Sample records for deep intronic mutations

  1. Deep intronic GPR143 mutation in a Japanese family with ocular albinism

    PubMed Central

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-01-01

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease. PMID:26061757

  2. Deep intronic GPR143 mutation in a Japanese family with ocular albinism.

    PubMed

    Naruto, Takuya; Okamoto, Nobuhiko; Masuda, Kiyoshi; Endo, Takao; Hatsukawa, Yoshikazu; Kohmoto, Tomohiro; Imoto, Issei

    2015-06-10

    Deep intronic mutations are often ignored as possible causes of human disease. Using whole-exome sequencing, we analysed genomic DNAs of a Japanese family with two male siblings affected by ocular albinism and congenital nystagmus. Although mutations or copy number alterations of coding regions were not identified in candidate genes, the novel intronic mutation c.659-131 T > G within GPR143 intron 5 was identified as hemizygous in affected siblings and as heterozygous in the unaffected mother. This mutation was predicted to create a cryptic splice donor site within intron 5 and activate a cryptic acceptor site at 41nt upstream, causing the insertion into the coding sequence of an out-of-frame 41-bp pseudoexon with a premature stop codon in the aberrant transcript, which was confirmed by minigene experiments. This result expands the mutational spectrum of GPR143 and suggests the utility of next-generation sequencing integrated with in silico and experimental analyses for improving the molecular diagnosis of this disease.

  3. High-throughput sequencing of the entire genomic regions of CCM1/KRIT1, CCM2 and CCM3/PDCD10 to search for pathogenic deep-intronic splice mutations in cerebral cavernous malformations.

    PubMed

    Rath, Matthias; Jenssen, Sönke E; Schwefel, Konrad; Spiegler, Stefanie; Kleimeier, Dana; Sperling, Christian; Kaderali, Lars; Felbor, Ute

    2017-09-01

    Cerebral cavernous malformations (CCM) are vascular lesions of the central nervous system that can cause headaches, seizures and hemorrhagic stroke. Disease-associated mutations have been identified in three genes: CCM1/KRIT1, CCM2 and CCM3/PDCD10. The precise proportion of deep-intronic variants in these genes and their clinical relevance is yet unknown. Here, a long-range PCR (LR-PCR) approach for target enrichment of the entire genomic regions of the three genes was combined with next generation sequencing (NGS) to screen for coding and non-coding variants. NGS detected all six CCM1/KRIT1, two CCM2 and four CCM3/PDCD10 mutations that had previously been identified by Sanger sequencing. Two of the pathogenic variants presented here are novel. Additionally, 20 stringently selected CCM index cases that had remained mutation-negative after conventional sequencing and exclusion of copy number variations were screened for deep-intronic mutations. The combination of bioinformatics filtering and transcript analyses did not reveal any deep-intronic splice mutations in these cases. Our results demonstrate that target enrichment by LR-PCR combined with NGS can be used for a comprehensive analysis of the entire genomic regions of the CCM genes in a research context. However, its clinical utility is limited as deep-intronic splice mutations in CCM1/KRIT1, CCM2 and CCM3/PDCD10 seem to be rather rare. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. A deep intronic mutation in the SLC12A3 gene leads to Gitelman syndrome.

    PubMed

    Nozu, Kandai; Iijima, Kazumoto; Nozu, Yoshimi; Ikegami, Ei; Imai, Takehide; Fu, Xue Jun; Kaito, Hiroshi; Nakanishi, Koichi; Yoshikawa, Norishige; Matsuo, Masafumi

    2009-11-01

    Many mutations have been detected in the SLC12A3 gene of Gitelman syndrome (GS, OMIM 263800) patients. In previous studies, only one mutant allele was detected in approximately 20 to 41% of patients with GS; however, the exact reason for the nonidentification has not been established. In this study, we used RT-PCR using mRNA to investigate for the first time transcript abnormalities caused by deep intronic mutation. Direct sequencing analysis of leukocyte DNA identified one base insertion in exon 6 (c.818_819insG), but no mutation was detected in another allele. We analyzed RNA extracted from leukocytes and urine sediments and detected unknown sequence containing 238bp between exons 13 and 14. The genomic DNA analysis of intron 13 revealed a single-base substitution (c.1670-191C>T) that creates a new donor splice site within the intron resulting in the inclusion of a novel cryptic exon in mRNA. This is the first report of creation of a splice site by a deep intronic single-nucleotide change in GS and the first report to detect the onset mechanism in a patient with GS and missing mutation in one allele. This molecular onset mechanism may partly explain the poor success rate of mutation detection in both alleles of patients with GS.

  5. Intronic splicing mutations in PTCH1 cause Gorlin syndrome.

    PubMed

    Bholah, Zaynab; Smith, Miriam J; Byers, Helen J; Miles, Emma K; Evans, D Gareth; Newman, William G

    2014-09-01

    Gorlin syndrome is an autosomal dominant disorder characterized by multiple early-onset basal cell carcinoma, odontogenic keratocysts and skeletal abnormalities. It is caused by heterozygous mutations in the tumour suppressor PTCH1. Routine clinical genetic testing, by Sanger sequencing and multiplex ligation-dependent probe amplification (MLPA) to confirm a clinical diagnosis of Gorlin syndrome, identifies a mutation in 60-90 % of cases. We undertook RNA analysis on lymphocytes from ten individuals diagnosed with Gorlin syndrome, but without known PTCH1 mutations by exonic sequencing or MLPA. Two altered PTCH1 transcripts were identified. Genomic DNA sequence analysis identified an intron 7 mutation c.1068-10T>A, which created a strong cryptic splice acceptor site, leading to an intronic insertion of eight bases; this is predicted to create a frameshift p.(His358Alafs*12). Secondly, a deep intronic mutation c.2561-2057A>G caused an inframe insertion of 78 intronic bases in the cDNA transcript, leading to a premature stop codon p.(Gly854fs*3). The mutations are predicted to cause loss of function of PTCH1, consistent with its tumour suppressor function. The findings indicate the importance of RNA analysis to detect intronic mutations in PTCH1 not identified by routine screening techniques.

  6. Evaluation of non-coding variation in GLUT1 deficiency.

    PubMed

    Liu, Yu-Chi; Lee, Jia Wei Audrey; Bellows, Susannah T; Damiano, John A; Mullen, Saul A; Berkovic, Samuel F; Bahlo, Melanie; Scheffer, Ingrid E; Hildebrand, Michael S

    2016-12-01

    Loss-of-function mutations in SLC2A1, encoding glucose transporter-1 (GLUT-1), lead to dysfunction of glucose transport across the blood-brain barrier. Ten percent of cases with hypoglycorrhachia (fasting cerebrospinal fluid [CSF] glucose <2.2mmol/L) do not have mutations. We hypothesized that GLUT1 deficiency could be due to non-coding SLC2A1 variants. We performed whole exome sequencing of one proband with a GLUT1 phenotype and hypoglycorrhachia negative for SLC2A1 sequencing and copy number variants. We studied a further 55 patients with different epilepsies and low CSF glucose who did not have exonic mutations or copy number variants. We sequenced non-coding promoter and intronic regions. We performed mRNA studies for the recurrent intronic variant. The proband had a de novo splice site mutation five base pairs from the intron-exon boundary. Three of 55 patients had deep intronic SLC2A1 variants, including a recurrent variant in two. The recurrent variant produced less SLC2A1 mRNA transcript. Fasting CSF glucose levels show an age-dependent correlation, which makes the definition of hypoglycorrhachia challenging. Low CSF glucose levels may be associated with pathogenic SLC2A1 mutations including deep intronic SLC2A1 variants. Extending genetic screening to non-coding regions will enable diagnosis of more patients with GLUT1 deficiency, allowing implementation of the ketogenic diet to improve outcomes. © 2016 Mac Keith Press.

  7. Partial androgen insensitivity syndrome caused by a deep intronic mutation creating an alternative splice acceptor site of the AR gene.

    PubMed

    Ono, Hiroyuki; Saitsu, Hirotomo; Horikawa, Reiko; Nakashima, Shinichi; Ohkubo, Yumiko; Yanagi, Kumiko; Nakabayashi, Kazuhiko; Fukami, Maki; Fujisawa, Yasuko; Ogata, Tsutomu

    2018-02-02

    Although partial androgen insensitivity syndrome (PAIS) is caused by attenuated responsiveness to androgens, androgen receptor gene (AR) mutations on the coding regions and their splice sites have been identified only in <25% of patients with a diagnosis of PAIS. We performed extensive molecular studies including whole exome sequencing in a Japanese family with PAIS, identifying a deep intronic variant beyond the branch site at intron 6 of AR (NM_000044.4:c.2450-42 G > A). This variant created the splice acceptor motif that was accompanied by pyrimidine-rich sequence and two candidate branch sites. Consistent with this, reverse transcriptase (RT)-PCR experiments for cycloheximide-treated lymphoblastoid cell lines revealed a relatively large amount of aberrant mRNA produced by the newly created splice acceptor site and a relatively small amount of wildtype mRNA produced by the normal splice acceptor site. Furthermore, most of the aberrant mRNA was shown to undergo nonsense mediated decay (NMD) and, if a small amount of aberrant mRNA may have escaped NMD, such mRNA was predicted to generate a truncated AR protein missing some functional domains. These findings imply that the deep intronic mutation creating an alternative splice acceptor site resulted in the production of a relatively small amount of wildtype AR mRNA, leading to PAIS.

  8. The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

    PubMed

    Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

    2014-06-01

    The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

  9. X-linked Alport syndrome caused by splicing mutations in COL4A5.

    PubMed

    Nozu, Kandai; Vorechovsky, Igor; Kaito, Hiroshi; Fu, Xue Jun; Nakanishi, Koichi; Hashimura, Yuya; Hashimoto, Fusako; Kamei, Koichi; Ito, Shuichi; Kaku, Yoshitsugu; Imasawa, Toshiyuki; Ushijima, Katsumi; Shimizu, Junya; Makita, Yoshio; Konomoto, Takao; Yoshikawa, Norishige; Iijima, Kazumoto

    2014-11-07

    X-linked Alport syndrome is caused by mutations in the COL4A5 gene. Although many COL4A5 mutations have been detected, the mutation detection rate has been unsatisfactory. Some men with X-linked Alport syndrome show a relatively mild phenotype, but molecular basis investigations have rarely been conducted to clarify the underlying mechanism. In total, 152 patients with X-linked Alport syndrome who were suspected of having Alport syndrome through clinical and pathologic investigations and referred to the hospital for mutational analysis between January of 2006 and January of 2013 were genetically diagnosed. Among those patients, 22 patients had suspected splice site mutations. Transcripts are routinely examined when suspected splice site mutations for abnormal transcripts are detected; 11 of them showed expected exon skipping, but others showed aberrant splicing patterns. The mutation detection strategy had two steps: (1) genomic DNA analysis using PCR and direct sequencing and (2) mRNA analysis using RT-PCR to detect RNA processing abnormalities. Six splicing consensus site mutations resulting in aberrant splicing patterns, one exonic mutation leading to exon skipping, and four deep intronic mutations producing cryptic splice site activation were identified. Interestingly, one case produced a cryptic splice site with a single nucleotide substitution in the deep intron that led to intronic exonization containing a stop codon; however, the patient showed a clearly milder phenotype for X-linked Alport syndrome in men with a truncating mutation. mRNA extracted from the kidney showed both normal and abnormal transcripts, with the normal transcript resulting in the milder phenotype. This novel mechanism leads to mild clinical characteristics. This report highlights the importance of analyzing transcripts to enhance the mutation detection rate and provides insight into genotype-phenotype correlations. This approach can clarify the cause of atypically mild phenotypes in X-linked Alport syndrome. Copyright © 2014 by the American Society of Nephrology.

  10. Extremely hypomorphic and severe deep intronic variants in the ABCA4 locus result in varying Stargardt disease phenotypes.

    PubMed

    Zernant, Jana; Lee, Winston; Nagasaki, Takayuki; Collison, Frederick T; Fishman, Gerald A; Bertelsen, Mette; Rosenberg, Thomas; Gouras, Peter; Tsang, Stephen H; Allikmets, Rando

    2018-05-30

    Autosomal recessive Stargardt disease (STGD1, MIM 248200) is caused by mutations in the ABCA4 gene. Complete sequencing of the ABCA4 locus in STGD1 patients identifies two expected disease-causing alleles in ~75% of patients and only one mutation in ~15% of patients. Recently, many possibly pathogenic variants in deep intronic sequences of ABCA4 have been identified in the latter group. We extended our analyses of deep intronic ABCA4 variants and determined that one of these, c.4253+43G>A (rs61754045), is present in 29/1155 (2.6%) of STGD1 patients. The variant is found at statistically significantly higher frequency in patients with only one pathogenic ABCA4 allele, 23/160 (14.38%), MAF=0.072, compared to MAF=0.013 in all STGD1 cases and MAF=0.006 in the matching general population (P<1x10-7). The variant, which is not predicted to have any effect on splicing, is the first reported intronic "extremely hypomorphic allele" in the ABCA4 locus; i.e., it is pathogenic only when in trans with a loss-of-function ABCA4 allele. It results in a distinct clinical phenotype characterized by late-onset of symptoms and foveal sparing. In ~70% of cases the variant was allelic with the c.6006-609T>A (rs575968112) variant, which was deemed non-pathogenic. Another rare deep intronic variant, c.5196+1056A>G (rs886044749), found in 5/834 (0.6%) of STGD1 cases is, conversely, a severe allele. This study determines pathogenicity for three non-coding variants in STGD1 patients of European descent accounting for ~3% of the disease. Defining disease-associated alleles in the non-coding sequences of the ABCA4 locus can be accomplished by integrated clinical and genetic analyses. Cold Spring Harbor Laboratory Press.

  11. A deep intronic CLRN1 (USH3A) founder mutation generates an aberrant exon and underlies severe Usher syndrome on the Arabian Peninsula.

    PubMed

    Khan, Arif O; Becirovic, Elvir; Betz, Christian; Neuhaus, Christine; Altmüller, Janine; Maria Riedmayr, Lisa; Motameny, Susanne; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno J

    2017-05-03

    Deafblindness is mostly due to Usher syndrome caused by recessive mutations in the known genes. Mutation-negative patients therefore either have distinct diseases, mutations in yet unknown Usher genes or in extra-exonic parts of the known genes - to date a largely unexplored possibility. In a consanguineous Saudi family segregating Usher syndrome type 1 (USH1), NGS of genes for Usher syndrome, deafness and retinal dystrophy and subsequent whole-exome sequencing each failed to identify a mutation. Genome-wide linkage analysis revealed two small candidate regions on chromosome 3, one containing the USH3A gene CLRN1, which has never been associated with Usher syndrome in Saudi Arabia. Whole-genome sequencing (WGS) identified a homozygous deep intronic mutation, c.254-649T > G, predicted to generate a novel donor splice site. CLRN1 minigene-based analysis confirmed the splicing of an aberrant exon due to usage of this novel motif, resulting in a frameshift and a premature termination codon. We identified this mutation in an additional two of seven unrelated mutation-negative Saudi USH1 patients. Locus-specific markers indicated that c.254-649T > G CLRN1 represents a founder allele that may significantly contribute to deafblindness in this population. Our finding underlines the potential of WGS to uncover atypically localized, hidden mutations in patients who lack exonic mutations in the known disease genes.

  12. Antisense oligonucleotide therapeutics for iron-sulphur cluster deficiency myopathy.

    PubMed

    Kollberg, Gittan; Holme, Elisabeth

    2009-12-01

    Iron-sulphur cluster deficiency myopathy is caused by a deep intronic mutation in ISCU resulting in inclusion of a cryptic exon in the mature mRNA. ISCU encodes the iron-sulphur cluster assembly protein IscU. Iron-sulphur clusters are essential for most basic redox transformations including the respiratory-chain function. Most patients are homozygous for the mutation with a phenotype characterized by a non-progressive myopathy with childhood onset of early fatigue, dyspnoea and palpitation on trivial exercise. A more severe phenotype with early onset of a slowly progressive severe muscle weakness, severe exercise intolerance and cardiomyopathy is caused by a missense mutation in compound with the intronic mutation. Treatment of cultured fibroblasts derived from three homozygous patients with an antisense phosphorodiamidate morpholino oligonucleotide for 48 h resulted in 100% restoration of the normal splicing pattern. The restoration was stable and after 21 days the correctly spliced mRNA still was the dominating RNA species.

  13. Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

    PubMed Central

    Vassiliki, Kokkinou; George, Koutsodontis; Polixeni, Stamatiou; Christoforos, Giatzakis; Minas, Aslanides Ioannis; Stavrenia, Koukoula; Ioannis, Datseris

    2018-01-01

    Aim To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1). Materials and Methods A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%). Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%). In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations. PMID:29854428

  14. A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

    PubMed

    Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

    2017-01-01

    Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

  15. Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

    PubMed Central

    2010-01-01

    Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

  16. Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

    PubMed

    Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

    2013-08-08

    Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of 23 (35%) of 'missing' mutations in Usher type 2 probands with only a single heterozygous USH2A mutation detected with Sanger sequencing could be attributed to deletions, duplications or a pathogenic deep intronic variant. Future mutation detection strategies and genetic counselling will need to take into account the prevalence of these types of mutations in order to provide a more comprehensive diagnostic service.

  17. Antisense-based RNA therapy of factor V deficiency: in vitro and ex vivo rescue of a F5 deep-intronic splicing mutation.

    PubMed

    Nuzzo, Francesca; Radu, Claudia; Baralle, Marco; Spiezia, Luca; Hackeng, Tilman M; Simioni, Paolo; Castoldi, Elisabetta

    2013-11-28

    Antisense molecules are emerging as a powerful tool to correct splicing defects. Recently, we identified a homozygous deep-intronic mutation (F5 c.1296+268A>G) activating a cryptic donor splice site in a patient with severe coagulation factor V (FV) deficiency and life-threatening bleeding episodes. Here, we assessed the ability of 2 mutation-specific antisense molecules (a morpholino oligonucleotide [MO] and an engineered U7 small nuclear RNA [snRNA]) to correct this splicing defect. COS-1 and HepG2 cells transfected with a F5 minigene construct containing the patient's mutation expressed aberrant messenger RNA (mRNA) in excess of normal mRNA. Treatment with mutation-specific antisense MO (1-5 µM) or a construct expressing antisense U7snRNA (0.25-2 µg) dose-dependently increased the relative amount of correctly spliced mRNA by 1 to 2 orders of magnitude, whereas control MO and U7snRNA were ineffective. Patient-derived megakaryocytes obtained by differentiation of circulating progenitor cells did not express FV, but became positive for FV at immunofluorescence staining after administration of antisense MO or U7snRNA. However, treatment adversely affected cell viability, mainly because of the transfection reagents used to deliver the antisense molecules. Our data provide in vitro and ex vivo proof of principle for the efficacy of RNA therapy in severe FV deficiency, but additional cytotoxicity studies are warranted.

  18. Accurate, simple, and inexpensive assays to diagnose F8 gene inversion mutations in hemophilia A patients and carriers.

    PubMed

    Dutta, Debargh; Gunasekera, Devi; Ragni, Margaret V; Pratt, Kathleen P

    2016-12-27

    The most frequent mutations resulting in hemophilia A are an intron 22 or intron 1 gene inversion, which together cause ∼50% of severe hemophilia A cases. We report a simple and accurate RNA-based assay to detect these mutations in patients and heterozygous carriers. The assays do not require specialized equipment or expensive reagents; therefore, they may provide useful and economic protocols that could be standardized for central laboratory testing. RNA is purified from a blood sample, and reverse transcription nested polymerase chain reaction (RT-NPCR) reactions amplify DNA fragments with the F8 sequence spanning the exon 22 to 23 splice site (intron 22 inversion test) or the exon 1 to 2 splice site (intron 1 inversion test). These sequences will be amplified only from F8 RNA without an intron 22 or intron 1 inversion mutation, respectively. Additional RT-NPCR reactions are then carried out to amplify the inverted sequences extending from F8 exon 19 to the first in-frame stop codon within intron 22 or a chimeric transcript containing F8 exon 1 and the VBP1 gene. These latter 2 products are produced only by individuals with an intron 22 or intron 1 inversion mutation, respectively. The intron 22 inversion mutations may be further classified (eg, as type 1 or type 2, reflecting the specific homologous recombination sites) by the standard DNA-based "inverse-shifting" PCR assay if desired. Efficient Bcl I and T4 DNA ligase enzymes that cleave and ligate DNA in minutes were used, which is a substantial improvement over previous protocols that required overnight incubations. These protocols can accurately detect F8 inversion mutations via same-day testing of patient samples.

  19. [Study of gene mutation in 62 hemophilia A children].

    PubMed

    Hu, Q; Liu, A G; Zhang, L Q; Zhang, A; Wang, Y Q; Wang, S M; Lu, Y J; Wang, X

    2017-11-02

    Objective: To analyze the mutation type of FⅧ gene in children with hemophilia A and to explore the relationship among hemophilia gene mutation spectrum, gene mutation and clinical phenotype. Method: Sixty-two children with hemophilia A from Department of Pediatric Hematology, Tongji Hospital of Tongji Medical College, Huazhong University of Science and Technology between January 2015 and March 2017 were enrolled. All patients were male, aged from 4 months to 7 years and F Ⅷ activity ranged 0.2%-11.0%. Fifty cases had severe, 10 cases had moderate and 2 cases had mild hemophilia A. DNA was isolated from peripheral blood in hemophilia A children and the target gene fragment was amplified by PCR, in combination with the second generation sequencing, 22 and 1 introns were detected. Negative cases were detected by the second generation sequencing and results were compared with those of the international FⅧ gene mutation database. Result: There were 20 cases (32%) of intron 22 inversion, 2 cases (3%) of intron 1 inversion, 18 cases (29%) of missense mutation, 5 cases (8%) of nonsense mutation, 7 cases (11%) of deletion mutation, 1 case(2%)of splice site mutation, 2 cases (3%) of large fragment deletion and 1 case of insertion mutation (2%). No mutation was detected in 2 cases (3%), and 4 cases (7%) failed to amplify. The correlation between phenotype and genotype showed that the most common gene mutation in severe hemophilia A was intron 22 inversion (20 cases), accounting for 40% of severe patients, followed by 11 cases of missense mutation (22%). The most common mutation in moderate hemophilia A was missense mutation (6 cases), accounting for 60% of moderate patients. Conclusion: The most frequent mutation type in hemophilia A was intron 22 inversion, followed by missense mutation, again for missing mutation. The relationship between phenotype and genotype: the most frequent gene mutation in severe hemophilia A is intron 22 inversion, followed by missense mutation; the most frequent gene mutation in medium hemophilia A is missense mutation.

  20. Ovarian Tumors related to Intronic Mutations in DICER1: A Report from the International Ovarian and Testicular Stromal Tumor Registry

    PubMed Central

    Schultz, Kris Ann; Harris, Anne; Messinger, Yoav; Sencer, Susan; Baldinger, Shari; Dehner, Louis P.; Hill, D. Ashley

    2015-01-01

    Germline DICER1 mutations have been described in individuals with pleuropulmonary blastoma (PPB), ovarian Sertoli-Leydig cell tumor (SLCT), sarcomas, multinodular goiter, thyroid carcinoma, cystic nephroma and other neoplastic conditions. Early results from the International Ovarian and Testicular Stromal Tumor Registry show germline DICER1 mutations in 48% of girls and women with SLCT. In this report, a young woman presented with ovarian undifferentiated sarcoma. Four years later, she presented with SLCT. She was successfully treated for both malignancies. Sequence results showed a germline intronic mutation in DICER1. This mutation results in an exact duplication of the six bases at the splice site at the intron 23 and exon 24 junction. Predicted improper splicing leads to inclusion of 10 bases of intronic sequence, frameshift and premature truncation of the protein disrupting the RNase IIIb domain. A second individual with SLCT was found to have an identical germline mutation. In each of the ovarian tumors, an additional somatic mutation in the RNase IIIb domain of DICER1 was found. In rare patients, germline intronic mutations in DICER1 that are predicted to cause incorrect splicing can also contribute to the pathogenesis of SLCT. PMID:26289771

  1. Familial early-onset dementia with tau intron 10 + 16 mutation with clinical features similar to those of Alzheimer disease.

    PubMed

    Doran, Mark; du Plessis, Daniel G; Ghadiali, Eric J; Mann, David M A; Pickering-Brown, Stuart; Larner, Andrew J

    2007-10-01

    Frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17) owing to the tau intron 10 + 16 mutation usually occurs with a prototypical frontotemporal dementia phenotype with prominent disinhibition and affective disturbances. To report a new FTDP-17 pedigree with the tau intron 10 + 16 mutation demonstrating a clinical phenotype suggestive of Alzheimer disease. Case reports. Regional neuroscience centers in northwest England. Patients We examined 4 members of a kindred in which 8 individuals were affected in 3 generations. All 4 patients reported memory difficulty. Marked anomia was also present, but behavioral disturbances were conspicuously absent in the early stages of disease. All patients had an initial clinical diagnosis of Alzheimer disease. No mutations were found in the presenilin or amyloid precursor protein genes. Pathologic examination of the proband showed features typical of FTDP-17, and tau gene analysis showed the intron 10 + 16 mutation. This pedigree illustrates the phenotypic variability of tau intron 10 + 16 mutations. In pedigrees with a clinical diagnosis of Alzheimer disease but without presenilin or amyloid precursor protein gene mutations, tau gene mutations may be found.

  2. A KCNH2 branch point mutation causing aberrant splicing contributes to an explanation of genotype-negative long QT syndrome.

    PubMed

    Crotti, Lia; Lewandowska, Marzena A; Schwartz, Peter J; Insolia, Roberto; Pedrazzini, Matteo; Bussani, Erica; Dagradi, Federica; George, Alfred L; Pagani, Franco

    2009-02-01

    Genetic screening of long QT syndrome (LQTS) fails to identify disease-causing mutations in about 30% of patients. So far, molecular screening has focused mainly on coding sequence mutations or on substitutions at canonical splice sites. The purpose of this study was to explore the possibility that intronic variants not at canonical splice sites might affect splicing regulatory elements, lead to aberrant transcripts, and cause LQTS. Molecular screening was performed through DHPLC and sequence analysis. The role of the intronic mutation identified was assessed with a hybrid minigene splicing assay. A three-generation LQTS family was investigated. Molecular screening failed to identify an obvious disease-causing mutation in the coding sequences of the major LQTS genes but revealed an intronic A-to-G substitution in KCNH2 (IVS9-28A/G) cosegregating with the clinical phenotype in family members. In vitro analysis proved that the mutation disrupts the acceptor splice site definition by affecting the branch point (BP) sequence and promoting intron retention. We further demonstrated a tight functional relationship between the BP and the polypyrimidine tract, whose weakness is responsible for the pathological effect of the IVS9-28A/G mutation. We identified a novel BP mutation in KCNH2 that disrupts the intron 9 acceptor splice site definition and causes LQT2. The present finding demonstrates that intronic mutations affecting pre-mRNA processing may contribute to the failure of traditional molecular screening in identifying disease-causing mutations in LQTS subjects and offers a rationale strategy for the reduction of genotype-negative cases.

  3. Novel BRCA1 mutations and more frequent intron-20 alteration found among 236 women from Western Poland.

    PubMed

    Sobczak, K; Kozłowski, P; Napierała, M; Czarny, J; Woźniak, M; Kapuścińska, M; Lośko, M; Koziczak, M; Jasińska, A; Powierska, J; Braczkowski, R; Breborowicz, J; Godlewski, D; Mackiewicz, A; Krzyzosiak, W

    1997-10-09

    Three different novel BRCA1 mutations, five independent cases of the same 12 bp insertion-duplication in intron-20 and two novel rare BRCA1 sequence variants were identified among 122 Polish women with positive, in most cases moderate family history of breast and/or ovarian cancer, 80 controls and 34 unselected breast cancer tissue specimens. All mutations and variants were germline. The 4153 delA frameshift mutation, the Tyr105Cys missense mutation and two cases of the alteration in intron-20 were found in the group of healthy women with positive family history. Two other cases of the intronic insertion were found in unselected controls. Their carriers had no family history of breast or ovarian cancer but other cancers occurred in their families. The 1782 Trp/STOP nonsense mutation and one case of the insertion in intron-20 were first found in tissue specimens of breast cancer patient and breast/ovarian cancer patient, respectively. Their carriers also had no family history of breast or ovarian cancer. The distribution of the insertion in intron-20 in analysed groups and results of RT-PCR experiments suggest a less prominent role for this variant considered earlier a splicing mutation. This study shows also, that more population-oriented research is needed, involving women with less profound or even no family history of breast and ovarian cancer, to better understand the role and significance of different BRCA1 variants and mutations.

  4. Neurodegenerative disorder FTDP-17-related tau intron 10 +16C → T mutation increases tau exon 10 splicing and causes tauopathy in transgenic mice.

    PubMed

    Umeda, Tomohiro; Yamashita, Takenari; Kimura, Tetsuya; Ohnishi, Kiyouhisa; Takuma, Hiroshi; Ozeki, Tomoko; Takashima, Akihiko; Tomiyama, Takami; Mori, Hiroshi

    2013-07-01

    Frontotemporal dementia and parkinsonism linked to chromosome 17 (FTDP-17) is a neurodegenerative disorder caused by mutations in the tau gene. Many mutations identified in FTDP-17 have been shown to affect tau exon 10 splicing in vitro, which presumably causes pathologic imbalances in exon 10(-) [3-repeat (3R)] and exon 10(+) [4-repeat (4R)] tau expression and leads to intracellular inclusions of hyperphosphorylated tau in patient brains. However, no reports have investigated this theory using model mice with a tau intronic mutation. Herein, we generated new transgenic mice harboring the tau intron 10 +16C → T mutation. We prepared a transgene construct containing intronic sequences required for exon 10 splicing in the longest tau isoform cDNA. Although mice bearing the construct without the intronic mutation showed normal developmental changes of the tau isoform from 3R tau to equal amounts of 3R and 4R tau, mice with the mutation showed much higher levels of 4R tau at the adult stage. 4R tau was selectively recovered in insoluble brain fractions in their old age. Furthermore, these mice displayed abnormal tau phosphorylation, synapse loss and dysfunction, memory impairment, glial activation, tangle formation, and neuronal loss in an age-dependent manner. These findings provide the first evidence in a mouse model that a tau intronic mutation-induced imbalance of 3R and 4R tau could be a cause of tauopathy. Copyright © 2013 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

  5. Leber Congenital Amaurosis Associated with Mutations in CEP290, Clinical Phenotype, and Natural History in Preparation for Trials of Novel Therapies.

    PubMed

    Sheck, Leo; Davies, Wayne I L; Moradi, Phillip; Robson, Anthony G; Kumaran, Neruban; Liasis, Alki C; Webster, Andrew R; Moore, Anthony T; Michaelides, Michel

    2018-06-01

    To investigate and describe in detail the demographics, functional and anatomic characteristics, and clinical course of Leber congenital amaurosis (LCA) associated with mutations in the CEP290 gene (LCA-CEP290) in a large cohort of adults and children. Retrospective case series. Patients with mutations in CEP290 identified at a single UK referral center. Review of case notes and results of retinal imaging (color fundus photography, fundus autofluorescence [FAF] imaging, OCT), electrophysiologic assessment, and molecular genetic testing. Molecular genetic testing, clinical findings including visual acuity and retinal imaging, and electrophysiologic assessment. Forty patients with LCA-CEP290 were identified. The deep intronic mutation c.2991+1655 A>G was the most common disease-causing variant (23/40 patients) identified in the compound heterozygous state in 20 patients (50%) and homozygous in 2 patients (5%). Visual acuity (VA) varied from 6/9 to no perception of light, and only 2 of 12 patients with longitudinal VA data showed deterioration in VA in their better-seeing eye over time. A normal fundus was found at diagnosis in younger patients (mean age, 1.9 years), with older patients showing white flecks (mean age, 5.9 years) or pigmentary retinopathy (mean age, 21.7 years). Eleven of 12 patients (92%) with OCT imaging had preservation of foveal architecture. Ten of 12 patients (83%) with FAF imaging had a perifoveal hyperautofluorescent ring. Having 2 nonsense CEP290 mutations was associated with worse final VA and the presence of nonocular features. Detailed analysis of the clinical phenotype of LCA-CEP290 in a large cohort confirms that there is a window of opportunity in childhood for therapeutic intervention based on relative structural preservation in the central cone-rich retina in a significant proportion of patients, with the majority harboring the deep intronic variant potentially tractable to several planned gene editing approaches. Copyright © 2018 American Academy of Ophthalmology. All rights reserved.

  6. Whole-gene CFTR sequencing combined with digital RT-PCR improves genetic diagnosis of cystic fibrosis.

    PubMed

    Straniero, Letizia; Soldà, Giulia; Costantino, Lucy; Seia, Manuela; Melotti, Paola; Colombo, Carla; Asselta, Rosanna; Duga, Stefano

    2016-12-01

    Despite extensive screening, 1-5% of cystic fibrosis (CF) patients lack a definite molecular diagnosis. Next-generation sequencing (NGS) is making affordable genetic testing based on the identification of variants in extended genomic regions. In this frame, we analyzed 23 CF patients and one carrier by whole-gene CFTR resequencing: 4 were previously characterized and served as controls; 17 were cases lacking a complete diagnosis after a full conventional CFTR screening; 3 were consecutive subjects referring to our centers, not previously submitted to any screening. We also included in the custom NGS design the coding portions of the SCNN1A, SCNN1B and SCNN1G genes, encoding the subunits of the sodium channel ENaC, which were found to be mutated in CF-like patients. Besides 2 novel SCNN1B missense mutations, we identified 22 previously-known CFTR mutations, including 2 large deletions (whose breakpoints were precisely mapped), and novel deep-intronic variants, whose role on splicing was excluded by ex-vivo analyses. Finally, for 2 patients, compound heterozygotes for a CFTR mutation and the intron-9c.1210-34TG [11-12] T 5 allele-known to be associated with decreased CFTR mRNA levels-the molecular diagnosis was implemented by measuring the residual level of wild-type transcript by digital reverse transcription polymerase chain reaction performed on RNA extracted from nasal brushing.

  7. Log-PCR: a new tool for immediate and cost-effective diagnosis of up to 85% of dystrophin gene mutations.

    PubMed

    Trimarco, Amelia; Torella, Annalaura; Piluso, Giulio; Maria Ventriglia, Vega; Politano, Luisa; Nigro, Vincenzo

    2008-06-01

    Duchenne (DMD) and Becker (BMD) muscular dystrophies are caused by mutations in the dystrophin gene. Despite the progress in the technologies of mutation detection, the disease of one third of patients escapes molecular definition because the labor and expense involved has precluded analyzing the entire gene. Novel techniques with higher detection rates, such as multiplex ligation-dependent probe amplification and multiplex amplifiable probe hybridization, have been introduced. We approached the challenge of multiplexing by modifying the PCR chemistry. We set up a rapid protocol that analyzes all dystrophin exons and flanking introns (57.5 kb). We grouped exons according to their effect on the reading frame and ran 2 PCR reactions for DMD mutations and 2 reactions for BMD mutations under the same conditions. The PCR products are evenly spaced logarithmically on the gel (Log-PCR) in an order that reproduces their chromosomal locations. This strategy enables both simultaneous mapping of all the mutation borders and distinguishing between DMD and BMD. As a proof of principle, we reexamined samples from 506 patients who had received a DMD or BMD diagnosis. We observed gross rearrangements in 428 of the patients (84.6%; 74.5% deletions and 10.1% duplications). We also recognized a much broader spectrum of mutations and identified 14.6% additional cases. This study is the first exhaustive investigation of this subject and has made possible the development of a cost-effective test for diagnosing a larger proportion of cases. The benefit of this approach may allow more focused efforts for discovering small or deep-intronic mutations among the few remaining undiagnosed cases. The same protocol can be extended to set up Log-PCRs for other high-throughput applications.

  8. An intronic mutation c.6430-3C>G in the F8 gene causes splicing efficiency and premature termination in hemophilia A.

    PubMed

    Xia, Zunjing; Lin, Jie; Lu, Lingping; Kim, Chol; Yu, Ping; Qi, Ming

    2018-06-01

    : Hemophilia A is a bleeding disorder caused by coagulation factor VIII protein deficiency or dysfunction, which is classified into severe, moderate, and mild according to factor clotting activity. An overwhelming majority of missense and nonsense mutations occur in exons of F8 gene, whereas mutations in introns can also be pathogenic. This study aimed to investigate the effect of an intronic mutation, c.6430-3C>G (IVS22-3C>G), on pre-mRNA splicing of the F8 gene. We applied DNA and cDNA sequencing in a Chinese boy with hemophilia A to search if any pathogenic mutation in the F8 gene. Functional analysis was performed to investigate the effect of an intronic mutation at the transcriptional level. Human Splicing Finder and PyMol were also used to predict its effect. We found the mutation c.6430-3C>G (IVS22-3C>G) in the F8 gene in the affected boy, with his mother being a carrier. cDNA from the mother and pSPL3 splicing assay showed that the mutation IVS22-3C>G results in a two-nucleotide AG inclusion at the 3' end of intron 22 and leads to a truncated coagulation factor VIII protein, with partial loss of the C1 domain and complete loss of the C2 domain. The in-silico tool predicted that the mutation induces altered pre-mRNA splicing by using a cryptic acceptor site in intron 22. The IVS22-3C>G mutation was confirmed to affect pre-mRNA splicing and produce a truncated protein, which reduces the stability of binding between the F8 protein and von Willebrand factor carrier protein due to the loss of an interaction domain.

  9. Functional examination of MLH1, MSH2, and MSH6 intronic mutations identified in Danish colorectal cancer patients.

    PubMed

    Petersen, Sanne M; Dandanell, Mette; Rasmussen, Lene J; Gerdes, Anne-Marie; Krogh, Lotte N; Bernstein, Inge; Okkels, Henrik; Wikman, Friedrik; Nielsen, Finn C; Hansen, Thomas V O

    2013-10-03

    Germ-line mutations in the DNA mismatch repair genes MLH1, MSH2, and MSH6 predispose to the development of colorectal cancer (Lynch syndrome or hereditary nonpolyposis colorectal cancer). These mutations include disease-causing frame-shift, nonsense, and splicing mutations as well as large genomic rearrangements. However, a large number of mutations, including missense, silent, and intronic variants, are classified as variants of unknown clinical significance. Intronic MLH1, MSH2, or MSH6 variants were investigated using in silico prediction tools and mini-gene assay to asses the effect on splicing. We describe in silico and in vitro characterization of nine intronic MLH1, MSH2, or MSH6 mutations identified in Danish colorectal cancer patients, of which four mutations are novel. The analysis revealed aberrant splicing of five mutations (MLH1 c.588 + 5G > A, MLH1 c.677 + 3A > T, MLH1 c.1732-2A > T, MSH2 c.1276 + 1G > T, and MSH2 c.1662-2A > C), while four mutations had no effect on splicing compared to wild type (MLH1 c.117-34A > T, MLH1 c.1039-8 T > A, MSH2 c.2459-18delT, and MSH6 c.3439-16C > T). In conclusion, we classify five MLH1/MSH2 mutations as pathogenic, whereas four MLH1/MSH2/MSH6 mutations are classified as neutral. This study supports the notion that in silico prediction tools and mini-gene assays are important for the classification of intronic variants, and thereby crucial for the genetic counseling of patients and their family members.

  10. Neuropathologic Characterization of Pontocerebellar Hypoplasia Type 6 Associated With Cardiomyopathy and Hydrops Fetalis and Severe Multisystem Respiratory Chain Deficiency due to Novel RARS2 Mutations.

    PubMed

    Lax, Nichola Z; Alston, Charlotte L; Schon, Katherine; Park, Soo-Mi; Krishnakumar, Deepa; He, Langping; Falkous, Gavin; Ogilvy-Stuart, Amanda; Lees, Christoph; King, Rosalind H; Hargreaves, Iain P; Brown, Garry K; McFarland, Robert; Dean, Andrew F; Taylor, Robert W

    2015-07-01

    Autosomal recessive mutations in the RARS2 gene encoding the mitochondrial arginyl-transfer RNA synthetase cause infantile-onset myoencephalopathy pontocerebellar hypoplasia type 6 (PCH6). We describe 2 sisters with novel compound heterozygous RARS2 mutations who presented perinatally with neurologic features typical of PCH6 but with additional features including cardiomyopathy, hydrops, and pulmonary hypoplasia and who died at 1 day and 14 days of age. Magnetic resonance imaging findings included marked cerebellar hypoplasia, gyral immaturity, punctate lesions in cerebral white matter, and unfused deep cerebral grey matter. Enzyme histochemistry of postmortem tissues revealed a near-global cytochrome c oxidase-deficiency; assessment of respiratory chain enzyme activities confirmed severe deficiencies involving complexes I, III, and IV. Molecular genetic studies revealed 2 RARS2 gene mutations: a c.1A>G, p.? variant predicted to abolish the initiator methionine, and a deep intronic c.613-3927C>T variant causing skipping of exons 6-8 in the mature RARS2 transcript. Neuropathologic investigation included low brain weights, small brainstem and cerebellum, deep cerebral white matter pathology, pontine nucleus neuron loss (in 1 sibling), and peripheral nerve pathology. Mitochondrial respiratory chain immunohistochemistry in brain tissues confirmed an absence of complexes I and IV immunoreactivity with sparing of mitochondrial numbers. These cases expand the clinical spectrum of RARS2 mutations, including antenatal features and widespread mitochondrial respiratory chain deficiencies in postmortem brain tissues.

  11. Neuropathologic Characterization of Pontocerebellar Hypoplasia Type 6 Associated With Cardiomyopathy and Hydrops Fetalis and Severe Multisystem Respiratory Chain Deficiency due to Novel RARS2 Mutations

    PubMed Central

    Lax, Nichola Z.; Alston, Charlotte L.; Schon, Katherine; Park, Soo-Mi; Krishnakumar, Deepa; He, Langping; Falkous, Gavin; Ogilvy-Stuart, Amanda; Lees, Christoph; King, Rosalind H.; Hargreaves, Iain P.; Brown, Garry K.; McFarland, Robert; Dean, Andrew F.; Taylor, Robert W.

    2015-01-01

    Abstract Autosomal recessive mutations in the RARS2 gene encoding the mitochondrial arginyl-transfer RNA synthetase cause infantile-onset myoencephalopathy pontocerebellar hypoplasia type 6 (PCH6). We describe 2 sisters with novel compound heterozygous RARS2 mutations who presented perinatally with neurologic features typical of PCH6 but with additional features including cardiomyopathy, hydrops, and pulmonary hypoplasia and who died at 1 day and 14 days of age. Magnetic resonance imaging findings included marked cerebellar hypoplasia, gyral immaturity, punctate lesions in cerebral white matter, and unfused deep cerebral grey matter. Enzyme histochemistry of postmortem tissues revealed a near-global cytochrome c oxidase-deficiency; assessment of respiratory chain enzyme activities confirmed severe deficiencies involving complexes I, III, and IV. Molecular genetic studies revealed 2 RARS2 gene mutations: a c.1A>G, p.? variant predicted to abolish the initiator methionine, and a deep intronic c.613-3927C>T variant causing skipping of exons 6–8 in the mature RARS2 transcript. Neuropathologic investigation included low brain weights, small brainstem and cerebellum, deep cerebral white matter pathology, pontine nucleus neuron loss (in 1 sibling), and peripheral nerve pathology. Mitochondrial respiratory chain immunohistochemistry in brain tissues confirmed an absence of complexes I and IV immunoreactivity with sparing of mitochondrial numbers. These cases expand the clinical spectrum of RARS2 mutations, including antenatal features and widespread mitochondrial respiratory chain deficiencies in postmortem brain tissues. PMID:26083569

  12. Usher syndrome type 2 caused by activation of an USH2A pseudoexon: implications for diagnosis and therapy.

    PubMed

    Vaché, Christel; Besnard, Thomas; le Berre, Pauline; García-García, Gema; Baux, David; Larrieu, Lise; Abadie, Caroline; Blanchet, Catherine; Bolz, Hanno Jörn; Millan, Jose; Hamel, Christian; Malcolm, Sue; Claustres, Mireille; Roux, Anne-Françoise

    2012-01-01

    USH2A sequencing in three affected members of a large family, referred for the recessive USH2 syndrome, identified a single pathogenic alteration in one of them and a different mutation in the two affected nieces. As the patients carried a common USH2A haplotype, they likely shared a mutation not found by standard sequencing techniques. Analysis of RNA from nasal cells in one affected individual identified an additional pseudoexon (PE) resulting from a deep intronic mutation. This was confirmed by minigene assay. This is the first example in Usher syndrome (USH) with a mutation causing activation of a PE. The finding of this alteration in eight other individuals of mixed European origin emphasizes the importance of including RNA analysis in a comprehensive diagnostic service. Finally, this mutation, which would not have been found by whole-exome sequencing, could offer, for the first time in USH, the possibility of therapeutic correction by antisense oligonucleotides (AONs). © 2011 Wiley Periodicals, Inc.

  13. Base pairing between the 3' exon and an internal guide sequence increases 3' splice site specificity in the Tetrahymena self-splicing rRNA intron.

    PubMed Central

    Suh, E R; Waring, R B

    1990-01-01

    It has been proposed that recognition of the 3' splice site in many group I introns involves base pairing between the start of the 3' exon and a region of the intron known as the internal guide sequence (R. W. Davies, R. B. Waring, J. Ray, T. A. Brown, and C. Scazzocchio, Nature [London] 300:719-724, 1982). We have examined this hypothesis, using the self-splicing rRNA intron from Tetrahymena thermophila. Mutations in the 3' exon that weaken this proposed pairing increased use of a downstream cryptic 3' splice site. Compensatory mutations in the guide sequence that restore this pairing resulted in even stronger selection of the normal 3' splice site. These changes in 3' splice site usage were more pronounced in the background of a mutation (414A) which resulted in an adenine instead of a guanine being the last base of the intron. These results show that the proposed pairing (P10) plays an important role in ensuring that cryptic 3' splice sites are selected against. Surprisingly, the 414A mutation alone did not result in activation of the cryptic 3' splice site. Images PMID:2342465

  14. Activation of a cryptic splice site in the mitochondrial elongation factor GFM1 causes combined OXPHOS deficiency☆

    PubMed Central

    Simon, Mariella T.; Ng, Bobby G.; Friederich, Marisa W.; Wang, Raymond Y.; Boyer, Monica; Kircher, Martin; Collard, Renata; Buckingham, Kati J.; Chang, Richard; Shendure, Jay; Nickerson, Deborah A.; Bamshad, Michael J.; Van Hove, Johan L.K.; Freeze, Hudson H.; Abdenur, Jose E.

    2017-01-01

    We report the clinical, biochemical, and molecular findings in two brothers with encephalopathy and multi-systemic disease. Abnormal transferrin glycoforms were suggestive of a type I congenital disorder of glycosylation (CDG). While exome sequencing was negative for CDG related candidate genes, the testing revealed compound heterozygous mutations in the mitochondrial elongation factor G gene (GFM1). One of the mutations had been reported previously while the second, novel variant was found deep in intron 6, activating a cryptic splice site. Functional studies demonstrated decreased GFM1 protein levels, suggested disrupted assembly of mitochondrial complexes III and V and decreased activities of mitochondrial complexes I and IV, all indicating combined OXPHOS deficiency. PMID:28216230

  15. X-linked hypophosphatemia attributable to pseudoexons of the PHEX gene.

    PubMed

    Christie, P T; Harding, B; Nesbit, M A; Whyte, M P; Thakker, R V

    2001-08-01

    X-linked hypophosphatemia is commonly caused by mutations of the coding region of PHEX (phosphate-regulating gene with homologies to endopeptidases on the X chromosome). However, such PHEX mutations are not detected in approximately one third of X-linked hypophosphatemia patients who may harbor defects in the noncoding or intronic regions. We have therefore investigated 11 unrelated X-linked hypophosphatemia patients in whom coding region mutations had been excluded, for intronic mutations that may lead to mRNA splicing abnormalities, by the use of lymphoblastoid RNA and RT-PCRs. One X-linked hypophosphatemia patient was found to have 3 abnormally large transcripts, resulting from 51-bp, 100-bp, and 170-bp insertions, all of which would lead to missense peptides and premature termination codons. The origin of these transcripts was a mutation (g to t) at position +1268 of intron 7, which resulted in the occurrence of a high quality novel donor splice site (ggaagg to gtaagg). Splicing between this novel donor splice site and 3 preexisting, but normally silent, acceptor splice sites within intron 7 resulted in the occurrences of the 3 pseudoexons. This represents the first report of PHEX pseudoexons and reveals further the diversity of genetic abnormalities causing X-linked hypophosphatemia.

  16. Quantitation of normal CFTR mRNA in CF patients with splice-site mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhou, Z.; Olsen, J.C.; Silverman, L.M.

    Previously we identified two mutations in introns of the CFTR gene associated with partially active splice sites and unusual clinical phenotypes. One mutation in intron 19 (3849+10 kb C to T) is common in CF patients with normal sweat chloride values; an 84 bp sequence from intron 19, which contains a stop codon, is inserted between exon 19 and exon 20 in most nasal CFTR transcripts. The other mutation in intron 14B (2789+5 G to A) is associated with elevated sweat chloride levels, but mild pulmonary disease; exon 14B (38 bp) is spliced out of most nasal CFTR transcipts. Themore » remaining CFTR cDNA sequences, other than the 84 bp insertion of exon 14B deletion, are identical to the published sequence. To correlate genotype and phenotype, we used quantitative RT-PCR to determine the levels of normally-spliced CFTR mRNA in nasal epithelia from these patients. CFTR cDNA was amplified (25 cycles) by using primers specific for normally-spliced species, {gamma}-actin cDNA was amplified as a standard.« less

  17. Functional and splicing defect analysis of 23 ACVRL1 mutations in a cohort of patients affected by Hereditary Hemorrhagic Telangiectasia

    PubMed Central

    Alaa el Din, Ferdos; Patri, Sylvie; Thoreau, Vincent; Rodriguez-Ballesteros, Montserrat; Hamade, Eva; Bailly, Sabine; Gilbert-Dussardier, Brigitte; Abou Merhi, Raghida; Kitzis, Alain

    2015-01-01

    Hereditary Hemorrhagic Telangiectasia syndrome (HHT) or Rendu-Osler-Weber (ROW) syndrome is an autosomal dominant vascular disorder. Two most common forms of HHT, HHT1 and HHT2, have been linked to mutations in the endoglin (ENG) and activin receptor-like kinase 1 (ACVRL1or ALK1) genes respectively. This work was designed to examine the pathogenicity of 23 nucleotide variations in ACVRL1 gene detected in more than 400 patients. Among them, 14 missense mutations and one intronic variant were novels, and 8 missense mutations were previously identified with questionable implication in HHT2. The functionality of missense mutations was analyzed in response to BMP9 (specific ligand of ALK1), the maturation of the protein products and their localization were analyzed by western blot and fluorescence microscopy. The splicing impairment of the intronic and of two missense mutations was examined by minigene assay. Functional analysis showed that 18 out of 22 missense mutations were defective. Splicing analysis revealed that one missense mutation (c.733A>G, p.Ile245Val) affects the splicing of the harboring exon 6. Similarly, the intronic mutation outside the consensus splicing sites (c.1048+5G>A in intron 7) was seen pathogenic by splicing study. Both mutations induce a frame shift creating a premature stop codon likely resulting in mRNA degradation by NMD surveillance mechanism. Our results confirm the haploinsufficiency model proposed for HHT2. The affected allele of ACVRL1 induces mRNA degradation or the synthesis of a protein lacking the receptor activity. Furthermore, our data demonstrate that functional and splicing analyses together, represent two robust diagnostic tools to be used by geneticists confronted with novel or conflicted ACVRL1 mutations. PMID:26176610

  18. A novel intronic mutation in the DDP1 gene in a family with X-linked dystonia-deafness syndrome.

    PubMed

    Ezquerra, Mario; Campdelacreu, Jaume; Muñoz, Esteban; Tolosa, Eduardo; Martí, María J

    2005-02-01

    X-linked dystonia-deafness syndrome (Mohr-Tranebjaerg syndrome) is a rare neurodegenerative disease characterized by hearing loss and dystonia. So far, 7 mutations in the coding region of the DDP1 gene have been described. They consist of frameshift, nonsense, missense mutations or deletions. To investigate the presence of mutations in the DDP1 gene in a family with dystonia-deafness syndrome. Seven members belonging to 2 generations of a family with 2 affected subjects underwent genetic analysis. Mutational screening in the DDP1 gene was made through DNA direct sequencing. We found an intronic mutation in the DDP1 gene. It consists of an A-to-C substitution in the position -23 in reference to the first nucleotide of exon 2 (IVS1-23A>C). The mutation was present in 2 affected men and their respective unaffected mothers, whereas it was absent in the healthy men from this family and in 90 healthy controls. Intronic mutations in the DDP1 gene can also cause X-linked dystonia-deafness syndrome. In our case, the effect of the mutation could be due to a splicing alteration.

  19. A homozygous mutation in the stem II domain of RNU4ATAC causes typical Roifman syndrome.

    PubMed

    Dinur Schejter, Yael; Ovadia, Adi; Alexandrova, Roumiana; Thiruvahindrapuram, Bhooma; Pereira, Sergio L; Manson, David E; Vincent, Ajoy; Merico, Daniele; Roifman, Chaim M

    2017-01-01

    Roifman syndrome (OMIM# 616651) is a complex syndrome encompassing skeletal dysplasia, immunodeficiency, retinal dystrophy and developmental delay, and is caused by compound heterozygous mutations involving the Stem II region and one of the other domains of the RNU4ATAC gene. This small nuclear RNA gene is essential for minor intron splicing. The Canadian Centre for Primary Immunodeficiency Registry and Repository were used to derive patient information as well as tissues. Utilising RNA sequencing methodologies, we analysed samples from patients with Roifman syndrome and assessed intron retention. We demonstrate that a homozygous mutation in Stem II is sufficient to cause the full spectrum of features associated with typical Roifman syndrome. Further, we demonstrate the same pattern of aberration in minor intron retention as found in cases with compound heterozygous mutations.

  20. Recurrent Loss of Specific Introns during Angiosperm Evolution

    PubMed Central

    Wang, Hao; Devos, Katrien M.; Bennetzen, Jeffrey L.

    2014-01-01

    Numerous instances of presence/absence variations for introns have been documented in eukaryotes, and some cases of recurrent loss of the same intron have been suggested. However, there has been no comprehensive or phylogenetically deep analysis of recurrent intron loss. Of 883 cases of intron presence/absence variation that we detected in five sequenced grass genomes, 93 were confirmed as recurrent losses and the rest could be explained by single losses (652) or single gains (118). No case of recurrent intron gain was observed. Deep phylogenetic analysis often indicated that apparent intron gains were actually numerous independent losses of the same intron. Recurrent loss exhibited extreme non-randomness, in that some introns were removed independently in many lineages. The two larger genomes, maize and sorghum, were found to have a higher rate of both recurrent loss and overall loss and/or gain than foxtail millet, rice or Brachypodium. Adjacent introns and small introns were found to be preferentially lost. Intron loss genes exhibited a high frequency of germ line or early embryogenesis expression. In addition, flanking exon A+T-richness and intron TG/CG ratios were higher in retained introns. This last result suggests that epigenetic status, as evidenced by a loss of methylated CG dinucleotides, may play a role in the process of intron loss. This study provides the first comprehensive analysis of recurrent intron loss, makes a series of novel findings on the patterns of recurrent intron loss during the evolution of the grass family, and provides insight into the molecular mechanism(s) underlying intron loss. PMID:25474210

  1. Updated genetic testing of Italian patients referred with a clinical diagnosis of primary hyperoxaluria.

    PubMed

    Pelle, Alessandra; Cuccurullo, Alessandra; Mancini, Cecilia; Sebastiano, Regina; Stallone, Giovanni; Negrisolo, Susanna; Benetti, Elisa; Peruzzi, Licia; Petrarulo, Michele; De Marchi, Mario; Marangella, Martino; Amoroso, Antonio; Giachino, Daniela; Mandrile, Giorgia

    2017-04-01

    Primary hyperoxaluria (PH) is a rare autosomal recessive disease commonly arising in childhood and presenting with nephrolithiasis, nephrocalcinosis and/or chronic renal failure. Three genes are currently known as responsible: alanine-glyoxylate aminotransferase (AGXT, PH type 1), glyoxylate reductase/hydroxypyruvate reductase (GRHPR, PH type 2), and 4-hydroxy-2-oxoglutarate aldolase (HOGA1, PH type 3). In our Centre, at the end of 2014 molecular diagnosis of PH1 had been performed in 80 patients, while one patient received a PH2 diagnosis. Fifteen patients referred to our Centre and suspected to have PH on clinical grounds were negative for pathogenic variants in the entire coding sequence and exon-intron boundaries of the AGXT gene. Therefore, we extended the analysis to the AGXT promoter region and the GRHPR and HOGA1 genes. Two patients were heterozygous for two novel AGXT-promoter variants (c.-647C > T, c.-424C > T) that were probably non pathogenic. One patient was homozygous for a novel HOGA1 variant of intron 2 (c.341-81delT), whose pathogenicity predicted by in silico splicing tools was not confirmed by a minigene splicing assay in COS-7 and HEK293T cells. New genetic subtypes of PH can be hypothesized in our patients, that may be caused by mutations in other gene encoding proteins of glyoxylate metabolism. Alternatively, some kind of mutations (e.g., deletions/duplications, deep intronic splicing regulatory variants) could be missed in a few cases, similarly to other genetic diseases.

  2. mRNA-based detection of rare CFTR mutations improves genetic diagnosis of cystic fibrosis in populations with high genetic heterogeneity.

    PubMed

    Felício, V; Ramalho, A S; Igreja, S; Amaral, M D

    2017-03-01

    Even with advent of next generation sequencing complete sequencing of large disease-associated genes and intronic regions is economically not feasible. This is the case of cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible for cystic fibrosis (CF). Yet, to confirm a CF diagnosis, proof of CFTR dysfunction needs to be obtained, namely by the identification of two disease-causing mutations. Moreover, with the advent of mutation-based therapies, genotyping is an essential tool for CF disease management. There is, however, still an unmet need to genotype CF patients by fast, comprehensive and cost-effective approaches, especially in populations with high genetic heterogeneity (and low p.F508del incidence), where CF is now emerging with new diagnosis dilemmas (Brazil, Asia, etc). Herein, we report an innovative mRNA-based approach to identify CFTR mutations in the complete coding and intronic regions. We applied this protocol to genotype individuals with a suspicion of CF and only one or no CFTR mutations identified by routine methods. It successfully detected multiple intronic mutations unlikely to be detected by CFTR exon sequencing. We conclude that this is a rapid, robust and inexpensive method to detect any CFTR coding/intronic mutation (including rare ones) that can be easily used either as primary approach or after routine DNA analysis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  3. Simultaneous mutation detection of three homoeologous genes in wheat by High Resolution Melting analysis and Mutation Surveyor.

    PubMed

    Dong, Chongmei; Vincent, Kate; Sharp, Peter

    2009-12-04

    TILLING (Targeting Induced Local Lesions IN Genomes) is a powerful tool for reverse genetics, combining traditional chemical mutagenesis with high-throughput PCR-based mutation detection to discover induced mutations that alter protein function. The most popular mutation detection method for TILLING is a mismatch cleavage assay using the endonuclease CelI. For this method, locus-specific PCR is essential. Most wheat genes are present as three similar sequences with high homology in exons and low homology in introns. Locus-specific primers can usually be designed in introns. However, it is sometimes difficult to design locus-specific PCR primers in a conserved region with high homology among the three homoeologous genes, or in a gene lacking introns, or if information on introns is not available. Here we describe a mutation detection method which combines High Resolution Melting (HRM) analysis of mixed PCR amplicons containing three homoeologous gene fragments and sequence analysis using Mutation Surveyor software, aimed at simultaneous detection of mutations in three homoeologous genes. We demonstrate that High Resolution Melting (HRM) analysis can be used in mutation scans in mixed PCR amplicons containing three homoeologous gene fragments. Combining HRM scanning with sequence analysis using Mutation Surveyor is sensitive enough to detect a single nucleotide mutation in the heterozygous state in a mixed PCR amplicon containing three homoeoloci. The method was tested and validated in an EMS (ethylmethane sulfonate)-treated wheat TILLING population, screening mutations in the carboxyl terminal domain of the Starch Synthase II (SSII) gene. Selected identified mutations of interest can be further analysed by cloning to confirm the mutation and determine the genomic origin of the mutation. Polyploidy is common in plants. Conserved regions of a gene often represent functional domains and have high sequence similarity between homoeologous loci. The method described here is a useful alternative to locus-specific based methods for screening mutations in conserved functional domains of homoeologous genes. This method can also be used for SNP (single nucleotide polymorphism) marker development and eco-TILLING in polyploid species.

  4. New splicing-site mutations in the SURF1 gene in Leigh syndrome patients.

    PubMed

    Pequignot, M O; Desguerre, I; Dey, R; Tartari, M; Zeviani, M; Agostino, A; Benelli, C; Fouque, F; Prip-Buus, C; Marchant, D; Abitbol, M; Marsac, C

    2001-05-04

    The gene SURF1 encodes a factor involved in the biogenesis of cytochrome c oxidase, the last complex in the respiratory chain. Mutations of the SURF1 gene result in Leigh syndrome and severe cytochrome c oxidase deficiency. Analysis of seven unrelated patients with cytochrome c oxidase deficiency and typical Leigh syndrome revealed different SURF1 mutations in four of them. Only these four cases had associated demyelinating neuropathy. Three mutations were novel splicing-site mutations that lead to the excision of exon 6. Two different novel heterozygous mutations were found at the same guanine residue at the donor splice site of intron 6; one was a deletion, whereas the other was a transition [588+1G>A]. The third novel splicing-site mutation was a homozygous [516-2_516-1delAG] in intron 5. One patient only had a homozygous polymorphism in the middle of the intron 8 [835+25C>T]. Western blot analysis showed that Surf1 protein was absent in all four patients harboring mutations. Our studies confirm that the SURF1 gene is an important nuclear gene involved in the cytochrome c oxidase deficiency. We also show that Surf1 protein is not implicated in the assembly of other respiratory chain complexes or the pyruvate dehydrogenase complex.

  5. Reduced mutation rate in exons due to differential mismatch repair

    PubMed Central

    Mularoni, Loris; Muiños, Ferran; Gonzalez-Perez, Abel; López-Bigas, Núria

    2017-01-01

    While recent studies have revealed higher than anticipated heterogeneity of mutation rate across genomic regions, mutations in exons and introns are assumed to be generated at the same rate. Here we find fewer somatic mutations in exons than expected based on their sequence content, and demonstrate that this is not due to purifying selection. Moreover, we show that it is caused by higher mismatch repair activity in exonic than in intronic regions. Our findings have important implications for our understanding of mutational and DNA repair processes, our knowledge of the evolution of eukaryotic genes, and practical ramifications for the study of the evolution of both tumors and species. PMID:29106418

  6. Intronic deletions in the SLC34A3 gene: A cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria

    PubMed Central

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R.; Gray, Amie K.; Baluarte, H. Jorge; Econs, Michael J.

    2013-01-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6 ½-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24- hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH) levels, and elevated 1,25(OH)2D level. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440–1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63 bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. PMID:24176905

  7. Intronic deletions in the SLC34A3 gene: a cautionary tale for mutation analysis of hereditary hypophosphatemic rickets with hypercalciuria.

    PubMed

    Ichikawa, Shoji; Tuchman, Shamir; Padgett, Leah R; Gray, Amie K; Baluarte, H Jorge; Econs, Michael J

    2014-02-01

    Hereditary hypophosphatemic rickets with hypercalciuria (HHRH) is a rare metabolic disorder, characterized by hypophosphatemia, variable degrees of rickets/osteomalacia, and hypercalciuria secondary to increased serum 1,25-dihydroxyvitamin D [1,25(OH)2D] levels. HHRH is caused by mutations in the SLC34A3 gene, which encodes sodium-phosphate co-transporter type IIc. A 6-1/2-year-old female presented with a history of nephrolithiasis. Her metabolic evaluation revealed increased 24-hour urine calcium excretion with high serum calcium, low intact parathyroid hormone (PTH), and elevated 1,25(OH)2D. In addition, the patient had low to low-normal serum phosphorus with high urine phosphorus. The patient had normal stature; without rachitic or boney deformities or a history of fractures. Genetic analysis of SLC34A3 revealed the patient to be a compound heterozygote for a novel single base pair deletion in exon 12 (c.1304delG) and 30-base pair deletion in intron 6 (g.1440-1469del). The single-base pair mutation causes a frameshift, which results in premature stop codon. The intronic deletion is likely caused by misalignment of the 4-basepair homologous repeats and results in the truncation of an already small intron to 63bp, which would impair proper RNA splicing of the intron. This is the fourth unique intronic deletion identified in patients with HHRH, suggesting the frequent occurrence of sequence misalignments in SLC34A3 and the importance of screening introns in patients with HHRH. © 2013.

  8. A large deletion of the AVPR2 gene causing severe nephrogenic diabetes insipidus in a Turkish family.

    PubMed

    Saglar, Emel; Deniz, Ferhat; Erdem, Beril; Karaduman, Tugce; Yönem, Arif; Cagiltay, Eylem; Mergen, Hatice

    2014-05-01

    X-linked nephrogenic diabetes insipidus (NDI) is a rare hereditary disease caused by mutations in arginine vasopressin type 2 receptor (AVPR2) and characterized by the production of large amounts of urine and an inability to concentrate urine in response to the antidiuretic hormone vasopressin. We have identified a novel 388 bp deletion starting in intron 1 and ending in exon 2 in the AVPR2 gene in a patient with NDI and in his family. We have revealed that this mutation is a de novo mutation for the mother of the proband patient. Prospective clinical data were collected for all family members. The water deprivation test confirmed the diagnosis of diabetes insipidus. The patient has severe symptoms like deep polyuria nocturia, polydipsia, and fatigue. He was given arginine vasopressin treatment while he was a child. However, he could not get well due to his nephrogenic type of illness. Both of his nephews have the same complains in addition to failure to grow. We have sequenced all exons and intron-exon boundaries of the AVPR2 gene of all family members. The analyses of bioinformatics and comparative genomics of the deletion were done via considering the DNA level damage. AVPR2 gene mutation results in the absence of the three transmembrane domains, two extracellular domains, and one cytoplasmic domain. Three-dimensional protein structure prediction was shown. We concluded that X-linked NDI and severity of illness in this family is caused by a novel 388 bp deletion in the AVPR2 gene that is predicted to truncate the receptor protein, and also this deletion may lead to dysfunctioning in protein activity and inefficient or inadequate binding abilities.

  9. Analysis of aberrant pre-messenger RNA splicing resulting from mutations in ATP8B1 and efficient in vitro rescue by adapted U1 small nuclear RNA.

    PubMed

    van der Woerd, Wendy L; Mulder, Johanna; Pagani, Franco; Beuers, Ulrich; Houwen, Roderick H J; van de Graaf, Stan F J

    2015-04-01

    ATP8B1 deficiency is a severe autosomal recessive liver disease resulting from mutations in the ATP8B1 gene characterized by a continuous phenotypical spectrum from intermittent (benign recurrent intrahepatic cholestasis; BRIC) to progressive familial intrahepatic cholestasis (PFIC). Current therapeutic options are insufficient, and elucidating the molecular consequences of mutations could lead to personalized mutation-specific therapies. We investigated the effect on pre-messenger RNA splicing of 14 ATP8B1 mutations at exon-intron boundaries using an in vitro minigene system. Eleven mutations, mostly associated with a PFIC phenotype, resulted in aberrant splicing and a complete absence of correctly spliced product. In contrast, three mutations led to partially correct splicing and were associated with a BRIC phenotype. These findings indicate an inverse correlation between the level of correctly spliced product and disease severity. Expression of modified U1 small nuclear RNAs (snRNA) complementary to the splice donor sites strongly improved or completely rescued splicing for several ATP8B1 mutations located at donor, as well as acceptor, splice sites. In one case, we also evaluated exon-specific U1 snRNAs that, by targeting nonconserved intronic sequences, might reduce possible off-target events. Although very effective in correcting exon skipping, they also induced retention of the short downstream intron. We systematically characterized the molecular consequences of 14 ATP8B1 mutations at exon-intron boundaries associated with ATP8B1 deficiency and found that the majority resulted in total exon skipping. The amount of correctly spliced product inversely correlated with disease severity. Compensatory modified U1 snRNAs, complementary to mutated donor splice sites, were able to improve exon definition very efficiently and could be a novel therapeutic strategy in ATP8B1 deficiency as well as other genetic diseases. © 2014 by the American Association for the Study of Liver Diseases.

  10. RNA splicing. The human splicing code reveals new insights into the genetic determinants of disease.

    PubMed

    Xiong, Hui Y; Alipanahi, Babak; Lee, Leo J; Bretschneider, Hannes; Merico, Daniele; Yuen, Ryan K C; Hua, Yimin; Gueroussov, Serge; Najafabadi, Hamed S; Hughes, Timothy R; Morris, Quaid; Barash, Yoseph; Krainer, Adrian R; Jojic, Nebojsa; Scherer, Stephen W; Blencowe, Benjamin J; Frey, Brendan J

    2015-01-09

    To facilitate precision medicine and whole-genome annotation, we developed a machine-learning technique that scores how strongly genetic variants affect RNA splicing, whose alteration contributes to many diseases. Analysis of more than 650,000 intronic and exonic variants revealed widespread patterns of mutation-driven aberrant splicing. Intronic disease mutations that are more than 30 nucleotides from any splice site alter splicing nine times as often as common variants, and missense exonic disease mutations that have the least impact on protein function are five times as likely as others to alter splicing. We detected tens of thousands of disease-causing mutations, including those involved in cancers and spinal muscular atrophy. Examination of intronic and exonic variants found using whole-genome sequencing of individuals with autism revealed misspliced genes with neurodevelopmental phenotypes. Our approach provides evidence for causal variants and should enable new discoveries in precision medicine. Copyright © 2015, American Association for the Advancement of Science.

  11. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene.

    PubMed

    Gonçalves, Ana; Oliveira, Jorge; Coelho, Teresa; Taipa, Ricardo; Melo-Pires, Manuel; Sousa, Mário; Santos, Rosário

    2017-10-03

    A broad mutational spectrum in the dystrophin ( DMD ) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD , adding to the diversity of mutational events that give rise to D/BMD.

  12. New Splice Site Acceptor Mutation in AIRE Gene in Autoimmune Polyendocrine Syndrome Type 1

    PubMed Central

    Mora, Mireia; Hanzu, Felicia A.; Pradas-Juni, Marta; Aranda, Gloria B.; Halperin, Irene; Puig-Domingo, Manuel; Aguiló, Sira; Fernández-Rebollo, Eduardo

    2014-01-01

    Autoimmune polyglandular syndrome type 1 (APS-1, OMIM 240300) is a rare autosomal recessive disorder, characterized by the presence of at least two of three major diseases: hypoparathyroidism, Addison’s disease, and chronic mucocutaneous candidiasis. We aim to identify the molecular defects and investigate the clinical and mutational characteristics in an index case and other members of a consanguineous family. We identified a novel homozygous mutation in the splice site acceptor (SSA) of intron 5 (c.653-1G>A) in two siblings with different clinical outcomes of APS-1. Coding DNA sequencing revealed that this AIRE mutation potentially compromised the recognition of the constitutive SSA of intron 5, splicing upstream onto a nearby cryptic SSA in intron 5. Surprisingly, the use of an alternative SSA entails the uncovering of a cryptic donor splice site in exon 5. This new transcript generates a truncated protein (p.A214fs67X) containing the first 213 amino acids and followed by 68 aberrant amino acids. The mutation affects the proper splicing, not only at the acceptor but also at the donor splice site, highlighting the complexity of recognizing suitable splicing sites and the importance of sequencing the intron-exon junctions for a more precise molecular diagnosis and correct genetic counseling. As both siblings were carrying the same mutation but exhibited a different APS-1 onset, and one of the brothers was not clinically diagnosed, our finding highlights the possibility to suspect mutations in the AIRE gene in cases of childhood chronic candidiasis and/or hypoparathyroidism otherwise unexplained, especially when the phenotype is associated with other autoimmune diseases. PMID:24988226

  13. Screening for microsatellite instability target genes in colorectal cancers

    PubMed Central

    Vilkki, S; Launonen, V; Karhu, A; Sistonen, P; Vastrik, I; Aaltonen, L

    2002-01-01

    Background: Defects in the DNA repair system lead to genetic instability because replication errors are not corrected. This type of genetic instability is a key event in the malignant progression of HNPCC and a subset of sporadic colon cancers and mutation rates are particularly high at short repetitive sequences. Somatic deletions of coding mononucleotide repeats have been detected, for example, in the TGFßRII and BAX genes, and recently many novel target genes for microsatellite instability (MSI) have been proposed. Novel target genes are likely to be discovered in the future. More data should be created on background mutation rates in MSI tumours to evaluate mutation rates observed in the candidate target genes. Methods: Mutation rates in 14 neutral intronic repeats were evaluated in MSI tumours. Bioinformatic searches combined with keywords related to cancer and tumour suppressor or CRC related gene homology were used to find new candidate MSI target genes. By comparison of mutation frequencies observed in intronic mononucleotide repeats versus exonic coding repeats of potential MSI target genes, the significance of the exonic mutations was estimated. Results: As expected, the length of an intronic mononucleotide repeat correlated positively with the number of slippages for both G/C and A/T repeats (p=0.0020 and p=0.0012, respectively). BRCA1, CtBP1, and Rb1 associated CtIP and other candidates were found in a bioinformatic search combined with keywords related to cancer. Sequencing showed a significantly increased mutation rate in the exonic A9 repeat of CtIP (25/109=22.9%) as compared with similar intronic repeats (p≤0.001). Conclusions: We propose a new candidate MSI target gene CtIP to be evaluated in further studies. PMID:12414815

  14. [The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].

    PubMed

    Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M

    2001-08-01

    To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.

  15. Novel p53 tumour suppressor mutations in cases of spindle cell sarcoma, pleomorphic sarcoma and fibrosarcoma in cats.

    PubMed

    Mayr, B; Reifinger, M; Alton, K; Schaffner, G

    1998-06-01

    Twenty feline neoplasms were sequenced in the region from exons 5 to 8 for the presence of tumour suppressor gene p53 mutations. In a spindle cell sarcoma of the bladder, a missense mutation (codon 164 AAG-->GAG, lysine-->glutamic acid) in exon 5 was detected. In a pleomorphic sarcoma, a 23 bp deletion involving the splicing junction between intron 5 and exon 6 was observed. In a fibrosarcoma, a 6 bp deletion of p53 covering 2 bp of exon 7 and 4 bp of intron 7, including the splicing junction, was found. The study demonstrates three new p53 mutations in different types of sarcomas in cats.

  16. In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

    PubMed Central

    Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

    2011-01-01

    The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

  17. Permanent Neonatal Diabetes Caused by Creation of an Ectopic Splice Site within the INS Gene

    PubMed Central

    Gastaldo, Elena; Harries, Lorna W.; Rubio-Cabezas, Oscar; Castaño, Luis

    2012-01-01

    Background The aim of this study was to characterize the genetic etiology in a patient who presented with permanent neonatal diabetes at 2 months of age. Methodology/Principal Findings Regulatory elements and coding exons 2 and 3 of the INS gene were amplified and sequenced from genomic and complementary DNA samples. A novel heterozygous INS mutation within the terminal intron of the gene was identified in the proband and her affected father. This mutation introduces an ectopic splice site leading to the insertion of 29 nucleotides from the intronic sequence into the mature mRNA, which results in a longer and abnormal transcript. Conclusions/Significance This study highlights the importance of routinely sequencing the exon-intron boundaries and the need to carry out additional studies to confirm the pathogenicity of any identified intronic genetic variants. PMID:22235272

  18. Novel splice site mutation in the growth hormone receptor gene in Turkish patients with Laron-type dwarfism.

    PubMed

    Arman, Ahmet; Ozon, Alev; Isguven, Pinar S; Coker, Ajda; Peker, Ismail; Yordam, Nursen

    2008-01-01

    Growth hormone (GH) is involved in growth, and fat and carbohydrate metabolism. Interaction of GH with the GH receptor (GHR) is necessary for systemic and local production of insulin-like growth factor-I (IGF-I) which mediates GH actions. Mutations in the GHR cause severe postnatal growth failure; the disorder is an autosomal recessive genetic disease resulting in GH insensitivity, called Laron syndrome. It is characterized by dwarfism with elevated serum GH and low levels of IGF-I. We analyzed the GHR gene for mutations and polymorphisms in eight patients with Laron-type dwarfism from six families. We found three missense mutations (S40L, V125A, I526L), one nonsense mutation (W157X), and one splice site mutation in the extracellular domain of GHR. Furthermore, G168G and exon 3 deletion polymorphisms were detected in patients with Laron syndrome. The splice site mutation, which is a novel mutation, was located at the donor splice site of exon 2/ intron 2 within GHR. Although this mutation changed the highly conserved donor splice site consensus sequence GT to GGT by insertion of a G residue, the intron splicing between exon 2 and exon 3 was detected in the patient. These results imply that the splicing occurs arthe GT site in intron 2, leaving the extra inserted G residue at the end of exon 2, thus changing the open reading frame of GHR resulting in a premature termination codon in exon 3.

  19. The mitochondrial genome of fission yeast: inability of all introns to splice autocatalytically, and construction and characterization of an intronless genome.

    PubMed

    Schäfer, B; Merlos-Lange, A M; Anderl, C; Welser, F; Zimmer, M; Wolf, K

    1991-01-01

    In this paper we report the inability of four group I introns in the gene encoding subunit I of cytochrome c oxidase (cox1) and the group II intron in the apocytochrome b gene (cob) to splice autocatalytically. Furthermore we present the characterization of the first cox1 intron in the mutator strain anar-14 and the construction and characterization of strains with intronless mitochondrial genomes. We provide evidence that removal of introns at the DNA level (termed DNA splicing) is dependent on an active RNA maturase. Finally we demonstrate that the absence of introns does not abolish homologous mitochondrial recombination.

  20. Rare Autosomal Recessive Cardiac Valvular Form of Ehlers-Danlos Syndrome Results from Mutations in the COL1A2 Gene That Activate the Nonsense-Mediated RNA Decay Pathway

    PubMed Central

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A.; Shinkai, Hiroshi; Hoyme, H. Eugene; Pyeritz, Reed E.; Byers, Peter H.

    2004-01-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of proα2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement. PMID:15077201

  1. Rare autosomal recessive cardiac valvular form of Ehlers-Danlos syndrome results from mutations in the COL1A2 gene that activate the nonsense-mediated RNA decay pathway.

    PubMed

    Schwarze, Ulrike; Hata, Ryu-Ichiro; McKusick, Victor A; Shinkai, Hiroshi; Hoyme, H Eugene; Pyeritz, Reed E; Byers, Peter H

    2004-05-01

    Splice site mutations in the COL1A2 gene of type I collagen can give rise to forms of Ehlers-Danlos syndrome (EDS) because of partial or complete skipping of exon 6, as well as to mild, moderate, or lethal forms of osteogenesis imperfecta as a consequence of skipping of other exons. We identified three unrelated individuals with a rare recessively inherited form of EDS (characterized by joint hypermobility, skin hyperextensibility, and cardiac valvular defects); in two of them, COL1A2 messenger RNA (mRNA) instability results from compound heterozygosity for splice site mutations in the COL1A2 gene, and, in the third, it results from homozygosity for a nonsense codon. The splice site mutations led to use of cryptic splice donor sites, creation of a downstream premature termination codon, and extremely unstable mRNA. In the wild-type allele, the two introns (IVS11 and IVS24) in which these mutations occurred were usually spliced slowly in relation to their respective immediate upstream introns. In the mutant alleles, the upstream intron was removed, so that exon skipping could not occur. In the context of the mutation in IVS24, computer-generated folding of a short stretch of mRNA surrounding the mutation site demonstrated realignment of the relationships between the donor and acceptor sites that could facilitate use of a cryptic donor site. These findings suggest that the order of intron removal is an important variable in prediction of mutation outcome at splice sites and that folding of the nascent mRNA could be one element that contributes to determination of order of splicing. The complete absence of pro alpha 2(I) chains has the surprising effect of producing cardiac valvular disease without bone involvement.

  2. Nuclear sequestration of COL1A1 mRNA transcript associated with type I osteogenesis imperfecta (OI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Primorac, D.; Stover, M.L.; McKinstry, M.B.

    Previously we identified an OI type I patient with a splice donor mutation that resulted in intron 26 retention instead of exon skipping and sequestration of normal levels of the mutant transcript in the nuclear compartment. Intron retention was consistent with the exon definition hypothesis for splice site selection since the size of the exon-intron-exon unit was less than 300 bp. Furthermore, the retained intron contained in-frame stop codons which is thought to cause the mutant RNA to remain within the nucleus rather than appearing in the cytoplasm. To test these hypotheses, genomic fragments containing the normal sequence or themore » donor mutation were cloned into a collagen minigene and expressed in stably tansfected NIH 3T3 cells. None of the modifications to the normal intron altered the level of RNA that accumulated in the cytoplasm, as expected. However none of the modifications to the mutant intron allowed accumulation of normal levels of mRNA in the cytoplasm. Moreover, in contrast to our findings in the patient`s cells only low levels of mutant transcript were found in the nucleus; a fraction of the transcript did appear in the cytoplasm which had spliced the mutant donor site correctly. Nuclear run-on experiments demonstrated equal levels of transcription from each transgene. Expression of another donor mutation known to cause in-frame exon skipping in OI type IV was accurately reproduced in the minigene in transfected 3T3 cells. Our experience suggests that either mechanism can lead to formation of a null allele possibly related to the type of splicing events surrounding the potential stop codons. Understanding the rules governing inactivation of a collagen RNA transcript may be important in designing a strategy to inactivate a dominate negative mutation associated with the more severe forms of OI.« less

  3. Exonization of an Intronic LINE-1 Element Causing Becker Muscular Dystrophy as a Novel Mutational Mechanism in Dystrophin Gene

    PubMed Central

    Gonçalves, Ana; Coelho, Teresa; Melo-Pires, Manuel; Sousa, Mário

    2017-01-01

    A broad mutational spectrum in the dystrophin (DMD) gene, from large deletions/duplications to point mutations, causes Duchenne/Becker muscular dystrophy (D/BMD). Comprehensive genotyping is particularly relevant considering the mutation-centered therapies for dystrophinopathies. We report the genetic characterization of a patient with disease onset at age 13 years, elevated creatine kinase levels and reduced dystrophin labeling, where multiplex-ligation probe amplification (MLPA) and genomic sequencing failed to detect pathogenic variants. Bioinformatic, transcriptomic (real time PCR, RT-PCR), and genomic approaches (Southern blot, long-range PCR, and single molecule real-time sequencing) were used to characterize the mutation. An aberrant transcript was identified, containing a 103-nucleotide insertion between exons 51 and 52, with no similarity with the DMD gene. This corresponded to the partial exonization of a long interspersed nuclear element (LINE-1), disrupting the open reading frame. Further characterization identified a complete LINE-1 (~6 kb with typical hallmarks) deeply inserted in intron 51. Haplotyping and segregation analysis demonstrated that the mutation had a de novo origin. Besides underscoring the importance of mRNA studies in genetically unsolved cases, this is the first report of a disease-causing fully intronic LINE-1 element in DMD, adding to the diversity of mutational events that give rise to D/BMD. PMID:28972564

  4. A mutation in yeast mitochondrial DNA results in a precise excision of the terminal intron of the cytochrome b gene.

    PubMed

    Hill, J; McGraw, P; Tzagoloff, A

    1985-03-25

    The yeast nuclear gene CBP2 was previously proposed to code for a protein necessary for processing of the terminal intron in the cytochrome b pre-mRNA (McGraw, P., and Tzagoloff, A. (1983) J. Biol. Chem. 258, 9459-9468). In the present study we describe a mitochondrial mutation capable of suppressing the respiratory deficiency of cbp2 mutants. The mitochondrial suppressor mutation has been shown to be the result of a precise excision of the last intervening sequence from the cytochrome b gene. Strains with the altered mitochondrial DNA have normal levels of mature cytochrome b mRNA and of cytochrome b and exhibit wild type growth on glycerol. These results confirm that CBP2 codes for a protein specifically required for splicing of the cytochrome b intron and further suggest that absence of the intervening sequence does not noticeably affect the expression of respiratory function in mitochondria.

  5. Evolution of RNA-Protein Interactions: Non-Specific Binding Led to RNA Splicing Activity of Fungal Mitochondrial Tyrosyl-tRNA Synthetases

    PubMed Central

    Lamech, Lilian T.; Mallam, Anna L.; Lambowitz, Alan M.

    2014-01-01

    The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was “fixed” by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins. PMID:25536042

  6. Evolution of RNA-protein interactions: non-specific binding led to RNA splicing activity of fungal mitochondrial tyrosyl-tRNA synthetases.

