiculaire et que le rapport oestrogènes/androgènes est plus important dans les gonocytes que dans le liquide interstitiel. En outre, on sait que, chez le fœtus de rat l’aromatase est essentiellement exprimée par les cellules de Sertoli. Nous proposons de prendre en compte cette différence inter-espèces comme un nouveau concept pour comprendre les diff

  13. Etude du champ magnetique dans les nuages moleculaires

    NASA Astrophysics Data System (ADS)

    Houde, Martin

    2001-12-01

    Ce travail est une étude du champ magnétique duns l'environnement circumstellaire des étoiles jeunes. Il a pour origine la certitude qu'avait l'auteur qu'il se devait d'être possible de détecter la présence d'un champ magnétique, et de possiblement le caractériser, par le biais d'observations de profils spectraux d'espèces moléculaires ioniques. Il en découle donc qu'un des buts principaux était de prouver que cela est effectivement possible. La thèse comporte alors des éléments théoriques et expérimentaux qui sont à la fois complémentaires et intimement liés. L'aspect théorique est basé sur l'interaction mutuelle que des particules neutres et chargées peuvent avoir l'une sur l'autre daps un plasma faiblement ionisé comme ceux existants daps les nuages moléculaires sites de formation stellaire. Il appert que la présence d'un champ magnétique a un effet direct sur le comportement des ions (via la force de Lorentz) et indirect sur les molécules neutres (via les nombreuses collisions entre les deux types de particules). Une telle interaction est, comme il est maintenant bien connu, présente dans les premières étapes de la formation dune étoile. Il s'agit bien sûr de la diffusion ambipolaire. Nous montrerons qu'il existe cependant un autre type de diffusion, jusqu'ici inconnue, qui se manifeste plus tard au tours de l'évolution des nuages moléculaires. Celle-ci peut avoir un effet dramatique sur l'apparence des profils spectraux (de rotation moléculaire) des espèces ioniques lorsque comparés à ceux qu'exhibent des espèces neutres coexistantes. Mais pour ce faire, il doit y avoir existence de mouvements organisés (des flots ou jets) de matière ou encore la présence de turbulence dans les régions considérées. Une distribution de vélocité du type maxwellienne ne révèlera pas la présence du champ magnétique. Les observations, qui ont pour but de confirmer la théorie, se situent dans le domaine des longueurs d

  14. Micromechanisms of intergranular brittle ftacture in intermetallic compounds

    NASA Astrophysics Data System (ADS)

    Vitek, V.

    1991-06-01

    peut pas se propager de manière fragile, une fois que l'émission de dislocations se produit. Cependant, si une microfissure apparaît pendant le changement, elle peut se développer en concurrence avec le développement d'un cisaillement irréversible en tête de fissure. Ce demier est alors le principal mécanisme dissipatif d'énergie. Dans la deuxième partie de cet article, nous présentons des résultats d'études atomiques de joints de grain dans Ni3AI et CU3Au, suggérant qu'il existe des différences de structure substancielles entre les alliages L12 fortement et faiblement ordonnés. Nous discutons ensuite la conséquence de ces différences pour la fragilité intergranulaire, à l'aide du modèle ci-dessus pour la propagation des microfissures. Sur cette base, nous proposons une explication pour la fragilité intergranulaire intrinsèque de quelques alliages L12, et nous la relions directement au degré d'ordre.

  15. [Evolution of functional capacity, assessed with the Egen Klassifikation scale, in the Spanish population with spinal muscular atrophy or Duchenne muscular dystrophy. A three year longitudinal study].

    PubMed

    Fagoaga, J; Girabent-Farres, M; Bagur-Calafat, C; Steffensen, B F

    2015-10-16

    Introduccion. La atrofia muscular espinal (AME) y la distrofia muscular de Duchenne (DMD) son dos enfermedades neuromusculares que evolucionan con perdida progresiva de la fuerza muscular y, en consecuencia, perdida de la capacidad funcional. La valoracion con escalas de medicion permite conocer mejor y cuantificar esta involucion, asi como tomar decisiones terapeuticas para anticiparse a los problemas y mejorar la calidad de vida de las personas afectas de estas patologias. Objetivo. Estudiar los cambios de la capacidad funcional de un grupo de pacientes con AME y DMD en un periodo de tres años. Pacientes y metodos. Diecinueve personas de la poblacion española afectas de AME o DMD, a las que se valoro con la escala Egen Klassifikation en dos ocasiones, en un periodo de tres años. Resultados. Los resultados obtenidos reflejan una disminucion de la capacidad funcional de estas personas durante este periodo de tiempo, con una diferencia significativa en la suma total de la escala (p = 0,003). Todos los items de la escala tuvieron valoraciones inferiores despues de tres años, y se llego a la significacion estadistica en la valoracion de la capacidad de mover las manos y de toser. Conclusion. La capacidad funcional de los pacientes con AME y DMD disminuye de forma significativa en tres años.

  16. Flutter Analysis of a Two-Dimensional Airfoil Containing Structural Nonlinearities.

    DTIC Science & Technology

    1987-05-01

    ou divergente . Des 6tudes de cas sont men6es A partir de divers param~tres de profil d’aile et de diverses valeurs de pr~charge et de jeu libre. On...possibles, soit: oscillation amortie, oscillation A amplitude limI~ et oscillation divergente . La limite d’a6ro~lasticit6 divergente est pratiquement

  17. A Preliminary Study of Krypton Laser-Induced Fluorescence

    DTIC Science & Technology

    2010-07-01

    pp. 397–402. 25Champeau, R. J. and Keller, J. C., “Spectroscopie Laser a Tres Haute Resolution Sur un Jet Atomique de Krypton,” Journal of Phyiscs B...1996, pp. 3196–3201. 28Young, L., Yang, D., and Dunford, R. W., “Opitical Pro- duction of Metastable Krypton,” Journal of Phyiscs B , Vol. 35, 2002, pp

  18. Transient Annealing Characterization of Irradiated MOSFETS

    DTIC Science & Technology

    1990-01-01

    silicium ) aux radiations nucleaires est une fonction du temps tres complexe. Ce rapport decrit les phenomenes physiques causant cette reponse et les...address of the organization preparing the document 2. SECURITY CLASSIFICATION Orgenizations for whom the document was Prepared, e.g Establishment

  19. An Evaluation of a Modified Simulated Annealing Algorithm for Various Formulations

    DTIC Science & Technology

    1990-08-01

    energy state for the system is termed the ground state (Fromhold, 1981). The concept of a stationary quantum state, first conceived by Niels Bohr ...Birkhoff, G. (1946). Tres observaciones sobre el algebra lineal, Rev. Univ. Nac. TucumanSer. A, 5, 147-151. Bohr , Niels (1913). Old quantum theory

  20. Uso de terreno urbano y rural en Puerto Rico

    Treesearch

    Sebastian Martinuzzi; William A. Gould; Olga M. Ramos Gonzalez; Maya Quinones; Michael E. Jimenez

    2008-01-01

    El Proyecto de Analisis de Gap de Puerto Rico (PRGAP) (Gould et al. 2008) desarrollo tres usos de terrenos para Puerto Rico: Urbano, Suburbano, y Rural (Martinuzzi et al. 2007). Estas regiones tambien pueden ser consideradas como urbano, densamente-poblado rural, y escasamente-poblado rural, o como urbano y area silvestre con una interfase de area silvestre-urbana. La...

  1. Imbalances of T cell subpopulations in primary immunodeficiencies and systemic lupus erythematosus.

    PubMed

    Pandolfi, F; Quinti, I; Sirianni, M C; Fiorilli, M; Zolla, S; Aiuti, F

    1981-01-01

    In the present report we describe a recently proposed technique for the enumeration of T lymphocyte subpopulations. The study was performed on peripheral blood lymphocytes (PBL) of 21 patients with primary immunodeficiencies and 10 with systemic lupus erythematosus (SLE). With this methodology, sheep rosettes are evaluated before and after preincubation with theophylline. Previous reports have shown that cells rosetting after the preincubation (T-res) contain most of the percentages of the helper activity, whereas sensitive cells (T-sens) exert suppression. T-res and T-sens cells were compared to several clinical and immunological parameters, including the detection of lymphocytes with Fc IgM and IgG receptors. We demonstrated a significant positive correlation between T-res and and EAox IgM cells and between T-sens and EAox IgG cells. In addition, patients with Ig defects demonstrated heterogeneity regarding alterations in the proportions of T-res and T-sens cells. On the contrary, in 8 patients with SLE, there was a markedly reduced proportion of T-sens cells. Variations in the balance of subpopulations were observed after treatment with thymic hormones and levamisole. We may conclude that theophylline rosettes represent an easy technique that can be profitably used in the evaluation of T cell subpopulations in immunological diseases.

  2. Resveratrol, Potential Therapeutic Interest in Joint Disorders: A Critical Narrative Review

    PubMed Central

    Nguyen, Christelle; Savouret, Jean-François; Widerak, Magdalena; Corvol, Marie-Thérèse; Rannou, François

    2017-01-01

    Trans-resveratrol (t-Res) is a natural compound of a family of hydroxystilbenes found in a variety of spermatophyte plants. Because of its effects on lipids and arachidonic acid metabolisms, and its antioxidant activity, t-Res is considered as the major cardioprotective component of red wine, leading to the “French Paradox” health concept. In the past decade, research on the effects of resveratrol on human health has developed considerably in diverse fields such as cancer, neurodegenerative and cardiovascular diseases, and metabolic disorders. In the field of rheumatic disorders, in vitro evidence suggest anti-inflammatory, anti-catabolic, anti-apoptotic and anti-oxidative properties of t-Res in various articular cell types, including chondrocytes and synoviocytes, along with immunomodulation properties on T and B lymphocytes. In preclinical models of osteoarthritis and rheumatoid arthritis, resveratrol has shown joint protective effects, mainly mediated by decreased production of pro-inflammatory and pro-degradative soluble factors, and modulation of cellular and humoral responses. Herein, we comprehensively reviewed evidence supporting a potential therapeutic interest of t-Res in treating symptoms related to rheumatic disorders. PMID:28067817

  3. Imagining the Mexican Immigrant Worker: (Inter)Nationalism, Identity, and Insurgency in the Chicano Movement in Los Angeles.

    ERIC Educational Resources Information Center

    Chavez, Ernesto

    2000-01-01

    Traces the history of two organizations of the 1970s Chicano Movement: the Committee to Free Los Tres and the Centro de Accion Social Autonomo (CASA). Discusses their Marxist ideology, notion of Chicano cultural nationalism, involvement of college students and other youth, campaigns supporting immigrant workers' rights and affirmative action at…

  4. Study of Optimality Criteria in Design of Experiments.

    DTIC Science & Technology

    1980-06-03

    XlX 2) = IXl- X 21. Any Schur convex funcion is symmetric, because for any permutaion matrix P we have 1 _______ §(Px) I (x) = (P-1Px) < +(PX).- Hence t...1970). Introduction to Matrix Analysis. 2nd edition, McGraw Hill. 2. Birkhoff, G.(1946). Tres observations sobre el algebra lineal , Univ. nac. Tucuman

  5. 27 CFR 9.39 - Paicines.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    .... They are titled: (1) “Tres Pinos Quadrangle, California,” 7.5 minute series (1971); (2) “Paicines Quadrangle, California,” 7.5 minute series (1968); and (3) “Cherry Peak Quadrangle, California,” 7.5 minute... South, Range 7 East; (4) Thence continuing south along the east border of Section 5, Township 15...

  6. VET Workers' Problem-Solving Skills in Technology-Rich Environments: European Approach

    ERIC Educational Resources Information Center

    Hämäläinen, Raija; Cincinnato, Sebastiano; Malin, Antero; De Wever, Bram

    2014-01-01

    The European workplace is challenging VET adults' problem-solving skills in technology-rich environments (TREs). So far, no international large-scale assessment data has been available for VET. The PIAAC data comprise the most comprehensive source of information on adults' skills to date. The present study (N = 50 369) focuses on gaining insight…

  7. Cigarrillos electrónicos | Smokefree Español

    Cancer.gov

    Seguramente ha oído a personas hablar del uso de los cigarrillos electrónicos como una manera de dejar de fumar. Si esta pensando en usar un cigarrillo electrónico, aquí hay tres cosas que debe de saber.

  8. The structure of the Mycobacterium smegmatis trehalose synthase reveals an unusual active site configuration and acarbose-binding mode†

    PubMed Central

    Caner, Sami; Nguyen, Nham; Aguda, Adeleke; Zhang, Ran; Pan, Yuan T; Withers, Stephen G; Brayer, Gary D

    2013-01-01

    Trehalose synthase (TreS) catalyzes the reversible conversion of maltose into trehalose in mycobacteria as one of three biosynthetic pathways to this nonreducing disaccharide. Given the importance of trehalose to survival of mycobacteria, there has been considerable interest in understanding the enzymes involved in its production; indeed the structures of the key enzymes in the other two pathways have already been determined. Herein, we present the first structure of TreS from Mycobacterium smegmatis, thereby providing insights into the catalytic machinery involved in this intriguing intramolecular reaction. This structure, which is of interest both mechanistically and as a potential pharmaceutical target, reveals a narrow and enclosed active site pocket within which intramolecular substrate rearrangements can occur. We also present the structure of a complex of TreS with acarbose, revealing a hitherto unsuspected oligosaccharide-binding site within the C-terminal domain. This may well provide an anchor point for the association of TreS with glycogen, thereby enhancing its role in glycogen biosynthesis and degradation. PMID:23735230

  9. Standardized UXO Technology Demonstration Site Moguls Scoring Record Number 380 (Geophysical Technology Limited)

    DTIC Science & Technology

    2005-10-01

    and electromagnetic (EM) data TFEMI sets, waveform stacking, removal of unwanted frequency components such as 60 Hz noise, EM decay curve integration...Rejection Rate (Rfp): Rfp = 1 - [Pfpdisc (tdic)/ Pfpe (tres)]; Measures (at a threshold of interest), the degree to which the sensor system’s false positive

  10. Imagining the Mexican Immigrant Worker: (Inter)Nationalism, Identity, and Insurgency in the Chicano Movement in Los Angeles.

    ERIC Educational Resources Information Center

    Chavez, Ernesto

    2000-01-01

    Traces the history of two organizations of the 1970s Chicano Movement: the Committee to Free Los Tres and the Centro de Accion Social Autonomo (CASA). Discusses their Marxist ideology, notion of Chicano cultural nationalism, involvement of college students and other youth, campaigns supporting immigrant workers' rights and affirmative action at…

  11. Radiations cosmiques : danger dans l'Espace

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.; Dzitko, H.

    2000-06-01

    Au sol, l'atmosphere nous protege plus ou moins bien. Mais dans l'espace ou a bord des avions de ligne, l'homme est directement expose aux rayonnements cosmiques qui peuvent etre mortels. Un veritable frein a la presence humaine prolongee dans l'espace. Une menace que les agences spatiales prennent tres au serieux.

  12. Resveratrol, Potential Therapeutic Interest in Joint Disorders: A Critical Narrative Review.

    PubMed

    Nguyen, Christelle; Savouret, Jean-François; Widerak, Magdalena; Corvol, Marie-Thérèse; Rannou, François

    2017-01-06

    Trans-resveratrol (t-Res) is a natural compound of a family of hydroxystilbenes found in a variety of spermatophyte plants. Because of its effects on lipids and arachidonic acid metabolisms, and its antioxidant activity, t-Res is considered as the major cardioprotective component of red wine, leading to the "French Paradox" health concept. In the past decade, research on the effects of resveratrol on human health has developed considerably in diverse fields such as cancer, neurodegenerative and cardiovascular diseases, and metabolic disorders. In the field of rheumatic disorders, in vitro evidence suggest anti-inflammatory, anti-catabolic, anti-apoptotic and anti-oxidative properties of t-Res in various articular cell types, including chondrocytes and synoviocytes, along with immunomodulation properties on T and B lymphocytes. In preclinical models of osteoarthritis and rheumatoid arthritis, resveratrol has shown joint protective effects, mainly mediated by decreased production of pro-inflammatory and pro-degradative soluble factors, and modulation of cellular and humoral responses. Herein, we comprehensively reviewed evidence supporting a potential therapeutic interest of t-Res in treating symptoms related to rheumatic disorders.

  13. Preliminary Report from the 2005 Conference on Teacher Research Experiences

    NASA Astrophysics Data System (ADS)

    Scowcroft, G. A.; Knowlton, C.

    2005-12-01

    There is a clearly expressed need from the field for a coordination of efforts and a sharing of best practices among institutions and projects providing teacher research experiences for K-12 science educators. To address these needs, over 100 participants from 30 Teacher Research Experience (TRE) Projects met at the University of Rhode Island in April 2005 to participate in the Conference on Teacher Research Experiences (CTRE). Three member teams from each project included principle investigators, project directors and evaluators, teachers, scientists, and other professionals engaged in TREs. The CTRE goals were to: 1.) initiate a community of professionals that engage in TREs; 2.) build a foundation of best practices for TREs; 3.) work toward standardizing teacher mentoring activities; 4.) establish connections and collaborations between projects; 5.) provide opportunities for meeting individual project challenges. This presentation will discuss conference results as well as highlight data collected from the participating projects describing project design elements, successes, and needs. There are common experiences shared by those participating in TREs that help to build an informed and supportive professional community.

  14. Critical Muralism

    ERIC Educational Resources Information Center

    Rosette, Arturo

    2009-01-01

    This study focuses on the development and practices of Critical Muralists--community-educator-artist-leader-activists--and situates these specifically in relation to the Mexican mural tradition of los Tres Grandes and in relation to the history of public art more generally. The study examines how Critical Muralists address artistic and…

  15. Proceedings of the AMEDD Clinical Psychology Short Course (1987): Military Applications of Neuropsychology and Health Psychology Held in San Francisco, California on 9-13 March 1987. Volume 2.

    DTIC Science & Technology

    1987-07-01

    shown in studies in such diverse areas of health as postcoronarn recover’,: enhancement ot . pulmonary function ; in patients suffering from chronic... pulmonary di,,ease: reduction in pain and ds function in rheumatoid arthritis. elilf"ittation of tension headaches. ,tres reduction, pain management...Neuropsychology Impairment Indices, Subcortical Indices. Localization and Distribution of Brain Functions Self-Efficacy and Health Functioning , Personality

  16. Analysis of hydrocarbon-bearing fluid inclusions (HCFI) using time-resolved fluorescence spectroscopy

    NASA Astrophysics Data System (ADS)

    Przyjalgowski, Milosz A.; Ryder, Alan G.; Feely, Martin; Glynn, Thomas J.

    2005-06-01

    Hydrocarbon-bearing fluid inclusions (HCFI) are microscopic cavities within rocks that are filled with petroleum oil, the composition of which may not have changed since the trapping event. Thus, the composition of that entrapped oil can provide information about the formation and evolution of the oil reservoir. This type of information is important to the petroleum production and exploration industries. Crude oil fluorescence originates from the presence of cyclic aromatic compounds and the nature of the emission is governed by the chemical composition of the oil. Fluorescence based methods are widely used for analysis of crude oil because they offer robust, non-contact and non-destructive measurement options. The goal of our group is the development of a non-destructive analytical method for HCFI using time-resolved fluorescence methods. In broad terms, crude oil fluorescence behavior is governed by the concentration of quenching species and the distribution of fluorophores. For the intensity averaged fluorescence lifetime, the best correlations have been found between polar or alkane concentrations, but these are not suitable for robust, quantitative analysis. We have recently started to investigate another approach for characterizing oils by looking at Time-resolved Emission Spectra (TRES). TRES are constructed from intensities sampled at discrete times during the fluorescence decay of the sample. In this study, TRES, from a series of 10 crude oils from the Middle East, have been measured at discrete time gates (0.5 ns, 1 ns, 2 ns, 4 ns) over the 450-700 nm wavelength range. The spectral changes in TRES, such as time gate dependent Stokes' shift and spectral broadening, are analyzed in the context of energy transfer rates. In this work, the efficacy of using TRES for fingerprinting individual oils and HCFI is also demonstrated.

  17. High-Throughput Library Screening Identifies Two Novel NQO1 Inducers in Human Lung Cells

    PubMed Central

    Marquardt, Gaby; Massimi, Aldo B.; Shi, Miao; Han, Weiguo; Spivack, Simon D.

    2012-01-01

    Many phytochemicals possess antioxidant and cancer-preventive properties, some putatively through antioxidant response element–mediated phase II metabolism, entailing mutagen/oxidant quenching. In our recent studies, however, most candidate phytochemical agents were not potent in inducing phase II genes in normal human lung cells. In this study, we applied a messenger RNA (mRNA)–specific gene expression–based high throughput in vitro screening approach to discover new, potent plant-derived phase II inducing chemopreventive agents. Primary normal human bronchial epithelial (NHBE) cells and immortalized human bronchial epithelial cells (HBECs) were exposed to 800 individual compounds in the MicroSource Natural Products Library. At a level achievable in humans by diet (1.0 μM), 2,3-dihydroxy-4-methoxy-4′-ethoxybenzophenone (DMEBP), triacetylresveratrol (TRES), ivermectin, sanguinarine sulfate, and daunorubicin induced reduced nicotinamide adenine dinucleotide phosphate:quinone oxidoreductase 1 (NQO1) mRNA and protein expression in NHBE cells. DMEBP and TRES were the most attractive agents as coupling potency and low toxicity for induction of NQO1 (mRNA level, ≥3- to 10.8-fold that of control; protein level, ≥ two- to fourfold that of control). Induction of glutathione S-transferase pi mRNA expression was modest, and none was apparent for glutathione S-transferase pi protein expression. Measurements of reactive oxygen species and glutathione/oxidized glutathione ratio showed an antioxidant effect for DMEBP, but no definite effect was found for TRES in NHBE cells. Exposure of NHBE cells to H2O2 induced nuclear translocation of nuclear factor erythroid 2–related factor 2, but this translocation was not significantly inhibited by TRES and DMEBP. These studies show that potency and low toxicity may align for two potential NQO1-inducing agents, DMEBP and TRES. PMID:22021338

  18. High-throughput library screening identifies two novel NQO1 inducers in human lung cells.

    PubMed

    Tan, Xiang-Lin; Marquardt, Gaby; Massimi, Aldo B; Shi, Miao; Han, Weiguo; Spivack, Simon D

    2012-03-01

    Many phytochemicals possess antioxidant and cancer-preventive properties, some putatively through antioxidant response element-mediated phase II metabolism, entailing mutagen/oxidant quenching. In our recent studies, however, most candidate phytochemical agents were not potent in inducing phase II genes in normal human lung cells. In this study, we applied a messenger RNA (mRNA)-specific gene expression-based high throughput in vitro screening approach to discover new, potent plant-derived phase II inducing chemopreventive agents. Primary normal human bronchial epithelial (NHBE) cells and immortalized human bronchial epithelial cells (HBECs) were exposed to 800 individual compounds in the MicroSource Natural Products Library. At a level achievable in humans by diet (1.0 μM), 2,3-dihydroxy-4-methoxy-4'-ethoxybenzophenone (DMEBP), triacetylresveratrol (TRES), ivermectin, sanguinarine sulfate, and daunorubicin induced reduced nicotinamide adenine dinucleotide phosphate:quinone oxidoreductase 1 (NQO1) mRNA and protein expression in NHBE cells. DMEBP and TRES were the most attractive agents as coupling potency and low toxicity for induction of NQO1 (mRNA level, ≥3- to 10.8-fold that of control; protein level, ≥ two- to fourfold that of control). Induction of glutathione S-transferase pi mRNA expression was modest, and none was apparent for glutathione S-transferase pi protein expression. Measurements of reactive oxygen species and glutathione/oxidized glutathione ratio showed an antioxidant effect for DMEBP, but no definite effect was found for TRES in NHBE cells. Exposure of NHBE cells to H(2)O(2) induced nuclear translocation of nuclear factor erythroid 2-related factor 2, but this translocation was not significantly inhibited by TRES and DMEBP. These studies show that potency and low toxicity may align for two potential NQO1-inducing agents, DMEBP and TRES.

  19. A Search for Additional Planets in the Exoplanetary Systems Studied by the NASA EPOXI Mission

    NASA Astrophysics Data System (ADS)

    Ballard, Sarah; Christiansen, J. L.; Charbonneau, D.; Holman, M. J.; Deming, D.; Wellnitz, D. D.; A'Hearn, M. F.; EPOXI Team

    2010-01-01

    The EPOCh (Extrasolar Planet Observation and Characterization) component of the NASA EPOXI mission used the HRI camera aboard the Deep Impact spacecraft to observe transiting exoplanet systems from January through August 2008. The majority of these targets were each observed nearly continuously for several weeks at a time. We searched these high-precision time series for additional planets in these systems, which could be revealed either directly through their photometric transits, or indirectly through the variations these second planets induce on the times of transit of the previously known planet. We present upper limits on putative additional planets in six of the systems observed by EPOXI: HAT-P-4, TrES-3, GJ 436, TrES-2, WASP-3, and HAT-P-7.

  20. Digital data from the northeast Tusas Mountains aeromagnetic survey, north-central New Mexico

    USGS Publications Warehouse

    Drenth, B.J.; Grauch, V.J.S.; ,

    2011-01-01

    This report contains digital data, image files, and text files describing data formats and survey procedures for a high-resolution aeromagnetic survey in the northeast Tusas Mountains region of north-central New Mexico. The survey covers a large portion of the Tres Piedras Ranger District of the Carson National Forest and adjacent areas, northwest of the town of Tres Piedras. Several related and derivative products from these data are also presented as grids and images, including radar-altimeter heights, analytically draped aeromagnetic data, the elevation surface used for draping, and reduced-to-pole aeromagnetic data. Images are presented in various formats and are intended to be used as input to geographic information systems, standard graphics software, or map-plotting packages.

  1. Identification d'une loi de Fick 3D anisotrope: théorie et validation

    NASA Astrophysics Data System (ADS)

    Pierron, F.; Poirette, Y.; Vautrin, A.

    2002-12-01

    Ce papier présente une nouvelle méthodologie d'identification de paramètres gouvernant une loi de Fick de diffusion d'humidité dans les composites à matrices polymères. Dans un premier temps, des aspects théoriques sont exposés et une solution du problème de Fick 3D anisotrope est donnée. Ensuite, différentes stratégies d'identification des paramètres pilotant cette loi sont examinées et une méthodologie originale est proposée. Enfin, cette méthodologie est validée à partir de courbes gravimétriques simulées. Ses avantages et limites sont discutés.

  2. Modeling of Impact Properties of Auxetic Materials: Phase 1

    DTIC Science & Technology

    2013-08-01

    numérique portant sur les propriétés de résistance aux chocs des mousses auxétiques, des matériaux spéciaux qui possèdent un coefficient de Poisson...mousses auxétiques soumises à des charges de choc et de réaliser une étude paramétrique afin de déterminer les effets de divers paramètres...prévoir la variation en fonction du temps de paramètres distincts tels que l’absorption de l’énergie interne, la force de choc et la réduction de la

  3. Aqueous solutions of uranium(VI) as studied by time-resolved emission spectroscopy: a round-robin test.

    PubMed

    Billard, Isabelle; Ansoborlo, Eric; Apperson, Kathleen; Arpigny, Sylvie; Azenha, M Emilia; Birch, David; Bros, Pascal; Burrows, Hugh D; Choppin, Gregory; Couston, Laurent; Dubois, Veronique; Fanghänel, Thomas; Geipel, Gerhard; Hubert, Solange; Kim, Jae I; Kimura, Takaumi; Klenze, Reinhardt; Kronenberg, Andreas; Kumke, Michael; Lagarde, Gerard; Lamarque, Gerard; Lis, Stefan; Madic, Charles; Meinrath, Gunther; Moulin, Christophe; Nagaishi, Ryuji; Parker, David; Plancque, Gabriel; Scherbaum, Franz; Simoni, Eric; Sinkov, Sergei; Viallesoubranne, Carole

    2003-08-01

    Results of an inter-laboratory round-robin study of the application of time-resolved emission spectroscopy (TRES) to the speciation of uranium(VI) in aqueous media are presented. The round-robin study involved 13 independent laboratories, using various instrumentation and data analysis methods. Samples were prepared based on appropriate speciation diagrams and, in general, were found to be chemically stable for at least six months. Four different types of aqueous uranyl solutions were studied: (1) acidic medium where UO2(2+)aq is the single emitting species, (2) uranyl in the presence of fluoride ions, (3) uranyl in the presence of sulfate ions, and (4) uranyl in aqueous solutions at different pH, promoting the formation of hydrolyzed species. Results between the laboratories are compared in terms of the number of decay components, luminescence lifetimes, and spectral band positions. The successes and limitations of TRES in uranyl analysis and speciation in aqueous solutions are discussed.

  4. Direct evidence on the energy transfer of near-infrared emission in PbS quantum dot-doped glass.

    PubMed

    Wang, Haipeng; Wu, Guobo; Qiu, Jianrong; Dong, Guoping

    2015-06-29

    PbS quantum dot (QD)-doped glass was prepared by the heat treatment of as-prepared glass, which was confirmed by transmission electron microscope (TEM), absorption and photoluminescence (PL) spectra. Choosing the glass heat treatment at 600°C for 24h as a representative sample, steady-state and transient-state PL, lifetime and time-resolve emission spectra (TRES) of PbS QD-doped glass were studied in detail. The results indicated that the lifetime spectra showed a similar variation tendency with the PL spectra. The steady-state, transient-state PL and TRES results first revealed the energy transfer process from smaller QDs with higher energy to bigger QDs with lower energy in the PbS QD-doped glass.

  5. The reprint of a chapter of Nicolaus Copernicus' principal book by Heinrich Brucaeus, Rostock 1573 (German Title: Der Nachdruck eines Kapitels des Hauptwerkes von Nicolaus Copernicus durch Heinrich Brucaeus, Rostock 1573)

    NASA Astrophysics Data System (ADS)

    Hamel, Jürgen

    The book "De motu primo libri tres" of the Rostock professor Heinrich Brucaeus (1530-1593), which appeared in 1573, contains an unmodified reprint of a section of Copernicus` principal work, first book, 14th chapter, exercise 3. This reprint, hitherto unnoticed, is of interest for the reception of Copernicus' work. This article reproduces the text and presents some research on Brucaeus, who was Tycho Brahe's teacher in Rostock. His biography and his scientific achievements are outlined.

  6. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  7. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  8. [Experience in kidney transplantation without blood transfusion: kidney transplantation transfusion-free in Jehovah's Witnesses. First communication in Mexico].

    PubMed

    Hernández-Navarrete, Liliana Stefany; Hernández-Jiménez, Jesús Diego; Jiménez-López, Luis Alfredo; Budar-Fernández, Luis Filadelfo; Méndez-López, Marco Tulio; Martínez-Mier, Gustavo

    2013-01-01

    Antecedentes: los Testigos de Jehová rechazan la transfusión sanguínea, pero aceptan el trasplante de órganos, albúmina, inmunoglobulina, vacunas y factores de coagulación. Casos clínicos: comunicamos tres casos de pacientes (dos masculinos y uno femenino) a quienes se realizó trasplante renal en Testigos de Jehová sin transfusión sanguínea, con edad promedio de 31.33 años e índice de masa corporal promedio de 20.99 kg/m(2). Los tres pacientes recibieron diálisis peritoneal pre trasplante por un promedio de 52.3 meses. Se realizaron dos trasplantes de donante vivo y uno de fallecido, con isquemia fría de 23 horas. Los donantes fueron dos femeninos y uno masculino, con edad promedio de 34.33 años. Los tres pacientes recibieron eritropoyetina y hierro dextrán pretrasplante y en el transoperatorio se utilizó una máquina de recuperación celular. Las concentraciones de hemoglobina, hematócrito, glóbulos rojos, creatinina sérica y filtración glomerular a 24 meses postrasplante permanecieron estables. La inducción se realizó con basiliximab y la inmunosupresión inicial con inhibidores de calcineurina. Uno de los pacientes tuvo como complicación un hematoma perirrenal que ameritó reintervención a los 20 días postrasplante. A 5, 26 y 36 meses postrasplante los tres pacientes están vivos y con injerto funcional. Conclusión: es posible realizar trasplantes renales sin transfusión sanguínea en Testigos de Jehová, con supervivencia global aceptable y sin episodios de rechazo agudo.

  9. Proceedings of the Second Annual Conference GeoComputation 97, University of Otago, Dunedin, New Zealand, 26-29 August 1997

    DTIC Science & Technology

    1997-08-29

    the dual spec- However, training these neural network classifiers can be tres ofdifcuky-of-use and lengthy oaining times (Skidmore, a time-consuming...commission. Non-zero has correctly classified 18 out of 20 class 3 samples, but figures that comprise of both ( dual -error boundaries) have only I out of...hyperplane will reduce this error, ieally to 2. Dual -error figures to be reduced only if there are suf- zero, by positioning it in the region between the

  10. Counterterrorism Policy in Colombia

    DTIC Science & Technology

    2007-06-01

    93 Fundación Seguridad y Democracia has recently published a number of statistics on violence in Colombia.94 Between 2001 and 2006 the homicide rate...Últimos Tres Períodos Presidenciales 1994-2006," Fundación Seguridad y Democracia http://www.seguridadydemocracia.org, (accessed March 21, 2007). 95...David. Counterinsurgency Warfare: Theory and Practice. New York: Frederick A. Praeger, 1964. Fundación Seguridad y Democracia . "La Seguridad en los

  11. 46 CFR 42.30-10 - Southern Winter Seasonal Zone.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... continent at Cape Tres Puntas to the point latitude 34° S., longitude 50° W.; thence the parallel of latitude 34° S. to longitude 17° E.; thence the rhumb line to the point latitude 35°10′ S., longitude 20° E.; thence the rhumb line to the point latitude 34° S. longitude 28° E.; thence along the rhumb line to...

  12. Astronomía y Física: un matrimonio Sartriano

    NASA Astrophysics Data System (ADS)

    Vucetich, H.

    Desde el siglo XVII, Física y Astronomía han formado un matrimonio similar al de Sartre y Beauvoir: lleno de amores contingentes, pero firme y duradero. En la charla examino tres de los frutos más recientes de este matrimonio: - La confirmación de la Relatividad General con datos astronómicos. - Astrofísica y Física de neutrinos. - Teorías de supercuerdas y astronomía.

  13. AISS Miro Manual: A Rough Guide

    DTIC Science & Technology

    2006-12-01

    concepts de base de « Miro » sont décrits en second, y compris le langage de définition de l’interface, les services de dénomination, le transfert...des services à la structure Automake, au Langage de définition ayant une interface GOM et aux fichiers de paramètres. DRDC Suffield TM 2006-115 i

  14. A New Concept of Synthetic Aperture Instrument for High Resolution Earth Observation from High Orbits

    DTIC Science & Technology

    2005-07-13

    ces composantes en adoptant une redécomposition des concepts d’interféromètres de type Fizeau ou Michelson . Concept qui autorise, en outre, de rendre le...considering monolithic concepts. It is necessary, to circumvent this problem, to consider a segmented instrument, turning it into a feasible concept...adopting a re-decomposition of the basic Michelson or Fizeau interferometer schemes. In addition to providing variable resolution power and field of

  15. Unusual Bloom of Tetraselmis sp. in the Valparaiso Bay, Chile

    DTIC Science & Technology

    2012-01-01

    a Mitchell (1990), con un espectrofotómetro UV-VIS Shimadzu- 2500, en cuatro estaciones costeras a lo largo de la bahía (Estación 1, 32º 57`25,7``S...tres metros de profundidad (Fig. 4). FIGURA 3. Absorción espectral del material particulado suspendido Ap(λ) de las cuatro estaciones de la Bahía de

  16. Magnétométrie à hélium par pompage laser: le bilan

    NASA Astrophysics Data System (ADS)

    Gilles, H.; Hamel, J.; Monfort, Y.

    2002-06-01

    Depuis 1986, l'équipe Physique Atomique et Capteurs du CIRIL-ISMRA de Caen étudie les magnétomètres à hélium par pompage laser. On présente ici le bilan de ces travaux de recherche et les performances des deux prototypes (hélium4 et hélium3) réalisés au Laboratoire.

  17. La distribución multimodal de cúmulos globulares en la galaxia NGC 1399

    NASA Astrophysics Data System (ADS)

    Forte, J. C.; Ostrov, P. G.

    Se presenta una discusión de las características del diagrama de dos colores para un muestreo de 400 cúmulos globulares asociados con NGC 1399. Los resultados indican la presencia de, por lo menos, tres familias de cúmulos. La naturaleza de una cuarta componente, muy azul, no es clara aunque podría tratarse de cúmulos ``sueltos" asociados con el sistema de Fornax.

  18. Construction. A Report on the Industry

    DTIC Science & Technology

    2004-06-01

    Transportation and Tres Urbano Subway Project, San Juan, Puerto Rico U.S. Corps of Engineers, San Juan, Puerto Rico U.S. Corps of Engineers, Mobile...decade, the industry has not acted to stem the problem.lxxix Many secondary schools have phased out industrial arts programs.l In addition...Architecture Design and MicroStationcxi are state-of - art commercial software packages assisting architects and design engineers in capturing requirements

  19. A Report on the Industry: Construction

    DTIC Science & Technology

    2004-06-01

    Maryland Department of Transportation and Tres Urbano Subway Project, San Juan, Puerto Rico U.S. Corps of Engineers, San Juan, Puerto Rico U.S. Corps...been predicted for a decade, the industry has not acted to stem the problem.lxxix Many secondary schools have phased out industrial arts ...Bentley’s Architecture Design and MicroStationcxi are state-of - art commercial software packages assisting architects and design engineers in

  20. Methode de Calcul du Flutter en Presence de jeu Mecanique et Verification Experimentale (Flutter Analysis Method in Presence of Mechanical Play and Experimental Verification)

    DTIC Science & Technology

    2000-05-01

    structuraux du controle actif et flexible des aeronefs] To order the complete compilation report, use: ADA388195 The component part is provided here to...fibres optiques, de 84 d’un facteur 2 capteurs de pression, ainsi que de deux: potentiom~tres pour mesurer la rotation de la Cette confrontation a...gouverne caisson * palette d’excitation * encastrement au mur * 250 capteurs ( pression, jauge, acc~l6romnbtre, fibre optique) guen7 gouverne dispositif de

  1. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin.

    PubMed

    Bina, Minou; Wyss, Phillip; Novorolsky, Elise; Zulkelfi, Noorfatin; Xue, Jing; Price, Randi; Fay, Matthew; Gutmann, Zach; Fogler, Brian; Wang, Daidong

    2013-12-28

    Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven "bookmarked" regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the memory of highly active genes

  2. Discovery of MLL1 binding units, their localization to CpG Islands, and their potential function in mitotic chromatin

    PubMed Central

    2013-01-01

    Background Mixed Lineage Leukemia 1 (MLL1) is a mammalian ortholog of the Drosophila Trithorax. In Drosophila, Trithorax complexes transmit the memory of active genes to daughter cells through interactions with Trithorax Response Elements (TREs). However, despite their functional importance, nothing is known about sequence features that may act as TREs in mammalian genomic DNA. Results By analyzing results of reported DNA binding assays, we identified several CpG rich motifs as potential MLL1 binding units (defined as morphemes). We find that these morphemes are dispersed within a relatively large collection of human promoter sequences and appear densely packed near transcription start sites of protein-coding genes. Genome wide analyses localized frequent morpheme occurrences to CpG islands. In the human HOX loci, the morphemes are spread across CpG islands and in some cases tail into the surrounding shores and shelves of the islands. By analyzing results of chromatin immunoprecipitation assays, we found a connection between morpheme occurrences, CpG islands, and chromatin segments reported to be associated with MLL1. Furthermore, we found a correspondence of reported MLL1-driven “bookmarked” regions in chromatin to frequent occurrences of MLL1 morphemes in CpG islands. Conclusion Our results implicate the MLL1 morphemes in sequence-features that define the mammalian TREs and provide a novel function for CpG islands. Apparently, our findings offer the first evidence for existence of potential TREs in mammalian genomic DNA and the first evidence for a connection between CpG islands and gene-bookmarking by MLL1 to transmit the memory of highly active genes during mitosis. Our results further suggest a role for overlapping morphemes in producing closely packed and multiple MLL1 binding events in genomic DNA so that MLL1 molecules could interact and reside simultaneously on extended potential transcriptional maintenance elements in human chromosomes to transmit the

  3. Pilot-Vehicle Interface

    DTIC Science & Technology

    2000-03-01

    facteurs humains lies au pilotage des avions de combat tres manoeuvrants] To order the complete compilation report, use: ADA388054 The component part...whether providing this sizes and distances to external objects. abundant amount of information is in the pilot’s best 6.3.1.2 HMD/T Symbology Size...more feasible under high acceleration of operator movement and external electrical activity conditions, compared to head or hand movement, on signal

  4. Geoffrey Burbidge : L'art de la critique

    NASA Astrophysics Data System (ADS)

    Bonnet-Bidaud, J. M.

    1997-06-01

    Avec pres de cinquante ans de carriere derriere lui, Geoffrey Burbidge n'a rien perdu de son gout du débat et de la controverse. Mondialement reconnu pour ses travaux sur les quasars, il en agace aujourd'hui plus d'un en venant deranger le bel ordonnancement de la cosmologie. Il porte sur le monde scientifique un regard tres critique, condamnant notamment ces chercheurs qui acceptent trop volontiers d'emprunter les chemins tout traces.

  5. Military Commissions

    DTIC Science & Technology

    1953-04-01

    prevent men from being punished or killed upon mere suspicion." 27 Grotius (De Jure Belli ac Pacis, Libri Tres (Trans- lation by Kelsey Clarendon...order of conquering prince. 29 Wolff wrote (Jus Gentium Methado Scientifica Petractatum (Translated from the 1761+ edition, Oxford, Claren- don Press...given authority "to declare war . . . and make rules concerning Captures on Land and Water I and "To define and punish Piracies and Felonies com- mittea

  6. Case Study of Small Molecules As Antimalarials: 2-Amino-1-phenylethanol (APE) Derivatives

    PubMed Central

    2014-01-01

    Antiparasitic oral drugs have been associated to lipophilic molecules due to their intrinsic permeability. However, these kind of molecules are associated to numerous adverse effects, which have been extensively studied. Within the Tres Cantos Antimalarial Set (TCAMS) we have identified two small, soluble and simple hits that even presenting antiplasmodial activities in the range of 0.4–0.5 μM are able to show in vivo activity. PMID:24944739

  7. Inducible expression of trehalose synthase in Bacillus licheniformis.

    PubMed

    Li, Youran; Gu, Zhenghua; Zhang, Liang; Ding, Zhongyang; Shi, Guiyang

    2017-02-01

    Trehalose synthase (TreS) could transform maltose into trehalose via isomerization. It is a crucial enzyme in the process of trehalose enzymatical transformation. In this study, plasmid-based inducible expression systems were constructed to produce Thermomonospora curvata TreS in B. licheniformis. Xylose operons from B. subtilis, B. licheniformis and B. megaterium were introduced to regulate the expression of the gene encoding TreS. It was functionally expressed, and the BlsTs construct yielded the highest enzyme activity (12.1 U/mL). Furthermore, the effect of different cultural conditions on the inducible expression of BlsTs was investigated, and the optimal condition was as follows: 4% maltodextrin, 0.4% soybean powder, 1% xylose added after 10 h of growth and an induction time of 12 h at 37 °C. As a result, the maximal yield reached 24.7 U/mL. This study contributes to the industrial application of B. licheniformis, a GRAS workhorse for enzyme production. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. Les Applications Therapeutiques Des Lasers

    NASA Astrophysics Data System (ADS)

    Brunetaud, J. M.; Mordon, S.; Bourez, J.; Mosquet, L.; Moschetto, Y.

    1984-03-01

    C'est de tres loin le mecanisme predominant dans les applications therapeutiques du laser. En concentrant le flux lumineux sur une surface redui-te, le laser chauffe localement les tissus qui se retractent (coagulation) pour etre elimines ensuite (detersion) ; si on chauffe plus intensement, les tissus peuvent etre volatilises. La coagulation est utilisee soit pour detruire de petits phenomenes tumoraux qui seront elimines lors du processus de detersion, soit pour arreter une hemorragie (hemo-stase) ; dans ce cas la retraction thermique des tissus va provoquer la fermeture de la lumiere des vaisseaux qui seront secondairement obliteres par des caillots formes sur place (thrombose). Par volatilisation it est possible de detruire des phenomenes tumoraux plus importants que ceux at-teints lors d'une simple coagulation. Si la zone volatilisee est tres etroite (de 0,1 a 1 mm) on obtient un effet de coupe avec une excellente hemostase au niveau des berges. Certes ces deux processus - coagulation et volatilisation - peuvent etre obtenus par d'autres procedes : echauffement par contact (sonde thermique) ou effet Joule (courant electrique haute frequence). Le laser a l'avantage de ne necessiter aucun contact mecanique entre le vecteur d'energie et les tissus ; on peut alors predire correctement la repartition d'energie au niveau des tissus et les effets sont tres repro-ductibles. Par ailleurs, l'absorption tissulaire variant considerablement avec la longueur d'onde on peut choisir la source laser en fonction des effets desires.

  9. [Kleine-Levin syndrome: differential diagnosis in recurrent encephalitic syndromes in adolescence].

    PubMed

    Duat-Rodriguez, A; Martinez-Albadalejo, I; Perez-Sebastian, I; Cantarin-Extremera, V; Hedrera-Fernandez, A; Garcia-Penas, J J

    2017-04-01

    Introduccion. El sindrome de Kleine-Levin es una enfermedad rara de causa desconocida que se caracteriza por episodios recurrentes autolimitados de hipersomnia acompañados de alteracion cognitiva y conductual. Entre los episodios, los pacientes tienen un patron de sueño y cognitivo normal. Casos clinicos. Se presentan tres pacientes de 14 años, dos chicos y una chica. Comenzaron tras un desencadenante (vacuna, una infeccion respiratoria por influenza B; en el caso de la chica, coincidian con la menstruacion). En el episodio agudo mostraban tendencia al sueño y en vigilia destacaba bradipsiquia, inquietud motora y gran labilidad emocional, con tendencia al llanto y necesidad de la presencia de los familiares. Presentaron una duracion aproximada de 10-15 dias y periodicidad mensual, y se mostraron asintomaticos entre los episodios. Los tres pacientes fueron valorados por pediatras, diagnosticados y tratados de encefalitis autoinmune. Solo uno cumplia la triada tipica de hipersomnia, hiperfagia e hipersexualidad, pero ninguno de los tres datos se habia recogido en la historia clinica inicial y la familia solo lo referia tras una anamnesis dirigida. Conclusiones. En el sindrome de Kleine-Levin, los sintomas neurologicos durante el cuadro agudo son aun mas frecuentes que los psiquiatricos. La tendencia al sueño y el hecho de que durante la vigilia no esten asintomaticos y se muestren lentos, apaticos, labiles e irascibles, situa en primer lugar la sospecha de sindrome encefalitico. Debemos tener presente esta entidad en encefalitis recurrentes de etiologia no filiada.

  10. [X-linked hereditary spastic paraplegia due to mutation in the L1CAM gene: three cases reports of CRASH syndrome].

    PubMed

    Muñoz, Abián; Cabrera-López, José C; Santana-Rodríguez, Alfredo; Toledo-Bravo de Laguna, Laura; Santana-Artiles, Alexandre; Sebastián-García, Irma

    2016-03-01

    Introduccion. La paraplejia espastica hereditaria (PEH) representa un conjunto de cuadros clinicos neurodegenerativos que se caracteriza por perdida progresiva de fuerza en los miembros inferiores con espasticidad. Esto se debe a una lesion axonal en los haces corticoespinales. La de tipo 1, conocida como SPG1, es la forma mas comun de PEH ligada al cromosoma X. Esta se produce por una mutacion en el gen de la molecula de adhesion celular L1 (L1CAM). La SPG1 se manifiesta con el sindrome CRASH (corpus callosum hypoplasia, retardation, adducted thumbs, spasticity and hydrocephalus). Casos clinicos. Tres varones, dos hermanos y un primo (materno), con un cuadro clinico de discapacidad intelectual, paraparesia espastica, piramidalismo, dismorfias faciales y pulgares en aduccion. La neuroimagen mostro agenesia del cuerpo calloso y ventriculomegalia en los tres. Los estudios neurofisiologico y metabolico fueron normales. El estudio genetico evidencio en todos ellos una mutacion concreta en el gen L1CAM (Xq28). Conclusion. Se describen los hallazgos clinicorradiologicos de tres varones afectos de sindrome CRASH por mutacion c.516G>A en el exon 5 del gen L1CAM. Estos parecen ser los primeros casos descritos en España segun la bibliografia actual. Recomendamos sospechar este sindrome cuando se asocian paraparesia espastica, discapacidad intelectual y pulgares aductos.

  11. Parasite communities of the neotropical cormorant Phalacrocorax brasilianus (Gmelin) (Aves, Phalacrocoracidae) from two coastal lagoons in Guerrero state, Mexico.

    PubMed

    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín; Flores-Garza, Rafael; Larumbe-Morán, Edvino

    2011-11-01

    The parasite community structure of the neotropical cormorant, Phalacrocorax brasilianus, from two lagoons (Coyuca and Tres Palos) from Guerrero state, México, was examined. Fourteen species of adult helminths (6,391 individuals) from 48 cormorants were identified: 9 digeneans, 1 acanthocephalan, 1 cestode, and 3 nematodes. A total of 11 species were collected in Coyuca Lagoon and 12 in Tres Palos Lagoon. Nine species co-occurred in cormorants of both lagoons but, with the exception of Contracaecum multipapillatum and Drepanocephalus olivaceus, species were not equally common in both lagoons. The prevalence values of six species of helminth and the mean abundance of four species varied significantly between lagoons, and C. multipapillatum was numerically dominant in both lagoons. The qualitative similarity between the two communities at the component level was 64%. All cormorants examined were infected, and parasite species richness was 3-5 in Coyuca and 4-9 in Tres Palos lagoon. The results indicate that both communities presented a similar structure at the component level, probably because the cormorants of both lagoons feed on the same species of fish and thus acquire almost the same species of parasites. Differences observed at the infracommunity level were attributed to variations in the degree of dominance of the particular species.

  12. Identification of thyroid hormone response elements in vivo using mice expressing a tagged thyroid hormone receptor α1.

    PubMed

    Dudazy-Gralla, Susi; Nordström, Kristina; Hofmann, Peter Josef; Meseh, Dina Abdul; Schomburg, Lutz; Vennström, Björn; Mittag, Jens

    2013-03-13

    TRα1 (thyroid hormone receptor α1) is well recognized for its importance in brain development. However, due to the difficulties in predicting TREs (thyroid hormone response elements) in silico and the lack of suitable antibodies against TRα1 for ChIP (chromatin immunoprecipitation), only a few direct TRα1 target genes have been identified in the brain. Here we demonstrate that mice expressing a TRα1-GFP (green fluorescent protein) fusion protein from the endogenous TRα locus provide a valuable animal model to identify TRα1 target genes. To this end, we analysed DNA-TRα1 interactions in vivo using ChIP with an anti-GFP antibody. We validated our system using established TREs from neurogranin and hairless, and by verifying additional TREs from known TRα1 target genes in brain and heart. Moreover, our model system enabled the identification of novel TRα1 target genes such as RNF166 (ring finger protein 166). Our results demonstrate that transgenic mice expressing a tagged nuclear receptor constitute a feasible approach to study receptor-DNA interactions in vivo, circumventing the need for specific antibodies. Models like the TRα1-GFP mice may thus pave the way for genome-wide mapping of nuclear receptor-binding sites, and advance the identification of novel target genes in vivo.

  13. Identification of thyroid hormone response elements in vivo using mice expressing a tagged thyroid hormone receptor α1

    PubMed Central

    Dudazy-Gralla, Susi; Nordström, Kristina; Hofmann, Peter Josef; Meseh, Dina Abdul; Schomburg, Lutz; Vennström, Björn; Mittag, Jens

    2013-01-01

    TRα1 (thyroid hormone receptor α1) is well recognized for its importance in brain development. However, due to the difficulties in predicting TREs (thyroid hormone response elements) in silico and the lack of suitable antibodies against TRα1 for ChIP (chromatin immunoprecipitation), only a few direct TRα1 target genes have been identified in the brain. Here we demonstrate that mice expressing a TRα1–GFP (green fluorescent protein) fusion protein from the endogenous TRα locus provide a valuable animal model to identify TRα1 target genes. To this end, we analysed DNA–TRα1 interactions in vivo using ChIP with an anti-GFP antibody. We validated our system using established TREs from neurogranin and hairless, and by verifying additional TREs from known TRα1 target genes in brain and heart. Moreover, our model system enabled the identification of novel TRα1 target genes such as RNF166 (ring finger protein 166). Our results demonstrate that transgenic mice expressing a tagged nuclear receptor constitute a feasible approach to study receptor–DNA interactions in vivo, circumventing the need for specific antibodies. Models like the TRα1–GFP mice may thus pave the way for genome-wide mapping of nuclear receptor-binding sites, and advance the identification of novel target genes in vivo. PMID:23398480

  14. [Alcohol consumption and adolescence: a descriptive epidemiological study].

    PubMed

    Alonso Hernández, J; Rosado Martín, J; Ruiz-Morote Aragón, R; Alonso Fernández, J

    1997-03-15

    To determine the consumption of alcoholic drinks among adolescents in Tres Cantos and its defining characteristics. A descriptive, cross-sectional study. State schools in Tres Cantos. All the students present (994) who had registered for the 1994-95 year. A self-filled anonymous questionnaire was answered in the class-rooms of the schools in Tres Cantos during May 1995. The relationship between the variables was worked out using the computer programme EPI-INFO (version 5.01). 73.1% of those polled consumed alcoholic drinks. There were no significant differences for gender. Most consumption was at the weekend. The commonest drink was wine and its combinations, followed by beer, rum or gin and coke, spirits and fizzy drinks. The CAGE test was positive in 14.1% of cases. 59.6% had got drunk on some occasion, 89.3% consumed alcohol for the first time before they were 16, which most did outside the home. There was a significant association between participating in religious activities and less alcohol consumption. The percentage of alcohol consumers among students is high. It is characterised by being similar in both sexes, starting at an early age and clear predominance of consumption at weekends and outside the home. Wine and its combinations is the commonest drink.

  15. [The Prefrontal Symptoms Inventory (PSI) in acquired brain injury: agreement between the scores of patients, relatives and professionals].

    PubMed

    Huertas-Hoyas, E; Pedrero-Perez, E J; Martinez-Campos, M; Laselle-Lopez, M

    2016-11-01

    Introduccion. El uso de autoinformes sobre sintomas de mal funcionamiento en la vida diaria derivados de deficits funcionales de origen prefrontal se ha generalizado en la practica clinica, dado que permiten aportar validez ecologica incremental a otras pruebas especificas. Sin embargo, queda por determinar si la autoevaluacion es suficiente por si misma o es preferible la participacion de un evaluador externo. Sujetos y metodos. Se administro el inventario de sintomas prefrontales (ISP) a 115 sujetos en tratamiento por diversas patologias cerebrales. La misma prueba, referida al paciente, se administro a algun profesional que siguiera estrechamente la evolucion del caso y, cuando fue posible (n = 88), a un familiar o cuidador. Se exploro la bondad psicometrica del ISP en las tres muestras y se estimo el grado de correlacion y concordancia entre las tres evaluaciones. Resultados. Las tres evaluaciones mostraron correlacion significativa, aunque los pacientes declararon menos sintomas que sus familiares y cuidadores en funcionamiento ejecutivo. Las evaluaciones de familiares y pacientes se superpusieron y mostraron un alto grado de concordancia en perfil y magnitud. Conclusiones. Se recomienda, junto con la obligada evaluacion neuropsicologica, la cumplimentacion de cuestionarios o inventarios de sintomas como el ISP, con probada robustez psicometrica, que permitan explorar el impacto de las disfunciones cerebrales en el funcionamiento cotidiano. Dado que muchas de estas disfunciones se acompañan de diversos grados de anosognosia, se recomienda su administracion a observadores externos, familiares o profesionales, de cara a obtener una evaluacion mas adecuada de la magnitud de las dificultades funcionales.

  16. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference.

    PubMed

    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin

    2016-06-22

    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice.

  17. [Description of the follow-up protocol for idiopathic intracranial hypertension in the neuro-ophthalmological unit of a tertiary hospital].

    PubMed

    González-Hernández, Ayoze; Tandón-Cárdenes, Luis; Cabrera-Naranjo, Fernando; Guzmán-Fernández, María; Fabre-Pi, Óscar; López-Veloso, Carolina

    2013-05-16

    Objetivo. Revisar los resultados de la implantacion de un protocolo de seguimiento de pacientes con hipertension intracraneal idiopatica (HICI) en una unidad de neurooftalmologia (UNO). Pacientes y metodos. Se realizo una revision bibliografica para determinar las exploraciones necesarias que debian incluirse en el protocolo de seguimiento, asi como la frecuencia optima de las visitas y la duracion adecuada del seguimiento. Posteriormente, se revisaron de forma prospectiva los pacientes incluidos desde la creacion de la UNO y se compararon con los pacientes incluidos en el registro de HICI previo a la creacion de la UNO. Resultados. Desde la implantacion del protocolo, en el 100% de los pacientes se ha valorado la agudeza visual y la campimetria visual a los tres meses, a los seis meses y al ano del diagnostico. Ademas, en un 91%, 72,8% y 100% de los pacientes con HICI se realizo una campimetria visual a los tres meses, a los seis meses y al ano del diagnostico, respectivamente. Antes de la implantacion de nuestro protocolo de seguimiento, se habian realizado 190, lo que corresponde a unas tres por paciente. El numero de punciones lumbares realizadas desde la creacion de la UNO es de 11. Conclusiones. La creacion de una UNO multidisciplinar permite optimizar los recursos y mejorar la asistencia a los pacientes con HICI. Esto deberia redundar en una mejoria del pronostico funcional de estos pacientes.

  18. Supplement to the site observational work plan for the UMTRA Project Site at Ambrosia Lake, New Mexico

    SciTech Connect

    1996-02-01

    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of (1) the average linear velocity of the ground water in the alluvium; (2) the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale; and (3) the fate and transport of contaminants from the uppermost aquifer to the Westwater Canyon Member of the Morrison Formation. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Shale unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. Figure 1 is a geologic cross section depicting the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Table 1 presents hydrogeologic information of each hydrostratigraphic unit.

  19. Improvement of the Spatial Amplitude Isotropy of a ^4He Magnetometer Using a Modulated Pumping Beam

    NASA Astrophysics Data System (ADS)

    Chéron, B.; Gilles, H.; Hamel, J.; Moreau, O.; Noël, E.

    1997-08-01

    Optically pumped magnetometers are scalar magnetometers. Contrary to vectoriel magnetometers, they measure the total magnetic field whatever the direction of the sensor. However, for some orientations of the magnetometer with respect to the magnetic field direction, the resonant signal vanishes and the measurement is impossible. In this paper we present a simple solution to reduce the amplitude spatial anisotropy and apply it to a ^4He magnetometer developed in our Laboratory. Les magnétomètres à pompage optique sont des magnétomètres scalaires. Contrairement aux magnétomètres vectoriels, ils mesurent le module du champ magnétique quelle que soit l'orientation du capteur dans l'espace. Cependant, pour certaines orientations du magnétomètre par rapport à la direction du champ à mesurer, l'amplitude du signal de résonance s'annule et la mesure devient impossible. Dans cet article, nous présentons une solution simple pour réduire l'anisotropie spatiale d'amplitude et nous l'appliquons à un magnétomètre à hélium-4 développé dans notre Laboratoire.

  20. [In vitro effect of the S3Pvac vaccine against cysticercosis in human mononucleate cells].

    PubMed

    Díaz-Orea, María Alicia; Mijares, José Miguel; Arcega, Raúl; Gómez-Conde, Eduardo; Castellanos-Sánchez, Víctor Omar; Briones-Rojas, Rosendo; Flores-Alonso, Juan Carlos; Marín-Briones, Miguel Ángel; Santos-López, Gerardo

    2013-05-01

    Introduccion. La neurocisticercosis (NCC) es una infeccion parasitaria generada por el establecimiento de cisticercos de Taenia solium en el sistema nervioso central. La fase larvaria del parasito tambien afecta al cerdo, que es el huesped intermediario indispensable para la transmision. Por tal motivo, muchos investigadores se han enfocado en identificar antigenos protectores para prevenir la cisticercosis porcina e interrumpir la transmision. Entre ellos figuran los antigenos de la vacuna S3Pvac, constituida por tres peptidos protectores: KETc1, KETc12 y GK1. Objetivo. Evaluar el efecto de los peptidos vacunales KETc1, KETc12 y GK1 en celulas mononucleares de pacientes con NCC e individuos sanos. Sujetos y metodos. Estudio comparativo, prospectivo y transversal. Se analizo la proliferacion y el perfil de citocinas inducidos por los tres peptidos en celulas mononucleares de tres pacientes con NCC activa, 16 pacientes con NCC calcificada y 16 sujetos sanos. Resultados. KETc1 induce bajos niveles de proliferacion en las celulas de los pacientes con NCC activa y controlada, tanto en linfocitos como en monocitos. KETc12 y GK-1 inducen niveles positivos de proliferacion de monocitos en sujetos sanos. Conclusiones. El peptido KETc1 podria usarse como coadyuvante en el tratamiento de los pacientes con NCC activa, ya que indujo una respuesta Th2; y el peptido GK1, como estimulador del monocito/macrofago en inmunizaciones con otras proteinas.

  1. Functional characterization of three trehalase genes regulating the chitin metabolism pathway in rice brown planthopper using RNA interference

    PubMed Central

    Zhao, Lina; Yang, Mengmeng; Shen, Qida; Liu, Xiaojun; Shi, Zuokun; Wang, Shigui; Tang, Bin

    2016-01-01

    RNA interference (RNAi) is an effective gene-silencing tool, and double stranded RNA (dsRNA) is considered a powerful strategy for gene function studies in insects. In the present study, we aimed to investigate the function of trehalase (TRE) genes (TRE 1-1, TRE 1-2, and TRE-2) isolated from the brown planthopper Nilaparvata lugens, a typical piercing-sucking insect in rice, and investigate their regulating roles in chitin synthesis by injecting larvae with dsRNA. The results showed that TRE1 and TRE2 had compensatory function, and the expression of each increased when the other was silenced. The total rate of insects with phenotypic deformities ranged from 19.83 to 24.36% after dsTRE injection, whereas the mortality rate ranged from 14.16 to 31.78%. The mRNA levels of genes involved in the chitin metabolism pathway in RNA-Seq and DGEP, namely hexokinase (HK), glucose-6-phosphate isomerase (G6PI) and chitinase (Cht), decreased significantly at 72 h after single dsTREs injection, whereas two transcripts of chitin synthase (CHS) genes decreased at 72 h after dsTRE1-1 and dsTREs injection. These results demonstrated that TRE silencing could affect the regulation of chitin biosynthesis and degradation, causing moulting deformities. Therefore, expression inhibitors of TREs might be effective tools for the control of planthoppers in rice. PMID:27328657

  2. Supplement to the site observational work plan for the UMTRA project site at Ambrosia Lake, New Mexico

    SciTech Connect

    1995-11-01

    The purpose of this document is to provide additional and more detailed information to supplement review of the site observational work plan (SOWP) (DOE, 1995) for the Ambrosia Lake, New Mexico, Uranium Mill Tailings Remedial Action (UMTRA) Project site. This document includes a discussion of the average linear velocity of the ground water in the alluvium and a discussion of the ground water quality of the alluvium, weathered Mancos Shale, and the Tres Hermanos-C Member of the Mancos Shale. The data from a 1989 aquifer test were analyzed using the curve-matching software AQTESOLV and then compared with the original results. A hydrograph of the ground water elevations in monitoring wells screened in the alluvium is presented to show how the ground water elevations change with time. Stiff and Piper diagrams were created to describe the changes in ground water geochemistry in the alluvium/weathered Mancos Sahel unit, the Tres Hermanos-C Sandstone unit, the Tres Hermanos-B Sandstone unit, and the Dakota Sandstone. Background information on other related topics such as site history, cell construction, soil characteristics, and well construction are presented in the SOWP. A geologic cross section depicts the conceptual model of the hydrostratigraphy and ground water chemistry of the Ambrosia Lake site. Hydrogeologic information of each hydrostratigraphic unit is presented.

  3. Spatially explicit exposure assessment for small streams in catchments of the orchard growing region `Lake Constance

    NASA Astrophysics Data System (ADS)

    Golla, B.; Bach, M.; Krumpe, J.

    2009-04-01

    drift values in the authorization procedure for plant protection products, pp. 133-141. In Workshop on risk management and risk mitigation measures in the context of authorization of plant protection products [3] Klein, A. W., Dechet, F., and Streloke, M (2003): Probabilistic Assessment Method for Risk Analysis in the framework of Plant Protection Product Authorisation, Industrieverband Agrar (IVA, 2006), Frankfurt/Main [4] Schulz R, Stehle S, Elsaesser F, Matezki S, Müller A, Neumann M, Ohliger R, Wogram J, Zenker K. 2008. Geodata-based Probabilistic Risk Assessment and Management of Pesticides in Germany, a Conceptual Framework. IEAM_2008-032R [5] Kubiak, R., Hommen, Bach, M., Classen, G. Fent, H.-G. Frede, A. Gergs, B. Golla, M. Klein, J. Krumpe, S. Matetzki, A. Müller, M. Neumann,T. G. Preuss, H. T. Ratte, M. Roß-Nickoll, S. Reichenberger, C. Schäfers, T. Strauss, A. Toschki, M. Trapp, J. Wogram (2009): A new GIS based approach for the assessment and management of environmental risks of plant protection, SETAC EUROPE Göteborg [6] Enzian, S. ,Golla., B. (2006) A method for the identification and classification of "save distance" cropland to the potential drift exposure of pesticides towards surface waters. UBA-Texte [7] Bach, M., Träbing, K. and Frede, H.-G. (2004): Morphological Characteristics of small rivers in the context of probabilistic exposure assessment. Nachrichtenblatt des Deutschen Pflanzenschutzdienstes 56

  4. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B.; Pearson, K.; Biddle, L. I.; Cates, I.; Berube, M.; Thompson, R.; Smith, C.; Teske, J. K.; Hardegree-Ullman, K.; Robertson, A.; Crawfod, B.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K.; Hoglund, S.; Hofmann, R.; Jones, C.; Towner, A. P.; Small, L.; Walker-LaFollette, A.; Sanford, B.; Sagan, T.

    2014-01-01

    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  5. Constraining the Magnetic Fields of Transiting Exoplanets through Ground-based Near-UV Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B. M.; Pearson, K. A.; Biddle, L. I.; Cates, I. T.; Berube, M.; Thompson, R. M.; Smith, C. W.; Teske, J. K.; Hardegree-Ullman, K. K.; Robertson, A. N.; Crawfod, B. E.; Zellem, R.; Nieberding, M. N.; Raphael, B. A.; Tombleson, R.; Cook, K. L.; Hoglund, S.; Hofmann, R. A.; Jones, C.; Towner, A.; Small, L. C.; Walker-LaFollette, A. M.; Sanford, B.; Griffith, C. C.; Sagan, T.

    2013-10-01

    We observed the primary transits of the exoplanets CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-12b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b in the near-ultraviolet photometric band in an attempt to detect their magnetic fields and update their planetary parameters. Vidotto et al. (2011) suggest that the magnetic fields of these targets could be constrained if their near-UV light curves show an early ingress compared to their optical light curves, while their egress remain unaffected. We do not observe this effect in any of our targets, however, we have determined an upper limit on their magnetic field strengths. Our results are consistent with observations of TrES-3b and HAT-P-16b which both have had upper limits on their magnetic fields found using this method. We find abnormally low field strengths for all our targets. Due to this result we advocate for follow-up studies on the magnetic fields of all our targets using other detection methods (such as radio emission and magnetic star-planet interactions) and other telescopes capable of achieving a better near-UV cadence to verify our findings and the techniques of Vidotto et al. (2011). We find that the near-UV planetary radii of all our targets are consistent within error of their optical radii. Our data includes the only published near-UV light curves of CoRoT-1b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-33b, WASP-44b, WASP-48b, and WASP77A-b. We used an automated reduction pipeline, ExoDRPL, to perform aperture photometry on our data. In addition, we developed a modeling package called EXOMOP that utilizes the Levenberg-Marquardt minimization algorithm to find a least-squares best fit and a differential evolution Markov Chain Monte Carlo algorithm to find the best fit to the light curve. To constrain the red noise in both fitting models we used the residual permutation (rosary bead), time-averaging, and wavelet method.

  6. Analyse Statistique des Anisotropies du Fond Diffus Cosmologique

    NASA Astrophysics Data System (ADS)

    Douspis, Marian

    2000-12-01

    Les détections de fluctuations de température du fond diffus cosmologique (CMB pour''Cosmic Microwave Background'' ) s'accumulent depuis près de 10 ans.La connaissance du spectre angulaire des fluctuations nous permet d'avoir accès à la physique de l'universlorsqu'il avait environ100 000 ans et donc de déterminerles paramètres cosmologiques.Ce manuscrit présentedifférentes méthodes statistiques qui permettent de passer de l'information disponible sur les observations du CMB aux paramètres cosmologiques. Après unedescription du CMB au sein du modèle du Big-Bang et de l'inflation, je montre que la méthode de vraisemblance permet d'estimer les puissances en bande ou les paramètres cosmologiques à partir d'une carte ou d'un ensemble de pixels (étude des expériences COBE, MAX et Saskatoon).Ensuite, je décris les méthodes qui permettent d'utiliser les puissances en bandedes observations du CMB publiées dans la littérature pour déterminer les paramètres cosmologiques. Ces méthodes sont plus rapides que l'analyse de vraisemblance mais supposent différentes hypothèses sur lesquelles j'insiste. A partir des analyses de vraisemblance que j'ai effectuées, j'ai pu développé d'une part, uneméthode approximative quipermet de mieuxreproduire la forme de la fonction de vraisemblance, et d'autre part une nouvelle technique pour estimer la qualité d'ajustement des modèles préférés. Ces techniques ont été appliquées sur les données actuelles,incluant les plus récentes BOOMERANG et MAXIMA, pour déterminer les paramètres cosmologiques. Les conclusions sont présentées dans ce mémoire.Enfin, une dernière partie est dédiée à l'expérience ARCHEOPS, expérience ballon basée sur la technologie de Planck.

  7. Phase transitions and reentrant phenomena in liquid crystals having both rigid and flexible intramolecular joints

    NASA Astrophysics Data System (ADS)

    Pyżuk, W.; Górecka, E.; Mieczkowski, J.; Przedmojski, J.

    1992-07-01

    : monocouche et partiellement bicouche. Pour des homologues plus longs dans la série des composés azoxy, on a constaté l'existence d'autres phases smectiques ce qui implique l'apparition, sur les diagrammes des phases, de nouveau points multicritiques, par exemple le point Ad Cd N^re. Sur chaque ligne séparant les phases smectiques A de la phase nématique les transitions sont faiblement du premier ordre ou du deuxième ordre ce qui mène dans certain cas à plus qu'un point tricritique. Sur la ligne A{1} N/A{1} N^re on observe à T_NI/T_AN = 0,834 un simple point tricritique N A{1} — l'apparition des autres dépend du choix des constituants du système binaire. Dans le cas de quatre composés azoxy on a constaté une transition du deuxième ordre entre les phases smectiques partiellement bicouches, Ad et Cd. La transition est accompagnée d'un brusque changement de la chaleur spécifique qui varie linéairement avec la longueur de la queue de la molécule. Pour des homologues suivants de la série des composés azoxy on observe différentes dépendances en température de la distance entre les couches de la phase Ad.

  8. Mixtures of ultracold gases: Fermi sea and Bose-Einstein condensate of lithium isotopes

    NASA Astrophysics Data System (ADS)

    Schreck, F.

    2003-03-01

    régime quantique à très basse température. Le refroidissement est obtenu par évaporation du ^7Li dans un piège magnétique très confinant. Puisque le refroidissement évaporatif d'un gaz de fermion polarisé est impossible, le ^6Li est refroidi sympathiquement par contact thermique avec le ^7Li. Dans une première série d'expériences, les propriétés des gaz quantiques dans les états hyperfins les plus élevés, piégés magnétiquement, sont étudiées. Un gaz de 10^5 fermions a une température de 0,25(5) fois la température de Fermi (T_F) est obtenu. L'instabilité du condensat pour plus de 300 atomes condensés, à cause des interactions attractives, limite la dégénérescence que l'on peut atteindre. Pour s'affranchir de cette limite, une autre série d'expérience est menée dans les états hyperfins bas, piégeable magnétiquement, où les interactions entre bosons sont faiblement répulsives. Les collisions inter-isotopiques permettent alors la thermalisation du mélange. Le mélange d'un condensat de Bose-Einstein (CBE) de ^7Li et d'un mer de Fermi de ^6Li est produit. Le condensat est quasi unidimensionnel et la fraction thermique peut être négligeable. La dégénérescence atteinte correspond à T/T_C=T/T_F=0{,}2(1). La température est mesurée à partir de la fraction thermique des bosons qui disparaît aux plus basses températures, et limite notre précision de mesure. Dans une troisième série d'expérience, les bosons sont transférés dans un piège optique, et placé dans l'état interne |F=1,m_F=1rangle, l'état fondamental pour les bosons. Une résonance de Feshbach est repérée puis exploitée pour former un condensai où les interactions sont ajustables. Quand les interactions effectives entre les atomes sont attractives, on observe la formation d'un soliton brillant de matière. La propagation de ce soliton sans dispersion sur une distance de 1{,}1 mm est observée.

  9. Etude des interdiffusions en phase solide dans le contact Er/GaAs

    NASA Astrophysics Data System (ADS)

    Députier, S.; Guivarc'h, A.; Caulet, J.; Minier, M.; Guérin, R.

    1994-05-01

    de mettre en évidence, en fonction de la température de recuit, plusieurs étapes successives d'interaction correspondant à des mélanges de phases, essentiellement des binaires. Elles dépendent fortement de l'orientation du substrat de GaAs, en particulier l'étape finale des interactions. Sur GaAs (001), seules deux étapes ont été observées : avant 600 ^{circ}C, il n'y a pas d'interaction visible de l'erbium avec le substrat ; celle-ci ne s'amorce qu'à 600 ^{circ}C pour n'évoluer ensuite que faiblement et conduire, à 800 ^{circ}C, à une composition nominale " Er{10}GaAs ", mélange des phases Er5Ga3 + Er + ErAs. Sur GaAs (111), plusieurs étapes d'interaction sont observées : l'erbium réagit avec le substrat dès 400 ^{circ}C (mélange des phases Er5Ga3 + Er), puis l'interaction se poursuit à 600 ^{circ}C (mélange Er5Ga3 + Er + ErAs) avant d'atteindre à 800 ^{circ}C la composition nominale " Er{1,5}GaAs ", constituée d'un mélange de grains des trois binaires ErAs + ErGa2 + Er3Ga5. Il faut noter que le recuit à 800 ^{circ}C n'est pas suffisant pour atteindre le mélange de phases Ga + ErAs qui, selon le diagramme ternaire, devrait être le stade ultime de l'interaction Er/GaAs. L'analyse des interdiffusions Er/GaAs montre que ErAs est le composé " clé " autour duquel pivote l'interaction Er/GaAs. Ce composé apparaît comme un candidat idéal pour la réalisation d'hétérostructures épitaxiées ErAs/GaAs.

  10. Étude par détection de photons des processus électroniques au sein d'une jonction tunnel dans un milieu moléculaire

    NASA Astrophysics Data System (ADS)

    Perronet, K.

    2005-03-01

    'émission à l'interface liquide-solide a été démontrée et le rôle de la fonction diélectrique du solvant mis en évidence. Nous avons ensuite étudié les corrélations temporelles entre les photons émis. Selon le liquide environnant la jonction, les photons peuvent être émis par paquets. Nous relions ce phénomène à la modification structurelle de la jonction induite par la présence d'une molécule et à la différence d'énergie entre ses orbitales frontières. Si elle est assez faible, des chemins tunnel résonants existent et les électrons traversent la barrière par paquets. L'influence d'une couche auto-assemblée sur le substrat est étudiée. Des dérivés de triphénylènes interagissent trop faiblement avec Au(111), mais avec des alcanethiols chimisorbés, la résolution moléculaire est atteinte simultanément sur l'image STM et la carte de photons. Nous montrons que le contraste sur cette dernière provient de la modulation de l'extension spatiale à l'intérieur de la barrière des densités d'état locales due à la liaison S Au. L'élaboration de multicouches organiques est alors envisagée pour observer l'électroluminescence d'une molécule unique, isolée du substrat par les thiols et étudier des corrélations d'origine électronique. Nous avons déjà caractérisé optiquement une telle couche de C{60}.

  11. A CENSUS OF ROTATION AND VARIABILITY IN L1495: A UNIFORM ANALYSIS OF TRANS-ATLANTIC EXOPLANET SURVEY LIGHT CURVES FOR PRE-MAIN-SEQUENCE STARS IN TAURUS

    SciTech Connect

    Xiao Hongyu; Covey, Kevin R.; Lloyd, James P.; Rebull, Luisa; Mandushev, Georgi; O'Donovan, Francis; Slesnick, Catherine

    2012-09-15

    We analyze light curves obtained by the Trans-atlantic Exoplanet Survey (TrES) for a field centered on the L1495 dark cloud in Taurus. The Spitzer Taurus Legacy Survey catalog identifies 179 bona fide Taurus members within the TrES field; 48 of the known Taurus members are detected by TrES, as well as 26 candidate members identified by the Spitzer Legacy team. We quantify the variability of each star in our sample using the ratio of the standard deviation of the original light curve ({sigma}{sub orig.}) to the standard deviation of a light curve that has been smoothed by 9 or 1001 epochs ({sigma}{sub 9} and {sigma}{sub 1001}, respectively). Known Taurus members typically demonstrate ({sigma}{sub orig.}/{sigma}{sub 9}) < 2.0, and ({sigma}{sub orig.}/{sigma}{sub 1001}) < 5, while field stars reveal ({sigma}{sub orig.}/{sigma}{sub 9}) {approx} 3.0 and ({sigma}{sub orig.}/{sigma}{sub 1001}) {approx} 10, as expected for light curves dominated by unstructured white noise. Of the 74 Taurus members/candidates with TrES light curves, we detect significant variability in 49 sources. Adapting a quantitative metric originally developed to assess the reliability of transit detections, we measure the amount of red and white noise in each light curve and identify 18 known or candidate Taurus members with highly significant period measurements. These appear to be the first periods measured for four of these sources (HD 282276, CX Tau, FP Tau, TrES J042423+265008), and in two other cases, the first non-aliased periods (LkCa 21 and DK Tau AB). For the remainder, the TrES measurements typically agree very well ({delta}P < 1%) with previously reported values. Including periods measured at lower confidence for 15 additional sources, we report periods for 11 objects where no previous periods were found, including 8 confirmed Taurus members. We also identify 10 of the 26 candidate Taurus members that demonstrate variability levels consistent with being bona fide T Tauri stars. A

  12. Monitoring Telluric Absorption with CAMAL

    NASA Astrophysics Data System (ADS)

    Baker, Ashley D.; Blake, Cullen H.; Sliski, David H.

    2017-08-01

    Ground-based astronomical observations may be limited by telluric water vapor absorption, which is highly variable in time and significantly complicates both spectroscopy and photometry in the near-infrared (NIR). To achieve the sensitivity required to detect Earth-sized exoplanets in the NIR, simultaneous monitoring of precipitable water vapor (PWV) becomes necessary to mitigate the impact of variable telluric lines on radial velocity measurements and transit light curves. To address this issue, we present the Camera for the Automatic Monitoring of Atmospheric Lines (CAMAL), a stand-alone, inexpensive six-inch aperture telescope dedicated to measuring PWV at the Fred Lawrence Whipple Observatory on Mount Hopkins. CAMAL utilizes three narrowband NIR filters to trace the amount of atmospheric water vapor affecting simultaneous observations with the MINiature Exoplanet Radial Velocity Array (MINERVA) and MINERVA-Red telescopes. Here, we present the current design of CAMAL, discuss our data analysis methods, and show results from 11 nights of PWV measurements taken with CAMAL. For seven nights of data we have independent PWV measurements extracted from high-resolution stellar spectra taken with the Tillinghast Reflector Echelle Spectrometer (TRES) also located on Mount Hopkins. We use the TRES spectra to calibrate the CAMAL absolute PWV scale. Comparisons between CAMAL and TRES PWV estimates show excellent agreement, matching to within 1 mm over a 10 mm range in PWV. Analysis of CAMAL’s photometric precision propagates to PWV measurements precise to better than 0.5 mm in dry (PWV < 4 mm) conditions. We also find that CAMAL-derived PWVs are highly correlated with those from a GPS-based water vapor monitor located approximately 90 km away at Kitt Peak National Observatory, with a root mean square PWV difference of 0.8 mm.

  13. [The atypical developments of rolandic epilepsy are predictable complications].

    PubMed

    Pesántez-Ríos, Gabriela; Martínez-Bermejo, Antonio; Arcas, Joaquín; Merino-Andreu, Milagros; Ugalde-Canitrot, Arturo

    2015-08-01

    Introduccion. Las evoluciones atipicas de la epilepsia rolandica son parte de un espectro clinico de fenotipos variables, idiopaticos, dependientes de la edad y con una predisposicion geneticamente determinada. Objetivo. Estudiar las caracteristicas electroclinicas sugestivas de una evolucion atipica en la epilepsia rolandica. Pacientes y metodos. Se realizo una busqueda retrospectiva de 133 niños diagnosticados de epilepsia focal benigna atipica (EFBA), sindrome de Landau-Kleffner y epilepsia de punta-onda continua durante el sueño (POCS). Se seleccionaron nueve pacientes que, en el trascurso de su epilepsia rolandica, presentaron un cuadro clinico atipico y un patron electroencefalografico (EEG) de estado epileptico electrico durante el sueño (ESES). Resultados. El inicio de la epilepsia rolandica fue, en promedio, a los 5 años. Los pacientes presentaron un empeoramiento clinico y del EEG año y medio mas tarde en promedio. En tres pacientes se observaron caracteristicas de EFBA, y en seis, de POCS. No se encontraron casos de sindrome de Landau-Kleffner. El EEG en vigilia mostro una focalidad centrotemporal izquierda en seis pacientes, y derecha, en tres. Todos los pacientes presentaron un ESES en el EEG de sueño. En tres de ellos se observo un patron atipico de ESES regional. Ademas, se detectaron alteraciones cognitivas y conductuales por deficits en areas especificas del aprendizaje, como lenguaje, memoria, atencion e inquietud. Conclusiones. El inicio precoz de la epilepsia rolandica, la aparicion de nuevas crisis con un incremento en su frecuencia y una focalidad frontocentrotemporal en el EEG, que aumenta en frecuencia, tanto en vigilia como en sueño, son caracteristicas electroclinicas sugerentes de una evolucion atipica.

  14. Seric ion level and its relationship with the symptoms of premenstrual syndrome in young women.

    PubMed

    dos Santos, Larissa Almenara Silva; de Azeredo, Vilma Blondet; Eloy Chaves Barbosa, Diane; Augusta de Sá, Solange

    2013-11-01

    El objetivo del estudio fue evaluar el nivel de iones séricos y su relación con el síndrome premenstrual (PMS) Los síntomas en las mujeres jóvenes. Método: Noventa y tres voluntarios fueron monitoreados durante tres meses. La evaluación del estado nutricional se basa en el índice de masa corporal. Tres "mapas de síntomas diarios" se utilizaron para investigar la frecuencia de los síntomas de SPM. La evaluación bioquímica se realizó en el primer mes de la fase lútea. Los niveles de sodio, de potasio, de calcio, de magnesio se determinaron por métodos colorimétricos. La concentración de hemoglobina y hematocrito se determinaron por métodos convencionales. Resultados: Los síntomas como la ansiedad (1,13, 0,81, 0,66), edema (0,99, 0,51, 0,22 e), depresión (0,58, 0,36, 0,20) y la mastalgia (0,56; 0,35; 0,09) fueron los más evidentes en el ciclo menstrual de lútea y la fase folicular. Un pequeño número de voluntarios presentó hipocalemia (1,4%), hiponatremia (4,22%) y la hipernatremia (7,04%). Sin embargo, el mayor número de los voluntarios presentó menor nivel de calcio (83,09%). La frecuencia de las mujeres anémicas fue alta (24%). Se encontraron asociaciones significativas (P.

  15. [Wernicke's encephalopathy and Caine criteria. Report of six cases].

    PubMed

    Kleinert-Altamirano, Anke Paula Ingrid; Juárez-Jiménez, Humberto

    2014-01-01

    INTRODUCCIÓN: la encefalopatía de Wernicke es un desorden neurológico agudo y reversible debido a deficiencia de tiamina. En el pasado, se reconocía al alcoholismo crónico como una de las principales causas; actualmente se conocen otras condiciones que lo favorecen: nutrición parenteral prolongada, hiperémesis gravídica, anorexia nerviosa, enteritis regional, síndrome de malabsorción, hemodiálisis, diálisis peritoneal y cirugía abdominal extensa, entre otras. CASOS CLÍNICOS: se describen seis pacientes, tres hombres y tres mujeres que tuvieron en común nutrición parenteral total por más de dos meses debido a complicaciones quirúrgicas abdominales que impedían la vía oral. Las manifestaciones clínicas fueron somnolencia, agitación psicomotriz, oftalmoplejía con limitación para la abducción bilateral y nistagmo horizontal; tres pacientes presentaron ataxia y dismetría apendicular. Los hallazgos en la resonancia magnética fueron hiperintensidad en T2 en los colículos superiores, sustancia gris periacueductal, tubérculos mamilares y núcleos dorsomediales del tálamo; así como hiperintensidad en T1 en ambos núcleos lenticulares por depósito de manganeso debido a la nutrición parenteral total.

  16. [Not Available].

    PubMed

    San Mauro Martin, Ismael; Mendive Dubourdieu, Paula; Paredes Barato, Víctor; Garicano Vilar, Elena

    2016-07-19

    Introducción: la tradición de la comida picante desempeña un papel muy importante en el gusto por este tipo de comida y su tolerancia. Las preferencias alimentarias muestran influencia genética y ambiental.Objetivos: estudiar la tolerancia y el gusto por el picante de tres poblaciones, y la influencia hereditaria y del ambiente.Métodos:se realizó una encuesta a 522 sujetos, de tres continentes (Asia, Europa y Latinoamérica) en tres idiomas (español, inglés y chino) a través de Internet. Se realizaron preguntas acerca de la tolerancia al picante, el gusto por los alimentos picantes, su uso, la edad de comienzo de consumo, el gusto del padre y de la madre y si ella lo consumía durante el embarazo y/o lactancia.Resultados: existe diferencia entre el gusto por el picante del hijo y el sexo (p < 0,001), la tolerancia (p < 0,001) y, solo en el sexo femenino, el gusto de la madre por el picante (p < 0,001), su consumo durante el embarazo (p < 0,001) y la lactancia (p = 0,005) y el gusto del padre por el picante (p = 0,003). Existe correlación entre el continente de residencia (p = 0,007) y de nacimiento (p = 0,012) y la tolerancia a los alimentos picantes.Conclusión: la influencia de los progenitores, el género y la composición corporal se relacionaron con gustos y tolerancias diferentes.

  17. [Response to everolimus in patients with giant cell astrocytoma associated to tuberous sclerosis complex].

    PubMed

    Mateos-González, M Elena; López-Laso, Eduardo; Vicente-Rueda, Josefina; Camino-León, Rafael; Fernández-Ramos, Joaquín A; Baena-Gómez, M Auxiliadora; Peña-Rosa, M José

    2014-12-01

    Introduccion. Los astrocitomas subependimarios de celulas gigantes (SEGA) se presentan en el 5-20% de los pacientes con complejo esclerosis tuberosa (CET) y son los tumores cerebrales mas comunes en el CET. Son tumores benignos, de estirpe glioneural, que se desarrollan fundamentalmente en las primeras dos decadas de la vida, en general cercanos al foramen de Monro, y pueden ocasionar hidrocefalia e hipertension intracraneal. Constituyen la principal causa de muerte en el CET. Recientemente, los inhibidores mTOR han demostrado ser una alternativa terapeutica a la reseccion quirurgica. Objetivo. Describir nuestra experiencia con everolimus para el tratamiento de pacientes con SEGA y CET. Pacientes y metodos. Estudio prospectivo de la respuesta de los pacientes con CET y al menos un SEGA en crecimiento. Resultados. Recibieron tratamiento tres mujeres y tres varones con una edad media de 12,3 años. Un paciente habia sido previamente intervenido quirurgicamente por SEGA con hidrocefalia. El diametro maximo medio del SEGA al inicio del tratamiento era de 15,3 mm (rango: 11,3-24,8 mm). Se inicio tratamiento con everolimus, 2,5 mg/dia por via oral en pacientes con superficie corporal < 1,2 m2 y 5 mg/dia en pacientes con superficie corporal > 1,2 m2. Dos pacientes presentaron hipertrigliceridemia; uno, anorexia; otro, un afta; y una paciente, amenorrea. La reduccion media del volumen del SEGA a los tres meses de tratamiento fue del 46%, y la reduccion se mantuvo estable en controles posteriores (6-25 meses). Conclusiones. El tratamiento con everolimus disminuye el tamaño de los SEGA asociados a CET con un perfil de seguridad adecuado, y constituye una alternativa a la cirugia en casos seleccionados.

  18. Relative Motion between the Rivera and North American Plates: Constraints from Focal Mechanisms

    NASA Astrophysics Data System (ADS)

    Suárez, Gerardo; Jaramillo, Said H.; Bandy, William

    2010-05-01

    The direction and velocity of the Rivera Plate in western Mexico relative to the North American plate has been a source of controversy. The southeastern segment of this plate boundary has been the site of one of the largest subduction events observed in Mexico during the last 100 years: the 3 June 1932 earthquake (Mw 8.2). To the northwest of the rupture zone of the 1932 event, however, there are no other known large subduction events, either from the historical or instrumental record. We analyze all focal mechanisms in this northern segment of the plate boundary to define the direction of relative motion between these two plates. The largest event occurred beneath the Tres Marias Escarpment, the earthquake of 4 December 1948. The recomputed magnitude yields Mw 6.4. This event caused widespread damage in a penal colony on the Tres Marias Islands. Although the focal mechanism of the 1948 event is not well constrained, the first arrival data collected shows reverse faulting with P axes oriented in a NE-SW direction. This mechanism coincides with other two fault plane solutions of more recent events. These mechanisms indicate reverse faulting beneath the Tres Marias Escarpment. To the northwest of the Islas Marias, in area where no clear physiographic feature defines the plate limits, we identify a group of strike-slip events, where the E-W trending nodal plane indicates right-lateral motion. These mechanisms suggest that the relative motion between Rivera and North America may be taken up by right-lateral strike slip motion. The accuracy of the locations does not allow to define in detail the geometry of this plate boundary. The slip vectors determined from these focal mechanisms are compared with the flow lines resulting from the various poles of relative motion between Rivera and North America to constrain its location.

  19. Photophysics of a Live-Cell-Marker, Red Silicon-Substituted Xanthene Dye.

    PubMed

    Crovetto, Luis; Orte, Angel; Paredes, Jose M; Resa, Sandra; Valverde, Javier; Castello, Fabio; Miguel, Delia; Cuerva, Juan M; Talavera, Eva M; Alvarez-Pez, Jose M

    2015-11-05

    Dyes with near-red emission are of great interest because of their undoubted advantages for use as probes in living cells. In-depth knowledge of their photophysics is essential for employment of such dyes. In this article, the photophysical behavior of a new silicon-substituted xanthene, 7-hydroxy-5,5-dimethyl-10-(o-tolyl)dibenzo[b,e]silin-3(5H)-one (2-Me TM), was explored by means absorption, steady-state, and time-resolved fluorescence. First, the near-neutral pH, ground-state acidity constant of the dye, pKN-A, was determined by absorbance and steady-state fluorescence at very low buffer concentrations. Next, we determined whether the addition of phosphate buffer promoted the excited-state proton-transfer (ESPT) reaction among the neutral and anion form of 2-Me TM in aqueous solutions at near-neutral pH. For this analysis, both the steady-state fluorescence method and time-resolved emission spectroscopy (TRES) were employed. The TRES experiments demonstrated a remarkably favored conversion of the neutral form to the anion form. Then, the values of the excited-state rate constants were determined by global analysis of the fluorescence decay traces recorded as a function of pH, and buffer concentration. The revealed kinetic parameters were consistent with the TRES results, exhibiting a higher rate constant for deprotonation than for protonation, which implies an unusual low value of the excited-state acidity constant pK*N-A and therefore an enhanced photoacid behavior of the neutral form. Finally, we determined whether 2-Me TM could be used as a sensor inside live cells by measuring the intensity profile of the probe in different cellular compartments of HeLa 229 cells.

  20. Controlled Vocabulary Service Application for Environmental Data Store

    NASA Astrophysics Data System (ADS)

    Ji, P.; Piasecki, M.; Lovell, R.

    2013-12-01

    In this paper we present a controlled vocabulary service application for Environmental Data Store (EDS). The purpose for such application is to help researchers and investigators to archive, manage, share, search, and retrieve data efficiently in EDS. The Simple Knowledge Organization System (SKOS) is used in the application for the representation of the controlled vocabularies coming from EDS. The controlled vocabularies of EDS are created by collecting, comparing, choosing and merging controlled vocabularies, taxonomies and ontologies widely used and recognized in geoscience/environmental informatics community, such as Environment ontology (EnvO), Semantic Web for Earth and Environmental Terminology (SWEET) ontology, CUAHSI Hydrologic Ontology and ODM Controlled Vocabulary, National Environmental Methods Index (NEMI), National Water Information System (NWIS) codes, EPSG Geodetic Parameter Data Set, WQX domain value etc. TemaTres, an open-source, web -based thesaurus management package is employed and extended to create and manage controlled vocabularies of EDS in the application. TemaTresView and VisualVocabulary that work well with TemaTres, are also integrated in the application to provide tree view and graphical view of the structure of vocabularies. The Open Source Edition of Virtuoso Universal Server is set up to provide a Web interface to make SPARQL queries against controlled vocabularies hosted on the Environmental Data Store. The replicas of some of the key vocabularies commonly used in the community, are also maintained as part of the application, such as General Multilingual Environmental Thesaurus (GEMET), NetCDF Climate and Forecast (CF) Standard Names, etc.. The application has now been deployed as an elementary and experimental prototype that provides management, search and download controlled vocabularies of EDS under SKOS framework.

  1. Application of MODIS-ASTER (MASTER) simulator data to geological mapping of young volcanic regions in Baja California, Mexico

    NASA Astrophysics Data System (ADS)

    Dmochowski, Jane Ellen

    Visible, near infrared, short-wave infrared, and thermal infrared multi-channel remote sensing data, MODIS-ASTER (MASTER), are used to extract geologic information from two volcanic regions in Baja California, Mexico: Tres Virgenes-La Reforma Volcanic Region and the volcanic island of Isla San Luis. The visible and near infrared and short-wave infrared data were atmospherically corrected and classified. The resulting classification roughly delineates surfaces that vary in their secondary minerals. Attempts to identify these minerals using ENVI's Spectral Analyst(TM) were moderately successful. The analysis of the thermal infrared data utilizes the shift to longer wavelengths in the Reststrahlen band as the mineralogy changes from felsic to mafic to translate the data into values of weight percent SiO2. The results indicate that the general approach tends to underestimate the weight percent SiO2 in the image. This discrepancy is removed with a "site calibration," which provides good results in the calculated weight percent SiO2 with errors of a few percent. However, errors become larger with rugged topography or low solar angle at the time of image acquisition. Analysis of bathymetric data around Isla San Luis, and consideration of the island's alignment with the Ballenas transform fault zone to the south and volcanic seamounts nearby, suggest Isla San Luis is potentially volcanically active and could be the product of a "leaky" transform fault. The results from the image analysis in the Tres Virgenes-La Reforma Volcanic Region show the La Reforma and El Aguajito volcanic centers to be bimodal in composition and verify the most recent volcanism in the Tres Virgenes region to be basaltic-andesite. The results of fieldwork and image analysis indicate that the volcanic products of the central dome of La Reforma are likely a sequence of welded ash flow tuffs and lavas of varied composition, evidence of its origin as a caldera.

  2. [Effect of lacosamide on the quality of life of patients with epilepsy].

    PubMed

    García-Escrivá, Alexandre; López-Hernández, Nicolás; Llorca, Vanessa; Alfaro, Arantxa; Asensio-Asensio, Montserrat; García, César; Lezcano-Rodas, Miriam; Medrano, Vicente; Palao, Susana

    2014-08-16

    Introduccion. La epilepsia provoca trastornos psiquiatricos en un 20-40% de los pacientes y repercute de forma negativa en su calidad de vida. La lacosamida es un nuevo antiepileptico que se utiliza como terapia añadida en crisis parciales con o sin generalizacion. Objetivo. Hemos realizado un estudio para valorar el impacto de la lacosamida en cuanto a la calidad de vida del paciente con epilepsia. Se han utilizado la escala hospitalaria de ansiedad y depresion (HADS) y la escala de calidad de vida en la epilepsia (QOLIE-10). Se ha valorado la eficacia y la tolerabilidad. Pacientes y metodos. Se recogen prospectivamente pacientes con epilepsia mal controlada y a los que se añade lacosamida. Se realiza una visita basal, a los tres y a los seis meses. Se cumplimentan los cuestionarios y se recaban los datos sobre la epilepsia. Resultados. Se incluyen 31 pacientes, con una edad media de 45,5 ± 17,2 años, un 64,5% varones. El numero de crisis mensuales previas es de 1,6 ± 1,8. La HADS para ansiedad muestra una mejoria significativa a los tres y seis meses. La HADS para depresion refleja una mejoria significativa en los parametros cualitativos. La QOLIE-10 muestra mejoria significativa para el grupo con baja calidad de vida previa a los tres y seis meses. Tras seis meses, el 61,3% de los pacientes presenta una reduccion de las crisis igual o superior al 50%, y el 54,8% esta libre de crisis. El mareo es el efecto secundario mas frecuente (22,8%). El 74,2% continua con el tratamiento. Conclusiones. La lacosamida podria mejorar la ansiedad, depresion y calidad de vida del paciente epileptico con independencia del control de las crisis. La respuesta al tratamiento, la adhesion y los efectos secundarios son similares a estudios previos.

  3. Variability of formulas to assess insulin sensitivity and their association with the Matsuda index.

    PubMed

    Henríquez, Sandra; Jara, Natalia; Bunout, Daniel; Hirsch, Sandra; de la Maza, María Pía; Leiva, Laura; Barrera, Gladys

    2013-01-01

    Objetivo: Evaluar la variabilidad individual de los índices HOMA y QUICKI para resistencia a insulina, utilizando tres muestras de sangre en ayunas obtenidas en un período de 30 minutos. Material y métodos: Se utilizaron datos provenientes de 80 participantes de 41.5 ± 15 años de edad (26 mujeres) a quienes se les efectuó una prueba de tolerancia a glucosa oral para calcular el índice de Matsuda. A cada participante se le tomaron tres muestras de sangre en ayunas en un período de 30 minutos y cuatro muestras a los 30, 60, 90 y 120 minutos después de una carga oral de 75 g de glucosa. En cada muestra se midieron los niveles de insulina y glucosa. Los índices HOMA y QUICKI se calcularon utilizando las nueve combinaciones posibles con las tres muestras obtenidas en ayunas. El índice de Matsuda se calculó utilizando todas las muestras. Resultados: Las medianas de los índices HOMA-IR, HOMA-?, QUICKI y Matsuda fueron 1,9, 117,9, 0,35 and 3,71 unidades arbitrarias, respectivamente. Los coeficientes de variación individual del HOMA-IR, HOMA-??y QUICKI fueron 11,8 (7,8-18,9), 15 (10,2-22,9) and 1,8 (8,8-21,9) %, respectivamente. Comparados con el índice de Matsuda, los valores de R2 para el HOMA-IR, HOMA-??y QUICKI fueron 0,46, 0,2 y 0,71, respectivamente. Conclusiones: De los índices que utilizan muestras en ayunas para determinar resistencia a insulina, el QUICKI es el que tiene el menor coeficiente de variación y la mejor correlación con el índice de Matsuda.

  4. [Comparison of the cost-utility of direct oral anticoagulants for the prevention of stroke in patients with atrial fibrillation in Spain].

    PubMed

    Monreal-Bosch, M; Soulard, S; Crespo, C; Brand, S; Kansal, A

    2017-03-16

    Introduccion. El apixaban, el dabigatran y el rivaroxaban son tres anticoagulantes orales de accion directa (ACOD) indicados para la prevencion del ictus y la embolia sistemica en pacientes con fibrilacion auricular no valvular (FANV) en España. Objetivo. Comparar el coste-utilidad de los tres ACOD frente a los antivitamina K. Pacientes y metodos. Se utilizo un modelo Markov con ciclos trimestrales para simular pacientes con FANV desde que inician su tratamiento hasta el resto de su vida desde la perspectiva del Sistema Nacional de Salud. El modelo incorporo 36 estados de salud, incluyendo combinaciones de tratamientos, discapacidad y antecedentes de eventos, y considero una cohorte hipotetica de 10.000 pacientes con FANV. La eficacia relativa se calculo a partir de una comparacion indirecta formal de los tratamientos segun los datos de los ensayos pivotales de cada ACOD. Resultados. El dabigatran se asocio al valor maximo de años de vida ajustados por calidad (AVAC) (8,40 AVAC), seguido del apixaban (8,33 AVAC), el rivaroxaban (8,15 AVAC) y el acenocumarol (8,03 AVAC). Los costes totales fueron menores con el acenocumarol (22.230 €), seguido del dabigatran (24.564 €), el apixaban (24.655 €) y el rivaroxaban (25.900 €). La ratio coste-utilidad incremental frente a los antivitamina K fue de 6.397, 8.039 y 29.957 €/AVAC para el dabigatran, el apixaban y el rivaroxaban, respectivamente. Comparados entre ellos, el dabigatran domino al apixaban y al rivaroxaban. Los analisis de sensibilidad confirmaron la robustez del caso base. Conclusiones. Los tres ACOD son coste-efectivos frente al acenocumarol. El dabigatran es economicamente dominante frente al rivaroxaban y al apixaban en España, al ser mas efectivo y menos costoso.

  5. La Vie Politique sous la Restauration a Travers ’Le Rouge et le Noir’ de Stendahl (The Political Life during the Restauration as Depicted in Le Rouge et le Noir by Stendahl)

    DTIC Science & Technology

    1989-01-01

    Valenod et Moirod, qul hissent le drapeau lib6ral uniquenient pour aznoIiorer leurs propres 20 conditions. Ils n’ont ni souci pour les paysans ni... propre benefice. Le lecteur est introduit a M. Valenod tres t~t dans le livre. 11 est le directeur du depot de mendicit6 A Verrlieres qui craint la visite... propres desse ins. Le groupe de vrais lib~t-aux stendhal lens comprend Fouqu6 qui est le bon ami de Julilen Sorel , le phi losophe Saint- Giraud. et

  6. Les rivières et les sources de la Plaine du Cul-de-Sac: extrait du rapport sur les eaux souterraines de la Plaine du Cul-de-Sac

    USGS Publications Warehouse

    Taylor, George C.; Lemoine, Rémy C.

    1949-01-01

    Les principales rivières de la Plaine du Cul-de-Sac, la Rivière Grise ou Grande Rivière du Cul-de-Sac et la Rivière Blanche, prennent naissance sur le flanc Nord du Massif de la Selle à des altitudes de 1,300 à 1,800 mètres au dessus du niveau de la mer. Elles coulent à l’amont à travers des gorges profondes et sont éloignées de 9 Kms. dans la partie central de la bordure Sud de la plaine.

  7. [Glycemic control through physical exercise in type 2 diabetes systematic review].

    PubMed

    Quílez Llopiz, Pablo; Reig García-Galbis, Manuel

    2015-04-01

    INTRODUCCIÓN: En España, cerca del 14% de la población es diabética y el 95% corresponde a Diabetes Mellitus tipo 2. Un pobre control glucémico provoca un aumento de la morbilidad y mortalidad. Tres son los pilares en el tratamiento de la DM2: la dieta, la medicación y el ejercicio físico, sin embargo, el potencial de la prescripción de entrenamiento físico no ha sido totalmente explotado.

  8. The GROUnd-based Secondary Eclipse project - GROUSE

    NASA Astrophysics Data System (ADS)

    de Mooij, Ernst; de Kok, Remco; Nefs, Bas; Brogi, Matteo; Snellen, Ignas

    2011-11-01

    Secondary eclipse observations of exoplanets at near-infrared wavelengths are important to constrain the energy budgets of hot-Jupiters, since they probe the radiation from the planet's atmosphere at the peak of the spectral energy distribution. Since this wavelength range is accesible from the ground, we have started the GROUnd-based Secondary Eclipse (GROUSE) project. As part of the GROUSE project, we target a sample of hot-Jupiters at near-infrared and optical wavelengths. Planets include TrES-3b, HAT-P-1, WASP-18b and WASP-33b.

  9. Una visita en Sud America

    NASA Astrophysics Data System (ADS)

    1982-09-01

    Oisfrute de una estadfa en el Hotel La Silla, el mejor hotel de Sud America con su tan unica atmosfera extraterrestre! Los espera su calificado personal de experimentados hoteleros, jefes de cocina, etc., ansiosos todos de satisfacer sus deseos hasta el mas mfnimo detalle. Naturalmente nuestro espacioso restaurant de tres estrellas ofrece un completo surtido de exquisitas comidas y deliciosos tragos (conocedores usualmente eligen "Oelicia Orion" 0 "Centauro Especial"). EI servicio cempleto durante 24 horas incluye nuestra ya mundialmente famosa "Cena de medianoche para los miradores de estrellas", por eso - no olvide: No pierda la oportunidad de una estadfa en EL HOTEL LA SILLA - una experiencia maravillosa!