    PubMed

    Lamech, Lilian T; Mallam, Anna L; Lambowitz, Alan M

    2014-12-01

    The Neurospora crassa mitochondrial tyrosyl-tRNA synthetase (mtTyrRS; CYT-18 protein) evolved a new function as a group I intron splicing factor by acquiring the ability to bind group I intron RNAs and stabilize their catalytically active RNA structure. Previous studies showed: (i) CYT-18 binds group I introns by using both its N-terminal catalytic domain and flexibly attached C-terminal anticodon-binding domain (CTD); and (ii) the catalytic domain binds group I introns specifically via multiple structural adaptations that occurred during or after the divergence of Peziomycotina and Saccharomycotina. However, the function of the CTD and how it contributed to the evolution of splicing activity have been unclear. Here, small angle X-ray scattering analysis of CYT-18 shows that both CTDs of the homodimeric protein extend outward from the catalytic domain, but move inward to bind opposite ends of a group I intron RNA. Biochemical assays show that the isolated CTD of CYT-18 binds RNAs non-specifically, possibly contributing to its interaction with the structurally different ends of the intron RNA. Finally, we find that the yeast mtTyrRS, which diverged from Pezizomycotina fungal mtTyrRSs prior to the evolution of splicing activity, binds group I intron and other RNAs non-specifically via its CTD, but lacks further adaptations needed for group I intron splicing. Our results suggest a scenario of constructive neutral (i.e., pre-adaptive) evolution in which an initial non-specific interaction between the CTD of an ancestral fungal mtTyrRS and a self-splicing group I intron was "fixed" by an intron RNA mutation that resulted in protein-dependent splicing. Once fixed, this interaction could be elaborated by further adaptive mutations in both the catalytic domain and CTD that enabled specific binding of group I introns. Our results highlight a role for non-specific RNA binding in the evolution of RNA-binding proteins.

  7. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    PubMed

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  8. Four novel cystic fibrosis mutations in splice junction sequences affecting the CFTR nucleotide binding folds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Doerk, T.; Wulbrand, U.; Tuemmler, B.

    1993-03-01

    Single cases of the four novel splice site mutations 1525[minus]1 G [r arrow] A (intron 9), 3601[minus]2 A [r arrow] G (intron 18), 3850[minus]3 T [r arrow] G (intron 19), and 4374+1 G [r arrow] T (intron 23) were detected in the CFTR gene of cystic fibrosis patients of Indo-Iranian, Turkish, Polish, and Germany descent. The nucleotide substitutions at the +1, [minus]1, and [minus]2 positions all destroy splice sites and lead to severe disease alleles associated with features typical of gastrointestinal and pulmonary cystic fibrosis disease. The 3850[minus]3 T-to-G change was discovered in a very mildly affected 33-year-old [Delta]F508 compoundmore » heterozygote, suggesting that the T-to-G transversion at the less conserved [minus]3 position of the acceptor splice site may retain some wildtype function. 13 refs., 1 fig., 2 tabs.« less

  9. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene

    PubMed Central

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B. P.

    2016-01-01

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients. PMID:26771602

  10. Altered Pre-mRNA Splicing Caused by a Novel Intronic Mutation c.1443+5G>A in the Dihydropyrimidinase (DPYS) Gene.

    PubMed

    Nakajima, Yoko; Meijer, Judith; Zhang, Chunhua; Wang, Xu; Kondo, Tomomi; Ito, Tetsuya; Dobritzsch, Doreen; Van Kuilenburg, André B P

    2016-01-12

    Dihydropyrimidinase (DHP) deficiency is an autosomal recessive disease caused by mutations in the DPYS gene. Patients present with highly elevated levels of dihydrouracil and dihydrothymine in their urine, blood and cerebrospinal fluid. The analysis of the effect of mutations in DPYS on pre-mRNA splicing is hampered by the fact that DHP is primarily expressed in liver and kidney cells. The minigene approach can detect mRNA splicing aberrations using cells that do not express the endogenous mRNA. We have used a minigene-based approach to analyze the effects of a presumptive pre-mRNA splicing mutation in two newly identified Chinese pediatric patients with DHP deficiency. Mutation analysis of DPYS showed that both patients were compound heterozygous for a novel intronic mutation c.1443+5G>A in intron 8 and a previously described missense mutation c.1001A>G (p.Q334R) in exon 6. Wild-type and the mutated minigene constructs, containing exons 7, 8 and 9 of DPYS, yielded different splicing products after expression in HEK293 cells. The c.1443+5G>A mutation resulted in altered pre-mRNA splicing of the DPYS minigene construct with full skipping of exon 8. Analysis of the DHP crystal structure showed that the deletion of exon 8 severely affects folding, stability and homooligomerization of the enzyme as well as disruption of the catalytic site. Thus, the analysis suggests that the c.1443+5G>A mutation results in aberrant splicing of the pre-mRNA encoding DHP, underlying the DHP deficiency in two unrelated Chinese patients.

  11. Molecular analysis of the PAX6 gene in Mexican patients with congenital aniridia: report of four novel mutations

    PubMed Central

    Villarroel, Camilo E.; Villanueva-Mendoza, Cristina; Orozco, Lorena; Alcántara-Ortigoza, Miguel Angel; Jiménez, Diana F.; Ordaz, Juan C.

    2008-01-01

    Purpose Paired box gene 6 (PAX6) heterozygous mutations are well known to cause congenital non-syndromic aniridia. These mutations produce primarily protein truncations and have been identified in approximately 40%–80% of all aniridia cases worldwide. In Mexico, there is only one previous report describing three intragenic deletions in five cases. In this study, we further analyze PAX6 variants in a group of Mexican aniridia patients and describe associated ocular findings. Methods We evaluated 30 nonrelated probands from two referral hospitals. Mutations were detected by single-strand conformation polymorphism (SSCP) and direct sequencing, and novel missense mutations and intronic changes were analyzed by in silico analysis. One intronic variation (IVS2+9G>A), which in silico analysis suggested had no pathological effects, was searched in 103 unaffected controls. Results Almost all cases exhibited phenotypes that were at the severe end of the aniridia spectrum with associated ocular alterations such as nystagmus, macular hypoplasia, and congenital cataracts. The mutation detection rate was 30%. Eight different mutations were identified: four (c.184_188dupGAGAC, c.361T>C, c.879dupC, and c.277G>A) were novel, and four (c.969C>T, IVS6+1G>C, c.853delC, and IVS7–2A>G) have been previously reported. The substitution at position 969 was observed in two patients. None of the intragenic deletions previously reported in Mexican patients were found. Most of the mutations detected predict either truncation of the PAX6 protein or conservative amino acid changes in the paired domain. We also detected two intronic non-pathogenic variations, IVS9–12C>T and IVS2+9G>A, that had been previously reported. Because the latter variation was considered potentially pathogenic, it was analyzed in 103 healthy Mexican newborns where we found an allelic frequency of 0.1116 for the A allele. Conclusions This study adds four novel mutations to the worldwide PAX6 mutational spectrum, and reaffirms the finding that c.969C>T is one of the three more frequent causal mutations in aniridia cases. It also provides evidence that IVS2+9G>A is an intronic change without pathogenic effect. PMID:18776953

  12. Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

    PubMed

    Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

    2015-12-15

    We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. Congenital amegakaryocytic thrombocytopenia in three siblings: molecular analysis of atypical clinical presentation.

    PubMed

    Gandhi, Manish J; Pendergrass, Thomas W; Cummings, Carrie C; Ihara, Kenji; Blau, C Anthony; Drachman, Jonathan G

    2005-10-01

    An 11-year-old girl, presenting with fatigue and bruising, was found to be profoundly pancytopenic. Bone marrow exam and clinical evaluation were consistent with aplastic anemia. Family members were studied as potential stem cell donors, revealing that both younger siblings displayed significant thrombocytopenia, whereas both parents had normal blood counts. We evaluated this pedigree to understand the unusually late presentation of congenital amegakaryocytic thrombocytopenia (CAMT). The coding region and the intron/exon junctions of MPL were sequenced from each family member. Vectors representing each of the mutations were constructed and tested for the ability to support growth of Baf3/Mpl(mutant) cells. All three siblings had elevated thrombopoietin levels. Analysis of genomic DNA demonstrated that each parent had mutations/polymorphisms in a single MPL allele and that each child was a compound heterozygote, having inherited both abnormal alleles. The maternal allele encoded a mutation of the donor splice-junction at the exon-3/intron-3 boundary. A mini-gene construct encoding normal vs mutant versions of the intron-3 donor-site demonstrated that physiologic splicing was significantly reduced in the mutant construct. Mutations that incompletely eliminate Mpl expression/function may result in delayed diagnosis of CAMT and confusion with aplastic anemia.

  14. Genetic Analysis of 13 Iranian Families With Leukocyte Adhesion Deficiency Type 1.

    PubMed

    Teimourian, Shahram; De Boer, Martin; Roos, Dirk; Isaian, Anna; Bemanian, Mohammad Hassan; Lashkary, Sharhzad; Nabavi, Mohammad; Arshi, Saba; Nateghian, Alireza; Sayyahfar, Shirin; Sazgara, Faezeh; Taheripak, Gholamreza; Alipour Fayez, Elham

    2018-05-10

    Leukocyte adhesion deficiency type 1 is a rare, autosomal recessive disorder that results from mutations in the ITGB2 gene. This gene encodes the CD18 subunit of β2 integrin leukocyte adhesion cell molecules. Leukocyte adhesion deficiency type 1 is characterized by recurrent bacterial infections, impaired wound healing, inadequate pus formation, and delayed separation of the umbilical cord. Blood samples were taken from 13 patients after written consent had been obtained. Genomic DNA was extracted, and ITGB2 exons and exon-intron boundaries were amplified by polymerase chain reaction. The products were examined by Sanger sequencing. In this study, 8 different previously reported mutations (intron7+1G>A, c.715G>A, c.1777 C>T, c.843del C, c.1768T>C, c.1821C>A, Intron7+1G>A, c.1885G>A) and 2 novel mutations (c.1821C>A; p.Tyr607Ter and c.1822C>T; p.Gln608Ter) were found. c.1821C>A (p.Tyr607Ter) and c.1822C>T (p.Gln608Ter) mutations should be included in the panel of carrier detection and prenatal diagnosis.

  15. Neuronal ceroid lipofuscinosis type CLN2: A new rationale for the construction of phenotypic subgroups based on a survey of 25 cases in South America

    PubMed Central

    Kohan, Romina; Noelia Carabelos, María; Xin, Winnie; Sims, Katherine; Guelbert, Norberto; Adriana Cismondi, Inés; Pons, Patricia; Alonso, Graciela Irene; Troncoso, Mónica; Witting, Scarlet; Pearce, David A.; de Kremer, Raquel Dodelson; Oller-Ramírez, Ana María; de Halac, Inés Noher

    2013-01-01

    Tripeptidyl-peptidase 1 (TPP1) null or residual activity occurs in neuronal ceroid lipofuscinosis (NCL) with underlying TPP1/CLN2 mutations. A survey of 25 South American CLN2 affected individuals enabled the differentiation of two phenotypes: classical late-infantile and variant juvenile, each in approximately 50% of patients, with residual TPP1 activity occurring in approximately 32%. Each individual was assigned to one of three subgroups: (I) n=11, null TPP1 activity in leukocytes; (II) n=8, residual TPP1 activity of 0.60–15.85 nmol/h/mg (nr 110–476); (III) n=6, activity not measured in leukocytes. Curvilinear bodies (CB) appeared in almost all studied CLN2 subjects; the only exceptions occurred in cases of subgroup II: two individuals had combined CBs/fingerprints (FPs), and one case had pure FPs. There were 15 mutations (4 first published in this paper, 3 previously observed in South America by our group, and 8 previously observed by others). In subgroup I, mutations were either missense or nonsense; in subgroups II and III, mutations prevailed at the non-conserved intronic site, c.887-10A>G (intron 7), and to a lesser extent at c.89+5G>C (intron 2), in heterozygous combinations. Grouping phenotypically and genetically known individuals on the basis of TPP1 activity supported the concept that residual enzyme activity underlies a protracted disease course. The prevalence of intronic mutations at nonconserved sites in subgroup II individuals indicates that some alternative splicing might allow some residual TPP1 activity. PMID:23266810

  16. RNA structure in splicing: An evolutionary perspective.

    PubMed

    Lin, Chien-Ling; Taggart, Allison J; Fairbrother, William G

    2016-09-01

    Pre-mRNA splicing is a key post-transcriptional regulation process in which introns are excised and exons are ligated together. A novel class of structured intron was recently discovered in fish. Simple expansions of complementary AC and GT dimers at opposite boundaries of an intron were found to form a bridging structure, thereby enforcing correct splice site pairing across the intron. In some fish introns, the RNA structures are strong enough to bypass the need of regulatory protein factors for splicing. Here, we discuss the prevalence and potential functions of highly structured introns. In humans, structured introns usually arise through the co-occurrence of C and G-rich repeats at intron boundaries. We explore the potentially instructive example of the HLA receptor genes. In HLA pre-mRNA, structured introns flank the exons that encode the highly polymorphic β sheet cleft, making the processing of the transcript robust to variants that disrupt splicing factor binding. While selective forces that have shaped HLA receptor are fairly atypical, numerous other highly polymorphic genes that encode receptors contain structured introns. Finally, we discuss how the elevated mutation rate associated with the simple repeats that often compose structured intron can make structured introns themselves rapidly evolving elements.

  17. Isolated growth hormone deficiency in two siblings because of paternal mosaicism for a mutation in the GH1 gene.

    PubMed

    Tsubahara, Mayuko; Hayashi, Yoshitaka; Niijima, Shin-ichi; Yamamoto, Michiyo; Kamijo, Takashi; Murata, Yoshiharu; Haruna, Hidenori; Okumura, Akihisa; Shimizu, Toshiaki

    2012-03-01

      Mutations in the GH1 gene have been identified in patients with isolated growth hormone deficiency (IGHD). Mutations causing aberrant splicing of exon 3 of GH1 that have been identified in IGHD are inherited in an autosomal dominant manner, whereas other mutations in GH1 that have been identified in IGHD are inherited in an autosomal recessive manner.   Two siblings born from nonconsanguineous healthy parents exhibited IGHD. To elucidate the cause, GH1 in all family members was analysed.   Two novel mutations in GH1, a point mutation in intron 3 and a 16-bp deletion in exon 3, were identified by sequence analyses. The intronic mutation was present in both siblings and was predicted to cause aberrant splicing. The deletion was present in one of the siblings as well as the mother with normal stature and was predicted to cause rapid degradation of mRNA through nonsense-mediated mRNA decay. The point mutation was not identified in the parents' peripheral blood DNA; however, it was detected in the DNA extracted from the father's sperms. As a trace of the mutant allele was detected in the peripheral blood of the father using PCR-RFLP, the mutation is likely to have occurred de novo at an early developmental stage before differentiation of somatic cells and germline cells.   This is the first report of mosaicism for a mutation in GH1 in a family with IGHD. It is clear that the intronic mutation plays a dominant role in the pathogenesis of IGHD in this family, as one of the siblings who had only the point mutation was affected. On the other hand, the other sibling was a compound heterozygote for the point mutation and the 16-bp deletion and it may be arguable whether IGHD in this patient should be regarded as autosomal dominant or recessive. © 2012 Blackwell Publishing Ltd.

  18. Tissue- and case-specific retention of intron 40 in mature dystrophin mRNA.

    PubMed

    Nishida, Atsushi; Minegishi, Maki; Takeuchi, Atsuko; Niba, Emma Tabe Eko; Awano, Hiroyuki; Lee, Tomoko; Iijima, Kazumoto; Takeshima, Yasuhiro; Matsuo, Masafumi

    2015-06-01

    The dystrophin gene, which is mutated in Duchenne muscular dystrophy (DMD), comprises 79 exons that show multiple alternative splicing events. Intron retention, a type of alternative splicing, may control gene expression. We examined intron retention in dystrophin introns by reverse-transcription PCR from skeletal muscle, focusing on the nine shortest (all <1000 bp), because these are more likely to be retained. Only one, intron 40, was retained in mRNA; sequencing revealed insertion of a complete intron 40 (851 nt) between exons 40 and 41. The intron 40 retention product accounted for 1.2% of the total product but had a premature stop codon at the fifth intronic codon. Intron 40 retention was most strongly observed in the kidney (36.6%) and was not obtained from the fetal liver, lung, spleen or placenta. This indicated that intron retention is a tissue-specific event whose level varies among tissues. In two DMD patients, intron 40 retention was observed in one patient but not in the other. Examination of splicing regulatory factors revealed that intron 40 had the highest guanine-cytosine content of all examined introns in a 30-nt segment at its 3' end. Further studies are needed to clarify the biological role of intron 40-retained dystrophin mRNA.

  19. G to A substitution in 5{prime} donor splice site of introns 18 and 48 of COL1A1 gene of type I collagen results in different splicing alternatives in osteogenesis imperfecta type I cell strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Willing, M.; Deschenes, S.

    We have identified a G to A substitution in the 5{prime} donor splice site of intron 18 of one COL1A1 allele in two unrelated families with osteogenesis imperfecta (OI) type I. A third OI type I family has a G to A substitution at the identical position in intron 48 of one COL1A1 allele. Both mutations abolish normal splicing and lead to reduced steady-state levels of mRNA from the mutant COL1A1 allele. The intron 18 mutation leads to both exon 18 skipping in the mRNA and to utilization of a single alternative splice site near the 3{prime} end of exonmore » 18. The latter results in deletion of the last 8 nucleotides of exon 18 from the mRNA, a shift in the translational reading-frame, and the creation of a premature termination codon in exon 19. Of the potential alternative 5{prime} splice sites in exon 18 and intron 18, the one utilized has a surrounding nucleotide sequence which most closely resembles that of the natural splice site. Although a G to A mutation was detected at the identical position in intron 48 of one COL1A1 allele in another OI type I family, nine complex alternative splicing patterns were identified by sequence analysis of cDNA clones derived from fibroblast mRNA from this cell strain. All result in partial or complete skipping of exon 48, with in-frame deletions of portions of exons 47 and/or 49. The different patterns of RNA splicing were not explained by their sequence homology with naturally occuring 5{prime} splice sites, but rather by recombination between highly homologous exon sequences, suggesting that we may not have identified the major splicing alternative(s) in this cell strain. Both G to A mutations result in decreased production of type I collagen, the common biochemical correlate of OI type I.« less

  20. A novel splicing mutation in GALT gene causing Galactosemia in Ecuadorian family.

    PubMed

    De Lucca, M; Barba, C; Casique, L

    2017-07-01

    Classic Galactosemia (OMIM 230400) is an autosomal recessive disorder of galactose metabolism caused by mutations in the galactose-1-phosphate uridyl transferase (GALT) gene. This disease caused by the inability to metabolize galactose is potentially life-threatening but its pathophysiology has not been clearly defined. GALT gene presents high allelic heterogeneity and around 336 variations have been identified. Here, we report the case of a patient with Classic Galactosemia who was detected during a neonatal screening in Ecuador. Molecular study revealed a mutation in GALT gene intron 1, c.82+3A>G in homozygous condition, this mutation has not been previously reported. This gene variation was not found in any of the 119 healthy Ecuadorian individuals used as control. Furthermore, the mutation was the only alteration detected in the propositus's GALT after sequencing all exons and introns of this gene. In silico modeling predicted that the mutation was pathogenic. Copyright © 2017. Published by Elsevier B.V.

  1. Splicing of a group II intron involved in the conjugative transfer of pRS01 in lactococci.

    PubMed

    Mills, D A; McKay, L L; Dunny, G M

    1996-06-01

    Analysis of a region involved in the conjugative transfer of the lactococcal conjugative element pRS01 has revealed a bacteria] group II intron. Splicing of this lactococcal intron (designated Ll.ltrB) in vivo resulted in the ligation of two exon messages (ltrBE1 and ltrBE2) which encoded a putative conjugative relaxase essential for the transfer of pRS01. Like many group II introns, the Ll.ltrB intron possessed an open reading frame (ltrA) with homology to reverse transcriptases. Remarkably, sequence analysis of ltrA suggested a greater similarity to open reading frames encoded by eukaryotic mitochondrial group II introns than to those identified to date from other bacteria. Several insertional mutations within ltrA resulted in plasmids exhibiting a conjugative transfer-deficient phenotype. These results provide the first direct evidence for splicing of a prokaryotic group II intron in vivo and suggest that conjugative transfer is a mechanism for group II intron dissemination in bacteria.

  2. Transposition of an intron in yeast mitochondria requires a protein encoded by that intron.

    PubMed

    Macreadie, I G; Scott, R M; Zinn, A R; Butow, R A

    1985-06-01

    The optional 1143 bp intron in the yeast mitochondrial 21S rRNA gene (omega +) is nearly quantitatively inserted in genetic crosses into 21S rRNA alleles that lack it (omega -). The intron contains an open reading frame that can encode a protein of 235 amino acids, but no function has been ascribed to this sequence. We previously found an in vivo double-strand break in omega - DNA at or close to the intron insertion site only in zygotes of omega + X omega - crosses that appears with the same kinetics as intron insertion. We now show that mutations in the intron open reading frame that would alter the translation product simultaneously inhibit nonreciprocal omega recombination and the in vivo double-strand break in omega - DNA. These results provide evidence that the open reading frame encodes a protein required for intron transposition and support the role of the double-strand break in the process.

  3. An Intron 9 CYP19 Gene Variant (IVS9+5G>A), Present in an Aromatase-Deficient Girl, Affects Normal Splicing and Is Also Present in Normal Human Steroidogenic Tissues.

    PubMed

    Saraco, Nora; Nesi-Franca, Suzana; Sainz, Romina; Marino, Roxana; Marques-Pereira, Rosana; La Pastina, Julia; Perez Garrido, Natalia; Sandrini, Romolo; Rivarola, Marco Aurelio; de Lacerda, Luiz; Belgorosky, Alicia

    2015-01-01

    Splicing CYP19 gene variants causing aromatase deficiency in 46,XX disorder of sexual development (DSD) patients have been reported in a few cases. A misbalance between normal and aberrant splicing variants was proposed to explain spontaneous pubertal breast development but an incomplete sex maturation progress. The aim of this study was to functionally characterize a novel CYP19A1 intronic homozygote mutation (IVS9+5G>A) in a 46,XX DSD girl presenting spontaneous breast development and primary amenorrhea, and to evaluate similar splicing variant expression in normal steroidogenic tissues. Genomic DNA analysis, splicing prediction programs, splicing assays, and in vitro protein expression and enzyme activity analyses were carried out. CYP19A1 mRNA expression in human steroidogenic tissues was also studied. A novel IVS9+5G>A homozygote mutation was found. In silico analysis predicts the disappearance of the splicing donor site in intron 9, confirmed by patient peripheral leukocyte cP450arom and in vitro studies. Protein analysis showed a shorter and inactive protein. The intron 9 transcript variant was also found in human steroidogenic tissues. The mutation IVS9+5G>A generates a splicing variant that includes intron 9 which is also present in normal human steroidogenic tissues, suggesting that a misbalance between normal and aberrant splicing variants might occur in target tissues, explaining the clinical phenotype in the affected patient. © 2015 S. Karger AG, Basel.

  4. Intron self-complementarity enforces exon inclusion in a yeast pre-mRNA

    PubMed Central

    Howe, Kenneth James; Ares, Manuel

    1997-01-01

    Skipping of internal exons during removal of introns from pre-mRNA must be avoided for proper expression of most eukaryotic genes. Despite significant understanding of the mechanics of intron removal, mechanisms that ensure inclusion of internal exons in multi-intron pre-mRNAs remain mysterious. Using a natural two-intron yeast gene, we have identified distinct RNA–RNA complementarities within each intron that prevent exon skipping and ensure inclusion of internal exons. We show that these complementarities are positioned to act as intron identity elements, bringing together only the appropriate 5′ splice sites and branchpoints. Destroying either intron self-complementarity allows exon skipping to occur, and restoring the complementarity using compensatory mutations rescues exon inclusion, indicating that the elements act through formation of RNA secondary structure. Introducing new pairing potential between regions near the 5′ splice site of intron 1 and the branchpoint of intron 2 dramatically enhances exon skipping. Similar elements identified in single intron yeast genes contribute to splicing efficiency. Our results illustrate how intron secondary structure serves to coordinate splice site pairing and enforce exon inclusion. We suggest that similar elements in vertebrate genes could assist in the splicing of very large introns and in the evolution of alternative splicing. PMID:9356473

  5. Detection of 98. 5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cuppens, H.; Marynen, P.; Cassiman, J.J.

    1993-12-01

    The authors have previously shown that about 85% of the mutations in 194 Belgian cystic fibrosis alleles could be detected by a reverse dot-blot assay. In the present study, 50 Belgian chromosomes were analyzed for mutations in the cystic fibrosis transmembrane conductance regulator gene by means of direct solid phase automatic sequencing of PCR products of individual exons. Twenty-six disease mutations and 14 polymorphisms were found. Twelve of these mutations and 3 polymorphisms were not described before. With the exception of one mutant allele carrying two mutations, these mutations were the only mutations found in the complete coding region andmore » their exon/intron boundaries. The total sensitivity of mutant CF alleles that could be identified was 98.5%. Given the heterogeneity of these mutations, most of them very rare, CFTR mutation screening still remains rather complex in the population, and population screening, whether desirable or not, does not appear to be technically feasible with the methods currently available. 24 refs., 1 fig., 2 tabs.« less

  6. Two novel mutations in the homogentisate-1,2-dioxygenase gene identified in Chinese Han Child with Alkaptonuria.

    PubMed

    Li, Hongying; Zhang, Kaihui; Xu, Qun; Ma, Lixia; Lv, Xin; Sun, Ruopeng

    2015-03-01

    Alkaptonuria (AKU) is an autosomal recessive disorder of tyrosine metabolism, which is caused by a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) with subsequent accumulation of homogentisic acid. Presently, more than 100 HGD mutations have been identified as the cause of the inborn error of metabolism across different populations worldwide. However, the HGD mutation is very rarely reported in Asia, especially China. In this study, we present mutational analyses of HGD gene in one Chinese Han child with AKU, which had been identified by gas chromatography-mass spectrometry detection of organic acids in urine samples. PCR and DNA sequencing of the entire coding region as well as exon-intron boundaries of HGD have been performed. Two novel mutations were identified in the HGD gene in this AKU case, a frameshift mutation of c.115delG in exon 3 and the splicing mutation of IVS5+3 A>C, a donor splice site of the exon 5 and exon-intron junction. The identification of these mutations in this study further expands the spectrum of known HGD gene mutations and contributes to prenatal molecular diagnosis of AKU.

  7. Deep sequencing with intronic capture enables identification of an APC exon 10 inversion in a patient with polyposis.

    PubMed

    Shirts, Brian H; Salipante, Stephen J; Casadei, Silvia; Ryan, Shawnia; Martin, Judith; Jacobson, Angela; Vlaskin, Tatyana; Koehler, Karen; Livingston, Robert J; King, Mary-Claire; Walsh, Tom; Pritchard, Colin C

    2014-10-01

    Single-exon inversions have rarely been described in clinical syndromes and are challenging to detect using Sanger sequencing. We report the case of a 40-year-old woman with adenomatous colon polyps too numerous to count and who had a complex inversion spanning the entire exon 10 in APC (the gene encoding for adenomatous polyposis coli), causing exon skipping and resulting in a frameshift and premature protein truncation. In this study, we employed complete APC gene sequencing using high-coverage next-generation sequencing by ColoSeq, analysis with BreakDancer and SLOPE software, and confirmatory transcript analysis. ColoSeq identified a complex small genomic rearrangement consisting of an inversion that results in translational skipping of exon 10 in the APC gene. This mutation would not have been detected by traditional sequencing or gene-dosage methods. We report a case of adenomatous polyposis resulting from a complex single-exon inversion. Our report highlights the benefits of large-scale sequencing methods that capture intronic sequences with high enough depth of coverage-as well as the use of informatics tools-to enable detection of small pathogenic structural rearrangements.

  8. The genomic structure: proof of the role of non-coding DNA.

    PubMed

    Bouaynaya, Nidhal; Schonfeld, Dan

    2006-01-01

    We prove that the introns play the role of a decoy in absorbing mutations in the same way hollow uninhabited structures are used by the military to protect important installations. Our approach is based on a probability of error analysis, where errors are mutations which occur in the exon sequences. We derive the optimal exon length distribution, which minimizes the probability of error in the genome. Furthermore, to understand how can Nature generate the optimal distribution, we propose a diffusive random walk model for exon generation throughout evolution. This model results in an alpha stable exon length distribution, which is asymptotically equivalent to the optimal distribution. Experimental results show that both distributions accurately fit the real data. Given that introns also drive biological evolution by increasing the rate of unequal crossover between genes, we conclude that the role of introns is to maintain a genius balance between stability and adaptability in eukaryotic genomes.

  9. Polymorphism of intron-1 in the voltage-gated sodium channel gene of Anopheles gambiae s.s. populations from Cameroon with emphasis on insecticide knockdown resistance mutations.

    PubMed

    Etang, Josiane; Vicente, Jose L; Nwane, Philippe; Chouaibou, Mouhamadou; Morlais, Isabelle; Do Rosario, Virgilio E; Simard, Frederic; Awono-Ambene, Parfait; Toto, Jean Claude; Pinto, Joao

    2009-07-01

    Sequence variation at the intron-1 of the voltage-gated sodium channel gene in Anopheles gambiae M- and S-forms from Cameroon was assessed to explore the number of mutational events originating knockdown resistance (kdr) alleles. Mosquitoes were sampled between December 2005 and June 2006 from three geographical areas: (i) Magba in the western region; (ii) Loum, Tiko, Douala, Kribi, and Campo along the Atlantic coast; and (iii) Bertoua, in the eastern continental plateau. Both 1014S and 1014F kdr alleles were found in the S-form with overall frequencies of 14% and 42% respectively. Only the 1014F allele was found in the M-form at lower frequency (11%). Analysis of a 455 bp region of intron-1 upstream the kdr locus revealed four independent mutation events originating kdr alleles, here named MS1 -1014F, S1-1014S and S2-1014S kdr-intron-1 haplotypes in S-form and MS3-1014F kdr-intron-1 haplotype in the M-form. Furthermore, there was evidence for mutual introgression of kdr 1014F allele between the two molecular forms, MS1 and MS3 being widely shared by them. Although no M/S hybrid was observed in analysed samples, this wide distribution of haplotypes MS1 and MS3 suggests inter-form hybridizing at significant level and emphasizes the rapid diffusion of the kdr alleles in Africa. The mosaic of genetic events found in Cameroon is representative of the situation in the West-Central African region and highlights the importance of evaluating the spatial and temporal evolution of kdr alleles for a better management of insecticide resistance.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    McDowell, G.A.; Blitzer, M.G.; Mules, E.H.

    A study was undertaken to characterize the mutation(s) responsible for Tay-Sachs disease (TSD) in a Cajun population in southwest Louisiana and to identify the origins of these mutations. Eleven of 12 infantile TSD alleles examined in six families had the [beta]-hexosaminidase A (Hex A) [alpha]-subunit exon 11 insertion mutation that is present in approximately 70% of Ashkenazi Jewish TSD heterozygotes. The mutation in the remaining allele was a single-base transition in the donor splice site of the [alpha]-subunit intron 9. To determine the origins of these two mutations in the Cajun population, the TSD carrier status was enzymatically determined formore » 90 members of four of the six families, and extensive pedigrees were constructed for all carriers. A single ancestral couple from France was found to be common to most of the carriers of the exon 11 insertion. Pedigree data suggest that this mutation has been in the Cajun population since its founding over 2 centuries ago and that it may be widely distributed within the population. In contrast, the intron 9 mutation apparently was introduced within the last century and probably is limited to a few Louisiana families. 29 refs., 4 figs.« less

  11. Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases.

    PubMed

    Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

    2013-11-01

    Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC 3 (NM_003786.3:c.1783-1G>A), KLHDC 1 (NM_172193.1:c.568-2A>G), HOOK 1 (NM_015888.4:c.1662-1G>A), SMAD 9 (NM_001127217.2:c.1004-1C>T), and DNAH 9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC 3, HOOK 1. In ABCC 3 and HOOK 1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK 1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4-6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis.

  12. Aurora-A as a Modifier of Breast Cancer Risk in BRCA 1/2 Mutation Carriers

    DTIC Science & Technology

    2007-06-01

    Dieter Schaefer, Institute of Human Genetics, University of Frankfurt, Frankfurt, Germany; Norbert Arnold, University of Schleswig- Holstein , Campus...Intron 2 Opossum Mouse Rat Cow Dog Intron 1 Figure 3 | The FGFR2 locus. a, Map of the whole FGFR2 gene, viewed relative to common SNPs on HapMap

  13. Identification and characterisation of mutations associated with von Willebrand disease in a Turkish patient cohort

    PubMed Central

    Hampshire, Daniel J.; Abuzenadah, Adel M.; Cartwright, Ashley; Al-Shammari, Nawal S.; Coyle, Rachael E.; Eckert, Michaela; Al-Buhairan, Ahlam M.; Messenger, Sarah L.; Budde, Ulrich; Gürsel, Türkiz; Ingerslev, Jørgen; Peake, Ian R.; Goodeve, Anne C.

    2014-01-01

    Summary Several cohort studies have investigated the molecular basis of von Willebrand disease (VWD); however these have mostly focused on European and North American populations. This study aimed to investigate mutation spectrum in 26 index cases (IC) from Turkey diagnosed with all three VWD types, the majority (73%) with parents who were knowingly related. IC were screened for mutations using multiplex ligation-dependent probe amplification and analysis of all von Willebrand factor gene (VWF) exons and exon/intron boundaries. Selected missense mutations were expressed in vitro. Candidate VWF mutations were identified in 25 of 26 IC and included propeptide missense mutations in four IC (two resulting in type 1 and two in recessive 2A), all influencing VWF expression in vitro. Four missense mutations, a nonsense mutation and a small in-frame insertion resulting in type 2A were also identified. Of 15 type 3 VWD IC, 13 were homozygous and two compound heterozygous for 14 candidate mutations predicted to result in lack of expression and two propeptide missense changes. Identification of intronic breakpoints of an exon 17–18 deletion suggested that the mutation resulted from non-homologous end joining. This study provides further insight into the pathogenesis of VWD in a population with a high degree of consanguineous partnerships. PMID:23702511

  14. Screening of Variations in CD22 Gene in Children with B-Precursor Acute Lymphoblastic Leukemia.

    PubMed

    Aslar Oner, Deniz; Akin, Dilara Fatma; Sipahi, Kadir; Mumcuoglu, Mine; Ezer, Ustun; Kürekci, A Emin; Akar, Nejat

    2016-09-01

    CD22 is expressed on the surface of B-cell lineage cells from the early progenitor stage of pro-B cell until terminal differentiation to mature B cells. It plays a role in signal transduction and as a regulator of B-cell receptor signaling in B-cell development. We aimed to screen exons 9-14 of the CD22 gene, which is a mutational hot spot region in B-precursor acute lymphoblastic leukemia (pre-B ALL) patients, to find possible genetic variants that could play role in the pathogenesis of pre-B ALL in Turkish children. This study included 109 Turkish children with pre-B ALL who were diagnosed at Losante Hospital for Children with Leukemia. Genomic DNA was extracted from both peripheral blood and bone marrow leukocytes. Gene amplification was performed with PCR, and all samples were screened for the variants by single strand conformation polymorphism. Samples showing band shifts were sequenced on an automated sequencer. In our patient group a total of 9 variants were identified in the CD22 gene by sequencing: a novel variant in intron 10 (T2199G); a missense variant in exon 12; 5 intronic variants between exon 12 and intron 13; a novel intronic variant (C2424T); and a synonymous in exon 13. Thirteen of 109 children (11.9%) carried the T2199G novel intronic variant located in intron 10, and 17 of 109 children (15.6%) carried the C2424T novel intronic variant. Novel variants in the CD22 gene in children with pre-B ALL in Turkey that are not present, in the Human Gene Mutation Database or NCBI SNP database, were found.

  15. Dysferlin rescue by spliceosome-mediated pre-mRNA trans-splicing targeting introns harbouring weakly defined 3' splice sites.

    PubMed

    Philippi, Susanne; Lorain, Stéphanie; Beley, Cyriaque; Peccate, Cécile; Précigout, Guillaume; Spuler, Simone; Garcia, Luis

    2015-07-15

    The modification of the pre-mRNA cis-splicing process employing a pre-mRNA trans-splicing molecule (PTM) is an attractive strategy for the in situ correction of genes whose careful transcription regulation and full-length expression is determinative for protein function, as it is the case for the dysferlin (DYSF, Dysf) gene. Loss-of-function mutations of DYSF result in different types of muscular dystrophy mainly manifesting as limb girdle muscular dystrophy 2B (LGMD2B) and Miyoshi muscular dystrophy 1 (MMD1). We established a 3' replacement strategy for mutated DYSF pre-mRNAs induced by spliceosome-mediated pre-mRNA trans-splicing (SmaRT) by the use of a PTM. In contrast to previously established SmaRT strategies, we particularly focused on the identification of a suitable pre-mRNA target intron other than the optimization of the PTM design. By targeting DYSF pre-mRNA introns harbouring differentially defined 3' splice sites (3' SS), we found that target introns encoding weakly defined 3' SSs were trans-spliced successfully in vitro in human LGMD2B myoblasts as well as in vivo in skeletal muscle of wild-type and Dysf(-/-) mice. For the first time, we demonstrate rescue of Dysf protein by SmaRT in vivo. Moreover, we identified concordant qualities among the successfully targeted Dysf introns and targeted endogenous introns in previously reported SmaRT approaches that might facilitate a selective choice of target introns in future SmaRT strategies. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  16. Molecular Phylogenetic Analysis of Archaeal Intron-Containing Genes Coding for rRNA Obtained from a Deep-Subsurface Geothermal Water Pool

    PubMed Central

    Takai, Ken; Horikoshi, Koki

    1999-01-01

    Molecular phylogenetic analysis of a naturally occurring microbial community in a deep-subsurface geothermal environment indicated that the phylogenetic diversity of the microbial population in the environment was extremely limited and that only hyperthermophilic archaeal members closely related to Pyrobaculum were present. All archaeal ribosomal DNA sequences contained intron-like sequences, some of which had open reading frames with repeated homing-endonuclease motifs. The sequence similarity analysis and the phylogenetic analysis of these homing endonucleases suggested the possible phylogenetic relationship among archaeal rRNA-encoded homing endonucleases. PMID:10584021

  17. New lessons from an old gene: complex splicing and a novel cryptic exon in VHL gene cause erythrocytosis and VHL disease.

    PubMed

    Lenglet, Marion; Robriquet, Florence; Schwarz, Klaus; Camps, Carme; Couturier, Anne; Hoogewijs, David; Buffet, Alexandre; Knight, Samantha Jl; Gad, Sophie; Couvé, Sophie; Chesnel, Franck; Pacault, Mathilde; Lindenbaum, Pierre; Job, Sylvie; Dumont, Solenne; Besnard, Thomas; Cornec, Marine; Dreau, Helene; Pentony, Melissa; Kvikstad, Erika; Deveaux, Sophie; Burnichon, Nelly; Ferlicot, Sophie; Vilaine, Mathias; Mazzella, Jean-Michaël; Airaud, Fabrice; Garrec, Céline; Heidet, Laurence; Irtan, Sabine; Mantadakis, Elpis; Bouchireb, Karim; Debatin, Klaus-Michael; Redon, Richard; Bezieau, Stéphane; Bressac-de Paillerets, Brigitte; Teh, Bin Tean; Girodon, François; Randi, Maria-Luigia; Putti, Maria Caterina; Bours, Vincent; Van Wijk, Richard; Göthert, Joachim R; Kattamis, Antonis; Janin, Nicolas; Bento, Celeste; Taylor, Jenny C; Arlot-Bonnemains, Yannick; Richard, Stéphane; Gimenez-Roqueplo, Anne-Paule; Cario, Holger; Gardie, Betty

    2018-06-11

    Chuvash polycythemia is an autosomal recessive form of erythrocytosis associated with a homozygous p.Arg200Trp mutation in the von Hippel-Lindau (VHL) gene. Since this discovery, additional VHL mutations have been identified in patients with congenital erythrocytosis, in a homozygous or compound-heterozygous state. VHL is a major tumor suppressor gene, mutations in which were first described in patients presenting with von Hippel-Lindau disease, which is characterized by the development of highly vascularized tumors. Here, we identified a new VHL cryptic-exon (termed E1') deep in intron 1 that is naturally expressed in many tissues. More importantly, we identified mutations in E1' in seven families with erythrocytosis (one homozygous case and six compound-heterozygous cases with a mutation in E1' in addition to a mutation in VHL coding sequences) and in one large family with typical VHL disease but without any alteration in the other VHL exons. In this study we have shown that the mutations induced a dysregulation of the VHL splicing with excessive retention of E1' and are associated with a downregulation of VHL protein expression. In addition, we have demonstrated a pathogenic role for synonymous mutations in VHL-Exon 2 that alter splicing through E2-skipping in five families with erythrocytosis or VHL disease. In all the studied cases, the mutations differentially impact splicing, correlating with phenotype severity. This study demonstrates that cryptic-exon-retention or exon-skipping are new VHL alterations and reveals a novel complex splicing regulation of the VHL gene. These findings open new avenues for diagnosis and research into the VHL-related-hypoxia-signaling pathway. Copyright © 2018 American Society of Hematology.

  18. Three distinct modes of intron dynamics in the evolution of eukaryotes.

    PubMed

    Carmel, Liran; Wolf, Yuri I; Rogozin, Igor B; Koonin, Eugene V

    2007-07-01

    Several contrasting scenarios have been proposed for the origin and evolution of spliceosomal introns, a hallmark of eukaryotic genes. A comprehensive probabilistic model to obtain a definitive reconstruction of intron evolution was developed and applied to 391 sets of conserved genes from 19 eukaryotic species. It is inferred that a relatively high intron density was reached early, i.e., the last common ancestor of eukaryotes contained >2.15 introns/kilobase, and the last common ancestor of multicellular life forms harbored approximately 3.4 introns/kilobase, a greater intron density than in most of the extant fungi and in some animals. The rates of intron gain and intron loss appear to have been dropping during the last approximately 1.3 billion years, with the decline in the gain rate being much steeper. Eukaryotic lineages exhibit three distinct modes of evolution of the intron-exon structure. The primary, balanced mode, apparently, operates in all lineages. In this mode, intron gain and loss are strongly and positively correlated, in contrast to previous reports on inverse correlation between these processes. The second mode involves an elevated rate of intron loss and is prevalent in several lineages, such as fungi and insects. The third mode, characterized by elevated rate of intron gain, is seen only in deep branches of the tree, indicating that bursts of intron invasion occurred at key points in eukaryotic evolution, such as the origin of animals. Intron dynamics could depend on multiple mechanisms, and in the balanced mode, gain and loss of introns might share common mechanistic features.

  19. Hypervariable and highly divergent intron-exon organizations in the chordate Oikopleura dioica.

    PubMed

    Edvardsen, Rolf B; Lerat, Emmanuelle; Maeland, Anne Dorthea; Flåt, Mette; Tewari, Rita; Jensen, Marit F; Lehrach, Hans; Reinhardt, Richard; Seo, Hee-Chan; Chourrout, Daniel

    2004-10-01

    Oikopleura dioica is a pelagic tunicate with a very small genome and a very short life cycle. In order to investigate the intron-exon organizations in Oikopleura, we have isolated and characterized ribosomal protein EF-1alpha, Hox, and alpha-tubulin genes. Their intron positions have been compared with those of the same genes from various invertebrates and vertebrates, including four species with entirely sequenced genomes. Oikopleura genes, like Caenorhabditis genes, have introns at a large number of nonconserved positions, which must originate from late insertions or intron sliding of ancient insertions. Both species exhibit hypervariable intron-exon organization within their alpha-tubulin gene family. This is due to localization of most nonconserved intron positions in single members of this gene family. The hypervariability and divergence of intron positions in Oikopleura and Caenorhabditis may be related to the predominance of short introns, the processing of which is not very dependent upon the exonic environment compared to large introns. Also, both species have an undermethylated genome, and the control of methylation-induced point mutations imposes a control on exon size, at least in vertebrate genes. That introns placed at such variable positions in Oikopleura or C. elegans may serve a specific purpose is not easy to infer from our current knowledge and hypotheses on intron functions. We propose that new introns are retained in species with very short life cycles, because illegitimate exchanges including gene conversion are repressed. We also speculate that introns placed at gene-specific positions may contribute to suppressing these exchanges and thereby favor their own persistence.

  20. Mutations in POLR3A and POLR3B are a major cause of hypomyelinating leukodystrophies with or without dental abnormalities and/or hypogonadotropic hypogonadism.

    PubMed

    Daoud, Hussein; Tétreault, Martine; Gibson, William; Guerrero, Kether; Cohen, Ana; Gburek-Augustat, Janina; Synofzik, Matthis; Brais, Bernard; Stevens, Cathy A; Sanchez-Carpintero, Rocio; Goizet, Cyril; Naidu, Sakkubai; Vanderver, Adeline; Bernard, Geneviève

    2013-03-01

    Leukodystrophies are a heterogeneous group of inherited neurodegenerative disorders characterised by abnormal central nervous system white matter. Mutations in POLR3A and POLR3B genes were recently reported to cause four clinically overlapping hypomyelinating leukodystrophy phenotypes. Our aim was to investigate the presence and frequency of POLR3A and POLR3B mutations in patients with genetically unexplained hypomyelinating leukodystrophies with typical clinical and/or radiologic features of Pol III-related leukodystrophies. The entire coding region and the flanking exon/intron boundaries of POLR3A and/or POLR3B genes were amplified and sequenced in 14 patients. Recessive mutations in POLR3A or POLR3B were uncovered in all 14 patients. Eight novel mutations were identified in POLR3A: six missenses, one nonsense, and one frameshift mutation. Seven patients carried compound heterozygous mutations in POLR3B, of whom six shared the common mutation in exon 15 (p.V523E). Seven novel mutations were identified in POLR3B: four missenses, two splice sites, and one intronic mutation. To date, our group has described 37 patients, of whom 27 have mutations in POLR3A and 10 in POLR3B, respectively. Altogether, our results further support the proposal that POLR3A and POLR3B mutations are a major cause of hypomyelinating leukodystrophies and suggest that POLR3A mutations are more frequent.

  1. Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency

    PubMed Central

    Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M.; Yildirimli, Deniz; Maynard, Dawn M.; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C.; Huizing, Marjan; Gahl, William A.

    2017-01-01

    Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic “molar tooth sign” on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients’ fibroblasts. PMID:28220259

  2. Mutations in KIAA0753 cause Joubert syndrome associated with growth hormone deficiency.

    PubMed

    Stephen, Joshi; Vilboux, Thierry; Mian, Luhe; Kuptanon, Chulaluck; Sinclair, Courtney M; Yildirimli, Deniz; Maynard, Dawn M; Bryant, Joy; Fischer, Roxanne; Vemulapalli, Meghana; Mullikin, James C; Huizing, Marjan; Gahl, William A; Malicdan, May Christine V; Gunay-Aygun, Meral

    2017-04-01

    Joubert syndrome and related disorders (JSRD) are a heterogeneous group of ciliopathies defined based on the mid-hindbrain abnormalities that result in the characteristic "molar tooth sign" on brain imaging. The core clinical findings of JSRD are hypotonia, developmental delay, abnormal eye movements and breathing abnormalities. To date, more than 30 JSRD genes that encode proteins important for structure and/or function of cilia have been identified. Here, we present 2 siblings with Joubert syndrome associated with growth hormone deficiency. Whole exome sequencing of the family identified compound heterozygous mutations in KIAA0753, i.e., a missense mutation (p.Arg257Gly) and an intronic mutation (c.2359-1G>C). The intronic mutation alters normal splicing by activating a cryptic acceptor splice site in exon 16. The novel acceptor site skips nine nucleotides, deleting three amino acids from the protein coding frame. KIAA0753 (OFIP) is a centrosome and pericentriolar satellite protein, previously not known to cause Joubert syndrome. We present comprehensive clinical descriptions of the Joubert syndrome patients as well as the cellular phenotype of defective ciliogenesis in the patients' fibroblasts.

  3. A novel mutation of the NDUFS7 gene leads to activation of a cryptic exon and impaired assembly of mitochondrial complex I in a patient with Leigh syndrome.

    PubMed

    Lebon, Sophie; Minai, Limor; Chretien, Dominique; Corcos, Johanna; Serre, Valérie; Kadhom, Noman; Steffann, Julie; Pauchard, Jean-Yves; Munnich, Arnold; Bonnefont, Jean-Paul; Rötig, Agnès

    2007-01-01

    Complex I deficiency is a frequent cause of mitochondrial disease as it accounts for one third of these disorders. By genotyping several putative disease loci using microsatellite markers we were able to describe a new NDUFS7 mutation in a consanguineous family with Leigh syndrome and isolated complex I deficiency. This mutation lies in the first intron of the NDUFS7 gene (c.17-1167 C>G) and creates a strong donor splice site resulting in the generation of a cryptic exon. This mutation is predicted to result in a shortened mutant protein of 41 instead of 213 amino acids containing only the first five amino acids of the normal protein. Analysis of the assembly state of the respiratory chain complexes under native condition revealed a marked decrease of fully assembled complex I while the quantity of the other complexes was not altered. These results report the first intronic NDUFS7 gene mutation and demonstrate the crucial role of NDUFS7 in the biogenesis of complex I.

  4. Intron retention and nuclear loss of SFPQ are molecular hallmarks of ALS.

    PubMed

    Luisier, Raphaelle; Tyzack, Giulia E; Hall, Claire E; Mitchell, Jamie S; Devine, Helen; Taha, Doaa M; Malik, Bilal; Meyer, Ione; Greensmith, Linda; Newcombe, Jia; Ule, Jernej; Luscombe, Nicholas M; Patani, Rickie

    2018-05-22

    Mutations causing amyotrophic lateral sclerosis (ALS) strongly implicate ubiquitously expressed regulators of RNA processing. To understand the molecular impact of ALS-causing mutations on neuronal development and disease, we analysed transcriptomes during in vitro differentiation of motor neurons (MNs) from human control and patient-specific VCP mutant induced-pluripotent stem cells (iPSCs). We identify increased intron retention (IR) as a dominant feature of the splicing programme during early neural differentiation. Importantly, IR occurs prematurely in VCP mutant cultures compared with control counterparts. These aberrant IR events are also seen in independent RNAseq data sets from SOD1- and FUS-mutant MNs. The most significant IR is seen in the SFPQ transcript. The SFPQ protein binds extensively to its retained intron, exhibits lower nuclear abundance in VCP mutant cultures and is lost from nuclei of MNs in mouse models and human sporadic ALS. Collectively, we demonstrate SFPQ IR and nuclear loss as molecular hallmarks of familial and sporadic ALS.

  5. Exon definition as a potential negative force against intron losses in evolution.

    PubMed

    Niu, Deng-Ke

    2008-11-13

    Previous studies have indicated that the wide variation in intron density (the number of introns per gene) among different eukaryotes largely reflects varying degrees of intron loss during evolution. The most popular model, which suggests that organisms lose introns through a mechanism in which reverse-transcribed cDNA recombines with the genomic DNA, concerns only one mutational force. Using exons as the units of splicing-site recognition, exon definition constrains the length of exons. An intron-loss event results in fusion of flanking exons and thus a larger exon. The large size of the newborn exon may cause splicing errors, i.e., exon skipping, if the splicing of pre-mRNAs is initiated by exon definition. By contrast, if the splicing of pre-mRNAs is initiated by intron definition, intron loss does not matter. Exon definition may thus be a selective force against intron loss. An organism with a high frequency of exon definition is expected to experience a low rate of intron loss throughout evolution and have a high density of spliceosomal introns. The majority of spliceosomal introns in vertebrates may be maintained during evolution not because of potential functions, but because of their splicing mechanism (i.e., exon definition). Further research is required to determine whether exon definition is a negative force in maintaining the high intron density of vertebrates. This article was reviewed by Dr. Scott W. Roy (nominated by Dr. John Logsdon), Dr.Eugene V. Koonin, and Dr. Igor B. Rogozin (nominated by Dr. Mikhail Gelfand). For the full reviews,please go to the Reviewers' comments section.

  6. Targeted exome sequencing reveals novel USH2A mutations in Chinese patients with simplex Usher syndrome.

    PubMed

    Shu, Hai-Rong; Bi, Huai; Pan, Yang-Chun; Xu, Hang-Yu; Song, Jian-Xin; Hu, Jie

    2015-09-16

    Usher syndrome (USH) is an autosomal recessive disorder characterized by hearing impairment and vision dysfunction due to retinitis pigmentosa. Phenotypic and genetic heterogeneities of this disease make it impractical to obtain a genetic diagnosis by conventional Sanger sequencing. In this study, we applied a next-generation sequencing approach to detect genetic abnormalities in patients with USH. Two unrelated Chinese families were recruited, consisting of two USH afflicted patients and four unaffected relatives. We selected 199 genes related to inherited retinal diseases as targets for deep exome sequencing. Through systematic data analysis using an established bioinformatics pipeline, all variants that passed filter criteria were validated by Sanger sequencing and co-segregation analysis. A homozygous frameshift mutation (c.4382delA, p.T1462Lfs*2) was revealed in exon20 of gene USH2A in the F1 family. Two compound heterozygous mutations, IVS47 + 1G > A and c.13156A > T (p.I4386F), located in intron 48 and exon 63 respectively, of USH2A, were identified as causative mutations for the F2 family. Of note, the missense mutation c.13156A > T has not been reported so far. In conclusion, targeted exome sequencing precisely and rapidly identified the genetic defects in two Chinese USH families and this technique can be applied as a routine examination for these disorders with significant clinical and genetic heterogeneity.

  7. Assessment of clinical analytical sensitivity and specificity of next-generation sequencing for detection of simple and complex mutations.

    PubMed

    Chin, Ephrem L H; da Silva, Cristina; Hegde, Madhuri

    2013-02-19

    Detecting mutations in disease genes by full gene sequence analysis is common in clinical diagnostic laboratories. Sanger dideoxy terminator sequencing allows for rapid development and implementation of sequencing assays in the clinical laboratory, but it has limited throughput, and due to cost constraints, only allows analysis of one or at most a few genes in a patient. Next-generation sequencing (NGS), on the other hand, has evolved rapidly, although to date it has mainly been used for large-scale genome sequencing projects and is beginning to be used in the clinical diagnostic testing. One advantage of NGS is that many genes can be analyzed easily at the same time, allowing for mutation detection when there are many possible causative genes for a specific phenotype. In addition, regions of a gene typically not tested for mutations, like deep intronic and promoter mutations, can also be detected. Here we use 20 previously characterized Sanger-sequenced positive controls in disease-causing genes to demonstrate the utility of NGS in a clinical setting using standard PCR based amplification to assess the analytical sensitivity and specificity of the technology for detecting all previously characterized changes (mutations and benign SNPs). The positive controls chosen for validation range from simple substitution mutations to complex deletion and insertion mutations occurring in autosomal dominant and recessive disorders. The NGS data was 100% concordant with the Sanger sequencing data identifying all 119 previously identified changes in the 20 samples. We have demonstrated that NGS technology is ready to be deployed in clinical laboratories. However, NGS and associated technologies are evolving, and clinical laboratories will need to invest significantly in staff and infrastructure to build the necessary foundation for success.

  8. Malonyl CoA decarboxylase deficiency: C to T transition in intron 2 of the MCD gene.

    PubMed

    Surendran, S; Sacksteder, K A; Gould, S J; Coldwell, J G; Rady, P L; Tyring, S K; Matalon, R

    2001-09-15

    Malonyl CoA decarboxylase (MCD) is an enzyme involved in the metabolism of fatty acids synthesis. Based on reports of MCD deficiency, this enzyme is particular important in muscle and brain metabolism. Mutations in the MCD gene result in a deficiency of MCD activity, that lead to psychomotor retardation, cardiomyopathy and neonatal death. To date however, only a few patients have been reported with defects in MCD. We report here studies of a patient with MCD deficiency, who presented with hypotonia, cardiomyopathy and psychomotor retardation. DNA sequencing of MCD revealed a homozygous intronic mutation, specifically a -5 C to T transition near the acceptor site for exon 3. RT-PCR amplification of exons 2 and 3 revealed that although mRNA from a normal control sample yielded one major DNA band, the mutant mRNA sample resulted in two distinct DNA fragments. Sequencing of the patient's two RT-PCR products revealed that the larger molecular weight fragments contained exons 2 and 3 as well as the intervening intronic sequence. The smaller size band from the patient contained the properly spliced exons, similar to the normal control. Western blotting analysis of the expressed protein showed only a faint band in the patient sample in contrast to a robust band in the control. In addition, the enzyme activity of the mutant protein was lower than that of the control protein. The data indicate that homozygous mutation in intron 2 disrupt normal splicing of the gene, leading to lower expression of the MCD protein and MCD deficiency. Copyright 2001 Wiley-Liss, Inc.

  9. Dynamic evolution of plant mitochondrial genomes: Mobile genes and introns and highly variable mutation rates

    PubMed Central

    Palmer, Jeffrey D.; Adams, Keith L.; Cho, Yangrae; Parkinson, Christopher L.; Qiu, Yin-Long; Song, Keming

    2000-01-01

    We summarize our recent studies showing that angiosperm mitochondrial (mt) genomes have experienced remarkably high rates of gene loss and concomitant transfer to the nucleus and of intron acquisition by horizontal transfer. Moreover, we find substantial lineage-specific variation in rates of these structural mutations and also point mutations. These findings mostly arise from a Southern blot survey of gene and intron distribution in 281 diverse angiosperms. These blots reveal numerous losses of mt ribosomal protein genes but, with one exception, only rare loss of respiratory genes. Some lineages of angiosperms have kept all of their mt ribosomal protein genes whereas others have lost most of them. These many losses appear to reflect remarkably high (and variable) rates of functional transfer of mt ribosomal protein genes to the nucleus in angiosperms. The recent transfer of cox2 to the nucleus in legumes provides both an example of interorganellar gene transfer in action and a starting point for discussion of the roles of mechanistic and selective forces in determining the distribution of genetic labor between organellar and nuclear genomes. Plant mt genomes also acquire sequences by horizontal transfer. A striking example of this is a homing group I intron in the mt cox1 gene. This extraordinarily invasive mobile element has probably been acquired over 1,000 times separately during angiosperm evolution via a recent wave of cross-species horizontal transfers. Finally, whereas all previously examined angiosperm mtDNAs have low rates of synonymous substitutions, mtDNAs of two distantly related angiosperms have highly accelerated substitution rates. PMID:10860957

  10. Smooth, an hnRNP-L Homolog, Might Decrease Mitochondrial Metabolism by Post-Transcriptional Regulation of Isocitrate Dehydrogenase (Idh) and Other Metabolic Genes in the Sub-Acute Phase of Traumatic Brain Injury.

    PubMed

    Sen, Arko; Gurdziel, Katherine; Liu, Jenney; Qu, Wen; Nuga, Oluwademi O; Burl, Rayanne B; Hüttemann, Maik; Pique-Regi, Roger; Ruden, Douglas M

    2017-01-01

    Traumatic brain injury (TBI) can cause persistent pathological alteration of neurons. This may lead to cognitive dysfunction, depression and increased susceptibility to life threatening diseases, such as epilepsy and Alzheimer's disease. To investigate the underlying genetic and molecular basis of TBI, we subjected w 1118 Drosophila melanogaster to mild closed head trauma and found that mitochondrial activity is reduced in the brains of these flies 24 h after inflicting trauma. To determine the transcriptomic changes after mild TBI, we collected fly heads 24 h after inflicting trauma, and performed RNA-seq analyses. Classification of alternative splicing changes showed selective retention (RI) of long introns (>81 bps), with a mean size of ~3,000 nucleotides. Some of the genes containing RI showed a significant reduction in transcript abundance and are involved in mitochondrial metabolism such as Isocitrate dehydrogenase (Idh), which makes α-KG, a co-factor needed for both DNA and histone demethylase enzymes. The long introns are enriched in CA-rich motifs known to bind to Smooth (Sm), a heterogeneous nuclear ribonucleoprotein L (hnRNP-L) class of splicing factor, which has been shown to interact with the H3K36 histone methyltransferase, SET2, and to be involved in intron retention in human cells. H3K36me3 is a histone mark that demarcates exons in genes by interacting with the mRNA splicing machinery. Mutating sm ( sm 4 /Df) resulted in loss of both basal and induced levels of RI in many of the same long-intron containing genes. Reducing the levels of Kdm4A, the H3K36me3 histone demethylase, also resulted in loss of basal levels of RI in many of the same long-intron containing genes. Chromatin immunoprecipitation followed by deep sequencing (ChIP-seq) for H3K36me3 revealed increased levels of this histone modification in retained introns post-trauma at CA-rich motifs. Based on these results, we propose a model in which TBI temporarily decreases mitochondrial activity in the brain 24 h after inflicting trauma, which decreases α-KG levels, and increases H3K36me3 levels and intron retention of long introns by decreasing Kdm4A activity. The consequent reduction in mature mRNA levels in metabolism genes, such as Idh, further reduces α-KG levels in a negative feedback loop. We further propose that decreasing metabolism after TBI in such a manner is a protective mechanism that gives the brain time to repair cellular damage induced by TBI.

  11. ATP-binding cassette subfamily A, member 4 intronic variants c.4773+3A>G and c.5461-10T>C cause Stargardt disease due to defective splicing.

    PubMed

    Jonsson, Frida; Westin, Ida Maria; Österman, Lennart; Sandgren, Ola; Burstedt, Marie; Holmberg, Monica; Golovleva, Irina

    2018-02-20

    Inherited retinal dystrophies (IRDs) represent a group of progressive conditions affecting the retina. There is a great genetic heterogeneity causing IRDs, and to date, more than 260 genes are associated with IRDs. Stargardt disease, type 1 (STGD1) or macular degeneration with flecks, STGD1 represents a disease with early onset, central visual impairment, frequent appearance of yellowish flecks and mutations in the ATP-binding cassette subfamily A, member 4 (ABCA4) gene. A large number of intronic sequence variants in ABCA4 have been considered pathogenic although their functional effect was seldom demonstrated. In this study, we aimed to reveal how intronic variants present in patients with Stargardt from the same Swedish family affect splicing. The splicing of the ABCA4 gene was studied in human embryonic kidney cells, HEK293T, and in human retinal pigment epithelium cells, ARPE-19, using a minigene system containing variants c.4773+3A>G and c.5461-10T>C. We showed that both ABCA4 variants, c.4773+3A>G and c.5461-10T>C, cause aberrant splicing of the ABCA4 minigene resulting in exon skipping. We also demonstrated that splicing of ABCA4 has different outcomes depending on transfected cell type. Two intronic variants c.4773+3A>G and c.5461-10T>C, both predicted to affect splicing, are indeed disease-causing mutations due to skipping of exons 33, 34, 39 and 40 of ABCA4 gene. The experimental proof that ABCA4 mutations in STGD patients affect protein function is crucial for their inclusion to future clinical trials; therefore, functional testing of all ABCA4 intronic variants associated with Stargardt disease by minigene technology is desirable. © 2018 Acta Ophthalmologica Scandinavica Foundation. Published by John Wiley & Sons Ltd.

  12. Magnetic resonance spectroscopy and molecular studies in ornithine transcarbamylase deficiency novel mutation c.802A>G in exon 8 (p.Met268Val).

    PubMed

    Jamroz, E; Paprocka, J; Sokół, M; Popowska, E; Ciara, E

    2013-01-01

    Ornithine transcarbamylase (OTC) deficiency, an X-linked, semidominant disorder, is the most common inherited de-fect in ureagenesis, resulting in hyperammonaemia type II. The OTC gene, localised on chromosome X, has been mapp-ed to band Xp21.1, proximate to the Duchenne muscular dystrophy (DMD) gene. More than 350 different mutations, including missense, nonsense, splice-site changes, small de-letions or insertions and gross deletions, have been describ-ed so far. Almost all mutations in consensus splicing sites confer a neonatal phenotype. Most mutations in the OTC gene are 'private' and are distributed throughout the gene with a paucity of mutation in the sequence encoding the leader peptide (exon 1 and beginning of exon 2) and in exon 7. They have familial origin or occur de novo. Even with sequencing of the entire reading frame and exon/intron boundaries, only about 80% of the mutations are detected in patients with proven OTC deficiency. The remainder probably occur within the introns or in regulatory domains. The authors present a 4-year-old boy with the unreported missense mutation c.802A>G. The nucleotide transition leads to amino acid substitution Met to Val at codon 268 of the OTC protein.

  13. Nonsense mutation in the phosphofructokinase muscle subunit gene associated with retention of intron 10 in one of the isolated transcripts in Ashkenazi Jewish patients with Tarui disease.

    PubMed Central

    Vasconcelos, O; Sivakumar, K; Dalakas, M C; Quezado, M; Nagle, J; Leon-Monzon, M; Dubnick, M; Gajdusek, D C; Goldfarb, L G

    1995-01-01

    Mutations in the human phosphofructokinase muscle subunit gene (PFKM) are known to cause myopathy classified as glycogenosis type VII (Tarui disease). Previously described molecular defects include base substitutions altering encoded amino acids or resulting in abnormal splicing. We report a mutation resulting in phosphofructokinase deficiency in three patients from an Ashkenazi Jewish family. Using a reverse transcription PCR assay, PFKM subunit transcripts differing by length were detected in skeletal muscle tissue of all three affected subjects. In the longer transcript, an insertion of 252 nucleotides totally homologous to the structure of the 10th intron of the PFKM gene was found separating exon 10 from exon 11. In addition, two single base transitions were identified by direct sequencing: [exon 6; codon 95; CGA (Arg) to TGA (stop)] and [exon 7; codon 172; ACC (Thr) to ACT (Thr)] in either transcript. Single-stranded conformational polymorphism and restriction enzyme analyses confirmed the presence of these point substitutions in genomic DNA and strongly suggested homozygosity for the pathogenic allele. The nonsense mutation at codon 95 appeared solely responsible for the phenotype in these patients, further expanding genetic heterogeneity of Tarui disease. Transcripts with and without intron 10 arising from identical mutant alleles probably resulted from differential pre-mRNA processing and may represent a novel message from the PFKM gene. Images Fig. 2 Fig. 4 Fig. 5 PMID:7479776

  14. [A study of PDE6B gene mutation and phenotype in Chinese cases with retinitis pigmentosa].

    PubMed

    Cui, Yun; Zhao, Kan-xing; Wang, Li; Wang, Qing; Zhang, Wei; Chen, Wei-ying; Wang, Li-ming

    2003-01-01

    To identify the mutation spectrum of phosphodiesterase beta subunit (PDE6B) gene, the incidence in Chinese patients with retinitis pigmentosa (RP) and their clinical phenotypic characteristics. Screening of mutations within PDE6B gene was performed using polymerase chain reaction-heteroduplex-single strand conformation polymorphism (PCR-SSCP) and DNA sequence in 35 autosomal recessive (AR) RP and 55 sporadic RP cases. The phenotypes of the patients with the gene mutation were examined and analyzed. Novel complex heterozygous variants of PDE6B gene in a sporadic case, a T to C transversion in codon 323 resulting in the substitution of Gly by Ser and 2 base pairs (bp: G and T) insert between the 27th-28th bp upstream of the 5'-end of exon 10 were both present in a same isolate RP. But they are not found in 100 unrelated healthy individuals. Ocular findings showed diffuse pigmentary retinal degeneration in the midperipheral and peripheral fundi, optic atrophy and vessel attenuation. Multi-focal ERG indicated that the rod function was more severely deteriorated. A mutation was found in a case with RP in a ARRP family, a G to A transversion at 19th base upstream 5'-end of exon 11 (within intron 10) of PDE6B gene. A sporadic RP carried a sequence variant of PDE6B gene, a G to C transition, at the 15th base adjacent to the 3'-end of exon l8. In another isolate case with RP was found 2 bp (GT) insert between 31st and 32nd base upstream 5'-end of exon 4 (in intron 3) of PDE6B gene. There are novel complex heterozygous mutations of PDE6B gene responsible for a sporadic RP patient in China. This gene mutation associated with rod deterioration and RP. Several DNA variants were found in introns of PDE6B gene in national population.

  15. Genetic diagnosis of familial hypercholesterolaemia: the importance of functional analysis of potential splice-site mutations.

    PubMed

    Bourbon, M; Duarte, M A; Alves, A C; Medeiros, A M; Marques, L; Soutar, A K

    2009-05-01

    Familial hypercholesterolemia (FH) results from defective low-density lipoprotein receptor (LDLR) activity, mainly due to LDLR gene defects. Of the many different LDLR mutations found in patients with FH, about 6% of single base substitutions are located near or within introns, and are predicted to result in exon skipping, retention of an intron, or activation of cryptic sites during mRNA splicing. This paper reports on the Portuguese FH Study, which found 10 such mutations, 6 of them novel. For the mutations that have not been described before or those whose effect on function have not been analysed, their effect on splicing was investigated, using reverse transcriptase PCR analysis of LDLR mRNA from freshly isolated blood mononuclear cells. Two of these variants (c.313+6 T-->C, c.2389G-->T (p.V776L)) caused exon skipping, and one caused retention of an intron (c.1359-5C-->G), whereas two others (c.2140+5 G-->A and c.1061-8T-->C) had no apparent effect. Any effect of c.1185G-->C (p.V374V) on splicing could not be determined because it was on an allele with a promoter mutation (-42C-->G) that was probably not transcribed. Variants in four patients lost to follow-up could not be tested experimentally, but they almost certainly affect splicing because they disrupt the invariant AG or GT in acceptor (c.818-2A-->G) or donor (c.1060+1G-->A, c.1845+1delG and c.2547+1G-->A) spice sites. These findings emphasise that care must be taken before reporting the presence or absence of a splice-site mutation in the LDLR gene for diagnostic purposes. The study also shows that relatively simple, quick and inexpensive RNA assays can evaluate putative splicing mutations that are not always predictable by available software, thereby reducing genetic misdiagnosis of patients with FH.

  16. Identification of novel point mutations in splicing sites integrating whole-exome and RNA-seq data in myeloproliferative diseases

    PubMed Central

    Spinelli, Roberta; Pirola, Alessandra; Redaelli, Sara; Sharma, Nitesh; Raman, Hima; Valletta, Simona; Magistroni, Vera; Piazza, Rocco; Gambacorti-Passerini, Carlo

    2013-01-01

    Point mutations in intronic regions near mRNA splice junctions can affect the splicing process. To identify novel splicing variants from exome sequencing data, we developed a bioinformatics splice-site prediction procedure to analyze next-generation sequencing (NGS) data (SpliceFinder). SpliceFinder integrates two functional annotation tools for NGS, ANNOVAR and MutationTaster and two canonical splice site prediction programs for single mutation analysis, SSPNN and NetGene2. By SpliceFinder, we identified somatic mutations affecting RNA splicing in a colon cancer sample, in eight atypical chronic myeloid leukemia (aCML), and eight CML patients. A novel homozygous splicing mutation was found in APC (NM_000038.4:c.1312+5G>A) and six heterozygous in GNAQ (NM_002072.2:c.735+1C>T), ABCC3 (NM_003786.3:c.1783-1G>A), KLHDC1 (NM_172193.1:c.568-2A>G), HOOK1 (NM_015888.4:c.1662-1G>A), SMAD9 (NM_001127217.2:c.1004-1C>T), and DNAH9 (NM_001372.3:c.10242+5G>A). Integrating whole-exome and RNA sequencing in aCML and CML, we assessed the phenotypic effect of mutations on mRNA splicing for GNAQ, ABCC3, HOOK1. In ABCC3 and HOOK1, RNA-Seq showed the presence of aberrant transcripts with activation of a cryptic splice site or intron retention, validated by the reverse transcription-polymerase chain reaction (RT-PCR) in the case of HOOK1. In GNAQ, RNA-Seq showed 22% of wild-type transcript and 78% of mRNA skipping exon 5, resulting in a 4–6 frameshift fusion confirmed by RT-PCR. The pipeline can be useful to identify intronic variants affecting RNA sequence by complementing conventional exome analysis. PMID:24498620

  17. Evolution of Mhc-DRB introns: implications for the origin of primates.

    PubMed

    Kupfermann, H; Satta, Y; Takahata, N; Tichy, H; Klein, J

    1999-06-01

    Introns are generally believed to evolve too rapidly and too erratically to be of much use in phylogenetic reconstructions. Few phylogenetically informative intron sequences are available, however, to ascertain the validity of this supposition. In the present study the supposition was tested on the example of the mammalian class II major histocompatibility complex (Mhc) genes of the DRB family. Since the Mhc genes evolve under balancing selection and are believed to recombine or rearrange frequently, the evolution of their introns could be expected to be particularly rapid and subject to scrambling. Sequences of intron 4 and 5 DRB genes were obtained from polymerase chain reaction-amplified fragments of genomic DNA from representatives of six eutherian orders-Primates, Scandentia, Chiroptera, Dermoptera, Lagomorpha, and Insectivora. Although short stretches of the introns have indeed proved to be unalignable, the bulk of the intron sequences from all six orders, spanning >85 million years (my) of evolution, could be aligned and used in a study of the tempo and mode of intron evolution. The analysis has revealed the Mhc introns to evolve at a rate similar to that of other genes and of synonymous sites of non-Mhc genes. No evidence of homogenization or large-scale scrambling of the intron sequences could be found. The Mhc introns apparently evolve largely by point mutations and insertions/deletions. The phylogenetic signals contained in the intron sequences could be used to identify Scandentia as the sister group of Primates, to support the existence of the Archonta superorder, and to confirm the monophyly of the Chiroptera.

  18. Impaired Spermatogenesis, Muscle, and Erythrocyte Function in U12 Intron Splicing-Defective Zrsr1 Mutant Mice.

    PubMed

    Horiuchi, Keiko; Perez-Cerezales, Serafín; Papasaikas, Panagiotis; Ramos-Ibeas, Priscila; López-Cardona, Angela Patricia; Laguna-Barraza, Ricardo; Fonseca Balvís, Noelia; Pericuesta, Eva; Fernández-González, Raul; Planells, Benjamín; Viera, Alberto; Suja, Jose Angel; Ross, Pablo Juan; Alén, Francisco; Orio, Laura; Rodriguez de Fonseca, Fernando; Pintado, Belén; Valcárcel, Juan; Gutiérrez-Adán, Alfonso

    2018-04-03

    The U2AF35-like ZRSR1 has been implicated in the recognition of 3' splice site during spliceosome assembly, but ZRSR1 knockout mice do not show abnormal phenotypes. To analyze ZRSR1 function and its precise role in RNA splicing, we generated ZRSR1 mutant mice containing truncating mutations within its RNA-recognition motif. Homozygous mutant mice exhibited severe defects in erythrocytes, muscle stretch, and spermatogenesis, along with germ cell sloughing and apoptosis, ultimately leading to azoospermia and male sterility. Testis RNA sequencing (RNA-seq) analyses revealed increased intron retention of both U2- and U12-type introns, including U12-type intron events in genes with key functions in spermatogenesis and spermatid development. Affected U2 introns were commonly found flanking U12 introns, suggesting functional cross-talk between the two spliceosomes. The splicing and tissue defects observed in mutant mice attributed to ZRSR1 loss of function suggest a physiological role for this factor in U12 intron splicing. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Sensitivity of BRCA1/2 testing in high-risk breast/ovarian/male breast cancer families: little contribution of comprehensive RNA/NGS panel testing.

    PubMed

    Byers, Helen; Wallis, Yvonne; van Veen, Elke M; Lalloo, Fiona; Reay, Kim; Smith, Philip; Wallace, Andrew J; Bowers, Naomi; Newman, William G; Evans, D Gareth

    2016-11-01

    The sensitivity of testing BRCA1 and BRCA2 remains unresolved as the frequency of deep intronic splicing variants has not been defined in high-risk familial breast/ovarian cancer families. This variant category is reported at significant frequency in other tumour predisposition genes, including NF1 and MSH2. We carried out comprehensive whole gene RNA analysis on 45 high-risk breast/ovary and male breast cancer families with no identified pathogenic variant on exonic sequencing and copy number analysis of BRCA1/2. In addition, we undertook variant screening of a 10-gene high/moderate risk breast/ovarian cancer panel by next-generation sequencing. DNA testing identified the causative variant in 50/56 (89%) breast/ovarian/male breast cancer families with Manchester scores of ≥50 with two variants being confirmed to affect splicing on RNA analysis. RNA sequencing of BRCA1/BRCA2 on 45 individuals from high-risk families identified no deep intronic variants and did not suggest loss of RNA expression as a cause of lost sensitivity. Panel testing in 42 samples identified a known RAD51D variant, a high-risk ATM variant in another breast ovary family and a truncating CHEK2 mutation. Current exonic sequencing and copy number analysis variant detection methods of BRCA1/2 have high sensitivity in high-risk breast/ovarian cancer families. Sequence analysis of RNA does not identify any variants undetected by current analysis of BRCA1/2. However, RNA analysis clarified the pathogenicity of variants of unknown significance detected by current methods. The low diagnostic uplift achieved through sequence analysis of the other known breast/ovarian cancer susceptibility genes indicates that further high-risk genes remain to be identified.

  20. Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

    PubMed Central

    Coffee, Erin M.; Tolan, Dean R.

    2010-01-01

    SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

  1. Molecular approach of auditory neuropathy.

    PubMed

    Silva, Magali Aparecida Orate Menezes da; Piatto, Vânia Belintani; Maniglia, Jose Victor

    2015-01-01

    Mutations in the otoferlin gene are responsible for auditory neuropathy. To investigate the prevalence of mutations in the mutations in the otoferlin gene in patients with and without auditory neuropathy. This original cross-sectional case study evaluated 16 index cases with auditory neuropathy, 13 patients with sensorineural hearing loss, and 20 normal-hearing subjects. DNA was extracted from peripheral blood leukocytes, and the mutations in the otoferlin gene sites were amplified by polymerase chain reaction/restriction fragment length polymorphism. The 16 index cases included nine (56%) females and seven (44%) males. The 13 deaf patients comprised seven (54%) males and six (46%) females. Among the 20 normal-hearing subjects, 13 (65%) were males and seven were (35%) females. Thirteen (81%) index cases had wild-type genotype (AA) and three (19%) had the heterozygous AG genotype for IVS8-2A-G (intron 8) mutation. The 5473C-G (exon 44) mutation was found in a heterozygous state (CG) in seven (44%) index cases and nine (56%) had the wild-type allele (CC). Of these mutants, two (25%) were compound heterozygotes for the mutations found in intron 8 and exon 44. All patients with sensorineural hearing loss and normal-hearing individuals did not have mutations (100%). There are differences at the molecular level in patients with and without auditory neuropathy. Copyright © 2015 Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial. Published by Elsevier Editora Ltda. All rights reserved.

  2. Human fructose-1,6-bisphosphatase gene (FBP1): Exon-intron organization, localization to chromosome bands 9q22.2-q22.3, and mutation screening in subjects with fructose-1,6-bisphosphatase deficiency

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    El-Maghrabi, M.R.; Jiang, W.

    1995-06-10

    Fructose-1,6-bisphosphatase (EC 3.1.3.11) is a key regulatory enzyme of gluconeogenesis that catalyzes the hydrolysis of fructose-1,6-bisphosphate to generate fructose-6-phosphate and inorganic phosphate. Deficiency of fructose-1,6-bisphosphatase is associated with fasting hypoglycemia and metabolic acidosis because of impaired gluconeogenesis. We have cloned and characterized the human liver fructose-1,6-bisphosphatase gene (FBP1). FBP1, localized to chromosome bands 9q22.2-q22.3 by fluorescence in situ hybridization, consists of seven exons that span > 31 kb, and the six introns are in the same position as in the rat gene. FBP1 was screened for mutations in two subjects with fructose-1,6-bisphosphatase deficiency. Four nucleotide substitutions were identified, two ofmore » which were silent mutations in the codons for Ala-216 (GCT {yields} GCC) and Gly-319 (GGG {yields} GGA). The other substitutions were in intron 3, a C {yields} T substitution 7 nucleotides downstream from the splice donor site, and in the promoter region, an A {yields} T substitution 188 nucleotides upstream from the start of transcription. These nucleotide substitutions were also found in normal unaffected subjects and thus are not the cause of fructose-1,6-bisphosphatase deficiency in the two subjects studied. The molecular basis of hepatic fructose-1,6-bisphosphatase deficiency in these subjects remains undetermined but could result from unidentified mutations in the promoter that decrease expression or from mutations in another gene that indirectly lead to decreased fructose-1,6-bisphosphatase activity. 18 refs., 3 figs., 3 tabs.« less

  3. Mutation analysis of the Fanconi Anemia Gene FACC

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Verlander, P.C.; Lin, J.D.; Udono, M.U.

    1994-04-01

    Fanconi anemia (FA) is a genetically heterogeneous autosomal recessive disorder characterized by a unique hypersensitivity of cells to DNA cross-linking agents; a gene for complementation group C (FACC) has recently been cloned. The authors have amplified FACC exons with their flanking intron sequences from genomic DNA from 174 racially and ethnically diverse families in the International Fanconi Anemia Registry and have screened for mutations by using SSCP analysis. They have identified eight different variants in 32 families; three were detected in exon 1, one in exon 4, one in intron 4, two in exon 6, and one in exon 14.more » Two of the eight variants, in seven families, did not segregate with the disease allele in multiplex families, suggesting that these variants represented benign polymorphisms. Disease-associated mutations in FACC were detected in a total of 25 (14.4%) of 174 families screened. The most frequent mutations were IVS4 + 4 A [yields] T (intron 4; 12 families) and 322delG (exon 1; 9 families). Other, less common mutations include Q13X in exon 1, R185X and D195V in exon 6, and L554P in exon 14. The polymorphisms were S26F in exon 1 and G139E in exon 4. All patients in the study with 322delG, Q13X, R185X, and D195V are of northern or eastern European or southern Italian ancestry, and 18 of 19 have a mild form of the disease, while the 2 patients with L554P, both from the same family, have a severe phenotype. All 19 patients with IVS4 + 4 A [yields] T have Jewish ancestry and have a severe phenotype. 19 refs., 1 fig., 3 tabs.« less

  4. Intriguing Balancing Selection on the Intron 5 Region of LMBR1 in Human Population

    PubMed Central

    He, Fang; Wu, Dong-Dong; Kong, Qing-Peng; Zhang, Ya-Ping

    2008-01-01

    Background The intron 5 of gene LMBR1 is the cis-acting regulatory module for the sonic hedgehog (SHH) gene. Mutation in this non-coding region is associated with preaxial polydactyly, and may play crucial roles in the evolution of limb and skeletal system. Methodology/Principal Findings We sequenced a region of the LMBR1 gene intron 5 in East Asian human population, and found a significant deviation of Tajima's D statistics from neutrality taking human population growth into account. Data from HapMap also demonstrated extended linkage disequilibrium in the region in East Asian and European population, and significantly low degree of genetic differentiation among human populations. Conclusion/Significance We proposed that the intron 5 of LMBR1 was presumably subject to balancing selection during the evolution of modern human. PMID:18698406

  5. Evolutionary pattern of mutation in the factor IX genes of great apes: How does it compare to the pattern of recent germline mutation in patients with hemophilia B?

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grouse, L.H.; Ketterling, R.P.; Sommer, S.S.

    Most mutations causing hemophilia B have arisen within the past 150 years. By correcting for multiple biases, the underlying rates of spontaneous germline mutation have been estimated in the factor IX gene. From these rates, an underlying pattern of mutation has emerged. To determine if this pattern compares to a underlying pattern found in the great apes, sequence changes were determined in intronic regions of the factor IX gene. The following species were studied: Gorilla gorilla, Pan troglodytes (chimpanzee), Pongo pygmacus (orangutan) and Homo sapiens. Intronic sequences at least 200 bp from a splice junction were randomly chosen, amplified bymore » cross-species PCR, and sequenced. These regions are expected to be subject to little if any selective pressure. Early diverged species of Old World monkeys were also studied to help determine the direction of mutational changes. A total of 62 sequence changes were observed. Initial data suggest that the average pattern since evolution of the great apes has a paucity of transitions at CpG dinucleotides and an excess of microinsertions to microdeletions when compared to the pattern observed in humans during the past 150 years (p<.05). A larger study is in progress to confirm these results.« less

  6. A novel pathogenic splice acceptor site germline mutation in intron 14 of the APC gene in a Chinese family with familial adenomatous polyposis.

    PubMed

    Wang, Dan; Liang, Shengyun; Zhang, Zhao; Zhao, Guoru; Hu, Yuan; Liang, Shengran; Zhang, Xipeng; Banerjee, Santasree

    2017-03-28

    Familial adenomatous polyposis (FAP) is an autosomal dominant precancerous condition, clinically characterized by the presence of multiple colorectal adenomas or polyps. Patients with FAP has a high risk of developing colorectal cancer (CRC) from these colorectal adenomatous polyps by the mean age of diagnosis at 40 years. Germline mutations of the APC gene cause familial adenomatous polyposis (FAP). Colectomy has recommended for the FAP patients with significant polyposis. Here, we present a clinical molecular study of a four generation Chinese family with FAP. Clinical diagnosis of FAP has been done according to the phenotype, family history and medical records. Patient's blood samples were collected and genomic DNA was extracted. In order to identify the pathogenic mutation underlying the disease phenotype targeted next-generation sequencing and confirmatory sanger sequencing has undertaken. Targeted next generation sequencing identified a novel heterozygous splice-acceptor site mutation [c.1744-1G>A] in intron 14 of APC gene, which is co-segregated with the FAP phenotypes in the proband and amongst all the affected family members. This mutation is not present in unaffected family members and in normal healthy controls of same ethnic origin. According to the LOVD database for Chinese colorectal cancer patients, in Chinese population, 60% of the previously reported APC gene mutations causes FAP, are missense mutations. This novel splice-acceptor site mutation causing FAP in this Chinese family expands the germline mutation spectrum of the APC gene in the Chinese population.