  10. A Directory of European, Middle Eastern, and N. African Coastal Ground Control Points for Mapping Satellite Images

    DTIC Science & Technology

    1984-03-15

    SANGUINAIRES C. DI MURO LONGITUDE + E. -W 11.109 9.i|05 8.933 8.725 8.533 8.595 8.652 LATITUDE N ^42.240 ^3.028 i|2.546 i(2.591 il2.372 ill...F-1 Z-3 *F-1 Z-3 47 SACLANTCEN SM-170 I. RACHGOUN 0 R 0 C C 0 C. DE AGUA C. TRES FORCAS S P A I I. DE ALBORAN W.TIP 0 R 0 C C 0 MORRO

  11. Pasado, presente y futuro de la epidemiología. Una perspective latinoamericana

    PubMed Central

    Morabia, Alfredo

    2015-01-01

    Este artículo intenta contestar tres preguntas. Sobre el pasado: ¿Por qué no existió una epidemiología precolombina? Sobre el presente: ¿Cuáles son los orígenes de la epidemiología moderna, incluyendo sus raíces sudamericanas? Y sobre el futuro, escogí un título surrealista para enfatizar el hecho que estoy consciente de que es siempre delicado hacer predicciones: ¿Por qué fenómenos complejos son los “objetos oscuros del deseo” epidemiológico? PMID:25124247

  12. Experimental Investigation of Combustion Stabilization in Supersonic Flow Using Free Recirculation Zones

    DTIC Science & Technology

    1997-08-01

    mixture varies greatly over the volume of flow). Residence time can be roughly estimated by equation [9,15-17] tres =k h/ue where k= 30-50, h is...1400 K and M=2.5 gives ue=1000 m/s. We would like to point out that value of k=50 in the last equation was the result of experiment [16], where...generator, distance between the vortex generator and the diffuser, throttling intencity . Besides, the influence of air or hydrogen injection through out the

  13. Assessment of the potential of the new Belgo-Moroccan telescope TRAPPIST-North for high-precision exoplanet transit photometry

    NASA Astrophysics Data System (ADS)

    Barkaoui, K.; Gillon, M.; Benkhaldoun, Z.; Emmanuel, J.; Elhalkouj, T.; Daassou, A.; Burdanov, A.; Delrez, L.

    2017-06-01

    We present the observation of a transit of the exoplanet TrES-3b by the newly commissioned robotic telescope TRAPPIST-North located at Oukaimeden Observatory (Morocco). The obtained light curve reaches a photometric precison 600 ppm. Its Bayesian analysis with a Markov Chain Monte Carlo code enables us to refine the radius of the planet to {R}p={1.346}-0.050+0.065{R}Jup. These results demonstrate the high potential of TRAPPIST-North for high-photometry of exoplanet transits.

  14. Special Course on Acoustic Wave Propagation

    DTIC Science & Technology

    1979-08-01

    l.Recipient’s Reference 2.Originator’s Reference 3.Further Reference 4.Security Classification of Document AGARD-R-686 ISBN 92-835-0248-5 UNCLASSIFIED 5...3L t’acoustique eat d’Ariatote (384-322 av. .Y.C.) qui a effectud una classification des diffdrentes branches de l’acoustique en cansacrant une part...silence a cotia- tique at balistique. DepuiS la econde guerre mondiale de tres nombreux travaux Sur la propagation acoustique dans les fluides et das

  15. CONFERENCE Proceedings of the computer Aided System Design and Simulation (50th) Held in Cesme/Ismir, Turkey on 22-25 May 1990 (Systeme de Conception Aide par Ordinateur et Simulation)

    DTIC Science & Technology

    1990-05-01

    plusieurs mod..Mos de type ’entr&e/sortie’ adapt~s essentiellement aux parain~tres que devait contro1er P’algorithme. (figure. ~ j euvironnement...D ’ACTION Les diff~rentes 6tapes qui ont marq ue notre 6tude sont essentiellement : -l’introduction d’une constante dans le mod~le (biais) -Ia n...premier objectif de la simulation 6tait de dimensionner le capteur. Les points essentiels qui ressortent de I𔄀tude param~trique sont les suivants

  16. Methods for Scaling to Doubly Stochastic Form,

    DTIC Science & Technology

    1981-06-26

    BIRKHOFF, G.: Tres observaciones sobre le algebra lineal , Rev. univ. nec. Tucuman, ser A, . 147-151, [1948] BRUALDI, R.A., S.V. PARTER, and H. SCHNEIDER...scaling square, nonnegative matrices to dou- bly stochastic form are described. A generalized version of the convergence theorem in SINKI-ORN and KNOPP... matrices D and E for a given square nonnegative matrix, A, such that DAE is doubly stochastic--or determine that such :.p h" du:es 7’. -,.xist. A

  17. An Assessment of the Options Available to Air Forces’ Commanders to Suppress Smoke from Oil Well Fires

    DTIC Science & Technology

    1992-09-22

    well, it has a telescopic appearance with each successive casing going from the surface deeper into the earth (Figure 1). When looking at a cross...bottom and back up the outside of the pipe, all the way to the surface of the earth where it is allowed to harden. This effectively attaches the casing...to the surrounding earth (Simms, 1991). Next, a 16-inch drill is lowered into the casing to bore through the plug and the 10 To Chrilsmas Tres E

  18. Ground-based near-UV observations of 15 transiting exoplanets: constraints on their atmospheres and no evidence for asymmetrical transits

    NASA Astrophysics Data System (ADS)

    Turner, Jake D.; Pearson, Kyle A.; Biddle, Lauren I.; Smart, Brianna M.; Zellem, Robert T.; Teske, Johanna K.; Hardegree-Ullman, Kevin K.; Griffith, Caitlin C.; Leiter, Robin M.; Cates, Ian T.; Nieberding, Megan N.; Smith, Carter-Thaxton W.; Thompson, Robert M.; Hofmann, Ryan; Berube, Michael P.; Nguyen, Chi H.; Small, Lindsay C.; Guvenen, Blythe C.; Richardson, Logan; McGraw, Allison; Raphael, Brandon; Crawford, Benjamin E.; Robertson, Amy N.; Tombleson, Ryan; Carleton, Timothy M.; Towner, Allison P. M.; Walker-LaFollette, Amanda M.; Hume, Jeffrey R.; Watson, Zachary T.; Jones, Christen K.; Lichtenberger, Matthew J.; Hoglund, Shelby R.; Cook, Kendall L.; Crossen, Cory A.; Jorgensen, Curtis R.; Romine, James M.; Thompson, Alejandro R.; Villegas, Christian F.; Wilson, Ashley A.; Sanford, Brent; Taylor, Joanna M.; Henz, Triana N.

    2016-06-01

    Transits of exoplanets observed in the near-UV have been used to study the scattering properties of their atmospheres and possible star-planet interactions. We observed the primary transits of 15 exoplanets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-16b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-12b, WASP-33b, WASP-36b, WASP-44b, WASP-48b, and WASP-77Ab) in the near-UV and several optical photometric bands to update their planetary parameters, ephemerides, search for a wavelength dependence in their transit depths to constrain their atmospheres, and determine if asymmetries are visible in their light curves. Here, we present the first ground-based near-UV light curves for 12 of the targets (CoRoT-1b, GJ436b, HAT-P-1b, HAT-P-13b, HAT-P-22b, TrES-2b, TrES-4b, WASP-1b, WASP-33b, WASP-36b, WASP-48b, and WASP-77Ab). We find that none of the near-UV transits exhibit any non-spherical asymmetries, this result is consistent with recent theoretical predictions by Ben-Jaffel et al. and Turner et al. The multiwavelength photometry indicates a constant transit depth from near-UV to optical wavelengths in 10 targets (suggestive of clouds), and a varying transit depth with wavelength in 5 targets (hinting at Rayleigh or aerosol scattering in their atmospheres). We also present the first detection of a smaller near-UV transit depth than that measured in the optical in WASP-1b and a possible opacity source that can cause such radius variations is currently unknown. WASP-36b also exhibits a smaller near-UV transit depth at 2.6σ. Further observations are encouraged to confirm the transit depth variations seen in this study.

  19. Synthesis and infrared properties of ethylenedioxythiophene and octylthiophene based copolymers

    NASA Astrophysics Data System (ADS)

    Buvat, P.; Hourquebie, P.

    1998-06-01

    The control of the structural parameters and doping conditions of PATs lead to quasi-metallic materials. We have developed the synthesis of copolymers and PAT to enhance the metallic properties with conservation of the solubility. Le contrôle des paramètres physico-chimiques des PATs et des conditions de dopage conduit à des matériaux quasi-métalliques. Nous nous sommes ici orientés vers des copolymères du PEDOT et des PATs pour augmenter le caractère métallique tout en conservant les propriétés de solubilité.

  20. Les fluctuations supraconductrices dans le compose praseodyme-cerium-oxyde de cuivre

    NASA Astrophysics Data System (ADS)

    Renaud, Jacques

    Ce travail etudie les fluctuations supraconductrices dans le compose supraconducteur a haute temperature critique dope aux electrons Pr2-xCe xCuO4+delta. La technique utilisee pour sonder ces fluctuations est le transport electrique DC dans le plan ab. Il s'agit, a notre connaissance, de la premiere etude de ce type dans la classe generale des supraconducteurs a haute temperature critique dopes aux electrons et, plus particulierement, dans Pr2-xCe xCuO4+delta. De plus, l'etude est effectuee pour trois regimes de dopage, soit sous-dope x = 0.135, dopage optimal x = 0.15 et surdope x = 0.17. Les echantillons etudies sont des couches minces d'epaisseur plus grande que 100 nm crues par ablation laser. Les mesures electriques DC effectuees dans ce travail sont la resistance en reponse lineaire et les courbes IV en reponse non lineaire en fonction de la temperature. La mise en oeuvre experimentale de ces mesures a necessite une grande attention au filtrage et aux effets de chauffage a haut courant. Nous montrons que, sans cette attention, les donnees experimentales sont toujours erronees dans le regime pertinent pour nos echantillons. Les resultats pour le dopage optimal x = 0.15 sont expliques de facon tres convaincante dans le cadre de fluctuations purement 2D. D'abord, le regime des fluctuations gaussiennes est tres bien decrit par le modele d'Aslamazov-Larkin en deux dimensions. Ensuite, le regime de fluctuations critiques, se trouvant a plus basse temperature que le regime gaussien, est tres bien decrit par la physique 2D de Kosterlitz-Thouless. Dans cette analyse, les deux regimes ont des temperatures critiques coherentes entre elles, ce qui semble confirmer ce scenario 2D. Une analyse des donnees dans le cadre de fluctuations 3D est exploree mais donne des conclusions incoherentes. Les resultats pour les autres dopages sont qualitativement equivalents avec le dopage optimal et permettent donc une explication purement 2D. Par contre, contrairement au dopage optimal

  1. Franchissement du seuil dans un laser monomode : approche phénoménologique à partir des équations d'évolution

    NASA Astrophysics Data System (ADS)

    Boucher, Y.

    2004-11-01

    Nous présentons une étude phénoménologique du franchissement du seuil dans un laser monomode, à partir des équations d'évolution du milieu (assimilé à une collection de systèmes à 2 niveaux ouverts) et du champ optique. Nous obtenons des expressions analytiques universelles en coordonnées réduites, caractérisées par deux paramètres indépendants.

  2. Photometric analysis of the system Kepler-1

    NASA Astrophysics Data System (ADS)

    Budding, E.; Rhodes, M. D.; Püsküllü, Ç.; Ji, Y.; Erdem, A.; Banks, T.

    2016-10-01

    We have applied the close binary system analysis program WinFitter to an intensive study of Kepler-1 (= TrES-2) using all the available photometry (14 quarters; 1570640 measures) from the NASA Exoplanet Archive (NEA) at the Caltech website http://exoplanetarchive.ipac.caltech.edu. The mean individual data-point error of the normalized flux values is 0.00026, leading to the model's specification for the mean reference flux of the system to an accuracy of {˜} 0.5 ppm. Completion of the analysis requires a number of prior quantities, relating mainly to the host star, that are adopted from relevant literature.

  3. La teoria economica y el enfoque Box-Jenkins en la modelizacion de la demanda de productos energeticos: el fuel-oil y la energia electrica en Espana

    NASA Astrophysics Data System (ADS)

    Garcia-Pardo, Maria Jimena

    Esta tesis trata de integrar la teoria economica el enfoque box-jenkins del analisis de series temporales y un conjunto de datos de la economia espanola en un intento de elaborar modelos empiricos de demanda de productos energeticos con especial atencion a la deteccion y medicion de los efectos precio. Se analizan para ello las demandas de tres productos: la energia electrica el fuel - oil utilizado en las centrales termicas para la generacion de electricidad y el fuel - oil no termico. El periodo muestral es el comprendido entre enero de 1970 y diciembre de 1977.

  4. Polycomb/Trithorax response elements and epigenetic memory of cell identity.

    PubMed

    Ringrose, Leonie; Paro, Renato

    2007-01-01

    Polycomb/Trithorax group response elements (PRE/TREs) are fascinating chromosomal pieces. Just a few hundred base pairs long, these elements can remember and maintain the active or silent transcriptional state of their associated genes for many cell generations, long after the initial determining activators and repressors have disappeared. Recently, substantial progress has been made towards understanding the nuts and bolts of PRE/TRE function at the molecular level and in experimentally mapping PRE/TRE sites across whole genomes. Here we examine the insights, controversies and new questions that have been generated by this recent flood of data.

  5. On Retaining the Seat Pack After Ejection when Landing in Trees

    DTIC Science & Technology

    2010-11-01

    option to retain the seat pack for tree landings. This study reviews aeromedical literature and analyses Canadian Forces ejection tree landing...l’équipement de survie contenu dans leur paquetage de siège au bout d’une sangle de 8 mètres pendant leur descente en parachute. Une exception est faite...paquetage en cas d’atterrissage dans les arbres. La présente étude passe en revue la documentation aéromédicale et analyse les cas de blessures à

  6. Recursive Bayesian Method for Tracking a Magnetic Target with a Gradiometer

    DTIC Science & Technology

    2006-09-01

    gradient magnétique donnait lieu à des solutions multiples, et les résultats peuvent être très sensibles au bruit contenu dans les données. Dans la...la solution physique, et les résultats peuvent être très sensibles au bruit contenu dans les données. Description des recherches et résultats...générer la distribution a priori des paramètres inconnus. Pour analyser le système dynamique d’une cible mobile, il faut deux modèles : (i) un

  7. The Uruguayan Armed Forces and the Challenge of 21st Century Peacekeeping Operations

    DTIC Science & Technology

    2005-12-01

    Autorización para hacer escala en Montevideo a tres Unidades de la Armada de Estados Unidos de América. En consideración,” Segundo Período Ordinario de...Cámara de Senadores de la República Oriental del Uruguay, Proyecto de Ley por el que se autoriza la salida de efectivos individuales y de unidades del...www.mercosur.org.uy/pagina1esp.htm. 82 SINOMAPA stands for “ Sistema Nacional de Apoyo a las Operaciones de Mantenimiento de la Paz.” 83 Poder Ejecutivo de la

  8. Physical Measurements of Water Properties Across the Mouth of the Gulf of California during April 2013 (PESCAR24 Cruise) (Mediciones Fisicas de las Propiedades del Agua a Traves de la Boca del Golfo de California Durante Abril de 2013 (Crucero PESCAR24)

    DTIC Science & Technology

    2013-11-26

    ningún datos del CTD disponible en el lance de subida para la estación 11, se utilizó información del Sistema de Adquisición de Datos en Curso (UDAS... sistema de adquisición de datos MK21 con su hardware asociado, los cuales también fueron adquiridos de Lockheed Martin Sippican. La lista de... sistema de agua de mar no contaminada desde un receptáculo situado junto a la quilla del barco, a unos tres metros bajo la superficie. Estos datos

  9. Cellules solaires photovoltaïques plastiques enjeux et perspectives

    NASA Astrophysics Data System (ADS)

    Sicot, L.; Dumarcher, V.; Raimond, P.; Rosilio, C.; Sentein, C.; Fiorini, C.

    2002-04-01

    Après avoir détaillé le fonctionnement d'une cellule photovoltaïque plastique et les paramètres photovoltaïques permettant de caractéiser son efficacité, un état de l'art des technologies de fabrication des cellules est présenté. Des moyens d'amélioration des performances des cellules photovoltaïques organiques sont ensuite illustrés par l'étude de dispositifs développés au Laboratoire Composants Organiques (LCO) du CEA Saclay.

  10. Utilization of signal transduction pathway by the human T-cell leukemia virus type I transcriptional activator tax

    SciTech Connect

    Tan, Tsehua; Jia, R.; Goeder, R.G. )

    1989-09-01

    The human T-cell leukemia virus type I (HTLV-I) trans-activator (tax)-inducible enhancer was localized to three copies of 21-base-pair repeats within the long terminal repeat. Interestingly, the TGACG motif found in the center of the 21-base-pair tax-responsive element (TRE) is also present in the cyclic AMP (cAMP)-responsive elements (CREs) and activating transcription factor (ATF)-binding sites. In this study, the authors demonstrate that the three TRE-binding proteins, TREB-1, TREB-2, and TREB-3, also bind to various CREs and ATF-binding sites and that the TREs can confer upon a heterologous promoter responsiveness to various inducing agents, including tax, cAMP, and E1a. Furthermore, the transcriptional activation of the HTLV-I promoter by tax can be inhibited by several protein kinase inhibitors, including sangivamycin. The results indicate that the TREs, CREs, and ATF-binding sites are similar cis-acting elements and further suggest (i) that the transcriptional activation of the HTLV-I promoter by tax involves the action of a protein kinase an (ii) that induction by tax, cAMP, and E1a might be mediated by distinct factors or kinases.

  11. Thyroid hormone availability and activity in avian species: a review.

    PubMed

    Decuypere, E; Van As, P; Van der Geyten, S; Darras, V M

    2005-07-01

    The intracellular thyroid hormone (TH) availability is influenced by different metabolic pathways. Some of the changes in intracellular TH availability can be linked to changes in local deiodination and sulfation capacities. The secretion of the chicken thyroid consists predominantly of thyroxine (T4). TH receptors (TRs) preferentially bind 3,5,3'-triiodothyronine (T3). Therefore, the metabolism of T4 secreted by the thyroid gland in peripheral tissues, resulting in the production and degradation of receptor-active T3, plays a major role in thyroid function. Food restriction in growing chickens increases hepatic type III deiodinase (D3) levels but decreases growth hormone (GH)-dependent variables such as plasma insulin-like growth factor-I (IGF-I) and T3 concentrations. Refeeding restores hepatic D3 and plasma T3 to control levels within a few hours. It can be concluded that the tissue and time dependent regulation of the balance between TH activating and inactivating enzymes plays an essential role in the control of local T3 availability and hence in TH activity. Two separate genes encode multiple TR isoforms, i.e. TRalpha and TRbeta. These TRs consist of a DNA-binding domain, a ligand-binding domain, a hinge region and an amino-terminal (A/B) domain. TRs mediate their effects on transcription by binding as homodimers or heterodimers to the TH response elements (TREs). Also, unliganded TRs can bind to TREs and may so modulate transcription of target genes.

  12. A strand-specific switch in noncoding transcription switches the function of a Polycomb/Trithorax response element

    PubMed Central

    Trupke, Johanna; Okulski, Helena; Altmutter, Christina; Ruge, Frank; Boidol, Bernd; Kubicek, Stefan; Schmauss, Gerald; Aumayr, Karin; Ruf, Marius; Pospisilik, Andrew; Dimond, Andrew; Senergin, Hasene Basak; Vargas, Marcus L.; Simon, Jeffrey A.; Ringrose, Leonie

    2014-01-01

    Polycomb/Trithorax response elements (PRE/TREs) can switch their function reversibly between silencing and activation, by mechanisms that are poorly understood. Here we show that a switch in forward and reverse noncoding transcription from the Drosophila vestigial (vg) PRE/TRE switches the status of the element between silencing (induced by the forward strand) and activation (induced by the reverse strand). In vitro, both ncRNAs inhibit PRC2 histone methyltransferase activity, but in vivo only the reverse strand binds PRC2. Over-expression of the reverse strand evicts PRC2 from chromatin and inhibits its enzymatic activity. We propose that interactions of RNAs with PRC2 are differentially regulated in vivo, allowing regulated inhibition of local PRC2 activity. Genome-wide analysis shows that strand switching of ncRNAs occurs at several hundred PcG binding sites in fly and vertebrate genomes. This work identifies a novel and potentially widespread class of PRE/TREs that switch function by switching the direction of ncRNA transcription. PMID:25108384

  13. Monkey hybrid stem cells develop cellular features of Huntington's disease

    PubMed Central

    2010-01-01

    Background Pluripotent stem cells that are capable of differentiating into different cell types and develop robust hallmark cellular features are useful tools for clarifying the impact of developmental events on neurodegenerative diseases such as Huntington's disease. Additionally, a Huntington's cell model that develops robust pathological features of Huntington's disease would be valuable for drug discovery research. Results To test this hypothesis, a pluripotent Huntington's disease monkey hybrid cell line (TrES1) was established from a tetraploid Huntington's disease monkey blastocyst generated by the fusion of transgenic Huntington's monkey skin fibroblast and a wild-type non-transgenic monkey oocyte. The TrES1 developed key Huntington's disease cellular pathological features that paralleled neural development. It expressed mutant huntingtin and stem cell markers, was capable of differentiating to neural cells, and developed teratoma in severely compromised immune deficient (SCID) mice. Interestingly, the expression of mutant htt, the accumulation of oligomeric mutant htt and the formation of intranuclear inclusions paralleled neural development in vitro , and even mutant htt was ubiquitously expressed. This suggests the development of Huntington's disease cellular features is influenced by neural developmental events. Conclusions Huntington's disease cellular features is influenced by neural developmental events. These results are the first to demonstrate that a pluripotent stem cell line is able to mimic Huntington's disease progression that parallels neural development, which could be a useful cell model for investigating the developmental impact on Huntington's disease pathogenesis. PMID:20132560

  14. Structure of mycobacterial maltokinase, the missing link in the essential GlgE-pathway

    PubMed Central

    Fraga, Joana; Maranha, Ana; Mendes, Vitor; Pereira, Pedro José Barbosa; Empadinhas, Nuno; Macedo-Ribeiro, Sandra

    2015-01-01

    A novel four-step pathway identified recently in mycobacteria channels trehalose to glycogen synthesis and is also likely involved in the biosynthesis of two other crucial polymers: intracellular methylglucose lipopolysaccharides and exposed capsular glucan. The structures of three of the intervening enzymes - GlgB, GlgE, and TreS - were recently reported, providing the first templates for rational drug design. Here we describe the structural characterization of the fourth enzyme of the pathway, mycobacterial maltokinase (Mak), uncovering a eukaryotic-like kinase (ELK) fold, similar to methylthioribose kinases and aminoglycoside phosphotransferases. The 1.15 Å structure of Mak in complex with a non-hydrolysable ATP analog reveals subtle structural rearrangements upon nucleotide binding in the cleft between the N- and the C-terminal lobes. Remarkably, this new family of ELKs has a novel N-terminal domain topologically resembling the cystatin family of protease inhibitors. By interfacing with and restraining the mobility of the phosphate-binding region of the N-terminal lobe, Mak's unusual N-terminal domain might regulate its phosphotransfer activity and represents the most likely anchoring point for TreS, the upstream enzyme in the pathway. By completing the gallery of atomic-detail models of an essential pathway, this structure opens new avenues for the rational design of alternative anti-tubercular compounds. PMID:25619172

  15. Contrasts between source parameters of M [>=] 5. 5 earthquakes in northern Baja California and southern California

    SciTech Connect

    Doser, D.I. . Dept. of Geological Sciences)

    1993-04-01

    Source parameters determined from the body waveform modeling of large (M [>=] 5.5) historic earthquakes occurring between 1915 and 1956 along the San Jacinto and Imperial fault zones of southern California and the Cerro Prieto, Tres Hermanas and San Miguel fault zones of Baja California have been combined with information from post-1960's events to study regional variations in source parameters. The results suggest that large earthquakes along the relatively young San Miguel and Tres Hermanas fault zones have complex rupture histories, small source dimensions (< 25 km), high stress drops (60 bar average), and a high incidence of foreshock activity. This may be a reflection of the rough, highly segmented nature of the young faults. In contrast, Imperial-Cerro Prieto events of similar magnitude have low stress drops (16 bar average) and longer rupture lengths (42 km average), reflecting rupture along older, smoother fault planes. Events along the San Jacinto fault zone appear to lie in between these two groups. These results suggest a relationship between the structural and seismological properties of strike-slip faults that should be considered during seismic risk studies.

  16. [Genetic isolates and inbreeding customs in three rural municipalities from Honduras].

    PubMed

    Herrera-Paz, Edwin Francisco

    2016-01-01

    Introducción: el método de isonimia ha sido utilizado ampliamente para la determinación de la estructura genética aproximada de las poblaciones humanas. El objetivo del estudio fue evaluar la magnitud del aislamiento genético y las costumbres endogámicas en 57 comunidades de tres municipios rurales de Honduras utilizando las técnicas de isonimia. Métodos: se utilizó el listado de 408 apellidos diferentes utilizados por 20 712 votantes registrados en el Tribunal Supremo Electoral, que residen en las 57 comunidades estudiadas. Para cada comunidad se calcularon los valores de la isonimia aleatoria (IR), no aleatoria (IN) y total (IT) con el fin de evaluar los coeficientes de consanguinidad FST, FIS y FIT. Resultados: se encontró alta consanguinidad debido a aislamiento y a costumbres endogámicas en muchas comunidades. En los tres municipios se observó desviación significativa del comportamiento exógamo típico de otras poblaciones de Honduras. Conclusiones: muchas de las comunidades estudiadas presentan una elevada consanguinidad debido al aislamiento, la segregación étnica y/o costumbres endogámicas.

  17. [Variability in the clinical presentation of Pompe disease: development following enzyme replacement therapy].

    PubMed

    Ley-Martos, Myriam; Salado-Reyes, María J; Espinosa-Rosso, Raúl; Solera-García, Jesús; Jiménez-Jiménez, Luis

    2015-11-01

    Introduccion. La enfermedad de Pompe es un trastorno generalizado progresivo producido por el deficit de la enzima alfa-glucosidasa acida (AGA) de los lisosomas. Se presentan tres casos manifestados de forma muy diferente y tratados con terapia enzimatica sustitutiva (TES), con evolucion favorable. Casos clinicos. Caso 1: varon de 3 meses, con debilidad y rechazo de la alimentacion, hepatomegalia leve, ligera macroglosia e hipotonia, y aumento de las enzimas musculares. Caso 2: varon de 5 meses, con retraso del desarrollo motor, sordera neurosensorial grave, trastornos respiratorios de repeticion de evolucion torpida, hipotonia y leve elevacion de la creatincinasa. Caso 3: varon de 22 años con disnea progresiva, con antecedentes de elevacion de la creatincinasa y las transaminasas, e hipercolesterolemia. Sufrio insuficiencia respiratoria grave que preciso intubacion endotraqueal. La biopsia muscular presento depositos de glucogeno sugestivos de la enfermedad. En los tres casos, el estudio electromiografico dio un patron caracteristico, con descargas pseudomiotonicas, y se confirmo el deficit de AGA en los linfocitos. Se encontro una mutacion en un caso y dos mutaciones en los otros dos. Todos recibieron TES con evolucion favorable: desaparicion de las alteraciones cardiacas en el caso 1, mejoria en los hitos motores en los dos casos infantiles y retirada del respirador en el caso 3. Conclusion. La enfermedad de Pompe tiene una amplia variabilidad en la expresion clinica. La TES consigue una buena respuesta, especialmente en las formas infantiles. La supervivencia a largo plazo de las formas infantiles tratadas permitira conocer mas aspectos del curso de la enfermedad.

  18. [Benign myoclonic epilepsy in infancy: natural history and behavioral and cognitive outcome].

    PubMed

    Domínguez-Carral, Jana; García-Peñas, Juan José; Pérez-Jiménez, M Ángeles; Fournier-Del Castillo, M Concepción; Carreras-Sáez, Inmaculada; Jiménez-Echevarría, Saioa

    2014-02-01

    Introduccion. La epilepsia mioclonica benigna del lactante (EMBL) es un sindrome electroclinico de caracteristicas homogeneas y bien definidas, considerado clasicamente de buen pronostico. Sin embargo, en los ultimos años se han publicado estudios con resultados variables en cuanto a evolucion neuropsicologica. Objetivo. Analizar la evolucion natural y el pronostico neurocognitivo y conductual de los pacientes con EMBL. Pacientes y metodos. Estudio retrospectivo de 10 pacientes con EMBL, con un periodo de seguimiento de mas de cinco años, durante los cuales se realizo una evaluacion neurocognitiva y conductual. Resultados. En el 60% de los pacientes las crisis se controlaron con acido valproico en monoterapia, y el 80% no presento nuevas crisis durante su seguimiento. El cociente intelectual de la cohorte se situo entre 74 y 93; tres pacientes tuvieron un cociente intelectual en rango de inteligencia limite, y seis, en rango de inteligencia media-baja. Nueve pacientes cumplieron criterios de trastorno por deficit de atencion/hiperactividad y dos asociaban otro trastorno del aprendizaje, uno de ellos trastorno de aprendizaje no verbal, y el otro, trastorno especifico de la lectoescritura. Todos los pacientes presentaron datos de pobre coordinacion motriz y visuoespacial, y tres fueron diagnosticados de trastorno de conducta. Conclusiones. El termino 'benigno' en la EMBL debe utilizarse con precaucion en cuanto a su pronostico neurocognitivo y conductual. El inicio precoz y un peor control de las crisis podrian suponer factores de riesgo de evolucion neuropsicologica desfavorable.

  19. Reconnaissance Invariante des Formes avec le Filtre de Fourier-Mellin et un Reseau Neuronique

    NASA Astrophysics Data System (ADS)

    Lejeune, Claude

    Le filtre de Fourier-Mellin est applique a un ensemble d'objets pour generer des vecteurs invariants sous translation, rotation et changement d'echelle. C'est la premiere methode permettant d'obtenir ces trois invariants simultanement. Le calcul des vecteurs invariants est fait numeriquement et optiquement. Les vecteurs ainsi obtenus sont utilises comme entrees dans un reseau neuronique backpropagation pour faire la classification des prototypes qui lui sont presentes. Les dimensions des vecteurs invariants sont tres petites par rapport aux objets d'entree et permettent d'utiliser un reseau possedant un nombre restreint de connexions. Il devient possible d'entrai ner le reseau dans des temps relativement courts sur un ordinateur du type PC. Une fois le reseau entrai ne, nous lui presentons des vecteurs invariants provenant d'objets se retrouvant dans l'ensemble d'entrai nement mais ayant subi des rotations et des changements d'echelle. Ce nouveau groupe represente l'ensemble de rappel. La performance de la methode est tres bonne avec des taux de succes superieurs a 85%.

  20. Estudio ab initio del mecanismo de la reacción HSO + O3

    NASA Astrophysics Data System (ADS)

    Nebot Gil, I.

    La reacción entre el radical HSO y el ozono ha sido ampliamente estudiada desde el punto de vista experimental debido a la importancia que tiene el radical HSO en la oxidación de los compuestos de azufre reductores y a que puede contribuir a la producción de H2SO4 [1-4]. Se realizaron diversos estudios teóricos sobre la cinética de la reacción entre el radical HSO y el ozono. La reacción del HSO con el ozono presenta tres canales diferentes : HSO + O3 &rightarrow &HSO2 + O2 &rightarrow &HS + 2 O2 &rightarrow &SO + OH + O2 La controversia existente entre los grupos experimentales sobre cuál de las tres vías es la predominante, se ha resuelto mediante un estudio teórico de todas ellas utilizando métodos ab initio. La estructura de todos los reactivos, productos, intermedios y estados de transición ha sido optimizada a nivel ab initio utilizando los métodos UMP2 /6-31G** y QCISD/6-31G**.

  1. Molecular identification of the advanced third-stage larvae (ADV L(3)) of Gnathostoma lamothei in Tabasco, Mexico.

    PubMed

    Hernández-Gómez, Raúl Enrique; Martínez-Salazar, Elizabeth Aurelia; López-Jiménez, Serapio; León-Règagnon, Virginia

    2010-03-01

    Advanced third-stage larvae (ADV L(3)) of Gnathostoma spp. were collected from the muscle tissue of three species of freshwater fish (i.e., Gobiomorus dormitor, Petenia splendida, and Parachromis managuensis) in Swamps of Centla, Tabasco, Mexico. Nine sequences of the ITS2 of the ribosomal DNA of Gnathostoma spp. were compared with sequences obtained from GenBank for G. binucleatum, G. lamothei, G. miyazakii, G. spinigerum, and G. turgidum. Sequences of the ADV L(3) from P. splendida (Isla Chinal), P. managuensis (Isla Chinal), and of two of the six larvae collected from G. dormitor (Tres Brazos), were identical to that of G. binucleatum (GenBank). Sequences from the other four larvae from G. dormitor (Tres Brazos) are identical to the sequence of G. lamothei (GenBank). This is the first record of the intermediate host of G. lamothei. The only species documented to cause human gnathostomiasis in the Americas is G. binucleatum. Our finding of G. binucleatum, and G. lamothei parasitizing the commercially important fish species, G. dormitor in Centla swamps, indicates the possibility of G. lamothei causing human gnathostomiasis in Mexico as well. Copyright 2009 Elsevier Ireland Ltd. All rights reserved.

  2. [Prefrontal clinical symptoms in daily living: screening assessment by means of the short Prefrontal Symptoms Inventory (PSI-20)].

    PubMed

    Pedrero-Pérez, Eduardo J; Ruiz-Sánchez de León, José M; Morales-Alonso, Sara; Pedrero-Aguilar, Jara; Fernández-Méndez, Laura M

    2015-05-01

    Introduccion. La estimacion de sintomas cotidianos de disfuncion frontal se considera imprescindible para aportar validez ecologica a las evaluaciones neuropsicologicas. Los cuestionarios disponibles se construyeron para estimar problemas ejecutivos en la vida diaria en poblaciones con daño neurologico. Se requieren instrumentos enfocados a medir estos comportamientos en la poblacion general o en poblaciones clinicas con fallos leves o moderados. Objetivo. Estudiar la validez factorial y encontrar indicios de validez concurrente de la version abreviada del inventario de sintomas prefrontales. Sujetos y metodos. Se obtuvieron tres muestras: la primera, a traves de Internet (n = 504); la segunda, en poblacion no clinica mediante lapiz y papel (n = 1.257), y la tercera, de pacientes en tratamiento por adiccion a sustancias (n = 602). Se utilizo un metodo de analisis factorial sin restricciones sobre la primera muestra y los resultados se sometieron a analisis factorial confirmatorio sobre las otras dos muestras. Resultados. La estructura de tres factores encontrada se confirmo con excelentes indicadores de ajuste en las otras dos muestras. Se hallaron indicios de validez concurrente con pruebas de calidad de vida y salud mental. Conclusiones. Se propone un cuestionario breve para la deteccion de fallos de origen prefrontal en la vida diaria, que mejora las cualidades psicometricas de tests similares, pero orientados a patologias neurologicas graves. La estabilidad estructural de la prueba garantiza la utilidad en la poblacion general, para la deteccion precoz del deterioro cognitivo, y en poblaciones clinicas con deterioro leve o moderado. Se proponen baremos para la interpretacion de resultados.

  3. [In Process Citation].

    PubMed

    Reyna, Nadia; Moreno Rojas, Rafael; Mendoza, Laura; Parra, Karla; Linares, Sergia; Reyna, Eduardo; Cámara Martos, Fernando

    2016-03-25

    Se ha estudiado el índice glicémico, la carga glicémica y el efecto de saciedad producido en adultos jóvenes (12 hombres y 8 mujeres) por el consumo de tres tipos de barritas nutricionales formuladas con proteínas lactoséricas (LS), caseínas (CS) o hidratos de carbono (HC) frente a un control (C). Los valores de glucemia en la sangre a los 30 min fueron significativamente mayores (p < 0,05) para la barra HC (129 ± 8 mg/dl) frente a las barras CS (103 ± 6 mg/dl) y LS (86 ± 8 mg/dl). Asimismo, también se encontraron diferencias estadísticamente significativas (p < 0,05) entre los índices glicémicos de los tres tipos de barras estudiadas (LS = 11,5 ± 3,9; CS = 40,7 ± 6,5; HC = 68,8 ± 13,0). Por otro lado, las barritas nutricionales formuladas con proteínas lácteas (LS y CS) muestran un efecto de saciedad mucho más intenso y prolongado que la formulada con hidratos de carbono (HC), lo que pone de manifiesto el potencial de estas proteínas para ser utilizadas en la formulación de productos para diabéticos y dietéticos.

  4. [Familial microepidemic of food-borne botulism in the Region of Madrid].

    PubMed

    Jalda, D; Junco, A; Alvarez-Moreno, M; Rodero, I; Carneado-Ruiz, J

    2016-07-01

    Introduccion. El botulismo es un sindrome causado por la toxina del bacilo Clostridium botulinum. La toxina actua bloqueando las terminaciones colinergicas presinapticas de la placa motora y del sistema nervioso parasimpatico, y ocasiona una paralisis flacida y un fallo parasimpatico. El modo mas habitual de adquisicion de la enfermedad es por ingesta de toxina preformada presente en las conservas caseras mal esterilizadas, aunque otros mecanismos son posibles. Su incidencia actual en Espana es muy baja. Casos clinicos. Se describen tres miembros convivientes de una familia que presentaron un cuadro de botulismo alimentario. Las manifestaciones clinicas iniciales mostraron predileccion por la paresia ocular y por sintomatologia disautonomica de escasa especificidad, y la agregacion familiar fue el indicio fundamental que sugirio el diagnostico. Posteriormente, los pacientes empeoraron y dos de ellos presentaron afectacion de la funcion respiratoria y precisaron ingreso prolongado en la unidad de cuidados intensivos. Los tres pacientes convalecieron y se recuperaron sin secuelas. Se consiguio detectar la toxina botulinica por bioensayo en los restos de alimentos, lo que confiere al caso la categoria diagnostica de confirmado. Conclusiones. La microepidemia familiar presentada constituye un caso de afectacion inicial predominantemente ocular y disautonomica. Asimismo, ilustra varios aspectos tipicos de la enfermedad: la sospecha diagnostica ante pacientes convivientes que acuden simultaneamente por clinica similar, las complicaciones caracteristicas del proceso y su tratamiento, el diagnostico de laboratorio y su historia natural hacia la resolucion.

  5. [Diffuse superficial siderosis of the central nervous system: four case reports and review of the literature].

    PubMed

    Calvo, Marta; de Miguel, Cristina; Pinel, Ana; Ortega, José M; Aladro, Yolanda

    2014-10-16

    Introduccion. La siderosis superficial difusa del sistema nervioso central (SNC) es una rara condicion debida a depositos de hemosiderina en las capas subpiales del cerebro y la medula espinal. La fuente de sangrado cronico o recurrente en el espacio subaracnoideo se detecta solo en un 50% de los casos. Los sintomas mas caracteristicos son ataxia cerebelosa e hipoacusia neurosensorial. Las secuencias eco de gradiente potenciadas en T2 de resonancia magnetica constituyen el metodo diagnostico de eleccion. Casos clinicos. Presentamos cuatro pacientes con siderosis superficial difusa del SNC relacionada con angiopatia amiloide, anticoagulacion oral, schwannoma del VIII par craneal y sin fuente de sangrado conocida en un caso. Dos pacientes desarrollaron ataxia cerebelosa; tres de ellos, episodios recurrentes de alteracion focal neurologica; uno, demencia; y el cuarto es un hallazgo radiologico. No se objetivo progresion clinica durante el seguimiento (2-11 años) en tres de ellos. El paciente con angiopatia amiloide evoluciono a demencia. Conclusiones. Los episodios recurrentes de alteracion focal neurologica son los sintomas mas frecuentes en nuestros casos de siderosis superficial difusa del SNC. La evolucion natural de esta condicion no se conoce bien y puede constituir un hallazgo radiologico.

  6. Helminth communities of two species of piscivorous birds, Ardea alba (Linnaeus) and Nyctanassa violacea (Gmelin) (Ciconiiformes: Ardeidae), in two coastal lagoons from Guerrero state, Mexico.

    PubMed

    Violante-González, Juan; Monks, Scott; Gil-Guerrero, Salvador; Rojas-Herrera, Agustín A; Flores-Rodríguez, Pedro

    2012-07-01

    The composition and species richness in helminth communities of two species of heron, Ardea alba and Nyctanassa violacea, in two coastal lagoons from Guerrero, Mexico were examined. Nineteen species of helminth (7,804 individuals) were identified in 43 adult birds: 15 digeneans, 1 acanthocephalan, 1 cestode, and 2 nematodes. Eight species co-occurred in herons of both species and lagoons. The prevalence values of seven species and the mean abundance of five species varied significantly between species of birds and between lagoons. The heterophyid, Ascocotyle (Phagicola) longa, was the helminth numerically dominant in the helminth community of A. alba in both lagoons, while the cestode, Parvitaenia cochlearii, dominated the community of N. violacea. At the component community level, species richness varied significantly: 10 species in A. alba from Coyuca to 16 in N. violacea (Tres Palos). All of the birds examined were infected with helminth parasites: three to seven species per host in A. alba from Coyuca, and two to eight species in A. alba and N. violacea from Tres Palos. The results indicate that even though species composition was similar between both species of heron, the structure of their communities was not the same. Differences in the feeding behavior of the birds (day/night habits), as well as local differences in the abundance of species of fish, and infection levels of helminths in each lagoon are suggested as being responsible for the variations registered in the structure of the helminth communities.

  7. Musical structure modulates semantic priming in vocal music.

    PubMed

    Poulin-Charronnat, Bénédicte; Bigand, Emmanuel; Madurell, François; Peereman, Ronald

    2005-01-01

    It has been shown that harmonic structure may influence the processing of phonemes whatever the extent of participants' musical expertise [Bigand, E., Tillmann, B., Poulin, B., D'Adamo, D. A., & Madurell, F. (2001). The effect of harmonic context on phoneme monitoring in vocal music. Cognition, 81, B11-B20]. The present study goes a step further by investigating how musical harmony may potentially interfere with the processing of words in vocal music. Eight-chord sung sentences were presented, their last word being either semantically related (La girafe a un tres grand cou, The giraffe has a very long neck) or unrelated to the previous linguistic context (La girafe a un tres grand pied, The giraffe has a very long foot). The target word was sung on a chord that acted either as a referential tonic chord or as a congruent but less referential subdominant chord. Participants performed a lexical decision task on the target word. A significant interaction was observed between semantic and harmonic relatedness suggesting that music modulates semantic priming in vocal music. Following Jones' dynamic attention theory, we argue that music can modulate semantic priming in vocal music, by modifying the allocation of attentional resource necessary for linguistic computation.

  8. Múltiples estados de desorden en el etanol sólido

    NASA Astrophysics Data System (ADS)

    Fernández-Perea, R.

    El diagrama de fases del etanol por debajo de los 169 K será presentado. Se mostrará que el etanol puede solidificarse en tres fases con diversos niveles de desorden,(como un vidrio(G), como un vidrio orientacional (OG) y como un cristal de fase rotora (RP)) además de en una fase totalmente cristalina. Las estructuras de estas tres fases serán presentadas tal y como se deducen a partir de diversas medidas de difracción de neutrones al igual que las proporciones de los isómeros de dicho material en las fases desordenadas y se compararán con los resultados de la fase cristalina y del líquido superenfriado. Igualmente diversas medidas sobre su dinámica serán presentadas, tanto de dispersión de neutrones, como de capacidad calorífica y de medidas dieléctricas y comparadas con modelos teóricos y simulaciones para tratar de explicar los procesos de relajación observados y las transiciones entre las diversas fases.

  9. Origin of the DUPAL anomaly in mantle xenoliths of Patagonia (Argentina) and geodynamic consequences

    NASA Astrophysics Data System (ADS)

    Mazzucchelli, Maurizio; Cipriani, Anna; Hémond, Christophe; Zanetti, Alberto; Bertotto, Gustavo Walter; Cingolani, Carlos Alberto

    2016-04-01

    The sub-continental lithospheric mantle of South America has been known for some time to carry the DUPAL isotope anomaly as seen in volcanics from the Paraná volcanic province. However, this has not allowed discriminating whether the DUPAL anomaly is a primary feature of the mantle source or acquired during the upwelling and emplacement of the primary magmas. We discovered mantle xenoliths from the Tres Lagos location in Patagonia that carry evidence of percolation by metasomatic melts that imparted the DUPAL isotope anomaly signature. We discuss a model that requires four isotope components (LCC, EM2, HIMU and DM) to account for the Sr, Nd and Pb isotope variability of our samples. We propose that upwelling of hot astenosphere during the Miocene could have triggered the melting of the LCC and EM2 components carrying the DUPAL anomaly, previously entrained in the subcontinental mantle by subduction. These ascending melts would have then metasomatised the local SCLM characterised by DMM and HIMU geochemical affinity generating the hybrid DUPAL-bearing mantle sampled by the Tres Lagos xenoliths.

  10. [Response to treatment with interferon beta in patients with multiple sclerosis. Validation of the Rio Score].

    PubMed

    Rio, J; Rovira, A; Blanco, Y; Sainz, A; Perkal, H; Robles, R; Ramio-Torrenta, Ll; Diaz, R M; Arroyo, R; Urbaneja, P; Fernandez, O; Garcia-Merino, J A; Reyes, M P; Oreja-Guevara, C; Prieto, J M; Izquierdo, G; Olascoaga, J; Alvarez-Cermeno, J C; Simon, E; Pujal, B; Comabella, M; Montalban, X

    2016-08-16

    Introduccion. Se han propuesto diferentes criterios de respuesta al tratamiento con interferon beta, y el Rio Score es uno de los mas utilizados. El objetivo de este estudio fue validar la utilidad del Rio Score en una cohorte independiente. Pacientes y metodos. Estudio multicentrico, prospectivo y longitudinal de pacientes con esclerosis multiple remitente recurrente tratados con interferon beta. Los pacientes fueron clasificados basandose en la presencia de brotes, lesiones activas (nuevas en T2 o lesiones que captaban gadolinio) en la resonancia magnetica, incremento confirmado de la discapacidad o combinaciones de estas variables (brotes, incremento en la Expanded Disability Status Scale y lesiones activas) tras un año de tratamiento. Se utilizo un analisis de regresion con el fin de identificar las variables de prediccion de respuesta despues de un seguimiento de tres años. Resultados. Se incluyo a 249 pacientes con esclerosis multiple remitente recurrente. El modelo logistico confirmo que la presencia de dos (odds ratio = 6,6; IC 95% = 2,7-16,1; p < 0,0001) o tres (odds ratio = 8,5; IC 95% = 1,6-46; p < 0,01) variables positivas durante el primer año de tratamiento conferia un riesgo significativo de actividad (brotes o progresion) en los siguientes dos años. Conclusiones. Se confirma, en una cohorte independiente, la utilidad del Rio Score para identificar a pacientes con un mayor riesgo de desarrollar actividad clinica o progresion de la discapacidad durante el tratamiento con interferon beta.

  11. [Effects of ß-alanine supplementation on wingate tests in university female footballers].

    PubMed

    Rodríguez Rodríguez, Fernando; Delgado Ormeño, Alex; Rivera Lobos, Patricio; Tapia Aranda, Víctor; Cristi-Montero, Carlos

    2014-11-01

    Introducción: El fútbol es un deporte intermitente que desarrolla acciones de alta intensidad usando la vía anaeróbica, por tal razón, la fatiga muscular se produciría principalmente por el aumento de la acidosis. La carnosina, la cual se forma a partir de L-histidina y ß-alanina, ha demostrado producir un efecto “Tampón” sobre la acidosis muscular. Objetivo: Determinar el efecto de la suplementación con ß-alanina, en tres pruebas de Wingate sucesivas, y comparar la potencia media, máxima y el lactato sanguíneo en seleccionadas universitarias de fútbol femenino. Métodos: Se evaluaron 10 jugadoras de futbol, quienes realizaron tres Wingate, descansando 5 min entre cada sprint, determinando la potencia media, máxima y el lactato al final de cada prueba, posteriormente consumieron 2,4 gr/día de ß-alanina por 30 días y se repitieron las pruebas. El grupo control (n=8) realizó las mismas pruebas, pero sin consumir el suplemento. Se usó el cicloergómetro Monark (Ergomedic 874E) y para medir lactato el Lactate Pro 2. Resultados: El grupo con suplementación, mejoró significativamente (p.

  12. Standing balance and trunk position sense in impaired glucose tolerance (IGT)-related peripheral neuropathy.

    PubMed

    Goldberg, Allon; Russell, James William; Alexander, Neil Burton

    2008-07-15

    Type 2 diabetes mellitus (T2DM) and pre-diabetes or impaired glucose tolerance (IGT) affect a large segment of the population. Peripheral neuropathy (PN) is a common complication of T2DM, leading to sensory and motor deficits. While T2DM-related PN often results in balance- and mobility-related dysfunction which manifests as gait instability and falls, little is known about balance capabilities in patients who have evidence of PN related to IGT (IGT-PN). We evaluated patients with IGT-PN on commonly-used clinical balance and mobility tests as well as a new test of trunk position sense and balance impairment, trunk repositioning errors (TREs). Eight participants aged 50-72 years with IGT-PN, and eight age- and gender-matched controls underwent balance, mobility and trunk repositioning accuracy tests at a university neurology clinic and mobility research laboratory. Compared to controls, IGT-PN participants had as much as twice the magnitude of TREs and stood approximately half as long on the single leg balance test. People with IGT-PN exhibit deficits in standing balance and trunk position sense. Furthermore, there was a significant association between performance on commonly-used clinical balance and mobility tests, and electrophysiological and clinical measures of neuropathy in IGT-PN participants. Because IGT-related neuropathy represents the earliest stage of diabetic neuropathy, deficits in IGT-PN participants highlight the importance of early screening in the dysglycemic process for neuropathy and associated balance deficits.

  13. [Reliability and validity of an instrument to evaluate integral clinical competence in medical residents].

    PubMed

    Sepúlveda-Vildósola, Ana Carolina; Gaspar-López, Nadia; Reyes-Lagunes, Lucina Isabel; Gonzalez-Cabello, Héctor Jaime

    2015-01-01

    Introducción: la evaluación de la competencia clínica de un residente es un proceso complejo. Los profesores requieren de instrumentos confiables y válidos para evaluar objetivamente la competencia clínica. El objetivo fue evaluar la confiabilidad y validez de un instrumento (IECC) diseñado para evaluar la competencia clínica integral de los médicos residentes. Métodos: se diseñó un instrumento a partir de los diferentes pasos del método clínico, y se determinaron tres niveles de competencia para cada uno. El instrumento fue revisado respecto a su claridad, pertinencia y la suficiencia de sus indicadores planteados por cinco médicos pediatras expertos. Cada residente fue evaluado independientemente por tres médicos. Resultados: se obtuvieron en total 651 mediciones en 234 residentes. El instrumento discriminó entre grupos extremos. Se obtuvo un valor de alfa de Cronbach de 0.778 y el análisis factorial distinguió dos factores: competencia clínica y competencias complementarias. No se encontraron diferencias entre evaluadores en las calificaciones globales ni en cada uno de los indicadores. Conclusión: el instrumento propuesto es válido y confiable. Se propone como una herramienta más en la evaluación formativa de los médicos residentes de especialidades clínicas.

  14. Temperature dependent spectroscopic and excited state dynamics of 3-hydroxychromones with electron donor and acceptor substituents.

    PubMed

    Szalai, Alan; Giordano, Luciana; Sánchez, Verónica M; Atvars, Teresa D Z; Faleiros, Marcelo; Jares-Erijman, Elizabeth; Aramendía, Pedro F

    2017-05-15

    We have studied the photophysical and photochemical behavior of three compounds derived from 3-hydroxychromone (3-HC), capable of undergoing excited state proton transfer (ESIPT). The compounds have two substituents, located in positions 2 and 7, one on each ring of the 3-HC heterocycle. The substituent pattern shows different electron donating and acceptor features. The compounds were studied by absorption and emission spectroscopy, steady state anisotropy, and time resolved emission spectroscopy (TRES) as a function of temperature. Results were interpreted using time dependent density functional theory calculations. Compared to reference compounds of 3-HC substituted only in the 2 position, the compounds show similar absorption and emission spectra, shifted 20-30 nm to higher wavelengths due to extended conjugation. TRES shows the existence of ESIPT in the thermodynamic equilibrium regime. This process is endothermic in all three compounds. The different behavior compared to monosubstituted 3-HC is attributed to the extended conjugation and to the electron donor acceptor character of the substituents, which has a more pronounced effect when the electron acceptor is located in position 2.

  15. Croissance en surfusion de métaborate de baryum par la méthode Czochralski

    NASA Astrophysics Data System (ADS)

    Maillard, A.; Moussambi, H.; Klein, R. S.; Polgar, K.

    2003-06-01

    La génération d'U.V. à partir de cristaux de métaborate de Baryum en phase basse température (β-BBO, β-BaB2O4) nécessite l'obtention de cristaux de bonne qualité exempts d'impureté. Afin d'obtenir des cristaux de haute pureté, nous proposons de réaliser la croissance dans un bain en surfusion dont la composition est celle de BBO sans ajout de solvant tel que Na2O. Un ensemble de paramètres est proposé pour assurer la croissance de la phase β, présentant les propriétés non linéaires requises. Cette méthode de croissance de β-BBO s'apparente à celle décrite par Kouta [1]. L'interprétation différente de la compréhension de la croissance dans un bain en surfusion nous permet de proposer des paramètres beaucoup moins extrêmes que ceux de l'équipe japonaise Ainsi les gradients de température sont divisés par deux, passant de 1200°/cm à 600°/cm. De ce fait les conditions extrêmes sont ramenées à des conditions de croissance plus classiques.

  16. [Burnout and quality of life in medical residents].

    PubMed

    Prieto-Miranda, Sergio Emilio; Rodríguez-Gallardo, Gisela Bethsabé; Jiménez-Bernardino, Carlos Alberto; Guerrero-Quintero, Laura Guadalupe

    2013-01-01

    Introducción: el burnout y la calidad de vida son fenómenos poco estudiados en estudiantes de posgrado y sus efectos se desconocen. Métodos: estudio descriptivo longitudinal. Se incluyeron residentes que iniciaron su primer año de posgrado en marzo de 2010. Se aplicó, a su ingreso, a los 6 y 12 meses, la versión española del cuestionario PEC VEC de perfil de calidad de vida validado al español y el inventario de burnout de Maslach específico para médicos. Para las variables nominales se utilizó ?2 y para variables numéricas Anova. Resultados: se incluyeron 45 residentes. La edad promedio fue de 26.9 ± 2.93; 18 (40 %) fueron del sexo femenino y 27 (60 %) del masculino. En la encuesta PEC VEC se encontró un descenso significativo en cuatro de las seis escalas valoradas en las tres mediciones realizadas. En el cuestionario de burnout se encontraron niveles altos de agotamiento emocional en las tres pruebas, bajo grado de despersonalización, y logros personales al ingreso, elevándolos a los 6 y 12 meses. La especialidad más afectada fue medicina interna. Conclusiones: hay presencia de burnout y deterioro de calidad de vida en médicos residentes que estudian posgrado y se mantiene durante el primer año de residencia.

  17. Aromaticity of Heterofullerenes C18BxNy (x + y = 2) and Their Molecular Ions

    NASA Astrophysics Data System (ADS)

    Chen, Jia-li; Kerim, Ablikim

    2008-04-01

    The aromaticity of all possible substituted fullerene isomers of C18N2, C18B2, C18BN, and their molecular ions which originate from the C20 (Ih) cage were studied by the topological resonance energy (TRE) and the percentage topological resonance energy methods. The relationship between the aromaticity of C18BxNy isomers and the sites where the heteroatoms dope at the C20 (Ih) cage is discussed. Calculation results show that at the neutral and cationic states all the isomers are predicted to be antiaromatic with negative TREs, but their polyvalent anions are predicted to be aromatic with positive TREs. The most stable isomer is formed by heteroatom doping at the 1, 11-sites in C18N2, C18B2, and C18BN. Heterofullerenes are more aromatic than C20. The stability order in the neutral states is C18N2 > C18 BN > C18 B2 > C20. The stability order in closed-shell is C18B28- > C206- > C18BN6- > C18N24-. This predicts theoretically that their polyvalent anions have high aromaticity.

  18. [Neurological health care activity in a recently created district hospital: model of high efficiency].

    PubMed

    Jiménez-Jiménez, Félix J; Plaza-Nieto, José F; Navacerrada, Francisco; Alonso-Navarro, Hortensia; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; Guillán, Marta; Calleja, Marisol; Moreno-Puertas, Dolores

    2015-03-01

    Objetivo. Analizar la actividad asistencial de un hospital comarcal de reciente creacion, con especial enfasis en los indicadores asistenciales en consultas externas y en actos medicos de pacientes ingresados. Pacientes y metodos. Describimos la actividad asistencial realizada por nuestra seccion de neurologia durante los años 2008-2013. Se comparan nuestros indicadores asistenciales de los años 2012 y 2013 (quinto y sexto año de actividad), tanto en consultas externas como en pacientes ingresados, con los de otros dos hospitales de caracteristicas similares, otros tres de nivel secundario y otros cuatro de nivel terciario. Resultados. La seccion de neurologia de nuestro hospital fue la que realizo mayor numero de primeras consultas por facultativo, tuvo el mejor indice de consultas sucesivas/primeras y el mayor porcentaje de consultas de alta resolucion, tuvo la menor estancia media en los dos grupos relacionados por el diagnostico (GRD) mas frecuentes en nuestra especialidad, y fue la segunda en ingresos por facultativo del GRD 'ictus con infarto' y la tercera en ingresos por facultativo del GRD 'otros trastornos del sistema nervioso'. Conclusiones. Los indicadores asistenciales de la seccion de neurologia de nuestro hospital muestran un modelo de muy alta eficiencia, al cual solo se aproximan los de otros dos de caracteristicas y desarrollo similares al nuestro. La implantacion gradual de modelos similares al de estos tres hospitales en los niveles secundario y terciario podria ser de utilidad en la mejora de su eficiencia asistencial.

  19. Using Group Research to Stimulate Undergraduate Astronomy Major Learning

    NASA Astrophysics Data System (ADS)

    McGraw, A. M.; Hardegree-Ullman, K. K.; Turner, J. D.; Shirley, Y. L.; Walker-LaFollette, A. M.; Robertson, A. N.; Carleton, T. M.; Smart, B. M.; Towner, A. P. M.; Wallace, S. C.; Smith, C.-T. W.; Austin, C. L.; Small, L. C.; Daugherty, M. J.; Guvenen, B. C.; Crawford, B. E.; Schlingman, W. M.

    2013-04-01

    The University of Arizona Astronomy Club has been working on two large group research projects since 2009. One research project is a transiting extrasolar project that is fully student led and run. We observed the transiting extrasolar planets, TrES-3b and TrES-4b, with the 1.55 meter Kuiper Telescope using different filters to test a proposed method of detecting extrasolar planet magnetic fields. The second project is a radio astronomy survey utilizing the Arizona Radio Observatory 12 meter telescope on Kitt Peak to study molecular gas in cold star-like cores identified by the Planck all sky survey. This project provides a unique opportunity for a large group of students to get hands-on experience observing with a world-class radio observatory. These projects involve students in every single step of the process including: proposal writing to obtain telescope time on various Southern Arizona telescopes, observing at these telescopes, data reduction and analysis, managing large data sets, and presenting results at scientific meetings and in journal publications. The primary goal of these projects is to involve students in cutting-edge research early on in their undergraduate studies. These projects are designed to be continuous long term projects so that new students can easily join. New students learn from the more experienced students on the projects, creating a learner-centered environment. Independent study credit is now an option for some students working on these projects.

  20. Constraining The Magnetic Fields Of Transiting Exoplanets Through Ground-based Near-UV And Optical Observations

    NASA Astrophysics Data System (ADS)

    Turner, Jake; Smart, B.; Hardegree-Ullman, K.; Griffith, C. A.; Biddle, L.; Carleton, T.; Crawford, B.; De La Rosa, R.; Donnels, M.; Guvenen, B.; Guvenen, B.; Hofmann, R.; McGraw, A. M.; Nieberding, M.; Robertson, A.; Scott, A.; Small, L.; Smith, C.; Teske, J.; Towner, A. P.; Walker-LaFollette, A.; Zellem, R.

    2013-01-01

    Studying the magnetic fields of exoplanets allow for the investigation of their interior structure and rotation period, the presence of extrasolar moons, atmospheric retention, and potential habitability. We observed the primary transits of the hot Jupiters TrES-3b, WASP-12b, TrES-4b, WASP-26b, WASP-33b, HAT-P-1b, WASP-14b, HAT-P-6b, XO-2b, CoRoT-9b, and CoRoT-1b, the hot Neptune GJ 436b, and the super Earth GJ 1214b with the Steward Observatory 1.55 meter Kuiper Telescope using near-UV and optical filters in an attempt to constrain their magnetic fields. Vidotto et al. (2011) suggest that the magnetic field of these planets can be constrained if their near-UV light curve shows an early ingress compared to its optical light curve, while their egress remains unaffected. Our study provides the first constraints on the effect proposed by Vidotto et al. (2011) and the magnetic field strengths for many of our targets.

  1. Using Group Research Projects to Stimulate Undergraduate Astronomy Major Learning

    NASA Astrophysics Data System (ADS)

    McGraw, Allison M.; Hardegree-Ullman, K. K.; Turner, J. D.; Shirley, Y. L.; Walker-LaFollette, A. M.; Robertson, A. N.; Carleton, T. M.; Smart, B. M.; Towner, A. P. M.; Wallace, S. C.; Smith, C. W.; Small, L. C.; Daugherty, M. J.; Guvenen, B. C.; Crawford, B. E.; Austin, C. L.; Schlingman, W. M.

    2012-05-01

    The University of Arizona Astronomy Club has been working on two large group research projects since 2009. One research project is a transiting extrasolar planet project that is fully student led and run. We observed the transiting exoplanets, TrES-3b and TrES-4b, with the 1.55 meter Kupier Telescope in near-UV and optical filters in order to detect any asymmetries between filters. The second project is a radio astronomy survey utilizing the Arizona Radio Observatory 12m telescope on Kitt Peak to study molecular gas in cold cores identified by the Planck all sky survey. This project provides a unique opportunity for a large group of students to get hands-on experience observing with a world-class radio observatory. These projects involve students in every single step of the process including: proposal writing to obtain telescope time on various Southern Arizona telescopes, observing at these telescopes, data reduction and analysis, managing large data sets, and presenting results at scientific meetings and in journal publications. The primary goal of these projects is to involve students in cutting-edge research early on in their undergraduate studies. The projects are designed to be continuous long term projects so that new students can easily join. As of January 2012 the extrasolar planet project became an official independent study class. New students learn from the more experienced students on the projects creating a learner-centered environment.

  2. The influence of aerosols on photochemical smog in Mexico City

    NASA Astrophysics Data System (ADS)

    Castro, T.; Madronich, S.; Rivale, S.; Muhlia, A.; Mar, B.

    Aerosols in the Mexico City atmosphere can have a non-negligible effect on the ultraviolet radiation field and hence on the formation of photochemical smog. We used estimates of aerosol optical depths from sun photometer observations in a detailed radiative transfer model, to calculate photolysis rate coefficients ( JNO 2) for the key reaction NO 2+ hν→NO+O ( λ<430 nm). The calculated values are in good agreement with previously published measurements of JNO 2 at two sites in Mexico City: Palacio de Minerı´a (19°25'59″N, 99°07'58″W, 2233 masl), and IMP (19°28'48″N, 99°11'07″W, 2277 masl) and in Tres Marias, a town near Mexico City (19°03'N, 99°14'W, 2810 masl). In particular, the model reproduces very well the contrast between the two urban sites and the evidently much cleaner Tres Marias site. For the measurement days, reductions in surface JNO 2 by 10-30% could be attributed to the presence of aerosols, with considerable uncertainty due largely to lack of detailed data on aerosol optical properties at ultraviolet wavelengths (esp. the single scattering albedo). The potential impact of such large reductions in photolysis rates on surface ozone concentrations is illustrated with a simple zero-dimensional photochemical model.

  3. A CORRELATION BETWEEN STELLAR ACTIVITY AND HOT JUPITER EMISSION SPECTRA

    SciTech Connect

    Knutson, Heather A.; Howard, Andrew W.; Isaacson, Howard

    2010-09-10

    We present evidence for a correlation between the observed properties of hot Jupiter emission spectra and the activity levels of the host stars measured using Ca II H and K emission lines. We find that planets with dayside emission spectra that are well-described by standard one-dimensional atmosphere models with water in absorption (HD 189733, TrES-1, TrES-3, WASP-4) orbit chromospherically active stars, while planets with emission spectra that are consistent with the presence of a strong high-altitude temperature inversion and water in emission orbit quieter stars. We estimate that active G and K stars have Lyman {alpha} fluxes that are typically a factor of 4-7 times higher than quiet stars with analogous spectral types and propose that the increased UV flux received by planets orbiting active stars destroys the compounds responsible for the formation of the observed temperature inversions. In this paper, we also derive a model-independent method for differentiating between these two atmosphere types using the secondary eclipse depths measured in the 3.6 and 4.5 {mu}m bands on the Spitzer Space Telescope and argue that the observed correlation is independent of the inverted/non-inverted paradigm for classifying hot Jupiter atmospheres.

  4. Cross-sectional, observational study of anterior segment parameters using anterior segment optical coherence tomography in North Indian Population.

    PubMed

    Dalal, Latika Khatri; Dhasmana, Renu; Maitreya, Amit

    2017-01-01

    To study the anterior segment (AS) parameters using AS optical coherence tomography (AS-OCT) in the North Indian population. A hospital-based, observational, cross-sectional study was conducted over a period of 1 year. It included 251 normal individuals aged 20-70 years. Participants underwent imaging with AS-OCT.Ocular parameters included anterior chamber angle (ACA), iris cross-sectional area (ICSA), iris thickness (IT), and iris curvature (IC). The parameters were measured nasally and temporally for both sexes and different age groups. The mean age of participants was 48.3 ± 13.9 years and 50.6% were men. The ACA decreased with age whereas ICSA, IT, and IC increased with age. The ACA (P = 0.0001nasally and temporally), ICSA (P = 0.011 nasally, P = 0.027 temporally), IT750 (P = 0.001 nasally, P = 0.011 temporally), IT1500 (P = 0.002 nasally, P = 0.002 temporally), and IC (P = 0.059 nasally, P = 0.128 temporally) underwent statistically significant changes with increasing age. No significant difference was seen in parameters of different sex. In this subset of the Indian population, the change in the AC parameters with age influences the AC dimensions predisposing the eye to glaucomatous conditions. These data are applicable clinically for the assessment and surgical management of patients requiring AS surgery. Objectif: Étudier les paramètres du segment antérieur (AS) en utilisant la tomodensitométrie optique AS (AS-OCT) dans la population du nord de l'Inde. Méthodes: Une étude axée sur l'hôpital, observationnelle et transversale a été menée sur une période de 1 an. Il comprenait 251 individus normaux âgés de 20 à 70 ans. Les participants ont subi une imagerie avec AS-OCT. Les paramètres oculaires comprenaient l'angle de la chambre antérieure (ACA), la surface transversale de l'iris (ICSA), l'épaisseur de l'iris (IT) et la courbure de l'iris (IC). Les paramètres ont été mesurés par voie nasale et temporelle pour les deux sexes et diff

  5. Activités physiques libres ou encadrées et condition physique liée à la santé chez des adultes burundais: étude transversale

    PubMed Central

    Bizimana, Jean Berchmans; Lawani, Mansourou Mohamed; Akplogan, Barnabé; Gaturagi, Charles

    2016-01-01

    Introduction l’activité physique régulière a un impact positif sur la santé. Cette étude a pour objet de comparer la condition physique liée à la santé des adultes qui s’exercent librement avec celle des adultes bénéficiant d’un encadrement professionnel. Elle tente aussi d’établir une relation entre le niveau d’activité physique et les paramètres de la condition liée à la santé. Méthodes nous avons évalué le niveau d’activité physique et les paramètres de la condition physique liée à la santé. Par le test t pour échantillons indépendants, nous avons comparé les moyennes et avons par le calcul du coefficient de corrélation r de Pearson analysé la relation entre le niveau d’activité physique et les paramètres de la condition physique. Résultats des écarts significatifs (p < 0,05) de niveau d’activité physique, de souplesse, de V˙O2max et de la FC de repos ont été enregistrés en faveur du groupe encadré. Le niveau d’activité physique est positivement corrélé (p < 0,05) au V˙O2max et à la force de préhension mais négativement corrélé à la FC de repos et au cholestérol LDL. La prévalence des facteurs de risque cardiovasculaire n’est pas élevée excepté pour le cholestérol HDL. Conclusion les résultats de cette étude montrent que l’activité physique libre est aussi efficace que l’activité physique encadrée dans le maintien des profils lipidique et physiologique favorables à la santé chez l’adulte burundais. Cependant, l’activité physique encadrée apporte des bénéfices supplémentaires pour le V˙O2max, la fréquence cardiaque de repos, la souplesse antérieure et la détente verticale PMID:28203315

  6. Use of IPA to demonstrate loss of forest interior birds from isolated woodlots

    USGS Publications Warehouse

    Robbins, C.S.; Boone, D.D.; Purroy, F.J.

    1983-01-01

    'Empleo de indices puntuales de abundancia (IPA) para demostrar la perdida de aves forestales en bosques aislados'. En Maryland, E.U., se seleccionaron bloques boscosos de diferente superficie, divididos en seis clase de tamano (2,8-6 ha, 7-14, 20-30, 34-80, 105-1300, mayores de 4000 ha). En estas ?islas' forestales fue programado un conjunto de muestreos puntuales con estas caracteristicas: 1) Cada punto se visito tres veces. 2) En cada visita se hicieron cuatro censos consecutivos de 5 minutos de duracion, empleando diferentes simbolos para machos cantores, adultos no cantores, aves en vuelo y aves inmaduras. 3) Los conteos se hicieron en tres epocas: final de Mayo, mitad de Junio y final de Junio. 4) Se dividio el tiempo de censo en tres priodos horarios: 5,15-6,30 ; 6,30-8; 8-9,30 hrs. 5) Los puntos se agruparon en co juntos de 4 a 9, considerando que un conjunto es el nlimero que un observador puede cubrir por manana. 6) La vegetacion fue descrita exhaustivamente en cuanto composicion y fisionomla. El principal objetivo que se busca consiste en conocer los requisitos areales de ciertas especies de bosque muy sensibles a la fragmentacion del habitat. Puede observarse (Figura 1) que una serie de migrantes de largo alcance se asientan en relacion con el aumento de la superficie del rodal arbo1ado, sabre todo en macizos de 4.000 o mas hectareas. Sin embargo, las especies sedentarias (Fig. 2) tienen pauta de presencia irregular en funcion del area, forestal, con tendencia a presentarse menos en los bosques mas extensos, Dryocopus pileatus, por excepcion, reacciona negativamente al pequeno tamano de la parcela arbolado, prefiriendo bosques grandes. Parecida respuesta da tambien Sitta carolinensis. Aunque se sabe poco de las exigencias areales de las aves forestales americanas, el metodo de los IPA resulta muy adecuado para esta clase de investigacion de tanto interes en gestion ambiental, posibilitando colectar gran cantidad de datos comparables en un periodo de

  7. Étude de l'efficacité des modes de Lamb dans la signature acoustique V(z) d'une couche mince par la théorie de la résonance

    NASA Astrophysics Data System (ADS)

    Ramdani, Abderrafi; Augereau, Franck; Despaux, Gilles

    1996-05-01

    Experimental acoustic signatures measured on thin films are perturbated by an interference process between the different Lamb waves generated at various incident angular values. This disables the correct determination of the layer's acoustic parameters and for this reason, it is helpful to develop a powerful method to study the influence of each layer parameter on these modes. For this purpose, a technique based on the calculation of the half-height width on resonance peaks of the reflectance power has been elaborated. From these simulations, we may determine which modes will be more efficiently extracted from acoustic signatures for steel and glass films. This result has been confirmed experimentally using ultrasonic frequencies optimized versus the sample thicknesses for glass and steel plates. Indeed, from experimental acoustic signatures, we have next been able to retrieve the acoustic parameters of these samples. Les relevés expérimentaux des signatures acoustiques sur des couches minces sont difficiles à interpréter car tous les modes de Lamb générés à differents angles d'incidence vont interférer, ce qui rend impossible toute détermination des paramètres acoustiques de la couche. Il est alors nécessaire de mettre en oeuvre une méthode d'analyse rapide afin d'étudier l'influence de chacun des paramètres de la couche sur ces modes afin de déterminer les conditions optimales de mesure. La méthode d'analyse basée sur la détermination de la largeur à mi-hauteur des pics de résonance du pouvoir réflecteur est un moyen original de résolution du problème direct, qui permet de montrer que certains modes sont plus efficaces que d'autres, et donc plus faciles à détecter sur les signatures expérimentales. Grâce aux résulats théoriques obtenus, les fréquences d'observation ont pu être optimisées pour des épaisseurs de plaques d'acier et de verre utilisées dans la partie expérimentale de ce travail. De ces mesures et en utilisant notre

  8. Osmotic Adaptation of Thermus thermophilus RQ-1: Lesson from a Mutant Deficient in Synthesis of Trehalose

    PubMed Central

    Silva, Zélia; Alarico, Susana; Nobre, Ana; Horlacher, Reinhold; Marugg, Joey; Boos, Winfried; Mingote, Ana I.; da Costa, Milton S.

    2003-01-01

    Strains of Thermus thermophilus accumulate primarily trehalose and smaller amounts of mannosylglycerate in response to salt stress in yeast extract-containing media (O. C. Nunes, C. M. Manaia, M. S. da Costa, and H. Santos, Appl. Environ. Microbiol. 61:2351-2357, 1995). A 2.4-kbp DNA fragment from T. thermophilus strain RQ-1 carrying otsA (encoding trehalose-phosphate synthase [TPS]), otsB (encoding trehalose-phosphate phosphatase [TPP]), and a short sequence of the 5′ end of treS (trehalose synthase [TreS]) was cloned from a gene library. The sequences of the three genes (including treS) were amplified by PCR and sequenced, revealing that the genes were structurally linked. To understand the role of trehalose during salt stress in T. thermophilus RQ-1, we constructed a mutant, designated RQ-1M6, in which TPS (otsA) and TPP (otsB) genes were disrupted by gene replacement. Mutant RQ-1M6 accumulated trehalose and mannosylglycerate in a medium containing yeast extract and NaCl. However, growth in a defined medium (without yeast extract, known to contain trehalose) containing NaCl led to the accumulation of mannosylglycerate but not trehalose. The deletion of otsA and otsB reduced the ability to grow in defined salt-containing medium, with the maximum salinity being 5% NaCl for RQ-1 and 3% NaCl for RQ-1M6. The lower salt tolerance observed in the mutant was relieved by the addition of trehalose to the growth media. In contrast to trehalose, the addition of glycine betaine, mannosylglycerate, maltose, and glucose to the growth medium did not allow the mutant to grow at higher salinities. The results presented here provide crucial evidence for the importance of the TPS/TPP pathway for the synthesis and accumulation of trehalose and the decisive contribution of this disaccharide to osmotic adaptation in T. thermophilus RQ-1. PMID:14526004

  9. Transcriptional regulatory network analysis during epithelial-mesenchymal transformation of retinal pigment epithelium

    PubMed Central

    Pratt, Craig H.; Vadigepalli, Rajanikanth; Chakravarthula, Praveen; Gonye, Gregory E.; Philp, Nancy J.

    2008-01-01

    Purpose Phenotypic transformation of retinal pigment epithelial (RPE) cells contributes to the onset and progression of ocular proliferative disorders such as proliferative vitreoretinopathy (PVR). The formation of epiretinal membranes in PVR may involve an epithelial-mesenchymal transformation (EMT) of RPE cells as part of an aberrant wound healing response. While the underlying mechanism remains unclear, this likely involves changes in RPE cell gene expression under the control of specific transcription factors (TFs). Thus, the purpose of the present study was to identify TFs that may play a role in this process. Methods Regulatory regions of genes that are differentially regulated during phenotypic transformation of ARPE-19 cells, a human RPE cell line, were subjected to computational analysis using the promoter analysis and interaction network toolset (PAINT). The PAINT analysis was used to identify transcription response elements (TREs) statistically overrepresented in the promoter and first intron regions of two reciprocally regulated RPE gene clusters, across four species including the human genome. These TREs were then used to construct transcriptional regulatory network models of the two RPE gene clusters. The validity of these models was then tested using RT–PCR to detect differential expression of the corresponding TF mRNAs during RPE differentiation in both undifferentiated and differentiated ARPE-19 and primary chicken RPE cell cultures. Results The computational analysis resulted in the successful identification of specific transcription response elements (TREs) and their cognate TFs that are candidates for serving as nodes in a transcriptional regulatory network regulating EMT in RPE cells. The models predicted TFs whose differential expression during RPE EMT was successfully verified by reverse transcriptase polymerase chain reaction (RT–PCR) analysis, including Oct-1, hepatocyte nuclear factor 1 (HNF-1), similar to mothers against

  10. Sensitized luminescence from water-soluble LaF3:Eu nanocrystals via partially-capped 1,10-phenanthroline: time-gated emission and multiple lifetimes.

    PubMed

    Irfanullah, Mir; Bhardwaj, Navneet; Chowdhury, Arindam

    2016-08-02

    Water dispersible citrate-capped LaF3:Eu(5%) nanocrystals (NCs) have been partially surface-functionalized by 1,10-phenanthroline (phen) via a ligand exchange method to produce novel water dispersed citrate/phen-capped LaF3:Eu(5%) NCs in which citrate ligands preserve the water dispersibility of the NCs and phen ligands act as sensitizers of surface Eu(3+)-dopant sites. The partial ligand exchange and the formation of water dispersed NCs have been monitored by (1)H NMR spectroscopy, as well as luminescence measurements at different time intervals during the reaction. These NCs display a distinct phen-sensitized Eu(3+)-emission profile with enhanced intensity in water as compared to the emission profile and intensity obtained upon direct excitation. Time-resolved (or time-gated) emission spectroscopy (TRES) has been used to probe PL dynamics of Eu(3+)-sites of LaF3:Eu(5%) NCs by taking advantage of selectively sensitizing surface Eu(3+)-dopant sites by phen ligands as well as by exciting all the Eu(3+)-sites in the NCs upon direct excitation. TRES upon direct excitation of the citrate-capped LaF3:Eu(5%) NCs reveals that Eu(3+)-dopants occupy at least three different sites, each with a different emission profile and lifetime, and emission from purely interior Eu(3+)-sites has been resolved due to their long lifetime as compared to the lifetime of purely surface and near surface Eu(3+)-sites. In contrast, the phen-sensitized emission from citrate/phen-capped LaF3:Eu(5%) NCs displays similar emission profiles and lifetimes in TRES measurements, which reveal that phen truly sensitizes purely surface dopant sites of the NCs in water, all of which have nearly the same local environment. The phen-sensitized Eu(3+)-emission of the NCs in water remains stable even upon addition of various buffer solutions at physiological pH, as well as upon addition of water-miscible organic solvents. Furthermore, the two-photon excitation (λex. = 720 nm) of these water-soluble phen

  11. Neogene stratigraphy, foraminifera, diatoms, and depositional history of Maria Madre Island, Mexico: Evidence of early Neogene marine conditions in the southern Gulf of California

    USGS Publications Warehouse

    McCloy, C.; Ingle, J.C.; Barron, J.A.

    1988-01-01

    Foraminifera and diatoms have been analyzed from an upper Miocene through Pleistocene(?) sequence of marine sediments exposed on Maria Madre Island, largest of the Tre??s Marias Islands off the Pacific coast of Mexico. The Neogene stratigraphic sequence exposed on Maria Madre Island includes a mid-Miocene(?) non-marine and/or shallow marine sandstone unconformably overlain by a lower upper Miocene to uppermost Miocene upper to middle bathyal laminated and massive diatomite, mudstone, and siltstone unit. This unit is unconformably overlain by lower Pliocene middle to lower bathyal sandstones and siltstones which, in turn, are unconformably overlain by upper Pliocene through Pleistocene(?) upper bathyal to upper middle bathyal foraminiferal limestones and siltstones. These beds are unconformably capped by Pleistocene terrace deposits. Basement rocks on the island include Cretaceous granite and granodiorite, and Tertiary(?) andesites and rhyolites. The upper Miocene diatomaceous unit contains a low diversity foraminiferal fauna dominated by species of Bolivina indicating low oxygen conditions in the proto-Gulf Maria Madre basin. The diatomaceous unit grades into a mudstone that contains a latest Miocene upper to middle bathyal biofacies characterized by Baggina californica and Uvigerina hootsi along with displaced neritic taxa. An angular unconformity separates the upper Miocene middle bathyal sediments from overlying lower Pliocene siltstones and mudstones that contain a middle to lower bathyal biofacies and abundant planktonic species including Neogloboquadrina acostaensis and Pulleniatina primalis indicating an early Pliocene age. Significantly, this Pliocene unit contains common occurrences of benthic species restricted to Miocene sediments in California including Bulimina uvigerinaformis. Pliocene to Pleistocene(?) foraminiferal limestones and siltstones characterize submarine bank accumulations formed during uplift of the Tre??s Marias Island area, and include

  12. Revision curricular a partir de un analisis comparativo de las discrepancias en los curriculos de una escuela de optometria en Puerto Rico con las competencias requeridas para las agencias de revalida y acreditacion 2004

    NASA Astrophysics Data System (ADS)

    Rivera Pacheco, Andres

    El proposito de esta investigacion, un estudio cualitativo de caso, fue comparar y contrastar el curriculo vigente de la Escuela de Optometria de la UIAPR con las competencias y estandares requeridos por las agencias de acreditacion y de revalida. Con este proposito, decidimos realizar una revision y un analisis de documentos: el prontuario de cada uno de los cursos de los curriculos implantados en el 1993 y en el 2001; las competencias y estandares establecidos por las agencias de revalida y de acreditacion; y las estadisticas en las que se analiza el porcentaje de estudiantes que aprueban cada una de las partes de los examenes de revalida entre el 1998 al 2003. Se realizaron entrevistas dirigidas para dar apoyo y complementar la revision y el analisis de estos documentos. Los participantes de las entrevistas fueron tres estudiantes de la clase de optometria del 2004 (ultima clase del curriculo del 1993); tres estudiantes de la clase de optometria del 2005 (primera clase graduanda del curriculo vigente) y tres profesores y/o directores de los Departamentos de Ciencias Basicas, Ciencias Clinicas y Cuidado al Paciente. Esta investigacion se enmarco en el modelo de evaluacion curricular de discrepancia de Malcolm Provus y en el modelo de desarrollo basado en competencias. Uno de los hallazgos mas importantes del estudio es que los cambios que se implantaron al curriculo del 2001 no han logrado que los estudiantes mejoren su ejecucion en los examenes de revalida. Por otro lado, se encontro que el curriculo vigente atiende completamente los estandares de la practica de Optometria, pero no las competencias. Esta informacion fue validada mediante el uso de una tabla de cotejo para el analisis de los cursos y de la informacion obtenida de las entrevistas. El estudio determina y concluye que existen discrepancias entre los prontuarios de los cursos del curriculo y las competencias requeridas por la agencia de revalida. Segundo, que el Departamento de Ciencias Basicas es el

  13. Optimization of parameters in the emulsification process by two different methods.

    PubMed

    Carlotti, M E; Pattarino, F; Gasco, M R; Brusasca, P

    1993-12-01

    Synopsis An O/W emulsion with a lipopeptidic emulsifier was optimized by means of two different methods, specifically by experimental design and by selective variation of the parameters. Two optimized emulsions were obtained; they had similar values of emulsification (time and rate of homogenization) and amounts of components. Résumé Une émulsion O/E, avec un lipopeptide comme tensioactif, a été optimisée par deux méthodes d'optimisation différentes, notamment par l'experimental design et par la variation selective de certain paramètres. Deux émulsions optimisées ont été ainsi obtenues: ces émulsions ont des valeurs d'emulsification (temp et vitesse d'homogénéisation) et des quantités des composantes très proches.

  14. Treatment of obstructive sleep apnea syndrome with a Kampo-formula, San'o-shashin-to: a case report.

    PubMed

    Hisanaga, A; Saitoh, O; Fukuda, H; Kurokawa, K; Okabe, A; Tachibana, H; Hagino, H; Mita, T; Yamashita, I; Tsutsumi, M; Kurachi, M; Itoh, T

    1999-04-01

    The following describes a 76-year-old male with obstructive sleep apnea syndrome successfully treated with a Kampo-formula, San'o-shashin-to (Formula medicamentorum tres ad dispellendi cordis). Polysomnography, performed before and after administration of San'o-shashin-to, revealed that the apnea index decreased from 11.1 events/hour to 4.1 events/hour, and that the apnea plus hypopnea index decreased from 18.4 events/hour to 10.7 events/hour. The patient was normo-weight (body mass index: 20.4 kg/m2), and events of sleep apnea and hypopnea were mostly noted during a non-rapid eye movement sleep. It is possible that San'o-shashin-to has some alleviating effects on the upper airway resistance during sleep.

  15. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica

    DOE PAGES

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; ...

    2015-06-14

    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Rootmore » Nodule Bacteria (GEBA-RNB) project proposal.« less

  16. Fabrication et etude de cristaux photoniques pour les longueurs d'onde de telecommunication optique

    NASA Astrophysics Data System (ADS)

    Aboudihab, Ismail

    Nous avons fabrique et etudie des cristaux photoniques bidimensionnels et tridimensionnels. Les cristaux 3D sont constitues de microbilles de polystyrene autoassemblees. La structure inverse en BaTiO3 a ete aussi fabriquee, ou l'on remplace l'espace entre les microbilles par du BaTiO3, alors que les microbilles sont eliminees. Nous avons essaye en particulier de comprendre les differents phenomenes qui influencent la cristallisation de ces structures afin d'obtenir des films de meilleure qualite. Les cristaux bidimensionnels, constitues de cylindres vides imbibes dans un semiconducteur (As2S3 ou Si), sont obtenus par holographie laser. Nous avons montre que cette technique est tres interessante pour la production en serie de ces structures. Des guides d'ondes, des coupleurs, et des jonctions Y, imbibes dans des cristaux photoniques bidimensionnels, ont aussi ete fabriques. Des mesures optiques et des simulations numeriques ont ete menees dans le but de caracteriser ces structures.

  17. Regiones H II alrededor de estrellas WR

    NASA Astrophysics Data System (ADS)

    Giménez Benitez, S.; Niemela, V.

    En base a observaciones espectroscópicas en el rango óptico, obtenidas en el CASLEO, se estudian las condiciones físicas de tres regiones H II alrededor de estrellas WR: N76 en el entorno de Ab7, en la Nube Menor de Magallanes, N79 alrededor de Br 2, en la Nube Mayor de Magallanes y G2.4+1.4 alrededor de WR 102, en nuestra Galaxia. Estas regiones presentan una alta ionización. Se observa la línea nebular de HeII en 4686 Å . Utilizando líneas nebulares de diagnóstico, se derivan los valores de la densidad y la temperatura electrónica, así como también las abundancias de algunos de los elementos químicos nebulares.

  18. Modélisation de la combustion dans un moteur diesel d'automobile

    NASA Astrophysics Data System (ADS)

    Pinchon, Philippe

    La plupart des moteurs diesels utilisés pour la traction des véhicules automobiles sont des moteurs à préchambre. Le combustible y est introduit sous forme liquide, à haute pression, se vaporise, auto-inflamme et brûle dans un espace confiné dans lequel règnent des vitesses d'écoulement très élevées. La vitesse de combustion, et donc le rendement du moteur, sont très sensibles à divers paramètres liés à l'injection ou à la géométrie de la chambre. Cette dernière joue un rôle prédominant sur l'aérodynamique interne et son interaction avec la propagation de la flamme.

  19. High-quality permanent draft genome sequence of Bradyrhizobium sp. Ai1a-2; a microsymbiont of Andira inermis discovered in Costa Rica

    SciTech Connect

    Tian, Rui; Parker, Matthew; Seshadri, Rekha; Reddy, T. B. K.; Markowitz, Victor; Ivanova, Natalia; Pati, Amrita; Woyke, Tanja; Baeshen, Mohammed; Baeshen, Nabih; Kyrpides, Nikos; Reeve, Wayne

    2015-06-14

    Bradyrhizobium sp. Ai1a-2 is is an aerobic, motile, Gram-negative, non-spore-forming rod that was isolated from an effective nitrogen fixing root nodule of Andira inermis collected from Tres Piedras in Costa Rica. In this report we describe, for the first time, the genome sequence information and annotation of this legume microsymbiont. The 9,029,266 bp genome has a GC content of 62.56% with 247 contigs arranged into 246 scaffolds. The assembled genome contains 8,482 protein-coding genes and 102 RNA-only encoding genes. Lastly, this rhizobial genome was sequenced as part of the DOE Joint Genome Institute 2010 Genomic Encyclopedia for Bacteria and Archaea-Root Nodule Bacteria (GEBA-RNB) project proposal.

  20. Importance of trehalose biosynthesis for Sinorhizobium meliloti Osmotolerance and nodulation of Alfalfa roots.

    PubMed

    Domínguez-Ferreras, Ana; Soto, María J; Pérez-Arnedo, Rebeca; Olivares, José; Sanjuán, Juan

    2009-12-01

    The disaccharide trehalose is a well-known osmoprotectant, and trehalose accumulation through de novo biosynthesis is a common response of bacteria to abiotic stress. In this study, we have investigated the role of endogenous trehalose synthesis in the osmotolerance of Sinorhizobium meliloti. Genes coding for three possible trehalose synthesis pathways are present in the genome of S. meliloti 1021: OtsA, TreYZ, and TreS. Among these, OtsA has a major role in trehalose accumulation under all of the conditions tested and is the main system involved in osmoadaptation. Nevertheless, the other two systems are also important for growth in hyperosmotic medium. Genes for the three pathways are transcriptionally responsive to osmotic stress. The presence of at least one functional trehalose biosynthesis pathway is required for optimal competitiveness of S. meliloti to nodulate alfalfa roots.

  1. Statistique des photons d'un laser à 4 niveaux soumis à un pompage optique

    NASA Astrophysics Data System (ADS)

    Chusseau, L.; Arnaud, J.; Philippe, F.

    2002-06-01

    Les lasers conventionnels à 4 niveaux peuvent délivrer de la lumière de statistique sous-Poissonienne même lorsqu'ils sont soumis à un pompage optique. Nous retrouvons exactement ces prédictions de l'optique quantique en supposant simplement que les atomes ont des niveaux d'énergie quantifiés interagissant avec un champ électromagnétique classique, la source du bruit optique étant les sauts quantiques entre niveaux. Des formules analytiques sont obtenues pour les deux paramètres clefs de la statistique des photons du laser: le facteur de Fano et la densité spectrale des photons émis.

  2. Vers une méthode de réglage expérimentale des commandes PID floues : application aux systèmes électromécaniques

    NASA Astrophysics Data System (ADS)

    Maussion, P.; Hissel, D.

    1998-08-01

    Electrical and electromechanical systems have to satisfy to more and more constrained specifications. Therefore, non-linear control structures must be spread out. Among them, fuzzy logic control can be one interessant and performant alternative. The main handicap of this kind of stucture resides in the fact that the tuning parameters are very numerous. In this paper, we first propose an on-site tuning strategy of this set of parameters in the case of a fuzzy proportionnal-integrative controller based on the experimental designs methodology and on a limited number of pre-defined closed-loop experiments. Then, a complete set of predetermined parameters for a fuzzy proportionnal-integrative-derivative controller will be given. These parameters have been optimized on a specified benchmark according to an IAE criterion. They are calculated like the Ziegler-Nichols or Broïda methodology on conventional controllers; that is, using a single open-loop step response to obtain a model of a first-order plus delay transfert function. Validity limits for this method are provided. Les systèmes électriques ou électromécaniques doivent satisfaire à des spécifications de plus en plus contraignantes qui nécessitent la mise au point de structures de commande non linéaires. Parmi celles-ci, la commande par logique floue constitue une alternative intéressante et performante. Son principal handicap réside dans le nombre très important de paramètres à régler. Dans cet article, nous nous proposons de systématiser ces réglages dans deux cas de figure. Tout d'abord nous utiliserons la méthodologie des plans d'expérimentations pour effectuer un réglage sur site d'un contrôleur flou de type proportionnel-intégral. Ce réglage sera obtenu en ne réalisant qu'un nombre limité d'essais expérimentaux en boucle fermée avec des combinaisons prédéfinies des paramètres à régler. La combinaison optimale de ces paramètres au sens d'un critère de type IAE (Intégrale de la

  3. Sixteen Years of Faculty and Undergraduate Student Research at Colgate University's Foggy Bottom Observatory

    NASA Astrophysics Data System (ADS)

    Balonek, T. J.

    2004-12-01

    Colgate University's Foggy Bottom Observatory on-campus 16-inch telescope (equipped with a CCD) has been utilized for sixteen years to conduct several faculty and undergraduate student research projects. Although the observatory is located in a region (central New York) with poor climatic conditions, the observatory is used on 120 nights per year for research and teaching. The primary research program being conducted at FBO is the optical monitoring of a sample of a dozen blazars with both good time resolution and long term coverage. Other optical photometry projects have included studies of the eclipsing binary star RZ Cas, detection and monitoring of variable stars in the fields of blazars, transits of the extrasolar planet TrES-1, rotation curves and astrometry of asteroids, and light curves of extragalactic supernovae. Representative results of these studies will be presented and the role of undergraduate student involvement in these projects will be discussed.

  4. Ground-based observations of exoplanet atmospheres

    NASA Astrophysics Data System (ADS)

    de Mooij, Ernst Johan Walter

    2011-11-01

    This thesis focuses on the properties of exoplanet atmospheres. The results for ground-based near-infrared secondary eclipse observations of three different exoplanets, TrES-3b, HAT-P-1b and WASP-33b, are presented which have been obtained with ground-based telescopes as part of the GROUSE project. In addition to secondary eclipse observations, the broadband transmission spectrum of the super-Earth GJ1214b is also presented. The transmission spectrum for this low-density planet indicates that it probably has a low-metallicity, hydrogen dominated atmosphere. Finally the results for an ensemble study of the thermal emission properties of hot Jupiters is presented, including the average spectrum for these planets separated based on the level of incident radiation and the activity of their host-stars.

  5. Effet de la substitution du cuivre par du lithium sur les proprietes de l'oxyde spinelle lithium(x)cuivre(y-x)cobalt(3-y)oxygen(4) etudie pour l'electrocatalyse de la reaction de degagement de l'oxygene en milieu alcalin

    NASA Astrophysics Data System (ADS)

    Fatih, Khalid

    L'electrolyse de l'eau demeure la seule technologie industrielle de generation de l'hydrogene et de l'oxygene tres purs sans rejet de CO2 dans l'atmosphere, ce qui le rend tres attrayant par rapport a la combustion de carburants fossiles qui provoque presentement de serieux problemes environnementaux. Dans le but d'ameliorer le rendement de ce procede, nous avons developpe de nouveaux materiaux d'anode peu couteux, a base de l'oxyde mixte CuyCo3-yO 4, qui possedent une cinetique rapide pour la reaction de degagement de l'oxygene (RDO). Cette reaction suscite un interet particulier en raison de la surtension d'activation relativement elevee a l'anode qui cause la principale perte de rendement du procede. Une etude systematique a ete effectuee sur la substitution du Cu par du Li (0 a 40%), afin d'elucider les proprietes electrocatalytiques des oxydes LixCuy-xCo3-yO4. Ces oxydes, prepares sous forme de poudres par decomposition thermique des nitrates precurseurs entre 300 et 500°C, ont montre (DRX et FTIR) une structure spinelle inverse non-stcechiometrique avec une diminution du volume de la maille cristalline. La surface specifique par BET est d'environ 6 m2 g-1. Le pcn, obtenu par titrage acido-basique, a indique une diminution de la force du lien M-OH avec le taux du Li dans l'oxyde. Les analyses par XPS, realisees sur des films d'oxyde prepares par nebulisation reactive sur un substrat lisse de nickel, revelent un enrichissement de la surface en Cu a partir de 30% Li, et la presence des cations de surface Co2+, Co3+, Cu +, Cu2+ et Cu3+. La concentration de ce dernier montre un maximum a 10 et 20% Li. Suite a la substitution du Cu par du Li, la compensation de la charge serait assuree principalement par la formation d'especes Cu3+ pour les oxydes contenant jusqu'a 20% Li, et par la formation d'especes Co3+ aux taux de substitution superieurs. Les micrographies MEB montrent une morphologie hemispherique des particules d'oxyde reparties uniformement sur le substrat

  6. [Serum lactate as a biomarker of severe sepsis in children with cancer, neutropenia and fever].

    PubMed

    Pacheco-Rosas, Daniel Octavio; Huelgas-Plaza, Ana Celia; Miranda-Novales, María Guadalupe

    2014-01-01

    INTRODUCCIÓN: la neutropenia es una complicación frecuente secundaria a la quimioterapia en los pacientes con cáncer, en quienes la prevalencia de sepsis es de 12.9 a 17.4 % y la letalidad es de 16 %. El objetivo de este estudio fue determinar la utilidad del lactato como biomarcador de sepsis grave en niños con cáncer, fiebre y neutropenia. MÉTODOS: se realizó un estudio de prueba diagnóstica fase II. Se midieron los niveles del lactato al ingreso. Los episodios de neutropenia se clasificaron en tres grupos: I, con sepsis II, sin sepsis; III, pacientes neutropénicos sin fiebre (controles). Se calculó sensibilidad, especificidad, valores predictivos positivo y negativo e índices de verosimilitud. El estándar de oro fue el diagnóstico clínico de sepsis grave.

  7. VizieR Online Data Catalog: K2 LC of HD 3167 and Robo-AO image (Vanderburg+, 2016)

    NASA Astrophysics Data System (ADS)

    Vanderburg, A.; Bieryla, A.; Duev, D. A.; Jensen-Clem, R.; Latham, D. W.; Mayo, A. W.; Baranec, C.; Berlind, P.; Kulkarni, S.; Law, N. M.; Nieberding, M. N.; Riddle, R.; Maissa, S.

    2016-11-01

    Kepler observed HD 3167 between 2016 January 3 and March 23 during Campaign 8 of its K2 mission. We observed HD 3167 with the Tillinghast Reflector Echelle Spectrograph (TRES) on the 1.5m telescope at the Fred L. Whipple Observatory on Mt. Hopkins, AZ. We acquired one spectrum with a spectral resolving power of R=44000 on 2016 July 11. We observed HD 3167 with the Robo-AO adaptive optics system installed at the 2.1m telescope at Kitt Peak National Observatory. We observed HD 3167 with an i'-band filter on 2016 July 11, taking images at a rate of 8.6Hz for a total of 120s. (2 data files).

  8. Thermodynamic properties, nonstoichiometry and phase transformation parameters of oxides in the Eu-O system

    NASA Astrophysics Data System (ADS)

    Sukhushina, I.; Vasiljeva, I.; Balabajeva, R.

    1998-01-01

    The influence of nonstoichiometry on the partial thermodynamic properties of oxygen and the {C to B} transformation parameters of europium sesquioxide within a temperature range from 1200 K to 1400 K using e.m.f., DTA and DSC methods, has been determined. A tentative phase diagram in the {Cto B} transformation region is proposed. L'influence de la nonstoechiométrie sur les propriétés thermodynamiques partielles de l'oxygène et sur les paramètres de la transition {C to B} de Eu2O3 dans l'intervalle de températures de 1200 K à 1400 K a été étudiée par les méthodes EMF, DTA, DSC. Une variante de diagramme de phases dans la région de la transition {Cto B} est présentée.

  9. 3D integral imaging with optical processing

    NASA Astrophysics Data System (ADS)

    Martínez-Corral, Manuel; Martínez-Cuenca, Raúl; Saavedra, Genaro; Javidi, Bahram

    2008-04-01

    Integral imaging (InI) systems are imaging devices that provide auto-stereoscopic images of 3D intensity objects. Since the birth of this new technology, InI systems have faced satisfactorily many of their initial drawbacks. Basically, two kind of procedures have been used: digital and optical procedures. The "3D Imaging and Display Group" at the University of Valencia, with the essential collaboration of Prof. Javidi, has centered its efforts in the 3D InI with optical processing. Among other achievements, our Group has proposed the annular amplitude modulation for enlargement of the depth of field, dynamic focusing for reduction of the facet-braiding effect, or the TRES and MATRES devices to enlarge the viewing angle.

  10. Estrellas Wolf-Rayet y el medio interestelar: huellas de una fuerte interacción

    NASA Astrophysics Data System (ADS)

    Cichowolski, S.; Arnal, E. M.

    Se presentan resultados observacionales de un estudio de la distribución de hidrógeno neutro en los alrededores de estrellas Wolf-Rayet (WR) galácticas. Los datos de la línea de 21 cm provienen de observaciones de resolución angular intermedia (9') tomadas con el radiotelescopio de Effelsberg. La muestra está compuesta por cuatro WR de la serie del nitrógeno (WN): WR130, WR131, WR155, WR156 y tres WR de la serie del carbono (WC): WR154, WR117 y WR126. Este análisis ha permitido detectar cavidades y envolturas de HI en expansión presumiblemente vinculadas a dichas estrellas.

  11. Infratentorial congenital glioblastoma multiforme. A rare tumour with a still unknown biology.

    PubMed

    Salas, S; Agut, T; Rovira, C; Canizo, D; Lavarino, C; Garcia-Alix, A

    2016-11-01

    Introduccion. El glioblastoma multiforme congenito representa solo el 3% de los tumores congenitos del sistema nervioso central, y su ubicacion infrantentorial es excepcional. Caso clinico. Recien nacido con un glioblastoma multiforme congenito sin mutacion en el gen TP53 ni inmunorreactividad nuclear p53, que infiltraba practicamente todo el tronco cerebral e invadia tambien estructuras supratentoriales. Conclusiones. Hasta donde sabemos, solo se han referido previamente cuatro casos de localizacion infratentorial, tres en el cerebelo y uno en el tronco del encefalo. La biologia del glioblastoma multiforme congenito no se conoce bien y, a diferencia del glioblastoma multiforme en la edad adulta, las mutaciones en el gen TP53 son poco frecuentes, sin que eso parezca implicar un mejor pronostico. Estas observaciones sugieren que el glioblastoma multiforme con origen en la vida fetal tiene una biologia diferente del que se presenta en otras etapas de la vida.

  12. [Bilateral cerebellopontine arachnoid cyst].

    PubMed

    Gelabert-Gonzalez, M; Aran-Echabe, E; Pita-Buezas, L

    2016-06-16

    Introduccion. Los quistes aracnoideos bilaterales del angulo pontocerebeloso son excepcionales, y unicamente existen tres casos publicados en la bibliografia. Caso clinico. Niña de 14 años, previamente sana, que acude a consultas por presentar cefalea bifrontal de seis semanas de evolucion. La exploracion clinica era normal y la resonancia magnetica craneal mostraba dos lesiones extraaxiales localizadas en ambos angulos pontocerebelosos, siendo ligeramente mayor la izquierda. Las lesiones se comportaban como homogeneamente intensas en T1 e hiperintensas en T2, no captaban contraste y no existia restriccion en las secuencias de difusion. No se indico tratamiento quirurgico. Conclusiones. Los quistes aracnoideos bilaterales situados en el angulo pontocerebeloso son excepcionales. La principal indicacion para el tratamiento quirurgico es la presencia de sintomas o signos neurologicos coincidentes con la localizacion de los quistes.

  13. Sistema Planeta-Satélite. Simulación orbital y potenciales gravitatorios

    NASA Astrophysics Data System (ADS)

    Medina, C.; Carrillo, M.

    Se presenta un programa (desarrollado en Quick Basic 4.5) que simula, en tres dimensiones, el movimiento orbital de un satélite (o luna) alrededor de un planeta, al tiempo que calcula y grafica, en un plano, el potencial gravitatorio del sistema en función de la distancia al planeta. Para la simulación orbital, se emplea la matriz de transformación entre el sistema del planeta y el plano orbital. Para el cálculo y graficación del potencial se aplica un desarrollo en serie hasta el segundo orden, que da cuenta del efecto de achatamiento de los polos, en caso de que éste exista. Las longitudes de los ejes del planeta, la masa de éste y del satélite, sus tamaños aparentes, y los parámetros orbitales son introducidos por el usuario.

  14. Tiempo para un cambio

    NASA Astrophysics Data System (ADS)

    Woltjer, L.

    1987-06-01

    En la reunion celebrada en diciembre dei ano pasado informe al Consejo de mi deseo de terminar mi contrato como Director General de la ESO una vez que fuera aprobado el proyecto dei VLT, que se espera sucedera hacia fines de este aAo. Cuando fue renovada mi designacion hace tres aAos, el Consejo conocia mi intencion de no completar los cinco aAos dei contrato debido a mi deseo de disponer de mas tiempo para otras actividades. Ahora, una vez terminada la fase preparatoria para el VLT, Y habiendose presentado el proyecto formalmente al Consejo el dia 31 de marzo, y esperando su muy probable aprobacion antes dei termino de este ano, me parece que el 10 de enero de 1988 presenta una excelente fecha para que se produzca un cambio en la administracion de la ESO.

  15. Field based analysis of sediment entrainment in two high gradient streams located in Alpine and Andine environments

    NASA Astrophysics Data System (ADS)

    Mao, Luca; Uyttendaele, Geertrui Paula; Iroumé, Andrés; Lenzi, Mario Aristide

    2008-01-01

    This paper presents an analysis of critical thresholds for bedload transport based on field measurements conducted in two small, high gradient streams: the Rio Cordon (Italian Alps) and the Tres Arroyos (Chilean Andes). The threshold of incipient motion was identified by using marked particles displacement and both flood and flow competence approaches. The findings are expressed in terms of Shields parameter, dimensionless discharge, and specific stream power, and are used to identify the effects of relative grain size, relative depth, and bedform resistance. Overall, particle entrainment tends to be size selective, rather than exhibiting equal mobility, and the high values of dimensionless critical shear stress observed at both study sites confirm the additional roughness effects of step-pool morphologies that are very effective in reducing the bed shear stress and causing an apparent increase in critical shear stress.

  16. Susceptibility status of Aedes aegypti (L.) (Diptera: Culicidae) to temephos in Venezuela.

    PubMed

    Alvarez, Leslie C; Ponce, Gustavo; Oviedo, Milagros; Lopez, Beatriz; Flores, Adriana E

    2014-08-01

    Temephos is an insecticide widely used in Venezuela to control the proliferation of the larvae of Aedes aegypti (L.), the principal vector of dengue virus. The aim of this study was to identify the susceptibility to temephos of Ae. aegypti in four locations in western Venezuela: Lara, Tres Esquinas, Ureña and Pampanito. Larval bioassays were conducted on samples collected in 2008 and 2010, and the levels of α- and β-esterases, mixed-function oxidases, glutathione-S-transferase and insensitive acethyl cholinesterase were determined. Larval populations from western Venezuela obtained during 2008 and 2010 were found to be susceptible to temephos, with low resistance ratios and without overexpression of enzymes. The low RR values reveal the effectiveness of temephos in controlling the larval populations of Ae. aegypti. Control strategies must be vigorously monitored to maintain the susceptibility to temephos of these populations of Ae. aegypti. © 2013 Society of Chemical Industry.