  7. Rare Noncoding Mutations Extend the Mutational Spectrum in the PGAP3 Subtype of Hyperphosphatasia with Mental Retardation Syndrome

    PubMed Central

    Knaus, Alexej; Awaya, Tomonari; Helbig, Ingo; Afawi, Zaid; Pendziwiat, Manuela; Abu‐Rachma, Jubran; Thompson, Miles D.; Cole, David E.; Skinner, Steve; Annese, Fran; Canham, Natalie; Schweiger, Michal R.; Robinson, Peter N.; Mundlos, Stefan; Kinoshita, Taroh; Munnich, Arnold

    2016-01-01

    ABSTRACT HPMRS or Mabry syndrome is a heterogeneous glycosylphosphatidylinositol (GPI) anchor deficiency that is caused by an impairment of synthesis or maturation of the GPI‐anchor. The expressivity of the clinical features in HPMRS varies from severe syndromic forms with multiple organ malformations to mild nonsyndromic intellectual disability. In about half of the patients with the clinical diagnosis of HPMRS, pathogenic mutations can be identified in the coding region in one of the six genes, one among them is PGAP3. In this work, we describe a screening approach with sequence specific baits for transcripts of genes of the GPI pathway that allows the detection of functionally relevant mutations also including introns and the 5′ and 3′ UTR. By this means, we also identified pathogenic noncoding mutations, which increases the diagnostic yield for HPMRS on the basis of intellectual disability and elevated serum alkaline phosphatase. In eight affected individuals from different ethnicities, we found seven novel pathogenic mutations in PGAP3. Besides five missense mutations, we identified an intronic mutation, c.558‐10G>A, that causes an aberrant splice product and a mutation in the 3′UTR, c.*559C>T, that is associated with substantially lower mRNA levels. We show that our novel screening approach is a useful rapid detection tool for alterations in genes coding for key components of the GPI pathway. PMID:27120253

  8. The insulin-like growth factor 2 (IGF2) gene intron3-g.3072G>A polymorphism is not the only Sus scrofa chromosome 2p mutation affecting meat production and carcass traits in pigs: evidence from the effects of a cathepsin D (CTSD) gene polymorphism.

    PubMed

    Fontanesi, L; Speroni, C; Buttazzoni, L; Scotti, E; Dall'Olio, S; Nanni Costa, L; Davoli, R; Russo, V

    2010-07-01

    The objective of this study was to evaluate the effects of mutations in 2 genes [IGF2 and cathepsin D (CTSD)] that map on the telomeric end of the p arm of SSC2. In this region, an imprinted QTL affecting muscle mass and fat deposition was reported, and the IGF2 intron3-g.3072G>A substitution was identified as the causative mutation. In the same chromosome region, we assigned, by linkage mapping, the CTSD gene, a lysosomal proteinase, for which we previously identified an SNP in the 3'-untranslated region (AM933484, g.70G>A). We have already shown strong effects of this CTSD mutation on several production traits in Italian Large White pigs, suggesting a possible independent role of this marker in fatness and meat deposition in pigs. To evaluate this hypothesis, after having refined the map position of the CTSD gene by radiation hybrid mapping, we analyzed the IGF2 and the CTSD polymorphisms in 270 Italian Large White and 311 Italian Duroc pigs, for which EBV and random residuals from fixed models were calculated for several traits. Different association analyses were carried out to distinguish the effects of the 2 close markers. In the Italian Large White pigs, the results for IGF2 were highly significant for all traits when using either EBV or random residuals (e.g., using EBV: lean cuts, P = 2.2 x 10(-18); ADG, P = 2.6 x 10(-16); backfat thickness, P = 2.2 x 10(-9); feed:gain ratio, P = 2.3 x 10(-9); ham weight, P = 1.5 x 10(-6)). No effect was observed for meat quality traits. The IGF2 intron3-g.3072G>A mutation did not show any association in the Italian Duroc pigs, probably because of the small variability at this polymorphic site for this breed. However, a significant association was evident for the CTSD marker (P < 0.001) with EBV of all carcass and production traits in Italian Duroc pigs (lean content, ADG, backfat thickness, feed:gain ratio) after excluding possible confounding effects of the IGF2 mutation. The effects of the CTSD g.70G>A mutation were also confirmed in a subset of Italian Large White animals carrying the homozygous genotype IGF2 intron3-g.3072GG, and by haplotype analysis between the markers of the 2 considered genes in the complete data set. Overall, these results indicate that the IGF2 intron3-g.3072G>A mutation is not the only polymorphism affecting fatness and muscle deposition on SSC2p. Therefore, the CTSD g.70G>A polymorphism could be used to increase selection efficiency in marker-assisted selection programs that already use the IGF2 mutation. However, for practical applications, because the CTSD gene should not be imprinted (we obtained this information from expression analysis in adult skeletal muscle), the different modes of inheritance of the 2 genes have to be considered.

  9. Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

    PubMed

    Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

    2010-03-17

    To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

  10. Mutation analysis of COL4A3 and COL4A4 genes in a Chinese autosomal-dominant Alport syndrome family.

    PubMed

    Guo, Liwei; Li, Duan; Dong, Shuangshuang; Wan, Donghao; Yang, Baosheng; Huang, Yanmei

    2017-06-01

    Autosomal dominant Alport syndrome (ADAS) accounts for 5% of all cases of Alport syndrome (AS), a primary basement membrane disorder arising from mutations in genes encoding the type IV collagen protein family.Mutations in COL4A3 and COL4A4 genes were reported to be associated with ADAS. In this study, clinical data in a large consanguineous family with seven affected members were reviewed, and genomic DNA was extracted. For mutation screening, all exons of COL4A3 and COL4A4 genes were polymerase chain reaction-amplified and direct sequenced from genomic DNA, and the mutations were analyzed by comparing with members in this family, 100 ethnicitymatched controls and the sequence of COL4A3 and COL4A4 genes from GenBank. A novel mutation determining a nucleotide change was found, i.e. c.4195 A>T (p.Met1399Leu) at 44th exon of COL4A4 gene, and this mutation showed heterozygous in all patients of this family. Also a novel intron mutation (c.4127+11 C>T) was observed at COL4A4 gene. Thus the novel missense mutation c.4195 A>T (p.Met1399Leu) and the intron mutation (c.4127+11 C>T) at COL4A4 gene might be responsible for ADAS of this family. Our results broadened the spectrum of mutations in COL4A4 and had important implications in the diagnosis, prognosis, and genetic counselling of ADAS.

  11. A genetic cluster of patients with variant xeroderma pigmentosum with two different founder mutations.

    PubMed

    Munford, V; Castro, L P; Souto, R; Lerner, L K; Vilar, J B; Quayle, C; Asif, H; Schuch, A P; de Souza, T A; Ienne, S; Alves, F I A; Moura, L M S; Galante, P A F; Camargo, A A; Liboredo, R; Pena, S D J; Sarasin, A; Chaibub, S C; Menck, C F M

    2017-05-01

    Xeroderma pigmentosum (XP) is a rare human syndrome associated with hypersensitivity to sunlight and a high frequency of skin tumours at an early age. We identified a community in the state of Goias (central Brazil), a sunny and tropical region, with a high incidence of XP (17 patients among approximately 1000 inhabitants). To identify gene mutations in the affected community and map the distribution of the affected alleles, correlating the mutations with clinical phenotypes. Functional analyses of DNA repair capacity and cell-cycle responses after ultraviolet exposure were investigated in cells from local patients with XP, allowing the identification of the mutated gene, which was then sequenced to locate the mutations. A specific assay was designed for mapping the distribution of these mutations in the community. Skin primary fibroblasts showed normal DNA damage removal but abnormal DNA synthesis after ultraviolet irradiation and deficient expression of the Polη protein, which is encoded by POLH. We detected two different POLH mutations: one at the splice donor site of intron 6 (c.764 +1 G>A), and the other in exon 8 (c.907 C>T, p.Arg303X). The mutation at intron 6 is novel, whereas the mutation at exon 8 has been previously described in Europe. Thus, these mutations were likely brought to the community long ago, suggesting two founder effects for this rare disease. This work describes a genetic cluster involving POLH, and, particularly unexpected, with two independent founder mutations, including one that likely originated in Europe. © 2016 British Association of Dermatologists.

  12. Gaucher disease: A G[sup +1][yields]A[sup +1] IVS2 splice donor site mutation causing exon 2 skipping in the acid [beta]-glucosidase mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    He, Guo-Shun; Grabowski, G.A.

    1992-10-01

    Gaucher disease is the most frequent lysosomal storage disease and the most prevalent Jewish genetic disease. About 30 identified missense mutations are causal to the defective activity of acid [beta]-glucosidase in this disease. cDNAs were characterized from a moderately affected 9-year-old Ashkenazi Jewish Gaucher disease type 1 patient whose 80-years-old, enzyme-deficient, 1226G (Asn[sup 370][yields]Ser [N370S]) homozygous grandfather was nearly asymptomatic. Sequence analyses revealed four populations of cDNAs with either the 1226G mutation, an exact exon 2 ([Delta] EX2) deletion, a deletion of exon 2 and the first 115 bp of exon 3 ([Delta] EX2-3), or a completely normal sequence. Aboutmore » 50% of the cDNAs were the [Delta] EX2, the [Delta] EX2-3, and the normal cDNAs, in a ratio of 6:3:1. Specific amplification and characterization of exon 2 and 5[prime] and 3[prime] intronic flanking sequences from the structural gene demonstrated clones with either the normal sequence or with a G[sup +1][yields]A[sup +1] transition at the exon 2/intron 2 boundary. This mutation destroyed the splice donor consensus site (U1 binding site) for mRNA processing. This transition also was present at the corresponding exon/intron boundary of the highly homologous pseudogene. This new mutation, termed [open quotes]IVS2 G[sup +1],[close quotes] is the first in the Ashkenazi Jewish population. The occurrence of this [open quotes]pseudogene[close quotes]-type mutation in the structural gene indicates the role of acid [beta]-glucosidase pseudogene and structural gene rearrangements in the pathogenesis of this disease. 33 refs., 8 figs., 1 tab.« less

  13. Identification of single nucleotide polymorphisms in the agouti signaling protein (ASIP) gene in some goat breeds in tropical and temperate climates.

    PubMed

    Adefenwa, Mufliat A; Peters, Sunday O; Agaviezor, Brilliant O; Wheto, Matthew; Adekoya, Khalid O; Okpeku, Moses; Oboh, Bola; Williams, Gabriel O; Adebambo, Olufunmilayo A; Singh, Mahipal; Thomas, Bolaji; De Donato, Marcos; Imumorin, Ikhide G

    2013-07-01

    The agouti-signaling protein (ASIP) plays a major role in mammalian pigmentation as an antagonist to melanocortin-1 receptor gene to stimulate pheomelanin synthesis, a major pigment conferring mammalian coat color. We sequenced a 352 bp fragment of ASIP gene spanning part of exon 2 and part of intron 2 in 215 animals representing six goat breeds from Nigeria and the United States: West African Dwarf, predominantly black; Red Sokoto, mostly red; and Sahel, mostly white from Nigeria; black and white Alpine, brown and white Spanish and white Saanen from the US. Twenty haplotypes from nine mutations representing three intronic, one silent and five missense (p.S19R, p.N35K, p.L36V, p.M42L and p.L45W) mutations were identified in Nigerian goats. Approximately 89 % of Nigerian goats carry haplotype 1 (TGCCATCCG) which seems to be the wild type configuration of mutations in this region of the gene. Although we found no association between these polymorphisms in the ASIP gene and coat color in Nigerian goats, in-silico functional analysis predicts putative deleterious functional impact of the p.L45W mutation on the basic amino-terminal domain of ASIP. In the American goats, two intronic mutations, g.293G>A and g.327C>A, were identified in the Alpine breed, although the g.293G>A mutation is common to American and Nigerian goat populations. All Sannen and Sahel goats in this study belong to haplotypes 1 of both populations which seem to be the wild-type composite ASIP haplotype. Overall, there was no clear association of this portion of the ASIP gene interrogated in this study with coat color variation. Therefore, additional genomic analyses of promoter sequence, the entire coding and non-coding regions of the ASIP gene will be required to obtain a definite conclusion.

  14. Primary hyperoxaluria type 1: diagnostic relevance of mutations and polymorphisms in the alanine:glyoxylate aminotransferase gene (AGXT).

    PubMed

    Tarn, A C; von Schnakenburg, C; Rumsby, G

    1997-09-01

    Primary hyperoxaluria type 1 (PH1) is an autosomal recessive disorder of glyoxylate metabolism caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The disease shows considerable phenotypic, enzymatic and genetic heterogeneity. To date, 7 polymorphisms and 11 point mutations have been described in the gene encoding AGT. We report on the prevalence of these polymorphisms and mutations in 79 patients with PH1 with the aim of assessing their diagnostic relevance. A strong association of the C154T, intron 1 insertion and C386T polymorphisms is confirmed and this linkage extends to include the type 1 variant of a polymorphic tandem repeat in intron 4. Only 64 of 158 (40%) PH1 alleles have one of the defined mutations, with the G630A mutation accounting for 39 of these and T853C for 14. Overall only 20 (25%) of the patients studied had the genetic basis of their disease fully explained: 7 were homozygous for the G630A mutation, 5 were homozygous for the T853C mutation, 1 was homozygous for the C819T mutation, and 7 had two different mutations identified and were presumed to be compound heterozygotes. Only the two more frequent G630A and T853C mutations are of general diagnostic relevance for mutation screening. It seems likely that there are a significant number of other mutations, perhaps family-specific, still to be described. There was no apparent difference in the types of mutations in patients presenting in the first year of life (36%), suggesting that other factors, such as periods of dehydration or urinary tract infections, might contribute more to the clinical manifestation than genotype.

  15. Identification of four novel mutations in the COL4A5 gene of patients with Alport syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lemmink, H.H.; Schroeder, C.H.; Brunner, H.G.

    1993-08-01

    The type IV collagen [alpha]5 chain (COL4A5) genes of patients with Alport syndrome were tested for major gene rearrangements by Southern blot analysis, using COL4A5 cDNA clones as probes. In addition, individual exons were screened for small mutations by single-strand conformation polymorphism (SSCP) analysis. Four new COL4A5 mutations were detected. A duplication of the nine most 3[prime] located nucleotides of exon 49 and the first nucleotide of intron 49 was identified in the COL4A5 gene of one patient. Two patients displayed single base substitutions leading to, respectively, a proline to threonine and an arginine to glutamine substitution in the C-terminalmore » end. Both substitutions involve amino acids conserved through evolution. In COL4A5 intron 41 a mutation changing the splice acceptor site from AG to AA was identified. All mutations cosegregate with the clinical phenotype of Alport syndrome in affected family members. In a control population of 50 individuals tested by PCR-SSCP these mutations were never identified. Together with two mutations reported previously, a total of six mutations were found in 26 patients with Alport syndrome (23%) after systematic screening of about 30% of the COL4A5 coding region. The clinical features of these six patients are described in detail. 21 refs., 2 figs., 3 tabs.« less

  16. FgPrp4 Kinase Is Important for Spliceosome B-Complex Activation and Splicing Efficiency in Fusarium graminearum

    PubMed Central

    Jiang, Cong; Li, Yang; Li, Chaohui; Liu, Huiquan; Kang, Zhensheng; Xu, Jin-Rong

    2016-01-01

    PRP4 encodes the only kinase among the spliceosome components. Although it is an essential gene in the fission yeast and other eukaryotic organisms, the Fgprp4 mutant was viable in the wheat scab fungus Fusarium graminearum. Deletion of FgPRP4 did not block intron splicing but affected intron splicing efficiency in over 60% of the F. graminearum genes. The Fgprp4 mutant had severe growth defects and produced spontaneous suppressors that were recovered in growth rate. Suppressor mutations were identified in the PRP6, PRP31, BRR2, and PRP8 orthologs in nine suppressor strains by sequencing analysis with candidate tri-snRNP component genes. The Q86K mutation in FgMSL1 was identified by whole genome sequencing in suppressor mutant S3. Whereas two of the suppressor mutations in FgBrr2 and FgPrp8 were similar to those characterized in their orthologs in yeasts, suppressor mutations in Prp6 and Prp31 orthologs or FgMSL1 have not been reported. Interestingly, four and two suppressor mutations identified in FgPrp6 and FgPrp31, respectively, all are near the conserved Prp4-phosphorylation sites, suggesting that these mutations may have similar effects with phosphorylation by Prp4 kinase. In FgPrp31, the non-sense mutation at R464 resulted in the truncation of the C-terminal 130 aa region that contains all the conserved Prp4-phosphorylation sites. Deletion analysis showed that the N-terminal 310-aa rich in SR residues plays a critical role in the localization and functions of FgPrp4. We also conducted phosphoproteomics analysis with FgPrp4 and identified S289 as the phosphorylation site that is essential for its functions. These results indicated that FgPrp4 is critical for splicing efficiency but not essential for intron splicing, and FgPrp4 may regulate pre-mRNA splicing by phosphorylation of other components of the tri-snRNP although itself may be activated by phosphorylation at S289. PMID:27058959

  17. Development of Yeast as an In Vivo Test Tube to Characterize a Broad Spectrum of p53 Mutations Associated with Breast Cancer

    DTIC Science & Technology

    2002-10-01

    there is a mutation in the p53 gene itself (4, 5). Interestingly, -80% of p53 mutations are missense changes that lead to single amino acid...substitutions, a feature that distinguishes p53 from other tumor suppressor genes (e.g., APC, NF1, BRCAJ) (6). The incidence of p53 mutations and the types of...intronic promoter is contained within the human mutation hotspot maps of p53: correlation with p53 protein structural and mdm2 gene . Nucleic Acids Res

  18. Mechanisms and Regulation of Alternative Pre-mRNA Splicing

    PubMed Central

    Lee, Yeon

    2015-01-01

    Precursor messenger RNA (pre-mRNA) splicing is a critical step in the posttranscriptional regulation of gene expression, providing significant expansion of the functional proteome of eukaryotic organisms with limited gene numbers. Split eukaryotic genes contain intervening sequences or introns disrupting protein-coding exons, and intron removal occurs by repeated assembly of a large and highly dynamic ribonucleoprotein complex termed the spliceosome, which is composed of five small nuclear ribonucleoprotein particles, U1, U2, U4/U6, and U5. Biochemical studies over the past 10 years have allowed the isolation as well as compositional, functional, and structural analysis of splicing complexes at distinct stages along the spliceosome cycle. The average human gene contains eight exons and seven introns, producing an average of three or more alternatively spliced mRNA isoforms. Recent high-throughput sequencing studies indicate that 100% of human genes produce at least two alternative mRNA isoforms. Mechanisms of alternative splicing include RNA–protein interactions of splicing factors with regulatory sites termed silencers or enhancers, RNA–RNA base-pairing interactions, or chromatin-based effects that can change or determine splicing patterns. Disease-causing mutations can often occur in splice sites near intron borders or in exonic or intronic RNA regulatory silencer or enhancer elements, as well as in genes that encode splicing factors. Together, these studies provide mechanistic insights into how spliceosome assembly, dynamics, and catalysis occur; how alternative splicing is regulated and evolves; and how splicing can be disrupted by cis- and trans-acting mutations leading to disease states. These findings make the spliceosome an attractive new target for small-molecule, antisense, and genome-editing therapeutic interventions. PMID:25784052

  19. Prenatal diagnosis for a novel splice mutation of PHEX gene in a large Han Chinese family affected with X-linked hypophosphatemic rickets.

    PubMed

    Qiu, Guangrong; Liu, Caixia; Zhou, Jingyi; Liu, Peiyan; Wang, Jun; Jiang, Hongkun; Hou, Zhiyan; Zhao, Yanyan; Sun, Kailai; Li-Ling, Jesse

    2010-06-01

    X-linked hypophosphatemia (XLH) is the most common form of heritable rickets characterized by X-linked dominant inheritance, renal phosphate wasting, hypophosphatemia, and defective bone mineralization. Inactivating mutations of the PHEX gene located at Xp22.1 have been linked with this disease. Ethnic distribution of such mutations seems widespread but only a few mutations in the Chinese population have been reported to date. We report on a large Han Chinese family affected with XLH rickets, which included 13 patients from four generations. Polymerase chain reaction and direct sequencing were performed for all exons and intron-exon boundaries of the PHEX gene. The effect of nucleotide changes was analyzed using bioinformatic software. Prenatal diagnosis was performed on umbilical cord blood at the 20th gestational week. A novel G-->A splice mutation in intron 7 (c.849+1G>A) was identified in all patients from the family. As confirmed by reverse-transcription (RT)-polymerase chain reaction (PCR), the mutation has rendered loss of a normal splice donor site (c.849+1G) while activating a cryptic one at c.849+519G, which resulted in addition of 518 nucleotides to the mature RNA. Prenatal diagnosis had excluded the fetus for carrying the same mutation. A healthy boy was born later. A novel splice mutation c.849+1G>A in the PHEX gene is responsible for XLH in the studied family. Further studies may enhance our understanding of the role of this mutation in the pathogenesis of XLH.

  20. [Mutation analysis of the PAH gene in children with phenylketonuria from the Qinghai area of China].

    PubMed

    He, Jiang; Wang, Hui-Zhen; Xu, Fa-Liang; Yang, Xi; Wang, Rui; Zou, Hong-Yun; Yu, Wu-Zhong

    2015-11-01

    To study the mutation characteristics of the phenylalanine hydroxylase (PAH) gene in children with phenylketonuria (PKU) from the Qinghai area of China, in order to provide basic information for genetic counseling and prenatal diagnosis. Mutations of the PAH gene were detected in the promoter and exons 1-13 and their flanking intronic sequences of PAH gene by PCR and DNA sequencing in 49 children with PKU and their parents from the Qinghai area of China. A total of 30 different mutations were detected in 80 out of 98 mutant alleles (82%), including 19 missense (63%), 5 nonsense (17%), 3 splice-site (10%) and 3 deletions (10%). Most mutations were detected in exons 3, 6, 7, 11 and intron 4 of PAH gene. The most frequent mutations were p.R243Q (19%), IVS4-1G>A (9%), p.Y356X (7%) and p.EX6-96A>G(5%). Two novel mutations p.N93fsX5 (c.279-282delCATC) and p.G171E (c.512G>A) were found. p.H64fsX9(c.190delC) was documented for the second time in Chinese PAH gene. The mutation spectrum of the gene PAH in the Qinghai population was similar to that in other populations in North China while significantly different from that in the populations from some provinces in southern China, Japan and Europe. The mutations of PAH gene in the Qinghai area of China demonstrate a unique diversity, complexity and specificity.

  1. [Identifying and sequence analysis of HLA-B*2736].

    PubMed

    Li, Zhen; Zou, Hong-Yan; Shao, Chao-Peng; Tang, Si; Wang, Da-Ming; Cheng, Liang-Hong

    2007-11-01

    An unknown HLA-B allele which was similar to HLA-B*270401 was detected by FLOW-SSOPCR-SSP and heterozygous sequence-based typing (SBT) in Chinese Han individual. Its anomalous patterns suggested the possible presence of new allele. Amplifying exon 2-5(include intron 2-4) of the HLA-B*27 allele separately by using allele-specific primers and sequencing in both directions. Identifying the difference between the novel B*27 allele and B*270401. The sequence of novel B*27 from exon 2 to partial exon 5 is 1 815 bp. There are 10 nt changes from B*270401 in exon 3-4, at nt634where A-->C(codon130 AGC-->CGC, 130 S-->R); nt670 where A-->T (codon142 ACC-->TCC, 142 T-->S); nt683 where G-->T (codon146 TGG-->TTG, 146 W-->L); nt698 where A-->T (codon151 GAG-->GTG, 151 E-->V); nt774 where G-->C (codon176 GAG-->GAC, 176 E-->D); nt776 where C-->A (codon177 ACG-->AAG, 177 T-->K); nt781 where C-->G (codon179 CAG-->GAG, 179Q-->E); nt789 where G-->T (codon181 GCG-->GCT) resulting no coding change; nt1438 where C-->T (codon206 GGC-->GGT) resulting no coding change; nt1449 where G-->C (codon210 GGG-->GCG, 210G-->A). In IMGT/HLA database, only three alleles (B*270502/2706/2732) have sequences of introns. The same sequence in intron 2 showed homology between the novel HLA-B*27 allele and B*2706, but their homology could not be supported in intron 3-4. Comparing the sequence of the novel B*27 allele in intron 3 and 4 with B*27 group, it showed there are three mutations at nt106 C-->G, nt179 G-->A, nt536 G-->A and one deletion at nt168 in intron 3 and one mutations at nt82 T-->C in intron 4, but the sequence of the novel B*27 allele in intron 3 and 4 was all the same to B*070201. The sequence was submitted to Gen-Bank and the accession number was DQ915176. The allele has been confirmed as an extension of B*2736 by the WHO Nomenclature committee in November 2006.

  2. Mitogenome rearrangement in the cold-water scleractinian coral Lophelia pertusa (Cnidaria, Anthozoa) involves a long-term evolving group I intron.

    PubMed

    Emblem, Åse; Karlsen, Bård Ove; Evertsen, Jussi; Johansen, Steinar D

    2011-11-01

    Group I introns are genetic insertion elements that invade host genomes in a wide range of organisms. In metazoans, however, group I introns are extremely rare, so far only identified within mitogenomes of hexacorals and some sponges. We sequenced the complete mitogenome of the cold-water scleractinian coral Lophelia pertusa, the dominating deep sea reef-building coral species in the North Atlantic Ocean. The mitogenome (16,150 bp) has the same gene content but organized in a unique gene order compared to that of other known scleractinian corals. A complex group I intron (6460 bp) inserted in the ND5 gene (position 717) was found to host seven essential mitochondrial protein genes and one ribosomal RNA gene. Phylogenetic analysis supports a vertical inheritance pattern of the ND5-717 intron among hexacoral mitogenomes with no examples of intron loss. Structural assessments of the Lophelia intron revealed an unusual organization that lacks the universally conserved ωG at the 3' end, as well as a highly compact RNA core structure with overlapping ribozyme and protein coding capacities. Based on phylogenetic and structural analyses we reconstructed the evolutionary history of ND5-717, from its ancestral protist origin, through intron loss in some early metazoan lineages, and into a compulsory feature with functional implications in hexacorals. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

    PubMed

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

    2013-01-01

    To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

  4. A novel point mutation (G[sup [minus]1] to T) in a 5[prime] splice donor site of intron 13 of the dystrophin gene results in exon skipping and is responsible for Becker Muscular Dystrophy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hagiwara, Yoko; Nishio, Hisahide; Kitoh, Yoshihiko

    1994-01-01

    The mutations in one-third of Duchenne and Becker muscular dystrophy patients remain unknown, as they do not involve gross rearrangements of the dystrophin gene. The authors now report a defect in the splicing of precursor mRNA (pre-mRNA), resulting from a maternally inherited mutation of the dystrophin gene in a patient with Becker muscular dystrophy. This defect results from a G-to-T transversion at the terminal nucleotide of exon 13, within the 5[prime] splice site of intron 13, and causes complete skipping of exon 13 during processing of dystrophin pre-mRNA. The predicted polypeptide encoded by the aberrant mRNA is a truncated dystrophinmore » lacking 40 amino acids from the amino-proximal end of the rod domain. This is the first report of an intraexon point mutation that completely inactivates a 5[prime] splice donor site in dystrophin pre-mRNA. Analysis of the genomic context of the G[sup [minus]1]-to-T mutation at the 5[prime] splice site supports the exon-definition model of pre-mRNA splicing and contributes to the understanding of splice-site selection. 48 refs., 5 figs.« less

  5. Genetic Testing Confirmed the Early Diagnosis of X-Linked Hypophosphatemic Rickets in a 7-Month-Old Infant

    PubMed Central

    Poon, Kok Siong; Sng, Andrew Anjian; Ho, Cindy Weili; Koay, Evelyn Siew-Chuan

    2015-01-01

    Loss-of-function mutations in the phosphate regulating gene with homologies to endopeptidases on the X-chromosome (PHEX) have been causally associated with X-linked hypophosphatemic rickets (XLHR). The early diagnosis of XLHR in infants is challenging when it is based solely on clinical features and biochemical findings. We report a 7-month-old boy with a family history of hypophosphatemic rickets., who demonstrated early clinical evidence of rickets, although serial biochemical findings could not definitively confirm rickets. A sequencing assay targeting the PHEX gene was first performed on the mother’s DNA to screen for mutations in the 5′UTR, 22 coding exons, and the exon-intron junctions. Targeted mutation analysis and mRNA studies were subsequently performed on the boys’ DNA to investigate the pathogenicity of the identified mutation. Genetic screening of the PHEX gene revealed a novel mutation, c.1080-2A>C, at the splice acceptor site in intron 9. The detection of an aberrant mRNA transcript with skipped (loss of) exon 10 establishes its pathogenicity and confirms the diagnosis of XLHR in this infant. Genetic testing of the PHEX gene resulted in early diagnosis of XLHR, thus enabling initiation of therapy and prevention of progressive rachitic changes in the infant. PMID:26904698

  6. Tumor Genomic Profiling in Breast Cancer Patients Using Targeted Massively Parallel Sequencing

    DTIC Science & Technology

    2016-03-01

    recently, we identified several novel alterations in in ER+ breast tumors, including translocations in ESR1 , the gene that encodes the estrogen receptor...modified our bait design to include genomic coordinates across select introns in ESR1 . In addition, two papers from the Broad Institute published in...with PIK3CA mutations, 23% with ESR1 ligand-binding domain mutations, 9% with ERBB2 mutations, 9% with FGFR1/2 amplifications, and 1% with

  7. A novel heterozygous intronic mutation in POU1F1 is associated with combined pituitary hormone deficiency.

    PubMed

    Takagi, Masaki; Kamasaki, Hotaka; Yagi, Hiroko; Fukuzawa, Ryuji; Narumi, Satoshi; Hasegawa, Tomonobu

    2017-02-27

    POU class 1 homeobox 1 (POU1F1) regulates pituitary cell-specific gene expression of somatotropes, lactotropes, and thyrotropes. In humans, two POU1F1 isoforms (long and short isoform), which are generated by the alternative use of the splice acceptor site for exon 2, have been identified. To date, more than 30 POU1F1 mutations in patients with combined pituitary hormone deficiency (CPHD) have been described. All POU1F1 variants reported to date affect both the short and long isoforms of the POU1F1 protein; therefore, it is unclear at present whether a decrease in the function of only one of these two isoforms is sufficient for disease onset in humans. Here, we described a sibling case of CPHD carrying a heterozygous mutation in intron 1 of POU1F1. In vitro experiments showed that this mutation resulted in exon 2-skipping of only in the short isoform of POU1F1, while the long isoform remained intact. This result strongly suggests the possibility, for the first time, that isolated mutations in the short isoform of POU1F1 could be sufficient for induction of POU1F1-related CPHD. This finding improves our understanding of the molecular mechanisms, and developmental course associated with mutations in POU1F1.

  8. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    PubMed

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. Mutation analysis of the chromosome 14q24.3 dihydrolipoyl succinyltransferase (DLST) gene in patients with early-onset Alzheimer disease.

    PubMed

    Cruts, M; Backhovens, H; Van Gassen, G; Theuns, J; Wang, S Y; Wehnert, A; van Duijn, C M; Karlsson, T; Hofman, A; Adolfsson, R

    1995-10-13

    Linkage analysis studies have indicated that the chromosome band 14q24.3 harbours a major gene for familial early-onset Alzheimer's disease (AD). Recently we localized the chromosome 14 AD gene (AD3) in the 6.4 cM interval between the markers D14S289 and D14S61. We mapped the gene encoding dihydrolipoyl succinyltransferase (DLST), the E2k component of human alpha-ketoglutarate dehydrogenase complex (KGDHC), in the AD3 candidate region using yeast artificial chromosomes (YACs). The DLST gene is a candidate for the AD3 gene since deficiencies in KGDHC activity have been observed in brain tissue and fibroblasts of AD patients. The 15 exons and the promoter region of the DLST gene were analysed for mutations in chromosome 14 linked AD cases and in two series of unrelated early-onset AD cases (onset age < 55 years). Sequence variations in intronic sequences (introns 3, 5 and 10) or silent mutations in exonic sequences (exons 8 and 14) were identified. However, no AD related mutations were observed, suggesting that the DLST gene is not the chromosome 14 AD3 gene.

  10. [A compound heterozygosity mutation in the interleukin-7 receptor-alpha gene resulted in severe combined immunodeficiency in a Chinese patient].

    PubMed

    Zhang, Zhi-yong; Zhao, Xiao-dong; Wang, Mo; Yu, Jie; An, Yun-fei; Yang, Xi-qiang

    2009-09-01

    Mutation in the interleukin-7 receptor-alpha (IL-7R alpha) chain causes a rare type of severe combined immunodeficiency (SCID) with presence of NK cells in the peripheral blood. Here we report the molecular and clinical characterization of a compound heterozygosity mutation in the interleukin-7 receptor-alpha gene that resulted in SCID in a patient firstly from China. A 5 month-old male patient and his parents were enrolled in this study. Since 15 days of age, the patient had had recurrent fever, persistent cough and diarrhea. He was in poor general condition with pyorrhea and ulceration of the BCG scar. His brother died of severe infection at 4 months of age. He was initially diagnosed as SCID according to clinical manifestation and immunological analysis. A panel of SCID candidate genes including IL-2RG, RAG1/RAG2 and IL-7R alpha of patient and his parents were amplified by polymerase chain reaction (PCR) from genomic DNA. Reverse transcription polymerase chain reaction (RT-PCR) was used to amplify the IL-7R alpha transcripts. Sequencing was performed directly on the PCR products forward and reversely. The serum immunoglobulin (Ig) profile was IgG 6867 mg/L (normal range, 3050 - 8870 mg/L); IgM 206 mg/L and IgA 249 mg/L, IgE 2.3 IU/ml (normal range < 150 IU/ml). The patient was treated with IVIG previously. There were no T-cells but increased percentage of B-cells (58%) and NK cells (42%) in the peripheral blood was found. Needle biopsies from enlarged axillary lymph node was identified positive for Mycobacterium bovis under microscope and by culture. The patient had a compound heterozygosity mutation in the IL-7R alpha gene:on one allele, there was a splice-junction mutation in intron 4 (intron 4(+1)G > A), for which his father was a carrier; whereas on the other allele, a nonsense mutation at position 638 in exon 5 with a premature stop codon (638 C > T, R206X) was identified, for which his mother was a carrier. The splice-junction mutation in intron 4 of IL-7R alpha was firstly reported. The IL-7R alpha mRNA expression of the patient was remarkably reduced whereas the parents had relatively normal IL-7R alpha mRNA expression. IL-7R alpha cDNA of the patient was amplified by nested PCR. The PCR products were purified, cloned with a TA Cloning Kit and sequenced directly. A 64 bp deletion was found in exon 4 of IL-7R alpha. No mutation was found in IL-2RG and RAG1/RAG2 of the patient and his parents. This is the first case with a compound heterozygosity mutation in the IL-7R receptor alpha gene and T-B+NK+ phenotype from China. Intron 4(+1)G > A was a novel mutation.

  11. Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

    PubMed

    Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

    2016-12-01

    ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

  12. Computation of direct and inverse mutations with the SEGM web server (Stochastic Evolution of Genetic Motifs): an application to splice sites of human genome introns.

    PubMed

    Benard, Emmanuel; Michel, Christian J

    2009-08-01

    We present here the SEGM web server (Stochastic Evolution of Genetic Motifs) in order to study the evolution of genetic motifs both in the direct evolutionary sense (past-present) and in the inverse evolutionary sense (present-past). The genetic motifs studied can be nucleotides, dinucleotides and trinucleotides. As an example of an application of SEGM and to understand its functionalities, we give an analysis of inverse mutations of splice sites of human genome introns. SEGM is freely accessible at http://lsiit-bioinfo.u-strasbg.fr:8080/webMathematica/SEGM/SEGM.html directly or by the web site http://dpt-info.u-strasbg.fr/~michel/. To our knowledge, this SEGM web server is to date the only computational biology software in this evolutionary approach.

  13. Genetic variations in the MCT1 (SLC16A1) gene in the Chinese population of Singapore.

    PubMed

    Lean, Choo Bee; Lee, Edmund Jon Deoon

    2009-01-01

    MCT1(SLC16A1) is the first member of the monocarboxylate transporter (MCT) and its family is involved in the transportation of metabolically important monocarboxylates such as lactate, pyruvate, acetate and ketone bodies. This study identifies genetic variations in SLC16A1 in the ethnic Chinese group of the Singaporean population (n=95). The promoter, coding region and exon-intron junctions of the SLC16A1 gene encoding the MCT1 transporter were screened for genetic variation in the study population by DNA sequencing. Seven genetic variations of SLC16A1, including 4 novel ones, were found: 2 in the promoter region, 2 in the coding exons (both nonsynonymous variations), 2 in the 3' untranslated region (3'UTR) and 1 in the intron. Of the two mutations detected in the promoter region, the -363-855T>C is a novel mutation. The 1282G>A (Val(428)Ile) is a novel SNP and was found as heterozygotic in 4 subjects. The 1470T>A (Asp(490)Glu) was found to be a common polymorphism in this study. Lastly, IVS3-17A>C in intron 3 and 2258 (755)A>G in 3'UTR are novel mutations found to be common polymorphisms in the local Chinese population. To our knowledge, this is the first report of a comprehensive analysis on the MCT1 gene in any population.

  14. Common founder mutation in the LDL receptor gene causing familial hypercholesterolaemia in the Icelandic population.

    PubMed

    Gudnason, V; Sigurdsson, G; Nissen, H; Humphries, S E

    1997-01-01

    Haplotype analysis in 18 apparently unrelated families with familial hypercholesterolaemia (FH) in Iceland has identified at least five different chromosomes cosegregating with hypercholesterolaemia. The most common haplotype was identified in 11 of the 18 families, indicating a responsible for FH in the Icelandic population. By using single-strand conformation polymorphism (SSCP) and direct sequencing of amplified DNA, we identified a novel mutation (a T to a C) in the second nucleotide in the 5' part of intron 4 in the LDL receptor gene. This mutation was present in approximately 60% of the FH families (10/18), supporting the prediction of a common founder. These families could be traced to a common ancestor in half of the cases by going back no further than the eighteenth century. The mutation was predicted to affect correct splicing of exon 4, and analysis at the cellular level demonstrated an abnormal mRNA containing intron 4 sequence in lymphoblastoid cells from a patient carrying this mutation. Translation of the mRNA would lead to a premature stop codon and a truncated nonfunctional protein of 285 amino acids. The novel sequence change created a new restriction site for the restriction endonuclease NlaIII, and using this assay, 29 unrelated individuals with possible FH attending a lipid clinic for treatment were examined for this mutation. Two individuals in this group of patients were found to be carriers of this mutation, supporting the suggestion of a founder mutation. Using this assay for the detection of FH in the Icelandic population should identify > 60% of these individuals.

  15. Two Novel HOGA1 Splicing Mutations Identified in a Chinese Patient with Primary Hyperoxaluria Type 3.

    PubMed

    Wang, Xinsheng; Zhao, Xiangzhong; Wang, Xiaoling; Yao, Jian; Zhang, Feifei; Lang, Yanhua; Tuffery-Giraud, Sylvie; Bottillo, Irene; Shao, Leping

    2015-01-01

    Twenty-six HOGA1 mutations have been reported in primary hyperoxaluria (PH) type 3 (PH3) patients with c.700 + 5G>T accounting for about 50% of the total alleles. However, PH3 has never been described in Asians. A Chinese child with early-onset nephrolithiasis was suspected of having PH. We searched for AGXT, GRHPR and HOGA1 gene mutations in this patient and his parents. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Two heterozygous mutations not previously described in the literature about HOGA1 were identified (compound heterozygous). One mutation was a successive 2 bp substitution at the last nucleotide of exon 6 and at the first nucleotide of intron 6, respectively (c.834_834 + 1GG>TT), while the other one was a guanine to adenine substitution of the last nucleotide of exon 6 (c.834G>A). Direct sequencing analysis failed to find these mutations in 100 unrelated healthy subjects and the functional role on splicing of both variants found in this study was confirmed by a minigene assay based on the pSPL3 exon trapping vector. In addition, we found a SNP in this family (c.715G>A, p.V239I). There were no mutations detected in AGXT and GRHPR. Two novel HOGA1 mutations were identified in association with PH3. This is the first description and investigation on mutant gene analysis of PH3 in an Asian. © 2015 S. Karger AG, Basel

  16. Mutation profile of all 49 exons of the human myosin VIIA gene, and haplotype analysis, in Usher 1B families from diverse origins.

    PubMed

    Adato, A; Weil, D; Kalinski, H; Pel-Or, Y; Ayadi, H; Petit, C; Korostishevsky, M; Bonne-Tamir, B

    1997-10-01

    Usher syndrome types I (USH1A-USH1E) are a group of autosomal recessive diseases characterized by profound congenital hearing loss, vestibular areflexia, and progressive visual loss due to retinitis pigmentosa. The human myosin VIIA gene, located on 11q14, has been shown to be responsible for Usher syndrome type 1B (USH1B). Haplotypes were constructed in 28 USH1 families by use of the following polymorphic markers spanning the USH1B locus: D11S787, D11S527, D11S1789, D11S906, D11S4186, and OMP. Affected individuals and members of their families from 12 different ethnic origins were screened for the presence of mutations in all 49 exons of the myosin VIIA gene. In 15 families myosin VIIA mutations were detected, verifying their classification as USH1B. All these mutations are novel, including three missense mutations, one premature stop codon, two splicing mutations, one frameshift, and one deletion of >2 kb comprising exons 47 and 48, a part of exon 49, and the introns between them. Three mutations were shared by more than one family, consistent with haplotype similarities. Altogether, 16 USH1B haplotypes were observed in the 15 families; most haplotypes were population specific. Several exonic and intronic polymorphisms were also detected. None of the 20 known USH1B mutations reported so far in other world populations were identified in our families.

  17. Exome sequencing identifies complex I NDUFV2 mutations as a novel cause of Leigh syndrome.

    PubMed

    Cameron, Jessie M; MacKay, Nevena; Feigenbaum, Annette; Tarnopolsky, Mark; Blaser, Susan; Robinson, Brian H; Schulze, Andreas

    2015-09-01

    Two siblings with hypertrophic cardiomyopathy and brain atrophy were diagnosed with Complex I deficiency based on low enzyme activity in muscle and high lactate/pyruvate ratio in fibroblasts. Whole exome sequencing results of fibroblast gDNA from one sibling was narrowed down to 190 SNPs or In/Dels in 185 candidate genes by selecting non-synonymous coding sequence base pair changes that were not present in the SNP database. Two compound heterozygous mutations were identified in both siblings in NDUFV2, encoding the 24 kDa subunit of Complex I. The intronic mutation (c.IVS2 + 1delGTAA) is disease causing and has been reported before. The other mutation is novel (c.669_670insG, p.Ser224Valfs*3) and predicted to cause a pathogenic frameshift in the protein. Subsequent investigation of 10 probands with complex I deficiency from different families revealed homozygosity for the intronic c.IVS2 + 1delGTAA mutation in a second, consanguineous family. In this family three of five siblings were affected. Interestingly, they presented with Leigh syndrome but no cardiac involvement. The same genotype had been reported previously in a two families but presenting with hypertrophic cardiomyopathy, trunk hypotonia and encephalopathy. We have identified NDUFV2 mutations in two families with Complex I deficiency, including a novel mutation. The diagnosis of Leigh syndrome expands the clinical phenotypes associated with the c.IVS2 + 1delGTAA mutation in this gene. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

  18. Novel growth hormone receptor mutation in a Chinese patient with Laron syndrome.

    PubMed

    Hui, Hamilton N T; Metherell, Louise A; Ng, K L; Savage, Martin O; Camacho-Hübner, Cecilia; Clark, Adrian J L

    2005-02-01

    Laron syndrome, growth hormone (GH) insensitivity syndrome, caused by a mutation of the GH receptor (GHR) gene, is extremely rare in the Chinese population. We report a Chinese girl diagnosed with Laron syndrome at age 1.9 years with height -4.9 SDS, basal GH 344 mIU/ml, IGF-I <12 ng/ml, IGFBP-3 <0.2 mg/ml, and undetectable GHBP. A novel mutation of the GHR, not previously described, was identified at the donor splice site of intron 6.

  19. Rare intronic variants of TCF7L2 arising by selective sweeps in an indigenous population from Mexico.

    PubMed

    Acosta, Jose Luis; Hernández-Mondragón, Alma Cristal; Correa-Acosta, Laura Carolina; Cazañas-Padilla, Sandra Nathaly; Chávez-Florencio, Berenice; Ramírez-Vega, Elvia Yamilet; Monge-Cázares, Tulia; Aguilar-Salinas, Carlos A; Tusié-Luna, Teresa; Del Bosque-Plata, Laura

    2016-05-26

    Genetic variations of the TCF7L2 gene are associated with the development of Type 2 diabetes (T2D). The associated mutations have demonstrated an adaptive role in some human populations, but no studies have determined the impact of evolutionary forces on genetic diversity in indigenous populations from Mexico. Here, we sequenced and analyzed the variation of the TCF7L2 gene in three Amerindian populations and compared the results with whole-exon-sequencing of Mestizo populations from Sigma and the 1000 Genomes Project to assess the roles of selection and recombination in diversity. The diversity in the indigenous populations was biased to intronic regions. Most of the variation was low frequency. Only mutations rs77961654 and rs61724286 were located on exon 15. We did not observe variation in intronic region 4-6 in any of the three indigenous populations. In addition, we identified peaks of selective sweeps in the mestizo samples from the Sigma Project within this region. By replicating the analysis of association with T2D between case-controls from the Sigma Project, we determined that T2D was most highly associated with the rs7903146 risk allele and to a lesser extent with the other six variants. All associated markers were located in intronic region 4-6, and their r(2) values of linkage disequilibrium were significantly higher in the Mexican population than in Africans from the 1000 Genomes Project. We observed reticulations in both the haplotypes network analysis from seven marker associates and the neighborNet tree based on 6061 markers in the TCF7L2 gene identified from all samples of the 1000 Genomes Project. Finally, we identified two recombination hotspots in the upstream region and 3' end of the TCF7L2 gene. The lack of diversity in intronic region 4-6 in Indigenous populations could be an effect of selective sweeps generated by the selection of neighboring rare variants at T2D-associated mutations. The survivors' variants make the intronic region 4-6 the area of the greatest population differentiation within the TCF7L2 gene. The abundance of selective peak sweeps in the downstream region of the TCF7L2 gene suggests that the TCF7L2 gene is part of a region that is in constant recombination between populations.

  20. Lack of pathogenic mutations in SOS1 gene in phenytoin-induced gingival overgrowth patients.

    PubMed

    Margiotti, Katia; Pascolini, Giulia; Consoli, Federica; Guida, Valentina; Di Bonaventura, Carlo; Giallonardo, Anna Teresa; Pizzuti, Antonio; De Luca, Alessandro

    2017-08-01

    Gingival overgrowth is a side effect associated with some distinct classes of drugs, such as anticonvulsants, immunosuppressants, and calcium channel blockers. One of the main drugs associated with gingival overgrowth is the antiepileptic phenytoin, which affects gingival tissues by altering extracellular matrix metabolism. It has been shown that mutation of human SOS1 gene is responsible for a rare hereditary gingival fibromatosis type 1, a benign gingival overgrowth. The aim of the present study is to evaluate the possible contribution of SOS1 mutation to gingival overgrowth-related phenotype. We selected and screened for mutations a group of 24 epileptic patients who experienced significant gingival overgrowth following phenytoin therapy. Mutation scanning was carried out by denaturing high-performance liquid chromatography analysis of the entire coding region of the SOS1 gene. Novel identified variants were analyzed in-silico by using Alamut Visual mutation interpretation software, and comparison with normal control group was done. Mutation scanning of the entire coding sequence of SOS1 gene identified seven intronic variants and one new exonic substitution (c.138G>A). The seven common intronic variants were not considered to be of pathogenic importance. The exonic substitution c.138G>A was found to be absent in 100 ethnically matched normal control chromosomes, but was not expected to have functional significance based on prediction bioinformatics tools. This study represents the first mutation analysis of the SOS1 gene in phenytoin-induced gingival overgrowth epileptic patients. Present results suggest that obvious pathogenic mutations in the SOS1 gene do not represent a common mechanism underlying phenytoin-induced gingival overgrowth in epileptic patients; other mechanisms are likely to be involved in the pathogenesis of this drug-induced phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. A novel DARS2 mutation in a Japanese patient with leukoencephalopathy with brainstem and spinal cord involvement but no lactate elevation

    PubMed Central

    Shimojima, Keiko; Higashiguchi, Takafumi; Kishimoto, Kanako; Miyatake, Satoko; Miyake, Noriko; Takanashi, Jun-ichi; Matsumoto, Naomichi; Yamamoto, Toshiyuki

    2017-01-01

    The mitochondrial aspartyl-tRNA synthetase 2 gene (DARS2) is responsible for leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). A Japanese patient with LBSL showed compound heterozygous DARS2 mutations c.358_359delinsTC (p.Gly120Ser) and c.228-15C>G (splicing error). This provides further evidence that most patients with LBSL show compound heterozygous mutations in DARS2 in association with a common splicing mutation in the splicing acceptor site of intron 2. PMID:29138691

  2. Evaluation of the phospholamban gene in purebred large-breed dogs with dilated cardiomyopathy.

    PubMed

    Stabej, Polona; Leegwater, Peter A; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; van Oost, Bernard A

    2005-03-01

    To evaluate the role of the phospholamban gene in purebred large-breed dogs with dilated cardiomyopathy (DCM). 6 dogs with DCM, including 2 Doberman Pinschers, 2 Newfoundlands, and 2 Great Danes. All dogs had clinical signs of congestive heart failure, and a diagnosis of DCM was made on the basis of echocardiographic findings. Blood samples were collected from each dog, and genomic DNA was isolated by a salt extraction method. Specific oligonucleotides were designed to amplify the promoter, exon 1, the 5'-part of exon 2 including the complete coding region, and part of intron 1 of the canine phospholamban gene via polymerase chain reaction procedures. These regions were screened for mutations in DNA obtained from the 6 dogs with DCM. No mutations were identified in the promoter, 5' untranslated region, part of intron 1, part of the 3' untranslated region, and the complete coding region of the phospholamban gene in dogs with DCM. Results indicate that mutations in the phospholamban gene are not a frequent cause of DCM in Doberman Pinschers, Newfoundlands, and Great Danes.

  3. [Detection and prenatal diagnosis for RS1 gene mutations in two Chinese families with X-linked juvenile retinoschisis].

    PubMed

    Chu, Yan; Fang, Dong; Hou, Qiao-fang; Wang, Li-ya; Guo, Xi-rang; Wang, Ying-tai; Liao, Shi-xiu

    2013-04-01

    To identify potential mutations of retinoschisis 1 (RS1) gene responsible for X-linked retinoschisis (XLRS) in two Chinese families. The 6 exons and flanking intronic regions were analyzed with PCR and direct sequencing. Two RS1 mutations were identified in the two families, which included 1 frameshift mutation (c.573delG, p.Pro192fs) and 1 missense mutation (c.626G>A, p.Arg209His). Two RS1 mutations have been identified, among which Pro192fs mutation is discovered for the first time in Chinese population. Above results may enrich our understanding of the clinical manifestations of XLRS and facilitated early diagnosis and genetic counseling for the disease.

  4. A novel DSPP mutation causes dentinogenesis imperfecta type II in a large Mongolian family

    PubMed Central

    2010-01-01

    Background Several studies have shown that the clinical phenotypes of dentinogenesis imperfecta type II (DGI-II) may be caused by mutations in dentin sialophosphoprotein (DSPP). However, no previous studies have documented the clinical phenotype and genetic basis of DGI-II in a Mongolian family from China. Methods We identified a large five-generation Mongolian family from China with DGI-II, comprising 64 living family members of whom 22 were affected. Linkage analysis of five polymorphic markers flanking DSPP gene was used to genotype the families and to construct the haplotypes of these families. All five DSPP exons including the intron-exon boundaries were PCR-amplified and sequenced in 48 members of this large family. Results All affected individuals showed discoloration and severe attrition of their teeth, with obliterated pulp chambers and without progressive high frequency hearing loss or skeletal abnormalities. No recombination was found at five polymorphic markers flanking DSPP in the family. Direct DNA sequencing identified a novel A→G transition mutation adjacent to the donor splicing site within intron 3 in all affected individuals but not in the unaffected family members and 50 unrelated Mongolian individuals. Conclusion This study identified a novel mutation (IVS3+3A→G) in DSPP, which caused DGI-II in a large Mongolian family. This expands the spectrum of mutations leading to DGI-II. PMID:20146806

  5. Mutation and new polymorphisms insight in introns 11 to 14a of CFTR gene of northern Iranian cystic fibrosis patients.

    PubMed

    Esmaeili Dooki, Mohammad Reza; Tabaripour, Reza; Rahimi, Razieh; Akhavan-Niaki, Haleh

    2015-06-15

    Cystic fibrosis (CF) is the most common autosomal recessive disease in Caucasians, caused by mutation in cystic fibrosis transmembrane conductance regulator (CFTR). The type and distribution of mutations vary widely between different countries and ethnic groups. We therefore aimed to perform a comprehensive analysis of the CFTR gene in northern Iranian CF patients. Forty northern Iranian CF patients were analyzed for mutations in introns 11 to 14a of their CFTR genes, using sequencing and reverse dot blot methods. Five normal subjects were also analyzed as normal control. One mutation and seven polymorphisms were identified. Of the eighty alleles studied, c.2043delG in exon 13 represented 12.5% of mutant alleles and was associated with two distinct haplotypes. rs1042077T>G, rs4148712delAT, rs4148711T>A and rs3808183 T>C with frequencies varying between 29.2% and 6.9% for the least common allele, as well as three new polymorphisms c.1680-224C>A (11.1%), c.2491-275T>G (14.1%) and c.2491-274C>G (35.9%) were detected. These findings suggest a founder effect for c.2043delG in the Middle East and will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Identification of a novel splicing mutation in the growth hormone (GH)-releasing hormone receptor gene in a Chinese family with pituitary dwarfism.

    PubMed

    Wang, Qi; Diao, Ying; Xu, Zhenping; Li, Xiaohui; Luo, Xiao Ping; Xu, Haibo; Ouyang, Ping; Liu, Mugen; Hu, Zhongli; Wang, Qing K; Liu, Jing Yu

    2009-12-10

    A Chinese family with autosomal recessive pituitary dwarfism was identified and the proband was evaluated by MRI and hormonal analysis, which revealed pituitary dwarfism with a complete growth hormone deficiency. MRI showed a pituitary gland with a small anterior pituitary of 2.2mm and evidence of hypoplastic pituitary. Linkage analysis with markers spanning 17 known genes for dwarfism revealed linkage of the family to the growth hormone-releasing hormone receptor (GHRHR) gene. Mutational analysis of all exons and exon-intron boundaries of GHRHR was carried out using direct DNA sequence analysis. A novel homozygosis mutation, a G to A transition located in the splice donor site at the beginning of intron 8 (IVS8+1G>A), was identified in the proband. The two other patients in the family are homozygous, whereas the living mother of the proband is heterozygous for the IVS8+1G>A mutation. The mutation was not found in 100 normal chromosomes from healthy Chinese individuals of Han nationality. An in vitro splicing assay using HeLa cells transfected with expression vectors containing the normal or the mutant GHRHR minigenes consisting of genomic fragments spanning exons 7-9 showed that the IVS8+1G>A mutation caused abnormal splicing, which is predicted to give rise to truncation or frameshift, leading to severely truncated GHRHR proteins. These results provide strong evidence that the splicing mutation IVS8+1G>A of GHRHR is a cause of pituitary dwarfism in the Chinese family.

  7. A contracted DNA repeat in LHX3 intron 5 is associated with aberrant splicing and pituitary dwarfism in German shepherd dogs.

    PubMed

    Voorbij, Annemarie M W Y; van Steenbeek, Frank G; Vos-Loohuis, Manon; Martens, Ellen E C P; Hanson-Nilsson, Jeanette M; van Oost, Bernard A; Kooistra, Hans S; Leegwater, Peter A

    2011-01-01

    Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism.

  8. A Contracted DNA Repeat in LHX3 Intron 5 Is Associated with Aberrant Splicing and Pituitary Dwarfism in German Shepherd Dogs

    PubMed Central

    Voorbij, Annemarie M. W. Y.; van Steenbeek, Frank G.; Vos-Loohuis, Manon; Martens, Ellen E. C. P.; Hanson-Nilsson, Jeanette M.; van Oost, Bernard A.; Kooistra, Hans S.; Leegwater, Peter A.

    2011-01-01

    Dwarfism in German shepherd dogs is due to combined pituitary hormone deficiency of unknown genetic cause. We localized the recessively inherited defect by a genome wide approach to a region on chromosome 9 with a lod score of 9.8. The region contains LHX3, which codes for a transcription factor essential for pituitary development. Dwarfs have a deletion of one of six 7 bp repeats in intron 5 of LHX3, reducing the intron size to 68 bp. One dwarf was compound heterozygous for the deletion and an insertion of an asparagine residue in the DNA-binding homeodomain of LHX3, suggesting involvement of the gene in the disorder. An exon trapping assay indicated that the shortened intron is not spliced efficiently, probably because it is too small. We applied bisulfite conversion of cytosine to uracil in RNA followed by RT-PCR to analyze the splicing products. The aberrantly spliced RNA molecules resulted from either skipping of exon 5 or retention of intron 5. The same splicing defects were observed in cDNA derived from the pituitary of dwarfs. A survey of similarly mutated introns suggests that there is a minimal distance requirement between the splice donor and branch site of 50 nucleotides. In conclusion, a contraction of a DNA repeat in intron 5 of canine LHX3 leads to deficient splicing and is associated with pituitary dwarfism. PMID:22132174

  9. An RNA electrophoretic mobility shift and mutational analysis of rnp-4f 5′-UTR intron splicing regulatory proteins in Drosophila reveals a novel new role for a dADAR protein isoform

    PubMed Central

    Lakshmi, G. Girija; Ghosh, Sushmita; Jones, Gabriel P.; Parikh, Roshni; Rawlins, Bridgette A.; Vaughn, Jack C.

    2014-01-01

    Alternative splicing greatly enhances the diversity of proteins encoded by eukaryotic genomes, and is also important in gene expression control. In contrast to the great depth of knowledge as to molecular mechanisms in the splicing pathway itself, relatively little is known about the regulatory events behind this process. The 5′-UTR and 3′-UTR in pre-mRNAs play a variety of roles in controlling eukaryotic gene expression, including translational modulation, and nearly 4,000 of the roughly 14,000 protein coding genes in Drosophila contain introns of unknown functional significance in their 5′-UTR. Here we report the results of an RNA electrophoretic mobility shift analysis of Drosophila rnp-4f 5′-UTR intron 0 splicing regulatory proteins. The pre-mRNA potential regulatory element consists of an evolutionarily-conserved 177-nt stem-loop arising from pairing of intron 0 with part of adjacent exon 2. Incubation of in vitro transcribed probe with embryo protein extract is shown to result in two shifted RNA-protein bands, and protein extract from a dADAR null mutant fly line results in only one shifted band. A mutated stem-loop in which the conserved exon 2 primary sequence is changed but secondary structure maintained by introducing compensatory base changes results in diminished band shifts. To test the hypothesis that dADAR plays a role in intron splicing regulation in vivo, levels of unspliced rnp-4f mRNA in dADAR mutant were compared to wild-type via real-time qRT-PCR. The results show that during embryogenesis unspliced rnp-4f mRNA levels fall by up to 85% in the mutant, in support of the hypothesis. Taken together, these results demonstrate a novel role for dADAR protein in rnp-4f 5′-UTR alternative intron splicing regulation which is consistent with a previously proposed model. PMID:23026215

  10. Mutation and polymorphism analysis of the human homogentisate 1, 2-dioxygenase gene in alkaptonuria patients.

    PubMed Central

    Beltrán-Valero de Bernabé, D; Granadino, B; Chiarelli, I; Porfirio, B; Mayatepek, E; Aquaron, R; Moore, M M; Festen, J J; Sanmartí, R; Peñalva, M A; de Córdoba, S R

    1998-01-01

    Alkaptonuria (AKU), a rare hereditary disorder of phenylalanine and tyrosine catabolism, was the first disease to be interpreted as an inborn error of metabolism. AKU patients are deficient for homogentisate 1,2 dioxygenase (HGO); this deficiency causes homogentisic aciduria, ochronosis, and arthritis. We cloned the human HGO gene and characterized two loss-of-function mutations, P230S and V300G, in the HGO gene in AKU patients. Here we report haplotype and mutational analysis of the HGO gene in 29 novel AKU chromosomes. We identified 12 novel mutations: 8 (E42A, W97G, D153G, S189I, I216T, R225H, F227S, and M368V) missense mutations that result in amino acid substitutions at positions conserved in HGO in different species, 1 (F10fs) frameshift mutation, 2 intronic mutations (IVS9-56G-->A, IVS9-17G-->A), and 1 splice-site mutation (IVS5+1G-->T). We also report characterization of five polymorphic sites in HGO and describe the haplotypic associations of alleles at these sites in normal and AKU chromosomes. One of these sites, HGO-3, is a variable dinucleotide repeat; IVS2+35T/A, IVS5+25T/C, and IVS6+46C/A are intronic sites at which single nucleotide substitutions (dimorphisms) have been detected; and c407T/A is a relatively frequent nucleotide substitution in the coding sequence, exon 4, resulting in an amino acid change (H80Q). These data provide insight into the origin and evolution of the various AKU alleles. PMID:9529363

  11. Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

    PubMed Central

    Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

    2013-01-01

    Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

  12. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811 + 1.6kbA {yields} G, produces a new exon: High frequency in spanish cystic fibrosis chromosomes and association with severe phenotype

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chillon, M.; Casals, T.; Gimenez, J.

    1995-03-01

    mRNA analysis of the cystic fibrosis transmembrane regulator (CFTR) gene in tissues of cystic fibrosis (CF) patients has allowed us to detect a cryptic exon. The new exon involves 49 base pairs between exons 11 and 12 and is due to a point mutation (1811+1.6bA{yields}G) that creates a new donor splice site in intron 11. Semiquantitative mRNA analysis showed that 1811+1.6kbA{r_arrow}G-mRNA was 5-10-fold less abundant than {triangle}F508 mRNA. Mutations 1811+1.6kbA{yields}G was found in 21 Spanish and 1 German CF chromosome(s), making it the fourth-most-frequent mutation (2%) in the Spanish population. Individuals with genotype {triangle}F508/1811+1.6kbA{yields}G have only 1%-3% of normal CFTRmore » mRNA. This loss of 97% of normal CFTR mRNA must be responsible for the pancreatic insufficiency and for the severe CF phenotype in these patients. 30 refs., 3 figs., 2 tabs.« less

  13. Mapping Interactive Cancer Susceptibility Genes in Prostate Cancer

    DTIC Science & Technology

    2007-04-01

    interval within intron 5 of FHIT. Since non- exonic causative mutations are difficult to identify, we employed an approach looking for signatures of...natural selection in this region within human populations to better understand the potential nature of any disease mutation(s). Since non- exonic ...0.523 0.126 CYP3A4 7 98.999-99.026 D7S647 199496 0.79 98.913 195 0.510 0.300 EZH2 7 147.961-147.982 D7S688 199984 0.84 147.981 49 0.478 0.687 PTEN 10

  14. The androgen receptor gene mutations database.

    PubMed

    Gottlieb, B; Trifiro, M; Lumbroso, R; Vasiliou, D M; Pinsky, L

    1996-01-01

    The current version of the androgen receptor (AR) gene mutations database is described. We have added (if available) data on the androgen binding phenotype of the mutant AR, the clinical phenotype of the affected persons, the family history and whether the pathogenicity of a mutation has been proven. Exonic mutations are now listed in 5'-->3' sequence regardless of type and single base pair changes are presented in codon context. Splice site and intronic mutations are listed separately. The database has allowed us to substantiate and amplify the observation of mutational hot spots within exons encoding the AR androgen binding domain. The database is available from EML (ftp://www.ebi.ac.uk/pub/databases/androgen) or as a Macintosh Filemaker file (MC33@musica.mcgill.ca).

  15. Intron Definition and a Branch Site Adenosine at nt 385 Control RNA Splicing of HPV16 E6*I and E7 Expression

    PubMed Central

    Ajiro, Masahiko; Jia, Rong; Zhang, Lifang; Liu, Xuefeng; Zheng, Zhi-Ming

    2012-01-01

    HPV16 E6 and E7, two viral oncogenes, are expressed from a single bicistronic pre-mRNA. In this report, we provide the evidence that the bicistronic pre-mRNA intron 1 contains three 5′ splice sites (5′ ss) and three 3′ splice sites (3′ ss) normally used in HPV16+ cervical cancer and its derived cell lines. The choice of two novel alternative 5′ ss (nt 221 5′ ss and nt 191 5′ ss) produces two novel isoforms of E6E7 mRNAs (E6*V and E6*VI). The nt 226 5′ ss and nt 409 3′ ss is preferentially selected over the other splice sites crossing over the intron to excise a minimal length of the intron in RNA splicing. We identified AACAAAC as the preferred branch point sequence (BPS) and an adenosine at nt 385 (underlined) in the BPS as a branch site to dictate the selection of the nt 409 3′ ss for E6*I splicing and E7 expression. Introduction of point mutations into the mapped BPS led to reduced U2 binding to the BPS and thereby inhibition of the second step of E6E7 splicing at the nt 409 3′ ss. Importantly, the E6E7 bicistronic RNA with a mutant BPS and inefficient splicing makes little or no E7 and the resulted E6 with mutations of 91QYNK94 to 91PSFW94 displays attenuate activity on p53 degradation. Together, our data provide structural basis of the E6E7 intron 1 for better understanding of how viral E6 and E7 expression is regulated by alternative RNA splicing. This study elucidates for the first time a mapped branch point in HPV16 genome involved in viral oncogene expression. PMID:23056301

  16. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

    PubMed Central

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-01-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

  17. Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

    PubMed

    Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

    2015-12-01

    Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

  18. Analysis of the Mitochondrial Genome in Hypomyces aurantius Reveals a Novel Twintron Complex in Fungi.

    PubMed

    Deng, Youjin; Zhang, Qihui; Ming, Ray; Lin, Longji; Lin, Xiangzhi; Lin, Yiying; Li, Xiao; Xie, Baogui; Wen, Zhiqiang

    2016-06-30

    Hypomyces aurantius is a mycoparasite that causes cobweb disease, a most serious disease of cultivated mushrooms. Intra-species identification is vital for disease control, however the lack of genomic data makes development of molecular markers challenging. Small size, high copy number, and high mutation rate of fungal mitochondrial genome makes it a good candidate for intra and inter species differentiation. In this study, the mitochondrial genome of H. H.a0001 was determined from genomic DNA using Illumina sequencing. The roughly 72 kb genome shows all major features found in other Hypocreales: 14 common protein genes, large and small subunit rRNAs genes and 27 tRNAs genes. Gene arrangement comparison showed conserved gene orders in Hypocreales mitochondria are relatively conserved, with the exception of Acremonium chrysogenum and Acremonium implicatum. Mitochondrial genome comparison also revealed that intron length primarily contributes to mitogenome size variation. Seventeen introns were detected in six conserved genes: five in cox1, four in rnl, three in cob, two each in atp6 and cox3, and one in cox2. Four introns were found to contain two introns or open reading frames: cox3-i2 is a twintron containing two group IA type introns; cox2-i1 is a group IB intron encoding two homing endonucleases; and cox1-i4 and cox1-i3 both contain two open reading frame (ORFs). Analyses combining secondary intronic structures, insertion sites, and similarities of homing endonuclease genes reveal two group IA introns arranged side by side within cox3-i2. Mitochondrial data for H. aurantius provides the basis for further studies relating to population genetics and species identification.

  19. Analysis of the Mitochondrial Genome in Hypomyces aurantius Reveals a Novel Twintron Complex in Fungi

    PubMed Central

    Deng, Youjin; Zhang, Qihui; Ming, Ray; Lin, Longji; Lin, Xiangzhi; Lin, Yiying; Li, Xiao; Xie, Baogui; Wen, Zhiqiang

    2016-01-01

    Hypomyces aurantius is a mycoparasite that causes cobweb disease, a most serious disease of cultivated mushrooms. Intra-species identification is vital for disease control, however the lack of genomic data makes development of molecular markers challenging. Small size, high copy number, and high mutation rate of fungal mitochondrial genome makes it a good candidate for intra and inter species differentiation. In this study, the mitochondrial genome of H. H.a0001 was determined from genomic DNA using Illumina sequencing. The roughly 72 kb genome shows all major features found in other Hypocreales: 14 common protein genes, large and small subunit rRNAs genes and 27 tRNAs genes. Gene arrangement comparison showed conserved gene orders in Hypocreales mitochondria are relatively conserved, with the exception of Acremonium chrysogenum and Acremonium implicatum. Mitochondrial genome comparison also revealed that intron length primarily contributes to mitogenome size variation. Seventeen introns were detected in six conserved genes: five in cox1, four in rnl, three in cob, two each in atp6 and cox3, and one in cox2. Four introns were found to contain two introns or open reading frames: cox3-i2 is a twintron containing two group IA type introns; cox2-i1 is a group IB intron encoding two homing endonucleases; and cox1-i4 and cox1-i3 both contain two open reading frame (ORFs). Analyses combining secondary intronic structures, insertion sites, and similarities of homing endonuclease genes reveal two group IA introns arranged side by side within cox3-i2. Mitochondrial data for H. aurantius provides the basis for further studies relating to population genetics and species identification. PMID:27376282

  20. SNPs of bovine HGF gene and their association with growth traits in Nanyang cattle.

    PubMed

    Cai, Hanfang; Lan, Xianyong; Li, Aimin; Zhou, Yang; Sun, Jiajie; Lei, Chuzhao; Zhang, Chunlei; Chen, Hong

    2013-10-01

    Hepatocyte growth factor (HGF) is one of the multifunctional cell factors that regulates cellular proliferation, motility and morphogenesis in mammalians. And its medical research has deep significance. In this paper, polymorphisms of HGF gene were investigated in 1433 health and irrelated Chinese cattle by PCR-RFLP and DNA sequencing approach. Ten novel Single nucleotide polymorphisms (SNPs) were identified, which included one missense mutation, g.72801G>A in the coding region, and the others in the intron. Association analysis between four of them, g.288T>C, g.72801G>A, g.77172G>T, and g.77408T>G, and growth traits in Nanyang, were performed. The results indicated that SNPs within bovine HGF gene were significantly associated with growth traits. Phylogenetic analysis showed that the genetic background of Caoyuan Red cattle was different from the others in the tested breeds. The findings will provide a background for application of bovine HGF gene in the selection program in Chinese cattle. Copyright © 2013 Elsevier Ltd. All rights reserved.

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mebarki, F.; Forest, M.G.; Josso, N.

    The androgen insensivity syndrome (AIS) is a recessive X-linked disorder resulting from a deficient function of the androgen receptor (AR). The human AR gene has 3 functional domains: N-terminal encoded by exon 1, DNA-binding domain encoded by exons 2 and 3, and androgen-binding domain encoded by exons 4 to 8. In order to characterize the molecular defects of the AR gene in AIS, the entire coding regions and the intronic bording sequences of the AR gene were amplified by PCR before automatic direct sequencing in 45 patients. Twenty seven different point mutations were found in 32 unrelated AIS patients: 18more » with a complete form (CAIS), 14 with a partial form (PAIS); 18 of these mutations are novel mutations, not published to date. Only 3 mutations were repeatedly found: R804H in 3 families; M780I in 3 families and R774C in 2 families. For 26 patients out of the 32 found to have a mutation, maternal DNA was collected and sequenced: 6 de novo mutations were detected (i.e. 23% of the cases). Finally, no mutation was detected in 13 patients (29%): 7 with CAIS and 6 familial severe PAIS. The latter all presented with perineal hypospadias, micropenis, 4 out of 6 being raised as girl. Diagnosis of AIS in these 13 families in whom no mutation was detected is supported by the following criteria: clinical data, familial history (2 or 3 index cases in the same family), familial segregation of the polymorphic CAG repeat of the AR gene. Mutations in intronic regions or the promoter of the AR gene could not explain all cases of AIS without mutations in the AR coding regions, because AR binding (performed in 9 out of 13) was normal in 6, suggesting the synthesis of an AR protein. This situation led us to speculate that another X-linked factor associated with the AR could be implicated in some cases of AIS.« less

  2. Severe Hemophilia A in a Male Old English Sheep Dog with a C→T Transition that Created a Premature Stop Codon in Factor VIII

    PubMed Central

    Lozier, Jay N; Kloos, Mark T; Merricks, Elizabeth P; Lemoine, Nathaly; Whitford, Margaret H; Raymer, Robin A; Bellinger, Dwight A; Nichols, Timothy C

    2016-01-01

    Animals with hemophilia are models for gene therapy, factor replacement, and inhibitor development in humans. We have actively sought dogs with severe hemophilia A that have novel factor VIII mutations unlike the previously described factor VIII intron 22 inversion. A male Old English Sheepdog with recurrent soft-tissue hemorrhage and hemarthrosis was diagnosed with severe hemophilia A (factor VIII activity less than 1% of normal). We purified genomic DNA from this dog and ruled out the common intron 22 inversion; we then sequenced all 26 exons. Comparing the results with the normal canine factor VIII sequence revealed a C→T transition in exon 12 of the factor VIII gene that created a premature stop codon at amino acid 577 in the A2 domain of the protein. In addition, 2 previously described polymorphisms that do not cause hemophilia were present at amino acids 909 and 1184. The hemophilia mutation creates a new TaqI site that facilitates rapid genotyping of affected offspring by PCR and restriction endonuclease analyses. This mutation is analogous to the previously described human factor VIII mutation at Arg583, which likewise is a CpG dinucleotide transition causing a premature stop codon in exon 12. Thus far, despite extensive treatment with factor VIII, this dog has not developed neutralizing antibodies (‘inhibitors’) to the protein. This novel mutation in a dog gives rise to severe hemophilia A analogous to a mutation seen in humans. This model will be useful for studies of the treatment of hemophilia. PMID:27780008

  3. Long-term 12 year follow-up of X-linked congenital retinoschisis

    PubMed Central

    Kjellström, Sten; Vijayasarathy, Camasamudram; Ponjavic, Vesna; Sieving, Paul A.; Andréasson, Sten

    2010-01-01

    Purpose To investigate the retinal structure and function during the progression of X-linked retinoschisis (XLRS) from childhood to adulthood. Methods Ten patients clinically diagnosed with XLRS were investigated at 6–15 years of age (mean age 9 years) with a follow-up 8 to 14 years later (mean 12 years). The patients underwent regular ophthalmic examination as well as testing of best corrected visual acuity (BCVA), visual field (VF) and assessment of full-field electroretinography (ERG) during their first visit. During the follow-up, the same clinical protocols were repeated. In addition, macular structure and function was examined with multifocal electroretinography (mfERG) and optical coherence tomography (OCT). The patients were 18–25 years of age (mean age 21 years) at the follow-up examination. All exons and exon-intron boundaries of RS1-gene were sequenced for gene mutations in 9 out of the 10 patients. Results Best corrected VA and VF were stable during this follow-up period. No significant progression in cone or rod function could be measured by full-field ERG. Multifocal electroretinography and OCT demonstrated a wide heterogeneity of macular changes in retinal structure and function at the time of follow-up visit. Three different mutations were detected in these nine patients, including a known nonsense mutation in exon 3, a novel insertion in exon 5 and an intronic mutation at 5' splice site of intron 3. Conclusions Clinical follow-up (mean 12 years) of ten young XLRS patients (mean age of 9 years) with a typical congenital retinoschisis phenotype revealed no significant decline in retinal function during this time period. MfERG and OCT demonstrated a wide variety of macular changes including structure and dysfunction. The XLRS disease was relatively stable during this period of observation and would afford opportunity for therapy studies to judge benefit against baseline and against the fellow eye. PMID:20569020

  4. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-02-15

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U).

  5. Characterization of intronic uridine-rich sequence elements acting as possible targets for nuclear proteins during pre-mRNA splicing in Nicotiana plumbaginifolia.

    PubMed Central

    Gniadkowski, M; Hemmings-Mieszczak, M; Klahre, U; Liu, H X; Filipowicz, W

    1996-01-01

    Introns of nuclear pre-mRNAs in dicotyledonous plants, unlike introns in vertebrates or yeast, are distinctly rich in A+U nucleotides and this feature is essential for their processing. In order to define more precisely sequence elements important for intron recognition in plants, we investigated the effects of short insertions, either U-rich or A-rich, on splicing of synthetic introns in transfected protoplast of Nicotiana plumbaginifolia. It was found that insertions of U-rich (sequence UUUUUAU) but not A-rich (AUAAAAA) segments can activate splicing of a GC-rich synthetic infron, and that U-rich segments, or multimers thereof, can function irrespective of the site of insertion within the intron. Insertions of multiple U-rich segments, either at the same or different locations, generally had an additive, stimulatory effect on splicing. Mutational analysis showed that replacement of one or two U residues in the UUUUUAU sequence with A or C residues had only a small effect on splicing, but replacement with G residues was strongly inhibitory. Proteins that interact with fragments of natural and synthetic pre-mRNAs in vitro were identified in nuclear extracts of N.plumbaginifolia by UV cross- linking. The profile of cross-linked plant proteins was considerably less complex than that obtained with a HeLa cell nuclear extract. Two major cross-linkable plant proteins had apparent molecular mass of 50 and 54 kDa and showed affinity for oligouridilates present in synGC introns or for poly(U). PMID:8604302

  6. Molecular characterization of the breakpoints of a 12-kb deletion in the NF1 gene in a family showing germ-line mosaicism.

    PubMed Central

    Lázaro, C; Gaona, A; Lynch, M; Kruyer, H; Ravella, A; Estivill, X

    1995-01-01

    Neurofibromatosis type 1 (NF1) is caused by deletions, insertions, translocations, and point mutations in the NF1 gene, which spans 350 kb on the long arm of human chromosome 17. Although several point mutations have been described, large molecular abnormalities have rarely been characterized in detail. We describe here the molecular breakpoints of a 12-kb deletion of the NF1 gene, which is responsible for the NF1 phenotype in a kindred with two children affected because of germline mosaicism in the unaffected father, who has the mutation in 10% of his spermatozoa. The mutation spans introns 31-39, removing 12,021 nt and inserting 30 bp, of which 19 bp are a direct repetition of a sequence located in intron 31, just 4 bp before the 5' breakpoint. The 5' and 3' breakpoints contain the sequence TATTTTA, which could be involved in the generation of the deletion. The most plausible explanation for the mechanism involved in the generation of this 12-kb deletion is homologous/nonhomologous recombination. Since sperm of the father does not contain the corresponding insertion of the 12-kb deleted sequence, this deletion could have occurred within the NF1 chromosome through loop formation. RNA from lymphocytes of one of the NF1 patients showed similar levels of the mutated and normal transcripts, suggesting that the NF1-mRNA from mutations causing frame shifts of the reading frame or stop codons in this gene is not degraded during its processing. The mutation was not detected in fresh lymphocytes from the unaffected father by PCR analysis, supporting the case for true germ-line mosaicism. Images Figure 1 Figure 3 PMID:7485153

  7. Age at cancer onset in germline TP53 mutation carriers: association with polymorphisms in predicted G-quadruplex structures

    PubMed Central

    Hainaut, Pierre

    2014-01-01

    Germline TP53 mutations predispose to multiple cancers defining Li-Fraumeni/Li-Fraumeni-like syndrome (LFS/LFL), a disease with large individual disparities in cancer profiles and age of onset. G-quadruplexes (G4s) are secondary structural motifs occurring in guanine tracks, with regulatory effects on DNA and RNA. We analyzed 85 polymorphisms within or near five predicted G4s in TP53 in search of modifiers of penetrance of LFS/LFL in Brazilian cancer families with (n = 35) or without (n = 110) TP53 mutations. Statistical analyses stratified on family structure showed that cancer tended to occur ~15 years later in mutation carriers who also carried the variant alleles of two polymorphisms within predicted G4-forming regions, rs17878362 (TP53 PIN3, 16 bp duplication in intron 3; P = 0.082) and rs17880560 (6 bp duplication in 3′ flanking region; P = 0.067). Haplotype analysis showed that this inverse association was driven by the polymorphic status of the remaining wild-type (WT) haplotype in mutation carriers: in carriers with a WT haplotype containing at least one variant allele of rs17878362 or rs17880560, cancer occurred ~15 years later than in carriers with other WT haplotypes (P = 0.019). No effect on age of cancer onset was observed in subjects without a TP53 mutation. The G4 in intron 3 has been shown to regulate alternative p53 messenger RNA splicing, whereas the biological roles of predicted G4s in the 3′ flanking region remain to be elucidated. In conclusion, this study demonstrates that G4 polymorphisms in haplotypes of the WT TP53 allele have an impact on LFS/LFL penetrance in germline TP53 mutation carriers. PMID:24336192

  8. Splicing of goose parvovirus pre-mRNA influences cytoplasmic translation of the processed mRNA

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Long; Pintel, David J., E-mail: pinteld@missouri.edu

    2012-04-25

    Translation of goose parvovirus (GPV) 72 kDa Rep 1 is initiated from unspliced P9-generated mRNAs in ORF1 from the first in-frame AUG (537 AUG); however, this AUG is bypassed in spliced P9-generated RNA: translation of the 52 kDa Rep 2 protein from spliced RNA is initiated in ORF2 at the next AUG downstream (650 AUG). Usage of the 537 AUG was restored in spliced RNA when the GPV intron was replaced with a chimeric SV40 intron, or following specific mutations of the GPV intron which did not appear in the final spliced mRNA. Additionally, 650 AUG usage was gained inmore » unspliced RNA when the GPV intron splice sites were debilitated. Splicing-dependent regulation of translation initiation was mediated in cis by GPV RNA surrounding the target AUGs. Thus, nuclear RNA processing of GPV P9-generated pre-mRNAs has a complex, but significant, effect on alternative translation initiation of the GPV Rep proteins.« less

  9. Aberrant splicing in maize rough endosperm3 reveals a conserved role for U12 splicing in eukaryotic multicellular development

    PubMed Central

    Barbazuk, W. Brad

    2017-01-01

    RNA splicing of U12-type introns functions in human cell differentiation, but it is not known whether this class of introns has a similar role in plants. The maize ROUGH ENDOSPERM3 (RGH3) protein is orthologous to the human splicing factor, ZRSR2. ZRSR2 mutations are associated with myelodysplastic syndrome (MDS) and cause U12 splicing defects. Maize rgh3 mutants have aberrant endosperm cell differentiation and proliferation. We found that most U12-type introns are retained or misspliced in rgh3. Genes affected in rgh3 and ZRSR2 mutants identify cell cycle and protein glycosylation as common pathways disrupted. Transcripts with retained U12-type introns can be found in polysomes, suggesting that splicing efficiency can alter protein isoforms. The rgh3 mutant protein disrupts colocalization with a known ZRSR2-interacting protein, U2AF2. These results indicate conserved function for RGH3/ZRSR2 in U12 splicing and a deeply conserved role for the minor spliceosome to promote cell differentiation from stem cells to terminal fates. PMID:28242684

  10. The paradox of MHC-DRB exon/intron evolution: alpha-helix and beta-sheet encoding regions diverge while hypervariable intronic simple repeats coevolve with beta-sheet codons.

    PubMed

    Schwaiger, F W; Weyers, E; Epplen, C; Brün, J; Ruff, G; Crawford, A; Epplen, J T

    1993-09-01

    Twenty-one different caprine and 13 ovine MHC-DRB exon 2 sequences were determined including part of the adjacent introns containing simple repetitive (gt)n(ga)m elements. The positions for highly polymorphic DRB amino acids vary slightly among ungulates and other mammals. From man and mouse to ungulates the basic (gt)n(ga)m structure is fixed in evolution for 7 x 10(7) years whereas ample variations exist in the tandem (gt)n and (ga)m dinucleotides and especially their "degenerated" derivatives. Phylogenetic trees for the alpha-helices and beta-pleated sheets of the ungulate DRB sequences suggest different evolutionary histories. In hoofed animals as well as in humans DRB beta-sheet encoding sequences and adjacent intronic repeats can be assembled into virtually identical groups suggesting coevolution of noncoding as well as coding DNA. In contrast alpha-helices and C-terminal parts of the first DRB domain evolve distinctly. In the absence of a defined mechanism causing specific, site-directed mutations, double-recombination or gene-conversion-like events would readily explain this fact. The role of the intronic simple (gt)n(ga)m repeat is discussed with respect to these genetic exchange mechanisms during evolution.