  17. Bolometer array developments in the DCMB collaboration

    NASA Astrophysics Data System (ADS)

    Hoffmann, C.; Bélier, B.; Benoit, A.; Bideau, A.; Camus, Ph.; Collin, S.; Dumoulin, L.; Jin, Y.; Marnieros, S.; Monfardini, A.; Swenson, L. J.; Dcmb Collaboration

    In the framework of the DCMB (Développement Concerté de Matrices de Bolomètres) collaboration we develop low temperature bolometer arrays for large field, high resolution imaging in astrophysics. DCMB is a R&D effort funded by CNES and CNRS involving a number of French laboratories. Two parallel developments have been made in this collaboration based on the NbSi alloy either semi-conducting or superconducting depending on the Nb concentration. Multiplexing schemes have been developed and demonstrated for these two options. Here we focus on high impedance bolometers and present two examples of array developments in progress: first, a 23 pixels array for the balloon-borne instrument OLIMPO and, second, 204 pixels for ground based observations with the 30m IRAM telescope.

  18. Nuevos fenómenos en erupciones cometarias

    NASA Astrophysics Data System (ADS)

    Silva, A.

    Se discuten aquí tres procesos físicos novedosos encontrados en la actividad de cometas: 1) El rol de una distribución de granos de hielo como fuente extendida de H2O en la coma, 2) El efecto de una discontinuidad en el plasma cometario, llamada Cometopausa, sobre la excitación del radical OH , y 3) La actividad por erupciones a grandes distancias heliocéntricas (r > 5 AU). Con respecto a 1) y 2), se presentan modelos que ajustan bien con las observaciones. En cuanto a 3), se presentan explicaciones posibles al fenómeno, y se trata el interesante caso de Chirón 2060, basándose en observaciones propias tomadas desde el CASLEO y datos anteriores.

  19. Fitting Formulae and Constraints for the Existence of S-type and P-type Habitable Zones in Binary Systems

    NASA Astrophysics Data System (ADS)

    Wang, Zhaopeng; Cuntz, Manfred

    2017-10-01

    We derive fitting formulae for the quick determination of the existence of S-type and P-type habitable zones (HZs) in binary systems. Based on previous work, we consider the limits of the climatological HZ in binary systems (which sensitively depend on the system parameters) based on a joint constraint encompassing planetary orbital stability and a habitable region for a possible system planet. Additionally, we employ updated results on planetary climate models obtained by Kopparapu and collaborators. Our results are applied to four P-type systems (Kepler-34, Kepler-35, Kepler-413, and Kepler-1647) and two S-type systems (TrES-2 and KOI-1257). Our method allows us to gauge the existence of climatological HZs for these systems in a straightforward manner with detailed consideration of the observational uncertainties. Further applications may include studies of other existing systems as well as systems to be identified through future observational campaigns.

  20. Evidence for the Presence of a Warping of the Ionizing Gas I-Ayer Derived from H166a Emission Observations in the Outer Galaxy

    NASA Astrophysics Data System (ADS)

    Azcarate, I. N.; Cersosimo, J. C.; Colomb, F. R.

    1990-12-01

    RESUMEN Se presentan resultados de un relevamiento de Ia emisi6n de la ifnea H 1 66a en el rango de longitudes galacticas 2700 < 1 <3000 y para tres latitudes galacticas b = 0.00, b = l0.50. De los mismos, resulta que hay evidencia de un alabeo de Ia capa de gas jonizado en el plano galactico, en las partes exteriores de Ia Galaxia. ABSTRACT Results from an H166a emission survey in the Galactic longitude range 2700 < 1 <3000 and for three Galactic latitudes (b = 0.00, b = 0.50), are presented. From these results, there is evidence for the presence of a warping of the ionized gas layer in the galactic plane, in the outer Galaxy. K words: GALAXY-SThUCTURE - RADIO HNES-

  1. Formación estelar en NGC 6357: viendo a través del polvo con Gemini

    NASA Astrophysics Data System (ADS)

    Bosch, G.; Morrell, N.; Barbá, R.

    Presentamos aquí los primeros resultados de fotometría JHKs obtenidos con Flamingos I en el telescopio Gemini Sur. El mosaico comprendido por tres posiciones adyacentes tomadas a lo largo de varios semestres nos permite caracterizar la población estelar en la zona que presenta una interacción más importante entre las estrellas masivas y la nube molecular que les dió origen. Los diagramas color-magnitud nos permiten identificar numerosas fuentes con exceso infrarrojo, la mayoría de ellas imposible de detectarse en el rango óptico debido a la fuerte absorción del polvo presente en la región. Es altamente probable que la mayoría de estas fuentes con exceso sean protoestrellas, aunque es necesario realizar espectroscopía infrarroja de las mismas para confirmar su naturaleza.

  2. Miroirs multicouches C/SI a incidence normale pour la region spectrale 25-40 nanometres

    NASA Astrophysics Data System (ADS)

    Grigonis, Marius

    Nous avons propose la nouvelle combinaison de materiaux, C/Si, pour la fabrication de miroirs multicouches a incidence normale dans la region spectrale 25-40 nm. Les resultats experimentaux montrent que cette combinaison possede une reflectivite d'environ ~25% dans la region spectrale 25-33 nm et une reflectivite d'environ ~23% dans la region spectrale 33-40 nm. Ces valeurs de reflectivite sont les plus grandes obtenues jusqu'a maintenant dans la region spectrale 25-40 nm. Les miroirs multicouches ont ete par la suite caracterises par microscopie electronique a transmission, par diverses techniques de diffraction des rayons X et par spectroscopies d'electrons AES et ESCA. La resistance des miroirs aux temperatures elevees a ete egalement etudiee. Les resultats fournis par les methodes de caracterisation indiquent que cette combinaison possede des caracteristiques tres prometteuses pour son application comme miroir pour les rayons X mous.

  3. [Difficult for intubation in a simulator with laryngoscope with and without mirror].

    PubMed

    Almaraz-Ibarra, Manuel; López-Garcés, Víctor Manuel; Amador-Licona, Norma; Pérez-Aguilar, Ramón

    2014-01-01

    INTRODUCCIÓN: el laringoscopio con espejo es usado frecuentemente en pacientes con variaciones anatómicas porque mejora la visibilidad de la epiglotis y acorta el tiempo de intubación. El objetivo de esta investigación fue comparar el grado de dificultad de la intubación con laringoscopio dotado de hoja curva sin espejo (Macintosh) adversus laringoscopio con espejo (Siker) en un simulador, en anestesiólogos de diferentes categorías. MÉTODOS: estudio transversal comparativo de 29 residentes y 21 médicos de base, quienes tuvieron tres intentos de 30 segundos cada uno para intubar con cada laringoscopio en dos escenarios distintos. Se registró el tiempo y el número de intento en el que se logró la intubación exitosa. Los datos se procesaron en el programa Statistica versión 6.

  4. Aerodynamics and Acoustics of Propellers, Conference Proceedings of the Fluid Dynamics Symposium Held at Toronto, Canada on 1-4 October 1984

    DTIC Science & Technology

    1985-02-01

    I—g-r—JJ MnM fr2 + V,1 ^ ♦ ßV Pn P ̂ ’"Xl -(^R) - ■’ -(^r)] where F, = 8qrt( nj ♦ ßp^6* + ^^ > * n*.* ^ o^pi « Bqrt( n* + ß; ß ej + ß’S...Figure 7 ’ > i5-i; I ViSU I * I <, * *’• ■5 B. 0,i* ».*’• «n at« oil «, ej «9* s radiales des trajectolres tourbillonnaires...I’ordre de 35 % et de 55 %. L’influence de la motorisation sur les derivees aerodynamiques laterales et transversales est done elle-aussi tres

  5. Évolution de la surface de plasticité sous chargement biaxial dans un acier inoxydable duplex

    NASA Astrophysics Data System (ADS)

    Aubin, V.; Quaegebeur, P.; Degallaix, S.

    2002-12-01

    Nous proposons une méthodologie de mesure automatique de la surface de plasticité pendant des chargements cycliques biaxiaux. La surface de plasticité est mesurée de manière discrète avec un faible offset de déformation plastique (2 10^{-5}) et des paramètres de mesure optimisés. La méthode est appliquée à un acier inoxydable duplex soumis à un trajet de chargement non-proportionnel. Les résultats montrent une distorsion et une translation de la surface de plasticité sans changement de taille. La méthode présentée permet également de vérifier la normalité de la vitesse d'écoulement plastique par rapport à la surface de plasticité.

  6. [Learning to read Pierre Lombard's Books of Sentences at the University of Paris in the 13(th) and 14 (th) centuries].

    PubMed

    Angotti, Claire

    2012-01-01

    In the middle ages, the ability to offer an oral commentary on Pierre Lombard's Books of Sentences was seen as an essential step in the training of masters of theology (maîtres régents). This was an exercise done by bachelors. While the first university statutes say little about this exercise, later statutes, particularly in the 14(th) century, suggest that it was carried out by following very strict guidelines. This article posits that students actually followed a number of « model commentaries » because the masters applied the methodology of exegesis. Looking at the manuscripts and their critical apparatus, this article offers a better understanding of the lectio of the Books of Sentences.

  7. Marginally Stable Swarms Are Flexible and Efficient

    NASA Astrophysics Data System (ADS)

    Bonabeau, Eric

    1996-02-01

    A simple model of cooperative food retrieval in ants is introduced to illustrate how a many-body biological system such as a swarm can exhibit an efficient and flexible behavior if it is close to an instability, but in a region where structured patterns of activity can grow and be maintained. Un modèle simplifié de fourragement coopératif chez les fourmis est introduit pour illustrer l'idée qu'un système biologique collectif tel qu'un essaim peut être à la fois flexible et efficace si les paramètres comportementaux qui le caractérisent se situent au voisinage d'une zone d'instabilité, mais dans une région où une activité structurée peut se développer et se maintenir.

  8. INFLATING HOT JUPITERS WITH OHMIC DISSIPATION

    SciTech Connect

    Batygin, Konstantin; Stevenson, David J.

    2010-05-10

    We present a new, magnetohydrodynamic mechanism for inflation of close-in giant extrasolar planets. The idea behind the mechanism is that current, which is induced through interaction of atmospheric winds and the planetary magnetic field, results in significant Ohmic dissipation of energy in the interior. We develop an analytical model for computation of interior Ohmic dissipation, with a simplified treatment of the atmosphere. We apply our model to HD209458b, Tres-4b, and HD189733b. With conservative assumptions for wind speed and field strength, our model predicts a generated power that appears to be large enough to maintain the transit radii, opening an unexplored avenue toward solving a decade-old puzzle of extrasolar gas giant radius anomalies.

  9. Preliminary geologic studies of Sierra El Aguajito (Baja California, Mexico): a resurgent-type caldera

    NASA Astrophysics Data System (ADS)

    Garduño-Monroy, V. H.; Vargas-Ledezma, H.; Campos-Enriquez, J. O.

    1993-12-01

    Geologic field studies conducted in the Quaternary volcanic field of Tres Virgenes (State of Baja California Sur, Mexico) revealed the existence of a resurgent caldera. The caldera's eruptive products, the Aguajito sequence, overlie the products of the nearby Reforma caldera (Reforma sequence) whose youngest products have already been dated as Quaternary. The rim of the Aguajito caldera is inferred by the existence of an arcuate alignment of rhyolitic domes. The mean diameter of this subcircular feature is 10 km. The volume of its mapped acidic products is a minimum of 10 km 3. Several horizons within the sequence contain shells. K/Ar dates of the ignimbrites and domes of El Aguajito formation confirm that the unit are Pleistocene. The detailed stratigraphy also shows the evolution of a marine regression partly related to the caldera.

  10. Banderas Rift Zone: A plausible NW limit of the Jalisco Block

    NASA Astrophysics Data System (ADS)

    Alvarez, Román

    2002-10-01

    Echo soundings recently made in Bahía de Banderas show that this region is a graben with steeply dipping walls and several basins; it is the offshore continuation of the Valle de Banderas graben, and of a branching rift (Río Ameca rift) originating in the Tepic-Zacoalco rift zone. The general trend of the three structures is ENE with some NE trending offsets, and they have a total length of 150 km; this Banderas Rift Zone is proposed as the NW limit of the Jalisco block. The existence of this limit suggests that there is another platelet, or block, between the Jalisco block and a portion of the Rivera plate, probably bounded by the Tres Marías escarpment, the Jalisco block and the North America plate.

  11. Use of LANDSAT images to study cerrado vegetation. [Mato Grosso Sul, Brazil

    NASA Technical Reports Server (NTRS)

    Parada, N. D. J. (Principal Investigator); Filho, P. H.

    1982-01-01

    Channel 5 and 7 LANDSAT imagery at the scale of 1:250,000 made during passes in the dry and rainy seasons were used to select the optimal season for cerrado characterization in Mato Grosso do Sul State. The study area is located around the cities of Campo Grande and Tres Lagoas, a region being used for reforestation and rangeland activities. Imagery acquired during the dry season permitted a good discrimination between "cerrado" (woodsy pasture) vegetation and reforestation. In relation to the altered areas, only the recently modified area presented good discrimination of cerrado vegetation. Imagery of the rainy season did not provide a reasonable separation between cerrado and reforestation areas but the altered area could be easily discriminated.

  12. Angiomes plans et laser à colorant pulsé: étude des facteurs pronostiques dans une série marocaine de 74 cas

    PubMed Central

    Baghad, Bouchra; Chiheb, Soumiya; Benchikhi, Hakima

    2016-01-01

    Le laser à colorant pulsé (LCP) est actuellement le traitement de référence des Angiomes Plans (AP). Cependant, les critères cliniques prédictifs d'une bonne ou d'une mauvaise réponse ne sont pas encore clairement établis dans notre contexte. Notre but était de déterminer les facteurs de mauvaise /bonne réponse des AP traités par le LCP dans la population marocaine. Une étude rétrospective des patients suivis pour AP a été réalisée au service de dermatologie du CHU Ibn Rochd de Casablanca entre Janvier 2008 et Décembre 2013. Nous avons collecté les paramètres cliniques suivants : âge, sexe, localisation, antécédents, paramètres utilisés, nombre de séances, phototype et la satisfaction des médecins soignants basée sur le blanchiment des lésions. La bonne réponse a été définie par le palissement de 50% des lésions au bout de la 6ème séance. Les patients ont été contactés par téléphone afin d'évaluer leur degré de satisfaction. Ces résultats ont été corrélés aux paramètres cliniques sus cités. Un seuil de signification de 0.05 a été utilisé. Soixante-quatorze patients ont été éligibles. Le sexe féminin représentait 69% et l'âge médian était de 18 ans. La localisation au visage était prédominante (94%). L'étude comparative des groupes bons / mauvais répondeurs a montré que l'âge moyen du groupe bon répondeur était inférieur au groupe mauvais répondeur avec une différence significative (p = 0.047). Le nombre de séances du groupe bon répondeur était plus élevé (p = 0.044). Les paramètres étaient variables d'un patient à un autre. Aucune différence n'a été notée concernant le type de peau entre les deux groupes. La localisation la mieux blanchie était la zone V2. Cette étude a montré que les AP pris en charge à un âge jeune en plusieurs séances avaient une réponse thérapeutique supérieure dans notre contexte. Ceci implique l'intérêt du diagnostic précoce et une prise en charge

  13. The evolution of hierarchical triple star-systems

    NASA Astrophysics Data System (ADS)

    Toonen, Silvia; Hamers, Adrian; Portegies Zwart, Simon

    2016-12-01

    Field stars are frequently formed in pairs, and many of these binaries are part of triples or even higher-order systems. Even though, the principles of single stellar evolution and binary evolution, have been accepted for a long time, the long-term evolution of stellar triples is poorly understood. The presence of a third star in an orbit around a binary system can significantly alter the evolution of those stars and the binary system. The rich dynamical behaviour in three-body systems can give rise to Lidov-Kozai cycles, in which the eccentricity of the inner orbit and the inclination between the inner and outer orbit vary periodically. In turn, this can lead to an enhancement of tidal effects (tidal friction), gravitational-wave emission and stellar interactions such as mass transfer and collisions. The lack of a self-consistent treatment of triple evolution, including both three-body dynamics as well as stellar evolution, hinders the systematic study and general understanding of the long-term evolution of triple systems. In this paper, we aim to address some of these hiatus, by discussing the dominant physical processes of hierarchical triple evolution, and presenting heuristic recipes for these processes. To improve our understanding on hierarchical stellar triples, these descriptions are implemented in a public source code TrES, which combines three-body dynamics (based on the secular approach) with stellar evolution and their mutual influences. Note that modelling through a phase of stable mass transfer in an eccentric orbit is currently not implemented in TrES, but can be implemented with the appropriate methodology at a later stage.

  14. Bathymetry, Crustal Imaging and Tectonics in the South of Islas Marias (Nayarit, Mexico)

    NASA Astrophysics Data System (ADS)

    Carrillo de la Cruz, J. L.; Nunez, D.; Nuñez-Cornu, F. J.; Barba, D. C., Sr.; Gonzalez-Fernandez, A.; Escalona, F.; Danobeitia, J.

    2016-12-01

    The seismic activity of the Mexican Pacific margin is principally due to the subduction process of the Rivera plate beneath the North America plate and Jalisco Block. In 2014, the TSUJAL geophysical experiment provided new data to archive a better knowledge about the crustal structure and their implications in seismic and tsunamigenic potential hazards. In this study, we present the processed and analyzed bathymetric, WAS and MCS data along the TS11 seismic transect (115 km length) across the southern of Islas Marías. The seismic sources used in this work correspond to the airgun shots provided by RRS James Cook every 120 s and 50 m to recover WAS and MCS data, respectively. These sources were registered by a network of 4 OBS and 30 land seismic stations and the MCS data were acquired with a 5.85 km length streamer with a 468 active channels. Meanwhile, the bathymetric data were obtained with 2 multibeam echo sounders, EM120 and EM710, obtaining a 75 - 80 m of grid resolution. After data processing and interpretation, we have obtained information about two basins (De la Cruz Basin and Tres Marias basin) delimitated with geological lineaments alongside the Sierra de Cleofas from bathymetry, being Tres Marias basin the deepest zone in the area. Moreover, the main canyon founded in this study (De la Cruz Canyon) has been classified as type 3, according to Harris & Whiteway (2011). From seismic data, we have determined the shallow and deep crustal structure of the northern part of Rivera plate subduction with a dip angle between 6° and 8°. In this region, the oceanic crust is 10 km deep, increasing up to 20 km, while the deepest layers of the upper mantle have been determined at 45-50 km.

  15. [Clinical characteristics of the thyroid follicular carcinoma].

    PubMed

    Gutiérrez-Hermosillo, Hugo; Tamez-Peréz, Héctor Eloy; Díaz de León-Gonzaléz, Enrique; Gutiérrez-Hermosillo, Violeta; Avila-Sanchéz, Jair

    2013-01-01

    Introducción: se ha identificado carcinoma folicular en 39 % de los pacientes con nódulos tiroideos cuya citología prequirúrgica ha indicado resultados indeterminados. El propósito de esta investigación fue conocer la prevalencia de esta entidad en un hospital de concentración. Métodos: se buscaron los reportes quirúrgicos con diagnóstico de carcinoma folicular. Se registró tamaño del tumor, sexo y edad del paciente, diagnósticos pre y posquirúrgico y patologías asociadas. Resultados: se diagnosticó carcinoma folicular en 35 pacientes: 30 mujeres (85 %) y cinco hombres (15 %). La edad en los hombres fue de 57 ± 6.6 y de 44 ± 16.9 en las mujeres. Los diagnósticos preoperatorios fueron carcinoma folicular en 14 (40 %), cáncer tiroideo en seis (17.1 %), adenoma folicular en cuatro (11.4 %), bocio en tres (8.5 %), nódulo tiroideo en tres (8.5 %); carcinoma papilar, tumor de tiroides, carcinoma poco diferenciado de tiroides, adenocarcinoma folicular bien diferenciado, cáncer medular en un paciente (2.8 %) cada uno. Las patologías asociadas fueron tiroiditis de Hashimoto y carcinoma papilar contralateral, con dos pacientes cada uno (5.6 %). Conclusiones: la edad de los pacientes y la presentación clínica del carcinoma folicular difirieron de las informadas en otras investigaciones.

  16. Standardissimo. Les limitations théoriques du Modèle Standard. Quelles réponses y apporter?

    NASA Astrophysics Data System (ADS)

    Renard, F. M.

    Nous présentons I 'état du Modèle Standard des interactions fortes, faibles et électromagnétiques. Après une description rapide de ses 3 secteurs, secteur de jauge (radiation), secteur fermionique (matière) et secteur scalaire (génération des masses), nous insistons sur le grand nombre de paramètres libres et sur les choix arbitraires qu'il a fallu faire dans l'élaboration du modèle. Nous faisons ressortir les problèmes techniques non résolus et nous dressons la liste des questions fondamentales restées sans réponses. Nous passons ensuite en revue les idées et méthodes proposées pour répondre à ces questions. Elles utilisent essentiellement 3 voies différentes. La première consiste à requérir plus de symétrie (extension du modèle, symétrie Gauche-Droite, Grandes Unifications, Supersymétrie,...). La seconde contient les diverses alternatives au Modèle Standard impliquant des modifications dans certains secteurs (par exemple le secteur scalaire avec le modèle de la Technicouleur) ou de façon plus violente l'hypothèse d'une sous-structure des leptons, des quarks et des bosons W et Z eux-mêmes. Une dernière voie cherche à justifier les particularités du Modèle Standard et relier ses paramètres libres en se basant sur des principes de cohérence interne du modèle. Les conséquences observables de ces diverses approches sont dans chaque cas mentionnées.

  17. BEER ANALYSIS OF KEPLER AND CoRoT LIGHT CURVES. II. EVIDENCE FOR SUPERROTATION IN THE PHASE CURVES OF THREE KEPLER HOT JUPITERS

    SciTech Connect

    Faigler, S.; Mazeh, T.

    2015-02-10

    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  18. Real-time pose estimation of devices from x-ray images: Application to x-ray/echo registration for cardiac interventions

    PubMed Central

    Hatt, Charles R.; Speidel, Michael A.; Raval, Amish N.

    2016-01-01

    In recent years, registration between x-ray fluoroscopy (XRF) and transesophageal echocardiography (TEE) has been rapidly developed, validated, and translated to the clinic as a tool for advanced image guidance of structural heart interventions. This technology relies on accurate pose-estimation of the TEE probe via standard 2D/3D registration methods. It has been shown that latencies caused by slow registrations can result in errors during untracked frames, and a real-time (> 15 hz) tracking algorithm is needed to minimize these errors. This paper presents two novel similarity metrics designed for accurate, robust, and extremely fast pose-estimation of devices from XRF images: Direct Splat Correlation (DSC) and Patch Gradient Correlation (PGC). Both metrics were implemented in CUDA C, and validated on simulated and clinical datasets against prior methods presented in the literature. It was shown that by combining DSC and PGC in a hybrid method (HYB), target registration errors comparable to previously reported methods were achieved, but at much higher speeds and lower failure rates. In simulated datasets, the proposed HYB method achieved a median projected target registration error (pTRE) of 0.33 mm and a mean registration frame-rate of 12.1 hz, while previously published methods produced median pTREs greater than 1.5 mm and mean registration frame-rates less than 4 hz. In clinical datasets, the HYB method achieved a median pTRE of 1.1 mm and a mean registration frame-rate of 20.5 hz, while previously published methods produced median pTREs greater than 1.3 mm and mean registration frame-rates less than 12 hz. The proposed hybrid method also had much lower failure rates than previously published methods. PMID:27179366

  19. Toward Space-like Photometric Precision from the Ground with Beam-shaping Diffusers

    NASA Astrophysics Data System (ADS)

    Stefansson, Gudmundur; Mahadevan, Suvrath; Hebb, Leslie; Wisniewski, John; Huehnerhoff, Joseph; Morris, Brett; Halverson, Sam; Zhao, Ming; Wright, Jason; O’rourke, Joseph; Knutson, Heather; Hawley, Suzanne; Kanodia, Shubham; Li, Yiting; Hagen, Lea M. Z.; Liu, Leo J.; Beatty, Thomas; Bender, Chad; Robertson, Paul; Dembicky, Jack; Gray, Candace; Ketzeback, William; McMillan, Russet; Rudyk, Theodore

    2017-10-01

    We demonstrate a path to hitherto unachievable differential photometric precisions from the ground, both in the optical and near-infrared (NIR), using custom-fabricated beam-shaping diffusers produced using specialized nanofabrication techniques. Such diffusers mold the focal plane image of a star into a broad and stable top-hat shape, minimizing photometric errors due to non-uniform pixel response, atmospheric seeing effects, imperfect guiding, and telescope-induced variable aberrations seen in defocusing. This PSF reshaping significantly increases the achievable dynamic range of our observations, increasing our observing efficiency and thus better averages over scintillation. Diffusers work in both collimated and converging beams. We present diffuser-assisted optical observations demonstrating {62}-16+26 ppm precision in 30 minute bins on a nearby bright star 16 Cygni A (V = 5.95) using the ARC 3.5 m telescope—within a factor of ∼2 of Kepler's photometric precision on the same star. We also show a transit of WASP-85-Ab (V = 11.2) and TRES-3b (V = 12.4), where the residuals bin down to {180}-41+66 ppm in 30 minute bins for WASP-85-Ab—a factor of ∼4 of the precision achieved by the K2 mission on this target—and to 101 ppm for TRES-3b. In the NIR, where diffusers may provide even more significant improvements over the current state of the art, our preliminary tests demonstrated {137}-36+64 ppm precision for a K S = 10.8 star on the 200 inch Hale Telescope. These photometric precisions match or surpass the expected photometric precisions of TESS for the same magnitude range. This technology is inexpensive, scalable, easily adaptable, and can have an important and immediate impact on the observations of transits and secondary eclipses of exoplanets.

  20. OPTICAL PHASE CURVES OF KEPLER EXOPLANETS

    SciTech Connect

    Esteves, Lisa J.; De Mooij, Ernst J. W.; Jayawardhana, Ray E-mail: demooij@astro.utoronto.ca

    2013-07-20

    We conducted a comprehensive search for optical phase variations of all close-in (a/R{sub *} < 10) planet candidates in 15 quarters of Kepler space telescope data. After correcting for systematics, we found eight systems that show secondary eclipses as well as phase variations. Of these, five (Kepler-5, Kepler-6, Kepler-8, KOI-64, and KOI-2133) are new and three (TrES-2, HAT-P-7, and KOI-13) have published phase curves, albeit with many fewer observations. We model the full phase curve of each planet candidate, including the primary and secondary transits, and derive their albedos, dayside and nightside temperatures, ellipsoidal variations, and Doppler beaming. We find that KOI-64 and KOI-2133 have nightside temperatures well above their equilibrium values (while KOI-2133 also has an albedo, >1), so we conclude that they are likely to be self-luminous objects rather than planets. The other six candidates have characteristics consistent with their being planets with low geometric albedos (<0.3). For TrES-2 and KOI-13, the Kepler bandpass appears to probe atmospheric layers hotter than the planet's equilibrium temperature. For KOI-13, we detect a never-before-seen third cosine harmonic with an amplitude of 6.7 {+-} 0.3 ppm and a phase shift of -1.1 {+-} 0.1 rad in the phase curve residual, possibly due to its spin-orbit misalignment. We report derived planetary parameters for all six planets, including masses from ellipsoidal variations and Doppler beaming, and compare our results to published values when available. Our results nearly double the number of Kepler exoplanets with measured phase curve variations, thus providing valuable constraints on the properties of hot Jupiters.

  1. 3, 3'5 Triiodo L thyronine induces apoptosis in human breast cancer MCF-7 cells, repressing SMP30 expression through negative thyroid response elements.

    PubMed

    Sar, Pranati; Peter, Rosalima; Rath, Bandita; Das Mohapatra, Alok; Mishra, Sandip K

    2011-01-01

    Thyroid hormones regulate cell proliferation, differentiation as well as apoptosis. However molecular mechanism underlying apoptosis as a result of thyroid hormone signaling is poorly understood. The antiapoptotic role of Senescence Marker Protein-30 (SMP30) has been characterized in response to varieties of stimuli as well as in knock out model. Our earlier data suggest that thyroid hormone 3, 3'5 Triiodo L Thyronine (T(3)), represses SMP30 in rat liver. In highly metastatic MCF-7, human breast cancer cell line T3 treatment repressed SMP30 expression leading to enhanced apoptosis. Analysis by flow cytometry and other techniques revealed that overexpression and silencing of SMP30 in MCF-7 resulted in decelerated and accelerated apoptosis respectively. In order to identify the cis-acting elements involved in this regulation, we have analyzed hormone responsiveness of transiently transfected hSMP30 promoter deletion reporter vectors in MCF-7 cells. As opposed to the expected epigenetic outcome, thyroid hormone down regulated hSMP30 promoter activity despite enhanced recruitment of acetylated H3 on thyroid response elements (TREs). From the stand point of established epigenetic concept we have categorised these two TREs as negative response elements. Our attempt of siRNA mediated silencing of TRβ, reduced the fold of repression of SMP30 gene expression. In presence of thyroid hormone, Trichostatin- A (TSA), which is a Histone deacetylase (HDAC) inhibitor further inhibited SMP30 promoter activity. The above findings are in support of categorisation of both the thyroid response element as negative response elements as usually TSA should have reversed the repressions. This is the first report of novel mechanistic insights into the remarkable downregulation of SMP30 gene expression by thyroid hormone which in turn induces apoptosis in MCF-7 human breast cancer cells. We believe that our study represents a good ground for future effort to develop new therapeutic

  2. Systematic Uncertainties of Glacial Chronologies Based on Surface Exposure Dating

    NASA Astrophysics Data System (ADS)

    Ilgner, J.; Zech, R.; Baechtiger, C.; Kubik, P. W.; Veit, H.

    2008-12-01

    Surface exposure dating using terrestrial cosmogenic nuclides provides the opportunity to establish glacial chronologies in semi-arid high mountain regions, where the lack of organic material for radiocarbon dating has limited our knowledge about the timing and the causes of glacial advances so far. However, several scaling systems and calculation schemes exist. This can result in significant systematic uncertainties, particularly at high altitudes as e.g. in the Central Andes. We present and discuss previously published exposure ages from Bolivia and Argentina in order to illustrate the extent of the current uncertainties. It is neither possible to unambiguously determine whether the local Last Glacial Maximum (local LGM) in the tropics occurred in-phase with or predated the global LGM, nor can the subsequent Late Glacial stages be dated accurately enough to infer temperature or precipitation changes at millennial-scale timescales. We then also present new results from the Tres Lagunas in the Sierra de Santa Victoria, NW Argentina. There we can compare our glacial exposure age chronology with bracketing radiocarbon ages from lake sediments. The Tres Lagunas may thus serve as a high-altitude calibration site for 10Be dating. Paleoclimatically, we conclude that glacial deposits in NW-Argentina document glacial advances in-phase with the global LGM, but that the prominent moraines there date to the Late Glacial. This coincides with the well-documented intensification and/or southward shift of the tropical circulation and reflects the strong precipitation-sensitivity of glaciers in arid and semi-arid environments.

  3. Optical Phase Curves of Kepler Exoplanets

    NASA Astrophysics Data System (ADS)

    Esteves, Lisa J.; De Mooij, Ernst J. W.; Jayawardhana, Ray

    2013-07-01

    We conducted a comprehensive search for optical phase variations of all close-in (a/R sstarf < 10) planet candidates in 15 quarters of Kepler space telescope data. After correcting for systematics, we found eight systems that show secondary eclipses as well as phase variations. Of these, five (Kepler-5, Kepler-6, Kepler-8, KOI-64, and KOI-2133) are new and three (TrES-2, HAT-P-7, and KOI-13) have published phase curves, albeit with many fewer observations. We model the full phase curve of each planet candidate, including the primary and secondary transits, and derive their albedos, dayside and nightside temperatures, ellipsoidal variations, and Doppler beaming. We find that KOI-64 and KOI-2133 have nightside temperatures well above their equilibrium values (while KOI-2133 also has an albedo, >1), so we conclude that they are likely to be self-luminous objects rather than planets. The other six candidates have characteristics consistent with their being planets with low geometric albedos (<0.3). For TrES-2 and KOI-13, the Kepler bandpass appears to probe atmospheric layers hotter than the planet's equilibrium temperature. For KOI-13, we detect a never-before-seen third cosine harmonic with an amplitude of 6.7 ± 0.3 ppm and a phase shift of -1.1 ± 0.1 rad in the phase curve residual, possibly due to its spin-orbit misalignment. We report derived planetary parameters for all six planets, including masses from ellipsoidal variations and Doppler beaming, and compare our results to published values when available. Our results nearly double the number of Kepler exoplanets with measured phase curve variations, thus providing valuable constraints on the properties of hot Jupiters.

  4. Host to Hot Jupiter

    NASA Image and Video Library

    2009-04-16

    This image zooms into a small portion of NASA Kepler full field of view -- an expansive, 100-square-degree patch of sky in our Milky Way galaxy. At the center of the field is a star with a known "hot Jupiter" planet, named "TrES-2," zipping closely around it every 2.5 days. Kepler will observe TrES-2 and other known planets as a test to demonstrate that it is working properly, and to obtain new information about those planets. The area pictured is one-thousandth of Kepler's full field of view, and shows hundreds of stars at the very edge of the constellation Cygnus. The image has been color-coded so that brighter stars appear white, and fainter stars, red. It is a 60-second exposure, taken on April 8, 2009, one day after the spacecraft's dust cover was jettisoned. Kepler was designed to hunt for planets like Earth. The mission will spend the next three-and-a-half years staring at the same stars, looking for periodic dips in brightness. Such dips occur when planets cross in front of their stars from our point of view in the galaxy, partially blocking the starlight. To achieve the level of precision needed to spot planets as small as Earth, Kepler's images are intentionally blurred slightly. This minimizes the number of saturated stars. Saturation, or "blooming," occurs when the brightest stars overload the individual pixels in the detectors, causing the signal to spill out into nearby pixels. http://photojournal.jpl.nasa.gov/catalog/PIA11985

  5. H-bonding vs non-H-bonding in 100% pyrene methacrylate comb polymers: self-assembly probed by time-resolved emission spectra and temperature dependent fluorescence.

    PubMed

    Kaushlendra, K; Asha, S K

    2014-05-08

    The differences in self-organization behavior in novel 100% pyrene labeled comb methacrylate polymers probed as a function of their varied origins of excimer formation are presented. The different structural variations in the polymers included the presence or absence of hydrogen bonding interactions in the form of urethane linkages, short or long alkyl spacer segments separating the pyrene units from the polymer backbone and linear versus kinked urethane linkage. The effect of variable concentration and temperature on the chemical shift of the NH proton of the urethane linkage was probed using (1)H NMR experiments conducted at temperatures varying from 25 to 70 °C at two different concentrations (2.5 and 25 mmol) in DMSO-d6 as solvent. The photophysical properties of the polymers in dilute DMF solutions were investigated by steady state emission, fluorescence decay studies, time-resolved emission spectra (TRES), and variable temperature emission studies. It was observed that the polymer poly(PBH) having a non-hydrogen-bondable ester linkage in the pendant chains formed an excimer completely via a static mechanism and the ground state aggregate species were not broken even at higher temperatures. The polymer poly(PIC) having a short hydrogen-bondable urethane linkage formed an excimer via a static as well as dynamic mechanism. The other hydrogen-bondable urethane methacrylate polymers having a linear linker poly(PHH) and kinked linker (PIHP) formed excimer mostly via a dynamic mechanism with a very small contribution from the static route. The TRES studies carried out for the polymers provided significant insight into the excimer formation mechanism in these polymers. The variable temperature fluorescence studies highlighted the differences in the H-bonded vs non-H-bonded polymer as a function of their excimer recovery upon cooling.

  6. [Diagnostic, prognostic and therapeutic implications of transcranial color-coded duplex sonography in acute ischemic stroke: TIBI and COGIF scores validation].

    PubMed

    Sobrino-Garcia, P; Garcia-Pastor, A; Garcia-Arratibel, A; Dominguez-Rubio, R; Rodriguez-Cruz, P M; Iglesias-Mohedano, A M; Diaz-Otero, F; Vazquez-Alen, P; Fernandez-Bullido, Y; Villanueva-Osorio, J A; Gil-Nunez, A

    2016-10-16

    Objetivo. Describir la informacion aportada por el duplex color transcraneal (DCTC) en pacientes con ictus isquemico agudo, analizando la relacion entre los hallazgos del DCTC, la gravedad y el pronostico, asi como su utilidad en la toma de decisiones terapeuticas. Pacientes y metodos. Analizamos los DCTC realizados a pacientes con ictus agudo de menos de seis horas de evolucion. Recogimos la existencia de oclusion arterial empleando las clasificaciones TIBI (Thrombolysis in Brain Ischemia) y COGIF (Consensus on Grading Intracranial Flow Obstruction). Determinamos la recanalizacion arterial a las 24 horas del ictus empleando criterios TIBI y COGIF. Consideramos buena evolucion funcional puntuaciones en la escala de Rankin de 0 a 2 a los tres meses. Resultados. Realizamos DCTC en 104 pacientes, 85 tratados con trombolisis intravenosa. Objetivamos oclusion arterial en el 79,8%. La deteccion de una oclusion arterial mediante DCTC permitio indicar tratamiento endovascular en el 23,1% de los pacientes. La presencia de oclusion arterial se asocio a mayor gravedad del ictus. Detectamos recanalizacion arterial en el 44,1% segun los criterios TIBI y en el 45,8% segun los criterios COGIF. El 80,8% de los pacientes que recanalizaron y solo el 39,5% de los que no recanalizaron obtuvieron una buena evolucion funcional a los tres meses. La recanalizacion dependio de la localizacion de la oclusion arterial. Conclusiones. El DCTC es util para deteccion y localizacion de oclusion arterial, aporta informacion pronostica valiosa y permite seleccionar pacientes para el empleo de terapias endovasculares. La informacion aportada por las clasificaciones TIBI y COGIF es equiparable.

  7. [Children hospitalized with influenza A H1N1. The field of private care during the pandemic in Mexico].

    PubMed

    Iglesias-Leboreiro, José; Rendón-Macías, Mario Enrique; Marín-Romero, Margarito; Bernárdez-Zapata, Isabel; Del Carmen López-Enríquez, Claudia

    2013-01-01

    Introducción: la pandemia de influenza A H1N1 en México generó gran preocupación por su potencial alta letalidad. El objetivo de esta investigación fue analizar las características y evolución de los pacientes pediátricos atendidos en un hospital privado. Métodos: se incluyeron todos los casos hospitalizados de abril de 2009 a marzo de 2010 con diagnóstico confirmado de influenza A H1N1 por medio de RT-PCR. Se analizaron los datos clínicos, radiológicos y tratamiento de los pacientes. Se determinaron días de estancia, muerte y necesidad de cuidados intensivos. Resultados: fueron hospitalizados 50 niños, 15 menores de tres años de edad (30 %), 23 de tres a cinco años (46 %) y 12 mayores de cinco años (24 %). Ninguno ameritó cuidados en terapia intensiva y no hubo defunciones; 86 % ingresó por fiebre y 40 % con dificultad respiratoria de leve a moderada. En 10 hubo evidencia radiológica de neumonía intersticial, en cuatro de condensación pulmonar y en seis de obstrucción aérea. Todos fueron tratados con oseltamivir y cuatro con antibióticos. La estancia media hospitalaria fue de 48 horas. Todos se egresaron sin complicaciones. Conclusiones: la evolución de los pacientes hospitalizados fue benigna.

  8. [Epidermoid neoplasm of the fourth ventricle. Report of two cases].

    PubMed

    Santos-Franco, Jorge Arturo; Vallejo-Moncada, Cristóbal; Collado-Arce, Griselda; Villalpando-Navarrete, Edgar; Sandoval-Balanzario, M

    2013-01-01

    Introducción: los tumores epidermoides representan 1 % de las neoplasias intracraneales; el ángulo pontocerebeloso es la localización más frecuente y en el cuarto ventrículo son raros. Casos clínicos: caso 1: mujer de 22 años de edad con cefalea intensa de tres meses de evolución. Al ingreso se identificó hipertensión endocraneana. La tomografía mostró hidrocefalia con aumento del volumen del cuarto ventrículo. La paciente fue tratada con derivación ventrículo-peritoneal; posteriormente se extirpó tumoración encapsulada de aspecto perlado. El estudio histológico indicó tumor epidermoide en el cuarto ventrículo. Caso 2: mujer de 44 años de edad con vértigo ocasional de cinco años de evolución, así como con diploplía y disfagia intermitentes de tres años de evolución. Al ingresó se identificó paresia bilateral de los nervios craneales VI y VII. La tomografía computarizada y la resonancia magnética mostraron lesión en el cuatro ventrículo. El manejo fue quirúrgico. Conclusiones: la resonancia magnética es el estudio diagnóstico específico para el diagnóstico del tumor epidermoide del cuarto ventrículo que, sin embargo, puede confundirse con neurocisticercosis. Están indicados la exéresis del quiste y el tratamiento de la hidrocefalia.

  9. [Perinatal infection by rubella virus in breast-fed babies with congenital heart disease].

    PubMed

    Solórzano-Santos, Fortino; Bárcenas-López, Selene Jeannette; Huerta-García, Gloria C; Miranda-Novales, María Guadalupe; Alvarez-Y Muñoz, María Teresa; Vázquez-Rosales, José Guillermo

    2013-01-01

    Introducción: las encuestas seroepidemiológicas sugieren que 20 % de las mujeres en edad fértil es susceptible a la rubéola. El objetivo de esta investigación fue determinar la frecuencia de infección perinatal por el virus de la rubéola en lactantes con cardiopatía congénita. Métodos: estudio prospectivo y transversal de niños menores de un año de edad con diagnóstico de cardiopatía congénita. Se tomaron 3 mL de sangre al binomio madre-hijo y se realizó ELISA de micropartículas para anticuerpos IgG e IgM contra la rubéola. Resultados: se estudiaron 80 pacientes con edad de tres meses; 56 % era del sexo femenino. Las cardiopatías congénitas más frecuentes fueron las comunicaciones interventricular (28.5 %) y la interauricular (17.5 %). La mediana de la edad materna fue de 28 años; 1.25 % de las madres tuvo antecedente de enfermedad febril y exantema durante el embarazo. Se detectaron siete casos (8.75 %) de infección perinatal por el virus de la rubéola, tres cumplieron el criterio de síndrome de rubéola congénita y cuatro de cardiopatía. Conclusiones: se sugiere buscar rubéola congénita en los recién nacidos y lactantes con cardiopatías, como una estrategia para detectar los casos no obvios.

  10. Comparative age and growth of common snook Centropomus undecimalis (Pisces: Centropomidae) from coastal and riverine areas in Southern Mexico.

    PubMed

    Perera-Garcia, Martha A; Mendoza-Carranza, Manuel; Contreras-Sánchez, Wilfrido; Ferrara, Allyse; Huerta-Ortiz, Maricela; Hernández-Gómez, Raúl E

    2013-06-01

    Common snook Centropomus unidecimalis is an important commercial and fishery species in Southern Mexico, however the high exploitation rates have resulted in a strong reduction of its abundances. Since, the information about its population structure is scarce, the objective of the present research was to determine and compare the age structure in four important fishery sites. For this, age and growth of common snook were determined from specimens collected monthly, from July 2006 to March 2008, from two coastal (Barra Bosque and Barra San Pedro) and two riverine (San Pedro and Tres Brazos) commercial fishery sites in Tabasco, Mexico. Age was determined using sectioned saggitae otoliths and data analyzed by von Bertalanffy and Levenberg-Marquardt among others. Estimated ages ranged from 2 to 17 years. Monthly patterns of marginal increment formation and the percentage of otoliths with opaque rings on the outer edge demonstrated that a single annulus was formed each year. The von Bertalanffy parameters were calculated for males and females using linear adjustment and the non-linear method of Levenberg-Marquardt. The von Bertalanffy growth equations were FLt = 109.21(1-e-0.2(t+0.57)) for Barra Bosque, FLt = 94.56(1-e-027(t+0.485)) for Barra San Pedro, FLt = 97.15(1-e 0.17(t + 1.32)) for San Pedro and FLt = 83.77(1-e-026(t + 0.49)) for Tres Brazos. According to (Hotelling's T2, p < 0.05) test growth was significantly greater for females than for males. Based on the Chen test, von Bertalanffy growth curves were different among the study sites (RSS, p < 0.05). Based on the observed differences in growth parameters among sampling sites (coastal and riverine environments) future research need to be conducted on migration and population genetics, in order to delineate the stock structure of this population and support management programs.

  11. BEER Analysis of Kepler and CoRoT Light Curves. II. Evidence for Superrotation in the Phase Curves of Three Kepler Hot Jupiters

    NASA Astrophysics Data System (ADS)

    Faigler, S.; Mazeh, T.

    2015-02-01

    We analyzed the Kepler light curves of four transiting hot Jupiter systems—KOI-13, HAT-P-7, TrES-2, and Kepler-76, which show BEaming, Ellipsoidal, and Reflection (BEER) phase modulations. The mass of the four planets can be estimated from either the beaming or the ellipsoidal amplitude, given the mass and radius of their parent stars. For KOI-13, HAT-P-7, and Kepler-76 we find that the beaming-based planetary mass estimate is larger than the mass estimated from the ellipsoidal amplitude, consistent with previous studies. This apparent discrepancy may be explained by equatorial superrotation of the planet atmosphere, which induces an angle shift of the planet reflection/emission phase modulation, as was suggested for Kepler-76 in the first paper of this series. We propose a modified BEER model that supports superrotation, assuming either a Lambertian or geometric reflection/emission phase function, and provides a photometry-consistent estimate of the planetary mass. Our analysis shows that for Kepler-76 and HAT-P-7, the Lambertian superrotation BEER model is highly preferable over an unshifted null model, while for KOI-13 it is preferable only at a 1.4σ level. For TrES-2 we do not find such preference. For all four systems the Lambertian superrotation model mass estimates are in excellent agreement with the planetary masses derived from, or constrained by, radial velocity measurements. This makes the Lambertian superrotation BEER model a viable tool for estimating the masses of hot Jupiters from photometry alone. We conclude that hot Jupiter superrotation may be a common phenomenon that can be detected in the visual light curves of Kepler.

  12. [Neurological complications of tick-borne relapsing fever].

    PubMed

    Castilla-Guerra, L; Fernandez-Moreno, M C; Vergara-Lopez, S; Merino-Rumin, M; Colmenero-Camacho, M A

    2016-09-16

    Introduccion. La fiebre recurrente transmitida por garrapatas (FRTG) puede producir complicaciones neurologicas. No existen apenas estudios en España sobre el tema. Objetivo. Estudiar la prevalencia y las caracteristicas clinicas de las complicaciones neurologicas de los pacientes con FRTG. Pacientes y metodos. Estudio retrospectivo de los pacientes atendidos con FRTG durante 12 años (2004-2015) en un hospital de una zona rural del sur de España. Resultados. Se incluyeron 75 pacientes, 42 varones (56%), con una edad media de 33 años (rango: 14-72 años). Se observaron picaduras de garrapatas en nueve pacientes (12%). Los sintomas mas frecuentes fueron: fiebre en 64 pacientes (85,3%), cefalea en 41 (54,6%) y vomitos en 26 (34,6%). Se sospecho afectacion meningea en nueve pacientes (12%), de los que tres (4%) tenian signos meningeos en el momento del ingreso. A todos ellos se les realizo una puncion lumbar. Ninguno presento paralisis facial ni otra manifestacion neurologica. Se encontraron alteraciones del liquido cefalorraquideo en los tres pacientes con meningismo. En uno de los casos se visualizo Borrelia en el liquido cefalorraquideo. En los pacientes con afectacion neurologica, el tratamiento utilizado fue penicilina G en un caso y ceftriaxona en dos. Todos los pacientes se recuperaron completamente. Conclusiones. La FRTG es una de las formas menos graves de borreliosis, y menos del 5% de los pacientes presenta complicaciones neurologicas. Sin embargo, los medicos deben saber que Borrelia puede causar meningitis en los sujetos expuestos a garrapatas en regiones endemicas de FRTG.

  13. Molecular detection of Rangelia vitalii in domestic dogs from Uruguay.

    PubMed

    Soares, João Fabio; Carvalho, Luis; Maya, Leticia; Dutra, Fernando; Venzal, José Manuel; Labruna, Marcelo B

    2015-05-30

    The piroplasm Rangelia vitalii is the etiological agent of canine rangeliosis, a severe disease affecting domestic dogs in South America. Two domestic dogs from two different Departments (Salto and Treinta y Tres) of Uruguay presented with clinical signs such as apathy, anorexia, pale mucous membranes, jaundice, and hemorrhagic manifestations, suggestive of a canine vector-borne disease. Molecular analysis, based on PCR and DNA sequencing of portions of the 18S rRNA gene, revealed that both dogs were infected by R. vitalii. Two consensus sequences, one from Salto and one from Treinta y Tres, differed from each other by only 1 nucleotide (99.8% similarity) and were 99.8-100% identical to corresponding sequences of R. vitalii from Brazil and Argentina available in GenBank. Through phylogenetic analysis inferred by the 18S rRNA gene, the two Uruguayan sequences of R. vitalii were aligned with the corresponding sequences from 7 other R. vitalii sequences available in GenBank (5 from Brazil and, 2 from Argentina) under high bootstrap support. The two dogs of the present study were negative for Ehrlichia canis according to the E. canis-specific real-time PCR assay. Our findings not only confirm the occurrence of R. vitalii in Uruguay but also provide the southernmost record of this re-emerging agent. The only previous report of R. vitalii in Uruguay dated from 1976, a period when molecular analyses were not available. We provide the first molecular detection of R. vitalii in Uruguay. Currently, canine rangeliosis is confirmed to occur in Brazil, Argentina, and Uruguay.

  14. Liganded Thyroid Hormone Receptors Transactivate the DNA Methyltransferase 3a Gene in Mouse Neuronal Cells

    PubMed Central

    Kyono, Yasuhiro; Subramani, Arasakumar; Ramadoss, Preeti; Hollenberg, Anthony N.; Bonett, Ronald M.

    2016-01-01

    Thyroid hormone (T3) is essential for proper neurological development. The hormone, bound to its receptors, regulates gene transcription in part by modulating posttranslational modifications of histones. Methylation of DNA, which is established by the de novo DNA methyltransferase (DNMT)3a and DNMT3b, and maintained by DNMT1 is another epigenetic modification influencing gene transcription. The expression of Dnmt3a, but not other Dnmt genes, increases in mouse brain in parallel with the postnatal rise in plasma [T3]. We found that treatment of the mouse neuroblastoma cell line Neuro2a[TRβ1] with T3 caused rapid induction of Dnmt3a mRNA, which was resistant to protein synthesis inhibition, supporting that it is a direct T3-response gene. Injection of T3 into postnatal day 6 mice increased Dnmt3a mRNA in the brain by 1 hour. Analysis of two chromatin immunoprecipitation-sequencing datasets, and targeted analyses using chromatin immunoprecipitation, transfection-reporter assays, and in vitro DNA binding identified 2 functional T3-response elements (TREs) at the mouse Dnmt3a locus located +30.3 and +49.3 kb from the transcription start site. Thyroid hormone receptors associated with both of these regions in mouse brain chromatin, but with only 1 (+30.3 kb) in Neuro2a[TRβ1] cells. Deletion of the +30.3-kb TRE using CRISPR/Cas9 genome editing eliminated or strongly reduced the Dnmt3a mRNA response to T3. Bioinformatics analysis showed that both TREs are highly conserved among eutherian mammals. Thyroid regulation of Dnmt3a may be an evolutionarily conserved mechanism for modulating global changes in DNA methylation during postnatal neurological development. PMID:27387481

  15. Differential roles of C-terminal Eps15 homology domain proteins as vesiculators and tubulators of recycling endosomes.

    PubMed

    Cai, Bishuang; Giridharan, Sai Srinivas Panapakkam; Zhang, Jing; Saxena, Sugandha; Bahl, Kriti; Schmidt, John A; Sorgen, Paul L; Guo, Wei; Naslavsky, Naava; Caplan, Steve

    2013-10-18

    Endocytic recycling involves the return of membranes and receptors to the plasma membrane following their internalization into the cell. Recycling generally occurs from a series of vesicular and tubular membranes localized to the perinuclear region, collectively known as the endocytic recycling compartment. Within this compartment, receptors are sorted into tubular extensions that later undergo vesiculation, allowing transport vesicles to move along microtubules and return to the cell surface where they ultimately undergo fusion with the plasma membrane. Recent studies have led to the hypothesis that the C-terminal Eps15 homology domain (EHD) ATPase proteins are involved in the vesiculation process. Here, we address the functional roles of the four EHD proteins. We developed a novel semipermeabilized cell system in which addition of purified EHD proteins to reconstitute vesiculation allows us to assess the ability of each protein to vesiculate MICAL-L1-decorated tubular recycling endosomes (TREs). Using this assay, we show that EHD1 vesiculates membranes, consistent with enhanced TRE generation observed upon EHD1 depletion. EHD4 serves a role similar to that of EHD1 in TRE vesiculation, whereas EHD2, despite being capable of vesiculating TREs in the semipermeabilized cells, fails to do so in vivo. Surprisingly, the addition of EHD3 causes tubulation of endocytic membranes in our semipermeabilized cell system, consistent with the lack of tubulation observed upon EHD3 depletion. Our novel vesiculation assay and in vitro electron microscopy analysis, combined with in vivo data, provide evidence that the functions of both EHD1 and EHD4 are primarily in TRE membrane vesiculation, whereas EHD3 is a membrane-tubulating protein.

  16. [Psychomotor skills assessment in basic procedures of laparoscopic surgery in undergraduate medical students at the School of Medicine of the University of Colima].

    PubMed

    Prieto-Díaz-Chávez, Emilio; Medina-Chávez, José Luís; Martínez-Lira, Rafael; Millán-Guerrero, Rebeca; Vázquez-Jiménez, Clemente; Trujillo-Hernández, Benjamín

    2014-01-01

    Antecedentes: la educación basada en competencias señala que el estudiante debe dominar tres rubros: saber, saber hacer y ser. El primero se refiere al conjunto de conocimientos teórico-prácticos, el segundo a las habilidades psicomotrices y el tercero al comportamiento profesional. El estudiante de Medicina adquiere las primeras destrezas en cirugía laparoscópica a través de modelos animales y simuladores virtuales. Sin embargo, no hemos evaluado la trascendencia de esta capacitación. Objetivo: evaluar en alumnos de pregrado las destrezas en cirugía laparoscópica obtenidas después de un curso con un simulador virtual. Material y métodos: estudio de investigación educativa, analíticocomparativo efectuado como parte de las actividades del programa de Aprendizaje Basado en Problemas de la asignatura de Educación y Técnica Quirúrgica de la Facultad de Medicina de la Universidad de Colima. Resultados: todos los participantes alcanzaron en el simulador un mejor nivel durante la tarea 1 después de tres repeticiones (p= 0.001). En la evaluación de la calificación final de los alumnos se observaron diferencias significativas en las medias que fueron más bajas durante la evaluación inicial (8.60 ± 0.76) en comparación con la final (8.96 ± 0.58) p= 0.001. Conclusiones: la adquisición de habilidades en el simulador es más prolongada y al final es superior a la adquisición de habilidades basada en el método tradicional; demuestra que conduce a la adquisición de competencias que favorecen la transferencia de habilidades al entorno quirúrgico.

  17. [Organic and functional limitations due to milking phenomenon: a clinical case report].

    PubMed

    Gómez-Henry, Juan Carlos; Rodríguez-Pérez, Francisco Antonio

    2014-01-01

    INTRODUCCIÓN: según series angiográficas, la incidencia del fenómeno de milking oscila entre 0.6 y 4 %, sin embargo, en estudios de autopsias hasta en 85 % se ha identificado puente miocárdico, patognómónico de este trastorno. La malformación del fenómeno de milking no es identificada en la mayoría de las ocasiones, pero puede tener grandes repercusiones. El propósito es ejemplificar un caso de fenómeno de milking con consecuencias de incapacidad permanente y consecuencias laborales. CASO CLÍNICO: hombre de 44 años de edad que laboralmente se ocupaba como peón albañil y peón agrícola. Como antecedentes refirió amigdalectomía y artrosis, tabaquismo de 10 cigarrillos diarios, dos o tres tazas de café diarias y dos o tres copas de vino en fin de semana. Mediante electrocardiograma se identificó ritmo sinusal y bloqueo incompleto de la rama derecha del fascículo atrioventricular. Su frecuencia cardiaca fue de 90 latidos por minuto. Para la prueba de esfuerzo se utilizó el protocolo de Bruce, que se detuvo en el primer estadio debido a crisis hipertensiva y fibrilación auricular paroxística. El cateterismo mostró tronco común izquierdo, arteria coronaria cincunfleja y arteria coronaria derecha sin lesiones, arteria descendente anterior sin lesiones con trayecto intramiocárdico y compresión sistólica en segmento medio, con lo cual se integró el diagnóstico de milking coronario. El paciente requirió incapacidad permanente total con limitación para actividades que necesitaran esfuerzo moderado.

  18. Optimized time-resolved imaging of contrast kinetics (TRICKS) in dynamic contrast-enhanced MRI after peptide receptor radionuclide therapy in small animal tumor models.

    PubMed

    Haeck, Joost; Bol, Karin; Bison, Sander; van Tiel, Sandra; Koelewijn, Stuart; de Jong, Marion; Veenland, Jifke; Bernsen, Monique

    2015-01-01

    Anti-tumor efficacy of targeted peptide-receptor radionuclide therapy (PRRT) relies on several factors, including functional tumor vasculature. Little is known about the effect of PRRT on tumor vasculature. With dynamic contrast-enhanced (DCE-) MRI, functional vasculature is imaged and quantified using contrast agents. In small animals DCE-MRI is a challenging application. We optimized a clinical sequence for fast hemodynamic acquisitions, time-resolved imaging of contrast kinetics (TRICKS), to obtain DCE-MRI images at both high spatial and high temporal resolution in mice and rats. Using TRICKS, functional vasculature was measured prior to PRRT and longitudinally to investigate the effect of treatment on tumor vascular characteristics. Nude mice bearing H69 tumor xenografts and rats bearing syngeneic CA20948 tumors were used to study perfusion following PRRT administration with (177) lutetium octreotate. Both semi-quantitative and quantitative parameters were calculated. Treatment efficacy was measured by tumor-size reduction. Optimized TRICKS enabled MRI at 0.032 mm(3) voxel size with a temporal resolution of less than 5 s and large volume coverage, a substantial improvement over routine pre-clinical DCE-MRI studies. Tumor response to therapy was reflected in changes in tumor perfusion/permeability parameters. The H69 tumor model showed pronounced changes in DCE-derived parameters following PRRT. The rat CA20948 tumor model showed more heterogeneity in both treatment outcome and perfusion parameters. TRICKS enabled the acquisition of DCE-MRI at both high temporal resolution (Tres ) and spatial resolutions relevant for small animal tumor models. With the high Tres enabled by TRICKS, accurate pharmacokinetic data modeling was feasible. DCE-MRI parameters revealed changes over time and showed a clear relationship between tumor size and Ktrans .

  19. [Experience in molecular diagnostic in hereditary neuropathies in a pediatric tertiary hospital].

    PubMed

    Fernández-Ramos, Joaquín A; López-Laso, Eduardo; Camino-León, Rafael; Gascón-Jiménez, Francisco J; Jiménez-González, M Dolores

    2015-12-01

    Introduccion. La enfermedad de Charcot-Marie-Tooth (CMT) es la neuropatia hereditaria sensitivomotora mas frecuente. Avances en el diagnostico molecular han incrementado las posibilidades diagnosticas de estos pacientes. Pacientes y metodos. Estudio retrospectivo de 36 casos pediatricos diagnosticados de CMT en un centro terciario en el periodo 2003-2015. Resultados. Se identificaron 16 pacientes con CMT1A por una duplicacion en PMP22; dos casos se diagnosticaron de neuropatia hereditaria con predisposicion a paralisis por presion, uno de ellos con una mutacion puntual en PMP22; un varon con un fenotipo leve desmielinizante se diagnostico de CMTX1 por mutacion en GJB1; un paciente con una hipotonia paralitica en el nacimiento y un patron axonal por mutacion en MFN2; un paciente de origen rumano se diagnostico de CMT4D por una mutacion en el gen NDRG1; una paciente con una atrofia muscular espinal congenita distal con neuropatia axonal leve asociada por mutacion en el gen TRPV4; tres niñas de una familia consanguinea de etnia gitana se diagnosticaron de CMT axonal con descargas neuromiotonicas por una mutacion en el gen HINT1; 12 pacientes no tienen diagnostico molecular actualmente, cuatro de ellos de etnia gitana. Conclusiones. CMT1A predomino en nuestra serie (44%), como corresponde a la bibliografia. Destacamos la descripcion de una paciente con una mutacion en TRPV4 recientemente descrita como causa de CMT2C y tres casos de una misma familia consanguinea gitana con la misma mutacion en el gen HINT1 recientemente publicada como causa de neuropatia axonal con neuromiotonia autosomica recesiva (AR-CMT2). El porcentaje de casos sin diagnostico molecular es similar al de grandes series europeas.

  20. Real-time pose estimation of devices from x-ray images: Application to x-ray/echo registration for cardiac interventions.

    PubMed

    Hatt, Charles R; Speidel, Michael A; Raval, Amish N

    2016-12-01

    In recent years, registration between x-ray fluoroscopy (XRF) and transesophageal echocardiography (TEE) has been rapidly developed, validated, and translated to the clinic as a tool for advanced image guidance of structural heart interventions. This technology relies on accurate pose-estimation of the TEE probe via standard 2D/3D registration methods. It has been shown that latencies caused by slow registrations can result in errors during untracked frames, and a real-time ( > 15 hz) tracking algorithm is needed to minimize these errors. This paper presents two novel similarity metrics designed for accurate, robust, and extremely fast pose-estimation of devices from XRF images: Direct Splat Correlation (DSC) and Patch Gradient Correlation (PGC). Both metrics were implemented in CUDA C, and validated on simulated and clinical datasets against prior methods presented in the literature. It was shown that by combining DSC and PGC in a hybrid method (HYB), target registration errors comparable to previously reported methods were achieved, but at much higher speeds and lower failure rates. In simulated datasets, the proposed HYB method achieved a median projected target registration error (pTRE) of 0.33 mm and a mean registration frame-rate of 12.1 hz, while previously published methods produced median pTREs greater than 1.5 mm and mean registration frame-rates less than 4 hz. In clinical datasets, the HYB method achieved a median pTRE of 1.1 mm and a mean registration frame-rate of 20.5 hz, while previously published methods produced median pTREs greater than 1.3 mm and mean registration frame-rates less than 12 hz. The proposed hybrid method also had much lower failure rates than previously published methods.

  1. [External evaluation of gait and functional changes after a single-session multiple myofibrotenotomy in school-aged children with spastic diplegia].

    PubMed

    Gómez-Andrés, David; Pulido-Valdeolivas, Irene; Martín-Gonzalo, Juan Andrés; López-López, Javier; Martínez-Caballero, Ignacio; Gómez-Barrena, Enrique; Rausell, Estrella

    2014-03-16

    Introduccion. Unos 23.000 pacientes con espasticidad han optado voluntariamente por la miofibrotomia multiple (MFM), una tecnica alternativa consistente en seccionar tejidos blandos para liberar restricciones articulares. Iniciada por Ulzibat (Rusia), se realiza fuera de controles clinicos ortodoxos. Objetivo. Evaluar externamente los efectos de la MFM sobre la funcionalidad motora y la marcha. Pacientes y metodos. Estudio observacional autocontrolado que evalua cambios en variables funcionales –Gross Motor Function Classification System, dimension E de la Gross Motor Function Measure (GMFM) y Functional Mobility Scale– y 32 parametros de marcha (medidos mediante analisis instrumental) en 22 escolares con diplejia espastica (edad mediana: 9 años y 6 meses; Q1-Q3: 7 años y 11 meses a 11 años y 6 meses) cuyos padres optaron por una MFM (mediana de observacion: 4 meses; rango: 3-7 meses). Resultados. El analisis de conglomerados jerarquicos utilizado para determinar patrones topograficos de cortes en los pacientes detecto que los cirujanos aplicaban a cada paciente uno de tres conjuntos de cortes. Analizados los tres grupos de pacientes, se observo que un grupo empeoro globalmente y una mejora significativa general en la dimension E del GMFM (diferencia de mediana: 4,86%; intervalo de confianza al 95% = 0-6,94%) tras la MFM. Algunos parametros de la marcha se normalizaron significativamente (izquierda: rango flexion-cadera, maxima dorsiflexion en apoyo; derecha: velocidad, rotacion pelvica media en apoyo y maxima dorsiflexion en apoyo). Conclusiones. Estos resultados no apoyan ni justifican el uso de la MFM como opcion para el tratamiento de la espasticidad. Insistimos en que esta tecnica debe evitarse fuera de protocolos de estudio. Sin embargo, los resultados asientan una base objetiva para justificar la realizacion de un ensayo clinico y estudios observacionales a largo plazo.

  2. Crustal Architecture at the Collision Zone Between Rivera and North American Plates at the Jalisco Block: Tsujal Project

    NASA Astrophysics Data System (ADS)

    Dañobeitia, Juanjo; Bartolomé, Rafael; Prada, Manel; Nuñez-Cornú, Francisco; Córdoba, Diego; Bandy, William L.; Estrada, F.; Cameselle, Alejandra L.; Nuñez, Diana; Castellón, Arturo; Alonso, José Luis; Mortera, Carlos; Ortiz, Modesto

    2016-10-01

    Processing and analysis of new multichannel seismic records, coincident with wide-angle seismic profiles, acquired in the framework of the TsuJal project allow us to investigate in detail the complex structure of the oceanic domain in the collision zone between Rivera Plate and Block Jalisco at its northern termination. The subducting Rivera Plate, which is overridden by the North American Plate-Jalisco Block, is clearly identified up to 21.5°N (just south of Maria Magdalena Island) as a two clear reflections that we interpret as the interplate and Moho discontinuities. North of the Tres Marias Islands the seismic images display a different tectonic scenario with structures that are consistent with large faulting and rifted margin. A two-dimensional velocity approach for the crustal geometry is achieved using joint refraction/reflection travel time tomography, the uncertainty of the results is assessed by means of Monte Carlo analysis. Our results show an average oceanic crustal thickness of 6-7 km with a moderate increase towards the Jalisco Block, an anomalous thick layers (~3.0 km) displaying a relatively low velocity (~5.5 km/s) underneath Maria Magdalena Rise, and an estimated Moho depth deeper than 15 km in the collision zone between Rivera Plate and Jalisco Block. We have also determined an anomalous crust on the western flank of the Tres Marias Islands, which may be related to the initial phases of continental breakup of the Baja California Peninsula and Mexico mainland. High-resolution bathymetry provides remarkable images of intensive slope instabilities marked by relatively large slides scars of more than 40 km2 extent, and mass-wasting deposits probably triggered by the intense seismicity in the area.

  3. Young Nearby Suns and Stellar Jitter Dependence on Age

    NASA Astrophysics Data System (ADS)

    Cabrera, Nicole; White, Russel; Delfosse, Xavier; Noah Quinn, Samuel; Latham, David W.

    2015-01-01

    Finding the nearest young planets offers the most direct way to improve our understanding of how planets form, how they migrate, and how they evolve. However, most radial velocity (RV) surveys have avoided young stars because of their problematic characteristics, including high levels of stellar activity. Recent advancements in infrared (IR) detectors as well as wavelength calibration methods have provided new ways of pursuing high-precision RV measurements of young stars. While this work has been successfully applied to many young late-K and M dwarfs, much less RV work has been done on young Sun-like stars, with the very recent exception of adolescent stars (~600 Myr) in open clusters. In order to better understand the dynamical and structural forces that shaped our own Solar system, we must begin to explore the more massive realm of Sun-like stars.We present precision optical radial velocity data of 5 young, nearby, Sun-like stars in AB Dor and assess our ability to detect young planets with current spectroscopic methods. The data were obtained with the TRES spectrograph on the 1.5-m Tillinghast Reflector at the Fred L. Whipple Observatory and with SOPHIE on the 1.95 m Telescope at the Observatoire de Haute Provence. We obtained a RV precision of ~8 m/s with TRES and ~7 m/s precision with SOPHIE; average observed dispersions are 38 m/s and 33 m/s, respectively. We combine our results with spectroscopic data of Sun-like stars spanning a broad range of youthful ages (< 1 Gyr) from the literature to investigate the relationship between stellar jitter and stellar age. The results suggest that the jitter of Sun-like stars decreases below 100 m/s for stars older than ~30 Myr, which would enable the discovery of hot Jupiters orbiting these adolescent age stars.

  4. Sur la reponse en frequence du tissu nerveux dans le cortex

    NASA Astrophysics Data System (ADS)

    Bedard, Claude

    Dans cette These de Physique, nous avons etudie la dependance en frequence du champ electrique du tissu nerveux dans le cortex. Ce champ est aussi designe par "Local field Potential" LFP dans la litterature scientifique. Cette etude est fondee sur la theorie du champ electromagnetisme de Maxwell et sur de l'information tiree de la donne experimentale. Le resultat essentiel de cette These est que la grandeur enorme du temps de relaxation de Maxwell des membranes cellulaires semble etre la cause principale de la dependance en frequence des LFPs. Cette dependance en frequence causee par chaque membrane cellulaire est l'analogue d'un circuit RC ou la resistance R est la resistivite parallele d'une membrane cellulaire, et ou la capacite C est la permittivite electrique de la membrane. L'effet resultant d'un tres grand nombre de cellules donne un spectre de Fourier dont l'enveloppe est tres pres d'un signal en 1/f. Le modele physique propose dans cette These permet de lier les mesures prises a l'interieur d'une dendrite des variations de potentiel electrique a celles prises dans le liquide extracellulaire. De plus, cette These semble ouvrir la possibilite de mesurer le temps de relaxation de Maxwell des membranes cellulaires a l'aide de la mesure de la reponse en frequence du potentiel electrique extracellulaire (LFP). Enfin, cette These permet de lever le voile sur un sujet peu etudie, principalement en raison de la difficulte que represente l'etude des phenomenes electriques dans des milieux complexes comme les tissus vivants. En particulier, le probleme du filtrage frequentiel du potentiel electrique extracellulaire est une propriete fondamentale du tissu nerveux et son origine n'est pas connue.

  5. [Drooling therapy in children with neurological disorders].

    PubMed

    Táboas-Pereira, M Andrea; Paredes-Mercado, Cecilia; Alonso-Curcó, Xènia; Badosa-Pagès, Joaquim; Muchart, Jordi; Póo, Pilar

    2015-07-16

    Introduccion. La sialorrea es la incapacidad para retener la saliva dentro de la boca y su progresion al tracto digestivo, y es un problema frecuente en pacientes pediatricos con patologia neurologica, por lo que se estan utilizando diferentes medidas para su tratamiento. Objetivo. Evaluar la eficacia y seguridad del trihexifenidilo, la escopolamina y la infiltracion de toxina botulinica en el tratamiento del babeo en niños con patologia neurologica. Pacientes y metodos. Es un estudio de tipo abierto y prospectivo. Incluye pacientes atendidos en el servicio de neurologia que presentaban babeo excesivo, con repercusion en su calidad de vida, entre 2009 y 2013. Resultados. En 46 pacientes se indico tratamiento con trihexifenidilo oral, y se obtuvo buena respuesta en 15 (32,6%), tres con efecto transitorio y el resto mantenido. Presentaron efectos secundarios tres pacientes (6,5%). De los 11 pacientes a los que se indicaron parches de escopolamina, se hallo efecto beneficioso en cuatro (36,36%), uno fue retirado por falta de eficacia y seis por efectos secundarios. Veinticinco pacientes fueron infiltrados con toxina botulinica, con disminucion significativa del babeo en 16 (64%) tras la primera infiltracion. No observamos cambios significativos en nueve casos. Solo uno presento efectos secundarios (disfagia leve). Conclusiones. Por no haber una opcion terapeutica totalmente eficaz para los pacientes con sialorrea, recomendamos iniciar el tratamiento con trihexifenidilo; como segunda opcion, los parches de escopolamina, y como tercera opcion, la toxina botulinica. La infiltracion de toxina botulinica en glandulas salivales se muestra como una alternativa eficaz y segura segun nuestra serie.

  6. Determining air-water exchange, spatial and temporal trends of freely dissolved PAHs in an urban estuary using passive polyethylene samplers.

    PubMed

    Lohmann, Rainer; Dapsis, Meredith; Morgan, Eric J; Dekany, Victoria; Luey, Pamela J

    2011-04-01

    Passive polyethylene (PE) samplers were deployed at six locations within Narragansett Bay (RI, USA) to determine sources and trends of freely dissolved and gas-phase polycyclic aromatic hydrocarbons (PAHs) from May to November 2006. Freely dissolved aqueous concentrations of PAHs were dominated by fluoranthene, pyrene, and phenanthrene, at concentrations ranging from tens to thousands of pg/L. These were also the dominant PAHs in the gas phase, at hundreds to thousands of pg/m3. All stations mostly followed the same temporal trends, with highest concentrations (up to 7300 pg/L for sum PAHs) during the second of 11 deployments, coinciding with a major rainstorm. Strong correlations of sum PAHs with river flows and wastewater treatment plant discharges highlighted the importance of rainfall in mobilizing PAHs from a combination of runoff and atmospheric washout. PAH concentrations declined through consecutive deployments III to V, which could be explained by an exponential decay due to flushing with cleaner ocean water during tides. The estimated residence time (tres) of the PAH pulse was 24 days, close to an earlier estimate of tres of 26 days for freshwater in the Bay. Air-water exchange gradients indicated net volatilization of most PAHs closest to Providence. Further south in the Bay, gradients had changed to mostly net uptake of the more volatile PAHs, but net volatilization for the less volatile PAHs. Based on characteristic PAH ratios, freely dissolved PAHs at most sites originated from the combustion of fossil fuels; only two sites were at times affected by fuel spill-derived PAHs.

  7. [Effects of a 'theory of mind' cognitive development pilot programme in three children with autism: emotional component].

    PubMed

    Villanueva-Bonilla, Cristian; Bonilla-Santos, Jasmín; Arana-Guzmán, Fernanda; Ninco-Cuenca, Ingrid; Quintero-Lozano, Andrea

    2016-03-16

    Introduccion. La teoria de la mente se define como la capacidad para predecir, comprender y actuar frente a la conducta de otras personas, sus conocimientos, sus intenciones, sus emociones y sus creencias. Se plantea como una alternativa viable para establecer un programa adaptado a las caracteristicas de los niños diagnosticados con trastorno del espectro autista. Casos clinicos. Se describe el efecto de un programa piloto de desarrollo cognitivo 'teoria de la mente' en las habilidades emocionales de tres niños con trastorno del espectro autista. Caso 1: niño de 9 años, con escasa identificacion y expresion emocional, asi como dificultades para mantener conversaciones fluidas y coherentes. Caso 2: niño de 10 años, con lenguaje mecanico, poco fluido, y dificultades para iniciar y mantener una conversacion. Caso 3: niña de 8 años que presenta deficits en las conductas comunicativas no verbales usadas en la interaccion social y dificultades para adaptarse a situaciones no cotidianas. En los tres casos se presenta mejoria de las capacidades emocionales posterior a la implementacion del programa; ademas, los padres, docentes o terapeutas percibieron cambios positivos en las habilidades adaptativas de los niños. Conclusiones. Los aspectos metodologicos y estructurales del programa de desarrollo cognitivo fueron adecuados para los niños con autismo participantes de la investigacion. Debido al caracter preliminar del estudio, se sugiere para futuras investigaciones una muestra mayor y un diseño doble ciego con aleatorizacion caso/control que permitan la generalizacion de los resultados.

  8. [Clinico-radiological profile of acute disseminated encephalomyelitis in the childhood population. A retrospective analysis of a series of 20 patients in a tertiary hospital].

    PubMed

    Tomás-Vila, Miguel; Menor, Francisco; Otero-Reigada, M Carmen; Pérez-Tamarit, Amparo; Téllez de Meneses, Montserrat; Pitarch-Castellanos, Inmaculada

    2014-01-01

    Introduccion. La encefalomielitis aguda diseminada (EAD) es un trastorno inflamatorio del sistema nervioso central mediado inmunologicamente y de patogenia desconocida. Puede presentarse en cualquier edad, pero es mucho mas frecuente en niños. La EAD no tiene marcador biologico especifico y el diagnostico se basa en hallazgos clinicos y neurorradiologicos. Objetivo. Mejorar el conocimiento del perfil clinicorradiologico de esta enfermedad. Pacientes y metodos. Estudio retrospectivo con inclusion de pacientes menores de 14 años ingresados en un hospital terciario en los ultimos 15 años con el diagnostico de EAD. Se revisaron antecedentes, signos clinicos de presentacion, datos analiticos en sangre/liquido cefalorraquideo y la semiologia radiologica. En 16 casos se realizo un seguimiento medio de 25 meses. Resultados. Se revisaron 20 pacientes, un 70% niños, con una edad media de 4,4 años. El 40% tuvo un episodio febril previo. El 85% presento fiebre o vomitos, y el 70%, afectacion del estado de consciencia. Predominaron los deficits motores (45%), las convulsiones (35%) y la afectacion de pares craneales (30%). Tres niños presentaron una evolucion recidivante, y otros tres, secuelas motoras. Los estudios de resonancia magnetica mostraron lesiones hiperintensas en secuencias T2, con patron de realce escaso o nulo, que predominaron en los talamos (70%), la medula (67%) y la sustancia blanca subcortical (50%). En dos pacientes se diagnostico EAD hemorragica. Conclusiones. La EAD representa una entidad con importante afectacion general y repercusion neurologica, que muestra un potencial secuelar considerable. Los datos clinicoanaliticos y la resonancia magnetica cerebral y medular son relevantes para el diagnostico inicial y seguimiento de pacientes con EAD.

  9. Trehalose biosynthesis in Thermus thermophilus RQ-1: biochemical properties of the trehalose-6-phosphate synthase and trehalose-6-phosphate phosphatase.

    PubMed

    Silva, Zélia; Alarico, Susana; da Costa, Milton S

    2005-02-01

    The genes for trehalose synthesis in Thermus thermophilus RQ-1, namely otsA [trehalose-phosphate synthase (TPS)], otsB [trehalose-phosphate phosphatase (TPP)], and treS [trehalose synthase (maltose converting) (TreS)] genes are structurally linked. The TPS/TPP pathway plays a role in osmoadaptation, since mutants unable to synthesize trehalose via this pathway were less osmotolerant, in trehalose-deprived medium, than the wild-type strain. The otsA and otsB genes have now been individually cloned and overexpressed in Escherichia coli and the corresponding recombinant enzymes purified. The apparent molecular masses of TPS and TPP were 52 and 26 kDa, respectively. The recombinant TPS utilized UDP-glucose, TDP-glucose, ADP-glucose, or GDP-glucose, in this order as glucosyl donors, and glucose-6-phosphate as the glucosyl acceptor to produce trehalose-6-phosphate (T6P). The recombinant TPP catalyzed the dephosphorylation of T6P to trehalose. This enzyme also dephosphorylated G6P, and this activity was enhanced by NDP-glucose. TPS had an optimal activity at about 98 degrees C and pH near 6.0; TPP had a maximal activity near 70 degrees C and at pH 7.0. The enzymes were extremely thermostable: at 100 degrees C, TPS had a half-life of 31 min, and TPP had a half-life of 40 min. The enzymes did not require the presence of divalent cations for activity; however, the presence of Co2+ and Mg2+ stimulates both TPS and TPP. This is the first report of the characterization of TPS and TPP from a thermophilic organism.

  10. Suppressing the activity of trehalase with validamycin disrupts the trehalose and chitin biosynthesis pathways in the rice brown planthopper, Nilaparvata lugens.

    PubMed

    Tang, Bin; Yang, Mengmeng; Shen, Qida; Xu, Yanxia; Wang, Huijuan; Wang, Shigui

    2017-04-01

    Trehalase (TRE) is a key enzyme in trehalose degradation and has important functions in insect growth and chitin synthesis. Though validamycin has the potential for pest control by suppressing TRE activities, it is not known whether validamycin acts on both trehalose and chitin metabolism. TRE1 and TRE2 activities and glucose and glycogen contents decreased significantly after the injection of different doses of validamycin solution compared with the control group, while the trehalose content increased significantly. Overall, it showed that about 13 to 38% insects was appeared abnormal phenotypes, and 10 to 57% of insects died 48h after injection of solutions with different concentrations of validamycin; the chitin content also decreased significantly. Validamycin altered the relative expression levels of trehalose, glycogen and chitin metabolism-related genes by suppressing the activities of two TREs. We showed that the expression levels of three TRE and two trehalose-6-phosphate synthase (TPS) genes increased, while the expression levels of GP; CHS1 and its two transcripts, CHS1a, CHS1b; six chitinases, including Cht3, Cht4, Cht5, Cht6, Cht7, Cht9; and the HK, G6PI2, GFAT, GNPNA, PAGM1, UAP, VVL, CI and AP genes decreased significantly 48h after the injection of any validamycin concentration compared with the control group. These results demonstrate that by inhibiting the activities of two TREs, validamycin alters N. lugens chitin synthesis and degradation and affects trehalose and chitin metabolism-related gene expression. The development of TRE inhibitors may provide effective pest control in the future. Copyright © 2016 Elsevier Inc. All rights reserved.

  11. Measuring the Physical Properties of the first two WASP transiting extrasolar planets

    NASA Astrophysics Data System (ADS)

    Haswell, Carole

    2006-07-01

    We have recently discovered the first two transiting extrasolar planets from the Wide Angle Search for Planets {WASP} project and confirmed both as planets using SOPHIE radial velocity measurements. Both WASP-1b and WASP-2b orbit about stars brighter than V=12, and are thus ideal targets for HST followup. WASP-1b is probably inflated in a manner similar to HD209458b but is in a closer orbit about the parent, which itself is the earliest-type parent star yet announced for a transiting extrasolar planet. At 0.03 AU from the parent star, WASP-2b is close to the minimum separation at which planets of this mass range are thought to survive. We request DD observations of WASP-1b and WASP-2b, to constrain the masses and radii of both objects to a precision of a few tenths of a percent. Both parent stars have very similar brightnesses to the TrES-1 parent star, thus we will achieve equivalent photometric precision to previous successful observations of TrES-1b. As all further physical investigations {such as interior heating} depend on precise mass- and radius-determinations, this investigation is the essential next step in uncovering the physical characteristics of these planets and their parent stars. We have requested 12 orbits, though 9 orbits would provide the minimum acceptable coverage for our program.The consortium will formally announce the discoveries of WASP-1b and WASP-2b on Tuesday 26th September 2006. We ask that all material in this proposal be kept confidential until that date. We can supply the discovery paper on request after this date.

  12. [Diploid/triploid mosaicism: a variable but characteristic phenotype].

    PubMed

    Natera-De Benito, Daniel; Poo, Pilar; Gean, Esther; Vicente-Villa, Asunción; García-Cazorla, Angels; Fons-Estupiña, M Carmen

    2014-08-16

    Introduccion. El mosaicismo diploide/triploide es una alteracion cromosomica poco frecuente. La produce un fallo en la division poscigotica durante el desarrollo embrionario. Da lugar a la coexistencia de dos lineas celulares con diferente constitucion cromosomica (46,XX y 69,XXX) en un mismo individuo. Su fenotipo clinico es caracteristico. Las alteraciones pigmentarias con un patron de distribucion que sigue las lineas de Blaschko son el principal signo guia, asi como las alteraciones de otros tejidos derivados del ectodermo. Casos clinicos. Describimos las caracteristicas clinicas de tres pacientes afectos de mosaicismo diploide/triploide y realizamos una comparacion de su fenotipo clinico con el de los casos publicados previamente en la bibliografia. Las alteraciones observadas con mayor frecuencia fueron alteraciones cutaneas, discapacidad intelectual, obesidad troncular, talla baja, hemihipertrofia, y manos pequeñas y estrechas con clino y camptodactilia. Las caracteristicas fenotipicas de nuestros pacientes fueron similares a las de los casos comunicados previamente. Aunque no existe un fenotipo unico y especifico asociado al mosaicismo diploide/triploide, existen malformaciones caracteristicas que conforman un sindrome malformativo bien definido. El cariotipo realizado en linfocitos de sangre periferica en las tres pacientes fue normal, y se logro el diagnostico mediante cariotipo en fibroblastos cultivados tras biopsia de piel hipopigmentada. Conclusiones. La presencia de discapacidad intelectual asociada a obesidad troncular, talla baja, hemihipertrofia o clino y camptodactilia, ademas de las alteraciones cutaneas, debe hacer pensar en la posible existencia de un mosaicismo diploide/triploide. En la mayoria de los casos, es necesario el estudio del cariotipo en los fibroblastos para llegar al diagnostico.

  13. Analyse quantitative des foraminifères benthiques actuels de la marge atiantique marocaine entre Cap Draˆa et Cap Juby: reponses fauniques aux changements de l'environnement

    NASA Astrophysics Data System (ADS)

    Rezqi, H.; Oujidi, M.; Boutakiout, M.; Labraimi, M.

    2000-02-01

    La population des foraminifères benthiques actuels de la marge atlantique marocaine, entre Cap Draˆa et Cap Juby, aétéétudiée dans 58 prélèvements parmi 430 répartis suivant un système de radiales perpendiculaireàla ligne de rivage. Quarante-sept espèces parmi 104 appartenantà58 genres et 28 familles ontétéreconnues. Les abondances absolues de chacune des espèces ontétécomparées dans les différents prélèvements ainsi que les indices biocénotiques (richesse spécifique, abondance, indice de pélagisme, nombre d'espèces benthiques enroulées, nombre d'espèces benthiques costulées) et les paramètres abiotiques (nature de substrat et profondeur). L'analyse factorielle des correspond ances, complétée par la classification hiérarchique et la projection des paramètres biotiques et abiotiques en tant que colonnes supplémentaires ont révéléclue la profondeur est le facteur principal de la distribution des espèces et des prélèvements. En effet, elle oppose les associations d'espèces infralittorales enroulées lisses aux associations d'espècesépibathyales rectilignes ornées, les espèces circalittorales occupent une position intermédiaire. Le facteur secondare correspondàla nature du substrat, oppose les associations d'espèces vasicoles aux associations d'espèces sabulicoles aussi bien celles de l'environnement infralittoral que celles de l'épibathyal.

  14. High strain-rate deformation fabrics characterize a kilometers-thick Paleozoic fault zone in the Eastern Sierras Pampeanas, central Argentina

    NASA Astrophysics Data System (ADS)

    Whitmeyer, Steven J.; Simpson, Carol

    2003-06-01

    High strain rate fabrics that transgress a crustal depth range of ca. 8-22 km occur within a major Paleozoic fault zone along the western margin of the Sierras de Córdoba, central Argentina. The NNW-striking, east-dipping 'Tres Arboles' fault zone extends for at least 250 km and separates two metamorphic terranes that reached peak temperatures in the middle Cambrian and Ordovician, respectively. Exposed fault zone rocks vary from a 16-km-thickness of ultramylonite and mylonite in the southern, deepest exposures to <5 km in the northern, shallower-level exposures. Three transects across the fault zone have been examined in detail. In the deepest section, newly crystallized sillimanite needles define the foliation and wrap garnet and feldspar theta- and delta-type porphyroclasts in a biotite-rich ultramylonite. Geothermometry and preserved microstructures in feldspar and quartz indicate deformation at temperatures >520 °C. Reaction-enhanced grain size reduction and grain boundary sliding were the predominant deformation mechanisms in these high strain rate rocks. Ultramylonites in the intermediate depth section also contain evidence for grain boundary sliding and diffusional mass transfer, although overprinted by late stage chlorite. In the shallowest exposed section, rocks were deformed at or near to the brittle-ductile transition to produce mylonite, cataclasite, shear bands and pseudotachylyte. The overall structure of the Tres Arboles zone is consistent with existing fault zone models and suggests that below the brittle-ductile transition, strain compatibility may be accommodated through very thick zones of high temperature ultramylonite.

  15. Inferring heat recirculation and albedo for exoplanetary atmospheres: Comparing optical phase curves and secondary eclipse data

    NASA Astrophysics Data System (ADS)

    von Paris, P.; Gratier, P.; Bordé, P.; Selsis, F.

    2016-03-01

    Context. Basic atmospheric properties, such as albedo and heat redistribution between day- and nightsides, have been inferred for a number of planets using observations of secondary eclipses and thermal phase curves. Optical phase curves have not yet been used to constrain these atmospheric properties consistently. Aims: We model previously published phase curves of CoRoT-1b, TrES-2b, and HAT-P-7b, and infer albedos and recirculation efficiencies. These are then compared to previous estimates based on secondary eclipse data. Methods: We use a physically consistent model to construct optical phase curves. This model takes Lambertian reflection, thermal emission, ellipsoidal variations, and Doppler boosting, into account. Results: CoRoT-1b shows a non-negligible scattering albedo (0.11 < AS < 0.3 at 95% confidence) as well as small day-night temperature contrasts, which are indicative of moderate to high re-distribution of energy between dayside and nightside. These values are contrary to previous secondary eclipse and phase curve analyses. In the case of HAT-P-7b, model results suggest a relatively high scattering albedo (AS ≈ 0.3). This confirms previous phase curve analysis; however, it is in slight contradiction to values inferred from secondary eclipse data. For TrES-2b, both approaches yield very similar estimates of albedo and heat recirculation. Discrepancies between recirculation and albedo values as inferred from secondary eclipse and optical phase curve analyses might be interpreted as a hint that optical and IR observations probe different atmospheric layers, hence temperatures.

  16. Search of Exoplanets - Phase I

    NASA Astrophysics Data System (ADS)

    Vodniza, Alberto Q.; Pereira, M. R.; Lopez, J. P.; Reyes, K.; Chaves, L.

    2008-09-01

    From the Astronomical Observatory at the University of Nariño-COLOMBIA, we have begun a systematic search for exoplanets. Initially we made differential photometry on variable stars weaker than the tenth magnitude to get enough experience on the establishment of stellar transits, so then we could undertake the work with exoplanets. We have already confirmed the transits of two exoplanets with good photometry data: At the exoplanet HAT-P-5b, discovered by Bakos and other investigators and which turns around the GSC 02634-01087, with an orbital period of 2.788491 days according to measurements of the discoverers, and also at the exoplanet TrES-3, discovered by O'Donovan and other investigators and which turns around the GSC 03089-00929, with an orbital period of 1.30619 days, established by its discoverers. Both exoplanets are quite interesting because they have one of the smallest periods found on exoplanets. The TrES-3 also provides a big opportunity for studying the orbital decay and mass loss due to evaporation, caused by the great closeness to its star. We have captured a lot of data to elaborate the lightcurves so we can estimate physical parameters of the bodies. We are getting data on various dates. Actually we are preparing the equipment to develop observations of radial velocities through spectrometry. In a later phase, we expect to verify the presence of other exoplanets which cause less deep transits, and then we can investigate stars with possible exoplanets around them. Besides we hope to design a mathematical model of the studied systems. The equipment we employed is: 14"LX200 GPS MEADE telescope, ST-7XME SBIG camera, STL-1001 SBIG camera, LHIRES III Spectrograph, and SGS-SBIG Spectrograph. On the poster it is explained at length the methodology followed over the search, the data we obtained and the physical- mathematical analysis that was carried out.

  17. DISYUNTIVAS EN LAS CONCEPCIONES SOBRE AUTONOMÍA Y BENEFICENCIA QUE AFECTAN LA TERAPÉUTICA DEL INTENTO SUICIDA1

    PubMed Central

    Mondragón, Liliana; Monroy, Zuraya; Ito, Ma. Emily; Medina-Mora, Dra. Ma. Elena

    2010-01-01

    El objetivo del trabajo es conocer las disyuntivas entre los principios de beneficencia y autonomía, que se presentan en la relación médico-paciente, durante la terapéutica del intento de suicidio. La investigación se realizó en dos hospitales psiquiátricos de la Ciudad de México. La muestra incluyó a tres sujetos con intento de suicidio, mayores de 18 años, que eran atendidos en consulta externa a causa de una lesión autoinfligida en el último año, y a tres psiquiatras que trataban a estos pacientes. La información se obtuvo previo consentimiento informado en entrevistas individuales. Se llevó a cabo un análisis de discurso argumentado para encontrar los significados que los participantes otorgaron a los principios bioéticos y las posibles disyuntivas entre éstos. Las discordancias entre la beneficencia y la autonomía estuvieron relacionadas con el beneficio del tratamiento, el respeto por los valores y las creencias de los pacientes, entre otros. Este trabajo presenta consideraciones éticas relevantes en el escenario clínico, al ofrecer al psiquiatra un análisis bioético que le permita actuar de acuerdo con la beneficencia y respetando la autonomía del paciente frente a casos de intento de suicidio y, de esta forma procurar una mejor atención para ellos. PMID:20830214

  18. [Nitrous oxide emission, nitrification, denitrification and nitrogen mineralization during rice growing season in 2 soils from Uruguay].

    PubMed

    Illarze, Gabriela; Del Pino, Amabelia; Riccetto, Sara; Irisarri, Pilar

    2017-09-23

    Microbial processes such as mineralization, nitrification and denitrification regulate nitrogen dynamics in the soil. The last two processes may produce nitrous oxide (N2O). In this work N2O fluxes were quantified at four moments of the rice cycle, sowing, tillering, panicle initiation and maturity, in two sites that differed mainly in their soil organic matter (OM) content, Salto (higher OM) and Treinta y Tres. Potential net N mineralization, ammonium oxidation and denitrification as well as the most probable numbers (MPN) of ammonia oxidizers and denitrifiers were determined. Potential N mineralization did not vary with the soil type and increased at rice maturity. Neither ammonia oxidation potential nor MPN were different among the soils. However, the soil with higher OM exhibited higher activity and MPN of denitrifiers, irrespective of the rice stage. In turn, at the latest phases of the crop, the MPN of denitrifiers increased coinciding with the highest mineralization potential and mineral N content of the soil. Significant differences in N2O flux were observed in Salto, where the highest emissions were detected at rice maturity, after the soil was drained (44.2 vs 20.8g N-N2O/ha d in Treinta y Tres). This work shows the importance of considering the soil type and end-of-season drainage of the rice field to elaborate GHGs (greenhouse gases) inventories. Copyright © 2017 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  19. [SNACK HIGH WHEY PROTEIN IMPROVES THE LEVEL OF SATIETY AND REDUCES APPETITE HEALTHY WOMEN].

    PubMed

    Reyna, Nadia; Moreno-Rojas, Rafael; Mendoza, Laura; Urdaneta, Andrés; Artigas, Carlos; Reyna, Eduardo; Cámara Martos, Fernando

    2015-10-01

    Antecedentes: el contenido nutricional y la densidad energética de los alimentos están relacionados con un mayor control del apetito, la saciedad y la reducción de la ingesta de alimentos. Material y métodos: el estudio consistió en un diseño cruzado aleatorizado que incluyó 20 mujeres sanas, con edades entre 20 y 30 años y con un IMC de 20 y 24,9 kg/m2 que se sometieron durante tres días a una prueba de ocho horas comparando meriendas de 130 kcal consumidas por la tarde: yogur con adición de proteína de suero de leche (PSL), galletas y chocolate. Consumieron un menú estandarizado; la merienda se consumía tres horas después del almuerzo. El hambre percibida y la plenitud se evaluaron durante la tarde hasta el consumo voluntario de la cena ad libitum. Resultados: el consumo de yogur con PSL ocasionó una mayor reducción del apetito y un aumento de la saciedad tras su ingesta y hasta la cena, respecto a la merienda de chocolate y galletas (p < 0,001), no existiendo diferencias entre estas últimas. La merienda de yogur con PSL ocasionó una reducción significativa de la ingesta calórica en la cena, en comparación con las otras meriendas (p < 0,001) y una solicitud más tardía de alimentos de hasta 45 minutos. Conclusiones: las meriendas con baja densidad energética y ricas en proteína (y concretamente el yogur con PSL), pueden ser una solución eficaz para mejorar el control del apetito y reducir la ingesta de alimentos en mujeres sanas.

  20. [Status epilepticus in paediatrics: a retrospective study and review of the literature].

    PubMed

    Moreno-Medinilla, Esther E; Negrillo-Ruano, Rocío; Calvo-Medina, Rocío; Mora-Ramírez, M Dolores; Martínez-Antón, Jacinto L

    2015-05-01

    Introduccion. El estado epileptico (EE) es la emergencia neurologica mas frecuente en pediatria. Dada la posibilidad de secuelas neurologicas y mortalidad asociadas, requiere un tratamiento agresivo precoz. Pacientes y metodos. Estudio descriptivo retrospectivo a traves de la revision de historias clinicas de pacientes ingresados en nuestro hospital entre 2010-2013 con diagnostico de EE. El objetivo fue describir las caracteristicas epidemiologicas y el manejo de estos pacientes, asi como revisar la bibliografia disponible sobre este tema. Resultados. Hemos recogido 39 pacientes (25 varones) y 51 episodios de EE. Edad media: 4,8 años. Tenian enfermedad de base 22 pacientes. Dieciocho eran epilepticos conocidos y cinco tuvieron un EE previo. De los 51 episodios de EE, 33 fueron sintomaticos, 15 febriles y tres criptogenicos. Los tipos de EE fueron: 25 parciales (de ellos, 16 complejos) y 26 generalizados. El tratamiento de primera eleccion fue benzodiacepinas en 47 pacientes (40, diacepam), fenitoina en tres y acido valproico en uno. Veintisiete pacientes precisaron farmacos de segunda linea: 16, acido valproico; ocho, fenitoina; dos, fenobarbital; y uno, levetiracetam. Diez pacientes precisaron farmacos de tercera linea para la induccion del coma: el midazolam fue el mas utilizado en nuestro centro, seguido del tiopental y el propofol. Dos EE superrefractarios requirieron inmunoglobulinas y corticoides sistemicos por presentarse en el curso de encefalitis autoinmunes. Conclusiones. Debe plantearse el esquema terapeutico del EE desde el inicio de cualquier crisis convulsiva. El tratamiento es escalonado, con benzodiacepinas en la primera etapa, antiepilepticos de amplio espectro y disponibilidad intravenosa en la segunda (acido valproico, levetiracetam en el EE generalizado y fenitoina en el EE focal), mientras que el tercer nivel varia en funcion de la experiencia de cada equipo.

  1. [The prevalence of obesity and metabolic syndrome in paediatric patients with epilepsy treated in monotherapy with valproic acid].

    PubMed

    Carmona-Vazquez, C R; Ruiz-Garcia, M; Pena-Landin, D M; Diaz-Garcia, L; Greenawalt, S R

    2015-09-01

    Introduccion. El acido valproico (VPA) es un antiepileptico util para controlar diferentes tipos de epilepsia. Tiene efectos colaterales y se asocia a incremento del peso corporal y a alteraciones metabolicas y endocrinas, entre ellas sindrome metabolico. Objetivo. Conocer la prevalencia de la obesidad y el sindrome metabolico en pacientes pediatricos con epilepsia tratados en monoterapia con VPA. Pacientes y metodos. Estudio transversal, observacional, analitico. Se estudiaron pacientes tratados con VPA entre 2010-2014, y se midio el indice de masa corporal (IMC), el perimetro abdominal, la presion arterial, la glucosa, los trigliceridos y las lipoproteinas de alta densidad (HDL), en busqueda de obesidad y sindrome metabolico. La obesidad se definio con un IMC mayor del percentil 95; el sindrome metabolico, con al menos tres de los siguientes criterios: perimetro abdominal mayor del percentil 90, presion arterial sistemica mayor del percentil 90, trigliceridos mayores de 110 mg/dL y HDL menor de 40 mg/dL. Resultados. Se estudiaron 47 pacientes con una edad media de 10,1 ± 4 años; el 51,06% eran varones. Ocho (17%) desarrollaron obesidad y, de ellos, dos (25%), sindrome metabolico. Tres pacientes desarrollaron sobrepeso (6%). Observamos diferencias estadisticamente significativas de media de edad comparados con los grupos de IMC, donde los pacientes obesos eran adolescentes (ANOVA; p = 0,0001), y aquellos que tomaban mas VPA al dia eran los obesos (ANOVA; p = 0,024). Conclusiones. Los pacientes tratados con VPA que se convierten en obesos pueden desarrollar sindrome metabolico. Requieren una monitorizacion cuidadosa y, ante la presencia de ganancia de peso, se debera valorar la retirada del farmaco.

  2. DISYUNTIVAS EN LAS CONCEPCIONES SOBRE AUTONOMÍA Y BENEFICENCIA QUE AFECTAN LA TERAPÉUTICA DEL INTENTO SUICIDA.

    PubMed

    Mondragón, Liliana; Monroy, Zuraya; Ito, Ma Emily; Medina-Mora, Dra Ma Elena

    2010-06-01

    El objetivo del trabajo es conocer las disyuntivas entre los principios de beneficencia y autonomía, que se presentan en la relación médico-paciente, durante la terapéutica del intento de suicidio.La investigación se realizó en dos hospitales psiquiátricos de la Ciudad de México. La muestra incluyó a tres sujetos con intento de suicidio, mayores de 18 años, que eran atendidos en consulta externa a causa de una lesión autoinfligida en el último año, y a tres psiquiatras que trataban a estos pacientes. La información se obtuvo previo consentimiento informado en entrevistas individuales. Se llevó a cabo un análisis de discurso argumentado para encontrar los significados que los participantes otorgaron a los principios bioéticos y las posibles disyuntivas entre éstos.Las discordancias entre la beneficencia y la autonomía estuvieron relacionadas con el beneficio del tratamiento, el respeto por los valores y las creencias de los pacientes, entre otros. Este trabajo presenta consideraciones éticas relevantes en el escenario clínico, al ofrecer al psiquiatra un análisis bioético que le permita actuar de acuerdo con la beneficencia y respetando la autonomía del paciente frente a casos de intento de suicidio y, de esta forma procurar una mejor atención para ellos.

  3. The Language of Planetary Light

    NASA Technical Reports Server (NTRS)

    2005-01-01

    This graph of data from NASA's Spitzer Space telescope shows changes in the infrared light output of two star-planet systems (one above, one below) located hundreds of light-years away. The data were taken while the planets, called HD 209458b and TrES-1, disappeared behind their stars in what is called a 'secondary eclipse.' The dip seen in the center of each graph represents the time when the planets were eclipsed, and tells astronomers exactly how much light they emit.

    Why a secondary eclipse? When a planet transits, or passes in front of, its star, it partially blocks the light of the star. When the planet swings around behind the star, the star completely blocks its light. This drop in total light can be measured to determine the amount of light coming from just the planet.

    Why infrared? In visible light, the glare of a star overwhelms its planetary companion and the little light the planet reflects. In infrared, a star shines less brightly, and its planet gives off its own internal light, or heat radiation, making the planet easier to detect.

    By observing these secondary eclipses at different infrared wavelengths, astronomers can obtain the planet's temperature, and, in the future, they may be able to pick out chemicals sprinkled throughout a planet's atmosphere. The technique also reveals whether a planet's orbit is elongated or circular.

    This strategy will not work for all known extrasolar planets. It is ideally suited to study those Jupiter-sized planets previously discovered to cross, or transit, between us and the Sun-like stars they orbit, out to distances of 500 light-years. NASA's Spitzer Space Telescope was the first to successfully employ this technique.

    The data of HD 209458b were taken by Spitzer's multiband imaging photometer using the 24-micron array. The data of TrES-1 were taken by Spitzer's infrared array camera using the 8-micron array.

  4. The GAPS programme with HARPS-N at TNG. IX. The multi-planet system KELT-6: Detection of the planet KELT-6 c and measurement of the Rossiter-McLaughlin effect for KELT-6 b

    NASA Astrophysics Data System (ADS)

    Damasso, M.; Esposito, M.; Nascimbeni, V.; Desidera, S.; Bonomo, A. S.; Bieryla, A.; Malavolta, L.; Biazzo, K.; Sozzetti, A.; Covino, E.; Latham, D. W.; Gandolfi, D.; Rainer, M.; Petrovich, C.; Collins, K. A.; Boccato, C.; Claudi, R. U.; Cosentino, R.; Gratton, R.; Lanza, A. F.; Maggio, A.; Micela, G.; Molinari, E.; Pagano, I.; Piotto, G.; Poretti, E.; Smareglia, R.; Di Fabrizio, L.; Giacobbe, P.; Gomez-Jimenez, M.; Murabito, S.; Molinaro, M.; Affer, L.; Barbieri, M.; Bedin, L. R.; Benatti, S.; Borsa, F.; Maldonado, J.; Mancini, L.; Scandariato, G.; Southworth, J.; Zanmar Sanchez, R.

    2015-09-01

    Aims: For more than 1.5 years we spectroscopically monitored the star KELT-6 (BD+31 2447), which is known to host the transiting hot-Saturn KELT-6 b, because a previously observed long-term trend in radial velocity time series suggested that there is an outer companion. Methods: We collected a total of 93 new spectra with the HARPS-N and TRES spectrographs. A spectroscopic transit of KELT-6 b was observed with HARPS-N, and simultaneous photometry was obtained with the IAC-80 telescope. Results: We proved the existence of an outer planet with a mininum mass Mpsin i = 3.71 ± 0.21 MJup and a moderately eccentric orbit (e = 0.21-0.036+0.039) of period P ~ 3.5 years. We improved the orbital solution of KELT-6 b and obtained the first measurement of the Rossiter-McLaughlin effect, showing that the planet has a likely circular, prograde, and slightly misaligned orbit with a projected spin-orbit angle of λ = -36 ± 11 degrees. We improved the KELT-6 b transit ephemeris from photometry and provide new measurements of the stellar parameters. KELT-6 appears as an interesting case for studying the formation and evolution of multi-planet systems. Based on observations made with (i) the HARPS-N spectrograph on the Italian Telescopio Nazionale Galileo (TNG), operated on the island of La Palma by the INAF - Fundacion Galileo Galilei (Spanish Observatory of Roque de los Muchachos of the IAC); (ii) the Tillinghast Reflector Echelle Spectrograph (TRES) on the 1.5-m Tillinghast telescope, located at the Smithsonian Astrophysical Observatory's Fred L. Whipple Observatory on Mt. Hopkins in Arizona; (iii) the IAC-80 telescope at the Teide Observatory (Instituto de Astrofísica de Canarias, IAC).Figure 4 and Tables 2 and 3 are available in electronic form at http://www.aanda.org

  5. A systematic retrieval analysis of secondary eclipse spectra. II. A uniform analysis of nine planets and their C to O ratios

    SciTech Connect

    Line, Michael R.; Knutson, Heather; Wolf, Aaron S.; Yung, Yuk L.