  11. Genetic study of the PAH locus in the Iranian population: familial gene mutations and minihaplotypes.

    PubMed

    Razipour, Masoumeh; Alavinejad, Elaheh; Sajedi, Seyede Zahra; Talebi, Saeed; Entezam, Mona; Mohajer, Neda; Kazemi-Sefat, Golnaz-Ensieh; Gharesouran, Jalal; Setoodeh, Aria; Mohaddes Ardebili, Seyyed Mojtaba; Keramatipour, Mohammad

    2017-10-01

    Phenylketonuria (PKU), one of the most common inborn errors of amino acid metabolism, is caused by mutations in the phenylalanine hydroxylase (PAH) gene (PAH). PKU has wide allelic heterogeneity, and over 600 different disease-causing mutations in PAH have been detected to date. Up to now, there have been no reports on the minihaplotype (VNTR/STR) analysis of PAH locus in the Iranian population. The aims of the present study were to determine PAH mutations and minihaplotypes in Iranian families with PAH deficiency and to investigate the correlation between them. A total of 81 Iranian families with PAH deficiency were examined using PCR-sequencing of all 13 PAH exons and their flanking intron regions to identify sequence variations. Fragment analysis of the PAH minihaplotypes was performed by capillary electrophoresis for 59 families. In our study, 33 different mutations were found accounting for 95% of the total mutant alleles. The majority of these mutations (72%) were distributed across exons 7, 11, 2 and their flanking intronic regions. Mutation c.1066-11G > A was the most common with a frequency of 20.37%. The less frequent mutations, p.Arg261Gln (8%), p.Arg243Ter (7.4%), p.Leu48Ser (7.4%), p.Lys363Asnfs*37 (6.79%), c.969 + 5G > A (6.17%), p.Pro281Leu (5.56), c.168 + 5G > C (5.56), and p.Arg261Ter (4.94) together comprised about 52% of all mutant alleles. In this study, a total of seventeen PAH gene minihaplotypes were detected, six of which associated exclusively with particular mutations. Our findings indicate a broad PAH mutation spectrum in the Iranian population, which is consistent with previous studies reporting a wide range of PAH mutations, most likely due to ethnic heterogeneity. High prevalence of c.1066-11G > A mutation linked to minihaplotype 7/250 among both Iranian and Mediterranean populations is indicative of historical and geographical links between them. Also, strong association between particular mutations and minihaplotypes could be useful for prenatal diagnosis (PND) and preimplantation genetic diagnosis (PGD) in affected families.

  12. Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis

    PubMed Central

    D’Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; He, Hong; Li, Shibo; Hejtmancik, James F.; Sieving, Paul A.; Wang, Xinjing

    2013-01-01

    Purpose X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4–5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Methods Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Results Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5′ region of the RS1 gene (including the promoter) through intron 1 (c.(−35)-1723_c.51+2664del4472). The exon 4–5 deletion spans introns 3 to intron 5 (c.185–1020_c.522+1844del5764). Conclusions Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes. PMID:24227916

  13. Characterization of novel RS1 exonic deletions in juvenile X-linked retinoschisis.

    PubMed

    D'Souza, Leera; Cukras, Catherine; Antolik, Christian; Craig, Candice; Lee, Ji-Yun; He, Hong; Li, Shibo; Smaoui, Nizar; Hejtmancik, James F; Sieving, Paul A; Wang, Xinjing

    2013-01-01

    X-linked juvenile retinoschisis (XLRS) is a vitreoretinal dystrophy characterized by schisis (splitting) of the inner layers of the neuroretina. Mutations within the retinoschisis (RS1) gene are responsible for this disease. The mutation spectrum consists of amino acid substitutions, splice site variations, small indels, and larger genomic deletions. Clinically, genomic deletions are rarely reported. Here, we characterize two novel full exonic deletions: one encompassing exon 1 and the other spanning exons 4-5 of the RS1 gene. We also report the clinical findings in these patients with XLRS with two different exonic deletions. Unrelated XLRS men and boys and their mothers (if available) were enrolled for molecular genetics evaluation. The patients also underwent ophthalmologic examination and in some cases electroretinogram (ERG) recording. All the exons and the flanking intronic regions of the RS1 gene were analyzed with direct sequencing. Two patients with exonic deletions were further evaluated with array comparative genomic hybridization to define the scope of the genomic aberrations. After the deleted genomic region was identified, primer walking followed by direct sequencing was used to determine the exact breakpoints. Two novel exonic deletions of the RS1 gene were identified: one including exon 1 and the other spanning exons 4 and 5. The exon 1 deletion extends from the 5' region of the RS1 gene (including the promoter) through intron 1 (c.(-35)-1723_c.51+2664del4472). The exon 4-5 deletion spans introns 3 to intron 5 (c.185-1020_c.522+1844del5764). Here we report two novel exonic deletions within the RS1 gene locus. We have also described the clinical presentations and hypothesized the genomic mechanisms underlying these schisis phenotypes.

  14. Functional characterization of the novel intronic nucleotide change c.288+9C>T within the BCKDHA gene: understanding a variant presentation of maple syrup urine disease.

    PubMed

    Fernández-Guerra, Paula; Navarrete, Rosa; Weisiger, Kara; Desviat, Lourdes R; Packman, Seymour; Ugarte, Magdalena; Rodríguez-Pombo, Pilar

    2010-12-01

    Mutations in any of the three different genes--BCKDHA, BCKDHB, and DBT--encoding for the E1α, E1β, and E2 catalytic components of the branched-chain α-ketoacid dehydrogenase complex can cause maple syrup urine disease (MSUD). Disease severity ranges from the classic to the mildest variant types and precise genotypes, mostly based on missense mutations, have been associated to the less severe presentations of the disease. Herein, we examine the consequences at the messenger RNA (mRNA) level of the novel intronic alteration c.288+9C>T found in heterozygous fashion in a BCKDHA variant MSUD patient who also carries the nucleotide change c.745G>A (p.Gly249Ser), previously described as a severe change. Direct analysis of the processed transcripts from the patient showed--in addition to a low but measurable level of normal mRNA product--an aberrantly spliced mRNA containing a 7-bp fragment of intron 2, which could be rescued when the patient's cells were treated with emetine. This aberrant transcript with a premature stop codon would be unstable, supporting the possible activation of nonsense-mediated mRNA decay pathway. Consistent with this finding, minigene splicing assays demonstrated that the point mutation c.288+9C>T is sufficient to create a cryptic splice site and cause the observed 7-bp insertion. Furthermore, our results strongly suggest that the c.288+9C>T allele in the patient generates both normal and aberrant transcripts that could sustain the variant presentation of the disease, highlighting the importance of correct genotyping to establish genotype-phenotype correlations and as basis for the development of therapeutic interventions.

  15. Gene encoding the human. beta. -hexosaminidase. beta. chain: Extensive homology of intron placement in the. alpha. - and. beta. -chain genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Proia, R.L.

    1988-03-01

    Lysosomal {beta}-hexosaminidase is composed of two structurally similar chains, {alpha} and {beta}, that are the products of different genes. Mutations in either gene causing {beta}-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the {alpha} and {beta} chains, the {beta}-chain gene was isolated, and its organization was characterized. The {beta}-chain coding region is divided into 14 exons distributed over {approx}40 kilobases of DNA. Comparison with the {alpha}-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions.more » This extensive sharing of intron placement demonstrates that the {alpha} and {beta} chains evolved by way of the duplication of a common ancestor.« less

  16. Carbonic anhydrase II deficiency: Single-base deletion in exon 7 is the predominant mutation in Caribbean Hispanic patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hu, P.Y.; Ernst, A.R.; Sly, W.S.

    1994-04-01

    To date, three different structural gene mutations have been identified in patients with carbonic anhydrase II deficiency (osteopetrosis with renal tubular acidosis and cerebral calcification). These include a missense mutation (H107Y) in two families, a splice junction mutation in intron 5 in one of these families, and a splice junction mutation in intron 2 for which many Arabic patients are homozygous. The authors report here a novel mutation for which carbonic anhydrase II-deficient patients from seven unrelated Hispanic families were found to be homozygous. The proband was a 2 1/2-year-old Hispanic girl of Puerto Rican ancestry who was unique clinically,more » in that she had no evidence of renal tubular acidosis, even though she did have osteopetrosis, developmental delay, and cerebral calcification. She proved to be homozygous for a single-base deletion in the coding region of exon 7 that produces a frameshift that changes the next 12 amino acids before leading to chain termination and that also introduces a new MaeIII restriction site. The 27-kD truncated enzyme produced when the mutant cDNA was expressed in COS cells was enzymatically inactive, present mainly in insoluble aggregates, and detectable immunologically at only 5% the level of the 29-kD normal carbonic anhydrase II expressed from the wild-type cDNA. Metabolic labeling revealed that this 27-kD mutant protein has an accelerated rate of degradation. Six subsequent Hispanic patients of Caribbean ancestry, all of whom had osteopetrosis and renal tubular acidosis but who varied widely in clinical severity, were found to be homozygous for the same mutation. These findings identify a novel mutation common to Hispanic patients from the Caribbean islands and provide a ready means for PCR-based diagnosis of the [open quotes]Hispanic mutation.[close quotes] The basis for their phenotypic variability is not yet clear. 15 refs., 5 figs., 1 tab.« less

  17. Antisense Masking of an hnRNP A1/A2 Intronic Splicing Silencer Corrects SMN2 Splicing in Transgenic Mice

    PubMed Central

    Hua, Yimin; Vickers, Timothy A.; Okunola, Hazeem L.; Bennett, C. Frank; Krainer, Adrian R.

    2008-01-01

    survival of motor neuron 2, centromeric (SMN2) is a gene that modifies the severity of spinal muscular atrophy (SMA), a motor-neuron disease that is the leading genetic cause of infant mortality. Increasing inclusion of SMN2 exon 7, which is predominantly skipped, holds promise to treat or possibly cure SMA; one practical strategy is the disruption of splicing silencers that impair exon 7 recognition. By using an antisense oligonucleotide (ASO)-tiling method, we systematically screened the proximal intronic regions flanking exon 7 and identified two intronic splicing silencers (ISSs): one in intron 6 and a recently described one in intron 7. We analyzed the intron 7 ISS by mutagenesis, coupled with splicing assays, RNA-affinity chromatography, and protein overexpression, and found two tandem hnRNP A1/A2 motifs within the ISS that are responsible for its inhibitory character. Mutations in these two motifs, or ASOs that block them, promote very efficient exon 7 inclusion. We screened 31 ASOs in this region and selected two optimal ones to test in human SMN2 transgenic mice. Both ASOs strongly increased hSMN2 exon 7 inclusion in the liver and kidney of the transgenic animals. Our results show that the high-resolution ASO-tiling approach can identify cis-elements that modulate splicing positively or negatively. Most importantly, our results highlight the therapeutic potential of some of these ASOs in the context of SMA. PMID:18371932

  18. Fanconi anemia in Tunisia: high prevalence of group A and identification of new FANCA mutations.

    PubMed

    Bouchlaka, Chiraz; Abdelhak, Sonia; Amouri, Ahlem; Ben Abid, Hela; Hadiji, Sondes; Frikha, Mounir; Ben Othman, Tarek; Amri, Fethi; Ayadi, Hammadi; Hachicha, Mongia; Rebaï, Ahmed; Saad, Ali; Dellagi, Koussay

    2003-01-01

    Fanconi anemia (FA) is a rare autosomal recessive disease characterized by progressive pancytopenia, congenital malformations, and predisposition to acute myeloid leukemia. Fanconi anemia is genetically heterogeneous, with at least eight distinct complementation groups of FA (A, B, C, D1, D2, E, F, and G) having been defined by somatic cell fusion studies. Six genes (FANCA, FANCC, FANCD2, FANCE, FANCG, and FANCF) have been cloned. Mutations of the seventh Fanconi anemia gene, BRCA2, have been shown to lead to FAD1 and probably FAB groups. In order to characterize the molecular defects underlying FA in Tunisia, 39 families were genotyped with microsatellite markers linked to known FA gene. Haplotype analysis and homozygosity mapping assigned 43 patients belonging to 34 families to the FAA group, whereas one family was probably not linked to the FANCA gene or to any known FA genes. For patients belonging to the FAA group, screening for mutations revealed four novel mutations: two small homozygous deletions 1693delT and 1751-1754del, which occurred in exon 17 and exon 19, respectively, and two transitions, viz., 513G-->A in exon 5 and A-->G at position 166 (IVS24+166A-->G) of intron 24. Two new polymorphisms were also identified in intron 24 (IVS24-5G/A and IVS24-6C/G).

  19. Adjacent DNA sequences modulate Sox9 transcriptional activation at paired Sox sites in three chondrocyte-specific enhancer elements

    PubMed Central

    Bridgewater, Laura C.; Walker, Marlan D.; Miller, Gwen C.; Ellison, Trevor A.; Holsinger, L. Daniel; Potter, Jennifer L.; Jackson, Todd L.; Chen, Reuben K.; Winkel, Vicki L.; Zhang, Zhaoping; McKinney, Sandra; de Crombrugghe, Benoit

    2003-01-01

    Expression of the type XI collagen gene Col11a2 is directed to cartilage by at least three chondrocyte-specific enhancer elements, two in the 5′ region and one in the first intron of the gene. The three enhancers each contain two heptameric sites with homology to the Sox protein-binding consensus sequence. The two sites are separated by 3 or 4 bp and arranged in opposite orientation to each other. Targeted mutational analyses of these three enhancers showed that in the intronic enhancer, as in the other two enhancers, both Sox sites in a pair are essential for enhancer activity. The transcription factor Sox9 binds as a dimer at the paired sites, and the introduction of insertion mutations between the sites demonstrated that physical interactions between the adjacently bound proteins are essential for enhancer activity. Additional mutational analyses demonstrated that although Sox9 binding at the paired Sox sites is necessary for enhancer activity, it alone is not sufficient. Adjacent DNA sequences in each enhancer are also required, and mutation of those sequences can eliminate enhancer activity without preventing Sox9 binding. The data suggest a new model in which adjacently bound proteins affect the DNA bend angle produced by Sox9, which in turn determines whether an active transcriptional enhancer complex is assembled. PMID:12595563

  20. Antisense Oligonucleotide (AON)-based Therapy for Leber Congenital Amaurosis Caused by a Frequent Mutation in CEP290

    PubMed Central

    Collin, Rob WJ; den Hollander, Anneke I; van der Velde-Visser, Saskia D; Bennicelli, Jeannette; Bennett, Jean; Cremers, Frans PM

    2012-01-01

    Leber congenital amaurosis (LCA) is the most severe form of inherited retinal degeneration, with an onset in the first year of life. The most frequent mutation that causes LCA, present in at least 10% of individuals with LCA from North-American and Northern-European descent, is an intronic mutation in CEP290 that results in the inclusion of an aberrant exon in the CEP290 mRNA. Here, we describe a genetic therapy approach that is based on antisense oligonucleotides (AONs), small RNA molecules that are able to redirect normal splicing of aberrantly processed pre-mRNA. Immortalized lymphoblastoid cells of individuals with LCA homozygously carrying the intronic CEP290 mutation were transfected with several AONs that target the aberrant exon that is incorporated in the mutant CEP290 mRNA. Subsequent RNA isolation and reverse transcription-PCR analysis revealed that a number of AONs were capable of almost fully redirecting normal CEP290 splicing, in a dose-dependent manner. Other AONs however, displayed no effect on CEP290 splicing at all, indicating that the rescue of aberrant CEP290 splicing shows a high degree of sequence specificity. Together, our data show that AON-based therapy is a promising therapeutic approach for CEP290-associated LCA that warrants future research in animal models to develop a cure for this blinding disease. PMID:23343883

  1. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE PAGES

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; ...

    2016-05-02

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  2. Landscape of somatic mutations in 560 breast cancer whole-genome sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan

    Here, we analysed whole-genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. We found that 93 protein-coding cancer genes carried probable driver mutations. Some non-coding regions exhibited high mutation frequencies, but most have distinctive structural features probably causing elevated mutation rates and do not contain driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed twelve base substitution and six rearrangement signatures. Three rearrangement signatures, characterized by tandem duplications or deletions, appear associated with defective homologous-recombination-based DNA repair: one with deficient BRCA1 function, anothermore » with deficient BRCA1 or BRCA2 function, the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operating, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer.« less

  3. Landscape of somatic mutations in 560 breast cancer whole genome sequences

    PubMed Central

    Nik-Zainal, Serena; Davies, Helen; Staaf, Johan; Ramakrishna, Manasa; Glodzik, Dominik; Zou, Xueqing; Martincorena, Inigo; Alexandrov, Ludmil B.; Martin, Sancha; Wedge, David C.; Van Loo, Peter; Ju, Young Seok; Smid, Marcel; Brinkman, Arie B; Morganella, Sandro; Aure, Miriam R.; Lingjærde, Ole Christian; Langerød, Anita; Ringnér, Markus; Ahn, Sung-Min; Boyault, Sandrine; Brock, Jane E.; Broeks, Annegien; Butler, Adam; Desmedt, Christine; Dirix, Luc; Dronov, Serge; Fatima, Aquila; Foekens, John A.; Gerstung, Moritz; Hooijer, Gerrit KJ; Jang, Se Jin; Jones, David R.; Kim, Hyung-Yong; King, Tari A.; Krishnamurthy, Savitri; Lee, Hee Jin; Lee, Jeong-Yeon; Li, Yilong; McLaren, Stuart; Menzies, Andrew; Mustonen, Ville; O’Meara, Sarah; Pauporté, Iris; Pivot, Xavier; Purdie, Colin A.; Raine, Keiran; Ramakrishnan, Kamna; Rodríguez-González, F. Germán; Romieu, Gilles; Sieuwerts, Anieta M.; Simpson, Peter T; Shepherd, Rebecca; Stebbings, Lucy; Stefansson, Olafur A; Teague, Jon; Tommasi, Stefania; Treilleux, Isabelle; Van den Eynden, Gert G.; Vermeulen, Peter; Vincent-Salomon, Anne; Yates, Lucy; Caldas, Carlos; van’t Veer, Laura; Tutt, Andrew; Knappskog, Stian; Tan, Benita Kiat Tee; Jonkers, Jos; Borg, Åke; Ueno, Naoto T; Sotiriou, Christos; Viari, Alain; Futreal, P. Andrew; Campbell, Peter J; Span, Paul N.; Van Laere, Steven; Lakhani, Sunil R; Eyfjord, Jorunn E.; Thompson, Alastair M.; Birney, Ewan; Stunnenberg, Hendrik G; van de Vijver, Marc J; Martens, John W.M.; Børresen-Dale, Anne-Lise; Richardson, Andrea L.; Kong, Gu; Thomas, Gilles; Stratton, Michael R.

    2016-01-01

    We analysed whole genome sequences of 560 breast cancers to advance understanding of the driver mutations conferring clonal advantage and the mutational processes generating somatic mutations. 93 protein-coding cancer genes carried likely driver mutations. Some non-coding regions exhibited high mutation frequencies but most have distinctive structural features probably causing elevated mutation rates and do not harbour driver mutations. Mutational signature analysis was extended to genome rearrangements and revealed 12 base substitution and six rearrangement signatures. Three rearrangement signatures, characterised by tandem duplications or deletions, appear associated with defective homologous recombination based DNA repair: one with deficient BRCA1 function; another with deficient BRCA1 or BRCA2 function; the cause of the third is unknown. This analysis of all classes of somatic mutation across exons, introns and intergenic regions highlights the repertoire of cancer genes and mutational processes operative, and progresses towards a comprehensive account of the somatic genetic basis of breast cancer. PMID:27135926

  4. Long-read sequencing of nascent RNA reveals coupling among RNA processing events.

    PubMed

    Herzel, Lydia; Straube, Korinna; Neugebauer, Karla M

    2018-06-14

    Pre-mRNA splicing is accomplished by the spliceosome, a megadalton complex that assembles de novo on each intron. Because spliceosome assembly and catalysis occur cotranscriptionally, we hypothesized that introns are removed in the order of their transcription in genomes dominated by constitutive splicing. Remarkably little is known about splicing order and the regulatory potential of nascent transcript remodeling by splicing, due to the limitations of existing methods that focus on analysis of mature splicing products (mRNAs) rather than substrates and intermediates. Here, we overcome this obstacle through long-read RNA sequencing of nascent, multi-intron transcripts in the fission yeast Schizosaccharomyces pombe Most multi-intron transcripts were fully spliced, consistent with rapid cotranscriptional splicing. However, an unexpectedly high proportion of transcripts were either fully spliced or fully unspliced, suggesting that splicing of any given intron is dependent on the splicing status of other introns in the transcript. Supporting this, mild inhibition of splicing by a temperature-sensitive mutation in prp2 , the homolog of vertebrate U2AF65, increased the frequency of fully unspliced transcripts. Importantly, fully unspliced transcripts displayed transcriptional read-through at the polyA site and were degraded cotranscriptionally by the nuclear exosome. Finally, we show that cellular mRNA levels were reduced in genes with a high number of unspliced nascent transcripts during caffeine treatment, showing regulatory significance of cotranscriptional splicing. Therefore, overall splicing of individual nascent transcripts, 3' end formation, and mRNA half-life depend on the splicing status of neighboring introns, suggesting crosstalk among spliceosomes and the polyA cleavage machinery during transcription elongation. © 2018 Herzel et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Integrated analysis of whole-exome sequencing and transcriptome profiling in males with autism spectrum disorders.

    PubMed

    Codina-Solà, Marta; Rodríguez-Santiago, Benjamín; Homs, Aïda; Santoyo, Javier; Rigau, Maria; Aznar-Laín, Gemma; Del Campo, Miguel; Gener, Blanca; Gabau, Elisabeth; Botella, María Pilar; Gutiérrez-Arumí, Armand; Antiñolo, Guillermo; Pérez-Jurado, Luis Alberto; Cuscó, Ivon

    2015-01-01

    Autism spectrum disorders (ASD) are a group of neurodevelopmental disorders with high heritability. Recent findings support a highly heterogeneous and complex genetic etiology including rare de novo and inherited mutations or chromosomal rearrangements as well as double or multiple hits. We performed whole-exome sequencing (WES) and blood cell transcriptome by RNAseq in a subset of male patients with idiopathic ASD (n = 36) in order to identify causative genes, transcriptomic alterations, and susceptibility variants. We detected likely monogenic causes in seven cases: five de novo (SCN2A, MED13L, KCNV1, CUL3, and PTEN) and two inherited X-linked variants (MAOA and CDKL5). Transcriptomic analyses allowed the identification of intronic causative mutations missed by the usual filtering of WES and revealed functional consequences of some rare mutations. These included aberrant transcripts (PTEN, POLR3C), deregulated expression in 1.7% of mutated genes (that is, SEMA6B, MECP2, ANK3, CREBBP), allele-specific expression (FUS, MTOR, TAF1C), and non-sense-mediated decay (RIT1, ALG9). The analysis of rare inherited variants showed enrichment in relevant pathways such as the PI3K-Akt signaling and the axon guidance. Integrative analysis of WES and blood RNAseq data has proven to be an efficient strategy to identify likely monogenic forms of ASD (19% in our cohort), as well as additional rare inherited mutations that can contribute to ASD risk in a multifactorial manner. Blood transcriptomic data, besides validating 88% of expressed variants, allowed the identification of missed intronic mutations and revealed functional correlations of genetic variants, including changes in splicing, expression levels, and allelic expression.

  6. A Novel Splice-Site Mutation in Angiotensin I-Converting Enzyme (ACE) Gene, c.3691+1G>A (IVS25+1G>A), Causes a Dramatic Increase in Circulating ACE through Deletion of the Transmembrane Anchor

    PubMed Central

    Persu, Alexandre; Lambert, Michel; Deinum, Jaap; Cossu, Marta; de Visscher, Nathalie; Irenge, Leonid; Ambroise, Jerôme; Minon, Jean-Marc; Nesterovitch, Andrew B.; Churbanov, Alexander; Popova, Isolda A.; Danilov, Sergei M.; Danser, A. H. Jan; Gala, Jean-Luc

    2013-01-01

    Background Angiotensin-converting enzyme (ACE) (EC 4.15.1) metabolizes many biologically active peptides and plays a key role in blood pressure regulation and vascular remodeling. Elevated ACE levels are associated with different cardiovascular and respiratory diseases. Methods and Results Two Belgian families with a 8-16-fold increase in blood ACE level were incidentally identified. A novel heterozygous splice site mutation of intron 25 - IVS25+1G>A (c.3691+1G>A) - cosegregating with elevated plasma ACE was identified in both pedigrees. Messenger RNA analysis revealed that the mutation led to the retention of intron 25 and Premature Termination Codon generation. Subjects harboring the mutation were mostly normotensive, had no left ventricular hypertrophy or cardiovascular disease. The levels of renin-angiotensin-aldosterone system components in the mutated cases and wild-type controls were similar, both at baseline and after 50 mg captopril. Compared with non-affected members, quantification of ACE surface expression and shedding using flow cytometry assay of dendritic cells derived from peripheral blood monocytes of affected members, demonstrated a 50% decrease and 3-fold increase, respectively. Together with a dramatic increase in circulating ACE levels, these findings argue in favor of deletion of transmembrane anchor, leading to direct secretion of ACE out of cells. Conclusions We describe a novel mutation of the ACE gene associated with a major familial elevation of circulating ACE, without evidence of activation of the renin-angiotensin system, target organ damage or cardiovascular complications. These data are consistent with the hypothesis that membrane-bound ACE, rather than circulating ACE, is responsible for Angiotensin II generation and its cardiovascular consequences. PMID:23560051

  7. [Molecular characterization of 71 cases of glucose-6-phosphate dehydrogenase deficiency in Hainan province].

    PubMed

    Huang, Dong-Ai; Wang, Xiao-Ying; Wang, Zheng; Zhou, Dai-Feng; Cai, Wang-Wei

    2007-04-01

    To molecularly analyze in Han and Li individuals of glucose-6-phosphate dehydrogenase deficiency in Hainan, China. The amplification refractory mutation system (ARMS) was employed to detect G1376T, G1388A and A95G mutations. The coding regions and flanking intronic regions from the second to the thirteenth exons of G6PD gene was analyzed by DNA sequencing to characterize the gene mutations in samples without G1376T, G1388A and A95G mutations. Among 29 Han cases of G6PD deficiency, 11 had G1376T (37.9%), 2 G1388A (6.9%), 1 G1376T and G1388A (3.4%) and 1 G1376T and A95G (3.4%) were identified. Mutations of G1376T, G1388A, A95G and their complex accounted for 51.7% of G6PD deficiency in the Han individuals. Among 42 Li cases of G6PD deficiency, 25 had G1376T (59.5%), 6 G1388A (14.3%), 2 A95G (4.8%), 4 G1376T and G1388A (9.5%), 1 G1376T and A95G (2.4% )were identified. These mutations accounted for 90.5% of the Li individuals. Gene mutation of 18 cases (14 Han and 4 Li individuals) remained unknown. Sequencing results of the 18 samples indicated that one case had a single base of T deletion at nucleotide 636 or 637 in the 5th intron (IVS-5 636 or 637 T del) and two cases had C1311T with IVS-11 T93C mutation. G6PD G1376T and G1388A are the most common mutations in the populations of the Han and Li nationalities in Hainan. The IVS-5 636 or 637 T del mutation is first reported in Chinese, and the complex mutation of G1376T/A95G is first found in the Li nationality.

  8. Discovery of Point Mutations in the Voltage-Gated Sodium Channel from African Aedes aegypti Populations: Potential Phylogenetic Reasons for Gene Introgression.

    PubMed

    Kawada, Hitoshi; Higa, Yukiko; Futami, Kyoko; Muranami, Yuto; Kawashima, Emiko; Osei, Joseph H N; Sakyi, Kojo Yirenkyi; Dadzie, Samuel; de Souza, Dziedzom K; Appawu, Maxwell; Ohta, Nobuo; Suzuki, Takashi; Minakawa, Noboru

    2016-06-01

    Yellow fever is endemic in some countries in Africa, and Aedes aegpyti is one of the most important vectors implicated in the outbreak. The mapping of the nation-wide distribution and the detection of insecticide resistance of vector mosquitoes will provide the beneficial information for forecasting of dengue and yellow fever outbreaks and effective control measures. High resistance to DDT was observed in all mosquito colonies collected in Ghana. The resistance and the possible existence of resistance or tolerance to permethrin were suspected in some colonies. High frequencies of point mutations at the voltage-gated sodium channel (F1534C) and one heterozygote of the other mutation (V1016I) were detected, and this is the first detection on the African continent. The frequency of F1534C allele and the ratio of F1534C homozygotes in Ae. aegypti aegypti (Aaa) were significantly higher than those in Ae. aegypti formosus (Aaf). We could detect the two types of introns between exon 20 and 21, and the F1534C mutations were strongly linked with one type of intron, which was commonly found in South East Asian and South and Central American countries, suggesting the possibility that this mutation was introduced from other continents or convergently selected after the introgression of Aaa genes from the above area. The worldwide eradication programs in 1940s and 1950s might have caused high selection pressure on the mosquito populations and expanded the distribution of insecticide-resistant Ae. aegypti populations. Selection of the F1534C point mutation could be hypothesized to have taken place during this period. The selection of the resistant population of Ae. aegypti with the point mutation of F1534C, and the worldwide transportation of vector mosquitoes in accordance with human activity such as trading of used tires, might result in the widespread distribution of F1534C point mutation in tropical countries.

  9. A Landscape of Driver Mutations in Melanoma

    PubMed Central

    Hodis, Eran; Watson, Ian R.; Kryukov, Gregory V.; Arold, Stefan T.; Imielinski, Marcin; Theurillat, Jean-Philippe; Nickerson, Elizabeth; Auclair, Daniel; Li, Liren; Place, Chelsea; DiCara, Daniel; Ramos, Alex H.; Lawrence, Michael S.; Cibulskis, Kristian; Sivachenko, Andrey; Voet, Douglas; Saksena, Gordon; Stransky, Nicolas; Onofrio, Robert C.; Winckler, Wendy; Ardlie, Kristin; Wagle, Nikhil; Wargo, Jennifer; Chong, Kelly; Morton, Donald L.; Stemke-Hale, Katherine; Chen, Guo; Noble, Michael; Meyerson, Matthew; Ladbury, John E.; Davies, Michael A.; Gershenwald, Jeffrey E.; Wagner, Stephan N.; Hoon, Dave S.B.; Schadendorf, Dirk; Lander, Eric S.; Gabriel, Stacey B.; Getz, Gad; Garraway, Levi A.; Chin, Lynda

    2012-01-01

    SUMMARY Despite recent insights into melanoma genetics, systematic surveys for driver mutations are challenged by an abundance of passenger mutations caused by carcinogenic ultraviolet (UV) light exposure. We developed a permutation-based framework to address this challenge, employing mutation data from intronic sequences to control for passenger mutational load on a per gene basis. Analysis of large-scale melanoma exome data by this approach discovered six novel melanoma genes (PPP6C, RAC1, SNX31, TACC1, STK19 and ARID2), three of which - RAC1, PPP6C and STK19 - harbored recurrent and potentially targetable mutations. Integration with chromosomal copy number data contextualized the landscape of driver mutations, providing oncogenic insights in BRAF- and NRAS-driven melanoma as well as those without known NRAS/BRAF mutations. The landscape also clarified a mutational basis for RB and p53 pathway deregulation in this malignancy. Finally, the spectrum of driver mutations provided unequivocal genomic evidence for a direct mutagenic role of UV light in melanoma pathogenesis. PMID:22817889

  10. DMD mutation spectrum analysis in 613 Chinese patients with dystrophinopathy.

    PubMed

    Guo, Ruolan; Zhu, Guosheng; Zhu, Huimin; Ma, Ruiyu; Peng, Ying; Liang, Desheng; Wu, Lingqian

    2015-08-01

    Dystrophinopathy is a group of inherited diseases caused by mutations in the DMD gene. Within the dystrophinopathy spectrum, Duchenne and Becker muscular dystrophies are common X-linked recessive disorders that mainly feature striated muscle necrosis. We combined multiplex ligation-dependent probe amplification with Sanger sequencing to detect large deletions/duplications and point mutations in the DMD gene in 613 Chinese patients. A total of 571 (93.1%) patients were diagnosed, including 428 (69.8%) with large deletions/duplications and 143 (23.3%) with point mutations. Deletion/duplication breakpoints gathered mostly in introns 44-55. Reading frame rules could explain 88.6% of deletion mutations. We identified seventy novel point mutations that had not been previously reported. Spectrum expansion and genotype-phenotype analysis of DMD mutations on such a large sample size in Han Chinese population would provide new insights into the pathogenic mechanism underlying dystrophinopathies.

  11. A natural allele of Nxf1/TAP supresses retrovirus insertional mutations

    PubMed Central

    Floyd, Jennifer A.; Gold, David A.; Concepcion, Dorothy; Poon, Tiffany H.; Wang, Xiaobo; Keithley, Elizabeth; Chen, Dan; Ward, Erica J.; Chinn, Steven B.; Friedman, Rick A.; Yu, Hon-Tsen; Moriwaki, Kazuo; Shiroishi, Toshihiko; Hamilton, Bruce A.

    2009-01-01

    Endogenous retroviruses have shaped the evolution of mammalian genomes. Host genes that control the effects of retrovirus insertions are therefore of great interest. The Modifier-of-vibrator-1 locus controls level of correctly processed mRNA from genes mutated by endogenous retrovirus insertions into introns, including the pitpnvb tremor mutation and the Eya1BOR model of human branchiootorenal syndrome. Positional complementation cloning identifies Mvb1 as the nuclear export factor Nxf1, providing an unexpected link between mRNA export receptor and pre-mRNA processing. Population structure of the suppressing allele in wild M. m. castaneus suggests selective advantage. A congenic Mvb1CAST allele is a useful tool for modifying gene expression from existing mutations and could be used to manipulate engineered mutations containing retroviral elements. PMID:14517553

  12. Deep developmental transcriptome sequencing uncovers numerous new genes and enhances gene annotation in the sponge Amphimedon queenslandica.

    PubMed

    Fernandez-Valverde, Selene L; Calcino, Andrew D; Degnan, Bernard M

    2015-05-15

    The demosponge Amphimedon queenslandica is amongst the few early-branching metazoans with an assembled and annotated draft genome, making it an important species in the study of the origin and early evolution of animals. Current gene models in this species are largely based on in silico predictions and low coverage expressed sequence tag (EST) evidence. Amphimedon queenslandica protein-coding gene models are improved using deep RNA-Seq data from four developmental stages and CEL-Seq data from 82 developmental samples. Over 86% of previously predicted genes are retained in the new gene models, although 24% have additional exons; there is also a marked increase in the total number of annotated 3' and 5' untranslated regions (UTRs). Importantly, these new developmental transcriptome data reveal numerous previously unannotated protein-coding genes in the Amphimedon genome, increasing the total gene number by 25%, from 30,060 to 40,122. In general, Amphimedon genes have introns that are markedly smaller than those in other animals and most of the alternatively spliced genes in Amphimedon undergo intron-retention; exon-skipping is the least common mode of alternative splicing. Finally, in addition to canonical polyadenylation signal sequences, Amphimedon genes are enriched in a number of unique AT-rich motifs in their 3' UTRs. The inclusion of developmental transcriptome data has substantially improved the structure and composition of protein-coding gene models in Amphimedon queenslandica, providing a more accurate and comprehensive set of genes for functional and comparative studies. These improvements reveal the Amphimedon genome is comprised of a remarkably high number of tightly packed genes. These genes have small introns and there is pervasive intron retention amongst alternatively spliced transcripts. These aspects of the sponge genome are more similar unicellular opisthokont genomes than to other animal genomes.

  13. Polyoma virus small tumor antigen pre-mRNA splicing requires cooperation between two 3' splice sites.

    PubMed Central

    Ge, H; Noble, J; Colgan, J; Manley, J L

    1990-01-01

    We have studied splicing of the polyoma virus early region pre-mRNA in vitro. This RNA is alternatively spliced in vivo to produce mRNA encoding the large, middle-sized (MTAg), and small (StAg) tumor antigens. Our primary interest was to learn how the 48-nucleotide StAg intron is excised, because the length of this intron is significantly less than the apparent minimum established for mammalian introns. Although the products of all three splices are detected in vitro, characterization of the pathway and sequence requirements of StAg splicing suggests that splicing factors interact with the precursor RNA in an unexpected way to catalyze removal of this intron. Specifically, StAg splicing uses either of two lariat branch points, one of which is located only 4 nucleotides from the 3' splice site. Furthermore, the StAg splice absolutely requires that the alternative MTAg 3' splice site, located 14 nucleotides downstream of the StAg 3' splice site, be intact. Insertion mutations that increase or decrease the quality of the MTAg pyrimidine stretch enhance or repress StAg as well as MTAg splicing, and a single-base change in the MTAg AG splice acceptor totally blocks both splices. These results demonstrate the ability of two 3' splice sites to cooperate with each other to bring about removal of a single intron. Images PMID:2159146

  14. Two novel mutations in the alpha-galactosidase gene in Japanese classical hemizygotes with Fabry disease.

    PubMed

    Okumiya, T; Takenaka, T; Ishii, S; Kase, R; Kamei, S; Sakuraba, H

    1996-09-01

    Four alpha-galactosidase gene mutations were identified in Japanese male patients with Fabry disease who had no detectable alpha-galactosidase activity. Two of them were novel mutations, an 11-bp deletion in exon 2 and a g-1 to t substitution at the 3' end of the splice acceptor site in intron 1. The former caused a frameshift and led to the creation of a new stop codon at codon 118. The latter was predicted to provoke aberrant mRNA splicing followed by accelerated degradation of the mRNA. A nonsense mutation, R301X, and a 2-bp deletion starting at nucleotide position 718, which were reported previously, were also identified in unrelated patients.

  15. RTTN Mutations Cause Primary Microcephaly and Primordial Dwarfism in Humans

    PubMed Central

    Shamseldin, Hanan; Alazami, Anas M.; Manning, Melanie; Hashem, Amal; Caluseiu, Oana; Tabarki, Brahim; Esplin, Edward; Schelley, Susan; Innes, A. Micheil; Parboosingh, Jillian S.; Lamont, Ryan; Majewski, Jacek; Bernier, Francois P.; Alkuraya, Fowzan S.

    2015-01-01

    Primary microcephaly is a developmental brain anomaly that results from defective proliferation of neuroprogenitors in the germinal periventricular zone. More than a dozen genes are known to be mutated in autosomal-recessive primary microcephaly in isolation or in association with a more generalized growth deficiency (microcephalic primordial dwarfism), but the genetic heterogeneity is probably more extensive. In a research protocol involving autozygome mapping and exome sequencing, we recruited a multiplex consanguineous family who is affected by severe microcephalic primordial dwarfism and tested negative on clinical exome sequencing. Two candidate autozygous intervals were identified, and the second round of exome sequencing revealed a single intronic variant therein (c.2885+8A>G [p.Ser963∗] in RTTN exon 23). RT-PCR confirmed that this change creates a cryptic splice donor and thus causes retention of the intervening 7 bp of the intron and leads to premature truncation. On the basis of this finding, we reanalyzed the exome file of a second consanguineous family affected by a similar phenotype and identified another homozygous change in RTTN as the likely causal mutation. Combined linkage analysis of the two families confirmed that RTTN maps to the only significant linkage peak. Finally, through international collaboration, a Canadian multiplex family affected by microcephalic primordial dwarfism and biallelic mutation of RTTN was identified. Our results expand the phenotype of RTTN-related disorders, hitherto limited to polymicrogyria, to include microcephalic primordial dwarfism with a complex brain phenotype involving simplified gyration. PMID:26608784

  16. The occurrence of spring forms in tetraploid Timopheevi wheat is associated with variation in the first intron of the VRN-A1 gene.

    PubMed

    Shcherban, Andrey Borisovich; Schichkina, Aleksandra Aleksandrovna; Salina, Elena Artemovna

    2016-11-16

    Triticum araraticum and Triticum timopheevii are tetraploid species of the Timopheevi group. The former includes both winter and spring forms with a predominance of winter forms, whereas T. timopheevii is considered a spring species. In order to clarify the origin of the spring growth habit in T. timopheevii, allelic variability of the VRN-1 gene was investigated in a set of accessions of both tetraploid species, together with the diploid species Ae. speltoides, presumed donor of the G genome to these tetraploids. The promoter region of the VRN-A1 locus in all studied tetraploid accessions of both T. araraticum and T. timopheevii represents the previously described allele VRN-A1f with a 50 bp deletion near the start codon. Three additional alleles were identified namely, VRN-A1f-del, VRN-A1f-ins and VRN-A1f-del/ins, which contained large mutations in the first (1 st ) intron of VRN-A1. The first allele, carrying a deletion of 2.7 kb in a central part of intron 1, occurred in a few accessions of T. araraticum and no accessions of T. timopheevii. The VRN-A1f-ins allele, containing the insertion of a 0.4 kb MITE element about 0.4 kb upstream from the start of intron 1, and allele VRN-A1f-del/ins having this insertion coupled with a deletion of 2.7 kb are characteristic only for T. timopheevii. Allelic variation at the VRN-G1 locus includes the previously described allele VRN-G1a (with the insertion of a 0.2 kb MITE in the promoter) found in a few accessions of both tetraploid species. We showed that alleles VRN-A1f-del and VRN-G1a have no association with the spring growth habit, while in all accessions of T. timopheevii this habit was associated with the dominant VRN-A1f-ins and VRN-A1f-del/ins alleles. None of the Ae. speltoides accessions included in this study had changes in the promoter or 1 st intron regions of VRN-1 which might confer a spring growth habit. The VRN-1 promoter sequences analyzed herein and downloaded from databases have been used to construct a phylogram to assess the time of divergence of Ae. speltoides in relation to other wheat species. Among accessions of T. araraticum, the preferentially winter predecessor of T. timopheevii, two large mutations were found in both VRN-A1 and VRN-G1 loci (VRN-A1f-del and VRN-G1a) that were found to have no effect on vernalization requirements. Spring tetraploid T. timopheevii had one VRN-1 allele in common for two species (VRN-G1a), and two that were specific (VRN-A1f-ins, VRN-A1f-del/ins). The latter alleles include mutations in the 1 st intron of VRN-A1 and also share a 0.4 kb MITE insertion near the start of intron 1. We suggested that this insertion resulted in a spring growth habit in a progenitor of T. timopheevii which has probably been selected during subsequent domestication. The phylogram constructed on the basis of the VRN-1 promoter sequences confirmed the early divergence (~3.5 MYA) of the ancestor(s) of the B/G genomes from Ae. speltoides.

  17. Factors influencing alternative splice site utilization in vivo.

    PubMed Central

    Fu, X Y; Manley, J L

    1987-01-01

    To study factors that influence the choice of alternative pre-mRNA splicing pathways, we introduced plasmids expressing either wild-type or mutated simian virus 40 (SV40) early regions into tissue culture cells and then measured the quantities of small-t and large-T RNAs produced. One important element controlling splice site selection was found to be the size of the intron removed in the production of small-t mRNA; expansion of this intron (from 66 to 77 or more nucleotides) resulted in a substantial increase in the amount of small-t mRNA produced relative to large-T mRNA. This suggests that in the normal course of SV40 early pre-mRNA processing, large-T splicing is at a competitive advantage relative to small-t splicing because of the small size of the latter intron. Several additional features of the pre-mRNA that can influence splice site selection were also identified by analyzing the effects of mutations containing splice site duplications. These include the strengths of competing 5' splice sites and the relative positions of splice sites in the pre-mRNA. Finally, we showed that the ratio of small-t to large-T mRNA was 10 to 15-fold greater in human 293 cells than in HeLa cells or other mammalian cell types. These results suggest the existence of cell-specific trans-acting factors that can dramatically alter the pattern of splice site selection in a pre-mRNA. Images PMID:3029566

  18. An equine chromosome 3 inversion is associated with the tobiano spotting pattern in German horse breeds.

    PubMed

    Haase, B; Jude, R; Brooks, S A; Leeb, T

    2008-06-01

    The tobiano white-spotting pattern is one of several known depigmentation phenotypes in horses and is desired by many horse breeders and owners. The tobiano spotting phenotype is inherited as an autosomal dominant trait. Horses that are heterozygous or homozygous for the tobiano allele (To) are phenotypically indistinguishable. A SNP associated with To had previously been identified in intron 13 of the equine KIT gene and was used for an indirect gene test. The test was useful in several horse breeds. However, genotyping this sequence variant in the Lewitzer horse breed revealed that 14% of horses with the tobiano pattern did not show the polymorphism in intron 13 and consequently the test was not useful to identify putative homozygotes for To within this breed. Speculations were raised that an independent mutation might cause the tobiano spotting pattern in this breed. Recently, the putative causative mutation for To was described as a large chromosomal inversion on equine chromosome 3. One of the inversion breakpoints is approximately 70 kb downstream of the KIT gene and probably disrupts a regulatory element of the KIT gene. We obtained genotypes for the intron 13 SNP and the chromosomal inversion for 204 tobiano spotted horses and 24 control animals of several breeds. The genotyping data confirmed that the chromosomal inversion was perfectly associated with the To allele in all investigated horses. Therefore, the new test is suitable to discriminate heterozygous To/+ and homozygous To/To horses in the investigated breeds.

  19. Autosomal-recessive congenital cerebellar ataxia is caused by mutations in metabotropic glutamate receptor 1.

    PubMed

    Guergueltcheva, Velina; Azmanov, Dimitar N; Angelicheva, Dora; Smith, Katherine R; Chamova, Teodora; Florez, Laura; Bynevelt, Michael; Nguyen, Thai; Cherninkova, Sylvia; Bojinova, Veneta; Kaprelyan, Ara; Angelova, Lyudmila; Morar, Bharti; Chandler, David; Kaneva, Radka; Bahlo, Melanie; Tournev, Ivailo; Kalaydjieva, Luba

    2012-09-07

    Autosomal-recessive congenital cerebellar ataxia was identified in Roma patients originating from a small subisolate with a known strong founder effect. Patients presented with global developmental delay, moderate to severe stance and gait ataxia, dysarthria, mild dysdiadochokinesia, dysmetria and tremors, intellectual deficit, and mild pyramidal signs. Brain imaging revealed progressive generalized cerebellar atrophy, and inferior vermian hypoplasia and/or a constitutionally small brain were observed in some patients. Exome sequencing, used for linkage analysis on extracted SNP genotypes and for mutation detection, identified two novel (i.e., not found in any database) variants located 7 bp apart within a unique 6q24 linkage region. Both mutations cosegregated with the disease in five affected families, in which all ten patients were homozygous. The mutated gene, GRM1, encodes metabotropic glutamate receptor mGluR1, which is highly expressed in cerebellar Purkinje cells and plays an important role in cerebellar development and synaptic plasticity. The two mutations affect a gene region critical for alternative splicing and the generation of receptor isoforms; they are a 3 bp exon 8 deletion and an intron 8 splicing mutation (c.2652_2654del and c.2660+2T>G, respectively [RefSeq accession number NM_000838.3]). The functional impact of the deletion is unclear and is overshadowed by the splicing defect. Although ataxia lymphoblastoid cell lines expressed GRM1 at levels comparable to those of control cells, the aberrant transcripts skipped exon 8 or ended in intron 8 and encoded various species of nonfunctional receptors either lacking the transmembrane domain and containing abnormal intracellular tails or completely missing the tail. The study implicates mGluR1 in human hereditary ataxia. It also illustrates the potential of the Roma founder populations for mutation identification by exome sequencing. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  20. Mutations in the RS1 gene in a Chinese family with X-linked juvenile retinoschisis.

    PubMed

    Hou, Qiaofang; Chu, Yan; Guo, Qiannan; Wu, Dong; Liao, Shixiu

    2012-02-01

    The purpose of our study was to identify the mutations in the retinoschisis 1 (RS1) gene, which was associated with X-linked retinoschisis (XLRS) in a four-generation Chinese family, and to provide the theoretical basis for gene diagnosis and gene therapy. Genomic DNA was extracted from peripheral leukocytes. All six exons and flanking intronic regions were amplified by polymerase chain reaction (PCR), followed by direct sequencing. Through our genetic analysis, one frameshift 573delG mutation was identified in the patients of this four-generation pedigree; however, this mutation was absent in normal or non-carrier subjects. In conclusion, this 573delG mutation is reported in the Chinese population for the first time. This mutation widens the mutational spectrum of RS1 in Asians. Identification of mutations in the RS1 gene and expanded information on clinical manifestations will facilitate early diagnosis, appropriate early therapy, and genetic counseling regarding the prognosis of XLRS.

  1. Identification of 5 novel mutations in the AGXT gene.

    PubMed

    Basmaison, O; Rolland, M O; Cochat, P; Bozon, D

    2000-06-01

    In order to identify additional genotypes in primary hyperoxaluria type 1, we sequenced the AGXT genes of 9 patients. We report 5 new mutations. Three are splice-site mutations situated at the end of intron 4 and 8 (647-1G>A, 969-1G>C, 969-3C>G), one is a missense mutation in exon 5 (D183N), and one is a short duplication in exon 2 (349ins7). Their consequence is always a lack of enzymatic activity of the Alanine-Glyoxylate Aminotransferase (AGT); for 4 of them, we were able to deduce that they were associated to the absence of AGT protein. These mutations are rare, as they have been found on one allele in our study (except 969-3C>G present in 2 unrelated families), and have not been previously reported.

  2. Short intronic repeat sequences facilitate circular RNA production

    PubMed Central

    Liang, Dongming

    2014-01-01

    Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery “backsplices” and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3′ end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. PMID:25281217

  3. Closing the tau loop: the missing tau mutation

    PubMed Central

    McCarthy, Allan; Lonergan, Roisin; Olszewska, Diana A.; O’Dowd, Sean; Cummins, Gemma; Magennis, Brian; Fallon, Emer M.; Pender, Niall; Huey, Edward D.; Cosentino, Stephanie; O’Rourke, Killian; Kelly, Brendan D.; O’Connell, Martin; Delon, Isabelle; Farrell, Michael; Spillantini, Maria Grazia; Rowland, Lewis P.; Fahn, Stanley; Craig, Peter; Hutton, Michael

    2015-01-01

    Frontotemporal lobar degeneration comprises a group of disorders characterized by behavioural, executive, language impairment and sometimes features of parkinsonism and motor neuron disease. In 1994 we described an Irish-American family with frontotemporal dementia linked to chromosome 17 associated with extensive tau pathology. We named this disinhibition-dementia-parkinsonism-amyotrophy complex. We subsequently identified mutations in the MAPT gene. Eleven MAPT gene splice site stem loop mutations were identified over time except for 5’ splice site of exon 10. We recently identified another Irish family with autosomal dominant early amnesia and behavioural change or parkinsonism associated with the ‘missing’ +15 mutation at the intronic boundary of exon 10. We performed a clinical, neuropsychological and neuroimaging study on the proband and four siblings, including two affected siblings. We sequenced MAPT and performed segregation analysis. We looked for a biological effect of the tau variant by performing real-time polymerase chain reaction analysis of RNA extracted from human embryonic kidney cells transfected with exon trapping constructs. We found a c.915+15A>C exon 10/intron 10 stem loop mutation in all affected subjects but not in the unaffected. The c.915+15A>C variant caused a shift in tau splicing pattern to a predominantly exon 10+ pattern presumably resulting in predominant 4 repeat tau and little 3 repeat tau. This strongly suggests that the c.915+15A>C variant is a mutation and that it causes frontotemporal dementia linked to chromosome 17 in this pedigree by shifting tau transcription and translation to +4 repeat tau. Tau (MAPT) screening should be considered in families where amnesia or atypical parkinsonism coexists with behavioural disturbance early in the disease process. We describe the final missing stem loop tau mutation predicted 15 years ago. Mutations have now been identified at all predicted sites within the ‘stem’ when the stem-loop model was first proposed and no mutations have been found within the ‘loop’ region as expected. Therefore we ‘close the tau loop’ having ‘opened the loop’ 21 years ago. PMID:26297556

  4. Identification of a novel large deletion in a patient with severe factor V deficiency using an in-house F5 MLPA assay.

    PubMed

    Nuzzo, F; Paraboschi, E M; Straniero, L; Pavlova, A; Duga, S; Castoldi, E

    2015-01-01

    Factor V (FV) deficiency is a rare autosomal recessive bleeding disorder caused by mutations in the F5 gene. FV-deficient patients in whom no mutation or only one mutation is found may harbour large gene rearrangements, which are not detected by conventional mutation screening strategies. The aim of this study was to develop and validate a multiplex ligation-dependent probe amplification (MLPA) assay for the detection of large deletions and duplications in the F5 gene. Twenty-two MLPA probes targeting 19 of the 25 exons and the upstream and downstream regions of the F5 gene were designed and tested in 10 normal controls, a patient with a known heterozygous deletion of F5 exons 1-7 (positive control) and 14 genetically unexplained FV-deficient patients. MLPA results were confirmed by digital PCR on a QuantStudio(™) 3D Digital PCR System. The F5-specific probes yielded a reproducible peak profile in normal controls, correctly detected the known deletion in the positive control and suggested the presence of a novel deletion of exons 9-10 in a patient with undetectable FV levels and only one identified mutation. Follow-up by chip-based digital PCR, long-range PCR and direct sequencing confirmed that this patient carried a heterozygous F5 deletion of 1823 bp extending from intron 8 to intron 10. Bioinformatics sequence analysis pinpointed repetitive elements that might have originated the deletion. In conclusion, we have developed and validated an MLPA assay for the detection of gross F5 gene rearrangements. This assay may represent a valuable tool for the molecular diagnosis of FV deficiency. © 2014 John Wiley & Sons Ltd.

  5. A novel COL11A1 mutation affecting splicing in a patient with Stickler syndrome.

    PubMed

    Kohmoto, Tomohiro; Naruto, Takuya; Kobayashi, Haruka; Watanabe, Miki; Okamoto, Nana; Masuda, Kiyoshi; Imoto, Issei; Okamoto, Nobuhiko

    2015-01-01

    Stickler syndrome is a clinically and genetically heterogeneous collagenopathy characterized by ocular, auditory, skeletal and orofacial abnormalities, commonly occurring as an autosomal dominant trait. We conducted target resequencing to analyze candidate genes associated with known clinical phenotypes from a 4-year-old girl with Stickler syndrome. We detected a novel heterozygous intronic mutation (NM_001854.3:c.3168+5G>A) in COL11A1 that may impair splicing, which was suggested by in silico prediction and a minigene assay.

  6. A novel COL11A1 mutation affecting splicing in a patient with Stickler syndrome

    PubMed Central

    Kohmoto, Tomohiro; Naruto, Takuya; Kobayashi, Haruka; Watanabe, Miki; Okamoto, Nana; Masuda, Kiyoshi; Imoto, Issei; Okamoto, Nobuhiko

    2015-01-01

    Stickler syndrome is a clinically and genetically heterogeneous collagenopathy characterized by ocular, auditory, skeletal and orofacial abnormalities, commonly occurring as an autosomal dominant trait. We conducted target resequencing to analyze candidate genes associated with known clinical phenotypes from a 4-year-old girl with Stickler syndrome. We detected a novel heterozygous intronic mutation (NM_001854.3:c.3168+5G>A) in COL11A1 that may impair splicing, which was suggested by in silico prediction and a minigene assay. PMID:27081549

  7. Fragile X mental retardation 1 (FMR1) intron 1 methylation in blood predicts verbal cognitive impairment in female carriers of expanded FMR1 alleles: evidence from a pilot study.

    PubMed

    Godler, David E; Slater, Howard R; Bui, Quang M; Storey, Elsdon; Ono, Michele Y; Gehling, Freya; Inaba, Yoshimi; Francis, David; Hopper, John L; Kinsella, Glynda; Amor, David J; Hagerman, Randi J; Loesch, Danuta Z

    2012-03-01

    Cognitive status in females with mutations in the FMR1 (fragile X mental retardation 1) gene is highly variable. A biomarker would be of value for predicting which individuals were liable to develop cognitive impairment and could benefit from early intervention. A detailed analysis of CpG sites bridging exon 1 and intron 1 of FMR1, known as fragile X-related epigenetic element 2 (FREE2), suggests that a simple blood test could identify these individuals. Study participants included 74 control females (<40 CGG repeats), 62 premutation (PM) females (55-200 CGG repeats), and 18 full-mutation (FM) females assessed with Wechsler intelligence quotient (IQ) tests. We used MALDI-TOF mass spectrometry to determine the methylation status of FREE2 CpG sites that best identified low-functioning (IQ <70) FM females (>200 CGG repeats), compared the results with those for Southern blot FMR1 activation ratios, and related these assessments to the level of production of the FMR1 protein product in blood. A methylation analysis of intron 1 CpG sites 10-12 showed the highest diagnostic sensitivity (100%) and specificity (98%) of all the molecular measures tested for detecting females with a standardized verbal IQ of <70 among the study participants. In the group consisting of only FM females, methylation of these sites was significantly correlated with full-scale IQ, verbal IQ, and performance IQ. Several verbal subtest scores showed strong correlation with the methylation of these sites (P = 1.2 × 10(-5)) after adjustment for multiple measures. The data suggest that hypermethylation of the FMR1 intron 1 sites in blood is predictive of cognitive impairment in FM females, with implications for improved fragile X syndrome diagnostics in young children and screening of the newborn population.

  8. Amino acid substitutions and intron polymorphism of acetylcholinesterase1 associated with mevinphos resistance in diamondback moth, Plutella xylostella (L.).

    PubMed

    Yeh, Shih-Chia; Lin, Chia-Li; Chang, Cheng; Feng, Hai-Tung; Dai, Shu-Mei

    2014-06-01

    The diamondback moth, Plutella xylostella L., is the most destructive insect pest of Brassica crops in the world. It has developed resistance rapidly to almost every insecticide used for its control. Mevinphos, a fast degrading and slow resistance evocating organophosphorus insecticide, has been recommended for controlling P. xylostella in Taiwan for more than 40years. SHM strain of P. xylostella, with ca. 22-fold resistance to this chemical, has been established from a field SH strain by selecting with mevinphos since 1997. Three mutations, i.e., G892T, G971C, and T1156T/G leading to A298S, G324A, and F386F/V amino acid substitutions in acetylcholinesterase1 (AChE1), were identified in these two strains; along with three haplotype pairs and a polymorphic intron in AChE1 gene (ace1). Two genetically pure lines, i.e., an SHggt wild type with intron AS and an SHMTCN mutant carrying G892T, G971C, T1156T/G mutations and intron AR in ace1, were established by single pair mating and haplotype determination. The F1 of SHMTCN strain had 52-fold resistance to mevinphos in comparison with the F1 of SHggt strain. In addition, AChE1 of this SHMTCN population, which exhibited lower maximum velocity (Vmax) and affinity (Km), was less susceptible to the inhibition of mevinphos, with an I50 32-fold higher than that of the SHggt F1 population. These results imply that amino acid substitutions in AChE1 of SHMTCN strain are associated with mevinphos resistance in this insect pest, and this finding is important for insecticide resistance management of P. xylostella in the field. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Mutations in the SURF1 gene associated with Leigh syndrome and cytochrome C oxidase deficiency.

    PubMed

    Péquignot, M O; Dey, R; Zeviani, M; Tiranti, V; Godinot, C; Poyau, A; Sue, C; Di Mauro, S; Abitbol, M; Marsac, C

    2001-05-01

    Cytochrome c oxidase (COX) deficiency is one of the major causes of Leigh Syndrome (LS), a fatal encephalopathy of infancy or childhood, characterized by symmetrical lesions in the basal ganglia and brainstem. Mutations in the nuclear genes encoding COX subunits have not been found in patients with LS and COX deficiency, but mutations have been identified in SURF1. SURF1 encodes a factor involved in COX biogenesis. To date, 30 different mutations have been reported in 40 unrelated patients. We aim to provide an overview of all known mutations in SURF1, and to propose a common nomenclature. Twelve of the mutations were insertion/deletion mutations in exons 1, 4, 6, 8, and 9; 10 were missense/nonsense mutations in exons 2, 4, 5, 7, and 8; and eight were detected at splicing sites in introns 3 to 7. The most frequent mutation was 312_321del 311_312insAT which was found in 12 patients out of 40. Twenty mutations have been described only once. We also list all polymorphisms discovered to date. Copyright 2001 Wiley-Liss, Inc.

  10. Structure of the human type IV collagen COL4A6 gene, which is mutated in Alport syndrome-associated leiomyomatosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Xu; Zhou, Jing; Reeders, S.T.

    1996-05-01

    Basement membrane (type IV) collagen, a subfamily of the collagen protein family, is encoded by six distinct genes in mammals. Three of those, COL4A3, COL4A4, and COL4A5, are linked with Alport syndrome (hereditary nephritis). Patients with leimoyomatosis associated with Alport syndrome have been shown to have deletions in the 5{prime} end of the COL4A6 gene, in addition to having deletions in COL4A6. The human COL4A6 gene is reported to be 425 kb as determined by mapping of overlapping YAC clones by probes for its 5{prime} and 3{prime} ends. In the present study we describe the complete exon/intron size pattern ofmore » the human COL4A6 gene. The 12 {lambda} phage clones characterized in the study spanned a total of 110 kb, including 85 kb of the actual gene and 25 kb of flanking sequences. The overlapping clones contained all 46 exons of the gene and all introns, except for intron 2. Since the total size of the exons and all introns except for intron 2 is about 85 kb, intron 2 must be about 340 kb. All exons of the gene were assigned to EcoRI restriction fragments to facilitate analysis of the gene in patients with leiomyomatosis associated with Alport syndrome. The exon size pattern of COL4A6 is highly homologous with that of the human and mouse COL4A2 genes, with 27 of the 46 exons of COL4A6 being identical in size between the genes. 42 refs., 2 figs., 3 tabs.« less

  11. DeepGene: an advanced cancer type classifier based on deep learning and somatic point mutations.

    PubMed

    Yuan, Yuchen; Shi, Yi; Li, Changyang; Kim, Jinman; Cai, Weidong; Han, Zeguang; Feng, David Dagan

    2016-12-23

    With the developments of DNA sequencing technology, large amounts of sequencing data have become available in recent years and provide unprecedented opportunities for advanced association studies between somatic point mutations and cancer types/subtypes, which may contribute to more accurate somatic point mutation based cancer classification (SMCC). However in existing SMCC methods, issues like high data sparsity, small volume of sample size, and the application of simple linear classifiers, are major obstacles in improving the classification performance. To address the obstacles in existing SMCC studies, we propose DeepGene, an advanced deep neural network (DNN) based classifier, that consists of three steps: firstly, the clustered gene filtering (CGF) concentrates the gene data by mutation occurrence frequency, filtering out the majority of irrelevant genes; secondly, the indexed sparsity reduction (ISR) converts the gene data into indexes of its non-zero elements, thereby significantly suppressing the impact of data sparsity; finally, the data after CGF and ISR is fed into a DNN classifier, which extracts high-level features for accurate classification. Experimental results on our curated TCGA-DeepGene dataset, which is a reformulated subset of the TCGA dataset containing 12 selected types of cancer, show that CGF, ISR and DNN all contribute in improving the overall classification performance. We further compare DeepGene with three widely adopted classifiers and demonstrate that DeepGene has at least 24% performance improvement in terms of testing accuracy. Based on deep learning and somatic point mutation data, we devise DeepGene, an advanced cancer type classifier, which addresses the obstacles in existing SMCC studies. Experiments indicate that DeepGene outperforms three widely adopted existing classifiers, which is mainly attributed to its deep learning module that is able to extract the high level features between combinatorial somatic point mutations and cancer types.

  12. The circling mutant Pcdh15roda is a new mouse model for hearing loss.

    PubMed

    Torres, Adriana Amorim; Rzadzinska, Agnieszka K; Ribeiro, Andrea Frozino; Silva, Daniel Almeida da Silva E; Guénet, Jean-Louis; Massironi, Sílvia Maria Gomes; Godard, Ana Lúcia Brunialti

    2013-01-01

    Mouse mutagenesis is a key tool for studying gene function and several mutant alleles have been described and constitute mouse models for human hereditary diseases. Genetic hearing loss represents over 50% of all hearing loss cases in children and, due to the heterogeneity of the disorder, there is still a demand for the isolation and characterization of new genes and alleles. Here we report phenotypic and molecular characterization of a new mouse model for hereditary hearing loss. The mutant rodador, isolated by Massironi and colleagues in 2006, presents an autosomal recessive disorder characterized by deafness and balance dysfunction associated with abnormal stereocilia in the inner ear. The mutation was mapped to mouse chromosome 10, and characterization of the gene Pcdh15 revealed an AT-to-GC transition in intron 23 of mutant animals. The alteration led to the switch of a dinucleotide ApA for ApG, creating a novel intronic acceptor splice site, which leads to incorporation of eight intronic bases into the processed mRNA and alteration of the downstream reading frame. In silico analysis indicated that the mutated protein is truncated and lacks two cadherin domains, and the transmembrane and cytoplasmic domains. Real Time PCR analyses revealed a significantly reduced Pcdh15 mRNA level in the brain of mutant mice, which might be due to the mechanism of non-sense mediated decay. In man, mutations in the orthologue PCDH15 cause non-syndromic deafness and Usher Syndrome Type 1F, a genetic disorder characterized by hearing loss and retinitis pigmentosa. Rodador mouse constitutes a new model for studying deafness in these conditions and may help in the comprehension of the pathogeneses of the disease, as well as of the mechanisms involved in the morphogenesis and function of inner ear stereocilia. This is a new ENU-induced allele and the first isolated in a BALB/c background. Copyright © 2013 Elsevier B.V. All rights reserved.

  13. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.

    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing ofmore » an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.« less

  14. Identification of a novel FAM83H mutation and microhardness of an affected molar in autosomal dominant hypocalcified amelogenesis imperfecta.

    PubMed

    Hyun, H-K; Lee, S-K; Lee, K-E; Kang, H-Y; Kim, E-J; Choung, P-H; Kim, J-W

    2009-11-01

    To determine the underlying molecular genetic aetiology of a family with the hypocalcified form of amelogenesis imperfecta and to investigate the hardness of the enamel and dentine of a known FAM83H mutation. Mutational screening of the FAM83H on the basis of candidate gene approach was performed. All exons and exon-intron boundaries was amplified and sequenced. A microhardness test was performed to measure the Vickers microhardness value. A novel nonsense mutation (c.1354C>T, p.Q452X) was identified in the last exon of FAM83H, which resulted in soft, uncalcified enamel. The affected enamel was extremely soft (about 17% of the normal control), but the underlying dentine was as hard as the normal control. Mutational analysis revealed a novel mutation in FAM83H gene. Hardness of dentine was not affected by the mutation, whilst the enamel was extremely soft.

  15. Gene replacements and insertions in rice by intron targeting using CRISPR-Cas9.

    PubMed

    Li, Jun; Meng, Xiangbing; Zong, Yuan; Chen, Kunling; Zhang, Huawei; Liu, Jinxing; Li, Jiayang; Gao, Caixia

    2016-09-12

    Sequence-specific nucleases have been exploited to create targeted gene knockouts in various plants(1), but replacing a fragment and even obtaining gene insertions at specific loci in plant genomes remain a serious challenge. Here, we report efficient intron-mediated site-specific gene replacement and insertion approaches that generate mutations using the non-homologous end joining (NHEJ) pathway using the clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated protein 9 (Cas9) system. Using a pair of single guide RNAs (sgRNAs) targeting adjacent introns and a donor DNA template including the same pair of sgRNA sites, we achieved gene replacements in the rice endogenous gene 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) at a frequency of 2.0%. We also obtained targeted gene insertions at a frequency of 2.2% using a sgRNA targeting one intron and a donor DNA template including the same sgRNA site. Rice plants harbouring the OsEPSPS gene with the intended substitutions were glyphosate-resistant. Furthermore, the site-specific gene replacements and insertions were faithfully transmitted to the next generation. These newly developed approaches can be generally used to replace targeted gene fragments and to insert exogenous DNA sequences into specific genomic sites in rice and other plants.

  16. Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

    PubMed

    Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

    2012-01-01

    Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

  17. tRNA nuclear export in saccharomyces cerevisiae: in situ hybridization analysis.

    PubMed

    Sarkar, S; Hopper, A K

    1998-11-01

    To understand the factors specifically affecting tRNA nuclear export, we adapted in situ hybridization procedures to locate endogenous levels of individual tRNA families in wild-type and mutant yeast cells. Our studies of tRNAs encoded by genes lacking introns show that nucleoporin Nup116p affects both poly(A) RNA and tRNA export, whereas Nup159p affects only poly(A) RNA export. Los1p is similar to exportin-t, which facilitates vertebrate tRNA export. A los1 deletion mutation affects tRNA but not poly(A) RNA export. The data support the notion that Los1p and exportin-t are functional homologues. Because LOS1 is nonessential, tRNA export in vertebrate and yeast cells likely involves factors in addition to exportin-t. Mutation of RNA1, which encodes RanGAP, causes nuclear accumulation of tRNAs and poly(A) RNA. Many yeast mutants, including those with the rna1-1 mutation, affect both pre-tRNA splicing and RNA export. Our studies of the location of intron-containing pre-tRNAs in the rna1-1 mutant rule out the possibility that this results from tRNA export occurring before splicing. Our results also argue against inappropriate subnuclear compartmentalization causing defects in pre-tRNA splicing. Rather, the data support "feedback" of nucleus/cytosol exchange to the pre-tRNA splicing machinery.

  18. tRNA Nuclear Export in Saccharomyces cerevisiae: In Situ Hybridization Analysis

    PubMed Central

    Sarkar, Srimonti; Hopper, Anita K.

    1998-01-01

    To understand the factors specifically affecting tRNA nuclear export, we adapted in situ hybridization procedures to locate endogenous levels of individual tRNA families in wild-type and mutant yeast cells. Our studies of tRNAs encoded by genes lacking introns show that nucleoporin Nup116p affects both poly(A) RNA and tRNA export, whereas Nup159p affects only poly(A) RNA export. Los1p is similar to exportin-t, which facilitates vertebrate tRNA export. A los1 deletion mutation affects tRNA but not poly(A) RNA export. The data support the notion that Los1p and exportin-t are functional homologues. Because LOS1 is nonessential, tRNA export in vertebrate and yeast cells likely involves factors in addition to exportin-t. Mutation of RNA1, which encodes RanGAP, causes nuclear accumulation of tRNAs and poly(A) RNA. Many yeast mutants, including those with the rna1-1 mutation, affect both pre-tRNA splicing and RNA export. Our studies of the location of intron-containing pre-tRNAs in the rna1-1 mutant rule out the possibility that this results from tRNA export occurring before splicing. Our results also argue against inappropriate subnuclear compartmentalization causing defects in pre-tRNA splicing. Rather, the data support “feedback” of nucleus/cytosol exchange to the pre-tRNA splicing machinery. PMID:9802895

  19. Interplay between Alternative Splicing and Alternative Polyadenylation Defines the Expression Outcome of the Plant Unique OXIDATIVE TOLERANT-6 Gene.

    PubMed

    Li, Qingshun Q; Liu, Zhaoyang; Lu, Wenjia; Liu, Man

    2017-05-17

    Pre-mRNA alternative splicing and alternative polyadenylation have been implicated to play important roles during eukaryotic gene expression. However, much remains unknown regarding the regulatory mechanisms and the interactions of these two processes in plants. Here we focus on an Arabidopsis gene OXT6 (Oxidative Tolerant-6) that has been demonstrated to encode two proteins through alternative splicing and alternative polyadenylation. Specifically, alternative polyadenylation at Intron-2 of OXT6 produces a transcript coding for AtCPSF30, an Arabidopsis ortholog of 30 kDa subunit of the Cleavage and Polyadenylation Specificity Factor. On the other hand, alternative splicing of Intron-2 generates a longer transcript encoding a protein named AtC30Y, a polypeptide including most part of AtCPSF30 and a YT521B domain. To investigate the expression outcome of OXT6 in plants, a set of mutations were constructed to alter the splicing and polyadenylation patterns of OXT6. Analysis of transgenic plants bearing these mutations by quantitative RT-PCR revealed a competition relationship between these two processes. Moreover, when both splice sites and poly(A) signals were mutated, polyadenylation became the preferred mode of OXT6 processing. These results demonstrate the interplay between alternative splicing and alternative polyadenylation, and it is their concerted actions that define a gene's expression outcome.

  20. RET fusion as a novel driver of medullary thyroid carcinoma.

    PubMed

    Grubbs, Elizabeth G; Ng, Patrick Kwok-Shing; Bui, Jacquelin; Busaidy, Naifa L; Chen, Ken; Lee, Jeffrey E; Lu, Xinyan; Lu, Hengyu; Meric-Bernstam, Funda; Mills, Gordon B; Palmer, Gary; Perrier, Nancy D; Scott, Kenneth L; Shaw, Kenna R; Waguespack, Steven G; Williams, Michelle D; Yelensky, Roman; Cote, Gilbert J

    2015-03-01

    Oncogenic RET tyrosine kinase gene fusions and activating mutations have recently been identified in lung cancers, prompting initiation of targeted therapy trials in this disease. Although RET point mutation has been identified as a driver of tumorigenesis in medullary thyroid carcinoma (MTC), no fusions have been described to date. We evaluated the role of RET fusion as an oncogenic driver in MTC. We describe a patient who died from aggressive sporadic MTC < 10 months after diagnosis. Her tumor was evaluated by means of next-generation sequencing, including an intronic capture strategy. A reciprocal translocation involving RET intron 12 was identified. The fusion was validated using a targeted break apart fluorescence in situ hybridization probe, and RNA sequencing confirmed the existence of an in-frame fusion transcript joining MYH13 exon 35 with RET exon 12. Ectopic expression of fusion product in a murine Ba/F3 cell reporter model established strong oncogenicity. Three tyrosine kinase inhibitors currently used to treat MTC in clinical practice blocked tumorigenic cell growth. This finding represents the report of a novel RET fusion, the first of its kind described in MTC. The finding of this potential novel oncogenic mechanism has clear implications for sporadic MTC, which in the majority of cases has no driver mutation identified. The presence of a RET fusion also provides a plausible target for RET tyrosine kinase inhibitor therapies.

  1. [Genetic diagnostics of pathogenic splicing abnormalities in the clinical laboratory--pitfalls and screening approaches].

    PubMed

    Niimi, Hideki; Ogawa, Tomomi; Note, Rhougou; Hayashi, Shirou; Ueno, Tomohiro; Harada, Kenu; Uji, Yoshinori; Kitajima, Isao

    2010-12-01

    In recent years, genetic diagnostics of pathogenic splicing abnormalities are increasingly recognized as critically important in the clinical genetic diagnostics. It is reported that approximately 10% of pathogenic mutations causing human inherited diseases are splicing mutations. Nonetheless, it is still difficult to identify splicing abnormalities in routine genetic diagnostic settings. Here, we studied two different kinds of cases with splicing abnormalities. The first case is a protein S deficiency. Nucleotide analyses revealed that the proband had a previously reported G to C substitution in the invariant AG dinucleotide at the splicing acceptor site of intronl/exon2, which produces multiple splicing abnormalities resulting in protein S deficiency. The second case is an antithrombin (AT) deficiency. This proband had a previously reported G to A substitution, at nucleotide position 9788 in intron 4, 14 bp in front of exon 5, which created a de novo exon 5 splice site and resulted in AT deficiency. From a practical standpoint, we discussed the pitfalls, attentions, and screening approaches in genetic diagnostics of pathogenic splicing abnormalities. Due to the difficulty with full-length sequence analysis of introns, and the lack of RNA samples, splicing mutations may escape identification. Although current genetic testing remains to be improved, to screen for splicing abnormalities more efficiently, it is significant to use an appropriate combination of various approaches such as DNA and/or RNA samples, splicing mutation databases, bioinformatic tools to detect splice sites and cis-regulatory elements, and in vitro and/or in vivo experimentally methods as needed.

  2. Urine-derived podocytes-lineage cells: A promising tool for precision medicine in Alport Syndrome.

    PubMed

    Daga, Sergio; Baldassarri, Margherita; Lo Rizzo, Caterina; Fallerini, Chiara; Imperatore, Valentina; Longo, Ilaria; Frullanti, Elisa; Landucci, Elisa; Massella, Laura; Pecoraro, Carmine; Garosi, Guido; Ariani, Francesca; Mencarelli, Maria Antonietta; Mari, Francesca; Renieri, Alessandra; Pinto, Anna Maria

    2018-02-01

    Alport Syndrome (ATS) is a rare genetic disorder caused by collagen IV genes mutations, leading to glomerular basement membrane damage up to end-stage renal disease. Podocytes, the main component of the glomerular structure, are the only cells able to produce all the three collagens IV alpha chains associated with ATS and thus, they are key players in ATS pathogenesis. However, podocytes-targeted therapeutic strategies have been hampered by the difficulty of non-invasively isolating them and transcripts-based diagnostic approaches are complicated by the inaccessibility of other COL4 chains-expressing cells. We firstly isolated podocyte-lineage cells from ATS patients' urine samples, in a non-invasive way. RT-PCR analysis revealed COL4A3, COL4A4, and COL4A5 expression. Transcripts analysis on RNA extracted from patient's urine derived podocyte-lineage cells allowed defining the pathogenic role of intronic variants, namely one mutation in COL4A3 (c.3882+5G>A), three mutations in COL4A4 (c.1623+2T>A, c.3699_3706+1del, c.2545+143T>A), and one mutation in COL4A5 (c.3454+2T>C). Therefore, our cellular model represents a novel tool, essential to unequivocally prove the effect of spliceogenic intronic variants on transcripts expressed exclusively at a glomerular level. This process is a key step for providing the patient with a definite molecular diagnosis and with a proper recurrence risk. The established system also opens up the possibility of testing personalized therapeutic approaches on disease-relevant cells. © 2017 Wiley Periodicals, Inc.

  3. RTTN Mutations Cause Primary Microcephaly and Primordial Dwarfism in Humans.

    PubMed

    Shamseldin, Hanan; Alazami, Anas M; Manning, Melanie; Hashem, Amal; Caluseiu, Oana; Tabarki, Brahim; Esplin, Edward; Schelley, Susan; Innes, A Micheil; Parboosingh, Jillian S; Lamont, Ryan; Majewski, Jacek; Bernier, Francois P; Alkuraya, Fowzan S

    2015-12-03

    Primary microcephaly is a developmental brain anomaly that results from defective proliferation of neuroprogenitors in the germinal periventricular zone. More than a dozen genes are known to be mutated in autosomal-recessive primary microcephaly in isolation or in association with a more generalized growth deficiency (microcephalic primordial dwarfism), but the genetic heterogeneity is probably more extensive. In a research protocol involving autozygome mapping and exome sequencing, we recruited a multiplex consanguineous family who is affected by severe microcephalic primordial dwarfism and tested negative on clinical exome sequencing. Two candidate autozygous intervals were identified, and the second round of exome sequencing revealed a single intronic variant therein (c.2885+8A>G [p.Ser963(∗)] in RTTN exon 23). RT-PCR confirmed that this change creates a cryptic splice donor and thus causes retention of the intervening 7 bp of the intron and leads to premature truncation. On the basis of this finding, we reanalyzed the exome file of a second consanguineous family affected by a similar phenotype and identified another homozygous change in RTTN as the likely causal mutation. Combined linkage analysis of the two families confirmed that RTTN maps to the only significant linkage peak. Finally, through international collaboration, a Canadian multiplex family affected by microcephalic primordial dwarfism and biallelic mutation of RTTN was identified. Our results expand the phenotype of RTTN-related disorders, hitherto limited to polymicrogyria, to include microcephalic primordial dwarfism with a complex brain phenotype involving simplified gyration. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  4. Spliceman2: a computational web server that predicts defects in pre-mRNA splicing.

    PubMed

    Cygan, Kamil Jan; Sanford, Clayton Hendrick; Fairbrother, William Guy

    2017-09-15

    Most pre-mRNA transcripts in eukaryotic cells must undergo splicing to remove introns and join exons, and splicing elements present a large mutational target for disease-causing mutations. Splicing elements are strongly position dependent with respect to the transcript annotations. In 2012, we presented Spliceman, an online tool that used positional dependence to predict how likely distant mutations around annotated splice sites were to disrupt splicing. Here, we present an improved version of the previous tool that will be more useful for predicting the likelihood of splicing mutations. We have added industry-standard input options (i.e. Spliceman now accepts variant call format files), which allow much larger inputs than previously available. The tool also can visualize the locations-within exons and introns-of sequence variants to be analyzed and the predicted effects on splicing of the pre-mRNA transcript. In addition, Spliceman2 integrates with RNAcompete motif libraries to provide a prediction of which trans -acting factors binding sites are disrupted/created and links out to the UCSC genome browser. In summary, the new features in Spliceman2 will allow scientists and physicians to better understand the effects of single nucleotide variations on splicing. Freely available on the web at http://fairbrother.biomed.brown.edu/spliceman2 . Website implemented in PHP framework-Laravel 5, PostgreSQL, Apache, and Perl, with all major browsers supported. william_fairbrother@brown.edu. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  5. Advanced cell-based modeling of the royal disease: characterization of the mutated F9 mRNA.

    PubMed

    Martorell, L; Luce, E; Vazquez, J L; Richaud-Patin, Y; Jimenez-Delgado, S; Corrales, I; Borras, N; Casacuberta-Serra, S; Weber, A; Parra, R; Altisent, C; Follenzi, A; Dubart-Kupperschmitt, A; Raya, A; Vidal, F; Barquinero, J

    2017-11-01

    Essentials The Royal disease (RD) is a form of hemophilia B predicted to be caused by a splicing mutation. We generated an iPSC-based model of the disease allowing mechanistic studies at the RNA level. F9 mRNA analysis in iPSC-derived hepatocyte-like cells showed the predicted abnormal splicing. Mutated F9 mRNA level was very low but we also found traces of wild type transcripts. Background The royal disease is a form of hemophilia B (HB) that affected many descendants of Queen Victoria in the 19th and 20th centuries. It was found to be caused by the mutation F9 c.278-3A>G. Objective To generate a physiological cell model of the disease and to study F9 expression at the RNA level. Methods Using fibroblasts from skin biopsies of a previously identified hemophilic patient bearing the F9 c.278-3A>G mutation and his mother, we generated induced pluripotent stem cells (iPSCs). Both the patient's and mother's iPSCs were differentiated into hepatocyte-like cells (HLCs) and their F9 mRNA was analyzed using next-generation sequencing (NGS). Results and Conclusion We demonstrated the previously predicted aberrant splicing of the F9 transcript as a result of an intronic nucleotide substitution leading to a frameshift and the generation of a premature termination codon (PTC). The F9 mRNA level in the patient's HLCs was significantly reduced compared with that of his mother, suggesting that mutated transcripts undergo nonsense-mediated decay (NMD), a cellular mechanism that degrades PTC-containing mRNAs. We also detected small proportions of correctly spliced transcripts in the patient's HLCs, which, combined with genetic variability in splicing and NMD machineries, could partially explain some clinical variability among affected members of the European royal families who had lifespans above the average. This work allowed the demonstration of the pathologic consequences of an intronic mutation in the F9 gene and represents the first bona fide cellular model of HB allowing the study of rare mutations at the RNA level. © 2017 International Society on Thrombosis and Haemostasis.

  6. Discovery of Point Mutations in the Voltage-Gated Sodium Channel from African Aedes aegypti Populations: Potential Phylogenetic Reasons for Gene Introgression

    PubMed Central

    Muranami, Yuto; Kawashima, Emiko; Osei, Joseph H. N.; Sakyi, Kojo Yirenkyi; Dadzie, Samuel; de Souza, Dziedzom K.; Appawu, Maxwell; Ohta, Nobuo; Minakawa, Noboru

    2016-01-01

    Background Yellow fever is endemic in some countries in Africa, and Aedes aegpyti is one of the most important vectors implicated in the outbreak. The mapping of the nation-wide distribution and the detection of insecticide resistance of vector mosquitoes will provide the beneficial information for forecasting of dengue and yellow fever outbreaks and effective control measures. Methodology/Principal Findings High resistance to DDT was observed in all mosquito colonies collected in Ghana. The resistance and the possible existence of resistance or tolerance to permethrin were suspected in some colonies. High frequencies of point mutations at the voltage-gated sodium channel (F1534C) and one heterozygote of the other mutation (V1016I) were detected, and this is the first detection on the African continent. The frequency of F1534C allele and the ratio of F1534C homozygotes in Ae. aegypti aegypti (Aaa) were significantly higher than those in Ae. aegypti formosus (Aaf). We could detect the two types of introns between exon 20 and 21, and the F1534C mutations were strongly linked with one type of intron, which was commonly found in South East Asian and South and Central American countries, suggesting the possibility that this mutation was introduced from other continents or convergently selected after the introgression of Aaa genes from the above area. Conclusions/Significance The worldwide eradication programs in 1940s and 1950s might have caused high selection pressure on the mosquito populations and expanded the distribution of insecticide-resistant Ae. aegypti populations. Selection of the F1534C point mutation could be hypothesized to have taken place during this period. The selection of the resistant population of Ae. aegypti with the point mutation of F1534C, and the worldwide transportation of vector mosquitoes in accordance with human activity such as trading of used tires, might result in the widespread distribution of F1534C point mutation in tropical countries. PMID:27304430

  7. Detection of KIT Genotype in Pigs by TaqMan MGB Real-Time Quantitative Polymerase Chain Reaction.

    PubMed

    Li, Xiuxiu; Li, Xiaoning; Luo, Rongrong; Wang, Wenwen; Wang, Tao; Tang, Hui

    2018-05-01

    The dominant white phenotype in domestic pigs is caused by two mutations in the KIT gene: a 450 kb duplication containing the entire KIT gene together with flanking sequences and one splice mutation with a G:A substitution in intron 17. The purpose of this study was to establish a simple, rapid method to determine KIT genotype in pigs. First, to detect KIT copy number variation (CNV), primers for exon 2 of the KIT gene, along with a TaqMan minor groove binder (MGB) probe, were designed. The single-copy gene, estrogen receptor (ESR), was used as an internal control. A real-time fluorescence-based quantitative PCR (FQ-PCR) protocol was developed to accurately detect KIT CNVs. Second, to detect the splice mutation ratio of the G:A substitution in intron 17, a 175 bp region, including the target mutation, was amplified from genomic DNA. Based on the sequence of the resulting amplified fragment, an MGB probe set was designed to detect the ratio of splice mutation to normal using FQ-PCR. A series of parallel amplification curves with the same internal distances were obtained using gradually diluted DNA as templates. The CT values among dilutions were significantly different (p < 0.001) and the coefficients of variation from each dilution were low (from 0.13% to 0.26%). The amplification efficiencies for KIT and ESR were approximately equal, indicating ESR was an appropriate control gene. Furthermore, use of the MGB probe set resulted in detection of the target mutation at a high resolution and stability; standard curves illustrated that the amplification efficiencies of KIT1 (G) and KIT2 (A) were approximately equal (98.8% and 97.2%). In conclusion, a simple, rapid method, with high specificity and stability, for the detection of the KIT genotype in pigs was established using TaqMan MGB probe real-time quantitative PCR.