    2014-03-10

    Secondary eclipse spectroscopy provides invaluable insights into the temperatures and compositions of exoplanetary atmospheres. We carry out a systematic temperature and abundance retrieval analysis of nine exoplanets (HD 189733b, HD 209458b, HD 149026b, GJ436b, WASP-12b, WASP-19b, WASP-43b, TrES-2b, and TrES-3b) observed in secondary eclipse using a combination of space- and ground-based facilities. Our goal with this analysis is to provide a consistent set of temperatures and compositions from which self-consistent models can be compared and to probe the underlying processes that shape these atmospheres. This paper is the second in a three part series of papers exploring the retrievability of temperatures and abundances from secondary eclipse spectra and the implications of these results for the chemistry of exoplanet atmospheres. In this investigation we present a catalogue of temperatures and abundances for H{sub 2}O, CH{sub 4}, CO, and CO{sub 2}. We find that our temperatures and abundances are generally consistent with those of previous studies, although we do not find any statistically convincing evidence for super-solar C to O ratios (e.g., solar C/O falls in the 1σ confidence intervals in eight of the nine planets in our sample). Furthermore, within our sample we find little evidence for thermal inversions over a wide range of effective temperatures (with the exception of HD 209458b), consistent with previous investigations. The lack of evidence for inversions for most planets in our sample over such a wide range of effective temperatures provides additional support for the hypothesis that TiO is unlikely to be the absorber responsible for the formation of these inversions.

  6. Scheme for development of monitoring networks for springs in Bavaria, Germany

    NASA Astrophysics Data System (ADS)

    Bender, Steffen; Einsiedl, Florian; Wohnlich, Stefan

    2001-03-01

    The present groundwater monitoring network in Bavaria consists mostly of wells and only a small number of natural groundwater springs, all of which are analyzed for mainly the common physical and chemical constituents in groundwater. In order to develop a long-term groundwater management plan for all the groundwater resources of Bavaria, the Bavarian State Office for Water Management intends to establish a separate spring-monitoring network throughout the 11 groundwater provinces of the state. As a first step, significant physicochemical parameters that show considerable annual fluctuation (after monitoring 1-3 years) were determined at 21 springs or spring systems to create a basic data set to guide future monitoring. A selection procedure was developed around four parameters: (1) geological units, which includes the principal aquifers; (2) rate of spring discharge; (3) land utilization within a catchment; and (4) approximate size of the subterranean catchment. However, in the initial phase of the study, only the first three parameters were investigated. These parameters established a matrix for evaluating each groundwater region of Bavaria to aid in the selection of additional springs for the proposed monitoring network. Résumé. Le réseau actuel de surveillance des eaux souterraines en Bavière consiste surtout en des puits avec seulement un petit nombre de sources, tous analysés pour l'essentiel pour les composants courants physiques et chimiques des eaux souterraines. Afin de développer un plan de gestion à long terme des eaux souterraines de la Bavière, l'Office bavarois pour la gestion de l'eau cherche à mettre en place un réseau séparé de surveillance des sources dans les onze provinces hydrogéologiques du lander. Dans un premier temps, les paramètres physico-chimiques significatifs qui présentent des variations annuelles considérables, après 1 à 3 ans de surveillance, ont été déterminés à 21 sources ou groupes de sources pour

  7. Nouvelles approches en theorie du champ moyen dynamique: le cas du pouvoir thermoelectrique et celui de l'effet orbital d'un champ magnetique

    NASA Astrophysics Data System (ADS)

    Arsenault, Louis-Francois

    Les applications reliees a la generation d'energie motivent la recherche de materiaux ayant un fort pouvoir thermoelectrique (S). De plus, S nous renseigne sur certaines proprietes fondamentales des materiaux, comme, par exemple, la transition entre l'etat coherent et incoherent des quasi-particules lorsque la temperature augmente. Empiriquement, la presence de fortes interactions electron-electron peut mener a un pouvoir thermoelectrique geant. Nous avons donc etudie le modele le plus simple qui tient compte de ces fortes interactions, le modele de Hubbard. La theorie du champ moyen dynamique (DMFT) est tout indiquee dans ce cas. Nous nous sommes concentres sur un systeme tridimensionnel (3d) cubique a face centree (fcc), et ce, pour plusieurs raisons. A) Ce type de cristal est tres commun dans la nature. B) La DMFT donne de tres bons resultats en 3d et donc ce choix sert aussi de preuve de principe de la methode. C) Finalement, a cause de la frustration electronique intrinseque au fcc, celui-ci ne presente pas de symetrie particule-trou, ce qui est tres favorable a l'apparition d'une grande valeur de S. Ce travail demontre que lorsque le materiau est un isolant a demi-remplissage a cause des fortes interactions (isolant de Mott), il est possible d'obtenir de grands pouvoirs thermoelectriques en le dopant legerement. C'est un resultat pratique important. Du point de vue methodologique, nous avons montre comment la limite de frequence infinie de S et l'approche dite de Kelvin, qui considere la limite de frequence nulle avant la limite thermodynamique pour S, donnent des estimations fiables de la vraie limite continue (DC) dans les domaines de temperature appropriee. Ces deux approches facilitent grandement les calculs en court-circuit ant la necessite de recourir a de problematiques prolongements analytiques. Nous avons trouve que la methode de calcul a frequence infinie fonctionne bien lorsque les echelles d'energie sont relativement faibles. En d'autres termes

  8. Improving mating performance of mass-reared sterile Mediterranean fruit flies (Diptera: Tephritidae) through changes in adult holding conditions: demography and mating competitiveness

    SciTech Connect

    Liedo, P.; Salgado, S.; Oropeza, A.; Toledo, J.

    2007-03-15

    with wild flies. As colonization progressed, life expectancy and fecundity rates increased in the 3 rearing systems. There was no significant difference in standard quality control parameters among the 3 rearing systems. Wild males always achieved more matings than any of the mass reared males. Mating competitiveness of males from the IS, although surprisingly not from the SS, was significantly greater than that of males from the MS. Our results indicate that these slight changes in the adult holding conditions can significantly reduce the harmful effects of mass rearing on the mating performance of sterile flies. (author) [Spanish] Se ha demostrado que las condiciones de cria masiva afectan el comportamiento de apareamiento de la mosca del Mediterraneo Ceratitis capitata (Wiedemann). Nosotros evaluamos el efecto de ligeros cambios en las condiciones en las que los adultos son mantenidos para la produccion de huevos, en el desempeno de apareamiento de las moscas esteriles. La colonizacion se inicio con moscas silvestres colectadas como larvas en cerezas de cafe (Coffea arabica L.) infestadas. Cuando las pupas estuvieron cerca de la emergencia de los adultos, se dividieron en tres grupos al azar y los adultos recien emergidos fueron criados en las siguientes condiciones: (1) Sistema Metapa (MS, testigo), consistente en jaulas con marco de aluminio de 70 x 45 x 15 cm, cubiertas con malla, con una densidad de 2,200 moscas por jaula y una relacion de sexos inicial de 1:1; (2); Sistema Insertos (IS), con el mismo tipo de jaula, densidad de moscas, y relacion de sexos que en el MS, pero conteniendo 12 piezas de plexiglas (23 x 8.5 cm) para proporcionar superficie horizontal al interior de la jaula; y (3) Sistema de Relacion de Sexos (SS), igual que el IS, pero en este caso la relacion inicial macho: hembra fue de 4:1, tres dias despues se introdujeron hembras recien emergidas para tener una relacion de 3:1 y en el 6 dia se anadio otro grupo de hembras para tener una relacion

  9. Indoor and Outdoor Mobility following Total Knee Arthroplasty.

    PubMed

    Storey, Ava S T; Myrah, Ainslie M; Bauck, Robyn A; Brinkman, Danielle M; Friess, Shawn N; Webber, Sandra C

    2013-01-01

    Objectifs : En premier lieu, établir la relation entre la capacité de mobilité à l'intérieur et à l'extérieur chez les aînés qui ont subi une arthroplastie unilatérale totale du genou (TKA); en second lieu, évaluer l'intensité de la marche chez les mêmes individus et comparer tous les résultats à l'aide d'un groupe de contrôle composé d'aînés n'ayant aucune pathologie du genou. Méthodologie : Dans le cadre d'une étude transversale, les participants (TKA=16, moyenne de 22,9 [écart-type 9,7] mois après TKA; groupe de contrôle=22) ont effectué des tests de marche à l'intérieur et ont marché sur un parcours extérieur de 580 m sur divers types de surfaces (p. ex. bordure de chaussée, gazon, trottoir), avec changements de direction fréquents. La capacité de marche a été évaluée à l'aide de montres chronomètres, de GPS et d'accéléromètres. Résultats : Le temps de marche à l'extérieur était modérément corrélé (p<0,05) avec un test TUG (timed up-and-go); (r=0,65), un test de l'escalier (stair-climb test, SCT) (r=0,67 en montée, r=0,79 en descente), un test de marche de 10 mètres (10 mWT); (r=0,73), et un test de marche de 6 minutes (6 MWT); (r=−0,75). En fonction du décompte des activités, les niveaux d'intensité pendant la marche pour les participants des deux groupes étaient modérés (marche à l'extérieur et 6 MWT). Il n'y a pas eu de différence significative dans la capacité de marche entre les deux groupes (pour le TUG, le SCT, le 10 mWT, le 6 MWT, et la marche à l'extérieur). Conclusions : Les tests de marche cliniques habituellement utilisés sont corrélés de façon modérée avec la mobilité à l'extérieur. La capacité de mobilité chez les personnes post-TKA était similaire aux participants du groupe de contrôle à l'intérieur comme à l'extérieur, et les participants des deux groupes sont parvenus à un niveau d'activité physique modérée grâce à la marche.

  10. [In Process Citation].

    PubMed

    González-Montesinos, José Luis; Ponce-González, Jesús Gustavo; Vicente-Campos, Davinia; López-Chicharro, José; Fernández-Santos, Jorge Del Rosario; Vaz-Pardal, Carmen; Costa-Sepúlveda, José Luis; Conde-Caveda, Julio; Castro-Piñero, José

    2016-03-25

    Introducción y objetivos: un dispositivo llamado FeelBreathe ® (FB) se ha diseñado, desarrollado y patentado para el entrenamiento de la musculatura inspiratoria (IMT). Para examinar los efectos de FB en la ventilación pulmonar y el intercambio gaseoso durante el ejercicio, se tomaron medidas de 27 voluntarios varones sanos entrenados (edad: 32,5 ± 7,2 años). Métodos: al inicio del estudio se midieron tanto la presión inspiratoria máxima estática (PIM) y la capacidad pulmonar mediante espirometría. Seguidamente, se realizó un test incremental en cicloergómetro para determinar el VO 2 pico. Cada sujeto, tres días más tarde, realizó aleatoriamente tres pruebas idénticas submáximas en cicloergómetro a una intensidad comprendida al 50% entre los umbrales ventilatorios bajo tres condiciones de respiración diferentes: a) respiración oronasal (ONB), b) respiración nasal (NB) y c) la respiración nasal a través del FB. Resultados: la prueba con FB mostró una ventilación minuto (VE) y una frecuencia respiratoria (BF) inferior que en las pruebas de NB, la cual a su vez tenía menor BF, pero similar VE que ONB (p < 0,001). A pesar de esto, FB obtuvo valores similares de VO 2 , cociente respiratorio (RER), frecuencia cardiaca (HR) y saturación de oxígeno capilar periférica (SpO2) en comparación con NB y ONB. Esto último puede ocurrir debido en parte al aumento del volumen tidal (VT) y el tiempo de expiración (Tex) en FB hasta el mismo nivel que en la prueba de NB, los cuales fueron un 15% y 14% en ambas pruebas, respectivamente, superiores a ONB (p < 0,001). El porcentaje de tiempo de inspiración (Ti/Tot) fue 7% mayor en la prueba de FB en comparación con NB y ONB (p < 0,001). Solamente en la prueba de FB se encontró un aumento de la presión final de la espiración de CO 2 (P ET CO 2 ) y la reducción de la presión final de la espiración de O 2 (P ET O 2 ) y la fracción de expiración de O 2 (FEO 2 ). Conclusiones: FeelBreathe es un

  11. Evaluation d'une approche pedagogique respectant les facons d'apprendre des filles en sciences et en TIC en 9e annee au Nouveau-Brunswick

    NASA Astrophysics Data System (ADS)

    Lirette-Pitre, Nicole T.

    2009-07-01

    La reussite scolaire des filles les amene de plus en plus a poursuivre une formation postsecondaire et a exercer des professions qui demandent un haut niveau de connaissances et d'expertise scientifique. Toutefois, les filles demeurent toujours tres peu nombreuses a envisager une carriere en sciences (chimie et physique), en ingenierie ou en TIC (technologie d'information et de la communication), soit une carriere reliee a la nouvelle economie. Pour plusieurs filles, les sciences et les TIC ne sont pas des matieres scolaires qu'elles trouvent interessantes meme si elles y reussissent tres bien. Ces filles admettent que leurs experiences d'apprentissage en sciences et en TIC ne leur ont pas permis de developper un interet ni de se sentir confiante en leurs habiletes a reussir dans ces matieres. Par consequent, peu de filles choisissent de poursuivre leurs etudes postsecondaires dans ces disciplines. La theorie sociocognitive du choix carriere a ete choisie comme modele theorique pour mieux comprendre quelles variables entrent en jeu lorsque les filles choisissent leur carriere. Notre etude a pour objet la conception et l'evaluation de l'efficacite d'un materiel pedagogique concu specifiquement pour ameliorer les experiences d'apprentissage en sciences et en TIC des filles de 9e annee au Nouveau-Brunswick. L'approche pedagogique privilegiee dans notre materiel a mis en oeuvre des strategies pedagogiques issues des meilleures pratiques que nous avons identifiees et qui visaient particulierement l'augmentation du sentiment d'auto-efficacite et de l'interet des filles pour ces disciplines. Ce materiel disponible par Internet a l'adresse http://www.umoncton.ca/lirettn/scientic est directement en lien avec le programme d'etudes en sciences de la nature de 9e annee du Nouveau-Brunswick. L'evaluation de l'efficacite de notre materiel pedagogique a ete faite selon deux grandes etapes methodologiques: 1) l'evaluation de l'utilisabilite et de la convivialite du materiel et 2

  12. Abundance and Morphological Effects of Large Woody Debris in Forested Basins of Southern Andes

    NASA Astrophysics Data System (ADS)

    Andreoli, A.; Comiti, F.; Lenzi, M. A.

    2006-12-01

    The Southern Andes mountain range represents an ideal location for studying large woody debris (LWD) in streams draining forested basins thanks to the presence of both pristine and managed woodland, and to the general low level of human alteration of stream corridors. However, no published investigations have been performed so far in such a large region. The investigated sites of this research are three basins (9-13 km2 drainage area, third-order channels) covered by Nothofagus forests: two of them are located in the Southern Chilean Andes (the Tres Arroyos in the Malalcahuello National Reserve and the Rio Toro within the Malleco Natural Reserve) and one basin lies in the Argentinean Tierra del Fuego (the Buena Esperanza basin, near the city of Ushuaia). Measured LWD were all wood pieces larger than 10 cm in diameter and 1 m in length, both in the active channel and in the adjacent active floodplain. Pieces forming log jams were all measured and the geometrical dimensions of jams were taken. Jam type was defined based on Abbe and Montgomery (2003) classification. Sediment stored behind log-steps and valley jams was evaluated approximating the sediment accumulated to a solid wedge whose geometrical dimensions were measured. Additional information relative to each LWD piece were recorded during the field survey: type (log, rootwad, log with rootwads attached), orientation to flow, origin (floated, bank erosion, landslide, natural mortality, harvest residuals) and position (log-step, in-channel, channel-bridging, channel margins, bankfull edge). In the Tres Arroyos, the average LWD volume stored within the bankfull channel is 710 m3 ha-1. The average number of pieces is 1,004 per hectare of bankfull channel area. Log-steps represent about 22% of all steps, whereas the elevation loss due to LWD (log-steps and valley jams) results in 27% loss of the total stream potential energy. About 1,600 m3 of sediment (assuming a porosity of 20%) is stored in the main channel

  13. VizieR Online Data Catalog: Radial velocities in M67. I. 1278 candidate members (Geller+, 2015)

    NASA Astrophysics Data System (ADS)

    Geller, A. M.; Latham, D. W.; Mathieu, R. D.

    2015-10-01

    This is the first in a series of papers studying the dynamical state of the old open cluster M67 through precise radial velocities. This is also the paper LXVII of the WIYN Open Cluster Study. Our radial velocity survey of M67 began as part of the dissertation work of Mathieu (1983PhDT.........8M), taking advantage of the CfA Digital Speedometers (DS). Three nearly identical instruments were used, initially on the MMT (from HJD2445337 to HJD2450830) and 1.5m Tillinghast Reflector (from HJD2444184 to HJD2454958) at the Fred Lawrence Whipple Observatory on Mount Hopins, Arizona, and then later on the 1.5m Wyeth Reflector (from HJD2445722 to HJD2453433) at the Oak Ridge Observatory in the Town of Harvard, Massachusetts. Subsequently the M67 target samples were expanded several times. Radial velocities measurements from other programs were integrated into the database, and our observational facilities were extended to include Hydra Multi-Object Spectrograph (MOS) at the WIYN Observatory (from HJD2453386 to HJD2456709) and the new Tillinghast Reflector Echelle Spectrograph (TRES) on the Tillinghast Reflector (from HJD2455143 to HJD2456801). Details about the telescopes, observing procedures, and data reductions of spectra obtained with the CfA DS can be found in Latham (1985srv..conf...21L, 1992ASPC...32..110L). The corresponding information for spectra obtained with Hydra at the WIYN Observatory can be found in Geller et al. 2008 (cat. J/AJ/135/2264), Geller et al. 2010 (cat. J/AJ/139/1383) and Hole et al. (2009). TRES is a stabilized fiber-fed echelle spectrograph with a CCD detector and resolution of 44000. The initial CfA sample was defined in 1982. The last surviving CfA Digital Speedometer, on the 1.5m Tillinghast Reflector, was retired in the summer of 2009. Over the following five observing seasons, TRES was used to continue the radial velocity observations of targets (mostly binaries) from both the CfA and the WIYN samples. Importantly, Roger Griffin and James

  14. Proterozoic SCLM domains beneath Southern Patagonia

    NASA Astrophysics Data System (ADS)

    Mundl, Andrea; Ntaflos, Theodoros; Ackerman, Lukas; Bizimis, Michael; Bjerg, Ernesto

    2014-05-01

    Alkali basalt hosted mantle xenoliths from 3 different areas in South Patagonia were studied with regard to their petrography and chemical, as well as their Re-Os and Lu-Hf isotopic compositions. The Pali Aike Volcanic Field (PAVF) located in the very south of Patagonia comprises sample localities Salsa, El Ruido and Potrok Aike. About 300 km north, in the western part of Patagonia, samples were collected at Tres Lagos and further north-east, within and at the edge of the Deseado massif, are sample localities Gobernador Gregores and Don Camilo, respectively. The collected sample suite comprises sp-lherzolites, sp-harzburgites, one sp-dunite and exclusively within PAVF also sp-gt-lherzolites and sp-gt-harzburgites. Textures are mostly protogranular with very few samples showing weak foliation. Whole rock Al2O3 and CaO contents range from 0.63 to 3.54 wt.% and 0.24 to 3.44 wt.%, respectively and exhibit a linear correlation with MgO ranging from 39.2 to 49 wt.%. The more refractory peridotites are represented by samples from the PAVF while samples from the Deseado massif are generally more fertile. Indications for the formation age of SCLM domains can be provided using the Re-Os isotopic system. A suite of 24 modally unmetasomatised sp-lherzolites and sp-harzburgites analyzed for Re-Os isotopic composition reveals Neo- to Paleoproterozoic rhenium depletion ages. Don Camilo and Gobernador Gregores lherzolites indicate a SCLM formation in Mesoproterozoic times (0.9 to 1.3 Ga). Tres Lagos harzburgites reveal slightly older formation ages with a max. TRD of 1.7 Ga. Samples from within the PAVF vary more strongly in 187Os/188Os ratios with Neo- to late Paleoproterozoic TRDs. 3 refractory samples indicate an at least 2.4 Ga old formation age of the SCLM domain underneath PAVF. Hf isotopic data combined with the information obtained from Os isotopic analyses provide new information on potential metasomatic overprints and their probable timing. Negative to low positive

  15. Relative Motion Between the Rivera and North American Plates Determined from the Slip Directions of Earthquakes

    NASA Astrophysics Data System (ADS)

    Suárez, Gerardo; Jaramillo, Said H.; Bandy, W. L.

    2013-12-01

    So far, the direction and rate of relative motion between the Rivera and the North American plates (RIV-NAM) has been determined by the combination of two Euler poles: Rivera (RIV), with respect to Pacific (PAC), and PAC with respect to North America. Here, we estimate the relative motion of this plate pair (RIV-NAM) assuming that the horizontal projection of the direction of slip of the earthquakes occurring on the RIV-NAM boundaries reflect their relative plate motion. A catalog of earthquakes for which focal mechanisms are reported since 1976 is used in the analysis. Earthquakes were considered in the three segments of the RIV-NAM plate boundary: the subduction zone of the Rivera plate beneath the Jalisco block, the Tres Marias Escarpment and the events associated with the Tamayo Fracture Zone. The best fitting Euler pole is determined using a grid search of 64 potential poles. The slip direction predicted for each grid point is compared to the slip direction of the focal mechanisms of the earthquakes on the plate boundary. The best fitting Euler pole, determined in a root mean square sense (RMS), is located at 21.8°N, 107.6°W. A rate of rotation of 5.3°/year is estimated assuming the seismic earthquake cycle of the 1932 and 1995 great earthquakes represents a lower bound of the rate of plate motion in the subduction zone. The best fitting Euler pole shows that the subduction of the Rivera plate takes place in a direction perpendicular to the trench with a relative velocity of 4.3 cm/year, offshore Manzanillo. The rate of relative motion RIV-NAM decreases from SE to NW. North of approximately 21°N, the subduction of the Rivera plate becomes oblique to the trench and the relative velocity between the two plates decreases to an average of 1.9 cm/year. This slow rate of convergence may explain the rapid decrease of seismicity in the trench and the apparent absence of large earthquakes in this region. In the Tres Marias Escarpment, our best-fitting pole suggests

  16. Assessment of the culture of safety in public hospitals in Brazil.

    PubMed

    Carvalho, Rhanna Emanuela Fontenele Lima de; Arruda, Lidyane Parente; Nascimento, Nayanne Karen Pinheiro do; Sampaio, Renata Lopes; Cavalcante, Maria Lígia Silva Nunes; Costa, Ana Carolina Pinto

    2017-03-02

    to assess the culture of safety in three public hospitals. transversal study undertaken in three Brazilian public hospitals, with health professionals through applying the Safety Attitudes Questionnaire (SAQ). Scores greater than or equal to 75 were considered positive. a total of 573 professionals participated in the study, including nurse technicians and auxiliary nurses 292 (51%), nurses 105 (18.3%), physicians 59 (10.3%), and other professionals 117 (20.4%). The mean of the SAQ varied between 65 and 69 in the three hospitals. Among the domains, however, 'Job satisfaction' presented a higher score, and the opposite was observed for the domain 'Perceptions of management'. The outsourced professionals presented a better perception of the culture of safety than did the statutory professionals. The professionals with higher education presented a better perception of the stressing factors than did the professionals educated to senior high school level. the level of the culture of safety found is below the ideal. The managerial actions are considered the main contributing factor to the culture's weakness; however, the professionals demonstrated themselves to be satisfied with the work. evaluar la cultura de seguridad en tres hospitales públicos. estudio transversal realizado en tres hospitales públicos brasileños, desarrollado con profesionales de la salud aplicando el Safety Attitudes Questionnaire (SAQ). Fueron considerados positivos puntajes mayores o iguales a 75. participaron del estudio 573 profesionales, incluyendo técnicos y auxiliares de enfermería 292 (51%), enfermeros 105 (18,3%), médicos 59 (10,3%), y otros profesionales 117 (20,4%). El promedio del SAQ varió entre 65 a 69 en los tres hospitales. Sin embargo, en los dominios, Satisfacción en el Trabajo presentó mayor puntaje y lo opuesto fue observado en el dominio Percepción de la Administración. Los profesionales tercerizados presentaron mejor percepción de la cultura de seguridad que los

  17. Chemotherapy near the end of life; assessment of the clinical practise in onco-hematological in adult patients.

    PubMed

    Taberner Bonastre, Pilar; Taberner Bonastre, María Teresa; Soler Company, Enrique; Pérez-Serrano Lainosa, María Dolores

    2016-01-01

    Objetivo: garantizar una buena calidad de vida en la última fase de los pacientes onco-hematológicos debería ser nuestro principal objetivo; a pesar de ello, disponemos de pocos datos a nivel europeo y los estudios publicados son contradictorios. No obstante, la mayoría coinciden en que administrar quimioterapia en la etapa final de la vida impacta de forma negativa en la calidad de vida del paciente. El objetivo principal del estudio es analizar los indicadores de no agresividad del tratamiento en pacientes onco-hematológicos. Como objetivo secundario, realizar un estudio descriptivo de las variables clínicas de los pacientes a los que se les administra quimioterapia en la fase final de la vida y los esquemas más utilizados. Método: se realizó un estudio observacional retrospectivo en un hospital de tercer nivel. Se incluyeron todos los pacientes oncológicos y hematológicos que recibieron quimioterapia (oral o intravenosa) entre enero y diciembre de 2013, a los que se les administró la última quimioterapia en los 90 días previos al fallecimiento. Resultados: se analizaron 823 pacientes que recibieron tratamiento entre enero y diciembre de 2013. De ellos, 106 (13%) cumplían los criterios de inclusión. Un 14,1% (n = 93) de los pacientes oncológicos y un 8,4% (n = 13) de los hematológicos que habían recibido quimioterapia durante el último año de vida lo seguían haciendo en los últimos tres meses. Un 21,7% (n = 23) de los pacientes recibieron quimioterapia en las dos últimas semanas, 41,5% (n = 44) en los últimos 30 días y 78,3% (n = 83) en los últimos dos meses de vida. El 67,9% (n = 72) de los pacientes ingresaron en el hospital durante los últimos tres meses de vida, el 47,2% (n = 50) lo hicieron durante el último mes, el 33% (n = 35) durante las dos últimas semanas y el 10,4% (n = 11) durante los últimos tres días de vida. El 25,5% (n = 27) de los pacientes ingresaron en más de una ocasión durante los 90 días previos al

  18. Etude Par Spectroscopie Infrarouge des Oxydes Moleculaires Superoxyde de Potassium, Peroxyde de Potassium et Trioxyde de Silicium Isoles EN Matrice D'argon

    NASA Astrophysics Data System (ADS)

    Tremblay, Benoit

    1995-01-01

    A l'aide de la spectroscopie d'absorption infrarouge et de la technique d'isolation en matrice d'argon, nous avons repris l'etude des differents oxydes moleculaires qui se forment lorsque l'oxygene moleculaire se trouve dans des agregats avec du potassium, du silicium et de l'oxyde de silicium SiO. Le choix des oxydes moleculaires KO_2 et K_2O_2 a ete motive par le fait qu'ils ont souvent ete mis en evidence dans tres travaux en physique des surfaces lors de letude du systeme O_2/K/Si. Ces oxydes avaient deja ete identifies par spectroscopie infrarouge en matrice d'argon au debut des annees soixante-dix. Pour KO_2, l'observation des modes nu_2 et nu_3 pour de nombreuses especes isotopiques nous a permis de deduire la longueur de la liaison K-O et de l'angle O-K-O. En effet, la construction d'un champ de force harmonique nous a permis de determiner sa structure et des constantes de force qui reprodusient tres bien les frequences experimentales observees. L'etude de l'oxyde K_2O _2 s'est averee interessante car avant notre travail, seule une vibration avait ete mise en evidence. Nous avons reussi a observer deux nouvelles vibrations fondamentales: une bande infrarouge faible a 185 cm^{-1}, avec les isotopes ^{16}O _2, ^{18}O _2 et ^{16} O^{18}O de l'oxygene, et une autre, activee en infrarouge avec l'isotope ^{16}O^{18 }O a 405 cm^{-1}. Les donnees experimentales etant insuffisantes pour deduire la structure de la molecule, des calculs theoriques avec la methode de la fonctionnelle de la densite ont donne le structure et les vibrations non observees du K _2O_2. Ces donnees supplementaires sont venues completer les resultats experimentaux et nous ont permis de construire un champ de force harmonique avec <=uel nous avons trouve des constantes de force qui reproduisent tres bien les frequences observees. Les calculs theoriques ont monte que K_2O _2 doit etre de structure C_ {rm 2v}, bien que la structure D _{rm 2h} ne puisse pas etre rejetee, puisque qu'il y a un

  19. Large wood storage, longitudinal distribution and mobility in channel segments of four mountain rivers, Chile

    NASA Astrophysics Data System (ADS)

    Iroume, A.; Mao, L.; Andreoli, A.; Ulloa, H.

    2013-12-01

    In Chile, besides an anecdotal reference to in-stream wood by Vidal Gormaz (1875), the first report on LW is the one by Andreoli et al. (2007). Since then, more abundant research has developed, focusing mainly on morphologic and hydraulic functions (Comiti et al., 2008; Mao et al., 2008, 2010; Iroumé at al., 2010, 2011; Ulloa et al., 2011), and also on the ecology of low order channels (Vera et al., 2012). Large wood storage, longitudinal distribution and mobility have been studied for several periods in channel segments of four mountain catchments (Pichún, El Toro, Tres Arroyos and Vuelta de Zorra) in southern Chile. The surveyed segments were divided into individual reaches, and the length of each reach was calculated using a laser distance meter and mean individual reach bankfull width and depth were obtained by averaging measurements in cross-sections. All wood pieces found within the bankfull channel more than 10 cm in diameter and 1 m in length were measured and their position was referenced to natural elements and to numbered wooden stakes indicating every reach limit. Several of these wood elements were tagged to study LW mobilization. A 1.54 km-long segment divided into 17 individual reaches was first surveyed in the Tres Arroyos during March-April 2005, and then re-surveyed in November 2008 when the study segment was extended to a total length of 2.07 km with the addition of 5 new individual reaches. Pichún, El Toro and Vuelta de Zorra were first surveyed from November 2008 to February 2009. The length of the channel segments is 1.0 (12 reaches), 2.2 (17 reaches) and 1.56 km (16 reaches) for Pichún, El Toro and Vuelta de Zorra, respectively. These segments have been re-surveyed after every winter rainy season to study LW recruitment and mobility. Using the area of the bankfull channel as reference, total LW volume was 54 m3/ha in Pichún, 202 m3/ha in El Toro, 1449 m3/ha for Tres Arroyos and 109 m3/ha for Vuelta de Zorra. The LW travel distance and

  20. Self-efficacy scale for the establishment of good relationships with families in neonatal and pediatric hospital settings.

    PubMed

    Cruz, Andréia Cascaes; Angelo, Margareth; Santos, Bernardo Pereira Dos

    2017-05-25

    The purpose of this study was to develop and test the psychometric properties of the Self-efficacy Scale for the Establishment of Good Relationships with Families in Neonatal and Pediatric Hospital Settings. Methodological study grounded on self-efficacy theory was conducted in three phases: conceptual and operational definition (review of the literature and interviews with the target population), content validity (opinion of five experts e three clinical nurses), and exploratory factor analysis and internal consistency reliability (cross-sectional survey with a valid sample of 194 nurses). A ten-point Likert scale with 40-item was designed and one item was excluded after review by experts. Three factors emerged from the exploratory factor analysis. The Cronbach's alpha for all items was 0.983 with item-total correlations in the range 0.657 to 0.847. Cronbach's alpha value if item deleted were less than or equal to 0.983. The final version of the scale demonstrated psychometric adequacy. It is a useful tool to be administered in the clinical, educational and research nursing fields to measure nurses' self-efficacy beliefs concerning the establishment of good relationships with families. El propósito de este estudio fue desarrollar y probar las propiedades psicométricas de la Escala de Autoeficacia para el Establecimiento de Buenas Relaciones con las Familias en Ambientes Neonatales y Pediátricos. Estudio metodológico fundamentado en la teoría de la auto-eficacia se realizó en tres fases: conceptual y definición operacional (revisión de la literatura y entrevistas con la población objetivo), la validez de contenido (opinión de cinco expertos y tres enfermeras clínicas), y el factor de análisis exploratorio e fiabilidad interna de consistencia (estudio transversal con una muestra válida de 194 enfermeras). La escala de Likert de diez puntos con 40 ítems fue diseñada y un elemento fue excluido después de la revisión por expertos. Hay tres factores que

  1. PubMed

    Vera-Remartínez, Enrique J; Paredes-Carbonell, Joan J; Aviñó Juan-Ulpiano, Dory; Jiménez-Pérez, Mercedes; Araujo Pérez, Rosa; Agulló-Cantos, José M; Mora Notario, Almudena

    2016-04-07

    Estudio realizado desde el enfoque de la salutogénesis que pretende determinar el sentido de coherencia (SOC) en jóvenes presos de la Comunidad Valenciana en España y elaborar un mapa de activos para la salud dirigido a promover la salud en esta población. Se utilizó el test "SOC-13" y un cuestionario de preguntas abiertas elaboradoad hoc, el cual autocompletaron los internos de 18 a 22 años de edad, de los tres centros penitenciarios de la región. Participaron 124 jóvenes varones (ya que no había ninguna mujer) y se recogieron variables sociodemográficas y penitenciarias. En el análisis cuantitativo, las variables categóricas se expresaron como frecuencias absolutas y relativas; y las cuantitativas, mediante medias con intervalos de confianza (IC) al 95%. Se realizó un estudio comparativo bivariante, utilizando las siguientes pruebas: Studentt-test, análisis de variación (ANOVA), Wilcoxon y Ji-cuadrado. Del cuestionario de preguntas abiertas, se realizó un análisis cualitativo descriptivo temático de los activos identificados, clasificándolos en: internos (recursos personales, en relación con los demás y capacidad para realizar comportamientos saludables) y externos (personas, grupos, instituciones y espacios físicos, situados tanto dentro como fuera de prisión). La edad media fue de 21,1 años (IC 95%: 20,8-21,3); y el SOC de 52,4 (IC 95%: 50,5-54,3), de entre un valor mínimo de 13 y máximo de 91 para la prueba. Los internos del centro penitenciario que ofrecía más actividades escolares y deportivas obtuvieron una puntuación mayor en la dimensión de significatividad del SOC (p= 0,024), y los internos inmigrantes presentaron un SOC superior (p= 0,037) a los españoles, en los tres centros. Los jóvenes identificaron los activos internos que cualitativamente se vinculan con las dimensiones de comprensibilidad, manejabilidad y significatividad del SOC; y los activos externos, sobre todo los amigos, familiares y espacios relacionados con

  2. Aluminum Enhances Growth and Sugar Concentration, Alters Macronutrient Status and Regulates the Expression of NAC Transcription Factors in Rice.

    PubMed

    Moreno-Alvarado, Marcos; García-Morales, Soledad; Trejo-Téllez, Libia Iris; Hidalgo-Contreras, Juan Valente; Gómez-Merino, Fernando Carlos

    2017-01-01

    Aluminum (Al) is a beneficial element for some plant species, especially when used at low concentrations. Though some transcription factors are induced by exposure to this element, no data indicate that Al regulates the expression of NAC genes in rice. In this study we tested the effect of applying 200 μM Al on growth, chlorophyll, amino acids, sugars, macronutrient concentration and regulation of NAC transcription factors gene expression in 24-day-old plants of four rice (Oryza sativa ssp. indica) cultivars: Cotaxtla, Tres Ríos, Huimanguillo and Temporalero, grown hydroponically under greenhouse conditions. Twenty days after treatment, we observed that Al enhanced growth in the four cultivars studied. On average, plants grown in the presence of Al produced 140% more root dry biomass and were 30% taller than control plants. Cotaxtla and Temporalero showed double the root length, while Huimanguillo and Cotaxtla had three times more root fresh biomass and 2.5 times more root dry biomass. Huimanguillo plants showed 1.5 times more shoot height, while Cotaxtla had almost double the root dry biomass. With the exception of Tres Ríos, the rest of the cultivars had almost double the chlorophyll concentration when treated with Al, whereas amino acid and proline concentrations were not affected by Al. Sugar concentration was also increased in plants treated with Al, almost 11-fold in comparison to the control. Furthermore, we observed a synergic response of Al application on P and K concentration in roots, and on Mg concentration in shoots. Twenty-four hours after Al treatment, NAC transcription factors gene expression was measured in roots by quantitative RT-PCR. Of the 57 NAC transcription factors genes primer-pairs tested, we could distinguish that 44% (25 genes) showed different expression patterns among rice cultivars, with most of the genes induced in Cotaxtla and Temporalero plants. Of the 25 transcription factors up-regulated, those showing differential expression

  3. Homogeneous studies of transiting extrasolar planets - IV. Thirty systems with space-based light curves

    NASA Astrophysics Data System (ADS)

    Southworth, John

    2011-11-01

    I calculate the physical properties of 32 transiting extrasolar planet and brown-dwarf systems from existing photometric observations and measured spectroscopic parameters. The systems studied include 15 observed by the CoRoT satellite, 10 by Kepler and five by the Deep Impact spacecraft. Inclusion of the objects studied in previous papers leads to a sample of 58 transiting systems with homogeneously measured properties. The Kepler data include observations from Quarter 2, and my analyses of several of the systems are the first to be based on short-cadence data from this satellite. The light curves are modelled using the JKTEBOP code, with attention paid to the treatment of limb darkening, contaminating light, orbital eccentricity, correlated noise and numerical integration over long exposure times. The physical properties are derived from the light-curve parameters, spectroscopic characteristics of the host star and constraints from five sets of theoretical stellar model predictions. An alternative approach using a calibration from eclipsing binary star systems is explored and found to give comparable results whilst imposing a much smaller computational burden. My results are in good agreement with published properties for most of the transiting systems, but discrepancies are identified for CoRoT-5, CoRoT-8, CoRoT-13, Kepler-5 and Kepler-7. Many of the error bars quoted in the literature are underestimated. Refined orbital ephemerides are given for CoRoT-8 and for the Kepler planets. Asteroseismic constraints on the density of the host stars are in good agreement with the photometric equivalents for HD 17156 and TrES-2, but not for HAT-P-7 and HAT-P-11. Complete error budgets are generated for each transiting system, allowing identification of the observations best-suited to improve measurements of their physical properties. Whilst most systems would benefit from further photometry and spectroscopy, HD 17156, HD 80606, HAT-P-7 and TrES-2 are now extremely well

  4. Analyse de la dynamique temporelle d'une molécule unique en matrice sol-gel

    NASA Astrophysics Data System (ADS)

    Débarre, A.; Tchénio, P.; Azoulay, J.; Jaf Iol, R.; Nutarelli, D.

    2002-06-01

    L'un des enjeux des études de molécules uniques est de développer des sondes très locales d'un environnement donné. De telles informations ne sont pas accessibles dans les expériences classiques où de nombreuses molécules sont détectées simultanément. Celles-ci ne permettent de déterminer que la valeur moyenne de la distribution d'un paramètre. Parmi les paramètres temporels, la durée de vie des états excités atteints par la molécule occupe une place particulière. Ce paramètre, qui est lié aux propriétés quantiques de la molécule peut varier considérablement si des transferts d'énergie s'établissent entre la molécule et son environnement immédiat. Un autre exemple est la mesure du nombre total de photons émis par la molécule avant qu'elle n'émette plus ( photoblanchiment ). L'arrêt définitif de l'émission est très directement lié aux interactions lumineuses ou collisionnelles que la molécule subit dans les états excités où elle est portée. Cet article décrit d'une part le dispositif expérimental qui a été développé pour déterminer plusieurs paramètres temporels sur la même molécule, et d'autre part les premiers résultats acquis dans des matériaux sol-gels dopés par des molécules dérivées du pérylène[1].

  5. Preliminary results from comparisons of redundant tiltmeters at three sites in central california

    USGS Publications Warehouse

    Mortensen, C.E.; Johnston, M.J.S.

    1979-01-01

    The U.S. Geological Survey has been operating a network of shallow-borehole tiltmeters in central California since June 1973. At six sites redundant instruments have been installed as a check on data coherency. These include the Sage Ranch, Tres Pinos, New Idria, Aromas, Bear Valley and San Juan Bautista tiltmeter sites. Preliminary results from the comparison of redundant data from the Aromas, Bear Valley and San Juan Bautista sites for periods of eight, three and seven months respectively, suggest that short period tilt signals in the range 5 min < T < 3-5 h and ranging in amplitude from 5 ?? 10-8 to 10-6 rad, but not including step offsets, show excellent agreement on closely spaced instruments. Agreement is not as good in this period range for instruments at San Juan Bautista with a separation of 200 m. Signals of interest observed in this period range include coseismic tilts, teleseisms and tilts associated with creep events. Tilt signals in the period range 3-5 h < T < 2- 5 weeks are not always coherent at all three of the redundant tilt sites studied. Tilt signals in this period range have amplitudes up to 5 ?? 10-6 rad and wavelengths down to at least the instrument separation at the closely spaced sites (~several meters). Regarding longerterm coherency, the instruments at San Juan Bautista with 200-m spacing, agree within 0.5 ??rad for the N-S component and 0.7 jurad for the E-W component for a period of two months. The closely spaced redundant instruments at Aromas agree within 2 ??rad for the N-S component and 1 ??rad for the E-W component for the eight-month period of operation. Data from the three sites have been checked for effects of temperature, atmospheric pressure and rainfall. The latter appears to be critically site dependent. The worst case tilts for 1 inch of rainfall can be more than 1 jurad with a duration of a few days to a week. Typical rain-induced tilts are less than 0.3 ??rad for 1 inch of rain. The two instruments at the Sage Ranch

  6. La implantacion del enfoque constructivista en el aula de ciencia: Estudio de caso multiple

    NASA Astrophysics Data System (ADS)

    Arroyo Betancourt, Luz I.

    Esta investigacion estudia la implantacion del enfoque constructivista en tres aulas de ciencia del contexto puertorriqueno. Se auscultaron las practicas educativas que utilizan maestras consideradas constructivistas y la correspondencia de sus practicas educativas con los elementos esenciales de la didactica que proponen los teoricos de los planteamientos constructivistas. Se ausculto, ademas, a que vision del enfoque constructivista responden las expresiones de las maestras acerca de su practica educativa y como compara con su quehacer, a la luz de los elementos esenciales de las visiones constructivistas piagetiana, social y radical. Se utilizo el diseno de estudio descriptivo de caso multiple. El estudio se baso en entrevistas a profundidad, revision de documentos y observacion no participativa a la sala de clases. El contexto fueron tres escuelas publicas de la Region Educativa de San Juan, una elemental, una intermedia y una superior. Los resultados confirmaron que la transicion hacia el enfoque constructivista es un proceso que toma tiempo, dedicacion y la participacion en adiestramientos y readiestramientos acerca del nuevo enfoque. Las maestras coinciden en la mayoria de las practicas educativas que utilizan para implantar el enfoque constructivista de ensenanza y difieren en algunas debido, probablemente, a que han tenido que adaptarlas a los correspondientes niveles de ensenanza: elemental, intermedio y superior. Dos de las maestras planifican por conceptos generadores, mientras que una de ellas planifica siguiendo la guia que recibe del Departamento de Educacion. Difieren ademas, en el enfasis que confieren al inquirir cientifico. Con relacion a la correspondencia entre la vision manifestada por las maestras a la luz de las visiones piagetiana, social y radical, aparentemente, las preguntas del protocolo de entrevistas no lograron evocar la informacion con suficiente profundidad, por lo que la investigadora tuvo que inferir las visiones de las

  7. In Pursuit of New Worlds: Searches for and Studies of Transiting Exoplanets from Three Space-Based Observatories

    NASA Astrophysics Data System (ADS)

    Ballard, Sarah Ashley

    2012-01-01

    This thesis presents studies of transiting exoplanets using observations gathered in large part from space, with the NASA EPOXI Mission, the Spitzer Space Telescope, and the Kepler Mission. The first part of this thesis describes searches for additional transiting planets in known exoplanet systems, using time series photometry gathered as part of the NASA EPOXI Mission. Using the EPOXI light curves spanning weeks for each star, we searched six exoplanetary systems for signatures of additional transiting planets. These six systems include five hosts to hot Jupiters: HAT-P-4, TrES-3, TrES-2, WASP-3, and HAT-P-7, and one host to a hot Neptune: GJ 436. We place upper limits on the presence of additional transiting planets in the super-Earth radius range for GJ 436 in Chapter 2, and in the Neptune-to-Saturn radius range for the other five systems in Chapter 4. Chapter 3 details a search for additional transits of a hypothesized planet smaller than the Earth, whose presence was suggested by the EPOXI observations of GJ 436. In that study, we demonstrate the sensitivity of Warm Spitzer observations to transits of a sub-Earth-sized planet. The fifth chapter details the characterization and validation of the Kepler-19 system, which hosts a transiting 2.2 R⊕ planet, Kepler-19b. We demonstrate the planetary nature of the transit signal with an analysis that combines information from high-resolution spectroscopy, the shape of the transit light curve, adaptive optics imaging, and near-infrared transits of the planet. The sinusoidal variation in the transit times of Kepler-19b indicates the presence of an additional perturbing body, and comprises the first definitive detection of a planet using the transit timing variation method. While we cannot uniquely determine the mass and orbital period of Kepler-19c, we establish that its mass must be less than 6 times the mass of Jupiter. The sixth chapter presents evidence for the validation of a 2.0 R ⊕ planet residing in the

  8. Étude théorique et expérimentale de la propagation des vibrations émises par un trafic ferroviaire se déplaçant à vitesse constante

    NASA Astrophysics Data System (ADS)

    Picoux, B.; Le Houédec, D.

    2002-12-01

    Dans cet article, nous présentons un modèle numérique spécialement conçu pour l'étude des vibrations basses fréquences couplant un sol stratifié à une voie ferrée supportant un train se déplaçant à vitesse constante. Les résultats ainsi obtenus sont en accord avec les observations expérimentales suivantes: pour une augmentation des vitesses, on note une majoration des déplacements à la surface du sol et dans la voie. Dans le but de la validation qualitative du modèle numérique, des mesures sur sites dont le sol est particulièrement “mou” ont également été réalisées. Une chaîne de mesures composée d'une caméra vidéo numérique rapide, d'un vélocimètre laser et de plusieurs accéléromètres est disposée aux abords d'une voie ferrée dans la région d'Amiens. Des tests géomécaniques et sismiques préalables sont mis en œuvre pour évaluer les paramètres mécaniques du sol. A l'issue de ces mesures, la vitesse des ondes de Rayleigh est calculée (proche de 100m/s). Les résultats issus des mesures de vidéo numérique rapide sont comparés à ceux du modèle. Les déplacements maximum ainsi que les vitesses particulaires à la surface du sol peuvent alors être retrouvés bien que la totalité du signal n'ait pas été prise en compte dans le modèle.

  9. Prevalence of factors related to the bone mass formation of children from a cohort in Southern Brazil.

    PubMed

    Doumid Borges Pretto, Alessandra; Correa Kaufmann, Cristina; Ferreira Dutra, Gisele; Pinto Albernaz, Elaine

    2014-12-17

    Introducción: La cantidad de masa ósea adquirida en las primeras etapas de la vida es un importante factor determinante de su pico y el riesgo futuro de osteoporosis y fracturas. Objetivo: Describir la prevalencia de factores que contribuye a la formación de la masa ósea en niños de una cohorte del sur de Brasil. Métodos: Estudio de cohorte retrospectiva con el hospital de todos los nacimientos (2741) se produjo en septiembre / 2002 a mayo / 2003 y el seguimiento de una muestra aleatoria de un 30,0% de los mismos (uno, tres y seis meses y ocho años de edad). En una visita a los ocho años de edad, aplicó un cuestionario con preguntas relacionadas con la alimentación y la actividad física. Resultados y Discusión: De los 616 niños, el 51,3% eran hombres, el 70,3% de raza caucásica, cerca de la mitad pertenecían a la clase económica C, 20,5% tenían sobrepeso, el 16,9% eran obesos y 71,2% sedentarios. La ingesta de alimentos es bajo consumo de frutas, verduras, productos lácteos, carne, los cereales y los tubérculos. La administración de vitamina D en los primeros seis meses de vida fue seguido por 14,1% de los prematuros, el 16,1% de los recién nacidos con bajo peso al nacer, el 24,2% de destete en el primer mes y sólo el 16,4% a los tres meses. Conclusión: Los niños evaluados tienen un bajo consumo de nutrientes, entre ellos el calcio, deficiente administración de vitamina D en el primer semestre de vida, poco actividad física regular y la alta prevalencia del sobrepeso y la obesidad son factores que pueden afectar a la formación de masa ósea.

  10. TRANSLATION AND VALIDATION OF THE FOOD NEOPHOBIA SCALE (FNS) TO THE BRAZILIAN PORTUGUESE.

    PubMed

    Ribeiro de Andrade Previato, Helena Dória; Herman Behrens, Jorge

    2015-08-01

    Introducción: La Escala de Neofobia Alimentaria (ENA), desarrollada originalmente en lengua inglesa, ha sido ampliamente utilizada en diferentes estudios para evaluar el deseo individual de probar nuevos alimentos. Sin embargo, es necesario un proceso de traducción y adaptación cultural para permitir su uso en otros países. Objetivo: traducir y validar la ENA en portugués brasileño. Métodos: la escala fue traducida al portugués, de forma independiente, por tres profesores de inglés, siendo traducido al revés al inglés por otros tres profesionales del sector. Se entregaron estas traduciones a una muestra de 40 estudiantes de posgrado de la Universidad de Campinas, São Paulo (Brasil), entre septiembre y octubre de 2014. La reproducibilidad entre los instrumentos se evaluó por medio del coeficiente de correlación intraclase (CCI). La confiabilidad interna de la escala se evaluó por medio del coeficiente alfa de Cronbach. La puntuación total de la ENA varió 10-70 y los individuos fueron clasificados con neofilia alimentaria (≤ 16,4), neutralidad (16,5-38,5) y neofobia alimentaria (≥ 38,6). Resultados: el CCI entre los ítems de la versión original y traducida se situó entre 0,266 y 0,815 (p < 0,05) y la puntuación total de la ENA fue 0,903 (p < 0,001). El coeficiente alfa de Cronbach fue 0,916. La mayoría de los encuestados fueron clasificados como neutrales (72,5%), el otro 10% como neofilia y solo el 17,5% con neofobia alimentaria. Conclusiones: la versión brasileña de la ENA resultó ser una herramienta adecuada y confiable para medir la neofobia alimentaria. No obstante, se necesitan investigaciones futuras para evaluar la presencia de neofobia alimentaria en la población brasileña y para analizar su impacto en la conducta alimentaria.

  11. Profil de l'hémogramme chez les enfants paludéens de 0 à 5 ans sous quinine, cas de la République Démocratique du Congo

    PubMed Central

    Kabamba, Arsène Tshikongo; Lukumwena, Zet Kalala; Longanga, Albert Otshudi

    2014-01-01

    Le paludisme constitue un des problèmes de santé publique majeur en République Démocratique du Congo (RDC) à cause d'une part des risques d’épidémies dans certaines zones du pays et d'autre part à cause du nombre des malades et des décès qu'il provoque. Cette étude expose les aspects hématologiques liés à la prise de la quinine au cours du paludisme grave chez l'enfant. Pour ce faire, les prises de sang ont été effectuées à deux groupes d'enfants, dans différents centres hospitaliers de Lubumbashi: le premier groupe est constitué d'enfants gravement impaludés et sous traitement à la quinine; tandis que le second groupe, composé d'enfants impaludés aussi mais sans traitement à la quinine et sert de groupe témoin. Ces prélèvements ont été analysés pour une exploration de l'hémogramme par un dosage sérique des paramètres hématologiques ci-après: les globules rouges, l'hémoglobine, l'hématocrite et le volume globulaire moyen. Les résultats obtenus montrent une différence statistiquement significative entre les deux groupes d'enfants examinés. En effet, dans la majorité des cas, une augmentation des taux plasmatiques des paramètres hématologiques analysés a été observée dans le groupe d'enfants impaludés sous traitement à la quinine, traduisant ainsi l'apport de la quinine sur la stabilisation de l'hémogramme au cours d'un paludisme grave chez l'enfant de moins de cinq ans. PMID:25722768

  12. Dimensionnement des actionneurs électriques alimentés à fréquence variable sous faible tension: I. Analyse du problème couplé magnétique, thermique, électrique

    NASA Astrophysics Data System (ADS)

    Biedinger, J.-M.; Vilain, J.-P.

    1998-07-01

    In this paper, the autors present a model for the multidisciplinary operation analysis of a variable frequency electrical drive, in the case of low voltage supply. This model takes into account the coupling between the electromagnetic, thermal and electrical phenomena. It allows to evaluate the performances under permanent or transient thermal conditions, as we can find in the working cycles of electrical vehicles with on board energy supply. This model is a part of an optimal design procedure, which will be described in an other article. For this reason, this paper is devoted to explain the dependences between the design variables and the performances. The proposed model is applied to a permanent magnet brushless DC motor. The performances are evaluated for the S1 and S2 duty-cycling operations. The influence of the driving parameters of the converter is also examined. L'objectif de cet article est de présenter la synthèse d'un modèle d'analyse pluridisciplinaire adapté à la caractérisation des performances d'un entraînement électrique alimenté à fréquence variable sous faible tension. Le modèle prend en compte le couplage entre les phénomènes électromagnétique, thermique et électrique. Il permet d'étudier le fonctionnement sous les conditions de régime thermique permanent ou transitoire qui interviennent dans la définition des cycles de travail des engins de traction à énergie embarquée. Ce modèle d'analyse constitue un élément d'une procédure de dimensionnement optimal qui sera développée dans un article séparé; aussi l'exposé est-il conduit en explicitant les dépendances fonctionnelles entre les paramètres de dimensionnement et les performances. La procédure d'analyse est appliquée à l'étude d'un moteur à aimants permanents périphériques alimenté suivant le mode “brushless trapézoïdal"; les performances sont évaluées pour deux types de cycle de travail: le cycle S1 en régime permanent, et le cycle S2 en r

  13. Interactive initialization of 2D/3D rigid registration

    SciTech Connect

    Gong, Ren Hui; Güler, Özgür; Kürklüoglu, Mustafa; Lovejoy, John; Yaniv, Ziv

    2013-12-15

    Purpose: Registration is one of the key technical components in an image-guided navigation system. A large number of 2D/3D registration algorithms have been previously proposed, but have not been able to transition into clinical practice. The authors identify the primary reason for the lack of adoption with the prerequisite for a sufficiently accurate initial transformation, mean target registration error of about 10 mm or less. In this paper, the authors present two interactive initialization approaches that provide the desired accuracy for x-ray/MR and x-ray/CT registration in the operating room setting. Methods: The authors have developed two interactive registration methods based on visual alignment of a preoperative image, MR, or CT to intraoperative x-rays. In the first approach, the operator uses a gesture based interface to align a volume rendering of the preoperative image to multiple x-rays. The second approach uses a tracked tool available as part of a navigation system. Preoperatively, a virtual replica of the tool is positioned next to the anatomical structures visible in the volumetric data. Intraoperatively, the physical tool is positioned in a similar manner and subsequently used to align a volume rendering to the x-ray images using an augmented reality (AR) approach. Both methods were assessed using three publicly available reference data sets for 2D/3D registration evaluation. Results: In the authors' experiments, the authors show that for x-ray/MR registration, the gesture based method resulted in a mean target registration error (mTRE) of 9.3 ± 5.0 mm with an average interaction time of 146.3 ± 73.0 s, and the AR-based method had mTREs of 7.2 ± 3.2 mm with interaction times of 44 ± 32 s. For x-ray/CT registration, the gesture based method resulted in a mTRE of 7.4 ± 5.0 mm with an average interaction time of 132.1 ± 66.4 s, and the AR-based method had mTREs of 8.3 ± 5.0 mm with interaction times of 58 ± 52 s. Conclusions: Based on the

  14. Evaluation of Bajo Blanco Sandbar as a Potential Beach Nourishment Borrow Site for Eroding Beaches in Rincon, Puerto Rico

    NASA Astrophysics Data System (ADS)

    Rojas, C. A.; Canals, M.

    2016-02-01

    The municipality of Rincón, Puerto Rico is recognized for its world-class surfing beaches. Unfortunately, the coast from Punta Higüero to Punta Cadena in Rincón is experiencing long-term erosion (Thieler 2007), which has caused the destruction of many beachfront homes and hotels and had negative impacts on the local tourism-driven economy. The purpose of this project is to evaluate whether the nearby Bajo Blanco sandbar, located just offshore of these eroded beaches, could be used as a possible beach nourishment borrow site. A high-resolution bathymetric survey of Bajo Blanco sandbar was conducted along with a grain size analysis to compare the grain size distribution of the Bajo Blanco sandbar with the sediment properties of the eroded beaches. It was found that the sediment from Bajo Blanco is finer yet may be suitable as beach fill material for these beaches according to Dean's overfill ratio. Compatibility analysis suggests a total volume of sandbar sediment of approximately 685,555 cubic meters to allow successful beach equilibrium. To evaluate the potential effects of the sand extraction on the nearshore wave climate, numerical simulations were performed using the spectral wave model of the USACE Coastal Modeling System (CMS-Wave). Wave model results for several dredging scenarios suggest that wave energy flux concentrates around the shoal causing an increase in wave height at the northern and southern edges of the shoal. Therefore, conservation of energy leads to a reduction of wave energy flux shoreward of the shoal, causing a shadow of reduced wave height. In addition, the Tres Palmas Marine reserve is located just north of Bajo Blanco sandbar and features some of the healthiest Elkorn Corals in the Caribbean. To avoid excessive sedimentation of these reefs during dredging activities, the Particle Tracking Module (PTM), integrated in the Surface-water Modeling System (SMS), was used to evaluate the Lagrangian particle transport processes along Bajo

  15. Description du Système Ternaire Ag-As-Te

    NASA Astrophysics Data System (ADS)

    Ollitrault-Fichet, Rolande; Rivet, Jacques; Flahaut, Jean; El Kfouri, Charbel

    1994-05-01

    Le diagramme de phases du système Ag-As-Te a été étudié par analyse thermique différentielle, diffraction de rayons X et analyse métallographique. Deux combinaisons ternaires ont été observées sur la section Ag 2Te-As 2Te 3: Ag 11AsTe 7 et AgAs 3Te 5, l'une et l'autre à décomposition péritectique de type binaire, la première à 405°C, la seconde à 331°C. La phase Ag 11AsTe 7, dont l'étude structurale est en cours de résolution, est hexagonale et isotype de Ag 11.67Te 7 (Ag 5Te 3). Elle n'est observée que dans un étroit domaine de température, entre 145 et 405°C. La triangulation et le décompte des invariants ternaires imposent l'existence d'une solution solide continue entre Ag 11.67Te 7 et Ag 11AsTe 7 avec apparition concomitante de deux domaines à deux phases. Il n'a toutefois pas été possible de confirmer l'existence de cette solution solide par mesure de la variation des paramètres en fonction de la composition, les paramètres des deux composés étant extrêmement voisins. Le réseau cristallin de la phase AgAs 3Te 5 est encore inconnu; il n'a pas, de plus, été possible d'obtenir une phase AgAsTe 2. Deux sections quasi binaires sont décrites dans ce système. Huit invariants ternaires, dont trois sont pratiquement confondus avec les invariants binaires du système Ag 2Te-As 2Te 3, sont dénombrés: trois eutectiques et cinq péritectiques. Ils sont localisés en température et en composition. Une zone de démixtion ternaire liquide-liquide est observée à partir de la monotexie binaire du système Ag-Te. Enfin, un domaine formateur de verres, extrêmement étendu, est mis en évidence au voisinage de As 2Te 3 ce qui est assez exceptionnel pour un système de tellurures.

  16. Neogene retro-arc basaltic magmatism in southern Patagonia: are there alternatives to teared slabs and slab window models?

    NASA Astrophysics Data System (ADS)

    Roggero, Davide; Müntener, Othmar; Pilet, Sébastien

    2017-04-01

    The Neogene retro-arc magmatism in southern Patagonia (South America) has been associated to the melting of OIB type asthenospheric mantle, related to the opening of a slab window and/or slab tearing beneath South America as a consequence of the subduction of the Chile ridge. This retro-arc magmatism produced alkaline to subalkaline transitional lavas - magmas with geochemical characterictics intermediate between alkaline and calc-alkaline geochemistry - yet the spatial and temporal evolution of the geochemical signatures are largely unconstrained. Here we use detailed field investigations and new geochemical data from the retro-arc lavas of the Sierra Baguales and Cerro del Fraile-Tres Lagos area (southern Patagonia), that are located about 100-150 km east of the active volcanic arc, to test potential relationships between the geochemical signature and the dynamics of the south-Patagonian subduction system in the last 20 million years. New geochemical analysis show that basaltic lavas and mafic rocks from Sierra Baguales are primitive magmas with subalkaline to high-K calc-alkaline signature. Positive Pb and negative Nb anomalies are hallmarks of calc-alkaline magmas, but the enriched incompatible trace element patterns differ from typical arc volcanoes. In contrast, the similar spatially located basaltic lavas from Cerro del Fraile and Tres Lagos have an alkaline and OIB-like signature, suggesting a mantle source without subduction-related component. Studies have demonstrated that melting of amphibole-rich metasomatic veins or cumulates located in the lithospheric mantle are a viable mechanism for the origin of intra-plate alkaline volcanism (e.g. Pilet et al. 2008). Likewise melting amphibole-rich lithologies in the sub-arc mantle might produce the trace element signatures of arc-related transitional to alkaline magmas and are directly related to the metasomatic process induced by mobile components that form the amphibole-rich rocks. Amphibole-rich cumulates

  17. [Analisis of the budget impact of adalimumab and etanercept in rheumatoid arthritis and spondyloarthropathies].

    PubMed

    González Álvarez, A; Gómez Barrera, M; Borrás Blasco, J; Giner Serret, E J

    2013-01-01

    Objetivo: Evaluar el impacto económico derivado de la ampliación de los intervalos de administración de adalimumab (ADA) y etanercept (ETN), en el tratamiento de la artritis reumatoide (AR) y espondiloartropatias (EAP) en nuestro ámbito de trabajo. Material y método: Se desarrolló un modelo de impacto presupuestario (MIP) para estimar la repercusión económica que tendría la ampliación en los intervalos habituales de administración de ADA 40 mg cada dos semanas y ETN 50 mg semanal (escenario A), por ADA 40 mg cada tres semanas y ETN 50 mg cada dos semanas (escenario B) de acuerdo a las guías y recomendaciones que se aplican a estos estudios, especificando la población diana, la perspectiva del estudio, el horizonte temporal y analizando la robustez del estudio a través de un análisis de sensibilidad univariante de tipo umbral. Resultados: Se incluyeron un total de 71 pacientes en el estudio. La aplicación del MIP mostró unos ahorros anuales para ADA y ETN de 19.784??y 38.271 ??respectivamente. El coste neto, es decir, el ahorro que esto supuso en el horizonte temporal considerado (dos años) ascendió a 116.110 ?. El análisis de sensibilidad realizado mostró que el MIP estimado para el periodo de estudio fue muy robusto ya que el resultado neto en diferentes escenarios apenas variaba, manteniéndose negativo en los nuevos escenarios. Conclusiones: La ampliación de los intervalos de administración de ADA y ETN cada tres semanas y dos semanas respectivamente, sería una estrategia que permitiría generar ahorros en el presupuesto hospitalario cercanos a los 116.110 ??en el horizonte temporal considerado, consiguiendo así una optimización del tratamiento con estos fármacos.

  18. Diapycnal diffusivity in the core and oxycline of the tropical North Atlantic oxygen minimum zone

    NASA Astrophysics Data System (ADS)

    Köllner, Manuela; Visbeck, Martin; Tanhua, Toste; Fischer, Tim

    2016-08-01

    Diapycnal diffusivity estimates from two Tracer Release Experiments (TREs) and microstructure measurements in the oxycline and core of the oxygen minimum zone (OMZ) in the Eastern Tropical North Atlantic (ETNA) are compared. For the first time, two TREs within the same area at different depths were realized: the Guinea Upwelling Tracer Release Experiment (GUTRE) initiated in 2008 in the oxycline at approximately 320 m depth, and the Oxygen Supply Tracer Release Experiment (OSTRE) initiated in 2012 in the core of the OMZ at approximately 410 m depth. The mean diapycnal diffusivity Dz was found to be insignificantly smaller in the OMZ core with (1.06 ± 0.24) × 10- 5 m2 s- 1 compared to (1.11 ± 0.22) × 10- 5 m2 s- 1 90 m shallower in the oxycline. Unexpectedly, GUTRE tracer was detected during two of the OSTRE surveys which showed that the estimated diapycnal diffusivity from GUTRE over a time period of seven years was within the uncertainty of the previous estimates over a time period of three years. The results are consistent with the Dz estimates from microstructure measurements and demonstrate that Dz does not vary significantly vertically in the OMZ within the depth range of 200-600 m and does not change with time. The presence of a seamount chain in the vicinity of the GUTRE injection region did not cause enhanced Dz compared to the smoother bottom topography of the OSTRE injection region, although the analysis of vertical shear spectra from ship ADCP data showed elevated internal wave energy level in the seamount vicinity. However, the two tracer patches covered increasingly overlapping areas with time and thus spatially integrated increasingly similar fields of local diffusivity, as well as the difference in local stratification counteracted the influence of roughness on Dz. For both experiments no significant vertical displacements of the tracer were observed, thus diapycnal upwelling within the ETNA OMZ is below the uncertainty level of 5 m yr- 1.

  19. Mass transfer phenomena of gaseous hydrocarbons and nitrogen dioxide across gas-inorganic pigments boundaries

    NASA Astrophysics Data System (ADS)

    Birbatakou, S.; Pagopoulou, I.; Kalantzopoulos, A.; Roubani-Kalantzopoulou, F.

    1998-11-01

    Reversed-flow gas chromatography was used to study the kinetics of the action of five hydrocarbons namely, ethane, ethene, ethyne, propene and butene and of the nitrogen dioxide, on three known and widely used pigments, the white one TiO2, and the yellows CdS and PbCrO4. The calculation of kinetic parameters and mass transfer coefficients is based on an experimental adsorption isotherm. All these calculations are based on a non linear adsorption isotherm model as it is well accepted that the linear one is inadequate for inorganic substances like these mentioned in this work. The inadequacy is mainly attributed to the non-uniformity of the solid surface. Five physicochemical parameters have been obtained for each of the twenty heterogeneous reactions studied. With these systematic experiments under conditions which are similar to the atmospheric ones, an extrapolation of the results obtained to “real" atmospheres with a high degree of confidence is possible. Some of the calculations were based on the linear model for comparison. La cinétique de la réaction de cinq hydrocarbures (éthane, éthylène, acétylène, propène, boutène) et du dioxyde d'azote avec trois pigments (le blanc de TiO2 et les jaunes de CdS et PbCrO4) a été étudiée par chromatographie en phase gazeuse a flux inversé. Le calcul des paramètres cinétiques et des coefficients de transfert de masse a été effectué à partir des isothermes d'adsorption expérimentales en faisant l'hypothèse d`un modèle d'adsorption non-linéaire, qui résulte de la non-uniformité de la surface. Cinq paramètres physico-chimiques ont été obténus pour chacune des vingt réaction hétérogènes étudiées. À partir de ces résultats obténus dans des conditions similaires aux conditions atmosphériques, l'extrapolation à des atmosphères réelles paraît possible avec une bonne confiance. Quelques calculs ont été effectués avec un modèle linéaire pour comparaison.

  20. Indirect comparison for Anti-TNF drugs in moderate to severe ulcerative colitis.

    PubMed

    Galván-Banqueri, M; Vega-Coca, M D; Castillo-Muñoz, M A; Beltrán Calvo, C; Molina López, T

    2015-03-01

    Objetivo: Comparar la eficacia relativa de infliximab, adalimumab y golimumab mediante comparaciones indirectas (CI) ajustadas. Métodos: Se realizó una búsqueda bibliográfica que abarcó hasta Octubre 2013. Las bases de datos consultadas fueron: MEDLINE, EMBASE, the Cochrane Library, the Centre for Reviews and Dissemination y the Web of Science. Se incluyeron ensayos clínicos aleatorizados (ECA) que compararan la eficacia de infliximab, adalimumab o golimumab frente a placebo en términos de remisión clínica, respuesta clínica y curación de la mucosa. En el caso de que se incluyera más de un ECA para un mismo fármaco se llevó a cabo un metanálisis utilizado el modelo de efectos fijos. Las CI se realizaron utilizando el método de Butcher et al. Resultados: Se incluyeron 6 ECA publicados en 5 artículos: 2 para infliximab (ACT 1 y ACT 2), 2 para adalimumab (ULTRA 1 y ULTRA 2) y 2 para golimumab (PURSUIT-SC y PURSUIT-M). Los tres agentes biológicos presentaron mayor eficacia que placebo. Los resultados de las CI fueron los siguientes: en relación a la remisión clínica, en el período de inducción y en el período de mantenimiento, no hubo diferencias estadísticamente significativas entre los tres fármacos anti-TNF. En relación a la respuesta clínica y a la curación de la mucosa, en el período de inducción hay diferencias estadísticamente significativas entre infliximab y adalimumab. Conclusiones: En base a los resultados obtenidos (eficacia similar), infliximab, adalimumab y golimumab parecen ser alternativas terapéuticas. Así, otras consideraciones como la seguridad, la tolerancia y el coste-efectividad deben considerarse a la hora de seleccionar el tratamiento más adecuado.

  1. CHANGES IN SOMATOTYPE CHARACTERISTICS IN THE MIDDLE-AGED BULGARIAN MEN.

    PubMed

    Andreenko, Emiliya; Mladenova, Silviya

    2015-12-01

    Objetivo: el objetivo de esta investigación transversal fue esbozar los diferentes somatotipos y las tendencias en los cambios de los tres componentes básicos (endomorfia, mesomorfia y ectomorfia) entre los hombres búlgaros de mediana edad. Material y métodos: el método de Heath-Carter se utilizó para identificar los somatotipos antropométricas de 860 hombres adultos, con edades entre 30-50 años, de la ciudad de Plovdiv, ubicada en el centro de Bulgaria. Los hombres fueron divididos en 4 grupos de edad, en intervalos de cinco años. En cada caso la altura del cuerpo, el peso y una serie de pliegues cutáneos, circunferencias y diámetros se midieron para calcular el somatotipo. El paquete SPSS se utilizó para el análisis estadístico. Resultados: los resultados muestran un modelo de endo- mesomorfo destacado en la muestra de estudio de la población masculina. Encontramos aumento relacionado con la edad de los valores del componente masa muscular- ósea, retención del nivel del componente graso y un descenso en el ectomorfia. Independientemente de los cambios cuantitativos de los tres componentes, la correlación entre ellos sigue siendo constante y el somatotipo medio se conserva. Una mayor variedad de morfotipos se encuentra en el grupo de hombres de 30-35 años de edad. El grupo más homogéneo es el de los hombres de 45-50 años de edad. Este grupo está dominado totalmente por el componente mesomórfico (fuerza), y el componente endomórfico (obesidad) es mayor que el ectomórfico (linealidad). Conclusión: el estudio revela que entre los años 30 y 50 los hombres tienden a construir músculo en lugar de grasa. A los 50 años de edad, los hombres son más mesomórficos que los hombres a la edad de 30, pero son más bajos y con segmentos corporales menos alargados.

  2. Near-infrared Characterization of the Atmospheres of Alien Worlds

    NASA Astrophysics Data System (ADS)

    Croll, Bryce

    In this thesis I present near-infrared detections of the thermal emission of a number of hot Jupiters and likely transit depth differences from different wavelength observations of a super-Earth. I have pioneered "Staring Mode" using the Wide-field Infrared Camera on the Canada-France-Hawaii Telescope to achieve the most accurate photometry to-date in the near- infrared from the ground. I also discuss avenues that should allow one to achieve even more accurate photometry in the future. Using WIRCam on CFHT my collaborators and I have detected the thermal emission of the following hot Jupiters: TrES-2b and TrES-3b in Ks-band, WASP-12b in the J, H & Ks-bands, and WASP-3b in the Ks-band on two occasions. Near- infrared detections of the thermal emission of hot Jupiters are important, because the majority of these planets' blackbodies peak in this wavelength range; near-infrared detections allow us to obtain the most model-independent constraints on these planets' atmospheric characteristics, their temperature-pressure profiles with depth and an estimate of their bolometric luminosities. With these detections we are able to answer such questions as: how efficiently these planets redistribute heat to their nightsides, if they're being inflated by tidal heating, whether there's any evidence that one of these planets is precessing, and whether another experiences extreme weather and violent storms? My collaborators and I have also observed several transits of the super-Earth GJ 1214b. We find a deeper transit depth in one of our near-infrared bands than the other. This is likely indicative of a spectral absorption feature. For the differences in the transit depth to be as large as we observed, the atmosphere of GJ 1214b must have a large scale height, low mean molecular weight and thus have a hydrogen/helium dominated atmosphere. Given that other researchers have not found similar transit depth differences, we also discuss the most likely atmospheric makeup for this

  3. [Effect of precipitation and seasonal period on the patterns of commuting to school in children and adolescents from Granada].

    PubMed

    Segura-Díaz, José Manuel; Herrador-Colmenero, Manuel; Martínez-Téllez, Borja; Chillón Garzón, Palma

    2014-12-17

    Introducción: El desplazamiento activo (ir andando o en bicicleta) al centro educativo contribuye a aumentar los niveles de actividad física en jóvenes. Las condiciones climatológicas podrían influenciar dicho comportamiento. Objetivo: El objetivo es estudiar la influencia de la precipitación en forma de lluvia y del periodo estacional, en el modo de desplazamiento al colegio e instituto en niños y adolescentes de la ciudad de Granada. Método: Participaron un total de 384 estudiantes (166 niños y 218 adolescentes) entre 8 y 18 años de 2 centros (colegio e instituto) de la capital Granadina. Los participantes completaron un cuestionario sobre el modo de desplazamiento semanal en las tres estaciones del año académico. Los datos de precipitación en estas tres semanas fueron obtenidos desde la Agencia Estatal de Meteorología. Las asociaciones entre la precipitación en forma de lluvia y la estación con el modo de desplazamiento activo al colegio se estudió mediante el test McNemar. Resultados: A nivel general, no se encontraron asociaciones significativas entre la precipitación y el periodo estacional con el modo de desplazamiento de los niños y adolescentes (p>0,05) a excepción de dos asociaciones: a) el efecto positivo de la lluvia en el porcentaje de niños que andan al colegio entre un día lluvioso y un día no lluvioso en primavera (p=0,031) y b) el ligero efecto de la estación en el porcentaje de niños y adolescentes que andan entre otoño e invierno (45,8% y 37,5% andan) y entre otoño y primavera (59,7% y 56%) respectivamente (p=0,07). Conclusión: Las condiciones climatológicas parecen tener poca influencia en el modo de desplazamiento en niños y adolescentes de Granada, pareciendo existir un hábito constante en dicho comportamiento a lo largo del curso académico.

  4. Simulation du comportement thermique en régime permanent d'un moteur asynchrone à refroidissement extérieur. Etude par éléments finis

    NASA Astrophysics Data System (ADS)

    Glises, R.; Hostache, G.; Kauffmann, J. M.

    1994-09-01

    The steady state thermal modelling of an 4kW asynchronous motor is realized. A design has been made thanks to the Flux2D finite element magnetic calculus software converted into a resolution tool of the heat equation. This last is used to simulate the heat flux in fluid and solid areas. A 3D study is effected thanks to two 2D studies. The first concerns a radial view (perpendicular to the mechanical axis) whereas the second is effected for an axial view (parallel to the mechanical axis). Thermal conductivities of the materials and thermal contact resistances of the motor are determined through two different tests creating different overheatings. The first is made with a sinewave supply and pre-determine the thermophysical parameters. The second effected with direct current supplies at the rotor and the stator is used to validate these last parameters. On réalise l'étude du comportement thermique en régime permanent d'un moteur asynchrone de 4kW. Le logiciel de calculs magnétiques par éléments finis flux2D est converti en un outil de résolution de l'équation de la chaleur. Cette dernière équation sert à simuler les transferts thermiques tant dans les domaines fluides que solides. Une pseudo-étude tridimensionnelle est réalisée par le biais de deux études bidimensionnelles : la première effectuée suivant un plan radial (plan perpendiculaire à l'axe du moteur) et la seconde suivant un plan axial (plan parallèle à l'axe). Les conductivités des matériaux et des résistances thermiques de contact composant le moteur sont déterminées à l'aide de deux types d'essais qui induisent des échauffements différents. Le premier est réalisé avec une alimentation sinusoïdale et sert à prédéterminer les paramètres thermophysiques. Le second est effectué avec des alimentations à courant continu tant au stator qu'au rotor et a pour rôle la validation de ces paramètres.

  5. Devenir néonatal immédiat de la grande et l'extrême prématurité: données rétrospectives d'une unité de néonatalogie à Yaoundé, Cameroun de 2009 à 2013

    PubMed Central

    Nlend, Anne Esther Njom; Zeudja, Cécile; Motaze, Annie Nga; Suzie, Moyo; Lydie, Nsoa

    2015-01-01

    L'objectif est de notre étude de décrire la typologie de la prématurité et mesurer la survie hospitalière à court terme des grands et extrêmes prématurés dans un pays à ressources limitées (PRL). C'est une étude descriptive rétrospective. Données extraites du registre des admissions du service. Inclusions de tous les nouveau-nés admis dans le service durant la période, ayant un âge gestationnel annoncé ≤ 36 semaines et 6 jours et plus de 26SA, avec au moins deux paramètres présents: âge gestationnel et poids de naissance. Principaux paramètres mesurés: pourcentage de nouveau-nés sortants vivants selon le type de prématurité: tardive, grande ou extrême. Nous avons recensé 1015 prématurés dont 314 grands prématurés (GP) et 61 extrêmes prématurés (EP). Le taux de nouveau-nés sortant vivants était de 95% chez les prématurés tardifs, de 71% chez les grands prématurés et de moins de 23% chez les extrêmes prématurés. Avant 28 semaines, le taux de mortalité était de prés de 100% chez les grands ou extrêmes prématurés de moins de 1000g contre 64% chez les plus de 1000g. Chez les GP le taux de décès était de 13% chez les nés par césarienne vs 21% chez ceux nés par voie basse (p ≤ 0,01). Le taux de prématurité médicalement induite était faible dans l'ensemble et de 3% chez les prématurés extrêmes. En conclusion le taux de mortalité hospitalière des EP est préoccupant, le faible taux de prématurité médicalement induite urge au renforcement de la prévention et à la mise en place de collaboration obstétrico-pédiatrique. PMID:26175812

  6. Migration and spawning of radio-tagged zulega Prochilodus argenteus in a dammed Brazilian river

    USGS Publications Warehouse

    Godinho, Alexandre L.; Kynard, B.

    2006-01-01

    It is difficult for agencies to evaluate the impacts of the many planned dams on Sa??o Francisco River, Brazil, migratory fishes because fish migrations are poorly known. We conducted a study on zulega Prochilodus argenteus, an important commercial and recreational fish in the Sa??o Francisco River, to identify migrations and spawning areas and to determine linear home range. During two spawning seasons (2001-2003), we radio-tagged fish in three main-stem reaches downstream of Tre??s Marias Dam (TMD), located at river kilometer (rkm) 2,109. We tagged 10 fish at Tre??s Marias (TM), which is 5 km downstream of TMD; 12 fish at Pontal, which is 28 km downstream of TMD and which includes the mouth of the Abaete?? River, and 10 fish at Cilga, which is 45 km downstream of TMD. Late-stage (ripe) adults tagged in each area during the spawning season remained at or near the tagging site, except for four Cilga fish that went to Pontal and probably spawned. The Pontal area at the Abaete?? River mouth was the most important spawning site we found. Prespawning fish moved back and forth between main-stem staging areas upstream of the Abaete?? River mouth and Pontal for short visits. These multiple visits were probably needed as ripe fish waited for spawning cues from a flooding Abaete?? River. Some fish homed to prespaw ning staging areas, spawning areas, and nonspawning areas. The migratory style of zulega was dualistic, with resident and migratory fish. Total linear home range was also dualistic, with small (<26-km) and large (53-127-km) ranges. The locations of spawning areas and home ranges suggest that the Pontal group (which includes Cilga fish) is one population that occupies about 110 km. The Pontal population overlaps a short distance with a population located downstream of Cilga. Movements of late-stage TM adults suggest that the TM group is a separate population, possibly with connections to populations upstream of TMD. ?? Copyright by the American Fisheries Society

  7. [Oral anaphylaxis by ingestion of mite contaminated food in Panama City, 2011-2014].

    PubMed

    Barrera, Olga M; Murgas, Ingrid L; Bermúdez, Sergio; Miranda, Roberto J

    2015-01-01

    Antecedentes: la anafilaxia oral por ácaros, o síndrome de las panquecas, ocurre cuando individuos atópicos ingieren alimentos elaborados con harina de trigo contaminada con ácaros, lo que induce reacciones alérgicas moderadas o severas, incluso fatales. Los reportes provienen de ambientes tropicales y subtropicales, donde las condiciones para la proliferación de ácaros domésticos son favorables. Se ha encontrado una asociación importante con la hipersensibilidad a ácido acetilsalicílico (AAS)-antiinflamatorios no esteroides (AINES) y el ejercicio físico. Objetivo: documentar el estudio clínico y descriptivo de casos de anafilaxia oral por ácaros atendidos en Ciudad de Panamá durante los años 2011 a 2014. Material y método: estudio clínico descriptivo y retrospectivo, que incluyó pruebas cutáneas de punción para cinco especies de ácaros domésticos. La identificación taxonómica de los ácaros se realizó bajo microscopio y se calculó la densidad de ácaros por gramo de alimento en tres casos. Resultados: se estudiaron 10 casos compatibles con anafilaxia oral por ácaros, la panqueca fue el alimento implicado con más frecuencia. Los primeros síntomas aparecieron entre 25 y 60 minutos después de la ingestión del alimento. Todos los pacientes fueron adultos jóvenes atópicos, cuatro con hipersensibilidad a AAS-AINES. Los pacientes resultaron positivos a las pruebas cutáneas de punción para los ácaros: Blomia tropicalis, Dermatophagoides pteronyssinus y Suidasia pontifica. Tres muestras de harina de trigo estudiadas motraron altas densidades de ácaros. Conclusiones: la panqueca fue el alimento implicado con más frecuencia en los casos de anafilaxia oral por ácaros. Suidasia pontifica y Blomia tropicalis parecen ser los ácaros más importantes relacionados con este síndrome en nuestro país.

  8. Vibrations et relaxations dans les molécules biologiques. Apports de la diffusion incohérente inélastique de neutrons

    NASA Astrophysics Data System (ADS)

    Zanotti, J.-M.

    2005-11-01

    Le présent document ne se veut pas un article de revue mais plutôt un élément d'initiation à une technique encore marginale en Biologie. Le lecteur est supposé être un non spécialiste de la diffusion de neutrons poursuivant une thématique à connotation biologique ou biophysique mettant en jeu des phénomènes dynamiques. En raison de la forte section de diffusion incohérente de l'atome d'hydrogène et de l'abondance de cet élément dans les protéines, la diffusion incohérente inélastique de neutrons est une technique irremplaçable pour sonder la dynamique interne des macromolécules biologiques. Après un rappel succinct des éléments théoriques de base, nous décrivons le fonctionnement de différents types de spectromètres inélastiques par temps de vol sur source continue ou pulsée et discutons leurs mérites respectifs. Les deux alternatives utilisées pour décrire la dynamique des protéines sont abordées: (i)l'une en termes de physique statistique, issue de la physique des verres, (ii) la seconde est une interprétation mécanistique. Nous montrons dans ce cas, comment mettre à profit les complémentarités de domaines en vecteur de diffusion et de résolution en énergie de différents spectromètres inélastiques de neutrons (temps de vol, backscattering et spin-écho) pour accéder, à l'aide d'un modèle physique simple, à la dynamique des protéines sur une échelle de temps allant d'une fraction de picoseconde à quelques nanosecondes.

  9. Effect of immunotherapy on basophil activation induced by allergens in patients with atopic dermatitis.

    PubMed

    Sánchez, Jorge; Cardona, Ricardo

    2014-01-01

    Antecedentes: la inmunoterapia subcutánea con alergenos ha demostrado ser sumamente efectiva para el tratamiento de las enfermedades respiratorias mediadas por IgE. Sin embargo, pocos estudios exploran los mecanismos inmunológicos de la inmunoterapia en pacientes con dermatitis atópica. Objetivo: explorar la respuesta inmunológica en pacientes con dermatitis atópica que reciben inmunoterapia con ácaros de acuerdo con la inmunidad humoral y la activación de basófilos. Material y método: estudio abierto en el que se evaluó la severidad de la dermatitis con el índice SCORAD en 20 pacientes (10 con inmunoterapia y 10 sin inmunoterapia) cada tres meses durante dos años. Las muestras de suero se tomaron previo al inicio del estudio y al primer y segundo año de seguimiento para evaluar la expresión de CD63 en basófilos, concentraciones de IgE total, IgE e IgG4 específica para Der p y Der f. Diez pacientes con rinitis alérgica y cinco controles no alérgicos se incluyeron en el estudio como controles. Resultados: la expresión de CD63 en los basófilos después de la estimulación con Der p fue más alta en los pacientes con dermatitis que en los pacientes con rinitis y en los sujetos no alérgicos. Luego del primer y segundo año de tratamiento, la expresión de CD63 fue menor en el grupo de pacientes con dermatitis que recibieron inmunoterapia en comparación con los tres grupos control. Observamos una correlación entre el SCORAD, IgG4 y la expresión de CD63. Conclusiones: en pacientes con dermatitis, la prueba de activación de basófilos podría usarse como biomarcador de respuesta clínica; asimismo, la modulación de esta célula puede llevar a un mejor control clínico.

  10. Effets de compétition entre les phénomènes de dopage et d'endommagement dans les polymères électroactifs implantés

    NASA Astrophysics Data System (ADS)

    Moliton, A.; Moreau, C.; Lucas, B.; Friend, R. H.; Froyer, G.

    1994-09-01

    From a general band scheme appropriate for electroactive polymers, we explain how each of the two main processes (damage or doping) induced by ion implantation can play a major role. DC conductivity, thermopower and AC conductivity studied versus temperature for varying implantation parameters allow us to confirm our interpretations : damage is produced by high implantation parameters in which case transport phenomena of p type occur mainly in degenerate states near the Fermi level, whereas low implantation parameters induce doping in polaronic bands characterized by thermally activated processes, although effects due to the existence of defects can appear, especially at low temperature. Compensation effects, described by a Kubo-Greenwood formula applied to the thermoelectric power, give a consistent explanation of the successive behaviours. Moreover, we present a general interpretation of the p type conductivity behaviour observed in intrinsic polymers. En utilisant le schéma de bandes des polymères électroactifs, nous expliquons les raisons pour lesquelles au cours de l'implantation ionique dans ces matériaux les deux principaux, processus générés (le dopage et les endommagements) sont à même de jouer un rôle important. Les mesures de conductivité continue, de pouvoir thermoélectrique et de conductivité alternative ont conforté nos interprétations : de forts paramètres d'implantation génèrent des endommagements qui induisent des phénomènes de transports de type p principalement dans les états dégénérés situés au voisinage du niveau de Fermi, alors que de faibles paramètres d'implantation favorisent le dopage dans les bandes polaroniques caractérisées par des processus thermiquement activés bien que la présence de défauts puisse se faire sentir notamment à basse température. Des effets de compensation, décrits à partir de la formule de Kubo-Greenwood appliquée au pouvoir thermoélectrique, fournissent une explication

  11. [In Process Citation].

    PubMed

    Zourdos, Michael C; Dolan, Chad; Quiles, Justin M; Klemp, Alex; Jo, Edward; Loenneke, Jeremy P; Blanco, Rocky; Whitehurst, Michael

    2016-03-25

    Introducción: el propósito de este estudio fue investigar la eficacia del entrenamiento diario de una repetición máxima (1RM) de la sentadilla en fuerza máxima. Material y método: tres levantadores de peso de competición realizaron la sentadilla durante 37 días consecutivos y se reportan como casos individuales. Participante 1 (P1) (masa corporal = 80,5 kg; edad = 28 años) y participante 3 (P3) (masa corporal = 108,8 kg; edad = 34 años) eran levantadores de fuerza; participante 2 (P2) (masa corporal = 64,1 kg; edad = 19 años) fue un levantador de pesas. Cada participante tenía por lo menos 5 años de experiencia con la posición en sentadilla de formación. Durante los días 1-35, los participantes realizaron una sentadilla de 1RM seguida por 5 conjuntos de volumen de 3 repeticiones al 85% o 2 repeticiones al 90% de la 1RM diario. En el día 36, los participantes realizan solo una serie de 1 repetición al 85% de 1RM del día 1; y el día 37 realizaron un 1RM. Resultados: cambios absolutos y porcentaje para P1 del 1 día al 37: + 5 kg/2,3% y desde el primer día al máximo (1RM era el mayor) + 12,5 kg/5,8%. P2 experimentó un aumento de 13,5 kg/10,8% en 1RM del día 1 al 37 y del día 1 al máximo. P3 demostró un aumento de 21 kg/9,5% del día 1 al 37 y del día 1 al máximo. Los tres participantes exhibieron significativa (p < 0,05) las correlaciones entre el tiempo (días) y 1RM (P1: r = 0,65, P2: r = 0,78, P3: r = 0,48). Conclusión: nuestros resultados sugieren que el entrenamiento diario de 1RM había producido efectivamente cambios significativos en la máxima fuerza en los atletas de fuerza competitiva en un periodo relativamente corto de entrenamiento.

  12. Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

    PubMed Central

    Muscat, G E; Mynett-Johnson, L; Dowhan, D; Downes, M; Griggs, R

    1994-01-01

    Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the

  13. [Mexican guidelines on the diagnosis and treatment of urticaria].

    PubMed

    Larenas-Linnemann, Désirée; Medina-Ávalos, Miguel Alejandro; Ortega-Martell, José Antonio; Beirana-Palencia, Angélica María; Rojo-Gutiérrez, María Isabel; Morales-Sánchez, Martha Alejandra; Solorio-Gómez, Héctor; Alonzo-Romero Pareyón, María Lourdes; Vargas-Correa, Jorge Bernardo; Baez-Loyola, Carlos; Blancas-Espinosa, Roberto; Esquer-Flores, Joaquín; Gómez-Vera, Javier; Guzmán-Perea, María Graciela; Macías-Weinmann, Alejandra; Maldonado-García, César Alfonso; Martínez-Villarreal, José Darío; Matta-Campos, Juan José; Medina-Segura, Elías; Del Río-Navarro, Blanca; Salgado-Gama, Juan Ignacio; Stone-Aguilar, Héctor; Sienra-Monge, Juan José Luis; González-Díaz, Sandra Nora; Mendoza-López, Enrique; Amaya-Guerra, Mario; Lemini-López, Alicia; Blanco-Montero, Andrés; Chavarría-Jiménez, María Teresa; Guerrero-Michaus, Martha Graciela; Martínez-Pérez, Albina; Ramírez-Segura, Ruth Ivonne Mireya; Montes-Narváez, Gabriel; Olvera-Salinas, Jorge; Rosas-Sumano, Ana Beatriz

    2014-01-01

    Antecedentes: la urticaria es una enfermedad que padece una quinta parte de la población en algún momento de su vida. Las guías internacionales recientes han propuesto unos cambios de fondo en su diagnóstico y tratamiento, por lo que había la necesidad de crear una guía nacional y multidisciplinaria, con base amplia en los gremios de especialistas y médicos de primer contacto en México. Material y método: un grupo interdisciplinario de expertos clínicos y algunos expertos en metodología determinó los objetivos y alcances de la Guía de Práctica Clínica Basada en Evidencia con el instrumento SCOPE. Se decidió llevar a cabo la adaptación y transculturización de guías internacionales para el diagnóstico y tratamiento de urticaria. Con el instrumento AGREE-II se seleccionaron las tres guías de alta calidad, como guías base (Zuberbier 2014, Sánchez-Borges 2012, Powell 2007) para formular y contestar la preguntas clínicas clave, en el contexto cultural y económico mexicano, según el método de desarrollo de recomendaciones GRADE. Resultados: mediante un proceso formal de discusión y votación durante varias juntas de expertos, se terminó la redacción de la forma final de la guía, con especial cuidado de lograr un ajuste a las realidades, valores y preferencias de los pacientes de México. Se hace hincapié en la administración de antihistamínicos vía oral de segunda generación, como tratamiento de primera elección. Conclusión: este documento es una Guía de Práctica Clínica Basada en Evidencia para el diagnóstico y tratamiento de urticaria aguda y crónica, basada en tres guías internacionales de alta calidad. Se desarrolló por un grupo multidisciplinario. Los cuadros y algoritmos hacen a la guía amigable para su uso por médicos de primer contacto y por especialistas.

  14. Impact of Dendrimer Terminal Group Chemistry on Blockage of the Anthrax Toxin Channel: A Single Molecule Study

    PubMed Central

    Yamini, Goli; Kalu, Nnanya; Nestorovich, Ekaterina M.

    2016-01-01

    Nearly all the cationic molecules tested so far have been shown to reversibly block K+ current through the cation-selective PA63 channels of anthrax toxin in a wide nM–mM range of effective concentrations. A significant increase in channel-blocking activity of the cationic compounds was achieved when multiple copies of positively charged ligands were covalently linked to multivalent scaffolds, such as cyclodextrins and dendrimers. Even though multivalent binding can be strong when the individual bonds are relatively weak, for drug discovery purposes we often strive to design multivalent compounds with high individual functional group affinity toward the respective binding site on a multivalent target. Keeping this requirement in mind, here we perform a single-channel/single-molecule study to investigate kinetic parameters of anthrax toxin PA63 channel blockage by second-generation (G2) poly(amido amine) (PAMAM) dendrimers functionalized with different surface ligands, including G2-NH2, G2-OH, G2-succinamate, and G2-COONa. We found that the previously reported difference in IC50 values of the G2-OH/PA63 and G2-NH2/PA63 binding was determined by both on- and off-rates of the reversible dendrimer/channel binding reaction. In 1 M KCl, we observed a decrease of about three folds in kon and a decrease of only about ten times in tres with G2-OH compared to G2-NH2. At the same time for both blockers, kon and tres increased dramatically with transmembrane voltage increase. PAMAM dendrimers functionalized with negatively charged succinamate, but not carboxyl surface groups, still had some residual activity in inhibiting the anthrax toxin channels. At 100 mV, the on-rate of the G2-succinamate binding was comparable with that of G2-OH but showed weaker voltage dependence when compared to G2-OH and G2-NH2. The residence time of G2-succinamate in the channel exhibited opposite voltage dependence compared to G2-OH and G2-NH2, increasing with the cis-negative voltage increase

  15. Effect of Temperature on the Survival and Development of Three Forensically Relevant Dermestes Species (Coleoptera: Dermestidae).

    PubMed

    Martín-Vega, Daniel; Díaz-Aranda, Luisa M; Baz, Arturo; Cifrián, Blanca

    2017-09-01

    La mayoría de las especies del género Dermestes (Coleoptera: Dermestidae) son carroñeras durante la fase larvaria y la fase adulta, con preferencia por la materia orgánica seca. Debido a esto, los derméstidos son indicadores potencialmente útiles en las investigaciones forenses que impliquen restos humanos momificados y/o esqueléticos. Lamentablemente, los datos de referencia sobre el desarrollo de la mayoría de las especies de Dermestes de relevancia forense son escasos. Este estudio analiza el efecto de cinco temperaturas constantes (15, 20, 25, 30 y 35 °C) sobre la supervivencia y la tasa de desarrollo de tres de los derméstidos de mayor relevancia forense: Dermestes frischii Kugelan, Dermestes maculatus De Geer y Dermestes undulatus Brahm. Como sustrato de cría se utilizó piel de cerdo, con el objetivo de utilizar un sustrato lo más parecido posible al explotado en condiciones naturales. En general, la temperatura tuvo un efecto significativo sobre la supervivencia y la duración del desarrollo, con valores óptimos bajo las temperaturas intermedias. D. frischii y D. maculatus mostraron tasas de desarrollo similares y tiempos de desarrollo más cortos a 30 °C, mientras que D. undulatus se desarrolló más rápido a temperaturas inferiores. A 15 °C, ni D. frischii ni D. undulatus pusieron huevos, mientras que ningún individuo de D. maculatus sobrevivió más allá de la fase pupa. Se observó un número inconsistente de estadios larvarios por individuo en las diferentes temperaturas constantes y en las tres especies. Este estudio tiene como objetivo proporcionar datos de referencia sobre el desarrollo para futuros avances en el uso de los derméstidos como herramientas forenses en casos de intervalos post mortem largos.

  16. Synthese de noir de carbone a partir de propane, utilisant un plasma thermique

    NASA Astrophysics Data System (ADS)

    Lavoie, Martin

    Ce projet de maitrise consiste principalement en une etude experimentale de la production de noir de carbone a haute valeur a partir des fractions lourdes du gaz naturel et a l'aide d'une plasma genere par induction electromagnetique. Cette etude comprend les aspects thermodynamiques de la decomposition des hydrocarbures comme le propane et le n-butane, la filtration en continu du noir de carbone et sa caracterisation. L'etude experimentale est realisee en deux phases distinctes: une phase exploratoire et une phase de mise a l'echelle. A l'issue de la phase exploratoire, un parametre se demarque des autres, le mode d'injection du gaz de procede. En effet, la morphologie du noir de carbone est completement differente selon le type d'injection choisi. Une injection radiale donne un noir de carbone en forme de plaquettes ayant une surface specifique elevee alors qu'une injection axiale donne un noir de carbone en forme de spheres ayant une surface specifique plus faible. Le design du systeme pour la phase de mise a l'echelle a tenu compte majoritairement du parametre qu'est l'injection. De plus, la deuxieme phase a permis une instrumentation adequate, une augmentation de la puissance et du debit du gaz de procede et une frequence differente (3 MHz a 400 kHz). Les resultats de la deuxieme phase se sont averes differents du point de vue morphologique. Plusieurs types d'injection ont ete testes et le noir de carbone obtenu contenait tres peu de plaquettes. L'injection joue un role important pour le taux de decomposition et du noir de carbone produit. Un debit de noir de carbone allant jusqu'a 21 grammes par minute a ete obtenu pour une injection radiale. En fait, les injections radiales testees etaient concues pour perturber l'ecoulement laminaire du plasma et ainsi obtenir de meilleurs echanges que l'injection axiale. Par contre, a faible debit, l'injection axiale est favorisee. Certains aspects demeurent encore a etudier et a approfondir. D'abord, l'effet de la

  17. Surface-based facial scan registration in neuronavigation procedures: a clinical study.

    PubMed

    Shamir, Reuben R; Freiman, Moti; Joskowicz, Leo; Spektor, Sergey; Shoshan, Yigal

    2009-12-01

    Surface-based registration (SBR) with facial surface scans has been proposed as an alternative for the commonly used fiducial-based registration in image-guided neurosurgery. Recent studies comparing the accuracy of SBR and fiducial-based registration have been based on a few targets located on the head surface rather than inside the brain and have yielded contradictory conclusions. Moreover, no visual feedback is provided with either method to inform the surgeon about the estimated target registration error (TRE) at various target locations. The goals in the present study were: 1) to quantify the SBR error in a clinical setup, 2) to estimate the targeting error for many target locations inside the brain, and 3) to create a map of the estimated TRE values superimposed on a patient's head image. The authors randomly selected 12 patients (8 supine and 4 in a lateral position) who underwent neurosurgery with a commercial navigation system. Intraoperatively, scans of the patients' faces were acquired using a fast 3D surface scanner and aligned with their preoperative MR or CT head image. In the laboratory, the SBR accuracy was measured on the facial zone and estimated at various intracranial target locations. Contours related to different TREs were superimposed on the patient's head image and informed the surgeon about the expected anisotropic error distribution. The mean surface registration error in the face zone was 0.9 +/- 0.35 mm. The mean estimated TREs for targets located 60, 105, and 150 mm from the facial surface were 2.0, 3.2, and 4.5 mm, respectively. There was no difference in the estimated TRE between the lateral and supine positions. The entire registration procedure, including positioning of the scanner, surface data acquisition, and the registration computation usually required < 5 minutes. Surface-based registration accuracy is better in the face and frontal zones, and error increases as the target location lies further from the face. Visualization of

  18. [Latex sensitization prevalence through prick test in patients with genitourinary malformations and more than 3 surgeries].

    PubMed

    Macías-Robles, Ana Paola; Morán-Mendoza, Ana Rocío

    2016-01-01

    Antecedentes: la alergia al látex tiene alta prevalencia en grupos de riesgo conocidos, especialmente en pacientes con espina bífida, malformaciones urinarias y ortopédicas con múltiples cirugías. En México no se cuenta con suficientes estudios que reporten la prevalencia y factores de riesgo asociados. Objetivo: determinar la prevalencia de sensibilización al látex mediante prueba de prick con extracto de látex en pacientes con malformaciones genitourinarias y más de tres cirugías en la Unidad Médica de Alta Especialidad de Pediatría del Centro Médico Nacional de Occidente, así como los factores asociados. Material y método: Se realizó un estudio transversal analítico y descriptivo, que incluyó hombres y mujeres de 1 a 16 años, con malformaciones genitourinarias y más de tres cirugías. Se aplicó una encuesta para conocer los factores de riesgo asociados y se realizó prueba cutánea por punción con extracto de látex, con control positivo y negativo. Se midieron niveles séricos de IgE total y eosinófilos en sangre periférica. Resultados: la prevalencia encontrada fue de 30.7% y los factores de riesgo asociados: atopia personal (p=0.047), antecedente de reacción previa con productos con látex (p=0.003), específicamente con globos (p=0.000) y guantes (p=0.002). No hubo asociación entre el número de cirugías e intervenciones quirúrgicas a edades tempranas, tampoco con concentraciones elevadas de IgE sérica total. Tuvieron reacción cruzada a frutas-látex 25% de los pacientes, los alimentos asociados fueron: aguacate, papaya, fresa y kiwi. Conclusión: la prevalencia de sensibilización al látex es alta en los grupos de riesgo, sobre todo con antecedente de atopia, por lo que es importante que el personal de salud identifique a estos pacientes a fin de implementar oportunamente las medidas de prevención primaria y secundaria; evitar efectos severos potencialmente mortales, como la anafilaxia, para disminuir la morbilidad y la

  19. Utilisation de traceurs radioactifs pour l'évaluation du recrutement des leucocytes et des échanges vasculaires au niveau d'organes in~vivo. Description d'une méthode et discussion des problèmes d'interprétation sur quelques exemples

    NASA Astrophysics Data System (ADS)

    Bureau, M. F.

    1997-03-01

    An experimental method using simultaneously different γ emiter tracers was developed to evaluate inflammation in vivo. Experiments were performed on the anaesthetized guinea-pig to test pulmonary effects of inflammatory agents. Red blood cells, albumin and inflammatory cells (platelets or leucocytes) radiolabelled with 99m technetium, 131 iodine and 111 indium respectively were injected i.v. Their radioactivities were measured on a pulmonary region by external detection and on blood samples in a well type counter. From these measurements variations of the lung contents in red blood cells, extravascular albumin and non circulating leucocytes during inflammatory stimulation were evaluated. These parameters axe indexes of blood perfusion, vascular exchanges and leucocyte sequestration respectively. Fiability of the method and meaning of the parameters evaluated are discussed. Une méthode expérimentale utilisant simultanément différents traceurs γ a été développée pour évaluer l'inflammation in vivo. Des expériences ont été réalisées chez le cobaye anesthésié pour tester l'effet pulmonaire d'agents inflammatoires. Des globules rouges, de l'albumine et des cellules inflammatoires (plaquettes ou leucocytes) radiomarqués respectivement au technetium 99m, à l'iode 131 et à l'indium 111 sont injectés i.v. Leurs radioactivités sont mesurées sur une région pulmonaire par détection externe et sur des échantillons sanguins au compteur puit. À partir de ces mesures sont évaluées les variations des contenus pulmonaires en globules rouges, en albumine extravasculaire et en leucocytes non circulants lors d'une stimulation inflammatoire. Ces paramètres sont corrélés aux modifications de la perfusion, des échanges vasculaires et de la séquestration leucocytaire. La fiabilité de la méthode et la signification des paramètres évalués sont discutées.

  20. CARDIOVASCULAR RISK AND ASSOCIATED FACTORS IN ADOLESCENTS.

    PubMed

    do Prado Junior, Pedro Paulo; de Faria, Franciane Rocha; de Faria, Eliane Rodrigues; Franceschini, Sylvia do Carmo Castro; Priore, Silvia Eloiza

    2015-08-01

    Introducción: los cambios en el estilo de vida están relacionados con la exposición temprana de los adolescentes a las comorbilidades asociadas a la enfermedad cardiovascular. Estas condiciones pueden tener consecuencias en la edad adulta. Objetivo: determinar la prevalencia de riesgo cardiovascular y factores asociados en las tres fases de la adolescencia. Métodos: estudio transversal que incluye a adolescentes de 10-19 años en la ciudad de Viçosa, distribuidos en tres fases. Se evaluaron las pruebas de laboratorio, el índice de masa corporal clasificadas en Z-score, según el sexo y la edad, y el porcentaje de grasa corporal, clasificados por sexo. Se utilizó la prueba de chi-cuadrado, la partición de chi-cuadrado con corrección de Bonferroni y la regresión de Poisson. El nivel de significación fue < 0,05. El proyecto fue aprobado por el Comité de Ética en Investigación de la UFV en humanos. Resultados: el sobrepeso, la grasa corporal, el perfil lipídico, el comportamiento sedentario y la historia de enfermedades cardiovasculares en la familia fueron los factores de riesgo cardiovascular más prevalentes entre los adolescentes. Los adolescentes tenían tasas más altas de sobrepeso y grasa. En cuanto a las etapas, la inicial mostró un mayor porcentaje de individuos con comportamiento sedentario, sobrepeso y colesterol total y LDL en comparación con otras fases. Los individuos con cambios en el estado nutricional eran más propensos a desarrollar hipertensión, cambios en el colesterol total, LDL, triglicéridos, insulina, HOMA y HDL bajo, en comparación con los individuos sanos. Conclusiones: los factores de riesgo cardiovascular se han observado en personas cada vez más jóvenes y son factores importantes para identificar una población en riesgo.