  8. Pathogenic mutations in TULP1 responsible for retinitis pigmentosa identified in consanguineous familial cases

    PubMed Central

    Ullah, Inayat; Kabir, Firoz; Iqbal, Muhammad; Gottsch, Clare Brooks S.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose To identify pathogenic mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous familial cases. Methods Seven large familial cases with multiple individuals diagnosed with retinitis pigmentosa were included in the study. Affected individuals in these families underwent ophthalmic examinations to document the symptoms and confirm the initial diagnosis. Blood samples were collected from all participating members, and genomic DNA was extracted. An exclusion analysis with microsatellite markers spanning the TULP1 locus on chromosome 6p was performed, and two-point logarithm of odds (LOD) scores were calculated. All coding exons along with the exon–intron boundaries of TULP1 were sequenced bidirectionally. We constructed a single nucleotide polymorphism (SNP) haplotype for the four familial cases harboring the K489R allele and estimated the likelihood of a founder effect. Results The ophthalmic examinations of the affected individuals in these familial cases were suggestive of RP. Exclusion analyses confirmed linkage to chromosome 6p harboring TULP1 with positive two-point LOD scores. Subsequent Sanger sequencing identified the single base pair substitution in exon14, c.1466A>G (p.K489R), in four families. Additionally, we identified a two-base deletion in exon 4, c.286_287delGA (p.E96Gfs77*); a homozygous splice site variant in intron 14, c.1495+4A>C; and a novel missense variation in exon 15, c.1561C>T (p.P521S). All mutations segregated with the disease phenotype in the respective families and were absent in ethnically matched control chromosomes. Haplotype analysis suggested (p<10−6) that affected individuals inherited the causal mutation from a common ancestor. Conclusions Pathogenic mutations in TULP1 are responsible for the RP phenotype in seven familial cases with a common ancestral mutation responsible for the disease phenotype in four of the seven families. PMID:27440997

  9. The effects of sex-biased gene expression and X-linkage on rates of sequence evolution in Drosophila.

    PubMed

    Campos, José Luis; Johnston, Keira; Charlesworth, Brian

    2017-12-08

    A faster rate of adaptive evolution of X-linked genes compared with autosomal genes (the faster-X effect) can be caused by the fixation of recessive or partially recessive advantageous mutations. This effect should be largest for advantageous mutations that affect only male fitness, and least for mutations that affect only female fitness. We tested these predictions in Drosophila melanogaster by using coding and functionally significant non-coding sequences of genes with different levels of sex-biased expression. Consistent with theory, nonsynonymous substitutions in most male-biased and unbiased genes show faster adaptive evolution on the X. However, genes with very low recombination rates do not show such an effect, possibly as a consequence of Hill-Robertson interference. Contrary to expectation, there was a substantial faster-X effect for female-biased genes. After correcting for recombination rate differences, however, female-biased genes did not show a faster X-effect. Similar analyses of non-coding UTRs and long introns showed a faster-X effect for all groups of genes, other than introns of female-biased genes. Given the strong evidence that deleterious mutations are mostly recessive or partially recessive, we would expect a slower rate of evolution of X-linked genes for slightly deleterious mutations that become fixed by genetic drift. Surprisingly, we found little evidence for this after correcting for recombination rate, implying that weakly deleterious mutations are mostly close to being semidominant. This is consistent with evidence from polymorphism data, which we use to test how models of selection that assume semidominance with no sex-specific fitness effects may bias estimates of purifying selection. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  10. Functional Studies and In Silico Analyses to Evaluate Non-Coding Variants in Inherited Cardiomyopathies.

    PubMed

    Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco

    2016-11-10

    Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.

  11. Targeted next-generation sequencing appoints c16orf57 as clericuzio-type poikiloderma with neutropenia gene.

    PubMed

    Volpi, Ludovica; Roversi, Gaia; Colombo, Elisa Adele; Leijsten, Nico; Concolino, Daniela; Calabria, Andrea; Mencarelli, Maria Antonietta; Fimiani, Michele; Macciardi, Fabio; Pfundt, Rolph; Schoenmakers, Eric F P M; Larizza, Lidia

    2010-01-01

    Next-generation sequencing is a straightforward tool for the identification of disease genes in extended genomic regions. Autozygosity mapping was performed on a five-generation inbred Italian family with three siblings affected with Clericuzio-type poikiloderma with neutropenia (PN [MIM %604173]), a rare autosomal-recessive genodermatosis characterised by poikiloderma, pachyonychia, and chronic neutropenia. The siblings were initially diagnosed as affected with Rothmund-Thomson syndrome (RTS [MIM #268400]), with which PN shows phenotypic overlap. Linkage analysis on all living subjects of the family identified a large 16q region inherited identically by descent (IBD) in all affected family members. Deep sequencing of this 3.4 Mb region previously enriched with array capture revealed a homozygous c.504-2 A>C mismatch in all affected siblings. The mutation destroys the invariant AG acceptor site of intron 4 of the evolutionarily conserved C16orf57 gene. Two distinct deleterious mutations (c.502A>G and c.666_676+1del12) identified in an unrelated PN patient confirmed that the C16orf57 gene is responsible for PN. The function of the predicted C16orf57 gene is unknown, but its product has been shown to be interconnected to RECQL4 protein via SMAD4 proteins. The unravelled clinical and genetic identity of PN allows patients to undergo genetic testing and follow-up. 2010 The American Society of Human Genetics. Published by Elsevier Inc.

  12. Predominant RET Germline Mutations in Exons 10, 11, and 16 in Iranian Patients with Hereditary Medullary Thyroid Carcinoma

    PubMed Central

    Hedayati, Mehdi; Zarif Yeganeh, Marjan; Sheikhol Eslami, Sara; Rezghi Barez, Shekoofe; Hoghooghi Rad, Laleh; Azizi, Fereidoun

    2011-01-01

    Medullary thyroid carcinoma occurs in both sporadic (75%) and hereditary (25%) forms. The missense mutations of RET proto-oncogene in MTC development have been well demonstrated. To investigate the spectrum of predominant RET germline mutations in exons 10, 11, and 16 in hereditary MTC in Iranian population, 217 participants were included. Genomic DNAs were extracted from the leukocytes using the standard Salting Out/Proteinase K method. Mutation detection was performed through PCR-RFLP and DNA sequencing. In 217 participants, 43 missense mutations were identified in exons 10 (6%), 11 (13%), and 16 (0.9%). Moreover, a novel germline mutation was detected in exon 11 (S686N). Also four different polymorphisms were found in intron 16 in eight patients. The obtained data showed the frequency profile of RET mutations in Iranian individuals with MTC (19.8%). The most frequent mutation in our population was C634G whereas in most population it was C634R. Altogether, these results underline the importance of the genetic background of family members of any patient with MTC. PMID:21765987

  13. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II.

    PubMed

    Boo, Sung Hyun; Song, Min-Jung; Kim, Hee-Jin; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won; Hong, Sung Hwa

    2013-03-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome.

  14. A Novel Germline Mutation in BRCA1 Causes Exon 20 Skipping in a Korean Family with a History of Breast Cancer.

    PubMed

    Yoon, Kyong-Ah; Kong, Sun-Young; Lee, Eun Ji; Cho, Jeong Nam; Chang, Suhwan; Lee, Eun Sook

    2017-09-01

    Germline mutations in the BRCA1 and BRCA2 genes are strong genetic factors for predispositions to breast, ovarian, and other related cancers. This report describes a family with a history of breast and ovarian cancers that harbored a novel BRCA1 germline mutation. A single nucleotide deletion in intron 20, namely c.5332+4delA, was detected in a 43-year-old patient with breast cancer. This mutation led to the skipping of exon 20, which in turn resulted in the production of a truncated BRCA1 protein that was 1773 amino acids in length. The mother of the proband had died due to ovarian cancer and had harbored the same germline mutation. Ectopically expressed mutant BRCA1 protein interacted with the BARD1 protein, but showed a reduced transcriptional function, as demonstrated by the expression of cyclin B1 . This novel germline mutation in the BRCA1 gene caused familial breast and ovarian cancers.

  15. The TREAT-NMD DMD Global Database: Analysis of More than 7,000 Duchenne Muscular Dystrophy Mutations

    PubMed Central

    Bladen, Catherine L; Salgado, David; Monges, Soledad; Foncuberta, Maria E; Kekou, Kyriaki; Kosma, Konstantina; Dawkins, Hugh; Lamont, Leanne; Roy, Anna J; Chamova, Teodora; Guergueltcheva, Velina; Chan, Sophelia; Korngut, Lawrence; Campbell, Craig; Dai, Yi; Wang, Jen; Barišić, Nina; Brabec, Petr; Lahdetie, Jaana; Walter, Maggie C; Schreiber-Katz, Olivia; Karcagi, Veronika; Garami, Marta; Viswanathan, Venkatarman; Bayat, Farhad; Buccella, Filippo; Kimura, En; Koeks, Zaïda; van den Bergen, Janneke C; Rodrigues, Miriam; Roxburgh, Richard; Lusakowska, Anna; Kostera-Pruszczyk, Anna; Zimowski, Janusz; Santos, Rosário; Neagu, Elena; Artemieva, Svetlana; Rasic, Vedrana Milic; Vojinovic, Dina; Posada, Manuel; Bloetzer, Clemens; Jeannet, Pierre-Yves; Joncourt, Franziska; Díaz-Manera, Jordi; Gallardo, Eduard; Karaduman, A Ayşe; Topaloğlu, Haluk; El Sherif, Rasha; Stringer, Angela; Shatillo, Andriy V; Martin, Ann S; Peay, Holly L; Bellgard, Matthew I; Kirschner, Jan; Flanigan, Kevin M; Straub, Volker; Bushby, Kate; Verschuuren, Jan; Aartsma-Rus, Annemieke; Béroud, Christophe; Lochmüller, Hanns

    2015-01-01

    Analyzing the type and frequency of patient-specific mutations that give rise to Duchenne muscular dystrophy (DMD) is an invaluable tool for diagnostics, basic scientific research, trial planning, and improved clinical care. Locus-specific databases allow for the collection, organization, storage, and analysis of genetic variants of disease. Here, we describe the development and analysis of the TREAT-NMD DMD Global database (http://umd.be/TREAT_DMD/). We analyzed genetic data for 7,149 DMD mutations held within the database. A total of 5,682 large mutations were observed (80% of total mutations), of which 4,894 (86%) were deletions (1 exon or larger) and 784 (14%) were duplications (1 exon or larger). There were 1,445 small mutations (smaller than 1 exon, 20% of all mutations), of which 358 (25%) were small deletions and 132 (9%) small insertions and 199 (14%) affected the splice sites. Point mutations totalled 756 (52% of small mutations) with 726 (50%) nonsense mutations and 30 (2%) missense mutations. Finally, 22 (0.3%) mid-intronic mutations were observed. In addition, mutations were identified within the database that would potentially benefit from novel genetic therapies for DMD including stop codon read-through therapies (10% of total mutations) and exon skipping therapy (80% of deletions and 55% of total mutations). PMID:25604253

  16. Short intronic repeat sequences facilitate circular RNA production.

    PubMed

    Liang, Dongming; Wilusz, Jeremy E

    2014-10-15

    Recent deep sequencing studies have revealed thousands of circular noncoding RNAs generated from protein-coding genes. These RNAs are produced when the precursor messenger RNA (pre-mRNA) splicing machinery "backsplices" and covalently joins, for example, the two ends of a single exon. However, the mechanism by which the spliceosome selects only certain exons to circularize is largely unknown. Using extensive mutagenesis of expression plasmids, we show that miniature introns containing the splice sites along with short (∼ 30- to 40-nucleotide) inverted repeats, such as Alu elements, are sufficient to allow the intervening exons to circularize in cells. The intronic repeats must base-pair to one another, thereby bringing the splice sites into close proximity to each other. More than simple thermodynamics is clearly at play, however, as not all repeats support circularization, and increasing the stability of the hairpin between the repeats can sometimes inhibit circular RNA biogenesis. The intronic repeats and exonic sequences must collaborate with one another, and a functional 3' end processing signal is required, suggesting that circularization may occur post-transcriptionally. These results suggest detailed and generalizable models that explain how the splicing machinery determines whether to produce a circular noncoding RNA or a linear mRNA. © 2014 Liang and Wilusz; Published by Cold Spring Harbor Laboratory Press.

  17. Enhanced sensitivity for detection of low-level germline mosaic RB1 mutations in sporadic retinoblastoma cases using deep semiconductor sequencing.

    PubMed

    Chen, Zhao; Moran, Kimberly; Richards-Yutz, Jennifer; Toorens, Erik; Gerhart, Daniel; Ganguly, Tapan; Shields, Carol L; Ganguly, Arupa

    2014-03-01

    Sporadic retinoblastoma (RB) is caused by de novo mutations in the RB1 gene. Often, these mutations are present as mosaic mutations that cannot be detected by Sanger sequencing. Next-generation deep sequencing allows unambiguous detection of the mosaic mutations in lymphocyte DNA. Deep sequencing of the RB1 gene on lymphocyte DNA from 20 bilateral and 70 unilateral RB cases was performed, where Sanger sequencing excluded the presence of mutations. The individual exons of the RB1 gene from each sample were amplified, pooled, ligated to barcoded adapters, and sequenced using semiconductor sequencing on an Ion Torrent Personal Genome Machine. Six low-level mosaic mutations were identified in bilateral RB and four in unilateral RB cases. The incidence of low-level mosaic mutation was estimated to be 30% and 6%, respectively, in sporadic bilateral and unilateral RB cases, previously classified as mutation negative. The frequency of point mutations detectable in lymphocyte DNA increased from 96% to 97% for bilateral RB and from 13% to 18% for unilateral RB. The use of deep sequencing technology increased the sensitivity of the detection of low-level germline mosaic mutations in the RB1 gene. This finding has significant implications for improved clinical diagnosis, genetic counseling, surveillance, and management of RB. © 2013 WILEY PERIODICALS, INC.

  18. Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain

    PubMed Central

    Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

    2016-01-01

    We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability. PMID:27022329

  19. Neonatal Marfan Syndrome: Report of a Case with an Inherited Splicing Mutation outside the Neonatal Domain.

    PubMed

    Le Gloan, Laurianne; Hauet, Quentin; David, Albert; Hanna, Nadine; Arfeuille, Chloé; Arnaud, Pauline; Boileau, Catherine; Romefort, Bénédicte; Benbrik, Nadir; Gournay, Véronique; Joram, Nicolas; Baron, Olivier; Isidor, Bertrand

    2016-02-01

    We report a child and her mother affected by Marfan syndrome. The child presented with a phenotype of neonatal Marfan syndrome, revealed by acute and refractory heart failure, finally leading to death within the first 4 months of life. Her mother had a common clinical presentation. Genetic analysis revealed an inherited FBN1 mutation. This intronic mutation (c.6163+3_6163+6del), undescribed to date, leads to exon 49 skipping, corresponding to in-frame deletion of 42 amino acids (p.Ile2014_Asp2055del). FBN1 next-generation sequencing did not show any argument for mosaicism. Association in the same family of severe neonatal and classical Marfan syndrome illustrates the intrafamilial phenotype variability.

  20. Chromosomal localization and partial genomic structure of the human peroxisome proliferator activated receptor-gamma (hPPAR gamma) gene.

    PubMed

    Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R

    1997-04-28

    We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.

  1. Genomic organization and expression of the human MSH3 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Watanabe, Atsushi; Ikejima, Miyoko; Suzuki, Noriko

    1996-02-01

    We have studied the expression and genomic organization of the human MSH3 gene, which encodes a human homologue of the bacterial DNA mismatch repair protein MutS. This gene is located upstream of the dihydrofolate reductase (DHFR) gene. Northern analysis has demonstrated that the hMSH3 gene is expressed in a variety of human tissues at low levels, like the DHFR gene. Characterization of cosmid clones has shown that the hMSH3 gene consists of 24 exons spanning at least 160 kb. All exon-intron junction sequences match the classical GT/AG rule, except that intron 6 has AT and AA at the ends. Twomore » major transcripts of 5.0 and 3.8 kb have been shown to be derived from the differential use of two polyadenylation sites. Elucidation of the complete genomic organization and the nucleotide sequences of the introns of the hMSH3 gene should be useful for studying the function of this gene and the possible involvement of specific mutations of the hMSH3 gene in some diseases. 34 refs., 5 figs., 1 tab.« less

  2. Mitochondrial genomes of the green macroalga Ulva pertusa (Ulvophyceae, Chlorophyta): novel insights into the evolution of mitogenomes in the Ulvophyceae.

    PubMed

    Liu, Feng; Melton, James T; Bi, Yuping

    2017-10-01

    To further understand the trends in the evolution of mitochondrial genomes (mitogenomes or mtDNAs) in the Ulvophyceae, the mitogenomes of two separate thalli of Ulva pertusa were sequenced. Two U. pertusa mitogenomes (Up1 and Up2) were 69,333 bp and 64,602 bp in length. These mitogenomes shared two ribosomal RNAs (rRNAs), 28 transfer RNAs (tRNAs), 29 protein-coding genes, and 12 open reading frames. The 4.7 kb difference in size was attributed to variation in intron content and tandem repeat regions. A total of six introns were present in the smaller U. pertusa mtDNA (Up2), while the larger mtDNA (Up1) had eight. The larger mtDNA had two additional group II introns in two genes (cox1 and cox2) and tandem duplication mutations in noncoding regions. Our results showed the first case of intraspecific variation in chlorophytan mitogenomes and provided further genomic data for the undersampled Ulvophyceae. © 2017 Phycological Society of America.

  3. Genomic organization and mutational analysis of the human UCP2 gene, a prime candidate gene for human obesity.

    PubMed

    Lentes, K U; Tu, N; Chen, H; Winnikes, U; Reinert, I; Marmann, G; Pirke, K M

    1999-01-01

    Uncoupling proteins (UCPs) are mitochondrial membrane transporters which are involved in dissipating the proton electrochemical gradient thereby releasing stored energy as heat. This implies a major role of UCPs in energy metabolism and thermogenesis which when deregulated are key risk factors for the development of obesity and other eating disorders. Recent studies have shown that the sympathetic nervous system, via norepinephrine (beta-adrenoceptors) and cAMP, as well as thyroid hormones and PPAR gamma ligands seem to be major regulators of UCP expression. From the three different UCPs identified so far by gene cloning UCP1 is expressed exclusively in brown adipocytes while UCP2 is widely expressed. The third analogue, UCP3, is expressed predominantly in human skeletal muscle and was found to exist in a long and a short form. At the amino acid level UCP2 has about 59% homology to UCP1 while UCP3 is 73% identical to UCP2. Both UCP2 and UCP3 were mapped in close proximity (75-150 kb) to regions of human chromosome 11 (11q13) that have been linked to obesity and hyper-insulinaemia. Furthermore, there is strong evidence that UCP2, by virtue of its ubiquitous expression, may be important for determining basal metabolic rate. Based on the published full-length cDNA sequence we have deduced the genomic structure of the human UCP2 (hUCP2) gene by PCR and direct sequence analysis. The hUCP2 gene spans over 8.4 kb distributed on 8 exons. The localization of the exon/intron boundaries within the coding region matches precisely the one found in the human UCP1 gene and is almost conserved in the recently discovered UCP3 gene as well. However, the size of each of the introns in the hUCP2 gene differs from its UCP1 and UCP3 counterparts. It varies from 81 bp (intron 5) to about 3 kb (intron 2). The high degree of homology at the nucleotide level and the conservation of the exon/intron boundaries among the three UCP genes suggests that they may have evolved from a common ancestor or are the result from gene duplication events. Mutational analysis of the hUCP2 gene in a cohort of 25 children of caucasian origin (aged 7-13) characterized by low BMR values revealed a point mutation in exon 4 (C to T transition at position 164 of the corresponding cDNA resulting in the substitution of an alanine residue by a valine at codon 55) and an insertion polymorphism in exon 8. The insertion polymorphism consists of a 45 bp repeat located 150 bp downstream of the stop codon in the 3'-UTR. The allele frequencies were 0.61 and 0.39 for the alanine and valine encoded alleles, respectively, and 0.71 versus 0.29 for the insertion polymorphism. Expression studies of the wildtype and mutant forms of UCP2 should clarify the functional consequences these mutations may have on energy metabolism and body weight regulation. In addition, mapping of the promoter region and the identification of putative promoter regulatory sequences should give insight into the transcriptional regulation of UCP2 expression--in particular by anyone of the above mentioned factors--in vitro and in vivo.

  4. A novel large deletion mutation of FERMT1 gene in a Chinese patient with Kindler syndrome.

    PubMed

    Gao, Ying; Bai, Jin-li; Liu, Xiao-yan; Qu, Yu-jin; Cao, Yan-yan; Wang, Jian-cai; Jin, Yu-wei; Wang, Hong; Song, Fang

    2015-11-01

    Kindler syndrome (KS; OMIM 173650) is a rare autosomal recessive skin disorder, which results in symptoms including blistering, epidermal atrophy, increased risk of cancer, and poor wound healing. The majority of mutations of the disease-determining gene (FERMT1 gene) are single nucleotide substitutions, including missense mutations, nonsense mutations, etc. Large deletion mutations are seldom reported. To determine the mutation in the FERMT1 gene associated with a 7-year-old Chinese patient who presented clinical manifestation of KS, we performed direct sequencing of all the exons of FERMT1 gene. For the exons 2-6 without amplicons, we analyzed the copy numbers using quantitative real-time polymerase chain reaction (qRT-PCR) with specific primers. The deletion breakpoints were sublocalized and the range of deletion was confirmed by PCR and direct sequencing. In this study, we identified a new 17-kb deletion mutation spanning the introns 1-6 of FERMT1 gene in a Chinese patient with severe KS phenotypes. Her parents were carriers of the same mutation. Our study reported a newly identified large deletion mutation of FERMT1 gene involved in KS, which further enriched the mutation spectrum of the FERMT1 gene.

  5. Cytochrome C oxydase deficiency: SURF1 gene investigation in patients with Leigh syndrome.

    PubMed

    Maalej, Marwa; Kammoun, Thouraya; Alila-Fersi, Olfa; Kharrat, Marwa; Ammar, Marwa; Felhi, Rahma; Mkaouar-Rebai, Emna; Keskes, Leila; Hachicha, Mongia; Fakhfakh, Faiza

    2018-03-18

    Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is the MT[HYPHEN]ATP6 and SURF1 gene screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions by clinical and bioinformatics analyses. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analyses to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A > C/c. c.751 + 16G > A). In silico analyses of theses intronic variations showed that it could alters splicing processes as well as SURF1 protein translation. Leigh syndrome (LS) is a rare progressive neurodegenerative disorder occurring in infancy. The most common clinical signs reported in LS are growth retardation, optic atrophy, ataxia, psychomotor retardation, dystonia, hypotonia, seizures and respiratory disorders. The paper reported a manifestation of 3 Tunisian patients presented with LS syndrome. The aim of this study is MT-ATP6 and SURF1 genes screening in Tunisian patients affected with classical Leigh syndrome and the computational investigation of the effect of detected mutations on its structure and functions. After clinical investigations, three Tunisian patients were tested for mutations in both MT-ATP6 and SURF1 genes by direct sequencing followed by in silico analysis to predict the effects of sequence variation. The result of mutational analysis revealed the absence of mitochondrial mutations in MT-ATP6 gene and the presence of a known homozygous splice site mutation c.516-517delAG in sibling patients added to the presence of a novel double het mutations in LS patient (c.752-18 A>C/ c.751+16G>A). In silico analysis of theses intronic vaiations showed that it could alters splicing processes as well as SURF1 protein translation. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. SPONTANEOUS AND MNNG-INDUCED REVERSION OF AN EGFP CONSTRUCT IN HELA CELLS: AN ASSAY FOR OBSERVING MUTATIONS IN LIVING CELLS BY FLUORESCENT MICROSCOPY

    EPA Science Inventory

    A HeLa cell line stably expressing the Enhanced Green Fluorescence Protein (EGFP) gene, interrupted by the IVS2-654 intron, was studied without treatment and after treatment with a single standard dose of 15 ?M of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). This assay was done ...

  7. Development of allele-specific multiplex PCR to determine the length of poly-T in intron 8 of CFTR

    PubMed Central

    Prada, Anne E.

    2014-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutation analysis has been implemented for Cystic Fibrosis (CF) carrier screening, and molecular diagnosis of CF and congenital bilateral absence of the vas deferens (CBAVD). Although poly-T allele analysis in intron 8 of CFTR is required when a patient is positive for R117H, it is not recommended for routine carrier screening. Therefore, commercial kits for CFTR mutation analysis were designed either to mask the poly-T allele results, unless a patient is R117H positive, or to have the poly-T analysis as a standalone reflex test using the same commercial platform. There are other standalone assays developed to detect poly-T alleles, such as heteroduplex analysis, High Resolution Melting (HRM) curve analysis, allele-specific PCR (AS-PCR) and Sanger sequencing. In this report, we developed a simple and easy-to-implement multiplex AS-PCR assay using unlabeled standard length primers, which can be used as a reflex or standalone test for CFTR poly-T track analysis. Out of 115 human gDNA samples tested, results from our new AS-PCR matched to the previous known poly-T results or results from Sanger sequencing. PMID:25071991

  8. The full-length microRNA cluster in the intron of large latency transcript is associated with the virulence of pseudorabies virus.

    PubMed

    Wang, Xin; Zhang, Mei-Mei; Yan, Kai; Tang, Qi; Wu, Yi-Quan; He, Wen-Bo; Chen, Huan-Chun; Liu, Zheng-Fei

    2018-07-01

    Pseudorabies virus (PRV), the etiological pathogen of Aujeszky's disease, belongs to the Alphaherpesvirus subfamily. Large latency transcript (LLT), the most abundant PRV transcript, harbors a ~ 4.6 kb microRNA (miRNA) cluster-encoding intron. To investigate the function of the LLT miRNA cluster during the life cycle of PRV, we generated a miRNA cluster mutation virus (PRV-∆miR cluster) and revertant virus. Analysis of the growth kinetics of PRV-ΔmiR cluster-infected cells revealed significantly smaller plaques and lower titers than the wild-type and revertant viruses. The mutation virus exhibited increased IE180 and decreased EP0 expression. The clinical symptoms observed in mice infected with PRV-ΔmiR cluster revealed that the miRNA cluster is involved in the pathogenesis of PRV. Physical parameters, virus shedding assays, and the SN 50 titers revealed that the miRNA cluster enhances PRV virulence in pigs. Collectively, our findings suggest that the full-length miRNA cluster is involved in PRV replication and virulence. Copyright © 2018 Elsevier Inc. All rights reserved.

  9. STAR splicing mutations cause the severe phenotype of lipoid congenital adrenal hyperplasia: insights from a novel splice mutation and review of reported cases.

    PubMed

    Camats, Núria; Pandey, Amit V; Fernández-Cancio, Mónica; Fernández, Juan M; Ortega, Ana M; Udhane, Sameer; Andaluz, Pilar; Audí, Laura; Flück, Christa E

    2014-02-01

    The steroidogenic acute regulatory protein (StAR) transports cholesterol to the mitochondria for steroidogenesis. Loss of StAR function causes lipoid congenital adrenal hyperplasia (LCAH) which is characterized by impaired synthesis of adrenal and gonadal steroids causing adrenal insufficiency, 46,XY disorder of sex development (DSD) and failure of pubertal development. Partial loss of StAR activity may cause adrenal insufficiency only. A newborn girl was admitted for mild dehydration, hyponatremia, hyperkalemia and hypoglycaemia and had normal external female genitalia without hyperpigmentation. Plasma cortisol, 17OH-progesterone, DHEA-S, androstendione and aldosterone were low, while ACTH and plasma renin activity were elevated, consistent with the diagnosis of primary adrenal insufficiency. Imaging showed normal adrenals, and cytogenetics revealed a 46,XX karyotype. She was treated with fluids, hydrocortisone and fludrocortisone. Genetic studies revealed a novel homozygous STAR mutation in the 3' acceptor splice site of intron 4, c.466-1G>A (IVS4-1G>A). To test whether this mutation would affect splicing, we performed a minigene experiment with a plasmid construct containing wild-type or mutant StAR gDNA of exons-introns 4-6 in COS-1 cells. The splicing was assessed on total RNA using RT-PCR for STAR cDNAs. The mutant STAR minigene skipped exon 5 completely and changed the reading frame. Thus, it is predicted to produce an aberrant and shorter protein (p.V156GfsX19). Computational analysis revealed that this mutant protein lacks wild-type exons 5-7 which are essential for StAR-cholesterol interaction. STAR c.466-1A skips exon 5 and causes a dramatic change in the C-terminal sequence of the protein, which is essential for StAR-cholesterol interaction. This splicing mutation is a loss-of-function mutation explaining the severe phenotype of our patient. Thus far, all reported splicing mutations of STAR cause a severe impairment of protein function and phenotype. © 2013 John Wiley & Sons Ltd.

  10. [Frequency of intron 1 inversion of factor VIII gene in Chinese hemophilia A patients with case report of a female patient with heterozygous intron 1 inversion].

    PubMed

    Yan, Zhen-yu; Liang, Yan; Yan, Mei; Fan, Lian-kai; Xiao, Bai; Hua, Bao-lai; Liu, Jing-zhong; Zhao, Yong-qiang

    2008-10-21

    To investigate the frequency of intron 1 inversion (inv1) in FVIII gene in Chinese hemophilia A (HA) patients and to investigate the mechanism of pathogenesis. Peripheral blood samples were collected from 158 unrelated HA patients, aged 20 (1 - 73), including one female HA patient, aged 5, and several family members of a patient positive in inv1. One-stage method was used to assay the FVIII activity (FVIII:C). Long distance PCR and multiple PCR in duplex reactions were used to screen for the intron 22 inversion (inv22) and inv1 of the FVIII coding gene (F8). The F8 coding sequence was amplified with PCR and sequenced with an automatic sequencer. Two unrelated patients (pedigrees) were detected as inv1 positive with a positive rate of 1.26%. A rare female HA patient with inv1 was also discovered in a positive family (3 HA cases were found in this family and regarded as one case in calculating the total detection rate). The full length of FVIII was sequenced, and no other mutation was detected. There frequency of FVIII inv1 is low in Chinese HA patients compared with other populations. Female HA patients are heterozygous for FVIII inv1 and that may be resulted from nonrandom inactivation of X chromosome.

  11. Structure and polymorphism of the mouse prion protein gene.

    PubMed Central

    Westaway, D; Cooper, C; Turner, S; Da Costa, M; Carlson, G A; Prusiner, S B

    1994-01-01

    Missense mutations in the prion protein (PrP) gene, overexpression of the cellular isoform of PrP (PrPC), and infection with prions containing the scrapie isoform of PrP (PrPSc) all cause neurodegenerative disease. To understand better the physiology and expression of PrPC, we retrieved mouse PrP gene (Prn-p) yeast artificial chromosome (YAC), cosmid, phage, and cDNA clones. Physical mapping positions Prn-p approximately 300 kb from ecotropic virus integration site number 4 (Evi-4), compatible with failure to detect recombination between Prn-p and Evi-4 in genetic crosses. The Prn-pa allele encompasses three exons, with exons 1 and 2 encoding the mRNA 5' untranslated region. Exon 2 has no equivalent in the Syrian hamster and human PrP genes. The Prn-pb gene shares this intron/exon structure but harbors an approximately 6-kb deletion within intron 2. While the Prn-pb open reading frame encodes two amino acid substitutions linked to prolonged scrapie incubation periods, a deletion of intron 2 sequences also characterizes inbred strains such as RIII/S and MOLF/Ei with shorter incubation periods, making a relationship between intron 2 size and scrapie pathogenesis unlikely. The promoter regions of a and b Prn-p alleles include consensus Sp1 and AP-1 sites, as well as other conserved motifs which may represent binding sites for as yet unidentified transcription factors. Images PMID:7912827

  12. Characterisation of ATM mutations in Slavic Ataxia telangiectasia patients.

    PubMed

    Soukupova, Jana; Pohlreich, Petr; Seemanova, Eva

    2011-09-01

    Ataxia telangiectasia (AT) is a genomic instability syndrome characterised, among others, by progressive cerebellar degeneration, oculocutaneous telangiectases, immunodeficiency, elevated serum alpha-phetoprotein level, chromosomal breakage, hypersensitivity to ionising radiation and increased cancer risk. This autosomal recessive disorder is caused by mutations in the ataxia telangiectasia mutated (ATM) gene coding for serine/threonine protein kinase with a crucial role in response to DNA double-strand breaks. We characterised genotype and phenotype of 12 Slavic AT patients from 11 families. Mutation analysis included sequencing of the entire coding sequence, adjacent intron regions, 3'UTR and 5'UTR of the ATM gene and multiplex ligation-dependent probe amplification (MLPA) for the detection of large deletions/duplications at the ATM locus. The high incidence of new and individual mutations demonstrates a marked mutational heterogeneity of AT in the Czech Republic. Our data indicate that sequence analysis of the entire coding region of ATM is sufficient for a high detection rate of mutations in ATM and that MLPA analysis for the detection of deletions/duplications seems to be redundant in the Slavic population.

  13. Loss of function mutations in RP1 are responsible for retinitis pigmentosa in consanguineous familial cases

    PubMed Central

    Kabir, Firoz; Ullah, Inayat; Ali, Shahbaz; Gottsch, Alexander D.H.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2016-01-01

    Purpose This study was undertaken to identify causal mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous families. Methods Large consanguineous families were ascertained from the Punjab province of Pakistan. An ophthalmic examination consisting of a fundus evaluation and electroretinography (ERG) was completed, and small aliquots of blood were collected from all participating individuals. Genomic DNA was extracted from white blood cells, and a genome-wide linkage or a locus-specific exclusion analysis was completed with polymorphic short tandem repeats (STRs). Two-point logarithm of odds (LOD) scores were calculated, and all coding exons and exon–intron boundaries of RP1 were sequenced to identify the causal mutation. Results The ophthalmic examination showed that affected individuals in all families manifest cardinal symptoms of RP. Genome-wide scans localized the disease phenotype to chromosome 8q, a region harboring RP1, a gene previously implicated in the pathogenesis of RP. Sanger sequencing identified a homozygous single base deletion in exon 4: c.3697delT (p.S1233Pfs22*), a single base substitution in intron 3: c.787+1G>A (p.I263Nfs8*), a 2 bp duplication in exon 2: c.551_552dupTA (p.Q185Yfs4*) and an 11,117 bp deletion that removes all three coding exons of RP1. These variations segregated with the disease phenotype within the respective families and were not present in ethnically matched control samples. Conclusions These results strongly suggest that these mutations in RP1 are responsible for the retinal phenotype in affected individuals of all four consanguineous families. PMID:27307693

  14. A Mouse Model for the Metabolic Effects of the Human Fat Mass and Obesity Associated FTO Gene

    PubMed Central

    Church, Chris; Deacon, Robert; Gerken, Thomas; Lee, Angela; Moir, Lee; Mecinović, Jasmin; Quwailid, Mohamed M.; Schofield, Christopher J.; Ashcroft, Frances M.; Cox, Roger D.

    2009-01-01

    Human FTO gene variants are associated with body mass index and type 2 diabetes. Because the obesity-associated SNPs are intronic, it is unclear whether changes in FTO expression or splicing are the cause of obesity or if regulatory elements within intron 1 influence upstream or downstream genes. We tested the idea that FTO itself is involved in obesity. We show that a dominant point mutation in the mouse Fto gene results in reduced fat mass, increased energy expenditure, and unchanged physical activity. Exposure to a high-fat diet enhances lean mass and lowers fat mass relative to control mice. Biochemical studies suggest the mutation occurs in a structurally novel domain and modifies FTO function, possibly by altering its dimerisation state. Gene expression profiling revealed increased expression of some fat and carbohydrate metabolism genes and an improved inflammatory profile in white adipose tissue of mutant mice. These data provide direct functional evidence that FTO is a causal gene underlying obesity. Compared to the reported mouse FTO knockout, our model more accurately reflects the effect of human FTO variants; we observe a heterozygous as well as homozygous phenotype, a smaller difference in weight and adiposity, and our mice do not show perinatal lethality or an age-related reduction in size and length. Our model suggests that a search for human coding mutations in FTO may be informative and that inhibition of FTO activity is a possible target for the treatment of morbid obesity. PMID:19680540

  15. Effective suppression of dengue virus using a novel group-I intron that induces apoptotic cell death upon infection through conditional expression of the Bax C-terminal domain.

    PubMed

    Carter, James R; Keith, James H; Fraser, Tresa S; Dawson, James L; Kucharski, Cheryl A; Horne, Kate M; Higgs, Stephen; Fraser, Malcolm J

    2014-06-13

    Approximately 100 million confirmed infections and 20,000 deaths are caused by Dengue virus (DENV) outbreaks annually. Global warming and rapid dispersal have resulted in DENV epidemics in formally non-endemic regions. Currently no consistently effective preventive measures for DENV exist, prompting development of transgenic and paratransgenic vector control approaches. Production of transgenic mosquitoes refractory for virus infection and/or transmission is contingent upon defining antiviral genes that have low probability for allowing escape mutations, and are equally effective against multiple serotypes. Previously we demonstrated the effectiveness of an anti-viral group I intron targeting U143 of the DENV genome in mediating trans-splicing and expression of a marker gene with the capsid coding domain. In this report we examine the effectiveness of coupling expression of ΔN Bax to trans-splicing U143 intron activity as a means of suppressing DENV infection of mosquito cells. Targeting the conserved DENV circularization sequence (CS) by U143 intron trans-splicing activity appends a 3' exon RNA encoding ΔN Bax to the capsid coding region of the genomic RNA, resulting in a chimeric protein that induces premature cell death upon infection. TCID50-IFA analyses demonstrate an enhancement of DENV suppression for all DENV serotypes tested over the identical group I intron coupled with the non-apoptotic inducing firefly luciferase as the 3' exon. These cumulative results confirm the increased effectiveness of this αDENV-U143-ΔN Bax group I intron as a sequence specific antiviral that should be useful for suppression of DENV in transgenic mosquitoes. Annexin V staining, caspase 3 assays, and DNA ladder observations confirm DCA-ΔN Bax fusion protein expression induces apoptotic cell death. This report confirms the relative effectiveness of an anti-DENV group I intron coupled to an apoptosis-inducing ΔN Bax 3' exon that trans-splices conserved sequences of the 5' CS region of all DENV serotypes and induces apoptotic cell death upon infection. Our results confirm coupling the targeted ribozyme capabilities of the group I intron with the generation of an apoptosis-inducing transcript increases the effectiveness of infection suppression, improving the prospects of this unique approach as a means of inducing transgenic refractoriness in mosquitoes for all serotypes of this important disease.

  16. Prevalence of the intron 22 inversion of the factor VIII gene and inhibitor development in Polish patients with severe hemophilia A.

    PubMed

    Sawecka, Jadwiga; Skulimowska, Joanna; Windyga, Jerzy; Lopaciuk, Stanisław; Kościelak, Jerzy

    2005-01-01

    Patients with severe hemophilia A often develop inhibitors (antibodies) against transfused factor VIII. One hundred thirteen Polish patients with severe hemophilia A, who had been treated on demand with cryoprecipitate until 1992 and exclusively with factor VIII concentrates after 1995, were examined for intron 22 inversion by Southern blotting and the presence and magnitude of inhibitor activity in blood as determined by the Bethesda assay. The patients' ages ranged 4--67 years (mean: 33.7+/-12.4 years, median: 32 years). The number of patients with the inversion amounted to 57, while in 56 patients the mutation types were unknown; 47 patients had a distal and 10 patients a proximal type of inversion. Thirteen patients with inversions (22.8%) were found to have inhibitor in their blood. Most patients (14 out of 15) who developed inhibitors in the course of cryoprecipitate therapy were high responders. Conversely, 4 of 5 patients treated between 1992 and 1995 with both cryoprecipitate and intermediate-purity factor VIII concentrates were low responders. One multitransfused patient who had remained inhibitor-free on cryoprecipitate therapy developed inhibitor after receiving a large dose of factor VIII concentrate during surgery. None of these 5 patients developed inhibitors during their 12--40 years of treatment with cryoprecipitate, suggesting that it was less immunogenic than factor VIII concentrates. The prevalence of the intron 22 inversion mutation of the factor VIII gene in Polish hemophiliacs is similar to that in other European countries. Treatment regimens with either cryoprecipitate or virus-inactivated plasma-derived factor VIII concentrates may affect inhibitor formation in hemophilia A patients.

  17. Using a minigene approach to characterize a novel splice site mutation in human F7 gene causing inherited factor VII deficiency in a Chinese pedigree.

    PubMed

    Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H

    2009-11-01

    Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.

  18. Unique CD44 intronic SNP is associated with tumor grade in breast cancer: a case control study and in silico analysis.

    PubMed

    Esmaeili, Rezvan; Abdoli, Nasrin; Yadegari, Fatemeh; Neishaboury, Mohamadreza; Farahmand, Leila; Kaviani, Ahmad; Majidzadeh-A, Keivan

    2018-01-01

    CD44 encoded by a single gene is a cell surface transmembrane glycoprotein. Exon 2 is one of the important exons to bind CD44 protein to hyaluronan. Experimental evidences show that hyaluronan-CD44 interaction intensifies the proliferation, migration, and invasion of breast cancer cells. Therefore, the current study aimed at investigating the association between specific polymorphisms in exon 2 and its flanking region of CD44 with predisposition to breast cancer. In the current study, 175 Iranian female patients with breast cancer and 175 age-matched healthy controls were recruited in biobank, Breast Cancer Research Center, Tehran, Iran. Single nucleotide polymorphisms of CD44 exon 2 and its flanking were analyzed via polymerase chain reaction and gene sequencing techniques. Association between the observed variation with breast cancer risk and clinico-pathological characteristics were studied. Subsequently, bioinformatics analysis was conducted to predict potential exonic splicing enhancer (ESE) motifs changed as the result of a mutation. A unique polymorphism of the gene encoding CD44 was identified at position 14 nucleotide upstream of exon 2 (A37692→G) by the sequencing method. The A > G polymorphism exhibited a significant association with higher-grades of breast cancer, although no significant relation was found between this polymorphism and breast cancer risk. Finally, computational analysis revealed that the intronic mutation generated a new consensus-binding motif for the splicing factor, SC35, within intron 1. The current study results indicated that A > G polymorphism was associated with breast cancer development; in addition, in silico analysis with ESE finder prediction software showed that the change created a new SC35 binding site.

  19. A mutational analysis of U12-dependent splice site dinucleotides

    PubMed Central

    DIETRICH, ROSEMARY C.; FULLER, JOHN D.; PADGETT, RICHARD A.

    2005-01-01

    Introns spliced by the U12-dependent minor spliceosome are divided into two classes based on their splice site dinucleotides. The /AU-AC/ class accounts for about one-third of U12-dependent introns in humans, while the /GU-AG/ class accounts for the other two-thirds. We have investigated the in vivo and in vitro splicing phenotypes of mutations in these dinucleotide sequences. A 5′ A residue can splice to any 3′ residue, although C is preferred. A 5′ G residue can splice to 3′ G or U residues with a preference for G. Little or no splicing was observed to 3′ A or C residues. A 5′ U or C residue is highly deleterious for U12-dependent splicing, although some combinations, notably 5′ U to 3′ U produced detectable spliced products. The dependence of 3′ splice site activity on the identity of the 5′ residue provides evidence for communication between the first and last nucleotides of the intron. Most mutants in the second position of the 5′ splice site and the next to last position of the 3′ splice site were defective for splicing. Double mutants of these residues showed no evidence of communication between these nucleotides. Varying the distance between the branch site and the 3′ splice site dinucleotide in the /GU-AG/ class showed that a somewhat larger range of distances was functional than for the /AU-AC/ class. The optimum branch site to 3′ splice site distance of 11–12 nucleotides appears to be the same for both classes. PMID:16043500

  20. A novel germline PALB2 deletion in Polish breast and ovarian cancer patients.

    PubMed

    Dansonka-Mieszkowska, Agnieszka; Kluska, Anna; Moes, Joanna; Dabrowska, Michalina; Nowakowska, Dorota; Niwinska, Anna; Derlatka, Pawel; Cendrowski, Krzysztof; Kupryjanczyk, Jolanta

    2010-02-02

    PALB2 protein was recently identified as a partner of BRCA1 and BRCA2 which determines their proper function in DNA repair. Initially, the entire coding sequence of the PALB2 gene with exon/intron boundaries was evaluated by the PCR-SSCP and direct sequencing methods on 70 ovarian carcinomas. Sequence variants of interest were further studied on enlarged groups of ovarian carcinomas (total 339 non-consecutive ovarian carcinomas), blood samples from 334 consecutive sporadic and 648 consecutive familial breast cancer patients, and 1310 healthy controls from central Poland. Ten types of sequence variants were detected, and among them four novel polymorphisms: c.2996+58T>C in intron 9; c.505C>A (p.L169I), c.618T>G (p.L206L), both in exon 4; and c.2135C>T (A712V) in exon 5 of the PALB2 gene. Another two polymorphisms, c.212-58A>C and c.2014G>C (E672Q) were always detected together, both in cancer (7.5% of patients) and control samples (4.9% of controls, p = 0.2). A novel germline truncating mutation, c.509_510delGA (p.R170fs) was found in exon 4: in 2 of 339 (0.6%) unrelated ovarian cancer patients, in 4 of 648 (0.6%) unrelated familial breast cancer patients, and in 1 of 1310 controls (0.08%, p = 0.1, p = 0.044, respectively). One ovarian cancer patient with the PALB2 mutation had also a germline nonsense mutation of the BRCA2 gene. The c.509_510delGA is a novel PALB2 mutation that increases the risk of familial breast cancer. Occurrence of the same PALB2 alteration in seven unrelated women suggests that c.509_510delGA (p.R170fs) is a recurrent mutation for Polish population.

  1. [Analysis of TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy].

    PubMed

    Guan, Tao; Zhang, Lingjie; Xu, Dejian; Wu, Haijian; Zheng, Libin

    2017-10-10

    To analyze the clinical features and TGFBI gene mutation in a Chinese family affected with Reis-Bucklers corneal dystrophy. Genomic DNA was extracted from 53 members including 9 patients from the family. The 17 exons and splice region of introns of the TGFBI gene were amplified by PCR and directly sequenced. All family members were subjected to ophthalmologic examination. A heterozygous mutation (R124L) was found in exon 4 of the TGFBI gene among all patients from the family. The same mutation was not found among unaffected family members. The inheritance pattern of the family was identified as autosomal dominant, and the Reis-Bucklers corneal dystrophy in the family was diagnosed as the geographic type. The R124L mutation of the TGFBI gene probably underlies the pathogenesis of Reis-Bucklers corneal dystrophy in this Chinese family. Molecular genetic approach is useful for the proper diagnosis of this type of corneal dystrophy.

  2. The search for mutations in the gene for the beta subunit of the cGMP phosphodiesterase (PDEB) in patients with autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Riess, O.; Weber, B.; Hayden, M.R.

    1992-10-01

    The finding of a mutation in the beta subunit of the cyclic GMP (cGMP) phosphodiesterase gene causing retinal degeneration in mice (the Pdeb gene) prompted a search for disease-causing mutations in the human phosphodiesterase gene (PDEB gene) in patients with retinitis pigmentosa. All 22 exons including 196 bp of the 5[prime] region of the PDEB gene have been assessed for mutations by using single-strand conformational polymorphism analysis in 14 patients from 13 unrelated families with autosomal recessive retinitis pigmentosa (ARRP). No disease-causing mutations were found in this group of affected individuals of seven different ancestries. However, a frequent intronic andmore » two exonic polymorphisms (Leu[sup 489][yields]Gln and Gly[sup 842][yields]Gly) were identified. Segregation analysis using these polymorphic sites excludes linkage of ARRP to the PDEB gene in a family with two affected children. 43 refs., 3 figs., 2 tabs.« less

  3. Nonsyndromic recessive deafness DFNB18 and Usher syndrome type IC are allelic mutations of USHIC.

    PubMed

    Ahmed, Zubair M; Smith, Tenesha N; Riazuddin, Saima; Makishima, Tomoko; Ghosh, Manju; Bokhari, Sirosh; Menon, Puthezhath S N; Deshmukh, Dilip; Griffith, Andrew J; Riazuddin, Sheikh; Friedman, Thomas B; Wilcox, Edward R

    2002-06-01

    Human chromosome 11 harbors two Usher type I loci, USHIB and USHIC, which encode myosin VIIA and harmonin, respectively. The USHIC locus overlaps the reported critical interval for nonsyndromic deafness locus DFNB18. We found an IVS12+5G-->C mutation in the USHIC gene, which is associated with nonsyndromic recessive deafness ( DFNB18) segregating in the original family, S-11/12. No other disease-associated mutation was found in the other 27 exons or in the intron-exon boundaries, and the IVS12+5G-->C mutation was not present in 200 representative unaffected individuals ascertained from the same area of India. An exon-trapping assay with a construct harboring IVS12+5G-->C generated wildtype spliced mRNA having exons 11 and 12 and mRNA that skipped exon 12. We conclude that mutations of USHIC can cause both Usher syndrome type IC and nonsyndromic recessive deafness DFNB18.

  4. Mutational Analysis of TCOF1, GSC, and HOXA2 in Patients With Treacher Collins Syndrome.

    PubMed

    Hao, Shaojuan; Jin, Lei; Wang, Huijun; Li, Chenlong; Zheng, Fengyun; Ma, Duan; Zhang, Tianyu

    2016-09-01

    Treacher Collins syndrome is an autosomal dominant craniofacial malformation mainly caused by mutations in the TCOF1 gene. Few cases have been observed in the Chinese population. Herein, the authors report the mutational analysis of TCOF1, GSC, and HOXA2 to determine the mutational features of the 3 genes in Chinese patients with Treacher Collins syndrome. Genomic DNA of the patients and their parents was extracted from peripheral blood following a standard protocol. DNA sequencing analysis was performed on all exons and the exon-intron borders of TCOF1, GSC, and HOXA2 in addition to the 1200-bp upstream of TCOF1. Four novel single nucleotide polymorphisms were detected in TCOF1, one of which was in the promoter region. Mutations in GSC and HOXA2 were not found in the 3 patients. Our results suggest the possibility of genetic heterogeneity or different mechanisms leading to the disease. Further functional study of the alteration is necessary to obtain more definitive information.

  5. Mutational Analysis of TCOF1, GSC, and HOXA2 in Patients With Treacher Collins Syndrome

    PubMed Central

    Hao, Shaojuan; Jin, Lei; Wang, Huijun; Li, Chenlong; Zheng, Fengyun; Ma, Duan; Zhang, Tianyu

    2016-01-01

    Abstract Treacher Collins syndrome is an autosomal dominant craniofacial malformation mainly caused by mutations in the TCOF1 gene. Few cases have been observed in the Chinese population. Herein, the authors report the mutational analysis of TCOF1, GSC, and HOXA2 to determine the mutational features of the 3 genes in Chinese patients with Treacher Collins syndrome. Genomic DNA of the patients and their parents was extracted from peripheral blood following a standard protocol. DNA sequencing analysis was performed on all exons and the exon-intron borders of TCOF1, GSC, and HOXA2 in addition to the 1200-bp upstream of TCOF1. Four novel single nucleotide polymorphisms were detected in TCOF1, one of which was in the promoter region. Mutations in GSC and HOXA2 were not found in the 3 patients. Our results suggest the possibility of genetic heterogeneity or different mechanisms leading to the disease. Further functional study of the alteration is necessary to obtain more definitive information. PMID:27526242

  6. Structure of the human MSH2 locus and analysis of two Muir-Torre kindreds for msh2 mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kolodner, R.D.; Lipford, J.; Kane, M.F.

    1994-12-01

    Hereditary nonpolyposis colorectal carcinoma (HNPCC) is a major cancer susceptibility syndrome known to be caused by inheritance of mutations in genes such as hMSH2 and hMLH1, which encode components of a DNA mismatch repair system. The MSH2 genomic locus has been cloned and shown to cover {approximately}73 kb of genomic DNA and to contain 16 exons. The sequence of all of the intron-exon junctions has been determined and used to develop methods for analyzing each MSH2 exon for mutations. These methods have been used to analyze two large HNPCC kindreds exhibiting features of the Muir-Torre syndrome and demonstrate that cancermore » susceptibility is due to the inheritance of a frameshift mutation in the MSH2 gene in one family and a nonsense mutation in the MSH2 gene in the other family. 59 refs., 5 figs., 1 tab.« less

  7. A novel mutation in the AGXT gene causing primary hyperoxaluria type I: genotype-phenotype correlation.

    PubMed

    M'Dimegh, Saoussen; Aquaviva-Bourdain, Cécile; Omezzine, Asma; M'Barek, Ibtihel; Souche, Geneviéve; Zellama, Dorsaf; Abidi, Kamel; Achour, Abdelattif; Gargah, Tahar; Abroug, Saoussen; Bouslama, Ali

    2016-09-01

    Primary hyperoxaluria type I (PH1) is an autosomal recessive metabolic disorder caused by inherited mutations in the AGXT gene encoding liver peroxisomal alanine : glyoxylate aminotransferase (AGT) which is deficient or mistargeted to mitochondria. PH1 shows considerable phenotypic and genotypic heterogeneity. The incidence and severity of PH1 varies in different geographic regions. DNA samples of the affected members from two unrelated Tunisian families were tested by amplifying and sequencing each of the AGXT exons and intron-exon junctions. We identified a novel frameshift mutation in the AGXT gene, the c.406_410dupACTGC resulting in a truncated protein (p.Gln137Hisfs*19). It is found in homozygous state in two nonconsanguineous unrelated families from Tunisia. These molecular findings provide genotype/phenotype correlations in the intrafamilial phenotypic and permit accurate carrier detection, and prenatal diagnosis. The novel p.Gln137Hisfs*19 mutation detected in our study extend the spectrum of known AGXT gene mutations in Tunisia.

  8. Genetic Instability at the Agouti Locus of the Mouse (Mus Musculus). I. Increased Reverse Mutation Frequency to the A(w) Allele in a/a Heterozygotes

    PubMed Central

    Sandulache, R.; Neuhauser-Klaus, A.; Favor, J.

    1994-01-01

    We have compiled the reverse mutation rate data to the white bellied agouti (A(w)) allele in heterozygous A/a mice and shown it to be increased by a factor of at least 350 in comparison to the reverse mutation rate in homozygous a/a mice. Employing tightly linked flanking restriction fragment length polymorphism DNA markers, we have shown that reversion to A(w) is associated with crossing over in the vicinity of the agouti locus. The non-agouti (a) allele has been recently shown to contain an 11-kb insert within the first intron of the agouti gene. Together with our present results, these observations suggest possible mechanisms to explain the reversion events. PMID:7982562

  9. Differential splicing of human androgen receptor pre-mRNA in X-linked reifenstein syndrome, because of a deletion involving a putative branch site

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ris-Stalpers, C.; Verleun-Mooijman, M.C.T.; Blaeij, T.J.P. de

    1994-04-01

    The analysis of the androgen receptor (AR) gene, mRNA, and protein in a subject with X-linked Reifenstein syndrome (partial androgen insensitivity) is reported. The presence of two mature AR transcripts in genital skin fibroblasts of the patient is established, and, by reverse transcriptase-PCR and RNase transcription analysis, the wild-type transcript and a transcript in which exon 3 sequences are absent without disruption of the translational reading frame are identified. Sequencing and hybridization analysis show a deletion of >6 kb in intron 2 of the human AR gene, starting 18 bp upstream of exon 3. The deletion includes the putative branch-pointmore » sequence (BPS) but not the acceptor splice site on the intron 2/exon 3 boundary. The deletion of the putative intron 2 BPS results in 90% inhibition of wild-type splicing. The mutant transcript encodes an AR protein lacking the second zinc finger of the DNA-binding domain. Western/immunoblotting analysis is used to show that the mutant AR protein is expressed in genital skin fibroblasts of the patient. The residual 10% wild-type transcript can be the result of the use of a cryptic BPS located 63 bp upstream of the intron 2/exon 3 boundary of the mutant AR gene. The mutated AR protein has no transcription-activating potential and does not influence the transactivating properties of the wild-type AR, as tested in cotransfection studies. It is concluded that the partial androgen-insensitivity syndrome of this patient is the consequence of the limited amount of wild-type AR protein expressed in androgen target cells, resulting from the deletion of the intron 2 putative BPS. 42 refs., 6 figs., 1 tab.« less

  10. [Analysis of gene mutation in a Chinese family with Norrie disease].

    PubMed

    Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

    2012-09-01

    To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

  11. Deep sequencing reveals double mutations in cis of MPL exon 10 in myeloproliferative neoplasms.

    PubMed

    Pietra, Daniela; Brisci, Angela; Rumi, Elisa; Boggi, Sabrina; Elena, Chiara; Pietrelli, Alessandro; Bordoni, Roberta; Ferrari, Maurizio; Passamonti, Francesco; De Bellis, Gianluca; Cremonesi, Laura; Cazzola, Mario

    2011-04-01

    Somatic mutations of MPL exon 10, mainly involving a W515 substitution, have been described in JAK2 (V617F)-negative patients with essential thrombocythemia and primary myelofibrosis. We used direct sequencing and high-resolution melt analysis to identify mutations of MPL exon 10 in 570 patients with myeloproliferative neoplasms, and allele specific PCR and deep sequencing to further characterize a subset of mutated patients. Somatic mutations were detected in 33 of 221 patients (15%) with JAK2 (V617F)-negative essential thrombocythemia or primary myelofibrosis. Only one patient with essential thrombocythemia carried both JAK2 (V617F) and MPL (W515L). High-resolution melt analysis identified abnormal patterns in all the MPL mutated cases, while direct sequencing did not detect the mutant MPL in one fifth of them. In 3 cases carrying double MPL mutations, deep sequencing analysis showed identical load and location in cis of the paired lesions, indicating their simultaneous occurrence on the same chromosome.

  12. Mutations in the PDE6B gene in autosomal recessive retinitis pigmentosa

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Danciger, M.; Blaney, J.; Gao, Y.Q.

    1995-11-01

    We have studied 24 small families with presumed autosomal recessive inheritance of retinitis pigmentosa by a combination of haplotype analysis and exon screening. Initial analysis of the families was made with a dinucleotide repeat polymorphism adjacent to the gene for rod cGMP-phosphodiesterase (PDE6B). This was followed by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism electrophoresis (SSCPE) of the 22 exons and a portion of the 5{prime} untranslated region of the PDE6B gene in the probands of each family in which the PDE6B locus could not be ruled out from segregating with disease. Two probands were found with compoundmore » heterozygous mutations: Gly576Asp and His620(1-bp del) mutations were present in one proband, and a Lys706X null mutation and an AG to AT splice acceptor site mutation in intron 2 were present in the other. Only the affecteds of each of the two families carried both corresponding mutations. 29 refs., 3 figs., 1 tab.« less

  13. A Novel Frameshift Mutation of the USH2A Gene in a Korean Patient with Usher Syndrome Type II

    PubMed Central

    Boo, Sung Hyun; Song, Min-Jung; Cho, Yang-Sun; Chu, Hosuk; Ko, Moon-Hee; Chung, Won-Ho; Kim, Jong-Won

    2013-01-01

    Usher syndrome type II (USH2) is the most common form of Usher syndrome, characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa. It has been shown that mutations in the USH2A gene are responsible for USH2. The authors herein describe a 34-year-old Korean woman with the typical clinical manifestation of USH2; she had bilateral hearing disturbance and progressive visual deterioration, without vestibular dysfunction. Molecular genetic study of the USH2A gene revealed a novel frameshift mutation (c.2310delA; Glu771LysfsX17). She was heterozygous for this mutation, and no other mutation was found in USH2A, suggesting the possibility of an intronic or large genomic rearrangement mutation. To the best of our knowledge, this is the first report of a genetically confirmed case of USH2 in Korea. More investigations are needed to delineate genotype-phenotype correlations and ethnicity-specific genetic background of Usher syndrome. PMID:23526569

  14. Report of Chinese family with severe dermatitis, multiple allergies and metabolic wasting syndrome caused by novel homozygous desmoglein-1 gene mutation.

    PubMed

    Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong

    2016-10-01

    Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.

  15. Identification of Genetic Defects Underlying FXII Deficiency in Four Unrelated Chinese Patients.

    PubMed

    Yang, Lihong; Wang, Yingyu; Zhou, Jianpin; Cheng, Xiaoli; Hao, Xiuping; Xie, Haixiao; Jin, Yanhui; Wang, Mingshan

    2016-01-01

    Congenital factor XII (FXII) dexFB01;ciency is a rare autosomal recessive disorder, characterized by a great variability in its clinical manifestations. In this study, we screened for mutations in the F12 gene of 4 unrelated patients with FXII coagulant activity <10% of that of normal human plasma. To investigate the molecular defects in these FXII-deficient patients, we performed FXII mutation screening. By sequencing all coding exons as well as xFB02;anking intronic regions of the F12 gene, 6 different mutations, including 3 missense mutations (Gly341Arg, Glu502Lys and Gly542 Ser), 1 insertion (7142insertC) and 2 deletions (5741-5742 delCA and 6753-6755delACA), were identixFB01;ed on the F12 gene. Three of them (Gly341Arg, 5741-5742delCA and 6753-6755delACA) are reported here for the first time. Computer-based algorithms predicted these missense mutations to be deleterious. This study has increased our knowledge of the mutational spectrum underlying FXII deficiency. © 2016 S. Karger AG, Basel.

  16. The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

    PubMed

    Toyoda, N; Kleinhaus, N; Larsen, P R

    1996-06-01

    We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

  17. Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

    PubMed

    Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

    2007-01-01

    Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

  18. Identification of 15 novel partial SHOX deletions and 13 partial duplications, and a review of the literature reveals intron 3 to be a hotspot region.

    PubMed

    Benito-Sanz, Sara; Belinchon-Martínez, Alberta; Aza-Carmona, Miriam; de la Torre, Carolina; Huber, Celine; González-Casado, Isabel; Ross, Judith L; Thomas, N Simon; Zinn, Andrew R; Cormier-Daire, Valerie; Heath, Karen E

    2017-02-01

    Short stature homeobox gene (SHOX) is located in the pseudoautosomal region 1 of the sex chromosomes. It encodes a transcription factor implicated in the skeletal growth. Point mutations, deletions or duplications of SHOX or its transcriptional regulatory elements are associated with two skeletal dysplasias, Léri-Weill dyschondrosteosis (LWD) and Langer mesomelic dysplasia (LMD), as well as in a small proportion of idiopathic short stature (ISS) individuals. We have identified a total of 15 partial SHOX deletions and 13 partial SHOX duplications in LWD, LMD and ISS patients referred for routine SHOX diagnostics during a 10 year period (2004-2014). Subsequently, we characterized these alterations using MLPA (multiplex ligation-dependent probe amplification assay), fine-tiling array CGH (comparative genomic hybridation) and breakpoint PCR. Nearly half of the alterations have a distal or proximal breakpoint in intron 3. Evaluation of our data and that in the literature reveals that although partial deletions and duplications only account for a small fraction of SHOX alterations, intron 3 appears to be a breakpoint hotspot, with alterations arising by non-allelic homologous recombination, non-homologous end joining or other complex mechanisms.

  19. MAPT as a predisposing gene for sporadic amyotrophic lateral sclerosis in the Chinese Han population

    PubMed Central

    Fang, Pu; Xu, Wenyuan; Wu, Chengsi; Zhu, Min; Li, Xiaobing; Hong, Daojun

    2013-01-01

    A previous study of European Caucasian patients with sporadic amyotrophic lateral sclerosis demonstrated that a polymorphism in the microtubule-associated protein Tau (MAPT) gene was significantly associated with sporadic amyotrophic lateral sclerosis pathogenesis. Here, we tested this association in 107 sporadic amyotrophic lateral sclerosis patients and 100 healthy controls from the Chinese Han population. We screened the mutation-susceptible regions of MAPT – the 3' and 5' untranslated regions as well as introns 9, 10, 11, and 12 – by direct sequencing, and identified 33 genetic variations. Two of these, 105788 A > G in intron 9 and 123972 T > A in intron 11, were not present in the control group. The age of onset in patients with the 105788 A > G and/or the 123972 T > A variant was younger than that in patients without either genetic variation. Moreover, the pa-tients with a genetic variation were more prone to bulbar palsy and breathing difficulties than those with the wild-type genotype. This led to a shorter survival period in patients with a MAPT genetic variant. Our study suggests that the MAPT gene is a potential risk gene for sporadic amyotrophic lateral sclerosis in the Chinese Han population. PMID:25206632

  20. An essential role for trimethylguanosine RNA caps in Saccharomyces cerevisiae meiosis and their requirement for splicing of SAE3 and PCH2 meiotic pre-mRNAs

    PubMed Central

    Qiu, Zhicheng R.; Shuman, Stewart; Schwer, Beate

    2011-01-01

    Tgs1 is the enzyme that converts m7G RNA caps to the 2,2,7-trimethylguanosine (TMG) caps characteristic of spliceosomal snRNAs. Fungi grow vegetatively without TMG caps, thereby raising the question of what cellular transactions, if any, are TMG cap-dependent. Here, we report that Saccharomyces cerevisiae Tgs1 methyltransferase activity is essential for meiosis. tgs1Δ cells are specifically defective in splicing PCH2 and SAE3 meiotic pre-mRNAs. The TMG requirement for SAE3 splicing is alleviated by two intron mutations: a UAUUAAC to UACUAAC change that restores a consensus branchpoint and disruption of a stem–loop encompassing the branchpoint. The TMG requirement for PCH2 splicing is alleviated by a CACUAAC to UACUAAC change restoring a consensus branchpoint and by shortening the PCH2 5′ exon. Placing the SAE3 and PCH2 introns within a HIS3 reporter confers Tgs1-dependent histidine prototrophy, signifying that the respective introns are portable determinants of TMG-dependent gene expression. Analysis of in vitro splicing in extracts of TGS1 versus tgs1Δ cells showed that SAE3 intron removal was enfeebled without TMG caps, whereas splicing of ACT1 was unaffected. Our findings illuminate a new mode of tunable splicing, a reliance on TMG caps for an essential developmental RNA transaction, and three genetically distinct meiotic splicing regulons in budding yeast. PMID:21398639

  1. An essential role for trimethylguanosine RNA caps in Saccharomyces cerevisiae meiosis and their requirement for splicing of SAE3 and PCH2 meiotic pre-mRNAs.

    PubMed

    Qiu, Zhicheng R; Shuman, Stewart; Schwer, Beate

    2011-07-01

    Tgs1 is the enzyme that converts m(7)G RNA caps to the 2,2,7-trimethylguanosine (TMG) caps characteristic of spliceosomal snRNAs. Fungi grow vegetatively without TMG caps, thereby raising the question of what cellular transactions, if any, are TMG cap-dependent. Here, we report that Saccharomyces cerevisiae Tgs1 methyltransferase activity is essential for meiosis. tgs1Δ cells are specifically defective in splicing PCH2 and SAE3 meiotic pre-mRNAs. The TMG requirement for SAE3 splicing is alleviated by two intron mutations: a UAUUAAC to UACUAAC change that restores a consensus branchpoint and disruption of a stem-loop encompassing the branchpoint. The TMG requirement for PCH2 splicing is alleviated by a CACUAAC to UACUAAC change restoring a consensus branchpoint and by shortening the PCH2 5' exon. Placing the SAE3 and PCH2 introns within a HIS3 reporter confers Tgs1-dependent histidine prototrophy, signifying that the respective introns are portable determinants of TMG-dependent gene expression. Analysis of in vitro splicing in extracts of TGS1 versus tgs1Δ cells showed that SAE3 intron removal was enfeebled without TMG caps, whereas splicing of ACT1 was unaffected. Our findings illuminate a new mode of tunable splicing, a reliance on TMG caps for an essential developmental RNA transaction, and three genetically distinct meiotic splicing regulons in budding yeast.

  2. Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

    PubMed Central

    Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

    1989-01-01

    We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

  3. Novel loss-of-function putative aminotransferase alleles cause biosynthesis of capsinoids, nonpungent capsaicinoid analogues, in mildly pungent chili peppers (Capsicum chinense).

    PubMed

    Tanaka, Yoshiyuki; Hosokawa, Munetaka; Miwa, Tetsuya; Watanabe, Tatsuo; Yazawa, Susumu

    2010-11-24

    Capsinoids are a group of nonpungent capsaicinoid analogues produced in Capsicum fruits. They have similar bioactivities to capsaicinoids such as suppression of fat accumulation and antioxidant activity. They are more palatable ingredients in dietary supplements than capsaicinoids because of their low pungency. Previous studies on nonpungent Capsicum annuum cultivars showed that capsinoid biosynthesis is caused by loss-of-function putative aminotransferase (p-amt) alleles. This study showed that three mildly pungent cultivars of Capsicum chinense (Zavory Hot, Aji Dulce strain 2, and Belize Sweet) contain high levels of capsinoid. It was shown that these cultivars have novel p-amt alleles, which contain mutations that differ from those of C. annuum. Sequence analysis of p-amt in Belize Sweet revealed that a 5 bp insertion (TGGGC) results in a frameshift mutation. A transposable element (Tcc) was found in the p-amt of Zavory Hot and Aji Dulce strain 2. Tcc has features similar to those of the hAT transposon family. This was inserted in the fifth intron of Zavory Hot and in third intron of Aji Dulce strain 2. The p-amt alleles harboring Tcc cannot produce an active p-AMT. These mildly pungent cultivars will provide a new natural source of capsinoids.

  4. CEF1/CDC5 alleles modulate transitions between catalytic conformations of the spliceosome

    PubMed Central

    Query, Charles C.; Konarska, Maria M.

    2012-01-01

    Conformational change within the spliceosome is required between the first and second catalytic steps of pre-mRNA splicing. A prior genetic screen for suppressors of an intron mutant that stalls between the two steps yielded both prp8 and non-prp8 alleles that suppressed second-step splicing defects. We have now identified the strongest non-prp8 suppressors as alleles of the NTC (Prp19 complex) component, CEF1. These cef1 alleles generally suppress second-step defects caused by a variety of intron mutations, mutations in U6 snRNA, or deletion of the second-step protein factor Prp17, and they can activate alternative 3′ splice sites. Genetic and functional interactions between cef1 and prp8 alleles suggest that they modulate the same event(s) in the first-to-second-step transition, most likely by stabilization of the second-step spliceosome; in contrast, alleles of U6 snRNA that also alter this transition modulate a distinct event, most likely by stabilization of the first-step spliceosome. These results implicate a myb-like domain of Cef1/CDC5 in interactions that modulate conformational states of the spliceosome and suggest that alteration of these events affects splice site use, resulting in alternative splicing-like patterns in yeast. PMID:22408182

  5. Splicing analysis for exonic and intronic mismatch repair gene variants associated with Lynch syndrome confirms high concordance between minigene assays and patient RNA analyses

    PubMed Central

    van der Klift, Heleen M; Jansen, Anne M L; van der Steenstraten, Niki; Bik, Elsa C; Tops, Carli M J; Devilee, Peter; Wijnen, Juul T

    2015-01-01

    A subset of DNA variants causes genetic disease through aberrant splicing. Experimental splicing assays, either RT-PCR analyses of patient RNA or functional splicing reporter minigene assays, are required to evaluate the molecular nature of the splice defect. Here, we present minigene assays performed for 17 variants in the consensus splice site regions, 14 exonic variants outside these regions, and two deep intronic variants, all in the DNA mismatch-repair (MMR) genes MLH1, MSH2, MSH6, and PMS2, associated with Lynch syndrome. We also included two deep intronic variants in APC and PKD2. For one variant (MLH1 c.122A>G), our minigene assay and patient RNA analysis could not confirm the previously reported aberrant splicing. The aim of our study was to further investigate the concordance between minigene splicing assays and patient RNA analyses. For 30 variants results from patient RNA analyses were available, either performed by our laboratory or presented in literature. Some variants were deliberately included in this study because they resulted in multiple aberrant transcripts in patient RNA analysis, or caused a splice effect other than the prevalent exon skip. While both methods were completely concordant in the assessment of splice effects, four variants exhibited major differences in aberrant splice patterns. Based on the present and earlier studies, together showing an almost 100% concordance of minigene assays with patient RNA analyses, we discuss the weight given to minigene splicing assays in the current criteria proposed by InSiGHT for clinical classification of MMR variants. PMID:26247049

  6. Delineation of the Marfan phenotype associated with mutations in exons 23-32 of the FBN1 gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Putnam, E.A.; Cho, M.; Milewicz, D.M.

    Marfan syndrome is a dominantly inherited connective tissue disorder with a wide range of phenotypic severity. The condition is the result of mutations in FBN1, a large gene composed of 65 exons encoding the fibrillin-1 protein. While mutations causing classic manifestations of Marfan syndrome have been identified throughout the FBN1 gene, the six previously characterized mutations resulting in the severe, perinatal lethal form of Marfan syndrome have clustered in exons 24-32 of the gene. We screened 8 patients with either neonatal Marfan syndrome or severe cardiovascular complications of Marfan syndrome for mutations in this region of the gene. Using intron-basedmore » exon-specific primers, we amplified exons 23-32 from genomic DNAs, screened these fragments by single-stranded conformational polymorphism analysis, and sequenced indicated exons. This analysis documented mutations in exons 25-27 of the FBN1 mutations in 6 of these patients. These results, taken together with previously published FBN1 mutations in this region, further define the phenotype associated with mutations in exons 24-32 of the FBN1 gene, information important for the development of possible diagnostic tests and genetic counseling. 49 refs., 4 figs., 2 tabs.« less

  7. Comprehensive analysis of Stargardt macular dystrophy patients reveals new genotype-phenotype correlations and unexpected diagnostic revisions

    PubMed Central

    Zaneveld, Jacques; Siddiqui, Sorath; Li, Huajin; Wang, Xia; Wang, Hui; Wang, Keqing; Li, Hui; Ren, Huanan; Lopez, Irma; Dorfman, Allison; Khan, Ayesha; Wang, Feng; Salvo, Jason; Gelowani, Violet; Li, Yumei; Sui, Ruifang; Koenekoop, Robert; Chen, Rui

    2014-01-01

    Purpose Stargardt macular dystrophy (STGD) results in early central vision loss. We sought to explain the genetic cause of STGD in a cohort of 88 patients from three different cultural backgrounds. Methods Next Generation Sequencing using a novel capture panel was used to search for disease causing mutations. Unsolved patients were clinically re-examined and tested for copy number variations (CNVs) as well as intronic mutations. Results We determined the cause of disease in 67% of our patients. Our analysis identified 35 novel ABCA4 alleles. Eleven patients had mutations in genes not previously reported to cause STGD. Finally, 45% of our unsolved patients had single deleterious mutations in ABCA4, a recessive disease gene. No likely pathogenic CNVs were identified. Conclusions This study expands our knowledge of STGD by identifying dozens of novel STGD causing alleles. The frequency of patients with single mutations in ABCA4 is higher than controls, indicating these mutations contribute to disease. Eleven patients were explained by mutations outside ABCA4 underlining the need to genotype all retinal disease genes to maximize genetic diagnostic rates. Few ABCA4 mutations were observed in our French Canadian patients. This population may contain an unidentified founder mutation. Our results indicate that CNVs are unlikely to be a major cause of STGD. PMID:25474345

  8. Missense mutation of the cholecystokinin B receptor gene: Lack of association with panic disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kato, Tadafumi; Wang, Zhe Wu; Crowe, R.R.

    1996-07-26

    Cholecystokinin tetrapeptide (CCK{sub 4}) is known to induce panic attacks in patients with panic disorder at a lower dose than in normal controls. Therefore, the cholecystokinin B (CCK{sub B}) receptor gene is a candidate gene for panic disorder. We searched for mutations in the CCK{sub B} gene in 22 probands of panic disorder pedigrees, using single-strand conformation polymorphism (SSCP) analysis. Two polymorphisms were detected. A polymorphism in an intron (2491 C{yields}A) between exons 4 and 5 was observed in 10 of 22 probands. A missense mutation in the extracellular loop of exon 2 (1550 G{yields}A, Val{sup 125}{yields}Ile) was found inmore » only one proband. This mutation was also examined in additional 34 unrelated patients with panic disorder and 112 controls. The prevalence rate of this mutation was 8.8% in patients with panic disorder (3/34) and 4.4% in controls (5/112). The mutation did not segregate with panic disorder in two families where this could be tested. These results suggest no pathophysiological significance of this mutation in panic disorder. 21 refs., 4 figs., 1 tab.« less

  9. Clinical and genetic analyses reveal novel pathogenic ABCA4 mutations in Stargardt disease families

    PubMed Central

    Lin, Bing; Cai, Xue-Bi; Zheng, Zhi-Li; Huang, Xiu-Feng; Liu, Xiao-Ling; Qu, Jia; Jin, Zi-Bing

    2016-01-01

    Stargardt disease (STGD1) is a juvenile macular degeneration predominantly inherited in an autosomal recessive pattern, characterized by decreased central vision in the first 2 decades of life. The condition has a genetic basis due to mutation in the ABCA4 gene, and arises from the deposition of lipofuscin-like substance in the retinal pigmented epithelium (RPE) with secondary photoreceptor cell death. In this study, we describe the clinical and genetic features of Stargardt patients from four unrelated Chinese cohorts. The targeted exome sequencing (TES) was carried out in four clinically confirmed patients and their family members using a gene panel comprising 164 known causative inherited retinal dystrophy (IRD) genes. Genetic analysis revealed eight ABCA4 mutations in all of the four pedigrees, including six mutations in coding exons and two mutations in adjacent intronic areas. All the affected individuals showed typical manifestations consistent with the disease phenotype. We disclose two novel ABCA4 mutations in Chinese patients with STGD disease, which will expand the existing spectrum of disease-causing variants and will further aid in the future mutation screening and genetic counseling, as well as in the understanding of phenotypic and genotypic correlations. PMID:27739528

  10. Identification of fifteen novel mutations in the SLC12A3 gene encoding the Na-Cl Co-transporter in Italian patients with Gitelman syndrome.

    PubMed

    Syrén, Marie-Louise; Tedeschi, Silvana; Cesareo, Laila; Bellantuono, Rosa; Colussi, Giacomo; Procaccio, Mirella; Alì, Anna; Domenici, Raffaele; Malberti, Fabio; Sprocati, Monica; Sacco, Michele; Miglietti, Nunzia; Edefonti, Alberto; Sereni, Fabio; Casari, Giorgio; Coviello, Domenico A; Bettinelli, Alberto

    2002-07-01

    The SLC12A3 gene encodes the thiazide-sensitive Na-Cl co-transporter (NCCT) expressed in the apical membrane of the distal convoluted tubule of the kidney. Inactivating mutations of this gene are responsible for Gitelman syndrome (GS), a disorder inherited as an autosomal recessive trait. We searched for SLC12A3 gene mutations in 21 Italian patients with the clinical and biochemical features of GS (hypokalemia, hypomagnesemia, metabolic alkalosis, hypocalciuria, and the absence of nephrocalcinosis). All coding regions with their intron-exon boundaries were analyzed using PCR and SSCP techniques followed by sequencing analysis. We identified 21 different mutations evenly distributed throughout the gene without any mutation hot-spot. Fifteen are novel variants, including 12 missense mutations, one deletion, one deletion-insertion and one splice site mutation: R158Q, T163M, W172R, G316V, G374V, G463E, A464T, S615W, V677M, R852S, R958G, C985Y, 2114-2120delACCAAGT, 2144-2158delGCCTTCTACTCGGATinsTG, and 531-2A>G. Copyright 2002 Wiley-Liss, Inc.

  11. Novel RS1 mutations associated with X-linked juvenile retinoschisis

    PubMed Central

    YI, JUNHUI; LI, SHIQIANG; JIA, XIAOYUN; XIAO, XUESHAN; WANG, PANFENG; GUO, XIANGMING; ZHANG, QINGJIONG

    2012-01-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS. PMID:22245991

  12. Novel RS1 mutations associated with X-linked juvenile retinoschisis.

    PubMed

    Yi, Junhui; Li, Shiqiang; Jia, Xiaoyun; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

    2012-04-01

    To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.

  13. Novel mutation in the 5' splice site of exon 4 of the TCOF1 gene in the patient with Treacher Collins syndrome.

    PubMed

    Marszalek, Bozena; Wisniewski, Slawomir A; Wojcicki, Piotr; Kobus, Kazimierz; Trzeciak, Wieslaw H

    2003-12-01

    Treacher Collins syndrome (TCS) is caused by mutations in the TCOF1 gene. This gene encodes a serine/alanine-rich protein called treacle. The structure of the entire TCOF1 gene was investigated in a patient with TCS. We detected a novel deletion (376delAAGGTGAGTGGGACTGCC) spanning 3 bp of exon 4 and 15 bp of the adjacent intronic sequence. This mutation causes premature termination of translation, resulting in a truncated protein devoid of nucleolar localization signal, and potential phosphorylation sites. Real-time PCR analysis showed different melting temperatures of the amplified fragment containing normal allele and that harboring the 18 bp deletion, thus providing a rapid screening assay for this and other deletions of the TCOF1 gene. Copyright 2003 Wiley-Liss, Inc.

  14. New genetic variants of LATS1 detected in urinary bladder and colon cancer.

    PubMed

    Saadeldin, Mona K; Shawer, Heba; Mostafa, Ahmed; Kassem, Neemat M; Amleh, Asma; Siam, Rania

    2014-01-01

    LATS1, the large tumor suppressor 1 gene, encodes for a serine/threonine kinase protein and is implicated in cell cycle progression. LATS1 is down-regulated in various human cancers, such as breast cancer, and astrocytoma. Point mutations in LATS1 were reported in human sarcomas. Additionally, loss of heterozygosity of LATS1 chromosomal region predisposes to breast, ovarian, and cervical tumors. In the current study, we investigated LATS1 genetic variations including single nucleotide polymorphisms (SNPs), in 28 Egyptian patients with either urinary bladder or colon cancers. The LATS1 gene was amplified and sequenced and the expression of LATS1 at the RNA level was assessed in 12 urinary bladder cancer samples. We report, the identification of a total of 29 variants including previously identified SNPs within LATS1 coding and non-coding sequences. A total of 18 variants were novel. Majority of the novel variants, 13, were mapped to intronic sequences and un-translated regions of the gene. Four of the five novel variants located in the coding region of the gene, represented missense mutations within the serine/threonine kinase catalytic domain. Interestingly, LATS1 RNA steady state levels was lost in urinary bladder cancerous tissue harboring four specific SNPs (16045 + 41736 + 34614 + 56177) positioned in the 5'UTR, intron 6, and two silent mutations within exon 4 and exon 8, respectively. This study identifies novel single-base-sequence alterations in the LATS1 gene. These newly identified variants could potentially be used as novel diagnostic or prognostic tools in cancer.

  15. A rare complex DNA rearrangement in the murine Steel gene results in exon duplication and a lethal phenotype.

    PubMed

    Chandra, Saurabh; Kapur, Reuben; Chuzhanova, Nadia; Summey, Victoria; Prentice, David; Barker, Jane; Cooper, David N; Williams, David A

    2003-11-15

    Kit ligand (Kitl), encoded by the Steel (Sl) locus, plays an essential role in hematopoiesis, gametogenesis, and melanogenesis during both embryonic and adult life. We have characterized a new spontaneous mutant of the Sl locus in mice designated KitlSl-20J that arose in the breeding colony at Jackson Laboratories. Heterozygous KitlSl-20J mice display a white belly spot and intercrossing results in an embryonic lethal phenotype in the homozygous state. Analysis of homozygous embryos demonstrated a significant reduction in fetal liver cellularity, colony forming unit-erythroid (CFU-E) progenitors, and a total absence of germ cells. Although expressed in vivo, recombinant mutant protein demonstrated loss of bioactivity that was correlated with lack of receptor binding. Analysis of the Sl gene transcripts in heterozygous KitlSl-20J mice revealed an in-frame tandem duplication of exon 3. A long-range polymerase chain reaction (PCR) strategy using overlapping primers in exon 3 amplified an approximately 7-kilobase (kb) product from DNA isolated from heterozygous KitlSl-20J mice but not from wild-type DNA that contained sequences from both introns 2 and 3 and an inverted intron 2 sequence, suggesting a complex rearrangement as the mechanism of the mutation. "Complexity analysis" of the sequence of the amplified product strongly suggests that local DNA motifs may have contributed to the generation of this spontaneous KitlSl-20J allele, likely mediated by a 2-step process. The KitlSl-20J mutation is a unique KitlSl allele and represents an unusual mechanism of mutation.

  16. Prevalence and Molecular Characterization of Glucose-6-Phosphate Dehydrogenase Deficiency at the China-Myanmar Border.

    PubMed

    Li, Qing; Yang, Fang; Liu, Rong; Luo, Lan; Yang, Yuling; Zhang, Lu; Liu, Huaie; Zhang, Wen; Fan, Zhixiang; Yang, Zhaoqing; Cui, Liwang; He, Yongshu

    2015-01-01

    Glucose-6-phosphate dehydrogenase (G6PD) deficiency is an X-linked hereditary disease that predisposes red blood cells to oxidative damage. G6PD deficiency is particularly prevalent in historically malaria-endemic areas. Use of primaquine for malaria treatment may result in severe hemolysis in G6PD deficient patients. In this study, we systematically evaluated the prevalence of G6PD deficiency in the Kachin (Jingpo) ethnic group along the China-Myanmar border and determined the underlying G6PD genotypes. We surveyed G6PD deficiency in 1770 adult individuals (671 males and 1099 females) of the Kachin ethnicity using a G6PD fluorescent spot test. The overall prevalence of G6PD deficiency in the study population was 29.6% (523/1770), among which 27.9% and 30.6% were males and females, respectively. From these G6PD deficient samples, 198 unrelated individuals (147 females and 51 males) were selected for genotyping at 11 known G6PD single nucleotide polymorphisms (SNPs) in Southeast Asia (ten in exons and one in intron 11) using a multiplex SNaPshot assay. Mutations with known association to a deficient phenotype were detected in 43.9% (87/198) of cases, intronic and synonymous mutations were detected alone in 34.8% (69/198) cases and no mutation were found in 21.2% (42/198) cases. Five non-synonymous mutations, Mahidol 487G>A, Kaiping 1388G>A, Canton 1376G>T, Chinese 4 392G>T, and Viangchan 871G>A were detected. Of the 87 cases with known deficient mutations, the Mahidol variant was the most common (89.7%; 78/87), followed by the Kaiping (8.0%; 7/87) and the Viangchan (2.2%; 2/87) variants. The Canton and Chinese 4 variants were found in 1.1% of these 87 cases. Among them, two females carried the Mahidol/Viangchan and Mahidol/Kaiping double mutations, respectively. Interestingly, the silent SNPs 1311C>T and IVS11nt93T>C both occurred in the same 95 subjects with frequencies at 56.4% and 23.5% in tested females and males, respectively (P<0.05). It is noteworthy that 24 subjects carrying the Mahidol mutation and two carrying the Kaiping mutation also carried the 1311C>T/IVS11nt93T>C SNPs. Further studies are needed to determine the enzyme levels of the G6PD deficient people and presence of additional G6PD mutations in the study population.

  17. Hereditary cancer genes are highly susceptible to splicing mutations

    PubMed Central

    Soemedi, Rachel; Maguire, Samantha; Murray, Michael F.; Monaghan, Sean F.

    2018-01-01

    Substitutions that disrupt pre-mRNA splicing are a common cause of genetic disease. On average, 13.4% of all hereditary disease alleles are classified as splicing mutations mapping to the canonical 5′ and 3′ splice sites. However, splicing mutations present in exons and deeper intronic positions are vastly underreported. A recent re-analysis of coding mutations in exon 10 of the Lynch Syndrome gene, MLH1, revealed an extremely high rate (77%) of mutations that lead to defective splicing. This finding is confirmed by extending the sampling to five other exons in the MLH1 gene. Further analysis suggests a more general phenomenon of defective splicing driving Lynch Syndrome. Of the 36 mutations tested, 11 disrupted splicing. Furthermore, analyzing past reports suggest that MLH1 mutations in canonical splice sites also occupy a much higher fraction (36%) of total mutations than expected. When performing a comprehensive analysis of splicing mutations in human disease genes, we found that three main causal genes of Lynch Syndrome, MLH1, MSH2, and PMS2, belonged to a class of 86 disease genes which are enriched for splicing mutations. Other cancer genes were also enriched in the 86 susceptible genes. The enrichment of splicing mutations in hereditary cancers strongly argues for additional priority in interpreting clinical sequencing data in relation to cancer and splicing. PMID:29505604

  18. A splice mutation in the PHKG1 gene causes high glycogen content and low meat quality in pig skeletal muscle.

    PubMed

    Ma, Junwu; Yang, Jie; Zhou, Lisheng; Ren, Jun; Liu, Xianxian; Zhang, Hui; Yang, Bin; Zhang, Zhiyan; Ma, Huanban; Xie, Xianhua; Xing, Yuyun; Guo, Yuanmei; Huang, Lusheng

    2014-10-01

    Glycolytic potential (GP) in skeletal muscle is economically important in the pig industry because of its effect on pork processing yield. We have previously mapped a major quantitative trait loci (QTL) for GP on chromosome 3 in a White Duroc × Erhualian F2 intercross. We herein performed a systems genetic analysis to identify the causal variant underlying the phenotype QTL (pQTL). We first conducted genome-wide association analyses in the F2 intercross and an F19 Sutai pig population. The QTL was then refined to an 180-kb interval based on the 2-LOD drop method. We then performed expression QTL (eQTL) mapping using muscle transcriptome data from 497 F2 animals. Within the QTL interval, only one gene (PHKG1) has a cis-eQTL that was colocolizated with pQTL peaked at the same SNP. The PHKG1 gene encodes a catalytic subunit of the phosphorylase kinase (PhK), which functions in the cascade activation of glycogen breakdown. Deep sequencing of PHKG1 revealed a point mutation (C>A) in a splice acceptor site of intron 9, resulting in a 32-bp deletion in the open reading frame and generating a premature stop codon. The aberrant transcript induces nonsense-mediated decay, leading to lower protein level and weaker enzymatic activity in affected animals. The mutation causes an increase of 43% in GP and a decrease of>20% in water-holding capacity of pork. These effects were consistent across the F2 and Sutai populations, as well as Duroc × (Landrace × Yorkshire) hybrid pigs. The unfavorable allele exists predominantly in Duroc-derived pigs. The findings provide new insights into understanding risk factors affecting glucose metabolism, and would greatly contribute to the genetic improvement of meat quality in Duroc related pigs.

  19. Mutation analysis in the long isoform of USH2A in American patients with Usher Syndrome type II.

    PubMed

    Yan, Denise; Ouyang, Xiaomei; Patterson, D Michael; Du, Li Lin; Jacobson, Samuel G; Liu, Xue-Zhong

    2009-12-01

    Usher syndrome type II (USH2) is an autosomal recessive disorder characterized by moderate to severe hearing impairment and progressive visual loss due to retinitis pigmentosa (RP). To identify novel mutations and determine the frequency of USH2A mutations as a cause of USH2, we have carried out mutation screening of all 72 coding exons and exon-intron splice sites of the USH2A gene. A total of 20 USH2 American probands of European descent were analyzed using single strand conformational polymorphism (SSCP) and direct sequencing methods. Ten different USH2A mutations were identified in 55% of the probands, five of which were novel mutations. The detected mutations include three missense, three frameshifts and four nonsense mutations, with c.2299delG/p.E767fs mutation, accounting for 38.9% of the pathological alleles. Two cases were homozygotes, two cases were compound heterozygotes and one case had complex allele with three variants. In seven probands, only one USH2A mutation was detected and no pathological mutation was found in the remaining eight individuals. Altogether, our data support the fact that c.2299delG/p.E767fs is indeed the most common USH2A mutation found in USH2 patients of European Caucasian background. Thus, if screening for mutations in USH2A is considered, it is reasonable to screen for the c.2299delG mutation first.

  20. Cloning of the Pichia anomala SEC61 gene and its expression in a Saccharomyces cerevisiae sec61 mutant.

    PubMed

    Ruíz, Teresa; De la Rosa, José M; Domínguez, Angel; Rodríguez, Luis

    2003-05-01

    In several organisms, including Saccharomyces cerevisiae and other yeast species, the product encoded by the SEC61 gene is considered to be the core element of the translocation apparatus within the endoplasmic reticulum membrane through which translocation of secretory and membrane proteins occurs. In this study, we have cloned and characterized the homolog of the SEC61 gene from the yeast Pichia anomala. The cloned gene includes an ORF, interrupted after the first ten nucleotides by an intron of 131 bp, encoding a 479-amino acid putative polypeptide exhibiting homology to the products encoded by different eukaryotic SEC61 genes, particularly to those from other yeast species. We show that the P. anomala SEC61 gene is correctly processed (intron splicing) when expressed in S. cerevisiae and that it is able to complement the thermosensitive phenotype associated with a mutation in the S. cerevisiae SEC61 gene.

  1. Defective minor spliceosome mRNA processing results in isolated familial growth hormone deficiency

    PubMed Central

    Argente, Jesús; Flores, Raquel; Gutiérrez-Arumí, Armand; Verma, Bhupendra; Martos-Moreno, Gabriel Á; Cuscó, Ivon; Oghabian, Ali; Chowen, Julie A; Frilander, Mikko J; Pérez-Jurado, Luis A

    2014-01-01

    The molecular basis of a significant number of cases of isolated growth hormone deficiency remains unknown. We describe three sisters affected with severe isolated growth hormone deficiency and pituitary hypoplasia caused by biallelic mutations in the RNPC3 gene, which codes for a minor spliceosome protein required for U11/U12 small nuclear ribonucleoprotein (snRNP) formation and splicing of U12-type introns. We found anomalies in U11/U12 di-snRNP formation and in splicing of multiple U12-type introns in patient cells. Defective transcripts include preprohormone convertases SPCS2 and SPCS3 and actin-related ARPC5L genes, which are candidates for the somatotroph-restricted dysfunction. The reported novel mechanism for familial growth hormone deficiency demonstrates that general mRNA processing defects of the minor spliceosome can lead to very narrow tissue-specific consequences. Subject Categories Genetics, Gene Therapy ' Genetic Disease; Metabolism PMID:24480542

  2. [Alternative splicing regulation: implications in cancer diagnosis and treatment].

    PubMed

    Martínez-Montiel, Nancy; Rosas-Murrieta, Nora; Martínez-Contreras, Rebeca

    2015-04-08

    The accurate expression of the genetic information is regulated by processes like mRNA splicing, proposed after the discoveries of Phil Sharp and Richard Roberts, who demonstrated the existence of intronic sequences, present in almost every structural eukaryotic gene, which should be precisely removed. This intron removal is called "splicing", which generates different proteins from a single mRNA, with different or even antagonistic functions. We currently know that alternative splicing is the most important source of protein diversity, given that 70% of the human genes undergo splicing and that mutations causing defects in this process could originate up to 50% of genetic diseases, including cancer. When these defects occur in genes involved in cell adhesion, proliferation and cell cycle regulation, there is an impact on cancer progression, rising the opportunity to diagnose and treat some types of cancer according to a particular splicing profile. Copyright © 2013 Elsevier España, S.L.U. All rights reserved.

  3. Novel types of COMP mutations and genotype-phenotype association in pseudoachondroplasia and multiple epiphyseal dysplasia.

    PubMed

    Mabuchi, Akihiko; Manabe, Noriyo; Haga, Nobuhiko; Kitoh, Hiroshi; Ikeda, Toshiyuki; Kawaji, Hiroyuki; Tamai, Kazuya; Hamada, Junichiro; Nakamura, Shigeru; Brunetti-Pierri, Nicola; Kimizuka, Mamori; Takatori, Yoshio; Nakamura, Kozo; Nishimura, Gen; Ohashi, Hirofumi; Ikegawa, Shiro

    2003-01-01

    Mutations in the gene encoding cartilage oligomeric matrix protein ( COMP) cause two skeletal dysplasias, pseudoachondroplasia (PSACH) and multiple epiphyseal dysplasia (MED). More than 40 mutations have been identified; however, genotype-phenotype relationships are not well delineated. Further, mutations other than in-frame insertion/deletions and substitutions have not been found, and currently known mutations are clustered within relatively small regions. Here we report the identification of nine novel and three recurrent COMP mutations in PSACH and MED patients. These include two novel types of mutations; the first, a gross deletion spanning an exon-intron junction, causes an exon deletion. The second, a frameshift mutation that results in a truncation of the C-terminal domain, is the first known truncating mutation in the COMP gene. The remaining mutations, other than a novel exon 18 mutation, affected highly conserved aspartate or cysteine residues in the calmodulin-like repeat (CLR) region. Genotype-phenotype analysis revealed a correlation between the position and type of mutations and the severity of short stature. Mutations in the seventh CLR produced more severe short stature compared with mutations elsewhere in the CLRs ( P=0.0003) and elsewhere in the COMP gene ( P=0.0007). Patients carrying mutations within the five-aspartates repeat (aa 469-473) in the seventh CLR were extremely short (below -6 SD). Patients with deletion mutations were significantly shorter than those with substitution mutations ( P=0.0024). These findings expand the mutation spectrum of the COMP gene and highlight genotype-phenotype relationships, facilitating improved genetic diagnosis and analysis of COMP function in humans.

  4. Finding FMR1 mosaicism in Fragile X syndrome

    PubMed Central

    Gonçalves, Thaís Fernandez; dos Santos, Jussara Mendonça; Gonçalves, Andressa Pereira; Tassone, Flora; Mendoza-Morales, Guadalupe; Ribeiro, Márcia Gonçalves; Kahn, Evelyn; Boy, Raquel; Pimentel, Márcia Mattos Gonçalves; Santos-Rebouças, Cíntia Barros

    2016-01-01

    OBJETIVE Almost all patients with Fragile X Syndrome (FXS) exhibit a CGG repeat expansion (full mutation) in the Fragile Mental Retardation 1 gene (FMR1). Here, we report five unrelated males with FXS harboring a somatic full mutation/deletion mosaicism. METHODS Mutational profiles were only elucidated by using a combination of molecular approaches (CGG-based PCR, Sanger sequencing, MS-MLPA, Southern blot and mPCR). RESULT Four patients exhibited small deletions encompassing the CGG repeats tract and flanking regions, whereas the remaining had a larger deletion comprising at least exon 1 and part of intron 1 of FMR1 gene. The presence of a 2–3 base pairs microhomology in proximal and distal non-recurrent breakpoints without scars supports the involvement of microhomology mediated induced repair (MMBIR) mechanism in three small deletions. CONCLUSION Our data highlights the importance of using different research methods to elucidate atypical FXS mutational profiles, which are clinically undistinguishable and may have been underestimated. PMID:26716517

  5. Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

    PubMed

    Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

    2016-04-01

    Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

  6. The characterization of a zebrafish mid-hindbrain mutant, mid-hindbrain gone (mgo).

    PubMed

    Shima, Takaki; Znosko, Wade; Tsang, Michael

    2009-04-01

    The vertebrate mid-hindbrain boundary (MHB) is a crucial morphological structure required for patterning and neural differentiation of the midbrain and anterior hindbrain. We isolated a novel zebrafish mutant, MHB gone (mgo), that exhibited a defective MHB. Expression of engrailed3 in the prospective MHB was absent at the 1-somite stage, suggesting that initiation of the isthmic organizer was disrupted in mgo mutants. Complementation test with mgo and noi, in which the pax2a gene is mutated, infer that the mgo mutant may represent a novel noi allele. However, pronephric, otic vesicle, and commissural axonal defects described in noi mutants were not associated with mgo mutants. Genetic mapping revealed that the mgo mutation is linked to the Pax2a locus, but no mutation was detected in pax2a exons or within intron-exon boundaries. Based on these findings, we propose that the mgo mutation genetically interacts with pax2a required for the initiation of MHB formation. Copyright 2009 Wiley-Liss, Inc.

  7. A syndrome of microcephaly, short stature, polysyndactyly, and dental anomalies caused by a homozygous KATNB1 mutation.

    PubMed

    Yigit, Gökhan; Wieczorek, Dagmar; Bögershausen, Nina; Beleggia, Filippo; Möller-Hartmann, Claudia; Altmüller, Janine; Thiele, Holger; Nürnberg, Peter; Wollnik, Bernd

    2016-03-01

    Using whole-exome sequencing, we identified a homozygous acceptor splice-site mutation in intron 6 of the KATNB1 gene in a patient from a consanguineous Turkish family who presented with congenital microcephaly, lissencephaly, short stature, polysyndactyly, and dental abnormalities. cDNA analysis revealed complete loss of the natural acceptor splice-site resulting either in the usage of an alternative, exonic acceptor splice-site inducing a frame-shift and premature protein truncation or, to a minor extent, in complete skipping of exon 7. Both effects most likely lead to complete loss of KATNB1 function. Homozygous and compound heterozygous mutations in KATNB1 have very recently been described as a cause of microcephaly with brain malformations and seizures. We extend the KATNB1 associated phenotype by describing a syndrome characterized by primordial dwarfism, lissencephaly, polysyndactyly, and dental anomalies, which is caused by a homozygous truncating KATNB1 mutation. © 2015 Wiley Periodicals, Inc.

  8. A Dentin Sialophosphoprotein Mutation That Partially Disrupts a Splice Acceptor Site Causes Type II Dentin Dysplasia

    PubMed Central

    Lee, Sook-Kyung; Hu, Jan C.-C.; Lee, Kyung-Eun; Simmer, James P.; Kim, Jung-Wook

    2009-01-01

    The dentin sialophosphoprotein (DSPP) gene on chromosome 4q21.3 encodes the major noncollagenous protein in tooth dentin. DSPP mutations are the principal cause of dentin dysplasia type II, dentinogenesis imperfecta type II, and dentinogenesis imperfecta type III. We have identified a DSPP splice junction mutation (IVS2-6T>G) in a family with dentin dysplasia type II. The primary dentition is discolored brown with severe attrition. The mildly discolored permanent dentition has thistle-shaped pulp chambers, pulp stones, and eventual pulp obliteration. The mutation is in the sixth nucleotide from the end of intron 2, perfectly segregates with the disease phenotype, and is absent in 200 normal control chromosomes. An in vitro splicing assay shows that pre-mRNA splicing of the mutant allele generates wild-type mRNA and mRNA lacking exon 3 in approximately equal amounts. Skipping exon 3 might interfere with signal peptide cleavage, causing endoplasmic reticulum stress, and also reduce DSPP secretion, leading to haploinsufficiency. PMID:19026876

  9. De novo mutation of PHEX in a type 1 diabetes patient.

    PubMed

    Fang, Chen; Li, Hui; Li, Xiaozhen; Xiao, Wenjin; Huang, Yun; Cai, Wu; Yang, Yi; Hu, Ji

    2016-05-01

    A new missense mutation on the X chromosome (PHEX) at exon 4(c.442C>T) in a 4-generation Chinese Han pedigree is reported. The proband and four family members were clinically identified as the X-linked hypophosphatemic rickets (XLH) which is a dominant inherited disorder characterized by renal phosphate wasting, aberrant vitamin D metabolism, and abnormal bone mineralization. The proband is identified as hemizygous with the four female family members to be heterozygous genotypes. The discovery was made through the complete sequencing of the exons and the intron-exon boundaries of the PHEX gene of this family. The mutation caused the S141 residue to change to Phe from Ser which is perfectly conserved among humans, mice, rats, cows and chickens. PolyPhen-2 software analysis of the mutation indicated it was probably damaging. The proband was also diagnosed with type 1 diabetes (T1D) and the relationship between XLH and diabetes phenotypes was discussed in the paper.

  10. Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?

    PubMed

    Shroyer, N F; Lewis, R A; Lupski, J R

    2001-06-01

    To determine if mutations in ABCR (ABCA4) are associated with chloroquine/hydroxychloroquine retinopathy. DNA from eight patients with chloroquine or hydroxychloroquine retinopathy was studied. Controls were 80 individuals over age 65 years with normal retinal examinations. Ophthalmoscopy, color vision testing, visual fields, retinal photography, and fluorescein angiography were performed on the eight patients. Direct DNA sequencing of the exons and flanking intronic regions of the ABCR gene was completed for all patients. Clinical evaluation confirmed the diagnosis of chloroquine/hydroxychloroquine retinopathy and excluded Stargardt disease in each patient. Two patients had heterozygous ABCR missense mutations previously associated with Stargardt disease. None of the controls had these missense mutations. Three other patients had other missense polymorphisms. Some individuals who have ABCR mutations may be predisposed to develop retinal toxicity when exposed to chloroquine/hydroxychloroquine. We urge further study of a larger cohort of patients with chloroquine/hydroxychloroquine retinopathy.

  11. Insertion of an SVA element, a nonautonomous retrotransposon, in PMS2 intron 7 as a novel cause of Lynch syndrome.

    PubMed

    van der Klift, Heleen M; Tops, Carli M; Hes, Frederik J; Devilee, Peter; Wijnen, Juul T

    2012-07-01

    Heterozygous germline mutations in the mismatch repair gene PMS2 predispose carriers for Lynch syndrome, an autosomal dominant predisposition to cancer. Here, we present a LINE-1-mediated retrotranspositional insertion in PMS2 as a novel mutation type for Lynch syndrome. This insertion, detected with Southern blot analysis in the genomic DNA of the patient, is characterized as a 2.2 kb long 5' truncated SVA_F element. The insertion is not detectable by current diagnostic testing limited to MLPA and direct Sanger sequencing on genomic DNA. The molecular nature of this insertion could only be resolved in RNA from cultured lymphocytes in which nonsense-mediated RNA decay was inhibited. Our report illustrates the technical problems encountered in the detection of this mutation type. Especially large heterozygous insertions will remain unnoticed because of preferential amplification of the smaller wild-type allele in genomic DNA, and are probably underreported in the mutation spectra of autosomal dominant disorders. © 2012 Wiley Periodicals, Inc.

  12. Rett syndrome in a 47,XXX patient with a de novo MECP2 mutation.

    PubMed

    Hammer, Sara; Dorrani, Naghmeh; Hartiala, Jaana; Stein, Stuart; Schanen, N Carolyn

    2003-10-15

    Rett syndrome is caused by mutation in MECP2, a gene located on Xq28 and subject to X-inactivation. MECP2 encodes methyl CpG-binding protein 2, a widely expressed transcriptional repressor of methylated DNA. Mutations in MECP2 are primarily de novo events in the male germ line and thus lead to an excess of affected females. Here we report the identification of a unique 47,XXX girl with relatively mild atypical Rett syndrome leading initially to a diagnosis of infantile autism with regression. Mutation analysis of the MECP2 gene identified a de novo MECP2 mutation, L100V. Examination of a panel of X-linked microsatellite markers indicated that her supernumerary X chromosome is maternally derived. X-inactivation patterns were determined by analysis of methylation of the androgen receptor locus, and indicated preferential inactivation of her paternal allele. The parental origin of her MECP2 mutation could not be determined because she was uninformative for intronic polymorphisms flanking her mutation. This is the first reported case of sex chromosome trisomy and MECP2 mutation in a female, and it illustrates the importance of allele dosage on the severity of Rett syndrome phenotype. Copyright 2003 Wiley-Liss, Inc.

  13. Identifying RNA splicing factors using IFT genes in Chlamydomonas reinhardtii.

    PubMed

    Lin, Huawen; Zhang, Zhengyan; Iomini, Carlo; Dutcher, Susan K

    2018-03-01

    Intraflagellar transport moves proteins in and out of flagella/cilia and it is essential for the assembly of these organelles. Using whole-genome sequencing, we identified splice site mutations in two IFT genes, IFT81 ( fla9 ) and IFT121 ( ift121-2 ), which lead to flagellar assembly defects in the unicellular green alga Chlamydomonas reinhardtii The splicing defects in these ift mutants are partially corrected by mutations in two conserved spliceosome proteins, DGR14 and FRA10. We identified a dgr14 deletion mutant, which suppresses the 3' splice site mutation in IFT81 , and a frameshift mutant of FRA10 , which suppresses the 5' splice site mutation in IFT121 Surprisingly, we found dgr14-1 and fra10 mutations suppress both splice site mutations. We suggest these two proteins are involved in facilitating splice site recognition/interaction; in their absence some splice site mutations are tolerated. Nonsense mutations in SMG1 , which is involved in nonsense-mediated decay, lead to accumulation of aberrant transcripts and partial restoration of flagellar assembly in the ift mutants. The high density of introns and the conservation of noncore splicing factors, together with the ease of scoring the ift mutant phenotype, make Chlamydomonas an attractive organism to identify new proteins involved in splicing through suppressor screening. © 2018 The Authors.

  14. The use of high resolution melting analysis to detect Fabry mutations in heterozygous females via dry bloodspots.

    PubMed

    Tai, Chang-Long; Liu, Mei-Ying; Yu, Hsiao-Chi; Chiang, Chiang-Chuan; Chiang, Hung; Suen, Jeng-Hung; Kao, Shu-Min; Huang, Yu-Hsiu; Wu, Tina Jui-Ting; Yang, Chia-Feng; Tsai, Fang-Chih; Lin, Ching-Yuang; Chang, Jan-Gowth; Chen, Hong-Duo; Niu, Dau-Ming

    2012-02-18

    As an X-linked genetic disorder, Fabry disease was first thought to affect males only, and females were generally considered to be asymptomatic carriers. However, recent research suggests that female carriers of Fabry disease may still develop vital organ damage causing severe morbidity and mortality. In the previous newborn screening, from 299,007 newborns, we identified a total of 20 different Fabry mutations and 121 newborns with Fabry mutations. However, we found that most female carriers are not detected by enzyme assays. A streamlined method for high resolution melting (HRM) analysis was designed to screen for GLA gene mutations using a same PCR and melting program. Primer sets were designed to cover the 7 exons and the Chinese common intronic mutation, IVS4+919G>A of GLA gene. The HRM analysis was successful in identifying heterozygous and hemizygous patients with the 20 surveyed mutations. We were also successful in using this method to test dry blood spots of newborns afflicted with Fabry mutations without having to determine DNA concentration before PCR amplification. The results of this study show that HRM could be a reliable and sensitive method for use in the rapid screening of females for GLA mutations. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. CHARGE syndrome: a recurrent hotspot of mutations in CHD7 IVS25 analyzed by bioinformatic tools and minigene assays.

    PubMed

    Legendre, Marine; Rodriguez-Ballesteros, Montserrat; Rossi, Massimiliano; Abadie, Véronique; Amiel, Jeanne; Revencu, Nicole; Blanchet, Patricia; Brioude, Frédéric; Delrue, Marie-Ange; Doubaj, Yassamine; Sefiani, Abdelaziz; Francannet, Christine; Holder-Espinasse, Muriel; Jouk, Pierre-Simon; Julia, Sophie; Melki, Judith; Mur, Sébastien; Naudion, Sophie; Fabre-Teste, Jennifer; Busa, Tiffany; Stamm, Stephen; Lyonnet, Stanislas; Attie-Bitach, Tania; Kitzis, Alain; Gilbert-Dussardier, Brigitte; Bilan, Frédéric

    2018-02-01

    CHARGE syndrome is a rare genetic disorder mainly due to de novo and private truncating mutations of CHD7 gene. Here we report an intriguing hot spot of intronic mutations (c.5405-7G > A, c.5405-13G > A, c.5405-17G > A and c.5405-18C > A) located in CHD7 IVS25. Combining computational in silico analysis, experimental branch-point determination and in vitro minigene assays, our study explains this mutation hot spot by a particular genomic context, including the weakness of the IVS25 natural acceptor-site and an unconventional lariat sequence localized outside the common 40 bp upstream the acceptor splice site. For each of the mutations reported here, bioinformatic tools indicated a newly created 3' splice site, of which the existence was confirmed using pSpliceExpress, an easy-to-use and reliable splicing reporter tool. Our study emphasizes the idea that combining these two complementary approaches could increase the efficiency of routine molecular diagnosis.

  16. [Point mutations of genes encoding proteins involvedin RNA splicing in patients with myelodysplastic syndromes].

    PubMed

    Barańska, Marta; Czerwińska-Rybak, Joanna; Gil, Lidia; Komarnicki, Mieczysław

    2015-01-01

    The myelodysplastic syndromes (MDS) constitute heterogeneous group of clonal disorders, characterized by ineffective hematopoiesis, peripheral cytopenia and increased risk of acute myeloid leukemia development. Molecular mechanisms behind MDS have not been fully explained, however recent studies based on new technologies confirmed that epigenetic abnormalities and somatic mutation in the spliceasome machinery are crucial in pathogenesis of these diseases. Abnormal mRNA splicing (excision of intronic sequences from mRNA) has been found in over half of all MDS patients and resulted in accumulation of cytogenetical and molecular changes. The biological impact of splicing factor genes mutations has been evaluated only in a limited extend and current studies concentrate on analysis of MDS transcriptome. Molecular characteristic of classical and alternative splicing is presented in the paper, according to current knowledge. We review the most prominent findings from recent years concerning mutation in the spliceasome machinery with respect to MDS phenotype and disease prognosis. Perspectives in applying of novel diagnostic and therapeutic possibilities for myelodysplasia, based on spliceosome mutations identification are also presented. © 2015 MEDPRESS.

  17. Mutational definition of binding requirements of an hnRNP-like protein in Arabidopsis using fluorescence correlation spectroscopy.

    PubMed

    Leder, Verena; Lummer, Martina; Tegeler, Kathrin; Humpert, Fabian; Lewinski, Martin; Schüttpelz, Mark; Staiger, Dorothee

    2014-10-10

    Arabidopsis thaliana glycine-rich RNA binding protein 7 (AtGRP7) is part of a negative feedback loop through which it regulates alternative splicing and steady-state abundance of its pre-mRNA. Here we use fluorescence correlation spectroscopy to investigate the requirements for AtGRP7 binding to its intron using fluorescently-labelled synthetic oligonucleotides. By systematically introducing point mutations we identify three nucleotides that lead to an increased Kd value when mutated and thus are critical for AtGRP7 binding. Simultaneous mutation of all three residues abrogates binding. The paralogue AtGRP8 binds to an overlapping motif but with a different sequence preference, in line with overlapping but not identical functions of this protein pair. Truncation of the glycine-rich domain reduces the binding affinity of AtGRP7, showing for the first time that the glycine-rich stretch of a plant hnRNP-like protein contributes to binding. Mutation of the conserved R(49) that is crucial for AtGRP7 function in pathogen defence and splicing abolishes binding. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Isolated cryptorchidism: no evidence for involvement of genes underlying isolated hypogonadotropic hypogonadism.

    PubMed

    Laitinen, Eeva-Maria; Tommiska, Johanna; Virtanen, Helena E; Oehlandt, Heidi; Koivu, Rosanna; Vaaralahti, Kirsi; Toppari, Jorma; Raivio, Taneli

    2011-07-20

    Mutations in FGFR1, GNRHR, PROK2, PROKR2, TAC3, or TACR3 underlie isolated hypogonadotropic hypogonadism (IHH) with clinically variable phenotypes, and, by causing incomplete intrauterine activation of the hypothalamic-pituitary-gonadal axis, may lead to cryptorchidism. To investigate the role of defects in these genes in the etiology of isolated cryptorchidism, we screened coding exons and exon-intron boundaries of these genes in 54 boys or men from 46 families with a history of cryptorchidism. Control subjects (200) included 120 males. None of the patients carried mutation(s) in FGFR1, PROK2, PROKR2, TAC3 or TACR3. Two of the 46 index subjects with unilateral cryptorchidism were heterozygous carriers of a single GNRHR mutation (Q106R or R262Q), also present in male controls with a similar frequency (3/120; p=0.62). No homozygous or compound heterozygous GNRHR mutations were found. In conclusion, cryptorchidism is not commonly caused by defects in genes involved in IHH. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  19. Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

    PubMed

    Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

    2013-01-01

    Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

  20. Tumor Genomic Profiling in Breast Cancer Patients Using Targeted Massively Parallel Sequencing

    DTIC Science & Technology

    2014-01-01

    binding domain mutations in ESR1 ) were identified. Analysis is currently underway to further elucidate causes of resistance in those cases where the... ESR1 , the gene that encodes the estrogen receptor (Wagle, Garraway, and Arteaga, unpublished results). Given the potential importance of ESR...translocations in ER+ breast cancer, we have further modified our bait design to include genomic coordinates across select introns in ESR1 . In addition, two

  1. Genetic and Hormonal Risk Factors for Prostate Cancer in African American Men

    DTIC Science & Technology

    2005-05-01

    Task 2. To perform DNA analyses to examine the following genotypes: Months 1-12 Months 12-24 LHB * CYP19 HSD3B2 CYP3A4 CYP17 IGF1 HSD17B2 We had...of publication of this article were defrayed in part by the payment of page mutation in exon 6 (P275A), and a 3-bp insertion/deletion in intron 7

  2. Dissecting genetic and environmental mutation signatures with model organisms.

    PubMed

    Segovia, Romulo; Tam, Annie S; Stirling, Peter C

    2015-08-01

    Deep sequencing has impacted on cancer research by enabling routine sequencing of genomes and exomes to identify genetic changes associated with carcinogenesis. Researchers can now use the frequency, type, and context of all mutations in tumor genomes to extract mutation signatures that reflect the driving mutational processes. Identifying mutation signatures, however, may not immediately suggest a mechanism. Consequently, several recent studies have employed deep sequencing of model organisms exposed to discrete genetic or environmental perturbations. These studies exploit the simpler genomes and availability of powerful genetic tools in model organisms to analyze mutation signatures under controlled conditions, forging mechanistic links between mutational processes and signatures. We discuss the power of this approach and suggest that many such studies may be on the horizon. Copyright © 2015 Elsevier Ltd. All rights reserved.

  3. A novel mutation in SMOC1 and variable phenotypic expression in two patients with Waardenburg anophthalmia syndrome.

    PubMed

    Jamshidi, Javad; Abdollahi, Shokoufeh; Ghaedi, Hamid; Alehabib, Elham; Tafakhori, Abbas; Alinaghi, Somayeh; Chapi, Marjan; Johari, Amir Hossein; Darvish, Hossein

    2017-11-01

    Waardenburg anophthalmia syndrome (WAS) is a rare disorder that mostly affects the eyes and distal limbs. In the current study we reported two Iranian patients with WAS. The first case was a 26-year-old girl with unilateral anophthalmia, bilateral camptodactyly and clinodactyly in her hands, oligodactly in her left foot and syndactyly of the second to fifth toes in her right foot. She also had severe hearing loss in both ears. The second case was a 12-year-old boy with bilateral anophthalmia, camptodactyly in his right hand, oligodactyly in his foot, clubfoot, and cryptorchidism. Both patients were mentally normal. To detect the causative mutation all exons and exon-intron boundaries of SMOC1 gene were sequenced in patients and other normal family members. We found a homozygous missense mutation (NM_001034852.2(SMOC1):c.367T > C) in exon 3 of SMOC1 gene in both patients. As the mutation segregated with the disease in the family, it should be the causative mutation. Our study extended the mutation spectrum of SMOC1 gene related to WAS. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  4. Mutation in an alternative transcript of CDKL5 in a boy with early-onset seizures.

    PubMed

    Bodian, Dale L; Schreiber, John M; Vilboux, Thierry; Khromykh, Alina; Hauser, Natalie S

    2018-06-01

    Infantile-onset epilepsies are a set of severe, heterogeneous disorders for which clinical genetic testing yields causative mutations in ∼20%-50% of affected individuals. We report the case of a boy presenting with intractable seizures at 2 wk of age, for whom gene panel testing was unrevealing. Research-based whole-genome sequencing of the proband and four unaffected family members identified a de novo mutation, NM_001323289.1:c.2828_2829delGA in CDKL5, a gene associated with X-linked early infantile epileptic encephalopathy 2. CDKL5 has multiple alternative transcripts, and the mutation lies in an exon in the brain-expressed forms. The mutation was undetected by gene panel sequencing because of its intronic location in the CDKL5 transcript typically used to define the exons of this gene for clinical exon-based tests (NM_003159). This is the first report of a patient with a mutation in an alternative transcript of CDKL5 This finding suggests that incorporating alternative transcripts into the design and variant interpretation of exon-based tests, including gene panel and exome sequencing, could improve the diagnostic yield. © 2018 Bodian et al.; Published by Cold Spring Harbor Laboratory Press.

  5. Mutation in an alternative transcript of CDKL5 in a boy with early-onset seizures

    PubMed Central

    Bodian, Dale L.; Schreiber, John M.; Vilboux, Thierry; Khromykh, Alina; Hauser, Natalie S.

    2018-01-01

    Infantile-onset epilepsies are a set of severe, heterogeneous disorders for which clinical genetic testing yields causative mutations in ∼20%–50% of affected individuals. We report the case of a boy presenting with intractable seizures at 2 wk of age, for whom gene panel testing was unrevealing. Research-based whole-genome sequencing of the proband and four unaffected family members identified a de novo mutation, NM_001323289.1:c.2828_2829delGA in CDKL5, a gene associated with X-linked early infantile epileptic encephalopathy 2. CDKL5 has multiple alternative transcripts, and the mutation lies in an exon in the brain-expressed forms. The mutation was undetected by gene panel sequencing because of its intronic location in the CDKL5 transcript typically used to define the exons of this gene for clinical exon-based tests (NM_003159). This is the first report of a patient with a mutation in an alternative transcript of CDKL5. This finding suggests that incorporating alternative transcripts into the design and variant interpretation of exon-based tests, including gene panel and exome sequencing, could improve the diagnostic yield. PMID:29444904

  6. A novel NHS mutation causes Nance-Horan Syndrome in a Chinese family.

    PubMed

    Tian, Qi; Li, Yunping; Kousar, Rizwana; Guo, Hui; Peng, Fenglan; Zheng, Yu; Yang, Xiaohua; Long, Zhigao; Tian, Runyi; Xia, Kun; Lin, Haiying; Pan, Qian

    2017-01-07

    Nance-Horan Syndrome (NHS) (OMIM: 302350) is a rare X-linked developmental disorder characterized by bilateral congenital cataracts, with occasional dental anomalies, characteristic dysmorphic features, brachymetacarpia and mental retardation. Carrier females exhibit similar manifestations that are less severe than in affected males. Here, we report a four-generation Chinese family with multiple affected individuals presenting Nance-Horan Syndrome. Whole-exome sequencing combined with RT-PCR and Sanger sequencing was used to search for a genetic cause underlying the disease phenotype. Whole-exome sequencing identified in all affected individuals of the family a novel donor splicing site mutation (NM_198270: c.1045 + 2T > A) in intron 4 of the gene NHS, which maps to chromosome Xp22.13. The identified mutation results in an RNA processing defect causing a 416-nucleotide addition to exon 4 of the mRNA transcript, likely producing a truncated NHS protein. The donor splicing site mutation NM_198270: c.1045 + 2T > A of the NHS gene is the causative mutation in this Nance-Horan Syndrome family. This research broadens the spectrum of NHS gene mutations, contributing to our understanding of the molecular genetics of NHS.

  7. GeneChip{sup {trademark}} screening assay for cystic fibrosis mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cronn, M.T.; Miyada, C.G.; Fucini, R.V.

    1994-09-01

    GeneChip{sup {trademark}} assays are based on high density, carefully designed arrays of short oligonucleotide probes (13-16 bases) built directly on derivatized silica substrates. DNA target sequence analysis is achieved by hybridizing fluorescently labeled amplification products to these arrays. Fluorescent hybridization signals located within the probe array are translated into target sequence information using the known probe sequence at each array feature. The mutation screening assay for cystic fibrosis includes sets of oligonucleotide probes designed to detect numerous different mutations that have been described in 14 exons and one intron of the CFTR gene. Each mutation site is addressed by amore » sub-array of at least 40 probe sequences, half designed to detect the wild type gene sequence and half designed to detect the reported mutant sequence. Hybridization with homozygous mutant, homozygous wild type or heterozygous targets results in distinctive hybridization patterns within a sub-array, permitting specific discrimination of each mutation. The GeneChip probe arrays are very small (approximately 1 cm{sup 2}). There miniature size coupled with their high information content make GeneChip probe arrays a useful and practical means for providing CF mutation analysis in a clinical setting.« less

  8. Evaluation of a deep learning architecture for MR imaging prediction of ATRX in glioma patients

    NASA Astrophysics Data System (ADS)

    Korfiatis, Panagiotis; Kline, Timothy L.; Erickson, Bradley J.

    2018-02-01

    Predicting mutation/loss of alpha-thalassemia/mental retardation syndrome X-linked (ATRX) gene utilizing MR imaging is of high importance since it is a predictor of response and prognosis in brain tumors. In this study, we compare a deep neural network approach based on a residual deep neural network (ResNet) architecture and one based on a classical machine learning approach and evaluate their ability in predicting ATRX mutation status without the need for a distinct tumor segmentation step. We found that the ResNet50 (50 layers) architecture, pre trained on ImageNet data was the best performing model, achieving an accuracy of 0.91 for the test set (classification of a slice as no tumor, ATRX mutated, or mutated) in terms of f1 score in a test set of 35 cases. The SVM classifier achieved 0.63 for differentiating the Flair signal abnormality regions from the test patients based on their mutation status. We report a method that alleviates the need for extensive preprocessing and acts as a proof of concept that deep neural network architectures can be used to predict molecular biomarkers from routine medical images.

  9. Understanding the complex evolution of rapidly mutating viruses with deep sequencing: Beyond the analysis of viral diversity.

    PubMed

    Leung, Preston; Eltahla, Auda A; Lloyd, Andrew R; Bull, Rowena A; Luciani, Fabio

    2017-07-15

    With the advent of affordable deep sequencing technologies, detection of low frequency variants within genetically diverse viral populations can now be achieved with unprecedented depth and efficiency. The high-resolution data provided by next generation sequencing technologies is currently recognised as the gold standard in estimation of viral diversity. In the analysis of rapidly mutating viruses, longitudinal deep sequencing datasets from viral genomes during individual infection episodes, as well as at the epidemiological level during outbreaks, now allow for more sophisticated analyses such as statistical estimates of the impact of complex mutation patterns on the evolution of the viral populations both within and between hosts. These analyses are revealing more accurate descriptions of the evolutionary dynamics that underpin the rapid adaptation of these viruses to the host response, and to drug therapies. This review assesses recent developments in methods and provide informative research examples using deep sequencing data generated from rapidly mutating viruses infecting humans, particularly hepatitis C virus (HCV), human immunodeficiency virus (HIV), Ebola virus and influenza virus, to understand the evolution of viral genomes and to explore the relationship between viral mutations and the host adaptive immune response. Finally, we discuss limitations in current technologies, and future directions that take advantage of publically available large deep sequencing datasets. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Deep learning of mutation-gene-drug relations from the literature.

    PubMed

    Lee, Kyubum; Kim, Byounggun; Choi, Yonghwa; Kim, Sunkyu; Shin, Wonho; Lee, Sunwon; Park, Sungjoon; Kim, Seongsoon; Tan, Aik Choon; Kang, Jaewoo

    2018-01-25

    Molecular biomarkers that can predict drug efficacy in cancer patients are crucial components for the advancement of precision medicine. However, identifying these molecular biomarkers remains a laborious and challenging task. Next-generation sequencing of patients and preclinical models have increasingly led to the identification of novel gene-mutation-drug relations, and these results have been reported and published in the scientific literature. Here, we present two new computational methods that utilize all the PubMed articles as domain specific background knowledge to assist in the extraction and curation of gene-mutation-drug relations from the literature. The first method uses the Biomedical Entity Search Tool (BEST) scoring results as some of the features to train the machine learning classifiers. The second method uses not only the BEST scoring results, but also word vectors in a deep convolutional neural network model that are constructed from and trained on numerous documents such as PubMed abstracts and Google News articles. Using the features obtained from both the BEST search engine scores and word vectors, we extract mutation-gene and mutation-drug relations from the literature using machine learning classifiers such as random forest and deep convolutional neural networks. Our methods achieved better results compared with the state-of-the-art methods. We used our proposed features in a simple machine learning model, and obtained F1-scores of 0.96 and 0.82 for mutation-gene and mutation-drug relation classification, respectively. We also developed a deep learning classification model using convolutional neural networks, BEST scores, and the word embeddings that are pre-trained on PubMed or Google News data. Using deep learning, the classification accuracy improved, and F1-scores of 0.96 and 0.86 were obtained for the mutation-gene and mutation-drug relations, respectively. We believe that our computational methods described in this research could be used as an important tool in identifying molecular biomarkers that predict drug responses in cancer patients. We also built a database of these mutation-gene-drug relations that were extracted from all the PubMed abstracts. We believe that our database can prove to be a valuable resource for precision medicine researchers.

  11. A base substitution in the donor site of intron 12 of KIT gene is responsible for the dominant white coat colour of blue fox (Alopex lagopus).

    PubMed

    Yan, S Q; Hou, J N; Bai, C Y; Jiang, Y; Zhang, X J; Ren, H L; Sun, B X; Zhao, Z H; Sun, J H

    2014-04-01

    The dominant white coat colour of farmed blue fox is inherited as a monogenic autosomal dominant trait and is suggested to be embryonic lethal in the homozygous state. In this study, the transcripts of KIT were identified by RT-PCR for a dominant white fox and a normal blue fox. Sequence analysis showed that the KIT transcript in normal blue fox contained the full-length coding sequence of 2919 bp (GenBank Acc. No KF530833), but in the dominant white individual, a truncated isoform lacking the entire exon 12 specifically co-expressed with the normal transcript. Genomic DNA sequencing revealed that a single nucleotide polymorphism (c.1867+1G>T) in intron 12 appeared only in the dominant white individuals and a 1-bp ins/del polymorphism in the same intron showed in individuals representing two different coat colours. Genotyping results of the SNP with PCR-RFLP in 185 individuals showed all 90 normal blue foxes were homozygous for the G allele, and all dominant white individuals were heterozygous. Due to the truncated protein with a deletion of 35 amino acids and an amino acid replacement (p.Pro623Ala) located in the conserved ATP binding domain, we propose that the mutant receptor had absent tyrosine kinase activity. These findings reveal that the base substitution at the first nucleotide of intron 12 of KIT gene, resulting in skipping of exon 12, is a causative mutation responsible for the dominant white phenotype of blue fox. © 2013 Stichting International Foundation for Animal Genetics.

  12. Molecular basis and consequences of a deletion in the amelogenin gene, analyzed by capture PCR

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lagerstroem-Fermer, M.; Pettersson, U.; Landegren, U.

    1993-07-01

    A mutation that disrupts the gene for one of the major proteins in tooth enamel has been investigated. The mutation is located in the amelogenin gene and causes X-linked amelogenesis imperfecta, characterized by defective mineralization of tooth enamel. The authors have isolated the breakpoints of a 5-kb deletion in the amelogenin gene on the basis of nucleotide sequence information located upstream of the lesion, using a technique termed capture PCR. The deletion removes five of the seven exons, spanning from the second intron to the last exon. Only the first two codons for the mature protein remain, consistent with themore » relatively severe phenotype of affected individuals in the present family. The mutation appears to have arisen as an illegitimate recombination event since of 11 nucleotide positions immediately surrounding the two breakpoints, 9 are identical. 17 refs., 3 figs., 1 tab.« less

  13. Netherton Syndrome in a Neonate with Possible Growth Hormone Deficiency and Transient Hyperaldosteronism

    PubMed Central

    Ilias, Chatziioannidis; Evgenia, Babatseva; Aikaterini, Patsatsi; Asimina, Galli-Tsinopoulou; Constantina, Sarri; Maria, Lithoxopoulou; George, Mitsiakos; Paraskevi, Karagianni; Christos, Tsakalidis; Zissis, Mamuris; Nikolaos, Nikolaidis

    2015-01-01

    Netherton syndrome, a rare autosomal recessive genetic disorder, is classified as an ichthyosiform syndrome. In this report we present the case of a neonate with erythroderma shortly after birth, accompanied by severe hypernatremia, recurrent infections, transient hyperaldosteronism, and signs of growth hormone (GH) deficiency. DNA molecular analysis in the SPINK5 gene revealed heterozygosity in our index patient for 238insG and 2468delA frameshift mutations in exons 4 and 26, respectively, in the maternal allele and 1431-12G>A splice-site mutation in intron 15 in the paternal allele as well as the missense variation E420K in homozygous state. Combination of the identified mutations along with transient hyperaldosteronism and possible GH deficiency have not been described before. Accordingly, the importance of early multidisciplinary approach is highlighted, in order to reach accurate diagnosis, initiate prompt treatment, and ensure survival with fewer disease complications. PMID:26229701

  14. Novel ancestral Dysferlin splicing mutation which migrated from the Iberian peninsula to South America.

    PubMed

    Vernengo, Luis; Oliveira, Jorge; Krahn, Martin; Vieira, Emilia; Santos, Rosário; Carrasco, Luisa; Negrão, Luís; Panuncio, Ana; Leturcq, France; Labelle, Veronique; Bronze-da-Rocha, Elsa; Mesa, Rosario; Pizzarossa, Carlos; Lévy, Nicolas; Rodriguez, Maria-Mirta

    2011-05-01

    Primary dysferlinopathies are a group of recessive heterogeneous muscular dystrophies. The most common clinical presentations are Miyoshi myopathy and LGMD2B. Additional presentations range from isolated hyperCKemia to severe functional disability. Symptomatology begins in the posterior muscle compartment of the calf and its clinical course progresses slowly in Miyoshi myopathy whereas LGMD2B involves predominantly the proximal muscles of the lower limbs. The age of onset ranges from 13 to 60years in Caucasians. We present five patients that carry a novel mutation in the exon12/intron12 boundary: c.1180_1180+7delAGTGCGTG (r.1054_1284del). We provide evidence of a founder effect due to a common ancestral origin of this mutation, detected in heterozygosity in four patients and in homozygosity in one patient. Copyright © 2011 Elsevier B.V. All rights reserved.

  15. An RRM–ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion

    PubMed Central

    Collins, Katherine M.; Kainov, Yaroslav A.; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A.

    2017-01-01

    Abstract RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1–ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. PMID:28379442

  16. An RRM-ZnF RNA recognition module targets RBM10 to exonic sequences to promote exon exclusion.

    PubMed

    Collins, Katherine M; Kainov, Yaroslav A; Christodolou, Evangelos; Ray, Debashish; Morris, Quaid; Hughes, Timothy; Taylor, Ian A; Makeyev, Eugene V; Ramos, Andres

    2017-06-20

    RBM10 is an RNA-binding protein that plays an essential role in development and is frequently mutated in the context of human disease. RBM10 recognizes a diverse set of RNA motifs in introns and exons and regulates alternative splicing. However, the molecular mechanisms underlying this seemingly relaxed sequence specificity are not understood and functional studies have focused on 3΄ intronic sites only. Here, we dissect the RNA code recognized by RBM10 and relate it to the splicing regulatory function of this protein. We show that a two-domain RRM1-ZnF unit recognizes a GGA-centered motif enriched in RBM10 exonic sites with high affinity and specificity and test that the interaction with these exonic sequences promotes exon skipping. Importantly, a second RRM domain (RRM2) of RBM10 recognizes a C-rich sequence, which explains its known interaction with the intronic 3΄ site of NUMB exon 9 contributing to regulation of the Notch pathway in cancer. Together, these findings explain RBM10's broad RNA specificity and suggest that RBM10 functions as a splicing regulator using two RNA-binding units with different specificities to promote exon skipping. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. Superficial venous thrombosis: prevalence of common genetic risk factors and their role on spreading to deep veins.

    PubMed

    Milio, Glauco; Siragusa, Sergio; Minà, Chiara; Amato, Corrado; Corrado, Egle; Grimaudo, Stefania; Novo, Salvatore

    2008-01-01

    Superficial venous thrombosis (SVT) has been considered for a long time a limited clinical condition with a low importance, but this approach has changed in recent years, when several studies demonstrated spreading to deep veins occurring from 7.3 to 44%, with high prevalence of pulmonary embolism. To evaluate the prevalence of genetic risk factors for VTE in patients suffering from SVT on both normal and varicose vein, and to understand their role on spreading to deep veins, we studied 107 patients with SVT, without other risk factors. Ultrasound examination was performed, and the presence of FV Leiden, Prothrombin G20210A mutation, and MTHFR C677T mutation was researched. In the patients where SVT occurred in normal veins, the presence of FV Leiden was 26.3% of the non-spreading and 60% of the spreading to deep veins SVT; Prothrombin mutation was found in 7.9% of the former case and in 20% of the latter; MTHFR C677T mutation was found respectively in 23.7% and 40%. In the patients with SVT on varicose veins, the presence of these factors was less evident (6.7%, 4.4% and 6.7% respectively), but their prevalence was considerably higher (35.7%, 7.4% and 21.4% respectively) in SVT spreading to deep veins than in non-spreading. Our data demonstrate the high prevalence of these mutations, especially FV Leiden and associations, in patients with SVT on normal veins and their role in the progression to deep vein system.

  18. Mutations of the Imprinted CDKN1C Gene as a Cause of the Overgrowth Beckwith-Wiedemann Syndrome: Clinical Spectrum and Functional Characterization.

    PubMed

    Brioude, Frederic; Netchine, Irène; Praz, Francoise; Le Jule, Marilyne; Calmel, Claire; Lacombe, Didier; Edery, Patrick; Catala, Martin; Odent, Sylvie; Isidor, Bertrand; Lyonnet, Stanislas; Sigaudy, Sabine; Leheup, Bruno; Audebert-Bellanger, Séverine; Burglen, Lydie; Giuliano, Fabienne; Alessandri, Jean-Luc; Cormier-Daire, Valérie; Laffargue, Fanny; Blesson, Sophie; Coupier, Isabelle; Lespinasse, James; Blanchet, Patricia; Boute, Odile; Baumann, Clarisse; Polak, Michel; Doray, Berenice; Verloes, Alain; Viot, Géraldine; Le Bouc, Yves; Rossignol, Sylvie

    2015-09-01

    Beckwith-Wiedemann syndrome (BWS) is an imprinting disorder associating macroglossia, abdominal wall defects, visceromegaly, and a high risk of childhood tumor. Molecular anomalies are mostly epigenetic; however, mutations of CDKN1C are implicated in 8% of cases, including both sporadic and familial forms. We aimed to describe the phenotype of BWS patients with CDKN1C mutations and develop a functional test for CDKN1C mutations. For each propositus, we sequenced the three exons and intron-exon boundaries of CDKN1C in patients presenting a BWS phenotype, including abdominal wall defects, without 11p15 methylation defects. We developed a functional test based on flow cytometry. We identified 37 mutations in 38 pedigrees (50 patients and seven fetuses). Analysis of parental samples when available showed that all mutations tested but one was inherited from the mother. The four missense mutations led to a less severe phenotype (lower frequency of exomphalos) than the other 33 mutations. The following four tumors occurred: one neuroblastoma, one ganglioneuroblastoma, one melanoma, and one acute lymphoid leukemia. Cases of BWS caused by CDKN1C mutations are not rare. CDKN1C sequencing should be performed for BWS patients presenting with abdominal wall defects or cleft palate without 11p15 methylation defects or body asymmetry, or in familial cases of BWS. © 2015 WILEY PERIODICALS, INC.

  19. DNA polymerase θ contributes to the generation of C/G mutations during somatic hypermutation of Ig genes

    PubMed Central

    Masuda, Keiji; Ouchida, Rika; Takeuchi, Arata; Saito, Takashi; Koseki, Haruhiko; Kawamura, Kiyoko; Tagawa, Masatoshi; Tokuhisa, Takeshi; Azuma, Takachika; O-Wang, Jiyang

    2005-01-01

    Somatic hypermutation of Ig variable region genes is initiated by activation-induced cytidine deaminase; however, the activity of multiple DNA polymerases is required to ultimately introduce mutations. DNA polymerase η (Polη) has been implicated in mutations at A/T, but polymerases involved in C/G mutations have not been identified. We have generated mutant mice expressing DNA polymerase (Polθ) specifically devoid of polymerase activity. Compared with WT mice, Polq-inactive (Polq, the gene encoding Polθ) mice exhibited a reduced level of serum IgM and IgG1. The mutant mice mounted relatively normal primary and secondary immune responses to a T-dependent antigen, but the production of high-affinity specific antibodies was partially impaired. Analysis of the JH4 intronic sequences revealed a slight reduction in the overall mutation frequency in Polq-inactive mice. Remarkably, although mutations at A/T were unaffected, mutations at C/G were significantly decreased, indicating an important, albeit not exclusive, role for Polθ activity. The reduction of C/G mutations was particularly focused on the intrinsic somatic hypermutation hotspots and both transitions and transversions were similarly reduced. These findings, together with the recent observation that Polθ efficiently catalyzes the bypass of abasic sites, lead us to propose that Polθ introduces mutations at C/G by replicating over abasic sites generated via uracil-DNA glycosylase. PMID:16172387

  20. [Analysis of the parental origin of MECP2 mutations in patients with Rett syndrome].

    PubMed

    Zhang, Jing-jing; Bao, Xin-hua; Cao, Guang-na; Jiang, Sheng-ling; Zhu, Xing-wang; Lu, Hong-mei; Jia, Li-fang; Pan, Hong; Wu, Xi-ru

    2010-04-01

    To identify the parental origin of methyl-CpG-binding protein 2 (MECP2) gene mutations in Chinese patients with Rett syndrome. Single nucleotide polymorphisms (SNPs) in intron 3 of the MECP2 gene were analyzed by PCR and sequencing in 115 patients with Rett syndrome. Then sequencing of the SNP region was performed for the fathers of the patients who had at least one SNP, to determine which allele was from the father. Then allele-specific PCR was performed and the products were sequenced to see whether the allele from father or mother harbored the mutation. Seventy-six of the 115 patients had at least one SNP. Three hot SNPs were found in these patients. They were: IVS3+22C >G, IVS3+266C >T and IVS3+683C>T. Among the 76 cases, 73 had a paternal origin of MECP2 mutations, and the other 3 had a maternal origin. There were multiple types of MECP2 mutation of the paternal origin, including 4 frame shift, 2 deletion and 67 point (56C >T, 6C >G, 2A >G, 2G >T and 1A >T) mutations. The mutation types of the 3 patients with maternal origin included 2 frame shift and 1 point (C >T) mutation. In Chinese RTT patients, the MECP2 mutations are mostly of paternal origin.

  1. Identification of two novel mutations in the PHEX gene in Chinese patients with hypophosphatemic rickets/osteomalacia.

    PubMed

    Yue, Hua; Yu, Jin-bo; He, Jin-wei; Zhang, Zeng; Fu, Wen-zhen; Zhang, Hao; Wang, Chun; Hu, Wei-wei; Gu, Jie-mei; Hu, Yun-qiu; Li, Miao; Liu, Yu-juan; Zhang, Zhen-Lin

    2014-01-01

    X-linked dominant hypophosphatemia (XLH) is the most prevalent form of inherited rickets/osteomalacia in humans. The aim of this study was to identify PHEX gene mutations and describe the clinical features observed in 6 unrelated Chinese families and 3 sporadic patients with hypophosphatemic rickets/osteomalacia. For this study, 45 individuals from 9 unrelated families of Chinese Han ethnicity (including 16 patients and 29 normal phenotype subjects), and 250 healthy donors were recruited. All 22 exons and exon-intron boundaries of the PHEX gene were amplified by polymerase chain reaction (PCR) and directly sequenced. The PHEX mutations were detected in 6 familial and 3 sporadic hypophosphatemic rickets/osteomalacia. Altogether, 2 novel mutations were detected: 1 missense mutation c.1183G>C in exon 11, resulting in p.Gly395Arg and 1 missense mutation c.1751A>C in exon 17, resulting in p.His584Pro. No mutations were found in the 250 healthy controls. Our study increases knowledge of the PHEX gene mutation types and clinical phenotypes found in Chinese patients with XLH, which is important for understanding the genetic basis of XLH. The molecular diagnosis of a PHEX genetic mutation is of great importance for confirming the clinical diagnosis of XLH, conducting genetic counseling, and facilitating prenatal intervention, especially in the case of sporadic patients.

  2. Genetic Epidemiology of Glucose-6-Dehydrogenase Deficiency in the Arab World.

    PubMed

    Doss, C George Priya; Alasmar, Dima R; Bux, Reem I; Sneha, P; Bakhsh, Fadheela Dad; Al-Azwani, Iman; Bekay, Rajaa El; Zayed, Hatem

    2016-11-17

    A systematic search was implemented using four literature databases (PubMed, Embase, Science Direct and Web of Science) to capture all the causative mutations of Glucose-6-phosphate dehydrogenase (G6PD) deficiency (G6PDD) in the 22 Arab countries. Our search yielded 43 studies that captured 33 mutations (23 missense, one silent, two deletions, and seven intronic mutations), in 3,430 Arab patients with G6PDD. The 23 missense mutations were then subjected to phenotypic classification using in silico prediction tools, which were compared to the WHO pathogenicity scale as a reference. These in silico tools were tested for their predicting efficiency using rigorous statistical analyses. Of the 23 missense mutations, p.S188F, p.I48T, p.N126D, and p.V68M, were identified as the most common mutations among Arab populations, but were not unique to the Arab world, interestingly, our search strategy found four other mutations (p.N135T, p.S179N, p.R246L, and p.Q307P) that are unique to Arabs. These mutations were exposed to structural analysis and molecular dynamics simulation analysis (MDSA), which predicting these mutant forms as potentially affect the enzyme function. The combination of the MDSA, structural analysis, and in silico predictions and statistical tools we used will provide a platform for future prediction accuracy for the pathogenicity of genetic mutations.

  3. Novel germline PALB2 truncating mutations in African-American breast cancer patients

    PubMed Central

    Zheng, Yonglan; Zhang, Jing; Niu, Qun; Huo, Dezheng; Olopade, Olufunmilayo I.

    2011-01-01

    Background It has been demonstrated that PALB2 acts as a bridging molecule between the BRCA1 and BRCA2 proteins and is responsible for facilitating BRCA2-mediated DNA repair. Truncating mutations in the PALB2 gene have been reported to be enriched in Fanconi anemia and breast cancer patients in various populations. Methods We evaluated the contribution of PALB2 germline mutations in 279 African-American breast cancer patients including 29 patients with a strong family history, 29 patients with a moderate family history, 75 patients with a weak family history, and 146 non-familial or sporadic breast cancer cases. Results After direct sequencing of all the coding exons, exon/intron boundaries, 5′UTR and 3′UTR of PALB2, three (1.08%; 3 in 279) novel monoallelic truncating mutations were identified: c.758dupT (exon4), c.1479delC (exon4) and c.3048delT (exon 10); together with 50 sequence variants, 27 of which are novel. None of the truncating mutations were found in 262 controls from the same population. Conclusions PALB2 mutations are present in both familial and non-familial breast cancer among African-Americans. Rare PALB2 mutations account for a small but substantial proportion of breast cancer patients. PMID:21932393

  4. Growth Hormone Receptor Mutations Related to Individual Dwarfism

    PubMed Central

    Li, Charles; Zhang, Xiquan

    2018-01-01

    Growth hormone (GH) promotes body growth by binding with two GH receptors (GHRs) at the cell surface. GHRs interact with Janus kinase, signal transducers, and transcription activators to stimulate metabolic effects and insulin-like growth factor (IGF) synthesis. However, process dysfunctions in the GH–GHR–IGF-1 axis cause animal dwarfism. If, during the GH process, GHR is not successfully recognized and/or bound, or GHR fails to transmit the GH signal to IGF-1, the GH dysfunction occurs. The goal of this review was to focus on the GHR mutations that lead to failures in the GH–GHR–IGF-1 signal transaction process in the dwarf phenotype. Until now, more than 90 GHR mutations relevant to human short stature (Laron syndrome and idiopathic short stature), including deletions, missense, nonsense, frameshift, and splice site mutations, and four GHR defects associated with chicken dwarfism, have been described. Among the 93 identified mutations of human GHR, 68 occur extracellularly, 13 occur in GHR introns, 10 occur intracellularly, and two occur in the transmembrane. These mutations interfere with the interaction between GH and GHRs, GHR dimerization, downstream signaling, and the expression of GHR. These mutations cause aberrant functioning in the GH-GHR-IGF-1 axis, resulting in defects in the number and diameter of muscle fibers as well as bone development. PMID:29748515

  5. Human Splicing Finder: an online bioinformatics tool to predict splicing signals.

    PubMed

    Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

    2009-05-01

    Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-beta Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5' and 3' splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project.

  6. Human Splicing Finder: an online bioinformatics tool to predict splicing signals

    PubMed Central

    Desmet, François-Olivier; Hamroun, Dalil; Lalande, Marine; Collod-Béroud, Gwenaëlle; Claustres, Mireille; Béroud, Christophe

    2009-01-01

    Thousands of mutations are identified yearly. Although many directly affect protein expression, an increasing proportion of mutations is now believed to influence mRNA splicing. They mostly affect existing splice sites, but synonymous, non-synonymous or nonsense mutations can also create or disrupt splice sites or auxiliary cis-splicing sequences. To facilitate the analysis of the different mutations, we designed Human Splicing Finder (HSF), a tool to predict the effects of mutations on splicing signals or to identify splicing motifs in any human sequence. It contains all available matrices for auxiliary sequence prediction as well as new ones for binding sites of the 9G8 and Tra2-β Serine-Arginine proteins and the hnRNP A1 ribonucleoprotein. We also developed new Position Weight Matrices to assess the strength of 5′ and 3′ splice sites and branch points. We evaluated HSF efficiency using a set of 83 intronic and 35 exonic mutations known to result in splicing defects. We showed that the mutation effect was correctly predicted in almost all cases. HSF could thus represent a valuable resource for research, diagnostic and therapeutic (e.g. therapeutic exon skipping) purposes as well as for global studies, such as the GEN2PHEN European Project or the Human Variome Project. PMID:19339519

  7. Clonal hematopoiesis, with and without candidate driver mutations, is common in the elderly

    PubMed Central

    Zink, Florian; Stacey, Simon N.; Norddahl, Gudmundur L.; Frigge, Michael L.; Magnusson, Olafur T.; Jonsdottir, Ingileif; Thorgeirsson, Thorgeir E.; Sigurdsson, Asgeir; Gudjonsson, Sigurjon A.; Gudmundsson, Julius; Jonasson, Jon G.; Tryggvadottir, Laufey; Jonsson, Thorvaldur; Helgason, Agnar; Gylfason, Arnaldur; Sulem, Patrick; Rafnar, Thorunn; Thorsteinsdottir, Unnur; Gudbjartsson, Daniel F.; Masson, Gisli; Kong, Augustine

    2017-01-01

    Clonal hematopoiesis (CH) arises when a substantial proportion of mature blood cells is derived from a single dominant hematopoietic stem cell lineage. Somatic mutations in candidate driver (CD) genes are thought to be responsible for at least some cases of CH. Using whole-genome sequencing of 11 262 Icelanders, we found 1403 cases of CH by using barcodes of mosaic somatic mutations in peripheral blood, whether or not they have a mutation in a CD gene. We find that CH is very common in the elderly, trending toward inevitability. We show that somatic mutations in TET2, DNMT3A, ASXL1, and PPM1D are associated with CH at high significance. However, known CD mutations were evident in only a fraction of CH cases. Nevertheless, the highly prevalent CH we detect associates with increased mortality rates, risk for hematological malignancy, smoking behavior, telomere length, Y-chromosome loss, and other phenotypic characteristics. Modeling suggests some CH cases could arise in the absence of CD mutations as a result of neutral drift acting on a small population of active hematopoietic stem cells. Finally, we find a germline deletion in intron 3 of the telomerase reverse transcriptase (TERT) gene that predisposes to CH (rs34002450; P = 7.4 × 10−12; odds ratio, 1.37). PMID:28483762

  8. A novel missense mutation of NDP in a Chinese family with X-linked familial exudative vitreoretinopathy.

    PubMed

    Liu, Hong Yan; Huang, Jia; Wang, Rui Li; Wang, Yue; Guo, Liang Jie; Li, Tao; Wu, Dong; Wang, Hong Dan; Guo, Qian Nan; Dong, Dao Quan

    2016-11-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary ocular disorder characterized by a failure of peripheral retinal vascularization. In this report, we describe a novel missense mutation of the Norrie disease gene (NDP) in a Chinese family with X-linked FEVR. Ophthalmologic evaluation was performed on four male patients and seven unaffected individuals after informed consent was obtained. Venous blood was collected from the 11 members of this family, and genomic DNA was extracted using standard methods. The coding exons 2 and 3 and their corresponding exon-intron junctions of NDP were amplified by polymerase chain reaction and then subjected to direct DNA sequencing. A novel missense mutation (c.310A>C) in exon 3, leading to a lysine-to-glutamine substitution at position 104 (p.Lys104Gln), was identified in all four patients with X-linked FEVR. Three unaffected female individuals (III2, IV3, and IV11) were found to be carriers of the mutation. This mutation was not detected in other unaffected individuals. The mutation c.310A>C (p.Lys104Gln) in exon 3 of NDP is associated with FEVR in the studied family. This result further enriches the mutation spectrum of FEVR. Copyright © 2016. Published by Elsevier Taiwan LLC.

  9. Low incidence of SCN1A genetic mutation in patients with hemiconvulsion-hemiplegia-epilepsy syndrome.

    PubMed

    Kim, Dong Wook; Lim, Byung Chan; Kim, Ki Joong; Chae, Jong Hee; Lee, Ran; Lee, Sang Kun

    2013-10-01

    Genetic mutations in SCN1A account for more than two-thirds of patients with classic Dravet syndrome. A role for SCN1A genetic mutations in the development of hemiconvulsion-hemiplegia-epilepsy (HHE) syndrome was recently suggested based on the observation that HHE syndrome and classic Dravet syndrome share many clinical features. We previously identified a 2 bp-deletion mutation in SCN1A in a Dravet patient, and we found out the patient also had HHE syndrome upon clinical re-evaluation. We subsequently screened 10 additional HHE patients for SCN1A. Among the 11 patients who were diagnosed with HHE syndrome, six patients had no other etiology with the exception of prolonged febrile illness, therefore classified as idiopathic HHE syndrome, whereas five patients were classified as symptomatic HHE syndrome. Direct sequencing of all coding exons and flanking intronic sequences of the SCN1A gene was performed, but we failed to identify additional mutations in 10 patients. The patient with SCN1A mutation had the earliest onset of febrile convulsion and hemiparesis. Our study suggests that SCN1A genetic mutation is only a rare predisposing cause of HHE syndrome. Copyright © 2013 Elsevier B.V. All rights reserved.

  10. Serine Protease Inhibitor Kazal Type 1 (SPINK1) c.194+2T > C Mutation May Predict Long-term Outcome of Endoscopic Treatments in Idiopathic Chronic Pancreatitis.

    PubMed

    Sun, Chang; Liu, Mu-Yun; Liu, Xiao-Gang; Hu, Liang-Hao; Xia, Tian; Liao, Zhuan; Li, Zhao-Shen

    2015-11-01

    Endoscopic interventional is a commonly used treatment method for idiopathic chronic pancreatitis. Serine protease inhibitor Kazal type 1 (SPINK1) 194+2T>C mutation is most frequently observed in Chinese pancreatitis patients and influences the clinical course of idiopathic chronic pancreatitis patients. We conducted this study to determine the impacts of this mutation on the outcome of endoscopic treatments.In this study, we enrolled 423 patients. Among them, 101 idiopathic chronic pancreatitis patients without other relevant mutations had a successful endoscopic procedure and completed follow-up. Clinical characteristics including Izbicki pain score, exocrine and endocrine function, were evaluated. Genetic sequencing was conducted to detect SPINK1 194+2T>C mutations.The c.194+2T>C mutation was found in 58 (57.43%) patients. Factors relevant to pain relief are c.194+2T>C mutation (P = 0.011), severe pain before treatment (P = 0.005), and necessary subsequent endoscopic treatments (P < 0.001). More patients with the intronic mutation had deteriorated endocrine function (P = 0.001) relative to those patients without the mutation.Patients carrying the c.194+2T>C mutation were less likely to achieve pain relief through endoscopic treatments. They also have a higher risk of endocrine function deterioration. SPINK1 c.194+2T>C mutation may be applied as a pretreatment predictor in idiopathic chronic pancreatitis patients.

  11. Paternal GNAS Mutations Lead to Severe Intrauterine Growth Retardation (IUGR) and Provide Evidence for a Role of XLαs in Fetal Development

    PubMed Central

    Richard, Nicolas; Molin, Arnaud; Coudray, Nadia; Rault-Guillaume, Pauline; Jüppner, Harald

    2013-01-01

    Context: Heterozygous GNAS inactivating mutations cause pseudohypoparathyroidism type Ia (PHP-Ia) when maternally inherited and pseudopseudohypoparathyroidism (PPHP)/progressive osseous heteroplasia (POH) when paternally inherited. Recent studies have suggested that mutations on the paternal, but not the maternal, GNAS allele could be associated with intrauterine growth retardation (IUGR) and thus small size for gestational age. Objectives: The aim of the study was to confirm and expand these findings in a large number of patients presenting with either PHP-Ia or PPHP/POH. Patients and Methods: We collected birth parameters (ie, gestational age, weight, length, and head circumference) of patients with either PHP-Ia (n = 29) or PPHP/POH (n = 26) with verified GNAS mutations. The parental allele carrying the mutation was assessed by investigating the parents or, when a de novo mutation was identified, through informative intragenic polymorphisms. Results: Heterozygous GNAS mutations on either parental allele were associated with IUGR. However, when these mutations are located on the paternal GNAS allele, IUGR was considerably more pronounced than with mutations on the maternal allele. Moreover, birth weights were lower with paternal GNAS mutations affecting exons 2–13 than with exon 1/intron 1 mutations. Conclusions: These data indicate that a paternally derived GNAS transcript, possibly XLαs, is required for normal fetal growth and development and that this transcript affects placental functions. Thus, similar to other imprinted genes, GNAS controls growth and/or fetal development. PMID:23884777

  12. Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

    PubMed Central

    Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

    2015-01-01

    Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

  13. An Unusual Splice Defect in the Mitofusin 2 Gene (MFN2) Is Associated with Degenerative Axonopathy in Tyrolean Grey Cattle

    PubMed Central

    Drögemüller, Cord; Reichart, Ursula; Seuberlich, Torsten; Oevermann, Anna; Baumgartner, Martin; Kühni Boghenbor, Kathrin; Stoffel, Michael H.; Syring, Claudia; Meylan, Mireille; Müller, Simone; Müller, Mathias; Gredler, Birgit

    2011-01-01

    Tyrolean Grey cattle represent a local breed with a population size of ∼5000 registered cows. In 2003, a previously unknown neurological disorder was recognized in Tyrolean Grey cattle. The clinical signs of the disorder are similar to those of bovine progressive degenerative myeloencephalopathy (weaver syndrome) in Brown Swiss cattle but occur much earlier in life. The neuropathological investigation of an affected calf showed axonal degeneration in the central nervous system (CNS) and femoral nerve. The pedigrees of the affected calves suggested a monogenic autosomal recessive inheritance. We localized the responsible mutation to a 1.9 Mb interval on chromosome 16 by genome-wide association and haplotype mapping. The MFN2 gene located in this interval encodes mitofusin 2, a mitochondrial membrane protein. A heritable human axonal neuropathy, Charcot-Marie-Tooth disease-2A2 (CMT2A2), is caused by MFN2 mutations. Therefore, we considered MFN2 a positional and functional candidate gene and performed mutation analysis in affected and control Tyrolean Grey cattle. We did not find any non-synonymous variants. However, we identified a perfectly associated silent SNP in the coding region of exon 20 of the MFN2 gene. This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript. Thus we have identified a highly unusual splicing defect, where an exonic single base exchange leads to the retention of the preceding intron. This splicing defect represents a potential explanation for the observed degenerative axonopathy. Marker assisted selection can now be used to eliminate degenerative axonopathy from Tyrolean Grey cattle. PMID:21526202

  14. An unusual splice defect in the mitofusin 2 gene (MFN2) is associated with degenerative axonopathy in Tyrolean Grey cattle.

    PubMed

    Drögemüller, Cord; Reichart, Ursula; Seuberlich, Torsten; Oevermann, Anna; Baumgartner, Martin; Kühni Boghenbor, Kathrin; Stoffel, Michael H; Syring, Claudia; Meylan, Mireille; Müller, Simone; Müller, Mathias; Gredler, Birgit; Sölkner, Johann; Leeb, Tosso

    2011-04-15

    Tyrolean Grey cattle represent a local breed with a population size of ∼5000 registered cows. In 2003, a previously unknown neurological disorder was recognized in Tyrolean Grey cattle. The clinical signs of the disorder are similar to those of bovine progressive degenerative myeloencephalopathy (weaver syndrome) in Brown Swiss cattle but occur much earlier in life. The neuropathological investigation of an affected calf showed axonal degeneration in the central nervous system (CNS) and femoral nerve. The pedigrees of the affected calves suggested a monogenic autosomal recessive inheritance. We localized the responsible mutation to a 1.9 Mb interval on chromosome 16 by genome-wide association and haplotype mapping. The MFN2 gene located in this interval encodes mitofusin 2, a mitochondrial membrane protein. A heritable human axonal neuropathy, Charcot-Marie-Tooth disease-2A2 (CMT2A2), is caused by MFN2 mutations. Therefore, we considered MFN2 a positional and functional candidate gene and performed mutation analysis in affected and control Tyrolean Grey cattle. We did not find any non-synonymous variants. However, we identified a perfectly associated silent SNP in the coding region of exon 20 of the MFN2 gene. This SNP is located within a putative exonic splice enhancer (ESE) and the variant allele leads to partial retention of the entire intron 19 and a premature stop codon in the aberrant MFN2 transcript. Thus we have identified a highly unusual splicing defect, where an exonic single base exchange leads to the retention of the preceding intron. This splicing defect represents a potential explanation for the observed degenerative axonopathy. Marker assisted selection can now be used to eliminate degenerative axonopathy from Tyrolean Grey cattle.

  15. An RNA internal loop acts as a hinge to facilitate ribozyme folding and catalysis.

    PubMed Central

    Szewczak, A A; Cech, T R

    1997-01-01

    RNA molecules commonly consist of helical regions separated by internal loops, and in many cases these internal loops have been found to assume stable structures. We have examined the function and dynamics of an internal loop, J5/5a, that joins the two halves of the P4-P6 domain of the Tetrahymena self-splicing group I intron. P4-P6 RNAs with mutations in the J5/5a region showed nondenaturing gel electrophoretic mobilities and levels of Fe(II)-EDTA cleavage protection intermediate between those of wild-type RNA and a mutant incapable of folding into the native P4-P6 tertiary structure. Mutants with the least structured J5/5a loops behaved the most like wild-type P4-P6, and required smaller amounts of Mg2+ to rescue folding. The activity of reconstituted introns containing mutant P4-P6 RNAs correlated similarly with the nature of the J5/5a mutation. Our results suggest that, in solution, the P4-P6 RNA is in a two-state equilibrium between folded and unfolded states. We conclude that this internal loop mainly acts as a flexible hinge, allowing the coaxially stacked helical regions on either side of it to interact via specific tertiary contacts. To a lesser extent, the specific bases within the loop contribute to folding. Furthermore, it is crucial that the junction remain unstructured in the unfolded state. These conclusions cannot be derived from a simple examination of the P4-P6 crystal structure (Cate JH et al., 1996, Science 273:1678-1685), showing once again that structure determination must be supplemented with mutational and thermodynamic analysis to provide a complete picture of a folded macromolecule. PMID:9257643

  16. Molecular population genetics of the melanic plumage polymorphism in Arctic skuas (Stercorarius parasiticus): evidence for divergent selection on plumage colour.

    PubMed

    Janssen, Kirstin; Mundy, Nicholas I

    2013-09-01

    The Arctic skua (Stercorarius parasiticus) is a classic example of an avian plumage polymorphism, with variation in melanin-based ventral plumage coloration defining pale, intermediate and dark morphs in adults of both sexes. However, despite several decades of field research, there is an incomplete understanding of how the polymorphism in ventral plumage colour is maintained and the selective forces involved. Here, we investigate selection on a locus (MC1R) that is strongly associated with plumage colour variation in Arctic skuas using patterns of nucleotide variation and comparison to neutral loci (nuclear introns and mtDNA). We find that three linked nonsynonymous mutations in MC1R, including the single mutation described previously, are associated with plumage colour in the Arctic skua. The position of nonsynonymous mutations on a MC1R haplotype network implies that divergent selection drove the initial evolution of the colour morphs. Comparisons of F(ST)s of MC1R vs. nuclear introns among five skua populations differing in proportion of dark morphs along an approximate north-south cline reveal a signature of divergent selection on MC1R. In contrast, we find limited evidence for balancing selection on MC1R within populations, although the power is low. Our results provide strong evidence for both past and ongoing selection on MC1R, and, by implication, plumage colour in Arctic skuas. The results suggest that a fruitful avenue for future ecological studies will be analysis of selection on morphs in colonies at the extremes along the morph ratio cline. © 2013 John Wiley & Sons Ltd.

  17. [A novel M142T mutation in the B glycosyltransferase gene associated with B3 variant in Chinese].

    PubMed

    Xu, Xian-guo; Hong, Xiao-zhen; Liu, Ying; Zhu, Fa-ming; Lv, Hang-jun; Yan, Li-xing

    2009-06-01

    To investigate the molecular genetic basis of the B3 variant of ABO blood group system with mixed-field hemagglutination in Chinese. Serological techniques were performed to characterize the erythrocyte phenotype of two discrepant samples. A sequential agglutination method and 13 short tandem repeat (STR) loci were tested to exclude the possibility of exogenous or endogenous DNA chimera. Mutations in exons 6 and 7, including partial intron of the ABO gene, were screened by polymerase chain reaction and DNA sequencing. Haplotypes of the two individuals were also analyzed by sequencing. A mixed-field hemagglutination of RBCs with anti-B and anti-AB antibodies was detected in the two unrelated individuals. Exogenous ABO-incompatible RBC transfusion and endogenous genetic chimera were excluded by sequential agglutination method and STR. The ABO phenotypes of the two individuals were classified as A1B3 according to the ABO subgroup definition. The sequence region from intron 5 to 3'-UTR of the B allele was identical to that of ABO*B101 allele, except for a T to C substitution at nucleotide position 425 in exon 7. This substitution resulted in an amino acid change of M142T in the B glycosyltransferase. A novel B allele with 425T>C substitution resulting in B3 subgroup was identified in two Chinese individuals.

  18. Cloning and characterization of CLCN5, the human kidney chloride channel gene implicated in Dent disease (an X-linked hereditary nephrolithiasis).

    PubMed

    Fisher, S E; van Bakel, I; Lloyd, S E; Pearce, S H; Thakker, R V; Craig, I W

    1995-10-10

    Dent disease, an X-linked familial renal tubular disorder, is a form of Fanconi syndrome associated with proteinuria, hypercalciuria, nephrocalcinosis, kidney stones, and eventual renal failure. We have previously used positional cloning to identify the 3' part of a novel kidney-specific gene (initially termed hClC-K2, but now referred to as CLCN5), which is deleted in patients from one pedigree segregating Dent disease. Mutations that disrupt this gene have been identified in other patients with this disorder. Here we describe the isolation and characterization of the complete open reading frame of the human CLCN5 gene, which is predicted to encode a protein of 746 amino acids, with significant homology to all known members of the ClC family of voltage-gated chloride channels. CLCN5 belongs to a distinct branch of this family, which also includes the recently identified genes CLCN3 and CLCN4. We have shown that the coding region of CLCN5 is organized into 12 exons, spanning 25-30 kb of genomic DNA, and have determined the sequence of each exon-intron boundary. The elucidation of the coding sequence and exon-intron organization of CLCN5 will both expedite the evaluation of structure/function relationships of these ion channels and facilitate the screening of other patients with renal tubular dysfunction for mutations at this locus.

  19. New COL6A6 variant detected by whole-exome sequencing is linked to break points in intron 4 and 3′-UTR, deleting exon 5 of RHO, and causing adRP

    PubMed Central

    de Sousa Dias, Miguel; Hernan, Imma; Delás, Barbara; Pascual, Beatriz; Borràs, Emma; Gamundi, Maria José; Mañé, Begoña; Fernández-San José, Patricia; Ayuso, Carmen

    2015-01-01

    Purpose This study aimed to test a newly devised cost-effective multiplex PCR assay for the molecular diagnosis of autosomal dominant retinitis pigmentosa (adRP), as well as the use of whole-exome sequencing (WES) to detect disease-causing mutations in adRP. Methods Genomic DNA was extracted from peripheral blood lymphocytes of index patients with adRP and their affected and unaffected family members. We used a newly devised multiplex PCR assay capable of amplifying the genetic loci of RHO, PRPH2, RP1, PRPF3, PRPF8, PRPF31, IMPDH1, NRL, CRX, KLHL7, and NR2E3 to molecularly diagnose 18 index patients with adRP. We also performed WES in affected and unaffected members of four families with adRP in whom a disease-causing mutation was previously not found. Results We identified five previously reported mutations (p.Arg677X in the RP1 gene, p.Asp133Val and p.Arg195Leu in the PRPH2 gene, and p.Pro171Leu and p.Pro215Leu in the RHO gene) and one novel mutation (p.Val345Gly in the RHO gene) representing 33% detection of causative mutations in our adRP cohort. Comparative WES analysis showed a new variant (p.Gly103Arg in the COL6A6 gene) that segregated with the disease in one family with adRP. As this variant was linked with the RHO locus, we sequenced the complete RHO gene, which revealed a deletion in intron 4 that encompassed all of exon 5 and 28 bp of the 3′-untranslated region (UTR). Conclusions The novel multiplex PCR assay with next-generation sequencing (NGS) proved effective for detecting most of the adRP-causing mutations. A WES approach led to identification of a deletion in RHO through detection of a new linked variant in COL6A6. No pathogenic variants were identified in the remaining three families. Moreover, NGS and WES were inefficient for detecting the complete deletion of exon 5 in the RHO gene in one family with adRP. Carriers of this deletion showed variable clinical status, and two of these carriers had not previously been diagnosed with RP. PMID:26321861

  20. Disruption of a long-range cis-acting regulator for Shh causes preaxial polydactyly

    PubMed Central

    Lettice, Laura A.; Horikoshi, Taizo; Heaney, Simon J. H.; van Baren, Marijke J.; van der Linde, Herma C.; Breedveld, Guido J.; Joosse, Marijke; Akarsu, Nurten; Oostra, Ben A.; Endo, Naoto; Shibata, Minoru; Suzuki, Mikio; Takahashi, Eiichi; Shinka, Toshikatsu; Nakahori, Yutaka; Ayusawa, Dai; Nakabayashi, Kazuhiko; Scherer, Stephen W.; Heutink, Peter; Hill, Robert E.; Noji, Sumihare

    2002-01-01

    Preaxial polydactyly (PPD) is a common limb malformation in human. A number of polydactylous mouse mutants indicate that misexpression of Shh is a common requirement for generating extra digits. Here we identify a translocation breakpoint in a PPD patient and a transgenic insertion site in the polydactylous mouse mutant sasquatch (Ssq). The genetic lesions in both lie within the same respective intron of the LMBR1/Lmbr1 gene, which resides ≈1 Mb away from Shh. Genetic analysis of Ssq reveals that the Lmbr1 gene is incidental to the phenotype and that the mutation directly interrupts a cis-acting regulator of Shh. This regulator is most likely the target for generating PPD mutations in human. PMID:12032320

  1. Low-abundance HIV drug-resistant viral variants in treatment-experienced persons correlate with historical antiretroviral use.

    PubMed

    Le, Thuy; Chiarella, Jennifer; Simen, Birgitte B; Hanczaruk, Bozena; Egholm, Michael; Landry, Marie L; Dieckhaus, Kevin; Rosen, Marc I; Kozal, Michael J

    2009-06-29

    It is largely unknown how frequently low-abundance HIV drug-resistant variants at levels under limit of detection of conventional genotyping (<20% of quasi-species) are present in antiretroviral-experienced persons experiencing virologic failure. Further, the clinical implications of low-abundance drug-resistant variants at time of virologic failure are unknown. Plasma samples from 22 antiretroviral-experienced subjects collected at time of virologic failure (viral load 1380 to 304,000 copies/mL) were obtained from a specimen bank (from 2004-2007). The prevalence and profile of drug-resistant mutations were determined using Sanger sequencing and ultra-deep pyrosequencing. Genotypes were interpreted using Stanford HIV database algorithm. Antiretroviral treatment histories were obtained by chart review and correlated with drug-resistant mutations. Low-abundance drug-resistant mutations were detected in all 22 subjects by deep sequencing and only in 3 subjects by Sanger sequencing. In total they accounted for 90 of 247 mutations (36%) detected by deep sequencing; the majority of these (95%) were not detected by standard genotyping. A mean of 4 additional mutations per subject were detected by deep sequencing (p<0.0001, 95%CI: 2.85-5.53). The additional low-abundance drug-resistant mutations increased a subject's genotypic resistance to one or more antiretrovirals in 17 of 22 subjects (77%). When correlated with subjects' antiretroviral treatment histories, the additional low-abundance drug-resistant mutations correlated with the failing antiretroviral drugs in 21% subjects and correlated with historical antiretroviral use in 79% subjects (OR, 13.73; 95% CI, 2.5-74.3, p = 0.0016). Low-abundance HIV drug-resistant mutations in antiretroviral-experienced subjects at time of virologic failure can increase a subject's overall burden of resistance, yet commonly go unrecognized by conventional genotyping. The majority of unrecognized resistant mutations correlate with historical antiretroviral use. Ultra-deep sequencing can provide important historical resistance information for clinicians when planning subsequent antiretroviral regimens for highly treatment-experienced patients, particularly when their prior treatment histories and longitudinal genotypes are not available.

  2. Low-Abundance HIV Drug-Resistant Viral Variants in Treatment-Experienced Persons Correlate with Historical Antiretroviral Use

    PubMed Central

    Le, Thuy; Chiarella, Jennifer; Simen, Birgitte B.; Hanczaruk, Bozena; Egholm, Michael; Landry, Marie L.; Dieckhaus, Kevin; Rosen, Marc I.; Kozal, Michael J.

    2009-01-01

    Background It is largely unknown how frequently low-abundance HIV drug-resistant variants at levels under limit of detection of conventional genotyping (<20% of quasi-species) are present in antiretroviral-experienced persons experiencing virologic failure. Further, the clinical implications of low-abundance drug-resistant variants at time of virologic failure are unknown. Methodology/Principal Findings Plasma samples from 22 antiretroviral-experienced subjects collected at time of virologic failure (viral load 1380 to 304,000 copies/mL) were obtained from a specimen bank (from 2004–2007). The prevalence and profile of drug-resistant mutations were determined using Sanger sequencing and ultra-deep pyrosequencing. Genotypes were interpreted using Stanford HIV database algorithm. Antiretroviral treatment histories were obtained by chart review and correlated with drug-resistant mutations. Low-abundance drug-resistant mutations were detected in all 22 subjects by deep sequencing and only in 3 subjects by Sanger sequencing. In total they accounted for 90 of 247 mutations (36%) detected by deep sequencing; the majority of these (95%) were not detected by standard genotyping. A mean of 4 additional mutations per subject were detected by deep sequencing (p<0.0001, 95%CI: 2.85–5.53). The additional low-abundance drug-resistant mutations increased a subject's genotypic resistance to one or more antiretrovirals in 17 of 22 subjects (77%). When correlated with subjects' antiretroviral treatment histories, the additional low-abundance drug-resistant mutations correlated with the failing antiretroviral drugs in 21% subjects and correlated with historical antiretroviral use in 79% subjects (OR, 13.73; 95% CI, 2.5–74.3, p = 0.0016). Conclusions/Significance Low-abundance HIV drug-resistant mutations in antiretroviral-experienced subjects at time of virologic failure can increase a subject's overall burden of resistance, yet commonly go unrecognized by conventional genotyping. The majority of unrecognized resistant mutations correlate with historical antiretroviral use. Ultra-deep sequencing can provide important historical resistance information for clinicians when planning subsequent antiretroviral regimens for highly treatment-experienced patients, particularly when their prior treatment histories and longitudinal genotypes are not available. PMID:19562031

  3. Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster.

    PubMed

    Robertson, Hugh M; Warr, Coral G; Carlson, John R

    2003-11-25

    The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods.

  4. Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster

    PubMed Central

    Robertson, Hugh M.; Warr, Coral G.; Carlson, John R.

    2003-01-01

    The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods. PMID:14608037

  5. Mild and severe muscular dystrophy caused by a single {gamma}-sarcoglycan mutation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McNally, E.M.; Boennemann, C.G.; Lidov, H.G.W.

    1996-11-01

    Autosomal recessive muscular dystrophy is genetically heterogeneous. One form of this disorder, limb-girdle muscular dystrophy type 2C (LGMD 2C), is prevalent in northern Africa and has been shown to be associated with a single mutation in the gene encoding the dystrophin-associated protein {gamma}-sarcoglycan. The previous mutation analysis of {gamma}-sarcoglycan required the availability of muscle biopsies. To establish a mutation assay for genomic DNA, the intron-exon structure of the {gamma}-sarcoglycan gene was determined, and primers were designed to amplify each of the exons encoding {gamma}-sarcoglycan. We studied a group of Brazilian muscular dystrophy patients for mutations in the {gamma}-sarcoglycan gene. Thesemore » patients were selected on the basis of autosomal inheritance and/or the presence of normal dystrophin and/or deficiency of {alpha}-sarcoglycan immunostaining. Four of 19 patients surveyed had a single, homozygous mutation in the {gamma}-sarcoglycan gene. The mutation identified in these patients, all of African-Brazilian descent, is identical to that seen in the North African population, suggesting that even patients of remote African descent may carry this mutation. The phenotype in these patients varied considerably. Of four families with an identical mutation, three have a severe Duchenne-like muscular dystrophy. However, one family has much milder symptoms, suggesting that other loci may be present that modify the severity of the clinical course resulting from {gamma}-sarcoglycan gene mutations. 19 refs., 5 figs., 3 tabs.« less

  6. Mutation screening of the HGD gene identifies a novel alkaptonuria mutation with significant founder effect and high prevalence.

    PubMed

    Sakthivel, Srinivasan; Zatkova, Andrea; Nemethova, Martina; Surovy, Milan; Kadasi, Ludevit; Saravanan, Madurai P

    2014-05-01

    Alkaptonuria (AKU) is an autosomal recessive disorder; caused by the mutations in the homogentisate 1, 2-dioxygenase (HGD) gene located on Chromosome 3q13.33. AKU is a rare disorder with an incidence of 1: 250,000 to 1: 1,000,000, but Slovakia and the Dominican Republic have a relatively higher incidence of 1: 19,000. Our study focused on studying the frequency of AKU and identification of HGD gene mutations in nomads. HGD gene sequencing was used to identify the mutations in alkaptonurics. For the past four years, from subjects suspected to be clinically affected, we found 16 positive cases among a randomly selected cohort of 41 Indian nomads (Narikuravar) settled in the specific area of Tamil Nadu, India. HGD gene mutation analysis showed that 11 of these patients carry the same homozygous splicing mutation c.87 + 1G > A; in five cases, this mutation was found to be heterozygous, while the second AKU-causing mutation was not identified in these patients. This result indicates that the founder effect and high degree of consanguineous marriages have contributed to AKU among nomads. Eleven positive samples were homozygous for a novel mutation c.87 + 1G > A, that abolishes an intron 2 donor splice site and most likely causes skipping of exon 2. The prevalence of AKU observed earlier seems to be highly increased in people of nomadic origin. © 2014 John Wiley & Sons Ltd/University College London.

  7. Target gene analyses of 39 amelogenesis imperfecta kindreds

    PubMed Central

    Chan, Hui-Chen; Estrella, Ninna M. R. P.; Milkovich, Rachel N.; Kim, Jung-Wook; Simmer, James P.; Hu, Jan C-C.

    2012-01-01

    Previously, mutational analyses identified six disease-causing mutations in 24 amelogenesis imperfecta (AI) kindreds. We have since expanded the number of AI kindreds to 39, and performed mutation analyses covering the coding exons and adjoining intron sequences for the six proven AI candidate genes [amelogenin (AMELX), enamelin (ENAM), family with sequence similarity 83, member H (FAM83H), WD repeat containing domain 72 (WDR72), enamelysin (MMP20), and kallikrein-related peptidase 4 (KLK4)] and for ameloblastin (AMBN) (a suspected candidate gene). All four of the X-linked AI families (100%) had disease-causing mutations in AMELX, suggesting that AMELX is the only gene involved in the aetiology of X-linked AI. Eighteen families showed an autosomal-dominant pattern of inheritance. Disease-causing mutations were identified in 12 (67%): eight in FAM83H, and four in ENAM. No FAM83H coding-region or splice-junction mutations were identified in three probands with autosomal-dominant hypocalcification AI (ADHCAI), suggesting that a second gene may contribute to the aetiology of ADHCAI. Six families showed an autosomal-recessive pattern of inheritance, and disease-causing mutations were identified in three (50%): two in MMP20, and one in WDR72. No disease-causing mutations were found in 11 families with only one affected member. We conclude that mutation analyses of the current candidate genes for AI have about a 50% chance of identifying the disease-causing mutation in a given kindred. PMID:22243262

  8. A novel mutation in homeobox DNA binding domain of HOXC13 gene underlies pure hair and nail ectodermal dysplasia (ECTD9) in a Pakistani family.

    PubMed

    Khan, Anwar Kamal; Muhammad, Noor; Aziz, Abdul; Khan, Sher Alam; Shah, Khadim; Nasir, Abdul; Khan, Muzammil Ahmad; Khan, Saadullah

    2017-04-12

    Pure hair and nail ectodermal dysplasia (PHNED) is a congenital disorder of hair abnormalities and nail dysplasia. Both autosomal recessive and dominant inheritance fashion of PHNED occurs. In literature, to date, five different forms of PHNED have been reported at molecular level, having three genes known and two loci with no gene yet. In this study, a four generations consanguineous family of Pakistani origin with autosomal recessive PHNED was investigated. Affected members exhibited PHNED phenotypes with involvement of complete hair loss and nail dysplasia. To screen for mutation in the genes (HOXC13, KRT74, KRT85), its coding exons and exons-intron boundaries were sequenced. The 3D models of normal and mutated HOXC13 were predicted by using homology modeling. Through investigating the family to known loci, the family was mapped to ectodermal dysplasia 9 (ECTD9) loci with genetic address of 12q13.13. Mutation screening revealed a novel missense mutation (c.929A > C; p.Asn310Thr) in homeobox DNA binding domain of HOXC13 gene in affected members of the family. Due to mutation, loss of hydrogen bonding and difference in potential energy occurs, which may resulting in alteration of protein function. This is the first mutation reported in homeodomain, while 5 th mutation reported in HOXC13 gene causing PHNED.

  9. High prevalence of the point mutation in exon 6 of the xeroderma pigmentosum group A-complementing (XPAC) gene in xeroderma pigmentosum group A patients in Tunisia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nishigori, Chikako; Imamura, Sadao; Yagi, Takashi

    1993-11-01

    Xeroderma pigmentosum (XP) patients in Tunisia who belong to the genetic complementation group A (XPA) have milder skin symptoms than do Japanese XPA patients. Such difference in the clinical features might be caused by the difference in the site of mutation in the XP A-complementing (XPAC) gene. The purpose of this study is to identify the genetic alterations in the XPAC gene in the Tunisian XPA patients and to investigate the relationship between the clinical symptoms and the genetic alterations. Three sites of mutation in the XPAC gene have been identified in the Japanese XPA patients, and about 85% ofmore » them have a G [yields] C point mutation at the splicing acceptor site of intron 3. The authors found that six (86%) of seven Tunisian XPA patients had a nonsense mutation in codon 228 in exon 6, because of a CGA [yields] TGA point mutation, which can be detected by the HphI RFLP. This type of mutation is the same as those found in two Japanese XPA patients with mild clinical RFLP. Milder skin symptoms in the XPA patients in Tunisia than in those in Japan, despite mostly sunny weather and the unsatisfactory sun protection in Tunisia, should be due to the difference in the mutation site. 11 refs., 2 figs., 2 tabs.« less

  10. Quantification of sequence exchange events between PMS2 and PMS2CL provides a basis for improved mutation scanning of Lynch syndrome patients.

    PubMed

    van der Klift, Heleen M; Tops, Carli M J; Bik, Elsa C; Boogaard, Merel W; Borgstein, Anne-Marijke; Hansson, Kerstin B M; Ausems, Margreet G E M; Gomez Garcia, Encarna; Green, Andrew; Hes, Frederik J; Izatt, Louise; van Hest, Liselotte P; Alonso, Angel M; Vriends, Annette H J T; Wagner, Anja; van Zelst-Stams, Wendy A G; Vasen, Hans F A; Morreau, Hans; Devilee, Peter; Wijnen, Juul T

    2010-05-01

    Heterozygous mutations in PMS2 are involved in Lynch syndrome, whereas biallelic mutations are found in Constitutional mismatch repair-deficiency syndrome patients. Mutation detection is complicated by the occurrence of sequence exchange events between the duplicated regions of PMS2 and PMS2CL. We investigated the frequency of such events with a nonspecific polymerase chain reaction (PCR) strategy, co-amplifying both PMS2 and PMS2CL sequences. This allowed us to score ratios between gene and pseudogene-specific nucleotides at 29 PSV sites from exon 11 to the end of the gene. We found sequence transfer at all investigated PSVs from intron 12 to the 3' end of the gene in 4 to 52% of DNA samples. Overall, sequence exchange between PMS2 and PMS2CL was observed in 69% (83/120) of individuals. We demonstrate that mutation scanning with PMS2-specific PCR primers and MLPA probes, designed on PSVs, in the 3' duplicated region is unreliable, and present an RNA-based mutation detection strategy to improve reliability. Using this strategy, we found 19 different putative pathogenic PMS2 mutations. Four of these (21%) are lying in the region with frequent sequence transfer and are missed or called incorrectly as homozygous with several PSV-based mutation detection methods. (c) 2010 Wiley-Liss, Inc.

  11. Emerging roles of the spliceosomal machinery in myelodysplastic syndromes and other hematological disorders.

    PubMed

    Visconte, V; Makishima, H; Maciejewski, J P; Tiu, R V

    2012-12-01

    In humans, the majority of all protein-coding transcripts contain introns that are removed by mRNA splicing carried out by spliceosomes. Mutations in the spliceosome machinery have recently been identified using whole-exome/genome technologies in myelodysplastic syndromes (MDS) and in other hematological disorders. Alterations in splicing factor 3 subunit b1 (SF3b1) were the first spliceosomal mutations described, immediately followed by identification of other splicing factor mutations, including U2 small nuclear RNA auxillary factor 1 (U2AF1) and serine arginine-rich splicing factor 2 (SRSF2). SF3b1/U2AF1/SRSF2 mutations occur at varying frequencies in different disease subtypes, each contributing to differences in survival outcomes. However, the exact functional consequences of these spliceosomal mutations in the pathogenesis of MDS and other hematological malignancies remain largely unknown and subject to intense investigation. For SF3b1, a gain of function mutation may offer the promise of new targeted therapies for diseases that carry this molecular abnormality that can potentially lead to cure. This review aims to provide a comprehensive overview of the emerging role of the spliceosome machinery in the biology of MDS/hematological disorders with an emphasis on the functional consequences of mutations, their clinical significance, and perspectives on how they may influence our understanding and management of diseases affected by these mutations.

  12. Emerging roles of the spliceosomal machinery in myelodysplastic syndromes and other hematologic disorders

    PubMed Central

    Visconte, V; Makishima, H; Maciejewski, JP; Tiu, RV

    2013-01-01

    In humans, the majority of all protein-coding transcripts contain introns that are removed by mRNA splicing carried out by spliceosomes. Mutations in the spliceosome machinery have recently been identified using whole exome/genome technologies in myelodysplastic syndromes (MDS) and in other hematologic disorders. Alterations in Splicing Factor 3 Subunit b1 (SF3b1) were the first spliceosomal mutations described, immediately followed by identification of other splicing factor mutations, including U2 Small Nuclear RNA Auxillary Factor 1 (U2AF1) and Serine Arginine Rich Splicing Factor 2 (SRSF2). SF3b1/U2AF1/SRSF2 mutations occur at varying frequencies in different disease subtypes, each contributing to differences in survival outcomes. However, the exact functional consequences of these spliceosomal mutations in the pathogenesis of MDS and other hematologic malignancies remain largely unknown and subject to intense investigation. For SF3b1, a gain of function mutation may offer the promise of new targeted therapies for diseases that carry this molecular abnormality that can potentially lead to cure. This review aims to provide a comprehensive overview of the emerging role of the spliceosome machinery in the biology of MDS/hematologic disorders with an emphasis on the functional consequences of mutations, their clinical significance, and perspectives on how they may influence our understanding and management of diseases affected by these mutations. PMID:22678168

  13. Novel inborn error of folate metabolism: identification by exome capture and sequencing of mutations in the MTHFD1 gene in a single proband.

    PubMed

    Watkins, David; Schwartzentruber, Jeremy A; Ganesh, Jaya; Orange, Jordan S; Kaplan, Bernard S; Nunez, Laura Dempsey; Majewski, Jacek; Rosenblatt, David S

    2011-09-01

    An infant was investigated because of megaloblastic anaemia, atypical hemolytic uraemic syndrome, severe combined immune deficiency, elevated blood levels of homocysteine and methylmalonic acid, and a selective decreased synthesis of methylcobalamin in cultured fibroblasts. Exome sequencing was performed on patient genomic DNA. Two mutations were identified in the MTHFD1 gene, which encodes a protein that catalyses three reactions involved in cellular folate metabolism. This protein is essential for the generation of formyltetrahydrofolate and methylenetetrahydrofolate and important for nucleotide and homocysteine metabolism. One mutation (c.727+1G>A) affects the splice acceptor site of intron 8. The second mutation, c.517C>T (p.R173C), changes a critical arginine residue in the NADP-binding site of the protein. Mutations affecting this arginine have previously been shown to affect enzyme activity. Both parents carry a single mutation and an unaffected sibling carries neither mutation. The combination of two mutations in the MTHFRD1 gene, predicted to have severe consequences, in the patient and their absence in the unaffected sibling, supports causality. This patient represents the first case of an inborn error of folate metabolism affecting the trifunctional MTHFD1 protein. This report reinforces the power of exome capture and sequencing for the discovery of novel genes, even when only a single proband is available for study.

  14. Arginine kinase in Toxocara canis: Exon-intron organization, functional analysis of site-directed mutants and evaluation of putative enzyme inhibitors.

    PubMed

    Wickramasinghe, Susiji; Yatawara, Lalani; Nagataki, Mitsuru; Agatsuma, Takeshi

    2016-10-01

    To determine exon/intron organization of the Toxocara canis (T. canis) AK (TCAK) and to test green and black tea and several other chemicals against the activity of recombinant TCAK in the guanidino-specific region by site-directed mutants. Amplification of genomic DNA fragments containing introns was carried out by PCRs. The open-reading frame (1200 bp) of TCAK (wild type) was cloned into the BamH1/SalI site of pMAL-c2X. The maltose-binding protein-TCAK fusion protein was expressed in Escherichia coli TB1 cells. The purity of the expressed enzyme was verified by SDS-PAGE. Mutations were introduced into the guanidino-specific region and other areas of pMAL/TCAK by PCR. Enzyme activity was measured with an NADH-linked assay at 25 °C for the forward reaction (phosphagen synthesis). Arginine kinase in T. canis has a seven-exon/six-intron gene structure. The lengths of the introns ranged from 542 bp to 2 500 bp. All introns begin with gt and end with ag. Furthermore, we measured the enzyme activity of site-directed mutants of the recombinant TCAK. The K m value of the mutant (Alanine to Serine) decreased indicating a higher affinity for substrate arginine than the wild-type. The K m value of the mutant (Serine to Glycine) increased to 0.19 mM. The K m value (0.19 mM) of the double mutant (Alanine-Serine to Serine-Glycine) was slightly greater than in the wild-type (0.12 mM). In addition, several other chemicals were tested; including plant extract Azadiracta indica (A. indica), an aminoglycoside antibiotic (aminosidine), a citrus flavonoid glycoside (rutin) and a commercially available catechin mixture against TCAK. Green and black tea (1:10 dilution) produced 15% and 25% inhibition of TCAK, respectively. The extract of A. indica produced 5% inhibition of TCAK. Moreover, green and black tea produced a non-competitive type of inhibition and A. indica produced a mixed-type of inhibition on TCAK. Arginine kinase in T. canis has a seven-exon/six-intron gene structure. However, further studies are needed to identify a specific compound within the extract causing the inhibitory effect and also to determine the molecular mechanisms behind inhibition of arginine kinase in T. canis. Copyright © 2016 Hainan Medical University. Production and hosting by Elsevier B.V. All rights reserved.

  15. Insights about minority HIV-1 strains in transmitted drug resistance mutation dynamics and disease progression.

    PubMed

    Leda, Ana Rachel; Hunter, James; Oliveira, Ursula Castro; Azevedo, Inacio Junqueira; Sucupira, Maria Cecilia Araripe; Diaz, Ricardo Sobhie

    2018-04-19

    The presence of minority transmitted drug resistance mutations was assessed using ultra-deep sequencing and correlated with disease progression among recently HIV-1-infected individuals from Brazil. Samples at baseline during recent infection and 1 year after the establishment of the infection were analysed. Viral RNA and proviral DNA from 25 individuals were subjected to ultra-deep sequencing of the reverse transcriptase and protease regions of HIV-1. Viral strains carrying transmitted drug resistance mutations were detected in 9 out of the 25 patients, for all major antiretroviral classes, ranging from one to five mutations per patient. Ultra-deep sequencing detected strains with frequencies as low as 1.6% and only strains with frequencies >20% were detected by population plasma sequencing (three patients). Transmitted drug resistance strains with frequencies <14.8% did not persist upon established infection. The presence of transmitted drug resistance mutations was negatively correlated with the viral load and with CD4+ T cell count decay. Transmitted drug resistance mutations representing small percentages of the viral population do not persist during infection because they are negatively selected in the first year after HIV-1 seroconversion.

  16. Identification of ribonucleotide reductase mutation causing temperature-sensitivity of herpes simplex virus isolates from whitlow by deep sequencing.

    PubMed

    Daikoku, Tohru; Oyama, Yukari; Yajima, Misako; Sekizuka, Tsuyoshi; Kuroda, Makoto; Shimada, Yuka; Takehara, Kazuhiko; Miwa, Naoko; Okuda, Tomoko; Sata, Tetsutaro; Shiraki, Kimiyasu

    2015-06-01

    Herpes simplex virus 2 caused a genital ulcer, and a secondary herpetic whitlow appeared during acyclovir therapy. The secondary and recurrent whitlow isolates were acyclovir-resistant and temperature-sensitive in contrast to a genital isolate. We identified the ribonucleotide reductase mutation responsible for temperature-sensitivity by deep-sequencing analysis.

  17. Unusual splice site mutations disrupt FANCA exon 8 definition.

    PubMed

    Mattioli, Chiara; Pianigiani, Giulia; De Rocco, Daniela; Bianco, Anna Monica Rosaria; Cappelli, Enrico; Savoia, Anna; Pagani, Franco

    2014-07-01

    The pathological role of mutations that affect not conserved splicing regulatory sequences can be difficult to determine. In a patient with Fanconi anemia, we identified two unpredictable splicing mutations that act on either sides of FANCA exon 8. In patients-derived cells and in minigene splicing assay, we showed that both an apparently benign intronic c.710-5T>C transition and the nonsense c.790C>T substitution induce almost complete exon 8 skipping. Site-directed mutagenesis experiments indicated that the c.710-5T>C transition affects a polypyrimidine tract where most of the thymidines cannot be compensated by cytidines. The c.790C>T mutation located in position -3 relative to the donor site induce exon 8 skipping in an NMD-independent manner and complementation experiments with modified U1 snRNAs showed that U1 snRNP is only partially involved in the splicing defect. Our results highlight the importance of performing splicing functional assay for correct identification of disease-causing mechanism of genomic variants and provide mechanistic insights on how these two FANCA mutations affect exon 8 definition. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. A novel homozygous mutation IVS6+5G>T in CYP11B1 gene in a Vietnamese patient with 11β-hydroxylase deficiency.

    PubMed

    Nguyen, Thi Phuong Mai; Nguyen, Thu Hien; Ngo, Diem Ngoc; Vu, Chi Dung; Nguyen, Thi Kim Lien; Nong, Van Hai; Nguyen, Huy Hoang

    2015-07-10

    Congenital adrenal hyperplasia (CAH) is an autosomal recessive disease which is characterized by a deficiency of one of the enzymes involved in the synthesis of cortisol from cholesterol by the adrenal cortex. CAH cases arising from impaired 11β-hydroxylase are the second most common form. Mutations in the CYP11B1 gene are the cause of 11β-hydroxylase deficiency. This study was performed on a patient with congenital adrenal hyperplasia and with premature development such as enlarged penis, muscle development, high blood pressure, and bone age equivalent of 5 years old at 2 years of chronological age. Biochemical tests for steroids confirmed the diagnosis of CAH. We used PCR and sequencing to screen for mutations in CYP11B1 gene. Results showed that the patient has a novel homozygous mutation of guanine (G) to thymine (T) in intron 6 (IVS6+5G>T). The analysis of this mutation by MaxEntScan boundary software indicated that this mutant could affect the gene splicing during transcription. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Mutational screening in genes related with porto-pulmonary hypertension: An analysis of 6 cases.

    PubMed

    Pousada, Guillermo; Baloira, Adolfo; Valverde, Diana

    2017-04-07

    Portopulmonary hypertension (PPH) is a rare disease with a low incidence and without a clearly-identified genetic component. The aim of this work was to check genes and genetic modifiers related to pulmonary arterial hypertension in patients with PPH in order to clarify the molecular basis of the pathology. We selected a total of 6 patients with PPH and amplified the exonic regions and intronic flanking regions of the relevant genes and regions of interest of the genetic modifiers. Six patients diagnosed with PPH were analyzed and compared to 55 healthy individuals. Potentially-pathogenic mutations were identified in the analyzed genes of 5 patients. None of these mutations, which are highly conserved throughout evolution, were detected in the control patients nor different databases analyzed (1000 Genomes, ExAC and DECIPHER). After analyzing for genetic modifiers, we found different variations that could favor the onset of the disease. The genetic analysis carried out in this small cohort of patients with PPH revealed a large number of mutations, with the ENG gene showing the greatest mutational frequency. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

  20. Roles of polypyrimidine tract binding proteins in major immediate-early gene expression and viral replication of human cytomegalovirus.

    PubMed

    Cosme, Ruth S Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-04-01

    Human cytomegalovirus (HCMV), a member of the beta subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns.

  1. Roles of Polypyrimidine Tract Binding Proteins in Major Immediate-Early Gene Expression and Viral Replication of Human Cytomegalovirus▿

    PubMed Central

    Cosme, Ruth S. Cruz; Yamamura, Yasuhiro; Tang, Qiyi

    2009-01-01

    Human cytomegalovirus (HCMV), a member of the β subgroup of the family Herpesviridae, causes serious health problems worldwide. HCMV gene expression in host cells is a well-defined sequential process: immediate-early (IE) gene expression, early-gene expression, DNA replication, and late-gene expression. The most abundant IE gene, major IE (MIE) gene pre-mRNA, needs to be spliced before being exported to the cytoplasm for translation. In this study, the regulation of MIE gene splicing was investigated; in so doing, we found that polypyrimidine tract binding proteins (PTBs) strongly repressed MIE gene production in cotransfection assays. In addition, we discovered that the repressive effects of PTB could be rescued by splicing factor U2AF. Taken together, the results suggest that PTBs inhibit MIE gene splicing by competing with U2AF65 for binding to the polypyrimidine tract in pre-mRNA. In intron deletion mutation assays and RNA detection experiments (reverse transcription [RT]-PCR and real-time RT-PCR), we further observed that PTBs target all the introns of the MIE gene, especially intron 2, and affect gene splicing, which was reflected in the variation in the ratio of pre-mRNA to mRNA. Using transfection assays, we demonstrated that PTB knockdown cells induce a higher degree of MIE gene splicing/expression. Consistently, HCMV can produce more viral proteins and viral particles in PTB knockdown cells after infection. We conclude that PTB inhibits HCMV replication by interfering with MIE gene splicing through competition with U2AF for binding to the polypyrimidine tract in MIE gene introns. PMID:19144709

  2. Mutations in the dopamine beta-hydroxylase gene are associated with human norepinephrine deficiency

    NASA Technical Reports Server (NTRS)

    Kim, Chun-Hyung; Zabetian, Cyrus P.; Cubells, Joseph F.; Cho, Sonhae; Biaggioni, Italo; Cohen, Bruce M.; Robertson, David; Kim, Kwang-Soo

    2002-01-01

    Norepinephrine (NE), a key neurotransmitter of the central and peripheral nervous systems, is synthesized by dopamine beta-hydroxylase (DBH) that catalyzes oxidation of dopamine (DA) to NE. NE deficiency is a congenital disorder of unknown etiology, in which affected patients suffer profound autonomic failure. Biochemical features of the syndrome include undetectable tissue and circulating levels of NE and epinephrine, elevated levels of DA, and undetectable levels of DBH. Here, we report identification of seven novel variants including four potentially pathogenic mutations in the human DBH gene (OMIM 223360) from analysis of two unrelated patients and their families. Both patients are compound heterozygotes for variants affecting expression of DBH protein. Each carries one copy of a T-->C transversion in the splice donor site of DBH intron 1, creating a premature stop codon. In patient 1, there is a missense mutation in DBH exon 2. Patient 2 carries missense mutations in exons 1 and 6 residing in cis. We propose that NE deficiency is an autosomal recessive disorder resulting from heterogeneous molecular lesions at DBH. Copyright 2002 Wiley-Liss, Inc.

  3. Luminal expression of cubilin is impaired in Imerslund-Gräsbeck syndrome with compound AMN mutations in intron 3 and exon 7

    PubMed Central

    Namour, Fares; Dobrovoljski, Gabriele; Chery, Celine; Audonnet, Sandra; Feillet, François; Sperl, Wolfgang; Gueant, Jean-Louis

    2011-01-01

    Juvenile megaloblastic anaemia 1 (OMIM # 261100) is a rare autosomic disorder characterized by selective cobalamin mal-absorption and inconstant proteinuria produced by mutations in either CUBN or AMN genes. Amnionless, the gene product of AMN, is a transmembrane protein that binds tightly to the N-terminal end of cubilin, the gene product of CUBN. Cubilin binds to intrinsic factor-cobalamin complex and is expressed in the distal intestine and the proximal renal tubule. We report a compound AMN heterozygosity with c.742C>T, p.Gln248X and c.208-2A>G mutations in 2 siblings that led to premature termination codon in exon 7 and exon 6, respectively. It produced a dramatic decrease in receptor activity in urine, despite absence of CUBN mutation and normal affinity of the receptor for intrinsic factor binding. Heterozygous carriers for c.742T and c.208-2G had no pathological signs. These results indicate that amnionless is essential for the correct luminal expression of cubilin in humans. PMID:21750092

  4. Five novel ALMS1 gene mutations in six patients with Alström syndrome.

    PubMed

    Kılınç, Suna; Yücel-Yılmaz, Didem; Ardagil, Aylin; Apaydın, Süheyla; Valverde, Diana; Özgül, Rıza Köksal; Güven, Ayla

    2018-05-01

    Alström syndrome is a rare autosomal recessive inherited disorder caused by mutations in the ALMS1 gene. We describe the clinical and five novel mutational screening findings in six patients with Alström syndrome from five families in a single center with distinct clinical presentations of this condition. Five novel mutations in ALMS1 in exon 8 and intron 17 were identified, one of them was a compound heterozygous: c.2259_2260insT, p.Glu754*; c.2035C>T p.Arg679*; c.2259_2260insT, p.Glu754*; c.5969C>G, p.Ser1990*; c.6541C>T, p. Gln2181*/c.11666-2A>G, splicing. One patient had gallstones, this association, to our knowledge, has not been reported in Alström syndrome previously. Early diagnosis of Alström syndrome is often difficult in children and adolescents, because many of the clinical features develop over time. Early diagnosis can initiate an effective managemen of this condition, and it will help to reduce future damage.

  5. Woot, an Active Gypsy-Class Retrotransposon in the Flour Beetle, Tribolium Castaneum, Is Associated with a Recent Mutation

    PubMed Central

    Beeman, R. W.; Thomson, M. S.; Clark, J. M.; DeCamillis, M. A.; Brown, S. J.; Denell, R. E.

    1996-01-01

    A recently isolated, lethal mutation of the homeotic Abdominal gene of the red flour beetle Tribolium castaneum is associated with an insertion of a novel retrotransposon into an intron. Sequence analysis indicates that this retrotransposon, named Woot, is a member of the gypsy family of mobile elements. Most strains of T. castaneum appear to harbor ~25-35 copies of Woot per genome. Woot is composed of long terminal repeats of unprecedented length (3.6 kb each), flanking an internal coding region 5.0 kb in length. For most copies of Woot, the internal region includes two open reading frames (ORFs) that correspond to the gag and pol genes of previously described retrotransposons and retroviruses. The copy of Woot inserted into Abdominal bears an apparent single frameshift mutation that separates the normal second ORF into two. Woot does not appear to generate infectious virions by the criterion that no envelop gene is discernible. The association of Woot with a recent mutation suggests that this retroelement is currently transpositionally active in at least some strains. PMID:8722793

  6. Novel Mutations in the ZEB1 Gene Identified in Czech and British Patients With Posterior Polymorphous Corneal Dystrophy

    PubMed Central

    Liskova, Petra; Tuft, Stephen J.; Gwilliam, Rhian; Ebenezer, Neil D.; Jirsova, Katerina; Prescott, Quincy; Martincova, Radka; Pretorius, Marike; Sinclair, Neil; Boase, David L.; Jeffrey, Margaret J.; Deloukas, Panos; Hardcastle, Alison J.; Filipec, Martin; Bhattacharya, Shomi S.

    2009-01-01

    We describe the search for mutations in six unrelated Czech and four unrelated British families with posterior polymorphous corneal dystrophy (PPCD); a relatively rare eye disorder. Coding exons and intron/exon boundaries of all three genes (VSX1, COL8A2, and ZEB1/TCF8) previously reported to be implicated in the pathogenesis of this disorder were screened by DNA sequencing. Four novel pathogenic mutations were identified in four families; two deletions, one nonsense, and one duplication within exon 7 in the ZEB1 gene located at 10p11.2. We also genotyped the Czech patients to test for a founder haplotype and lack of disease segregation with the 20p11.2 locus we previously described. Although a systematic clinical examination was not performed, our investigation does not support an association between ZEB1 changes and self reported non-ocular anomalies. In the remaining six families no disease causing mutations were identified thereby indicating that as yet unidentified gene(s) are likely to be responsible for PPCD. PMID:17437275

  7. Mutations in PRPF31 Inhibit Pre-mRNA Splicing of Rhodopsin Gene and Cause Apoptosis of Retinal Cells

    PubMed Central

    Yuan, Liya; Kawada, Mariko; Havlioglu, Necat; Tang, Hao; Wu, Jane Y.

    2007-01-01

    Mutations in human PRPF31 gene have been identified in patients with autosomal dominant retinitis pigmentosa (adRP). To begin to understand mechanisms by which defects in this general splicing factor cause retinal degeneration, we examined the relationship between PRPF31 and pre-mRNA splicing of photoreceptor-specific genes. We used a specific anti-PRPF31 antibody to immunoprecipitate splicing complexes from retinal cells and identified the transcript of rhodopsin gene (RHO) among RNA species associated with PRPF31-containing complexes. Mutant PRPF31 proteins significantly inhibited pre-mRNA splicing of intron 3 in RHO gene. In primary retinal cell cultures, expression of the mutant PRPF31 proteins reduced rhodopsin expression and caused apoptosis of rhodopsin-positive retinal cells. This primary retinal culture assay provides an in vitro model to study photoreceptor cell death caused by PRPF31 mutations. Our results demonstrate that mutations in PRPF31 gene affect RHO pre-mRNA splicing and reveal a link between PRPF31 and RHO, two major adRP genes. PMID:15659613

  8. First evidence of a large CHEK2 duplication involved in cancer predisposition in an Italian family with hereditary breast cancer

    PubMed Central

    2014-01-01

    Background CHEK2 is a multi-cancer susceptibility gene whose common germline mutations are known to contribute to the risk of developing breast and prostate cancer. Case presentation Here, we describe an Italian family with a high number of cases of breast cancer and other types of tumour subjected to the MLPA test to verify the presence of BRCA1, BRCA2 and CHEK2 deletions and duplications. We identified a new 23-kb duplication in the CHEK2 gene extending from intron 5 to 13 that was associated with breast cancer in the family. The presence and localisation of the alteration was confirmed by a second analysis by Next-Generation Sequencing. Conclusions This finding suggests that CHEK2 mutations are heterogeneous and that techniques other than sequencing, such as MLPA, are needed to identify CHEK2 mutations. It also indicates that CHEK2 rare variants, such as duplications, can confer a high susceptibility to cancer development and should thus be studied in depth as most of our knowledge of CHEK2 concerns common mutations. PMID:24986639

  9. First evidence of a large CHEK2 duplication involved in cancer predisposition in an Italian family with hereditary breast cancer.

    PubMed

    Tedaldi, Gianluca; Danesi, Rita; Zampiga, Valentina; Tebaldi, Michela; Bedei, Lucia; Zoli, Wainer; Amadori, Dino; Falcini, Fabio; Calistri, Daniele

    2014-07-01

    CHEK2 is a multi-cancer susceptibility gene whose common germline mutations are known to contribute to the risk of developing breast and prostate cancer. Here, we describe an Italian family with a high number of cases of breast cancer and other types of tumour subjected to the MLPA test to verify the presence of BRCA1, BRCA2 and CHEK2 deletions and duplications. We identified a new 23-kb duplication in the CHEK2 gene extending from intron 5 to 13 that was associated with breast cancer in the family. The presence and localisation of the alteration was confirmed by a second analysis by Next-Generation Sequencing. This finding suggests that CHEK2 mutations are heterogeneous and that techniques other than sequencing, such as MLPA, are needed to identify CHEK2 mutations. It also indicates that CHEK2 rare variants, such as duplications, can confer a high susceptibility to cancer development and should thus be studied in depth as most of our knowledge of CHEK2 concerns common mutations.

  10. A novel missense mutation of the TYR gene in a pedigree with oculocutaneous albinism type 1 from China.

    PubMed

    Lin, Yu-Ying; Wei, Ai-Hua; Zhou, Zhi-Yong; Zhu, Wei; He, Xin; Lian, Shi

    2011-10-01

    The mutation of the tyrosinase (TYR) gene results in oculocutaneous albinism type 1 (OCA1), an autosomal recessive genetic disorder. OCA1 is the most common type of OCA in the Chinese population. Hence, the TYR gene was tested in this study. We also delineated the genetic analysis of OCA1 in a Chinese family. Genomic DNA was isolated from the blood leukocytes of a proband and his family. Mutational analysis at the TYR locus by DNA sequencing was used to screen five exons, including the intron/exon junctions. A pedigree chart was drawn and the fundus of the eyes of the proband was also examined. A novel missense mutation p.I151S on exon 1, and homozygous TYR mutant alleles were identified in the proband. None of the mutants was identified among the 100 normal control subjects. Genetic analysis of the proband's wife showed normal alleles in the TYR gene. Thus, the fetus was predicated a carrier of OCA1 with a normal appearance. This study provided new information about a novel mutation, p.I151S, in the TYR gene in a Chinese family with OCA1. Further investigation of the proband would be helpful to determine the effects of this mutation on TYR activity.

  11. A cluster of lysinuric protein intolerance (LPI) patients in a northern part of Iwate, Japan due to a founder effect. The Mass Screening Group.

    PubMed

    Koizumi, A; Shoji, Y; Nozaki, J; Noguchi, A; E, X; Dakeishi, M; Ohura, T; Tsuyoshi, K; Yasuhiko, W; Manabe, M; Takasago, Y; Takada, G

    2000-09-01

    Lysinuric protein intolerance is an autosomal recessive disease characterized by defective transport of the dibasic aminoacids. Mutational analysis of LPI patients in the northern part of Japan revealed that six were homozygous for the R410X mutation and two others were compound heterozygotes of R410X and other unknown mutations. In the population epidemiology study in a local cluster in the northern part of Iwate, ten heterozygotes were found in 1190 newborn babies leading to an estimated LPI incidence of 1/57,000. Polymorphism analysis revealed two major alleles, A and B, in intron 8. While the population frequency of allele A was 0.9 and that of allele B was 0.1 in the northern part of Japan the R410X mutations were exclusively on allele B in 31 chromosomes suggesting a founder effect. Genetic analysis in patients revealed strong linkage disequilibrium with D14S283 and TCRA indicating that the R410X mutation occurred before at least 130 generations ago (about 2600 years). The R410X mutation was shown to be useful as a molecular marker for screening LPI patients in the northern part of Japan. Copyright 2000 Wiley-Liss, Inc.

  12. Mutation-adapted U1 snRNA corrects a splicing error of the dopa decarboxylase gene.

    PubMed

    Lee, Ni-Chung; Lee, Yu-May; Chen, Pin-Wen; Byrne, Barry J; Hwu, Wuh-Liang

    2016-12-01

    Aromatic l-amino acid decarboxylase (AADC) deficiency is an inborn error of monoamine neurotransmitter synthesis, which results in dopamine, serotonin, epinephrine and norepinephrine deficiencies. The DDC gene founder mutation IVS6 + 4A > T is highly prevalent in Chinese patients with AADC deficiency. In this study, we designed several U1 snRNA vectors to adapt U1 snRNA binding sequences of the mutated DDC gene. We found that only the modified U1 snRNA (IVS-AAA) that completely matched both the intronic and exonic U1 binding sequences of the mutated DDC gene could correct splicing errors of either the mutated human DDC minigene or the mouse artificial splicing construct in vitro. We further injected an adeno-associated viral (AAV) vector to express IVS-AAA in the brain of a knock-in mouse model. This treatment was well tolerated and improved both the survival and brain dopamine and serotonin levels of mice with AADC deficiency. Therefore, mutation-adapted U1 snRNA gene therapy can be a promising method to treat genetic diseases caused by splicing errors, but the efficiency of such a treatment still needs improvements. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  13. The rat pink-eyed dilution (p) mutation: an identical intragenic deletion in pink-eye dilute-coat strains and several Wistar-derived albino strains.

    PubMed

    Kuramoto, Takashi; Gohma, Hiroshi; Kimura, Kunio; Wedekind, Dirk; Hedrich, Hans J; Serikawa, Tadao

    2005-09-01

    We identified the rat pink-eyed dilution (p) and pink eye Mishima (p(m)) mutations. The p(m) mutation, which was isolated from a wild rat caught in Mishima Japan in 1961 and is carried in the NIG-III strain, is a splice donor site mutation in intron 5. The p mutation, which was first described in 1914 and is carried in several p/p rats including the RCS and BDV strains, is an intragenic deletion including exons 17 and 18. In addition to RCS and BDV strains, several albino strains, KHR, KMI and WNA, all descendants of albino stock of the Wistar Institute, are homozygous for the p allele. Analyses revealed that the colored p strains and the Wistar-derived albino p strains had the same marker haplotype spanning approximately 4 Mb around the P locus. This indicates that these p strains share a common ancestor and the p allele did not arise independently via recurrent mutations. The historical relationship among the p strains suggests that the p deletion had been maintained in stock heterogeneous for the C and P loci and then was inherited independently by the ancestor of the Wistar albino stock and the ancestor of the pink-eyed agouti rats in Europe.

  14. Affinity Maturation of a Cyclic Peptide Handle for Therapeutic Antibodies Using Deep Mutational Scanning*

    PubMed Central

    van Rosmalen, Martijn; Janssen, Brian M. G.; Hendrikse, Natalie M.; van der Linden, Ardjan J.; Pieters, Pascal A.; Wanders, Dave; de Greef, Tom F. A.; Merkx, Maarten

    2017-01-01

    Meditopes are cyclic peptides that bind in a specific pocket in the antigen-binding fragment of a therapeutic antibody such as cetuximab. Provided their moderate affinity can be enhanced, meditope peptides could be used as specific non-covalent and paratope-independent handles in targeted drug delivery, molecular imaging, and therapeutic drug monitoring. Here we show that the affinity of a recently reported meditope for cetuximab can be substantially enhanced using a combination of yeast display and deep mutational scanning. Deep sequencing was used to construct a fitness landscape of this protein-peptide interaction, and four mutations were identified that together improved the affinity for cetuximab 10-fold to 15 nm. Importantly, the increased affinity translated into enhanced cetuximab-mediated recruitment to EGF receptor-overexpressing cancer cells. Although in silico Rosetta simulations correctly identified positions that were tolerant to mutation, modeling did not accurately predict the affinity-enhancing mutations. The experimental approach reported here should be generally applicable and could be used to develop meditope peptides with low nanomolar affinity for other therapeutic antibodies. PMID:27974464

  15. Recurrent and functional regulatory mutations in breast cancer.

    PubMed

    Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

    2017-07-06

    Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

  16. Mutation screening of Chinese Treacher Collins syndrome patients identified novel TCOF1 mutations.

    PubMed

    Chen, Ying; Guo, Luo; Li, Chen-Long; Shan, Jing; Xu, Hai-Song; Li, Jie-Ying; Sun, Shan; Hao, Shao-Juan; Jin, Lei; Chai, Gang; Zhang, Tian-Yu

    2018-04-01

    Treacher Collins syndrome (TCS) (OMIM 154500) is a rare congenital craniofacial disorder with an autosomal dominant manner of inheritance in most cases. To date, three pathogenic genes (TCOF1, POLR1D and POLR1C) have been identified. In this study, we conducted mutational analysis on Chinese TCS patients to reveal a mutational spectrum of known causative genes and show phenotype-genotype data to provide more information for gene counselling and future studies on the pathogenesis of TCS. Twenty-two TCS patients were recruited from two tertiary referral centres, and Sanger sequencing for the coding exons and exon-intron boundaries of TCOF1, POLR1D and POLR1C was performed. For patients without small variants, further copy number variations (CNVs) analysis was conducted using high-density SNP array platforms. The Sanger sequencing overall mutation detection rate was as high as 86.3% (19/22) for our cohort. Fifteen TCOF1 pathogenic variants, including ten novel mutations, were identified in nineteen patients. No causative mutations in POLR1D and POLR1C genes and no CNVs mutations were detected. A suspected autosomal dominant inheritance case that implies germinal mosaicism was described. Our study confirmed that TCOF1 was the main disease-causing gene for the Chinese TCS population and revealed its mutation spectrum. We also addressed the need for more studies of mosaicism in TCS cases, which could explain the mechanism of autosomal dominant inheritance in TCS cases and benefit the prevention of TCS.

  17. Molecular genetics analysis of hereditary breast and ovarian cancer patients in India

    PubMed Central

    Soumittra, Nagasamy; Meenakumari, Balaiah; Parija, Tithi; Sridevi, Veluswami; Nancy, Karunakaran N; Swaminathan, Rajaraman; Rajalekshmy, Kamalalayam R; Majhi, Urmila; Rajkumar, Thangarajan

    2009-01-01

    Background Hereditary cancers account for 5–10% of cancers. In this study BRCA1, BRCA2 and CHEK2*(1100delC) were analyzed for mutations in 91 HBOC/HBC/HOC families and early onset breast and early onset ovarian cancer cases. Methods PCR-DHPLC was used for mutation screening followed by DNA sequencing for identification and confirmation of mutations. Kaplan-Meier survival probabilities were computed for five-year survival data on Breast and Ovarian cancer cases separately, and differences were tested using the Log-rank test. Results Fifteen (16%) pathogenic mutations (12 in BRCA1 and 3 in BRCA2), of which six were novel BRCA1 mutations were identified. None of the cases showed CHEK2*1100delC mutation. Many reported polymorphisms in the exonic and intronic regions of BRCA1 and BRCA2 were also seen. The mutation status and the polymorphisms were analyzed for association with the clinico-pathological features like age, stage, grade, histology, disease status, survival (overall and disease free) and with prognostic molecular markers (ER, PR, c-erbB2 and p53). Conclusion The stage of the disease at diagnosis was the only statistically significant (p < 0.0035) prognostic parameter. The mutation frequency and the polymorphisms were similar to reports on other ethnic populations. The lack of association between the clinico-pathological variables, mutation status and the disease status is likely to be due to the small numbers. PMID:19656415

  18. Molecular basis of cystic fibrosis in Lithuania: incomplete CFTR mutation detection by PCR-based screening protocols.

    PubMed

    Giannattasio, S; Bobba, A; Jurgelevicius, V; Vacca, R A; Lattanzio, P; Merafina, R S; Utkus, A; Kucinskas, V; Marra, E

    2006-01-01

    Mutational analysis of the cystic fibrosis transmembrane regulator (CFTR) gene was performed in 98 unrelated CF chromosomes from 49 Lithuanian CF patients through a combined approach in which the p.F508del mutation was first screened by allele-specific PCR while CFTR mutations in nonp.F508del chromosomes have been screened for by denaturing gradient gel electrophoresis analysis. A CFTR mutation was characterized in 62.2% of CF chromosomes, two of which (2.0%) have been previously shown to carry a large gene deletion CFTRdele2,3(21 kb). The most frequent Lithuanian CF mutation is p.F508del (52.0%). Seven CFTR mutations, p.N1303K (2.0%), p.R75Q (1.0%), p.G314R (1.0%), p.R553X (4.2%), p.W1282X (1.0%), and g.3944delGT (1.0%), accounted for 10.1% of Lithuanian CF chromosomes. It was not possible to characterize 35.8% of the CF Lithuanian chromosomes. Analysis of intron 8 (TG)mTn and M470V polymorphic loci did not permit the characterization of the CFTR dysfunction underlying the CF phenotype in the patients for which no CFTR mutation was identified. Thus, screening of the eight CFTR mutations identified in this study and of the large deletion CFTRdele2,3(21 kb) allows the implementation of an early molecular or confirmatory CF diagnosis for 65% of Lithuanian CF chromosomes.

  19. Molecular genetics of cystinuria: Identification of four new mutations and seven polymorphisms, and evidence for genetic heterogeneity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gasparini, P.; Bisceglia, L.; Notarangelo, A.

    A cystinuria disease gene (rBAT) has been recently identified, and some mutations causing the disease have been described. The frequency of these mutations has been investigated in a large sample of 51 Italian and Spanish cystinuric patients. In addition, to identify new mutated alleles, genomic DNA has been analyzed by an accurate and sensitive method able to detect nucleotide changes. Because of the lack of information available on the genomic structure of rBAT gene, the study was carried out using the sequence data so far obtained by us. More than 70% of the entire coding sequence and 8 intron-exon boundariesmore » have been analyzed. Four new mutations and seven intragenic polymorphisms have been detected. All mutations so far identified in rBAT belong only to cystinuria type I alleles, accounting for {approximately} 44% of all type I cystinuric chromosomes. Mutation M467T is the most common mutated allele in the Italian and Spanish populations. After analysis of 70% of the rBAT coding region, we have detected normal sequences in cystinuria type II and type III chromosomes. The presence of rBAT mutated alleles only in type I chromosomes of homozygous (type I/I) and heterozygous (type I/III) patients provides evidence for genetic heterogeneity where rBAT would be responsible only for type I cystinuria and suggests a complementation mechanism to explain the intermediate type I/type III phenotype. 25 refs., 1 fig., 3 tabs.« less

  20. Spectrum of SMPD1 mutations in Asian-Indian patients with acid sphingomyelinase (ASM)-deficient Niemann-Pick disease.

    PubMed

    Ranganath, Prajnya; Matta, Divya; Bhavani, Gandham SriLakshmi; Wangnekar, Savita; Jain, Jamal Mohammed Nurul; Verma, Ishwar C; Kabra, Madhulika; Puri, Ratna Dua; Danda, Sumita; Gupta, Neerja; Girisha, Katta M; Sankar, Vaikom H; Patil, Siddaramappa J; Ramadevi, Akella Radha; Bhat, Meenakshi; Gowrishankar, Kalpana; Mandal, Kausik; Aggarwal, Shagun; Tamhankar, Parag Mohan; Tilak, Preetha; Phadke, Shubha R; Dalal, Ashwin

    2016-10-01

    Acid sphingomyelinase (ASM)-deficient Niemann-Pick disease is an autosomal recessive lysosomal storage disorder caused by biallelic mutations in the SMPD1 gene. To date, around 185 mutations have been reported in patients with ASM-deficient NPD world-wide, but the mutation spectrum of this disease in India has not yet been reported. The aim of this study was to ascertain the mutation profile in Indian patients with ASM-deficient NPD. We sequenced SMPD1 in 60 unrelated families affected with ASM-deficient NPD. A total of 45 distinct pathogenic sequence variants were found, of which 14 were known and 31 were novel. The variants included 30 missense, 4 nonsense, and 9 frameshift (7 single base deletions and 2 single base insertions) mutations, 1 indel, and 1 intronic duplication. The pathogenicity of the novel mutations was inferred with the help of the mutation prediction software MutationTaster, SIFT, Polyphen-2, PROVEAN, and HANSA. The effects of the identified sequence variants on the protein structure were studied using the structure modeled with the help of the SWISS-MODEL workspace program. The p. (Arg542*) (c.1624C>T) mutation was the most commonly identified mutation, found in 22% (26 out of 120) of the alleles tested, but haplotype analysis for this mutation did not identify a founder effect for the Indian population. To the best of our knowledge, this is the largest study on mutation analysis of patients with ASM-deficient Niemann-Pick disease reported in literature and also the first study on the SMPD1 gene mutation spectrum in India. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  1. Null missense ABCR (ABCA4) mutations in a family with stargardt disease and retinitis pigmentosa.

    PubMed

    Shroyer, N F; Lewis, R A; Yatsenko, A N; Lupski, J R

    2001-11-01

    To determine the type of ABCR mutations that segregate in a family that manifests both Stargardt disease (STGD) and retinitis pigmentosa (RP), and the functional consequences of the underlying mutations. Direct sequencing of all 50 exons and flanking intronic regions of ABCR was performed for the STGD- and RP-affected relatives. RNA hybridization, Western blot analysis, and azido-adenosine triphosphate (ATP) labeling was used to determine the effect of disease-associated ABCR mutations in an in vitro assay system. Compound heterozygous missense mutations were identified in patients with STGD and RP. STGD-affected individual AR682-03 was compound heterozygous for the mutation 2588G-->C and a complex allele, [W1408R; R1640W]. RP-affected individuals AR682-04 and-05 were compound heterozygous for the complex allele [W1408R; R1640W] and the missense mutation V767D. Functional analysis of the mutation V767D by Western blot and ATP binding revealed a severe reduction in protein expression. In vitro analysis of ABCR protein with the mutations W1408R and R1640W showed a moderate effect of these individual mutations on expression and ATP-binding; the complex allele [W1408R; R1640W] caused a severe reduction in protein expression. These data reveal that missense ABCR mutations may be associated with RP. Functional analysis reveals that the RP-associated missense ABCR mutations are likely to be functionally null. These studies of the complex allele W1408R; R1640W suggest a synergistic effect of the individual mutations. These data are congruent with a model in which RP is associated with homozygous null mutations and with the notion that severity of retinal disease is inversely related to residual ABCR activity.

  2. Trans-activation of the Tetrahymena group I intron ribozyme via a non-native RNA-RNA interaction.

    PubMed Central

    Ikawa, Y; Shiraishi, H; Inoue, T

    1999-01-01

    The peripheral P2.1 domain of the Tetrahymena group I intron ribozyme has been shown to be non-essential for splicing. We found, however, that separately prepared P2.1 RNA efficiently accelerates the 3' splice-site-specific hydrolysis reaction of a mutant ribozyme lacking both P2.1 and its upstream region in trans. We report here the unusual properties of this trans-activation. Compensatory mutational analysis revealed that non-native long-range base-pairings between the loop region of P2.1 RNA and L5c region of the mutant ribozyme are needed for the activation in spite of the fact that P2.1 forms base-pairings with P9.1 in the Tetrahymena ribozyme. The trans -activation depends on the non-native RNA-RNA interaction together with the higher order structure of P2.1 RNA. This activation is unique among the known trans-activations that utilize native tertiary interactions or RNA chaperons. PMID:10075996

  3. Genetic Variation among Major Human Geographic Groups Supports a Peculiar Evolutionary Trend in PAX9

    PubMed Central

    Paixão-Côrtes, Vanessa R.; Meyer, Diogo; Pereira, Tiago V.; Mazières, Stéphane; Elion, Jacques; Krishnamoorthy, Rajagopal; Zago, Marco A.; Silva, Wilson A.; Salzano, Francisco M.; Bortolini, Maria Cátira

    2011-01-01

    A total of 172 persons from nine South Amerindian, three African and one Eskimo populations were studied in relation to the Paired box gene 9 (PAX9) exon 3 (138 base pairs) as well as its 5′and 3′flanking intronic segments (232 bp and 220 bp, respectively) and integrated with the information available for the same genetic region from individuals of different geographical origins. Nine mutations were scored in exon 3 and six in its flanking regions; four of them are new South American tribe-specific singletons. Exon3 nucleotide diversity is several orders of magnitude higher than its intronic regions. Additionally, a set of variants in the PAX9 and 101 other genes related with dentition can define at least some dental morphological differences between Sub-Saharan Africans and non-Africans, probably associated with adaptations after the modern human exodus from Africa. Exon 3 of PAX9 could be a good molecular example of how evolvability works. PMID:21298044

  4. The ins and outs of editing and splicing of plastid RNAs: lessons from parasitic plants.

    PubMed

    Tillich, Michael; Krause, Kirsten

    2010-07-31

    In chloroplasts of higher plants, editing and splicing of transcripts is a prerequisite for the proper expression of the plastid genetic information and thereby for photosynthesis. Holoparasitic plants differ from photosynthetic plants in that they have abandoned a photoautotrophic life style, which has led to a reduction or loss of photosynthetic activity. The analysis of several parasitic plant plastid genomes revealed that coding capacities were reduced to different extent, encompassing genes that regulate plastid gene expression as well as photosynthesis genes. The reorganization of the plastid genome is also reflected in overall increases in point mutation rates that parallel the vanishing of RNA editing sites. Unprecedented in land plants is the parallel loss of the plastid gene coding for an intron maturase and all but one group IIa introns in two parasitic species. These observations highlight the plastome-wide effects that are associated with a relaxed evolutionary pressure in plants living a heterotrophic life style. Copyright (c) 2010 Elsevier B.V. All rights reserved.

  5. Phase distribution of spliceosomal introns: implications for intron origin

    PubMed Central

    Nguyen, Hung D; Yoshihama, Maki; Kenmochi, Naoya

    2006-01-01

    Background The origin of spliceosomal introns is the central subject of the introns-early versus introns-late debate. The distribution of intron phases is non-uniform, with an excess of phase-0 introns. Introns-early explains this by speculating that a fraction of present-day introns were present between minigenes in the progenote and therefore must lie in phase-0. In contrast, introns-late predicts that the nonuniformity of intron phase distribution reflects the nonrandomness of intron insertions. Results In this paper, we tested the two theories using analyses of intron phase distribution. We inferred the evolution of intron phase distribution from a dataset of 684 gene orthologs from seven eukaryotes using a maximum likelihood method. We also tested whether the observed intron phase distributions from 10 eukaryotes can be explained by intron insertions on a genome-wide scale. In contrast to the prediction of introns-early, the inferred evolution of intron phase distribution showed that the proportion of phase-0 introns increased over evolution. Consistent with introns-late, the observed intron phase distributions matched those predicted by an intron insertion model quite well. Conclusion Our results strongly support the introns-late hypothesis of the origin of spliceosomal introns. PMID:16959043

  6. Evolutionary Analysis Predicts Sensitive Positions of MMP20 and Validates Newly- and Previously-Identified MMP20 Mutations Causing Amelogenesis Imperfecta

    PubMed Central

    Gasse, Barbara; Prasad, Megana; Delgado, Sidney; Huckert, Mathilde; Kawczynski, Marzena; Garret-Bernardin, Annelyse; Lopez-Cazaux, Serena; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Stoetzel, Corinne; Bloch-Zupan, Agnès; Sire, Jean-Yves

    2017-01-01

    Amelogenesis imperfecta (AI) designates a group of genetic diseases characterized by a large range of enamel disorders causing important social and health problems. These defects can result from mutations in enamel matrix proteins or protease encoding genes. A range of mutations in the enamel cleavage enzyme matrix metalloproteinase-20 gene (MMP20) produce enamel defects of varying severity. To address how various alterations produce a range of AI phenotypes, we performed a targeted analysis to find MMP20 mutations in French patients diagnosed with non-syndromic AI. Genomic DNA was isolated from saliva and MMP20 exons and exon-intron boundaries sequenced. We identified several homozygous or heterozygous mutations, putatively involved in the AI phenotypes. To validate missense mutations and predict sensitive positions in the MMP20 sequence, we evolutionarily compared 75 sequences extracted from the public databases using the Datamonkey webserver. These sequences were representative of mammalian lineages, covering more than 150 million years of evolution. This analysis allowed us to find 324 sensitive positions (out of the 483 MMP20 residues), pinpoint functionally important domains, and build an evolutionary chart of important conserved MMP20 regions. This is an efficient tool to identify new- and previously-identified mutations. We thus identified six functional MMP20 mutations in unrelated families, finding two novel mutated sites. The genotypes and phenotypes of these six mutations are described and compared. To date, 13 MMP20 mutations causing AI have been reported, making these genotypes and associated hypomature enamel phenotypes the most frequent in AI. PMID:28659819

  7. Evolutionary Analysis Predicts Sensitive Positions of MMP20 and Validates Newly- and Previously-Identified MMP20 Mutations Causing Amelogenesis Imperfecta.

    PubMed

    Gasse, Barbara; Prasad, Megana; Delgado, Sidney; Huckert, Mathilde; Kawczynski, Marzena; Garret-Bernardin, Annelyse; Lopez-Cazaux, Serena; Bailleul-Forestier, Isabelle; Manière, Marie-Cécile; Stoetzel, Corinne; Bloch-Zupan, Agnès; Sire, Jean-Yves

    2017-01-01

    Amelogenesis imperfecta (AI) designates a group of genetic diseases characterized by a large range of enamel disorders causing important social and health problems. These defects can result from mutations in enamel matrix proteins or protease encoding genes. A range of mutations in the enamel cleavage enzyme matrix metalloproteinase-20 gene ( MMP20 ) produce enamel defects of varying severity. To address how various alterations produce a range of AI phenotypes, we performed a targeted analysis to find MMP20 mutations in French patients diagnosed with non-syndromic AI. Genomic DNA was isolated from saliva and MMP20 exons and exon-intron boundaries sequenced. We identified several homozygous or heterozygous mutations, putatively involved in the AI phenotypes. To validate missense mutations and predict sensitive positions in the MMP20 sequence, we evolutionarily compared 75 sequences extracted from the public databases using the Datamonkey webserver. These sequences were representative of mammalian lineages, covering more than 150 million years of evolution. This analysis allowed us to find 324 sensitive positions (out of the 483 MMP20 residues), pinpoint functionally important domains, and build an evolutionary chart of important conserved MMP20 regions. This is an efficient tool to identify new- and previously-identified mutations. We thus identified six functional MMP20 mutations in unrelated families, finding two novel mutated sites. The genotypes and phenotypes of these six mutations are described and compared. To date, 13 MMP20 mutations causing AI have been reported, making these genotypes and associated hypomature enamel phenotypes the most frequent in AI.

  8. In situ genetic correction of F8 intron 22 inversion in hemophilia A patient-specific iPSCs.

    PubMed

    Wu, Yong; Hu, Zhiqing; Li, Zhuo; Pang, Jialun; Feng, Mai; Hu, Xuyun; Wang, Xiaolin; Lin-Peng, Siyuan; Liu, Bo; Chen, Fangping; Wu, Lingqian; Liang, Desheng

    2016-01-08

    Nearly half of severe Hemophilia A (HA) cases are caused by F8 intron 22 inversion (Inv22). This 0.6-Mb inversion splits the 186-kb F8 into two parts with opposite transcription directions. The inverted 5' part (141 kb) preserves the first 22 exons that are driven by the intrinsic F8 promoter, leading to a truncated F8 transcript due to the lack of the last 627 bp coding sequence of exons 23-26. Here we describe an in situ genetic correction of Inv22 in patient-specific induced pluripotent stem cells (iPSCs). By using TALENs, the 627 bp sequence plus a polyA signal was precisely targeted at the junction of exon 22 and intron 22 via homologous recombination (HR) with high targeting efficiencies of 62.5% and 52.9%. The gene-corrected iPSCs retained a normal karyotype following removal of drug selection cassette using a Cre-LoxP system. Importantly, both F8 transcription and FVIII secretion were rescued in the candidate cell types for HA gene therapy including endothelial cells (ECs) and mesenchymal stem cells (MSCs) derived from the gene-corrected iPSCs. This is the first report of an efficient in situ genetic correction of the large inversion mutation using a strategy of targeted gene addition.

  9. In situ genetic correction of F8 intron 22 inversion in hemophilia A patient-specific iPSCs

    PubMed Central

    Wu, Yong; Hu, Zhiqing; Li, Zhuo; Pang, Jialun; Feng, Mai; Hu, Xuyun; Wang, Xiaolin; Lin-Peng, Siyuan; Liu, Bo; Chen, Fangping; Wu, Lingqian; Liang, Desheng

    2016-01-01

    Nearly half of severe Hemophilia A (HA) cases are caused by F8 intron 22 inversion (Inv22). This 0.6-Mb inversion splits the 186-kb F8 into two parts with opposite transcription directions. The inverted 5′ part (141 kb) preserves the first 22 exons that are driven by the intrinsic F8 promoter, leading to a truncated F8 transcript due to the lack of the last 627 bp coding sequence of exons 23–26. Here we describe an in situ genetic correction of Inv22 in patient-specific induced pluripotent stem cells (iPSCs). By using TALENs, the 627 bp sequence plus a polyA signal was precisely targeted at the junction of exon 22 and intron 22 via homologous recombination (HR) with high targeting efficiencies of 62.5% and 52.9%. The gene-corrected iPSCs retained a normal karyotype following removal of drug selection cassette using a Cre-LoxP system. Importantly, both F8 transcription and FVIII secretion were rescued in the candidate cell types for HA gene therapy including endothelial cells (ECs) and mesenchymal stem cells (MSCs) derived from the gene-corrected iPSCs. This is the first report of an efficient in situ genetic correction of the large inversion mutation using a strategy of targeted gene addition. PMID:26743572

  10. Conservation/Mutation in the Splice Sites of Mitochondrial Solute Carrier Genes of Vertebrates.

    PubMed

    Calvello, Rosa; Panaro, Maria A; Salvatore, Rosaria; Mitolo, Vincenzo; Cianciulli, Antonia

    2016-10-01

    The "canonical" introns begin by the dinucleotide GT and end by the dinucleotide AG. GT, together with a few downstream nucleotides, and AG, with a few of the immediately preceding nucleotides, are thought to be the strongest splicing signals (5'ss and 3'ss, respectively). We examined the composition of the intronic initial and terminal hexanucleotides of the mitochondrial solute carrier genes (SLC25A's) of zebrafish, chicken, mouse, and human. These genes are orthologous and we selected the transcripts in which the arrangement of exons and introns was superimposable in the species considered. Both 5'ss and 3'ss were highly polymorphic, with 104 and 126 different configurations, respectively, in our sample. In the line of evolution from zebrafish to chicken, as well as in that from zebrafish to mammals, the average nucleotide conservation in the four variable nucleotides was about 50 % at 5' and 40 % at 3'. In the divergent evolution of mouse and human, the conservation was about 80 % at 5' and 70 % at 3'. Despite these changes, the splicing signals remain strong enough to operate at the same site. At both 5' and 3', the frequency of a nucleotide at a given position in the zebrafish sequence is positively correlated with its conservation in chicken and mammals, suggesting that selection continued to operate in birds and mammals along similar lines.

  11. Intronic Deletions That Disrupt mRNA Splicing of the tva Receptor Gene Result in Decreased Susceptibility to Infection by Avian Sarcoma and Leukosis Virus Subgroup A

    PubMed Central

    Reinišová, Markéta; Plachý, Jiří; Trejbalová, Kateřina; Šenigl, Filip; Kučerová, Dana; Geryk, Josef; Svoboda, Jan

    2012-01-01

    The group of closely related avian sarcoma and leukosis viruses (ASLVs) evolved from a common ancestor into multiple subgroups, A to J, with differential host range among galliform species and chicken lines. These subgroups differ in variable parts of their envelope glycoproteins, the major determinants of virus interaction with specific receptor molecules. Three genetic loci, tva, tvb, and tvc, code for single membrane-spanning receptors from diverse protein families that confer susceptibility to the ASLV subgroups. The host range expansion of the ancestral virus might have been driven by gradual evolution of resistance in host cells, and the resistance alleles in all three receptor loci have been identified. Here, we characterized two alleles of the tva receptor gene with similar intronic deletions comprising the deduced branch-point signal within the first intron and leading to inefficient splicing of tva mRNA. As a result, we observed decreased susceptibility to subgroup A ASLV in vitro and in vivo. These alleles were independently found in a close-bred line of domestic chicken and Indian red jungle fowl (Gallus gallus murghi), suggesting that their prevalence might be much wider in outbred chicken breeds. We identified defective splicing to be a mechanism of resistance to ASLV and conclude that such a type of mutation could play an important role in virus-host coevolution. PMID:22171251

  12. Detection of Emerging Vaccine-Related Polioviruses by Deep Sequencing.

    PubMed

    Sahoo, Malaya K; Holubar, Marisa; Huang, ChunHong; Mohamed-Hadley, Alisha; Liu, Yuanyuan; Waggoner, Jesse J; Troy, Stephanie B; Garcia-Garcia, Lourdes; Ferreyra-Reyes, Leticia; Maldonado, Yvonne; Pinsky, Benjamin A

    2017-07-01

    Oral poliovirus vaccine can mutate to regain neurovirulence. To date, evaluation of these mutations has been performed primarily on culture-enriched isolates by using conventional Sanger sequencing. We therefore developed a culture-independent, deep-sequencing method targeting the 5' untranslated region (UTR) and P1 genomic region to characterize vaccine-related poliovirus variants. Error analysis of the deep-sequencing method demonstrated reliable detection of poliovirus mutations at levels of <1%, depending on read depth. Sequencing of viral nucleic acids from the stool of vaccinated, asymptomatic children and their close contacts collected during a prospective cohort study in Veracruz, Mexico, revealed no vaccine-derived polioviruses. This was expected given that the longest duration between sequenced sample collection and the end of the most recent national immunization week was 66 days. However, we identified many low-level variants (<5%) distributed across the 5' UTR and P1 genomic region in all three Sabin serotypes, as well as vaccine-related viruses with multiple canonical mutations associated with phenotypic reversion present at high levels (>90%). These results suggest that monitoring emerging vaccine-related poliovirus variants by deep sequencing may aid in the poliovirus endgame and efforts to ensure global polio eradication. Copyright © 2017 Sahoo et al.

  13. MLL2 mutation detection in 86 patients with Kabuki syndrome: a genotype-phenotype study.

    PubMed

    Makrythanasis, P; van Bon, B W; Steehouwer, M; Rodríguez-Santiago, B; Simpson, M; Dias, P; Anderlid, B M; Arts, P; Bhat, M; Augello, B; Biamino, E; Bongers, E M H F; Del Campo, M; Cordeiro, I; Cueto-González, A M; Cuscó, I; Deshpande, C; Frysira, E; Izatt, L; Flores, R; Galán, E; Gener, B; Gilissen, C; Granneman, S M; Hoyer, J; Yntema, H G; Kets, C M; Koolen, D A; Marcelis, C l; Medeira, A; Micale, L; Mohammed, S; de Munnik, S A; Nordgren, A; Psoni, S; Reardon, W; Revencu, N; Roscioli, T; Ruiterkamp-Versteeg, M; Santos, H G; Schoumans, J; Schuurs-Hoeijmakers, J H M; Silengo, M C; Toledo, L; Vendrell, T; van der Burgt, I; van Lier, B; Zweier, C; Reymond, A; Trembath, R C; Perez-Jurado, L; Dupont, J; de Vries, B B A; Brunner, H G; Veltman, J A; Merla, G; Antonarakis, S E; Hoischen, A

    2013-12-01

    Recently, pathogenic variants in the MLL2 gene were identified as the most common cause of Kabuki (Niikawa-Kuroki) syndrome (MIM#147920). To further elucidate the genotype-phenotype correlation, we studied a large cohort of 86 clinically defined patients with Kabuki syndrome (KS) for mutations in MLL2. All patients were assessed using a standardized phenotype list and all were scored using a newly developed clinical score list for KS (MLL2-Kabuki score 0-10). Sequencing of the full coding region and intron-exon boundaries of MLL2 identified a total of 45 likely pathogenic mutations (52%): 31 nonsense, 10 missense and four splice-site mutations, 34 of which were novel. In five additional patients, novel, i.e. non-dbSNP132 variants of clinically unknown relevance, were identified. Patients with likely pathogenic nonsense or missense MLL2 mutations were usually more severely affected (median 'MLL2-Kabuki score' of 6) as compared to the patients without MLL2 mutations (median 'MLL2-Kabuki score' of 5), a significant difference (p < 0.0014). Several typical facial features such as large dysplastic ears, arched eyebrows with sparse lateral third, blue sclerae, a flat nasal tip with a broad nasal root, and a thin upper and a full lower lip were observed more often in mutation positive patients. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  14. Two novel AGXT mutations identified in primary hyperoxaluria type-1 and distinct morphological and structural difference in kidney stones

    PubMed Central

    Wang, Cui; Lu, Jingru; Lang, Yanhua; Liu, Ting; Wang, Xiaoling; Zhao, Xiangzhong; Shao, Leping

    2016-01-01

    Primary hyperoxaluria type 1 (PH1) is a rare genetic disease characterized by excessive oxalate accumulation in plasma and urine, resulting in various phenotypes because of allelic and clinical heterogeneity. This study aimed to detect disease-associated genetic mutations in three PH1 patients in a Chinese family. All AGXT exons and 3 common polymorphisms which might synergistically interact with mutations, including P11L, I340 M and IVSI+74 bp were analyzed by direct sequencing in all family members. It demonstrated that in each of three patients, a previously reported nonsense mutation p.R333* was in cis with a novel missense mutation p.M49L in the minor allele characterized by the polymorphism of 74-bp duplication in intron 1, while the other novel missense mutation p.N72I was in trans with both p.R333* and P.M49L in the major allele. Kidney stones from two sibling patients were also observed though stereomicroscopic examination and scanning electron microscopy. Distinct morphological and inner-structure differences in calculi were noticed, suggesting clinical heterozygosity of PH1 to a certain extent. In brief, two novel missense mutations were identified probably in association with PH1, a finding which should provide an accurate tool for prenatal diagnosis, genetic counseling and screening for potential presymptomatic individuals. PMID:27644547

  15. Two novel AGXT mutations identified in primary hyperoxaluria type-1 and distinct morphological and structural difference in kidney stones.

    PubMed

    Wang, Cui; Lu, Jingru; Lang, Yanhua; Liu, Ting; Wang, Xiaoling; Zhao, Xiangzhong; Shao, Leping

    2016-09-20

    Primary hyperoxaluria type 1 (PH1) is a rare genetic disease characterized by excessive oxalate accumulation in plasma and urine, resulting in various phenotypes because of allelic and clinical heterogeneity. This study aimed to detect disease-associated genetic mutations in three PH1 patients in a Chinese family. All AGXT exons and 3 common polymorphisms which might synergistically interact with mutations, including P11L, I340 M and IVSI+74 bp were analyzed by direct sequencing in all family members. It demonstrated that in each of three patients, a previously reported nonsense mutation p.R333(*) was in cis with a novel missense mutation p.M49L in the minor allele characterized by the polymorphism of 74-bp duplication in intron 1, while the other novel missense mutation p.N72I was in trans with both p.R333(*) and P.M49L in the major allele. Kidney stones from two sibling patients were also observed though stereomicroscopic examination and scanning electron microscopy. Distinct morphological and inner-structure differences in calculi were noticed, suggesting clinical heterozygosity of PH1 to a certain extent. In brief, two novel missense mutations were identified probably in association with PH1, a finding which should provide an accurate tool for prenatal diagnosis, genetic counseling and screening for potential presymptomatic individuals.

  16. The Near Naked Hairless (HrN) Mutation Disrupts Hair Formation but is not Due to a Mutation in the Hairless Coding Region

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Liu, Yutao; Das, Suchita; Olszewski, Robert Edward

    Near naked hairless (HrN) is a semi-dominant mutation that arose spontaneously and was suggested by allelism testing to be an allele of mouse Hairless (Hr). HrN mice differ from other Hr mutants in that hair loss appears as the postnatal coat begins to emerge, as opposed to failure to initiate the first postnatal hair cycle, and that the mutation displays semi-dominant inheritance. We sequenced the Hr cDNA in HrN/HrN mice and characterized the pathological and molecular phenotypes to identify the basis for hair loss in this model. HrN/HrN mice exhibit dystrophic hairs that are unable to consistently emerge from themore » hair follicle, while HrN/+ mice display a sparse coat of hair and a milder degree of follicular dystrophy than their homozygous littermates. DNA microarray analysis of cutaneous gene expression demonstrates that numerous genes are downregulated in HrN/HrN mice, primarily genes important for hair structure. By contrast, Hr expression is significantly increased. Sequencing the Hr coding region, intron-exon boundaries, 5'- and 3'- UTR and immediate upstream region did not reveal the underlying mutation. Therefore HrN does not appear to be an allele of Hr but may result from a mutation in a closely linked gene or from a regulatory mutation in Hr.« less

  17. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    PubMed

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  18. SelTarbase, a database of human mononucleotide-microsatellite mutations and their potential impact to tumorigenesis and immunology

    PubMed Central

    Woerner, Stefan M.; Yuan, Yan P.; Benner, Axel; Korff, Sebastian; von Knebel Doeberitz, Magnus; Bork, Peer

    2010-01-01

    About 15% of human colorectal cancers and, at varying degrees, other tumor entities as well as nearly all tumors related to Lynch syndrome are hallmarked by microsatellite instability (MSI) as a result of a defective mismatch repair system. The functional impact of resulting mutations depends on their genomic localization. Alterations within coding mononucleotide repeat tracts (MNRs) can lead to protein truncation and formation of neopeptides, whereas alterations within untranslated MNRs can alter transcription level or transcript stability. These mutations may provide selective advantage or disadvantage to affected cells. They may further concern the biology of microsatellite unstable cells, e.g. by generating immunogenic peptides induced by frameshifts mutations. The Selective Targets database (http://www.seltarbase.org) is a curated database of a growing number of public MNR mutation data in microsatellite unstable human tumors. Regression calculations for various MSI–H tumor entities indicating statistically deviant mutation frequencies predict TGFBR2, BAX, ACVR2A and others that are shown or highly suspected to be involved in MSI tumorigenesis. Many useful tools for further analyzing genomic DNA, derived wild-type and mutated cDNAs and peptides are integrated. A comprehensive database of all human coding, untranslated, non-coding RNA- and intronic MNRs (MNR_ensembl) is also included. Herewith, SelTarbase presents as a plenty instrument for MSI-carcinogenesis-related research, diagnostics and therapy. PMID:19820113

  19. Eosinophilic myositis as first manifestation in a patient with type 2 myotonic dystrophy CCTG expansion mutation and rheumatoid arthritis.

    PubMed

    Meyer, Alain; Lannes, Béatrice; Carapito, Raphaël; Bahram, Seiamak; Echaniz-Laguna, Andoni; Geny, Bernard; Sibilia, Jean; Gottenberg, Jacques Eric

    2015-02-01

    Eosinophilic myositis is characterized by eosinophilic infiltration of skeletal muscles. In the absence of an identifiable causative factor or source (including parasitic infection, intake of drugs or L-tryptophan, certain systemic disorders as well as malignant diseases), the diagnosis of idiopathic eosinophilic myositis is usually retained. However, some muscular dystrophies have been recently identified in this subset of eosinophilic myositis. Here, we report a patient with an 8 kb CCTG expansion in intron 1 of the CNBP gene, a mutation characteristic of myotonic dystrophy type 2 (DM2), whose first manifestation was "idiopathic" eosinophilic myositis. This report suggests that in "idiopathic" eosinophilic myositis, clinicians should consider muscular dystrophies, including DM2. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis

    PubMed Central

    Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra

    2016-01-01

    Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227

  1. Investigation of inflicted injury in a young girl reveals mild haemophilia A and Turner's syndrome.

    PubMed

    Williams, V K; Suppiah, R; Coppin, B; Nicholls, C M; Simsek, A; McGregor, L K

    2012-02-01

    A 2-year-old girl presented to casualty with a right knee effusion after apparently minor trauma. Inflicted injury was suspected and full forensic coagulation studies were performed which revealed a mild deficiency of factor VIII. Screening of the exons and intron/exon boundaries of F8 gene indicated that the child appeared to be homozygous for the missense mutation c.5123G>A (p.Arg1708His) in exon 14 of the F8 gene. This mutation has been reported to be associated with mild haemophilia A. The possibility of hemizygosity had been masked by the test kit employed but referral to the genetics service and subsequent array CGH resulted in a diagnosis of Turner syndrome. © 2011 Blackwell Publishing Ltd.

  2. Mutational analysis of COL1A1 and COL1A2 genes among Estonian osteogenesis imperfecta patients.

    PubMed

    Zhytnik, Lidiia; Maasalu, Katre; Reimann, Ene; Prans, Ele; Kõks, Sulev; Märtson, Aare

    2017-08-15

    Osteogenesis imperfecta (OI) is a rare bone disorder. In 90% of cases, OI is caused by mutations in the COL1A1/2 genes, which code procollagen α1 and α2 chains. The main aim of the current research was to identify the mutational spectrum of COL1A1/2 genes in Estonian patients. The small population size of Estonia provides a unique chance to explore the collagen I mutational profile of 100% of OI families in the country. We performed mutational analysis of peripheral blood gDNA of 30 unrelated Estonian OI patients using Sanger sequencing of COL1A1 and COL1A2 genes, including all intron-exon junctions and 5'UTR and 3'UTR regions, to identify causative OI mutations. We identified COL1A1/2 mutations in 86.67% of patients (26/30). 76.92% of discovered mutations were located in the COL1A1 (n = 20) and 23.08% in the COL1A2 (n = 6) gene. Half of the COL1A1/2 mutations appeared to be novel. The percentage of quantitative COL1A1/2 mutations was 69.23%. Glycine substitution with serine was the most prevalent among missense mutations. All qualitative mutations were situated in the chain domain of pro-α1/2 chains. Our study shows that among the Estonian OI population, the range of collagen I mutations is quite high, which agrees with other described OI cohorts of Northern Europe. The Estonian OI cohort differs due to the high number of quantitative variants and simple missense variants, which are mostly Gly to Ser substitutions and do not extend the chain domain of COL1A1/2 products.

  3. Mutations in the small nuclear riboprotein 200 kDa gene (SNRNP200) cause 1.6% of autosomal dominant retinitis pigmentosa

    PubMed Central

    Sullivan, Lori S.; Avery, Cheryl E.; Sasser, Elizabeth M.; Roorda, Austin; Duncan, Jacque L.; Wheaton, Dianna H.; Birch, David G.; Branham, Kari E.; Heckenlively, John R.; Sieving, Paul A.; Daiger, Stephen P.

    2013-01-01

    Purpose The purpose of this project was to determine the spectrum and frequency of mutations in the small nuclear riboprotein 200 kDa gene (SNRNP200) that cause autosomal dominant retinitis pigmentosa (adRP). Methods A well-characterized adRP cohort of 251 families was tested for mutations in the exons and intron/exon junctions of SNRNP200 using fluorescent dideoxy sequencing. An additional 21 adRP families from the eyeGENE® Network were tested for possible mutations. Bioinformatic and segregation analysis was performed on novel variants. Results SNRNP200 mutations were identified in seven of the families tested. Two previously reported mutations, p.Arg681Cys and p.Ser1087Leu, were found in two families each. One family had the previously reported p.Arg681His mutation. Two novel SNRNP200 variants, p.Pro682Ser and p.Ala542Val, were also identified in one family each. Bioinformatic and segregation analyses suggested that these novel variants are likely to be pathogenic. Clinical examination of patients with SNRNP200 mutations showed a wide range of clinical symptoms and severity, including one instance of non-penetrance. Conclusions Mutations in SNRNP200 caused 1.6% of disease in our adRP cohort. Pathogenic mutations were found primarily in exons 16 and 25, but the novel p.Ala542Val mutation in exon 13 suggests that variation in other genetic regions is also responsible for causing dominant disease. SNRNP200 mutations were associated with a wide range of clinical symptoms similar to those of individuals with other splice-factor gene mutations. PMID:24319334

  4. Deep Sequencing-guided Design of a High Affinity Dual Specificity Antibody to Target Two Angiogenic Factors in Neovascular Age-related Macular Degeneration* ♦

    PubMed Central

    Koenig, Patrick; Lee, Chingwei V.; Sanowar, Sarah; Wu, Ping; Stinson, Jeremy; Harris, Seth F.; Fuh, Germaine

    2015-01-01

    The development of dual targeting antibodies promises therapies with improved efficacy over mono-specific antibodies. Here, we engineered a Two-in-One VEGF/angiopoietin 2 antibody with dual action Fab (DAF) as a potential therapeutic for neovascular age-related macular degeneration. Crystal structures of the VEGF/angiopoietin 2 DAF in complex with its two antigens showed highly overlapping binding sites. To achieve sufficient affinity of the DAF to block both angiogenic factors, we turned to deep mutational scanning in the complementarity determining regions (CDRs). By mutating all three CDRs of each antibody chain simultaneously, we were able not only to identify affinity improving single mutations but also mutation pairs from different CDRs that synergistically improve both binding functions. Furthermore, insights into the cooperativity between mutations allowed us to identify fold-stabilizing mutations in the CDRs. The data obtained from deep mutational scanning reveal that the majority of the 52 CDR residues are utilized differently for the two antigen binding function and permit, for the first time, the engineering of several DAF variants with sub-nanomolar affinity against two structurally unrelated antigens. The improved variants show similar blocking activity of receptor binding as the high affinity mono-specific antibodies against these two proteins, demonstrating the feasibility of generating a dual specificity binding surface with comparable properties to individual high affinity mono-specific antibodies. PMID:26088137

  5. Genome-wide mapping of alternative splicing in Arabidopsis thaliana

    PubMed Central

    Filichkin, Sergei A.; Priest, Henry D.; Givan, Scott A.; Shen, Rongkun; Bryant, Douglas W.; Fox, Samuel E.; Wong, Weng-Keen; Mockler, Todd C.

    2010-01-01

    Alternative splicing can enhance transcriptome plasticity and proteome diversity. In plants, alternative splicing can be manifested at different developmental stages, and is frequently associated with specific tissue types or environmental conditions such as abiotic stress. We mapped the Arabidopsis transcriptome at single-base resolution using the Illumina platform for ultrahigh-throughput RNA sequencing (RNA-seq). Deep transcriptome sequencing confirmed a majority of annotated introns and identified thousands of novel alternatively spliced mRNA isoforms. Our analysis suggests that at least ∼42% of intron-containing genes in Arabidopsis are alternatively spliced; this is significantly higher than previous estimates based on cDNA/expressed sequence tag sequencing. Random validation confirmed that novel splice isoforms empirically predicted by RNA-seq can be detected in vivo. Novel introns detected by RNA-seq were substantially enriched in nonconsensus terminal dinucleotide splice signals. Alternative isoforms with premature termination codons (PTCs) comprised the majority of alternatively spliced transcripts. Using an example of an essential circadian clock gene, we show that intron retention can generate relatively abundant PTC+ isoforms and that this specific event is highly conserved among diverse plant species. Alternatively spliced PTC+ isoforms can be potentially targeted for degradation by the nonsense mediated mRNA decay (NMD) surveillance machinery or regulate the level of functional transcripts by the mechanism of regulated unproductive splicing and translation (RUST). We demonstrate that the relative ratios of the PTC+ and reference isoforms for several key regulatory genes can be considerably shifted under abiotic stress treatments. Taken together, our results suggest that like in animals, NMD and RUST may be widespread in plants and may play important roles in regulating gene expression. PMID:19858364

  6. Novel Single-Base Deletional Mutation in Major Intrinsic Protein (MIP) in Autosomal Dominant Cataract

    PubMed Central

    Geyer, David D.; Spence, M. Anne; Johannes, Meriam; Flodman, Pamela; Clancy, Kevin P.; Berry, Rebecca; Sparkes, Robert S.; Jonsen, Matthew D.; Isenberg, Sherwin J.; Bateman, J. Bronwyn

    2006-01-01

    PURPOSE To further elucidate the cataract phenotype, and identify the gene and mutation for autosomal dominant cataract (ADC) in an American family of European descent (ADC2) by sequencing the major intrinsic protein gene (MIP), a candidate based on linkage to chromosome 12q13. DESIGN Observational case series and laboratory experimental study. METHODS We examined two at-risk individuals in ADC2. We PCR-amplified and sequenced all four exons and all intron-exon boundaries of the MIP gene from genomic and cloned DNA in affected members to confirm one variant as the putative mutation. RESULTS We found a novel single deletion of nucleotide (nt) 3223 (within codon 235) in exon four, causing a frameshift that alters 41 of 45 subsequent amino acids and creates a premature stop codon. CONCLUSIONS We identified a novel single base pair deletion in the MIP gene and conclude that it is a pathogenic sequence alteration. PMID:16564824

  7. TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region.

    PubMed

    Wise, C A; Chiang, L C; Paznekas, W A; Sharma, M; Musy, M M; Ashley, J A; Lovett, M; Jabs, E W

    1997-04-01

    Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development.

  8. TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region

    PubMed Central

    Wise, Carol A.; Chiang, Lydia C.; Paznekas, William A.; Sharma, Mridula; Musy, Maurice M.; Ashley, Jennifer A.; Lovett, Michael; Jabs, Ethylin W.

    1997-01-01

    Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development. PMID:9096354

  9. Mutations of the RTEL1 Helicase in a Hoyeraal-Hreidarsson Syndrome Patient Highlight the Importance of the ARCH Domain.

    PubMed

    Jullien, Laurent; Kannengiesser, Caroline; Kermasson, Laetitia; Cormier-Daire, Valérie; Leblanc, Thierry; Soulier, Jean; Londono-Vallejo, Arturo; de Villartay, Jean-Pierre; Callebaut, Isabelle; Revy, Patrick

    2016-05-01

    The DNA helicase RTEL1 participates in telomere maintenance and genome stability. Biallelic mutations in the RTEL1 gene account for the severe telomere biology disorder characteristic of the Hoyeraal-Hreidarsson syndrome (HH). Here, we report a HH patient (P4) carrying two novel compound heterozygous mutations in RTEL1: a premature stop codon (c.949A>T, p.Lys317*) and an intronic deletion leading to an exon skipping and an in-frame deletion of 25 amino-acids (p.Ile398_Lys422). P4's cells exhibit short and dysfunctional telomeres similarly to other RTEL1-deficient patients. 3D structure predictions indicated that the p.Ile398_Lys422 deletion affects a part of the helicase ARCH domain, which lines the pore formed with the core HD and the iron-sulfur cluster domains and is highly specific of sequences from the eukaryotic XPD family members. © 2016 WILEY PERIODICALS, INC.

  10. Observation of c.260A > G mutation in superoxide dismutase 1 that causes p.Asn86Ser in Iranian amyotrophic lateral sclerosis patient and absence of genotype/phenotype correlation.

    PubMed

    Khani, Marzieh; Alavi, Afagh; Nafissi, Shahriar; Elahi, Elahe

    2015-07-06

    Amyotrophic lateral sclerosis (ALS) is the most common motor neuron disorder in European populations. ALS can be sporadic ALS (SALS) or familial ALS (FALS). Among 20 known ALS genes, mutations in C9orf72 and superoxide dismutase 1 (SOD1) are the most common genetic causes of the disease. Whereas C9orf72 mutations are more common in Western populations, the contribution of SOD1 to ALS in Iran is more than C9orf72. At present, a clear genotype/phenotype correlation for ALS has not been identified. We aimed to perform mutation screening of SOD1 in a newly identified Iranian FALS patient and to assess whether a genotype/phenotype correlation for the identified mutation exists. The five exons of SOD1 and flanking intronic sequences of a FALS proband were screened for mutations by direct sequencing. The clinical features of the proband were assessed by a neuromuscular specialist (SN). The phenotypic presentations were compared to previously reported patients with the same mutation. Heterozygous c.260A > G mutation in SOD1 that causes Asn86Ser was identified in the proband. Age at onset was 34 years and site of the first presentation was in the lower extremities. Comparisons of clinical features of different ALS patients with the same mutation evidenced variable presentations. The c.260A > G mutation in SOD1 that causes Asn86Ser appears to cause ALS with variable clinical presentations.

  11. HSJ1-related hereditary neuropathies: novel mutations and extended clinical spectrum.

    PubMed

    Gess, Burkhard; Auer-Grumbach, Michaela; Schirmacher, Anja; Strom, Tim; Zitzelsberger, Manuela; Rudnik-Schöneborn, Sabine; Röhr, Dominik; Halfter, Hartmut; Young, Peter; Senderek, Jan

    2014-11-04

    To determine the nature and frequency of HSJ1 mutations in patients with hereditary motor and hereditary motor and sensory neuropathies. Patients were screened for mutations by genome-wide or targeted linkage and homozygosity studies, whole-exome sequencing, and Sanger sequencing. RNA and protein studies of skin fibroblasts were used for functional characterization. We describe 2 additional mutations in the HSJ1 gene in a cohort of 90 patients with autosomal recessive distal hereditary motor neuropathy (dHMN) and Charcot-Marie-Tooth disease type 2 (CMT2). One family with a dHMN phenotype showed the homozygous splice-site mutation c.229+1G>A, which leads to retention of intron 4 in the HSJ1 messenger RNA with a premature stop codon and loss of protein expression. Another family, presenting with a CMT2 phenotype, carried the homozygous missense mutation c.14A>G (p.Tyr5Cys). This mutation was classified as likely disease-related by several automatic algorithms for prediction of possible impact of an amino acid substitution on the structure and function of proteins. Both mutations cosegregated with autosomal recessive inheritance of the disease and were absent from the general population. Taken together, in our cohort of 90 probands, we confirm that HSJ1 mutations are a rare but detectable cause of autosomal recessive dHMN and CMT2. We provide clinical and functional information on an HSJ1 splice-site mutation and report the detailed phenotype of 2 patients with CMT2, broadening the phenotypic spectrum of HSJ1-related neuropathies. © 2014 American Academy of Neurology.

  12. Genotype-phenotype correlations of dyshormonogenetic goiter in children and adolescents from South India

    PubMed Central

    Ramesh, Bangaraiah Gari; Bhargav, Panchangam Ramakanth; Rajesh, Bangaraiah Gari; Devi, Nangedda Vimala; Vijayaraghavan, Rajagopalan; Varma, Bhongir Aparna

    2016-01-01

    Background: Dyshormonogenetic goiter is one of the most common causes of hypothyroidism in children and adolescents in iodine nonendemic areas. The exact genotype-phenotypic correlations (GPCs) and risk categorization of hypothyroid phenotypes of dyshormonogenetic mutations are largely speculative. The genetic studies in pediatric dyshormonogenesis are very sparse from Indian sub-continent. In this context, we analyzed the implications of TPO, NIS, and DUOX2 gene mutations in hypothyroid children with dyshormonogenetic hypothyroidism (DH) from South India. Materials and Methods: This is interdisciplinary prospective study, we employed eight sets of primers and screened for 142 known single nucleotide polymorphisms in TPO, NIS, and DUOX2 genes. The subjects were children and adolescents with hypothyroidism due to dyshormonogenetic goiter. Congenital hypothyroidism, iodine deficiency, and Hashimoto's thyroiditis cases were excluded. Results: We detected nine mutations in 8/22 (36%) children. All the mutations were observed in the intronic regions of NIS gene and none in TPO or DUOX2 genes. Except for bi-allelic, synonymous polymorphism of TPO gene in child number 14, all other mutations were heterozygous in nature. GPCs show that our mutations significantly expressed the phenotypic traits such as overt hypothyroidism, goiter, and existence of family history. Other phenotypic characters such as sex predilection, the age of onset and transitory nature of hypothyroidism were not significantly affected by these mutations. Conclusion: NIS gene mutations alone appears to be most prevalent mutations in DH among South Indian children and these mutations significantly influenced phenotypic expressions such as severity of hypothyroidism, goiter rates, and familial clustering. PMID:27867886

  13. GH-releasing hormone receptor gene: a novel splice-disrupting mutation and study of founder effects.

    PubMed

    Marui, Suemi; Trarbach, Ericka B; Boguszewski, Margaret C S; França, Marcela M; Jorge, Alexander A L; Inoue, Hiroshi; Nishi, Mirian Y; de Lacerda Filho, Luiz; Aguiar-Oliveira, Manuel H; Mendonca, Berenice B; Arnhold, Ivo J P

    2012-01-01

    Mutations in GH-releasing hormone receptor gene (GHRHR) are emerging as the most common cause of autosomal recessive isolated GH deficiency (IGHD). To search for GHRHR mutations in patients with familial or sporadic IGHD and to investigate founder effects in recurring mutations. The coding region of GHRHR was entirely amplified and sequenced from DNA of 18 patients with IGHD (16 unrelated) with topic posterior pituitary lobe on MRI. Haplotypes containing promoter SNPs and microsatellites flanking GHRHR were analyzed in patients with c.57+1G>A (IVS1+1G>A) mutation of our previously published kindred and also a Brazilian patient and 2 previously reported Japanese sisters with c.1146G>A (p.E382E) mutation. A novel homozygous intronic GHRHR c.752-1G>A (IVS7-1G>A) mutation, predicting loss of the constitutive splice acceptor site, was identified in two siblings with IGHD. A compound heterozygous c.[57+1G>A];[1146G>A] and a heterozygous c.527C>T (p.A176V) were found in two sporadic cases. Haplotype analysis provided evidence for a founder effect for the c.57+1G>A mutation and independent recurrence for the c.1146G>A mutation. We report a novel splice-disrupting mutation in GHRHR in 2 siblings and provide evidence that all c.57+1G>A (IVS1+1G>A) mutant chromosomes have the same haplotype ancestor, indicating the occurrence of a founder effect in Brazilian patients with IGHD. Copyright © 2012 S. Karger AG, Basel.

  14. Genotype-phenotype correlation of xeroderma pigmentosum in a Chinese Han population.

    PubMed

    Sun, Z; Zhang, J; Guo, Y; Ni, C; Liang, J; Cheng, R; Li, M; Yao, Z

    2015-04-01

    Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by extreme sensitivity to sunlight, freckle-like pigmentation and a greatly increased incidence of skin cancers. Genetic mutation detection and genotype-phenotype analysis of XP are rarely reported in the Chinese Han population. To investigate the mutational spectrum of XP in a Chinese Han population, to discover any genotype-phenotype correlation and, consequently, to propose a simple and effective tool for the molecular diagnosis of XP. This study was carried out on 12 unrelated Chinese families that included 13 patients with clinically suspected XP. Genomic DNA was extracted from peripheral blood samples. Mutation screening was performed by direct sequencing of exons and flanking intron-exon boundaries for the entire coding region of eight XP genes. In 12 patients, direct sequencing of the whole coding region of eight XP genes revealed pathogenic mutations, including seven compound heterozygous mutations, three homozygous mutations and a Japanese founder mutation. Thirteen mutations have not been previously identified. This cohort was composed of four patients with XP-C (XPC), two with XP-G (ERCC5), three with XP-A (XPA) and three with XP-V (POLH). This study identified 13 novel mutations and extended the mutation spectrum of XP in the Chinese Han population. In this cohort, we found that patients with XP-G have no neurological symptoms, and patients with XP-A and XP-V have a high incidence of malignancy. Furthermore, lack of stringent protection against sunlight, late diagnosis and long duration of disease play an important role. © 2014 British Association of Dermatologists.

  15. A Novel Deletion Mutation in the MEN1 Gene in a Patient with Prolactinoma and a Family History of Pancreatic Tumors.

    PubMed

    Kageyama, Kazunori; Usui, Takeshi; Yoshizawa, Kaori; Daimon, Makoto

    2014-09-01

    Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant tumor syndrome caused by mutations in the MEN1 gene. Mutations in this tumor suppressor gene are often associated with neuroendocrine tumors. Here we describe a novel deletion mutation at codon 304 in the MEN1 gene of a patient with a prolactinoma and strong family history of pancreatic tumors. We describe the patient's clinical course and mutational analysis and review the relevant literature. A 30-year-old pregnant female was referred to our institution's psychological department for treatment of depression. She had developed a prolactinoma at age 17 and was being treated with 1 mg/week of cabergoline. A medical interview revealed a family history of pancreatic islet cell and other tumors; her mother died of pancreatic cancer, her brother is living with gastrinoma, and her sister died of leiomyosarcoma. Extensive examinations performed after delivery, including laboratory tests and computed tomography (CT) scans, did not reveal any other tumors. Mutational analysis of the MEN1 gene identified a heterozygous deletion mutation (c911_914delAGGT) at codon 304. This mutation produces a frameshift at p.304Lys and might disturb the splicing of intron 6 due to the lack of a donor site. The predicted menin protein from the mutated allele is truncated at amino acid 328. We report a novel deletion mutation (c911_914delAGGT) in the MEN1 gene that was likely associated with the patient's prolactinoma and her strong family history of pancreatic tumors.

  16. Missense mutations in SURF1 associated with deficient cytochrome c oxidase assembly in Leigh syndrome patients.

    PubMed

    Poyau, A; Buchet, K; Bouzidi, M F; Zabot, M T; Echenne, B; Yao, J; Shoubridge, E A; Godinot, C

    2000-02-01

    We have studied the fibroblasts of three patients suffering from Leigh syndrome associated with cytochrome c oxidase deficiency (LS-COX-). Their mitochondrial DNA was functional and all nuclear COX subunits had a normal sequence. The expression of transcripts encoding mitochondrial and nuclear COX subunits was normal or slightly increased. Similarly, the OXA1 transcript coding for a protein involved in COX assembly was increased. However, several COX-protein subunits were severely depressed, indicating deficient COX assembly. Surf1, a factor involved in COX biogenesis, was recently reported as mutated in LS-COX- patients, all mutations predicting a truncated protein. Sequence analysis of SURF1 gene in our three patients revealed seven heterozygous mutations, six of which were new : an insertion, a nonsense mutation, a splicing mutation of intron 7 in addition to three missense mutations. The mutation G385 A (Gly124-->Glu) changes a Gly that is strictly conserved in Surfl homologs of 12 species. The substitution G618 C (Asp202-->His), changing an Asp that is conserved only in mammals, appears to be a polymorphism. The mutation T751 C changes Ile246 to Thr, a position at which a hydrophobic amino acid is conserved in all eukaryotic and some bacterial species. Replacing Ile246 by Thr disrupts a predicted beta sheet structure present in all higher eukaryotes. COX activity could be restored in fibroblasts of the three patients by complementation with a retroviral vector containing normal SURF1 cDNA. These mutations identify domains essential to Surf1 protein structure and/or function.

  17. Mhc class II B gene evolution in East African cichlid fishes.

    PubMed

    Figueroa, F; Mayer, W E; Sültmann, H; O'hUigin, C; Tichy, H; Satta, Y; Takezaki, N; Takahata, N; Klein, J

    2000-06-01

    A distinctive feature of essential major histocompatibility complex (Mhc) loci is their polymorphism characterized by large genetic distances between alleles and long persistence times of allelic lineages. Since the lineages often span several successive speciations, we investigated the behavior of the Mhc alleles during or close to the speciation phase. We sequenced exon 2 of the class II B locus 4 from 232 East African cichlid fishes representing 32 related species. The divergence times of the (sub)species ranged from 6,000 to 8.4 million years. Two types of evolutionary analysis were used to elucidate the pattern of exon 2 sequence divergence. First, phylogenetic methods were applied to reconstruct the most likely evolutionary pathways leading from the last common ancestor of the set to the extant sequences, and to assess the probable mechanisms involved in allelic diversification. Second, pairwise comparisons of sequences were carried out to detect differences seemingly incompatible with origin by nonparallel point mutations. The analysis revealed point mutations to be the most important mechanism behind allelic divergences, with recombination playing only an auxiliary part. Comparison of sequences from related species revealed evidence of random allelic (lineage) losses apparently associated with speciation. Sharing of identical alleles could be demonstrated between species that diverged 2 million years ago. The phylogeny of the exon was incongruent with that of the flanking introns, indicating either a high degree of convergent evolution at the peptide-binding region-encoding sites, or intron homogenization.

  18. Positional cloning of the sex-linked giant egg (Ge) locus in the silkworm, Bombyx mori.

    PubMed

    Fujii, T; Abe, H; Kawamoto, M; Banno, Y; Shimada, T

    2015-04-01

    The giant egg (Ge) locus is a Z-linked mutation that leads to the production of large eggs. Cytological observations suggest that an unusual translocation of a large fragment of the W chromosome bearing a putative egg size-determining gene, Esd, gave rise to giant egg mutants. However, there is currently no molecular evidence confirming either a W-Z translocation or the presence of Esd on the W chromosome. To elucidate the origin of giant egg mutants, we performed positional cloning. We observed that the Bombyx mori. orthologue of the human Phytanoyl-CoA dioxygenase domain containing 1 gene (PHYHD1) is disrupted in giant egg mutants. PHYHD1 is highly conserved in eukaryotes and is predicted to be a Fe(II) and 2-oxoglutarate-dependent oxygenase. Exon skipping in one of the two available Ge mutants is probably caused by the insertion of a non-long terminal repeat transposon into intron 4 in the vicinity of the 5' splice site. Segmental duplication in Ge(2) , an independent allele, was caused by unequal recombination between short interspersed elements inserted into introns 3 and 5. Our results indicate that (1) Bombyx PHYHD1 is responsible for the Ge mutants and that (2) the Ge locus is unrelated to the W-linked putative Esd. To our knowledge, this is the first report describing the phenotypic defects caused by mutations in PHYHD1 orthologues. © 2014 The Royal Entomological Society.

  19. Congenital analbuminemia caused by a novel aberrant splicing in the albumin gene.

    PubMed

    Caridi, Gianluca; Dagnino, Monica; Erdeve, Omer; Di Duca, Marco; Yildiz, Duran; Alan, Serdar; Atasay, Begum; Arsan, Saadet; Campagnoli, Monica; Galliano, Monica; Minchiotti, Lorenzo

    2014-01-01

    Congenital analbuminemia is a rare autosomal recessive disorder manifested by the presence of a very low amount of circulating serum albumin. It is an allelic heterogeneous defect, caused by variety of mutations within the albumin gene in homozygous or compound heterozygous state. Herein we report the clinical and molecular characterization of a new case of congenital analbuminemia diagnosed in a female newborn of consanguineous (first degree cousins) parents from Ankara, Turkey, who presented with a low albumin concentration (< 8 g/L) and severe clinical symptoms. The albumin gene of the index case was screened by single-strand conformation polymorphism, heteroduplex analysis, and direct DNA sequencing. The effect of the splicing mutation was evaluated by examining the cDNA obtained by reverse transcriptase - polymerase chain reaction (RT-PCR) from the albumin mRNA extracted from proband's leukocytes. DNA sequencing revealed that the proband is homozygous, and both parents are heterozygous, for a novel G>A transition at position c.1652+1, the first base of intron 12, which inactivates the strongly conserved GT dinucleotide at the 5' splice site consensus sequence of this intron. The splicing defect results in the complete skipping of the preceding exon (exon 12) and in a frame-shift within exon 13 with a premature stop codon after the translation of three mutant amino acid residues. Our results confirm the clinical diagnosis of congenital analbuminemia in the proband and the inheritance of the trait and contribute to shed light on the molecular genetics of analbuminemia.

  20. Pivotal Advance: Eosinophilia in the MES rat strain is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba).

    PubMed

    Mori, Masayuki; Li, Guixin; Hashimoto, Maiko; Nishio, Ayako; Tomozawa, Hiroshi; Suzuki, Nobuyoshi; Usami, Shin-ichi; Higuchi, Keiichi; Matsumoto, Kiyoshi

    2009-09-01

    MES is a rat strain that spontaneously develops severe blood eosinophilia as a hereditary trait. Herein, we report that eosinophilia in MES rats is caused by a loss-of-function mutation in the gene for cytochrome b(-245), alpha polypeptide (Cyba; also known as p22(phox)), which is an essential component of the superoxide-generating NADPH oxidase complex. The MES rat has a deletion of four nucleotides, including the 5' splice donor GpT of intron 4 of the Cyba gene. As a consequence of the deletion, a 51-nucleotide sequence of intron 4 is incorporated into the Cyba transcripts. Leukocytes from the MES strain lack both CYBA protein and NADPH oxidase activity. Nevertheless, unlike patients with chronic granulomatous disease, who suffer from infections with pathogens due to similar genetic defects in NADPH oxidase, MES rats retain normal innate immune defense against Staphylococcus aureus infection. This is due to large quantities of peritoneal eosinophils in MES rats, which phagocytose and kill the bacteria. MES rat has a balance defect due to impaired formation of otoconia in the utricles and saccules. Eosinophilia of the MES rat was normalized by introduction of a normal Cyba transgene. The mechanisms by which impairment of NADPH oxidase leads to eosinophilia in the MES rat are elusive. However, our study highlights the essential role of NADPH oxidase in homeostatic regulation of innate immunity beyond conventional microbicidial functions.

  1. Tannic acid facilitates expression of the polypyrimidine tract binding protein and alleviates deleterious inclusion of CHRNA1 exon P3A due to an hnRNP H-disrupting mutation in congenital myasthenic syndrome

    PubMed Central

    Bian, Yang; Masuda, Akio; Matsuura, Tohru; Ito, Mikako; Okushin, Kazuya; Engel, Andrew G.; Ohno, Kinji

    2009-01-01

    We recently reported that the intronic splice-site mutation IVS3-8G>A of CHRNA1 that encodes the muscle nicotinic acetylcholine receptor α subunit disrupts binding of a splicing repressor, hnRNP H. This, in turn, results in exclusive inclusion of the downstream exon P3A. The P3A(+) transcript encodes a non-functional α subunit that comprises 50% of the transcripts in normal human skeletal muscle, but its functional significance remains undetermined. In an effort to search for a potential therapy, we screened off-label effects of 960 bioactive chemical compounds and found that tannic acid ameliorates the aberrant splicing due to IVS3-8G>A but without altering the expression of hnRNP H. Therefore, we searched for another splicing trans-factor. We found that the polypyrimidine tract binding protein (PTB) binds close to the 3′ end of CHRNA1 intron 3, that PTB induces skipping of exon P3A and that tannic acid increases the expression of PTB in a dose-dependent manner. Deletion assays of the PTB promoter region revealed that the tannic acid-responsive element is between positions −232 and −74 from the translation initiation site. These observations open the door to the discovery of novel therapies based on PTB overexpression and to detecting possible untoward effects of the overexpression. PMID:19147685

  2. Isolated familial somatotropinomas: clinical features and analysis of the MEN1 gene.

    PubMed

    De Menis, Ernesto; Prezant, Toni R

    2002-01-01

    Isolated familial somatotropinomas (IFS) rarely occurs in the absence of multiple endocrine neoplasia type I (MEN1) or the Carney complex. In the present study we report two Italian siblings affected by GH-secreting adenomas. There was no history of parental consanguinity. The sister presented at 18 years of age with secondary amenorrhea and acromegalic features and one of her two brothers presented with gigantism at the same age. Endocrinological investigations confirmed GH hypersecretion in both cases. Although a pituitary microadenoma was detected in both patients, transsphenoidal surgery was not successful. The sister received conventional radiotherapy and acromegaly is now considered controlled; the brother is being treated with octreotide LAR 30 mg monthly and the disease is considered clinically active. Patients, their parents and the unaffected brother underwent extensive evaluation, and no features of MEN1 or Carney complex were found. Analysis of polymorphic microsatellite markers from chromosome 11q13 (D11S599, D11S4945, D11S4939, D11S4938 and D11S987) showed that the acromegalic siblings had inherited different maternal chromosomes and shared the paternal chromosome. No pathogenic MEN1 sequence changes were detected by sequencing or dideoxy fingerprinting of the coding sequence (exons 2-10) and exon/intron junctions. Although mutations in the promoter, introns or untranslated regions of the MEN1 gene cannot be excluded, germline mutations within the coding region of this gene do not appear responsible for IFS in this family.

  3. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  4. Early-Onset X-Linked Retinitis Pigmentosa in a Heterozygous Female Harboring an Intronic Donor Splice Site Mutation in the Retinitis Pigmentosa GTPase Regulator Gene.

    PubMed

    Shifera, Amde Selassie; Kay, Christine Nichols

    2015-01-01

    To report a heterozygous female presenting with an early-onset and severe form of X-linked retinitis pigmentosa (XLRP). This is a case series presenting the clinical findings in a heterozygous female with XLRP and two of her family members. Fundus photography, fundus autofluorescence, ocular coherence tomography, and visual perimetry are presented. The proband reported here is a heterozygous female who presented at the age of 8 years with an early onset and aggressive form of XLRP. The patient belongs to a four-generation family with a total of three affected females and four affected males. The patient was initially diagnosed with retinitis pigmentosa (RP) at the age of 4 years. Genetic testing identified a heterozygous donor splice site mutation in intron 1 (IVS1 + 1G > A) of the retinitis pigmentosa GTPase regulator gene. The father of the proband was diagnosed with RP when he was a young child. The sister of the proband, evaluated at the age of 6 years, showed macular pigmentary changes. Although carriers of XLRP are usually asymptomatic or have a mild disease of late onset, the proband presented here exhibited an early-onset, aggressive form of the disease. It is not clear why some carrier females manifest a severe phenotype. A better understanding of the genetic processes involved in the penetrance and expressivity of XLRP in heterozygous females could assist in providing the appropriate counseling to affected families.

  5. Human retinoblastoma susceptibility gene: genomic organization and analysis of heterozygous intragenic deletion mutants.

    PubMed Central

    Bookstein, R; Lee, E Y; To, H; Young, L J; Sery, T W; Hayes, R C; Friedmann, T; Lee, W H

    1988-01-01

    A gene in chromosome region 13q14 has been identified as the human retinoblastoma susceptibility (RB) gene on the basis of altered gene expression found in virtually all retinoblastomas. In order to further characterize the RB gene and its structural alterations, we examined genomic clones of the RB gene isolated from both a normal human genomic library and a library made from DNA of the retinoblastoma cell line Y79. First, a restriction and exon map of the RB gene was constructed by aligning overlapping genomic clones, yielding three contiguous regions ("contigs") of 150 kilobases total length separated by two gaps. At least 20 exons were identified in genomic clones, and these were provisionally numbered. Second, two overlapping genomic clones that demonstrated a DNA deletion of exons 2 through 6 from one RB allele were isolated from the Y79 library. To confirm and extend this result, a unique sequence probe from intron 1 was used to detect similar and possibly identical heterozygous deletions in genomic DNA from three retinoblastoma cell lines, thereby explaining the origins of their shortened RB mRNA transcripts. The same probe detected genomic rearrangements in fibroblasts from two hereditary retinoblastoma patients, indicating that intron 1 includes a frequent site for mutations conferring predisposition to retinoblastoma. Third, this probe also detected a polymorphic site for BamHI with allele frequencies near 0.5/0.5. Identification of commonly mutated regions will contribute significantly to genetic diagnosis in retinoblastoma patients and families. Images PMID:2895471

  6. G20210A prothrombin gene mutation identified in patients with venous leg ulcers.

    PubMed

    Jebeleanu, G; Procopciuc, L

    2001-01-01

    The G20210A mutation variant of prothrombin gene is the second most frequent mutation identified in patients with deep venous thrombosis, after factor V Leiden. The risk for developing deep venous thrombosis is high in patients identified as heterozygous for G20210A mutation. In order to identify this polymorphism in the gene coding prothrombin, the 345bp fragment in the 3'- untranslated region of the prothrombin gene was amplified using amplification by polymerase chain reaction and enzymatic digestion by HindIII (restriction endonuclease enzyme). The products of amplification and enzymatic's digestion were analized using agarose gel electrophoresis. We investigated 20 patients with venous leg ulcers and we found 2 heterozygous (10%) for G20210A mutation. None of the patients in the control group had G20210A mutation. Our study confirms the presence of G20210A mutation in the Romanian population. Our study also shows the link between venous leg ulcers and this polymorphism in the prothrombin gene.

  7. The genetic characteristics of congenital hypothyroidism in China by comprehensive screening of 21 candidate genes.

    PubMed

    Sun, Feng; Zhang, Jun-Xiu; Yang, Chang-Yi; Gao, Guan-Qi; Zhu, Wen-Bin; Han, Bing; Zhang, Le-Le; Wan, Yue-Yue; Ye, Xiao-Ping; Ma, Yu-Ru; Zhang, Man-Man; Yang, Liu; Zhang, Qian-Yue; Liu, Wei; Guo, Cui-Cui; Chen, Gang; Zhao, Shuang-Xia; Song, Ke-Yi; Song, Huai-Dong

    2018-06-01

    Congenital hypothyroidism (CH), the most common neonatal metabolic disorder, is characterized by impaired neurodevelopment. Although several candidate genes have been associated with CH, comprehensive screening of causative genes has been limited. One hundred ten patients with primary CH were recruited in this study. All exons and exon-intron boundaries of 21 candidate genes for CH were analyzed by next-generation sequencing. And the inheritance pattern of causative genes was analyzed by the study of family pedigrees. Our results showed that 57 patients (51.82%) carried biallelic mutations (containing compound heterozygous mutations and homozygous mutations) in six genes ( DUOX2 , DUOXA2 , DUOXA1 , TG , TPO and TSHR ) involved in thyroid hormone synthesis. Autosomal recessive inheritance of CH caused by mutations in DUOX2 , DUOXA2 , TG and TPO was confirmed by analysis of 22 family pedigrees. Notably, eight mutations in four genes ( FOXE1 , NKX2-1 , PAX8 and HHEX ) that lead to thyroid dysgenesis were identified in eight probands. These mutations were heterozygous in all cases and hypothyroidism was not observed in parents of these probands. Most cases of congenital hypothyroidism in China were caused by thyroid dyshormonogenesis rather than thyroid dysgenesis. This study identified previously reported causative genes for 57/110 Chinese patients and revealed DUOX2 was the most frequently mutated gene in these patients. Our study expanded the mutation spectrum of CH in Chinese patients, which was significantly different from Western countries. © 2018 The authors.

  8. Mutations in STT3A and STT3B cause two congenital disorders of glycosylation

    PubMed Central

    Shrimal, Shiteshu; Ng, Bobby G.; Losfeld, Marie-Estelle; Gilmore, Reid; Freeze, Hudson H.

    2013-01-01

    We describe two unreported types of congenital disorders of glycosylation (CDG) which are caused by mutations in different isoforms of the catalytic subunit of the oligosaccharyltransferase (OST). Each isoform is encoded by a different gene (STT3A or STT3B), resides in a different OST complex and has distinct donor and acceptor substrate specificities with partially overlapping functions in N-glycosylation. The two cases from unrelated consanguineous families both show neurologic abnormalities, hypotonia, intellectual disability, failure to thrive and feeding problems. A homozygous mutation (c.1877T > C) in STT3A causes a p.Val626Ala change and a homozygous intronic mutation (c.1539 + 20G > T) in STT3B causes the other disorder. Both mutations impair glycosylation of a GFP biomarker and are rescued with the corresponding cDNA. Glycosylation of STT3A- and STT3B-specific acceptors is decreased in fibroblasts carrying the corresponding mutated gene and expression of the STT3A (p.Val626Ala) allele in STT3A-deficient HeLa cells does not rescue glycosylation. No additional cases were found in our collection or in reviewing various databases. The STT3A mutation significantly impairs glycosylation of the biomarker transferrin, but the STT3B mutation only slightly affects its glycosylation. Additional cases of STT3B-CDG may be missed by transferrin analysis and will require exome or genome sequencing. PMID:23842455

  9. Identification of three novel mutations by studying the molecular genetics of Maple Syrup Urine Disease (MSUD) in the Lebanese population.

    PubMed

    Tabbouche, Omar; Saker, Amer; Mountain, Harry

    2014-01-01

    Maple Syrup Urine Disease (MSUD) is a genetically heterogeneous metabolic disorder that is transmitted in an autosomal recessive manner. According to clinical data, MSUD prevalence in Lebanon is expected to be higher than the International prevalence because of consanguineous marriage. Novel mutations are still getting detected by using DNA sequencing for mutation analysis in MSUD patients. In the current study, we have extracted DNA from Lebanese MSUD patients in order to amplify the exonic and flanking intronic regions of the genes implicated in MSUD ( BCKDHA , BCKDHB , and DBT ) and sequenced the resultant amplified products to assess the molecular genetics of MSUD in the Lebanese population studied. All of the mutations identified occurred in the homozygous state, which reflects the high rate of consanguineous marriage in Lebanon. In the current study, we have identified one previously cited mutation and three novel mutations not previously described in the scientific literature. The identified mutations were distributed as follows: three patients (60%) had two nucleotide substitutions in the DBT gene (c.224G>A and c.1430T>G), one patient (20%) had a gross deletion in the BCKDHA gene (c.488_1167+3del), and one patient (20%) had a small deletion in the BCKDHB gene (c.92_102del). The majority of the mutations identified in the Lebanese MSUD patients occurred in the DBT gene. Consanguineous marriage is a major risk factor for the prevalence of MSUD in Lebanon.

  10. PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1.

    PubMed

    Wang, Juan; Li, Shiqiang; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

    2010-06-22

    To detect paired box gene 3 (PAX3) mutations and associated phenotypes in Chinese patients with Waardenburg syndrome type 1 (WS1). Five unrelated families with suspected WS1 were selected from our Genomic DNA Repository for Hereditary Eye Diseases. The coding and adjacent intronic regions of PAX3 were amplified by polymerase chain reaction and the amplicons were then analyzed by cycle sequencing. Variations detected were further evaluated in available family members as well as one hundred controls with heteroduplex-single strand conformational polymorphism (heteroduplex-SSCP) analysis and/or clone sequencing. Three novel and two known mutations in PAX3 were detected in five patients, respectively: c.567_586+17del (p.Asp189_Gln505delinsGluGlyGlyAlaLeuAlaGly), c.456_459dupTTCC (p.Ile154PhefsX162), c.795_800delCTGGTT (p.Trp266_Phe267del), c.799T>A (p.Phe267Ile), and c.667C>T (p.Arg223X). Two novel mutations proved to be de novo as their parents did not carry the mutations. All five patients with PAX3 mutations had dystopia canthorum and different iris color and fundi between their two eyes. However, none had white forelock, skin hypopigmentation, and deafness. Our findings expand the frequency and spectrum of PAX3 mutations and ethnic-related phenotypes in Chinese patients with WS1. De novo mutations in PAX3 have not been reported before.

  11. PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1

    PubMed Central

    Wang, Juan; Li, Shiqiang; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming

    2010-01-01

    Purpose To detect paired box gene 3 (PAX3) mutations and associated phenotypes in Chinese patients with Waardenburg syndrome type 1 (WS1). Methods Five unrelated families with suspected WS1 were selected from our Genomic DNA Repository for Hereditary Eye Diseases. The coding and adjacent intronic regions of PAX3 were amplified by polymerase chain reaction and the amplicons were then analyzed by cycle sequencing. Variations detected were further evaluated in available family members as well as one hundred controls with heteroduplex-single strand conformational polymorphism (heteroduplex-SSCP) analysis and/or clone sequencing. Results Three novel and two known mutations in PAX3 were detected in five patients, respectively: c.567_586+17del (p.Asp189_Gln505delinsGluGlyGlyAlaLeuAlaGly), c.456_459dupTTCC (p.Ile154PhefsX162), c.795_800delCTGGTT (p.Trp266_Phe267del), c.799T>A (p.Phe267Ile), and c.667C>T (p.Arg223X). Two novel mutations proved to be de novo as their parents did not carry the mutations. All five patients with PAX3 mutations had dystopia canthorum and different iris color and fundi between their two eyes. However, none had white forelock, skin hypopigmentation, and deafness. Conclusions Our findings expand the frequency and spectrum of PAX3 mutations and ethnic-related phenotypes in Chinese patients with WS1. De novo mutations in PAX3 have not been reported before. PMID:20664692

  12. Novel signal transducer and activator of transcription 3 (STAT3) mutations, reduced T(H)17 cell numbers, and variably defective STAT3 phosphorylation in hyper-IgE syndrome.

    PubMed

    Renner, Ellen D; Rylaarsdam, Stacey; Anover-Sombke, Stephanie; Rack, Anita L; Reichenbach, Janine; Carey, John C; Zhu, Qili; Jansson, Annette F; Barboza, Julia; Schimke, Lena F; Leppert, Mark F; Getz, Melissa M; Seger, Reinhard A; Hill, Harry R; Belohradsky, Bernd H; Torgerson, Troy R; Ochs, Hans D

    2008-07-01

    Hyper-IgE syndrome (HIES) is a rare, autosomal-dominant immunodeficiency characterized by eczema, Staphylococcus aureus skin abscesses, pneumonia with pneumatocele formation, Candida infections, and skeletal/connective tissue abnormalities. Recently it was shown that heterozygous signal transducer and activator of transcription 3 (STAT3) mutations cause autosomal-dominant HIES. To determine the spectrum and functional consequences of heterozygous STAT3 mutations in a cohort of patients with HIES. We sequenced the STAT3 gene in 38 patients with HIES (National Institutes of Health score >40 points) from 35 families, quantified T(H)17 cells in peripheral blood, and evaluated tyrosine phosphorylation of STAT3. Most STAT3 mutations in our cohort were in the DNA-binding domain (DBD; 22/35 families) or Src homology 2 (SH2) domain (10/35) and were missense mutations. We identified 2 intronic mutations resulting in exon skipping and in-frame deletions within the DBD. In addition, we identified 2 mutations located in the transactivation domain downstream of the SH2 domain: a 10-amino acid deletion and an amino acid substitution. In 1 patient, we were unable to identify a STAT3 mutation. T(H)17 cells were absent or low in the peripheral blood of all patients who were evaluated (n = 17). IL-6-induced STAT3-phosphorylation was consistently reduced in patients with SH2 domain mutations but comparable to normal controls in patients with mutations in the DBD. Heterozygous STAT3 mutations were identified in 34 of 35 unrelated HIES families. Patients had impaired T(H)17 cell development, and those with SH2 domain mutations had reduced STAT3 phosphorylation.

  13. A functional study of proximal goat β-casein promoter and intron 1 in immortalized goat mammary epithelial cells.

    PubMed

    Kung, M H; Lee, Y J; Hsu, J T; Huang, M C; Ju, Y T

    2015-06-01

    Goat β-casein (CSN2) promoter has been extensively used to derive expression of recombinant therapeutic protein in transgenic goats; however, little direct evidence exists for signaling molecules and the cis-elements of goat CSN2 promoter in response to lactogenic hormone stimulation in goat mammary epithelial cells. Here, we use an immortalized caprine mammary epithelial cell line (CMC) to search for evidence of the above. Serial 5'-flanking regions deleted of promoter and intron 1 in goat CSN2 (-4,047 to +2,054) driven by firefly luciferase reporter gene were constructed and applied to measure promoter activity in CMC. The intron 1 region (+393 to +501) significantly decreased basal activity of the promoter. This finding contradicts other studies of the role of intron 1. The signal transducer and activator of transcription (STAT)5a played a significant role in activating promoter activity by prolactin stimulation. Hydrocortisone enhanced and prolonged the activity of STAT5a and promoter in CMC, but was independent of the glucocorticoid receptor response element. The minimum length of the CSN2 promoter segment in response to lactogenic stimulation was confirmed by 5' serial deletions. A cis-element located from -300 to -90 in proximal goat CSN2 promoter that is absent in bovine and human CSN2 promoter was newly identified. We demonstrated the presence of a STAT5a binding site (-102 to -82) and preservation of the guanosine nucleotide at position -90 based on responses to the presence of lactogenic hormone using internal deletions and point mutations of the predicted STAT5a binding site, and chromatin immunoprecipitation assay. Together, these findings demonstrate that the proximal -300 bp of goat CSN2 promoter containing the STAT5a binding site (-102 to -82) is the response element for lactogenic hormone stimulation. Additionally, intron 1 may be required for tissue or developmental stage-specific expression in mammary gland. The role of the far-distal regions of goat CSN2 promoter in high-level lactogenic hormone induction and specific expression require further examination. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  14. Cancer-Associated Perturbations in Alternative Pre-messenger RNA Splicing.

    PubMed

    Shkreta, Lulzim; Bell, Brendan; Revil, Timothée; Venables, Julian P; Prinos, Panagiotis; Elela, Sherif Abou; Chabot, Benoit

    2013-01-01

    For most of our 25,000 genes, the removal of introns by pre-messenger RNA (pre-mRNA) splicing represents an essential step toward the production of functional messenger RNAs (mRNAs). Alternative splicing of a single pre-mRNA results in the production of different mRNAs. Although complex organisms use alternative splicing to expand protein function and phenotypic diversity, patterns of alternative splicing are often altered in cancer cells. Alternative splicing contributes to tumorigenesis by producing splice isoforms that can stimulate cell proliferation and cell migration or induce resistance to apoptosis and anticancer agents. Cancer-specific changes in splicing profiles can occur through mutations that are affecting splice sites and splicing control elements, and also by alterations in the expression of proteins that control splicing decisions. Recent progress in global approaches that interrogate splicing diversity should help to obtain specific splicing signatures for cancer types. The development of innovative approaches for annotating and reprogramming splicing events will more fully establish the essential contribution of alternative splicing to the biology of cancer and will hopefully provide novel targets and anticancer strategies. Metazoan genes are usually made up of several exons interrupted by introns. The introns are removed from the pre-mRNA by RNA splicing. In conjunction with other maturation steps, such as capping and polyadenylation, the spliced mRNA is then transported to the cytoplasm to be translated into a functional protein. The basic mechanism of splicing requires accurate recognition of each extremity of each intron by the spliceosome. Introns are identified by the binding of U1 snRNP to the 5' splice site and the U2AF65/U2AF35 complex to the 3' splice site. Following these interactions, other proteins and snRNPs are recruited to generate the complete spliceosomal complex needed to excise the intron. While many introns are constitutively removed by the spliceosome, other splice junctions are not used systematically, generating the phenomenon of alternative splicing. Alternative splicing is therefore the process by which a single species of pre-mRNA can be matured to produce different mRNA molecules (Fig. 1). Depending on the number and types of alternative splicing events, a pre-mRNA can generate from two to several thousands different mRNAs leading to the production of a corresponding number of proteins. It is now believed that the expression of at least 70 % of human genes is subjected to alternative splicing, implying an enormous contribution to proteomic diversity, and by extension, to the development and the evolution of complex animals. Defects in splicing have been associated with human diseases (Caceres and Kornblihtt, Trends Genet 18(4):186-93, 2002, Cartegni et al., Nat Rev Genet 3(4):285-98, 2002, Pagani and Baralle, Nat Rev Genet 5(5):389-96, 2004), including cancer (Brinkman, Clin Biochem 37(7):584-94, 2004, Venables, Bioessays 28(4):378-86, 2006, Srebrow and Kornblihtt, J Cell Sci 119(Pt 13):2635-2641, 2006, Revil et al., Bull Cancer 93(9):909-919, 2006, Venables, Transworld Res Network, 2006, Pajares et al., Lancet Oncol 8(4):349-57, 2007, Skotheim and Nees, Int J Biochem Cell Biol 39:1432-1449, 2007). Numerous studies have now confirmed the existence of specific differences in the alternative splicing profiles between normal and cancer tissues. Although there are a few cases where specific mutations are the primary cause for these changes, global alterations in alternative splicing in cancer cells may be primarily derived from changes in the expression of RNA-binding proteins that control splice site selection. Overall, these cancer-specific differences in alternative splicing offer an immense potential to improve the diagnosis and the prognosis of cancer. This review will focus on the functional impact of cancer-associated alternative splicing variants, the molecular determinants that alter the splicing decisions in cancer cells, and future therapeutic strategies.

  15. Deep sequencing detects very-low-grade somatic mosaicism in the unaffected mother of siblings with nemaline myopathy.

    PubMed

    Miyatake, Satoko; Koshimizu, Eriko; Hayashi, Yukiko K; Miya, Kazushi; Shiina, Masaaki; Nakashima, Mitsuko; Tsurusaki, Yoshinori; Miyake, Noriko; Saitsu, Hirotomo; Ogata, Kazuhiro; Nishino, Ichizo; Matsumoto, Naomichi

    2014-07-01

    When an expected mutation in a particular disease-causing gene is not identified in a suspected carrier, it is usually assumed to be due to germline mosaicism. We report here very-low-grade somatic mosaicism in ACTA1 in an unaffected mother of two siblings affected with a neonatal form of nemaline myopathy. The mosaicism was detected by deep resequencing using a next-generation sequencer. We identified a novel heterozygous mutation in ACTA1, c.448A>G (p.Thr150Ala), in the affected siblings. Three-dimensional structural modeling suggested that this mutation may affect polymerization and/or actin's interactions with other proteins. In this family, we expected autosomal dominant inheritance with either parent demonstrating germline or somatic mosaicism. Sanger sequencing identified no mutation. However, further deep resequencing of this mutation on a next-generation sequencer identified very-low-grade somatic mosaicism in the mother: 0.4%, 1.1%, and 8.3% in the saliva, blood leukocytes, and nails, respectively. Our study demonstrates the possibility of very-low-grade somatic mosaicism in suspected carriers, rather than germline mosaicism. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. A novel syndrome of hypohidrosis and intellectual disability is linked to COG6 deficiency.

    PubMed

    Shaheen, Ranad; Ansari, Shinu; Alshammari, Muneera J; Alkhalidi, Hisham; Alrukban, Hadeel; Eyaid, Wafaa; Alkuraya, Fowzan S

    2013-07-01

    Numerous syndromic forms of intellectual disability have been described including those with abnormal sweating pattern. To describe the clinical and molecular analysis of a large multiplex consanguineous Saudi family with an unusual constellation of severe intellectual disability, hypohidrosis, abnormal teeth, and acquired microcephaly. Clinical evaluation, autozygosity mapping, exome sequencing, and expression analysis. Autozygosity mapping revealed a single critical locus corresponding to chr13:39 338 062-40 857 430. Exome sequencing uncovered a deep intronic (NM_020751.2:c.1167-24A>G) variant in COG6 that largely replaces the consensus acceptor site, resulting in pronounced reduction of the normal transcript and consequent deficiency of COG6 protein. Patient cells also exhibited pronounced deficiency of STX6, consistent with the established stabilising effect of COG6 on STX6. Four additional patients representing two families of the same tribal origin as the original family were found to have the same mutation, confirming a founder effect. Remarkably, none of the patients displayed any detectable abnormality in the glycosylation pattern of transferrin, which contradicts a previously published report of a patient whose abnormal glycosylation pattern was presumed to be caused by a missense variant in COG6. Our data implicate COG6 in the pathogenesis of a novel hypohidrotic disorder in humans that is distinct from congenital disorders of glycosylation.

  17. Splice-site mutations identified in PDE6A responsible for retinitis pigmentosa in consanguineous Pakistani families

    PubMed Central

    Khan, Shahid Y.; Ali, Shahbaz; Naeem, Muhammad Asif; Khan, Shaheen N.; Husnain, Tayyab; Butt, Nadeem H.; Qazi, Zaheeruddin A.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

    2015-01-01

    Purpose This study was conducted to localize and identify causal mutations associated with autosomal recessive retinitis pigmentosa (RP) in consanguineous familial cases of Pakistani origin. Methods Ophthalmic examinations that included funduscopy and electroretinography (ERG) were performed to confirm the affectation status. Blood samples were collected from all participating individuals, and genomic DNA was extracted. A genome-wide scan was performed, and two-point logarithm of odds (LOD) scores were calculated. Sanger sequencing was performed to identify the causative variants. Subsequently, we performed whole exome sequencing to rule out the possibility of a second causal variant within the linkage interval. Sequence conservation was performed with alignment analyses of PDE6A orthologs, and in silico splicing analysis was completed with Human Splicing Finder version 2.4.1. Results A large multigenerational consanguineous family diagnosed with early-onset RP was ascertained. An ophthalmic clinical examination consisting of fundus photography and electroretinography confirmed the diagnosis of RP. A genome-wide scan was performed, and suggestive two-point LOD scores were observed with markers on chromosome 5q. Haplotype analyses identified the region; however, the region did not segregate with the disease phenotype in the family. Subsequently, we performed a second genome-wide scan that excluded the entire genome except the chromosome 5q region harboring PDE6A. Next-generation whole exome sequencing identified a splice acceptor site mutation in intron 16: c.2028–1G>A, which was completely conserved in PDE6A orthologs and was absent in ethnically matched 350 control chromosomes, the 1000 Genomes database, and the NHLBI Exome Sequencing Project. Subsequently, we investigated our entire cohort of RP familial cases and identified a second family who harbored a splice acceptor site mutation in intron 10: c.1408–2A>G. In silico analysis suggested that these mutations will result in the elimination of wild-type splice acceptor sites that would result in either skipping of the respective exon or the creation of a new cryptic splice acceptor site; both possibilities would result in retinal photoreceptor cells that lack PDE6A wild-type protein. Conclusions we report two splice acceptor site variations in PDE6A in consanguineous Pakistani families who manifested cardinal symptoms of RP. Taken together with our previously published work, our data suggest that mutations in PDE6A account for about 2% of the total genetic load of RP in our cohort and possibly in the Pakistani population as well. PMID:26321862

  18. Rational Protein Engineering Guided by Deep Mutational Scanning

    PubMed Central

    Shin, HyeonSeok; Cho, Byung-Kwan

    2015-01-01

    Sequence–function relationship in a protein is commonly determined by the three-dimensional protein structure followed by various biochemical experiments. However, with the explosive increase in the number of genome sequences, facilitated by recent advances in sequencing technology, the gap between protein sequences available and three-dimensional structures is rapidly widening. A recently developed method termed deep mutational scanning explores the functional phenotype of thousands of mutants via massive sequencing. Coupled with a highly efficient screening system, this approach assesses the phenotypic changes made by the substitution of each amino acid sequence that constitutes a protein. Such an informational resource provides the functional role of each amino acid sequence, thereby providing sufficient rationale for selecting target residues for protein engineering. Here, we discuss the current applications of deep mutational scanning and consider experimental design. PMID:26404267

  19. The p16INK4alpha/p19ARF gene mutations are infrequent and are mutually exclusive to p53 mutations in Indian oral squamous cell carcinomas.

    PubMed

    Kannan, K; Munirajan, A K; Krishnamurthy, J; Bhuvarahamurthy, V; Mohanprasad, B K; Panishankar, K H; Tsuchida, N; Shanmugam, G

    2000-03-01

    Eighty-seven untreated primary oral squamous cell carcinomas (SCCs) associated with betel quid and tobacco chewing from Indian patients were analysed for the presence of mutations in the commonly shared exon 2 of p16INK4alpha/p19ARF genes. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) and sequencing analysis were used to detect mutations. SSCP analysis indicated that only 9% (8/87) of the tumours had mutation in p16INK4alpha/p19ARF genes. Seventy-two tumours studied here were previously analysed for p53 mutations and 21% (15/72) of them were found to have mutations in p53 gene. Only one tumour was found to have mutation at both p53 and p16INK4alpha/p19ARF genes. Thus, the mutation rates observed were 21% for p53, 9% for p16INK4alpha/p19ARF, and 1% for both. Sequencing analysis revealed two types of mutations; i) G to C (GCAG to CCAG) transversion type mutation at intron 1-exon 2 splice junction and ii) another C to T transition type mutation resulting in CGA to TGA changing arginine to a termination codon at p16INK4alpha gene codon 80 and the same mutation will alter codon 94 of p19ARF gene from CCG to CTG (proline to leucine). These results suggest that p16INK4alpha/p19ARF mutations are less frequent than p53 mutations in Indian oral SCCs. The p53 and p16INK4alpha/p19ARF mutational events are independent and are mutually exclusive suggesting that mutational inactivation of either p53 or p16INK4alpha/p19ARF may alleviate the need for the inactivation of the other gene.

  20. CDH23 mutation and phenotype heterogeneity: a profile of 107 diverse families with Usher syndrome and nonsyndromic deafness.

    PubMed

    Astuto, L M; Bork, J M; Weston, M D; Askew, J W; Fields, R R; Orten, D J; Ohliger, S J; Riazuddin, S; Morell, R J; Khan, S; Riazuddin, S; Kremer, H; van Hauwe, P; Moller, C G; Cremers, C W R J; Ayuso, C; Heckenlively, J R; Rohrschneider, K; Spandau, U; Greenberg, J; Ramesar, R; Reardon, W; Bitoun, P; Millan, J; Legge, R; Friedman, T B; Kimberling, W J

    2002-08-01

    Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP-like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia.

  1. CDKL5 and ARX mutations are not responsible for early onset severe myoclonic epilepsy in infancy.

    PubMed

    Nabbout, Rima; Depienne, Christel; Chipaux, Mathilde; Girard, Benoit; Souville, Isabelle; Trouillard, Oriane; Dulac, Olivier; Chelly, Jamel; Afenjar, Alexandra; Héron, Delphine; Leguern, Eric; Beldjord, Cherif; Bienvenu, Thierry; Bahi-Buisson, Nadia

    2009-11-01

    Severe myoclonic epilepsy of infancy (SMEI) or Dravet syndrome (DS) is a distinctive epilepsy syndrome often associated with de novo mutations in the SCN1A gene. However, 25-30% patients with SMEI/DS are negative for SCN1A mutation screening, suggesting that other molecular mechanisms may account for these disorders. Given the overlapping and heterogeneous clinical features of CDKL5- and ARX-related epilepsies and SMEI/DS, we postulated that CDKL5 mutations in females and ARX mutations gene in males may be associated with early onset seizures forms of SMEI/DS. Twenty-eight patients with early onset SMEI/DS before 6 months negative for SCN1A mutational screening were selected and screened for mutations in the ARX gene in males (n=14) or the CDKL5 gene in females (n=14). No mutations in either gene were found except one intronic variation of uncertain pathogenicity in the CDKL5 gene. All patients started seizures at mean age of 3.48 months. Thirteen patients had familial history of epilepsy or febrile seizures. Patients evolved toward refractory epilepsy with generalized tonic clonic seizures (18/28) and myoclonia (23/28) and severe neurological impairment with autistic features (13/28), ataxia (14/28) and spasticity (5/28). No patient ever exhibited infantile spasms, dystonia, or Rett-like features. Our results illustrate that mutation screening of ARX and CDKL5 is not effective in patients selected on the basis of clinical signs associated to early onset SMEI/DS. In addition, they might reflect that other phenotypic features associated with CDKL5 mutations (Rett-like features, infantile spasm) or ARX mutations (dystonia, spasticity) are more distinctive. 2009 Elsevier B.V. All rights reserved.

  2. Molecular genetic analysis of some mutations in the cystic fibrosis gene in Moldova: Characterization of molecular markers and their linkage to various mutations

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gimbovskaya, S.D.; Kalinin, V.N.; Ivashchenko, T.E.

    1994-12-01

    Sixty-one patients with cystic fibrosis (CF) from Moldova were tested for mutations {Delta}F508, G551D, and R553X. Frequencies of various alleles of the repeated GATT sequence in intron 6B of the GFTR gene, their linkage to other polymorphic markers, and various mutations were determined. The frequency of occurrence of mutation {Delta}F508 was only 25%. An absolute majority of CF patients (80%) had pancreatic insufficiency. Mutations G551D and R553X were not found in our sample. Each of 31 chromosomes with mutation {Delta}F508 carry the 6-GATT allele. Most {open_quotes}non {Delta}F508{close_quotes} (78%) and normal (80%) chromosomes were marked by the 7-GATT allele. Twenty-seven {Delta}F508more » chromosomes (96.4%) belong to haplotype B6, and only one to D6. Most chromosomes with {open_quotes}non {Delta}F508{close_quotes} mutations are associated with haplotypes D7 (26.3%) and C7 (21%). In addition, a significant portion of chromosomes from this subgroup were associated with haplotypes A7 (23.7%), A6 (10.5%), and C6 (2.7%), which are not yet described for mutant chromosomes. The results obtained demonstrate that CF in Moldova is mainly associated with mutations other than {Delta}F508, G551D, and R553X. Severe forms of the disease, with pancreatic insufficiency, are more frequently caused by these mutations; moreover, our data provides strong evidence for the presence of at least seven additional CF mutations in Moldova, apart from {Delta}F508, G551D, and R553X. Some of these are probably not described.« less

  3. Four Novel Mutations in the ALPL Gene in Chinese patients with Odonto, Childhood and Adult Hypophosphatasia.

    PubMed

    Xu, Lijun; Pang, Qianqian; Jiang, Yan; Wang, Ou; Li, Mei; Xing, Xiaoping; Xia, Weibo

    2018-05-03

    Background and purpose: Hypophosphatasiais (HPP) is a rare inherited disorder characterized by defective bone and/or dental mineralization, and decreased serum alkaline phosphatase activity. ALPL , the only gene related with HPP, encodes tissue non-specific alkaline phosphatase (TNSALP). Few studies were carried out in ALPL gene mutations in the Chinese population with HPP. The purpose of this study is to elucidate the clinical and genetic characteristics of HPP in 5 unrelated Chinese families and 2 sporadic patients. Methods : 10 clinically diagnosed HPP patients from 5 unrelated Chinese families and 2 sporadic patients and 50 healthy controls were genetic investigated. All 12 exons and exon-intron boundaries of the ALPL gene were amplified by polymerase chain reaction and directly sequenced. The laboratory and radiological investigations were conducted simultaneously in these 10 HPP patients. A three-dimensional model of the TNSALP was used to predict the dominant negative effect of identified missense mutations. Results : 3 odonto, 3 childhood and 4 adult types of HPP were clinically diagnosed. 10 mutations were identified in 5 unrelated Chinese families and 2 sporadic patients, including 8 missense mutations and 2 frameshift mutations. Of which, 4 were novel: 1 frameshift mutation (p.R138Pfsx45); 3 missense mutations (p.C201R, p.V459A, p.C497S). No identical mutations and any other new ALPL mutations were found in unrelated 50 healthy controls. Conclusions : Our study demonstrated that the ALPL  gene mutations are responsible for HPP in these Chinese families. These findings will be useful for clinicians to improve understanding of this heritable bone disorder. ©2018 The Author(s).

  4. CDH23 Mutation and Phenotype Heterogeneity: A Profile of 107 Diverse Families with Usher Syndrome and Nonsyndromic Deafness

    PubMed Central

    Astuto, L. M.; Bork, J. M.; Weston, M. D.; Askew, J. W.; Fields, R. R.; Orten, D. J.; Ohliger, S. J.; Riazuddin, S.; Morell, R. J.; Khan, S.; Riazuddin, S.; Kremer, H.; van Hauwe, P.; Moller, C. G.; Cremers, C. W. R. J.; Ayuso, C.; Heckenlively, J. R.; Rohrschneider, K.; Spandau, U.; Greenberg, J.; Ramesar, R.; Reardon, W.; Bitoun, P.; Millan, J.; Legge, R.; Friedman, T. B.; Kimberling, W. J.

    2002-01-01

    Usher syndrome type I is characterized by congenital hearing loss, retinitis pigmentosa (RP), and variable vestibular areflexia. Usher syndrome type ID, one of seven Usher syndrome type I genetic localizations, have been mapped to a chromosomal interval that overlaps with a nonsyndromic-deafness localization, DFNB12. Mutations in CDH23, a gene that encodes a putative cell-adhesion protein with multiple cadherin-like domains, are responsible for both Usher syndrome and DFNB12 nonsyndromic deafness. Specific CDH23 mutational defects have been identified that differentiate these two phenotypes. Only missense mutations of CDH23 have been observed in families with nonsyndromic deafness, whereas nonsense, frameshift, splice-site, and missense mutations have been identified in families with Usher syndrome. In the present study, a panel of 69 probands with Usher syndrome and 38 probands with recessive nonsyndromic deafness were screened for the presence of mutations in the entire coding region of CDH23, by heteroduplex, single-strand conformation polymorphism, and direct sequence analyses. A total of 36 different CDH23 mutations were detected in 45 families; 33 of these mutations were novel, including 18 missense, 3 nonsense, 5 splicing defects, 5 microdeletions, and 2 insertions. A total of seven mutations were common to more than one family. Numerous exonic and intronic polymorphisms also were detected. Results of ophthalmologic examinations of the patients with nonsyndromic deafness have found asymptomatic RP–like manifestations, indicating that missense mutations may have a subtle effect in the retina. Furthermore, patients with mutations in CDH23 display a wide range of hearing loss and RP phenotypes, differing in severity, age at onset, type, and the presence or absence of vestibular areflexia. PMID:12075507

  5. [Molecular and clinical characterization of Colombian patients suffering from type III glycogen storage disease].

    PubMed

    Mantilla, Carolina; Toro, Mónica; Sepúlveda, María Elsy; Insuasty, Margarita; Di Filippo, Diana; López, Juan Álvaro; Baquero, Carolina; Navas, María Cristina; Arias, Andrés Augusto

    2018-05-01

    Type III glycogen storage disease (GSD III) is an autosomal recessive disorder in which a mutation in the AGL gene causes deficiency of the glycogen debranching enzyme. The disease is characterized by fasting hypoglycemia, hepatomegaly and progressive myopathy. Molecular analyses of AGL have indicated heterogeneity depending on ethnic groups. The full spectrum of AGL mutations in Colombia remains unclear. To describe the clinical and molecular characteristics of ten Colombian patients diagnosed with GSD III. We recruited ten Colombian children with a clinical and biochemical diagnosis of GSD III to undergo genetic testing. The full coding exons and the relevant exon-intron boundaries of the AGL underwent Sanger sequencing to identify mutation. All patients had the classic phenotype of the GSD III. Genetic analysis revealed a mutation p.Arg910X in two patients. One patient had the mutation p.Glu1072AspfsX36, and one case showed a compound heterozygosity with p.Arg910X and p.Glu1072AspfsX36 mutations. We also detected the deletion of AGL gene 3, 4, 5, and 6 exons in three patients. The in silico studies predicted that these defects are pathogenic. No mutations were detected in the amplified regions in three patients. We found mutations and deletions that explain the clinical phenotype of GSD III patients. This is the first report with a description of the clinical phenotype and the spectrum of AGL mutations in Colombian patients. This is important to provide appropriate prognosis and genetic counseling to the patient and their relatives.

  6. Mutations of maturity-onset diabetes of the young (MODY) genes in Thais with early-onset type 2 diabetes mellitus.

    PubMed

    Plengvidhya, Nattachet; Boonyasrisawat, Watip; Chongjaroen, Nalinee; Jungtrakoon, Prapaporn; Sriussadaporn, Sutin; Vannaseang, Sathit; Banchuin, Napatawn; Yenchitsomanus, Pa-thai

    2009-06-01

    Six known genes responsible for maturity-onset diabetes of the young (MODY) were analysed to evaluate the prevalence of their mutations in Thai patients with MODY and early-onset type 2 diabetes. Fifty-one unrelated probands with early-onset type 2 diabetes, 21 of them fitted into classic MODY criteria, were analysed for nucleotide variations in promoters, exons, and exon-intron boundaries of six known MODY genes, including HNF-4alpha, GCK, HNF-1alpha, IPF-1, HNF-1beta, and NeuroD1/beta2, by the polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method followed by direct DNA sequencing. Missense mutations or mutations located in regulatory region, which were absent in 130 chromosomes of non-diabetic controls, were classified as potentially pathogenic mutations. We found that mutations of the six known MODY genes account for a small proportion of classic MODY (19%) and early-onset type 2 diabetes (10%) in Thais. Five of these mutations are novel including GCK R327H, HNF-1alpha P475L, HNF-1alphaG554fsX556, NeuroD1-1972 G > A and NeuroD1 A322N. Mutations of IPF-1 and HNF-1beta were not identified in the studied probands. Mutations of the six known MODY genes may not be a major cause of MODY and early-onset type 2 diabetes in Thais. Therefore, unidentified genes await discovery in a majority of Thai patients with MODY and early-onset type 2 diabetes.

  7. Comparative oncology DNA sequencing of canine T cell lymphoma via human hotspot panel

    PubMed Central

    Beheshti, Afshin; Pilichowska, Monika; Burgess, Kristine; Ricks-Santi, Luisel; McNiel, Elizabeth; London, Cheryl B.; Ravi, Dashnamoorthy; Evens, Andrew M.

    2018-01-01

    T-cell lymphoma (TCL) is an uncommon and aggressive form of human cancer. Lymphoma is the most common hematopoietic tumor in canines (companion animals), with TCL representing approximately 30% of diagnoses. Collectively, the canine is an appealing model for cancer research given the spontaneous occurrence of cancer, intact immune system, and phytogenetic proximity to humans. We sought to establish mutational congruence of the canine with known human TCL mutations in order to identify potential actionable oncogenic pathways. Following pathologic confirmation, DNA was sequenced in 16 canine TCL (cTCL) cases using a custom Human Cancer Hotspot Panel of 68 genes commonly mutated in human TCL. Sequencing identified 4,527,638 total reads with average length of 229 bases containing 346 unique variants and 1,474 total variants; each sample had an average of 92 variants. Among these, there were 258 germline and 32 somatic variants. Among the 32 somatic variants there were 8 missense variants, 1 splice junction variant and the remaining were intron or synonymous variants. A frequency of 4 somatic mutations per sample were noted with >7 mutations detected in MET, KDR, STK11 and BRAF. Expression of these associated proteins were also detected via Western blot analyses. In addition, Sanger sequencing confirmed three variants of high quality (MYC, MET, and TP53 missense mutation). Taken together, the mutational spectrum and protein analyses showed mutations in signaling pathways similar to human TCL and also identified novel mutations that may serve as drug targets as well as potential biomarkers. PMID:29854308

  8. Identification and characterization of a novel XK splice site mutation in a patient with McLeod syndrome.

    PubMed

    Arnaud, Lionel; Salachas, François; Lucien, Nicole; Maisonobe, Thierry; Le Pennec, Pierre-Yves; Babinet, Jérôme; Cartron, Jean-Pierre

    2009-03-01

    McLeod syndrome is a rare X-linked neuroacanthocytosis syndrome with hematologic, muscular, and neurologic manifestations. McLeod syndrome is caused by mutations in the XK gene whose product is expressed at the red blood cell (RBC) surface but whose function is currently unknown. A variety of XK mutations has been reported but no clear phenotype-genotype correlation has been found, especially for the point mutations affecting splicing sites. A man suspected of neuroacanthocytosis was evaluated by neurologic examination, electromyography, muscle biopsy, muscle computed tomography, and cerebral magnetic resonance imaging. The McLeod RBC phenotype was disclosed by blood smear and immunohematology analyses and then confirmed at the biochemical level by Western blot analysis. The responsible XK mutation was characterized at the mRNA level by reverse transcription-polymerase chain reaction (PCR), identified by genomic DNA sequencing, and verified by allele-specific PCR. A novel XK splice site mutation (IVS1-1G>A) has been identified in a McLeod patient who has developed hematologic, neuromuscular, and neurologic symptoms. This is the first reported example of a XK point mutation affecting the 3' acceptor splice site of Intron 1, and it was demonstrated that this mutation indeed induces aberrant splicing of XK RNA and lack of XK protein at the RBC membrane. The detailed characterization at the molecular biology level of this novel XK splice site mutation associated with the clinical description of the patient contributes to a better understanding of the phenotype-genotype correlation in the McLeod syndrome.

  9. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study

    PubMed Central

    Porter, Danielle P.; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D.; White, Kirsten L.

    2015-01-01

    At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study. PMID:26690199

  10. Emergent HIV-1 Drug Resistance Mutations Were Not Present at Low-Frequency at Baseline in Non-Nucleoside Reverse Transcriptase Inhibitor-Treated Subjects in the STaR Study.

    PubMed

    Porter, Danielle P; Daeumer, Martin; Thielen, Alexander; Chang, Silvia; Martin, Ross; Cohen, Cal; Miller, Michael D; White, Kirsten L

    2015-12-07

    At Week 96 of the Single-Tablet Regimen (STaR) study, more treatment-naïve subjects that received rilpivirine/emtricitabine/tenofovir DF (RPV/FTC/TDF) developed resistance mutations compared to those treated with efavirenz (EFV)/FTC/TDF by population sequencing. Furthermore, more RPV/FTC/TDF-treated subjects with baseline HIV-1 RNA >100,000 copies/mL developed resistance compared to subjects with baseline HIV-1 RNA ≤100,000 copies/mL. Here, deep sequencing was utilized to assess the presence of pre-existing low-frequency variants in subjects with and without resistance development in the STaR study. Deep sequencing (Illumina MiSeq) was performed on baseline and virologic failure samples for all subjects analyzed for resistance by population sequencing during the clinical study (n = 33), as well as baseline samples from control subjects with virologic response (n = 118). Primary NRTI or NNRTI drug resistance mutations present at low frequency (≥2% to 20%) were detected in 6.6% of baseline samples by deep sequencing, all of which occurred in control subjects. Deep sequencing results were generally consistent with population sequencing but detected additional primary NNRTI and NRTI resistance mutations at virologic failure in seven samples. HIV-1 drug resistance mutations emerging while on RPV/FTC/TDF or EFV/FTC/TDF treatment were not present at low frequency at baseline in the STaR study.

  11. Cystic fibrosis (CF) mutation detection and frequencies in central New York state using single strand conformation (SSC) and heteroduplex analysis (HA) gel analysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shrimpton, A.E.; Lamberson, C.M.; Hicks, K.E.

    1994-09-01

    Over 100 cystic fibrosis (CF) bearing chromosomes from patients living in central New York state have been screened in order to identify their CF mutations. Ethnic background information and parental samples were also collected when available. Polymerase chain reaction (PCR) amplified products from exons 3, 4, 5, 7, 9, 10, 11, 12, 13, 14B, 15, 17B, 19, 20, 21 and intro 19 have been screened for over 50 known CF mutations by restriction enzyme digest, heteroduplex analysis (HA) and/or single stand conformation (SSC) gel analysis. The exon 9 PCR product was difficult to analyze by HA or SSC gel analysis.more » Restriction enzyme site generating PCR primers were used to identify the R117H, 711+1,G>T, G542X, 1717-1,G>A, 1898-1,G>A and N1303K CF mutations. Haplotyping at CFTR-linked (xv-2c/Taq I, km19/Pst, I, MP6d.9/Msp I and J3.11/Pst I) and CFTR intragenic markers (intron 6 GATT{sub n}, 1540 A/G, 1898+152,T/A) was performed to aid in CF mutation identification.« less

  12. Investigation of Congenital Myasthenia Reveals Functional Asymmetry of Invariant Acetylcholine Receptor (AChR) Cys-loop Aspartates.

    PubMed

    Shen, Xin-Ming; Brengman, Joan; Neubauer, David; Sine, Steven M; Engel, Andrew G

    2016-02-12

    We identify two heteroallelic mutations in the acetylcholine receptor δ-subunit from a patient with severe myasthenic symptoms since birth: a novel δD140N mutation in the signature Cys-loop and a mutation in intron 7 of the δ-subunit gene that disrupts splicing of exon 8. The mutated Asp residue, which determines the disease phenotype, is conserved in all eukaryotic members of the Cys-loop receptor superfamily. Studies of the mutant acetylcholine receptor expressed in HEK 293 cells reveal that δD140N attenuates cell surface expression and apparent channel gating, predicting a reduced magnitude and an accelerated decay of the synaptic response, thus reducing the safety margin for neuromuscular transmission. Substituting Asn for Asp at equivalent positions in the α-, β-, and ϵ-subunits also suppresses apparent channel gating, but the suppression is much greater in the α-subunit. Mutant cycle analysis applied to single and pairwise mutations reveals that αAsp-138 is energetically coupled to αArg-209 in the neighboring pre-M1 domain. Our findings suggest that the conserved αAsp-138 and αArg-209 contribute to a principal pathway that functionally links the ligand binding and pore domains. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Studying phenotypic evolution in domestic animals: a walk in the footsteps of Charles Darwin.

    PubMed

    Andersson, L

    2009-01-01

    Charles Darwin used domesticated plants and animals as proof of principle for his theory on phenotypic evolution by means of natural selection. Inspired by Darwin's work, we developed an intercross between the wild boar and domestic pigs to study the genetic basis for phenotypic changes during domestication. The difference in coat color is controlled by two major loci. Dominant white color is due to two consecutive mutations in the KIT gene: a 450-kb duplication and a splice mutation. Black spotting is caused by the combined effect of two mutations in MC1R: a missense mutation for dominant black color and a 2-bp insertion leading to a frameshift. A major discovery made using this pedigree is the identification of a single-nucleotide substitution in intron 3 of the gene for insulin-like growth factor 2 (IGF2) that is underlying a quantitative trait locus affecting muscle growth, size of the heart, and fat deposition. The mutation disrupts the interaction with a repressor and leads to threefold increased IGF2 expression in postnatal muscle. In a recent study, we have identified the IGF2 repressor, and this previously unknown protein, named ZBED6, is specific for placental mammals and derived from a domesticated DNA transposon.

  14. Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

    PubMed

    Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

    2010-08-01

    Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

  15. A nuclear mutation defective in mitochondrial recombination in yeast.

    PubMed

    Ling, F; Makishima, F; Morishima, N; Shibata, T

    1995-08-15

    Homologous recombination (crossing over and gene conversion) is generally essential for heritage and DNA repair, and occasionally causes DNA aberrations, in nuclei of eukaryotes. However, little is known about the roles of homologous recombination in the inheritance and stability of mitochondrial DNA which is continuously damaged by reactive oxygen species, by-products of respiration. Here, we report the first example of a nuclear recessive mutation which suggests an essential role for homologous recombination in the stable inheritance of mitochondrial DNA. For the detection of this class of mutants, we devised a novel procedure, 'mitochondrial crossing in haploid', which has enabled us to examine many mutant clones. Using this procedure, we examined mutants of Saccharomyces cerevisiae that showed an elevated UV induction of respiration-deficient mutations. We obtained a mutant that was defective in both the omega-intron homing and Endo.SceI-induced homologous gene conversion. We found that the mutant cells are temperature sensitive in the maintenance of mitochondrial DNA. A tetrad analysis indicated that elevated UV induction of respiration-deficient mutations, recombination deficiency and temperature sensitivity are all caused by a single nuclear mutation (mhr1) on chromosome XII. The pleiotropic characteristics of the mutant suggest an essential role for the MHR1 gene in DNA repair, recombination and the maintenance of DNA in mitochondria.

  16. Alu distribution and mutation types of cancer genes

    PubMed Central

    2011-01-01

    Background Alu elements are the most abundant retrotransposable elements comprising ~11% of the human genome. Many studies have highlighted the role that Alu elements have in genetic instability and how their contribution to the assortment of mutagenic events can lead to cancer. As of yet, little has been done to quantitatively assess the association between Alu distribution and genes that are causally implicated in oncogenesis. Results We have investigated the effect of various Alu densities on the mutation type based classifications of cancer genes. In order to establish the direct relationship between Alus and the cancer genes of interest, genome wide Alu-related densities were measured using genes rather than the sliding windows of fixed length as the units. Several novel genomic features, such as the density of the adjacent Alu pairs and the number of Alu-Exon-Alu triplets, were developed in order to extend the investigation via the multivariate statistical analysis toward more advanced biological insight. In addition, we characterized the genome-wide intron Alu distribution with a mixture model that distinguished genes containing Alu elements from those with no Alus, and evaluated the gene-level effect of the 5'-TTAAAA motif associated with Alu insertion sites using a two-step regression analysis method. Conclusions The study resulted in several novel findings worthy of further investigation. They include: (1) Recessive cancer genes (tumor suppressor genes) are enriched with Alu elements (p < 0.01) compared to dominant cancer genes (oncogenes) and the entire set of genes in the human genome; (2) Alu-related genomic features can be used to cluster cancer genes into biological meaningful groups; (3) The retention of exon Alus has been restricted in the human genome development, and an upper limit to the chromosome-level exon Alu densities is suggested by the distribution profile; (4) For the genes with at least one intron Alu repeat in individual chromosomes, the intron Alu densities can be well fitted by a Gamma distribution; (5) The effect of the 5'-TTAAAA motif on Alu densities varies across different chromosomes. PMID:21429208

  17. Doubling the referral rate of monogenic diabetes through a nationwide information campaign--update on glucokinase gene mutations in a Polish cohort.

    PubMed

    Borowiec, M; Fendler, W; Antosik, K; Baranowska, A; Gnys, P; Zmyslowska, A; Malecki, M; Mlynarski, W

    2012-12-01

    In order to improve recruitment efficiency of patients with monogenic diabetes in Poland, in September 2010 a nationwide advertising campaign was launched to inform multiple target groups interested or participating in pediatric diabetologic care. Promotional actions aimed at informing physicians, patients, parents and educators were carried out through nationwide newspapers, medical and patient-developed websites and educational conference presentations. Recruitment efficiency was compared between September 2010 (publication of the first report on project's results) and the following 12 months. The number of families and patients referred to genetic screening was increased by 92% and 96% respectively nearly reaching the numbers recruited throughout the initial 4 years of the project. Participation of non-academic centers was also significantly increased from 2.3% to 7.5% (p = 0.0005). DNA sequencing and Multiplex Ligation-dependant Probe Amplification of the glucokinase gene resulted in finding 50 different mutations. Among those mutations, 19 were novel variants, which included: 17 missense mutations (predicted to be pathogenic according to bioinformatic analysis), 1 nonsense mutation and 1 mutation affecting a consensus intronic splice site. Advertising actions directed at increasing recruitment efficiency are a powerful and possibly neglected tool in screening for rare genetic disorders with a clinically defined phenotype. © 2011 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

  18. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  19. PAH mutation spectrum and correlation with PKU manifestation in north Jiangsu province population.

    PubMed

    Wang, Zhen-Wen; Jiang, Shi-Wen; Zhou, Bao-Cheng

    2018-02-01

    Phenylketonuria (PKU) is a common autosomal recessive disorder of phenylalanine metabolism and mainly results a deficiency of phenylalanine hydroxylase gene (PAH). The incidence of various PAH mutations have race and ethnicity differences. We report a spectrum of PAH mutations complied from 35 PKU children who are all Chinese Han population from north Jiangsu in this study. All 13 exons and their flanking intron sequences of PAH were determined by Ion Torrent PGM™ sequencing. The relationship of genotype and phenotype was analyzed based on the sum of the arbitrary value (AV) values of the two alleles. We identified 61 mutations, with a frequency of 87.14%, among 70 alleles of 35 patients. The most prevalent mutations were R243Q (26.23%), R241C (9.84%) and V399V (8.20%). Furthermore, the consistency between prediction of the biochemical phenotype and the observed phenotype was 81.25%, with the highest consistency observed in classic PKU (87.50%). A significant correlation was found between pretreatment levels of phenylalanine and AV sum (r = -0.87, P < 0.05). Finally, our study constructs PAH mutation spectrum by next generation sequencing (NGS), and reveals that the PAH genotypes and biochemical phenotypes were significantly correlated. These offers facilitate the provision of appropriate genetic counseling for PKU patients. Copyright © 2017. Published by Elsevier Taiwan.

  20. Deep Sequencing-guided Design of a High Affinity Dual Specificity Antibody to Target Two Angiogenic Factors in Neovascular Age-related Macular Degeneration.

    PubMed

    Koenig, Patrick; Lee, Chingwei V; Sanowar, Sarah; Wu, Ping; Stinson, Jeremy; Harris, Seth F; Fuh, Germaine

    2015-09-04

    The development of dual targeting antibodies promises therapies with improved efficacy over mono-specific antibodies. Here, we engineered a Two-in-One VEGF/angiopoietin 2 antibody with dual action Fab (DAF) as a potential therapeutic for neovascular age-related macular degeneration. Crystal structures of the VEGF/angiopoietin 2 DAF in complex with its two antigens showed highly overlapping binding sites. To achieve sufficient affinity of the DAF to block both angiogenic factors, we turned to deep mutational scanning in the complementarity determining regions (CDRs). By mutating all three CDRs of each antibody chain simultaneously, we were able not only to identify affinity improving single mutations but also mutation pairs from different CDRs that synergistically improve both binding functions. Furthermore, insights into the cooperativity between mutations allowed us to identify fold-stabilizing mutations in the CDRs. The data obtained from deep mutational scanning reveal that the majority of the 52 CDR residues are utilized differently for the two antigen binding function and permit, for the first time, the engineering of several DAF variants with sub-nanomolar affinity against two structurally unrelated antigens. The improved variants show similar blocking activity of receptor binding as the high affinity mono-specific antibodies against these two proteins, demonstrating the feasibility of generating a dual specificity binding surface with comparable properties to individual high affinity mono-specific antibodies. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Top